National Library of Energy BETA

Sample records for human genome project

  1. The human genome project

    SciTech Connect (OSTI)

    Yager, T.D.; Zewert, T.E.; Hood, L.E. )

    1994-04-01

    The Human Genome Project (HGP) is a coordinated worldwide effort to precisely map the human genome and the genomes of selected model organisms. The first explicit proposal for this project dates from 1985 although its foundations (both conceptual and technological) can be traced back many years in genetics, molecular biology, and biotechnology. The HGP has matured rapidly and is producing results of great significance.

  2. Genomics and the human genome project: implications for psychiatry

    E-Print Network [OSTI]

    Kelsoe, J R

    2004-01-01

    300 Genomics and the Human Genome Project: implications forpast decade the Human Genome Project has made extraordinaryto each other. The Human Genome Project has approached human

  3. Editorial: The Human Genome Project

    E-Print Network [OSTI]

    Crawford, Michael H.; Baer, A.S.; Hall, R.; Omenn, G.S.; Thomson, G.J.; Wilson, A.C.

    1990-08-01

    iv / Editorial: The Human Genome Project Dear readers, The last few decades have seen a number of exciting developments in genetics. First, Watson and Crick broke the genetic code; since then, tech-nologic and methodologic breakthroughs have... permitted the study and direct manipulation of our DNA. Now there is an international ground swell to map and sequence the human genome. The Bush administration had originally requested $128 million in last year's budget for the Human Genome Project. However...

  4. The Human Genome Diversity Project

    SciTech Connect (OSTI)

    Cavalli-Sforza, L.

    1994-12-31

    The Human Genome Diversity Project (HGD Project) is an international anthropology project that seeks to study the genetic richness of the entire human species. This kind of genetic information can add a unique thread to the tapestry knowledge of humanity. Culture, environment, history, and other factors are often more important, but humanity`s genetic heritage, when analyzed with recent technology, brings another type of evidence for understanding species` past and present. The Project will deepen the understanding of this genetic richness and show both humanity`s diversity and its deep and underlying unity. The HGD Project is still largely in its planning stages, seeking the best ways to reach its goals. The continuing discussions of the Project, throughout the world, should improve the plans for the Project and their implementation. The Project is as global as humanity itself; its implementation will require the kinds of partnerships among different nations and cultures that make the involvement of UNESCO and other international organizations particularly appropriate. The author will briefly discuss the Project`s history, describe the Project, set out the core principles of the Project, and demonstrate how the Project will help combat the scourge of racism.

  5. The Human Genome Project and its Social Implications

    E-Print Network [OSTI]

    Meyer, Paul B

    1990-01-01

    The Human Genome Project and its Social Implications By Paulit is about the Human Genome Project. In a sense this isheredity. The Human Genome Project is concerned essentially

  6. Genomics and the human genome project: implications for psychiatry

    E-Print Network [OSTI]

    Kelsoe, J R

    2004-01-01

    and psychosis: a convergent functional genomics approach.Physiology & Genomics, 4, 83–91. O LIPHANT , A. , B ARKER ,2004), 16(4), 294–300 Genomics and the Human Genome Project:

  7. Implications of the Human Genome Project

    SciTech Connect (OSTI)

    Kitcher, P.

    1998-11-01

    The Human Genome Project (HGP), launched in 1991, aims to map and sequence the human genome by 2006. During the fifteen-year life of the project, it is projected that $3 billion in federal funds will be allocated to it. The ultimate aims of spending this money are to analyze the structure of human DNA, to identify all human genes, to recognize the functions of those genes, and to prepare for the biology and medicine of the twenty-first century. The following summary examines some of the implications of the program, concentrating on its scientific import and on the ethical and social problems that it raises. Its aim is to expose principles that might be used in applying the information which the HGP will generate. There is no attempt here to translate the principles into detailed proposals for legislation. Arguments and discussion can be found in the full report, but, like this summary, that report does not contain any legislative proposals.

  8. Justice and the Human Genome Project

    SciTech Connect (OSTI)

    Murphy, T.F.; Lappe, M.

    1992-12-31

    Most of the essays gathered in this volume were first presented at a conference, Justice and the Human Genome, in Chicago in early November, 1991. The goal of the, conference was to consider questions of justice as they are and will be raised by the Human Genome Project. To achieve its goal of identifying and elucidating the challenges of justice inherent in genomic research and its social applications the conference drew together in one forum members from academia, medicine, and industry with interests divergent as rate-setting for insurance, the care of newborns, and the history of ethics. The essays in this volume address a number of theoretical and practical concerns relative to the meaning of genomic research.

  9. Justice and the Human Genome Project

    SciTech Connect (OSTI)

    Murphy, T.F.; Lappe, M.

    1992-01-01

    Most of the essays gathered in this volume were first presented at a conference, Justice and the Human Genome, in Chicago in early November, 1991. The goal of the, conference was to consider questions of justice as they are and will be raised by the Human Genome Project. To achieve its goal of identifying and elucidating the challenges of justice inherent in genomic research and its social applications the conference drew together in one forum members from academia, medicine, and industry with interests divergent as rate-setting for insurance, the care of newborns, and the history of ethics. The essays in this volume address a number of theoretical and practical concerns relative to the meaning of genomic research.

  10. Justice and the human genome project

    SciTech Connect (OSTI)

    Murphy, T.F.; Lappe, M.A.

    1995-04-01

    This book is a collection of nine essays originally presented at a conference entitled {open_quotes}Justice and the Human Genome{close_quotes} held in Chicago in late 1991. The goal of the articles in this collection is to explore questions of justice raised by developments in genomic research and by applications of genetic knowledge and technology. The Human Genome Project (HGP) is used as a starting point for exploring these questions, but, as Marc Lappe recognizes, the database generated by HGP research will have implications far beyond the medical applications frequently used to justify this research effort. Thus, the book`s contributors consider questions of justice in relation to screening and testing for various predispositions, conditions, and diseases and gene therapy but also examine testing for other characteristics, forensic uses of genetic information, issues associated with DNA banks, and (hypothetical) genetic enhancement possibilities.

  11. Exuberant innovation: The Human Genome Project

    E-Print Network [OSTI]

    Gisler, Monika; Woodard, Ryan

    2010-01-01

    We present a detailed synthesis of the development of the Human Genome Project (HGP) from 1986 to 2003 in order to test the "social bubble" hypothesis that strong social interactions between enthusiastic supporters of the HGP weaved a network of reinforcing feedbacks that led to a widespread endorsement and extraordinary commitment by those involved in the project, beyond what would be rationalized by a standard cost-benefit analysis in the presence of extraordinary uncertainties and risks. The vigorous competition and race between the initially public project and several private initiatives is argued to support the social bubble hypothesis. We also present quantitative analyses of the concomitant financial bubble concentrated on the biotech sector. Confirmation of this hypothesis is offered by the present consensus that it will take decades to exploit the fruits of the HGP, via a slow and arduous process aiming at disentangling the extraordinary complexity of the human complex body. The HGP has ushered other...

  12. The Human Genome Project: Sequencing the Future

    E-Print Network [OSTI]

    genome programs--Genomes to Life, the Microbial Genome Program, and the Microbial Cell Project on fossil fuels. The new findings also have the potential to provide tools for enhanced biothreat agent detection and response and for using genetically engineered microbes to clean up toxic wastes in contaminat

  13. Facilitating Transformations in a Human Genome Project Database

    E-Print Network [OSTI]

    Pennsylvania, University of

    to express data transforma- tions and constraints. The goal of the Human Genome Project (HGP) is to sequence- tire genome (3 billion bases) at one time. Consequently the HGP has set mapping the chromosomes of the major problems faced in HGP databases is rapid schema evolution and the resulting need to mod- ify

  14. The Human Genome From human genome to other

    E-Print Network [OSTI]

    Linial, Michal

    The Human Genome Project From human genome to other genomes and to gene function June 2000 From genome to health Structural Genomics initiative #12;What is the Human Genome Project? · U.S. govt that arise from genome research #12;The Human Genome Project Project began in 1990 as a $3 billion, 15-year

  15. Facilitating Transformations in a Human Genome Project Database *

    E-Print Network [OSTI]

    Madiraju, Praveen

    and constraints. The goal of the Human Genome Project (HGP) is to sequence the 24 distiuct chromosomes comprising time. Consequently the HGP has set mapping the chromosomes ax a less ambitious intermediate goal of Pennsylvania and Children's Hospital of Philadelphia. One of the major problems faced in HGP databases is rapid

  16. The context and content of the human genome project and the American eugenics movement: An analytical, case study approach

    E-Print Network [OSTI]

    Mandel, Sarah M

    1993-01-01

    40 Four: The human genome project and its implications forimplications of the human genome project: where did we come109 Davis, BD. Human Genome Project: is big science bad for

  17. Abstract--As the human genome project progresses and some microbial and eukaryotic genomes are recognized, a

    E-Print Network [OSTI]

    Zelikovsky, Alexander

    1 of 4 Abstract--As the human genome project progresses and some microbial and eukaryotic genomes. This technology promises to monitor the whole genome at once, so that researchers can study the whole genome virus as well as simulated data. Our experiments show that the genomic data follow the pattern predicted

  18. GENCODE: The reference human genome annotation for The ENCODE Project

    E-Print Network [OSTI]

    Lin, Michael

    The GENCODE Consortium aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. Since the first public release of this annotation ...

  19. The Human Genome Project: Information access, management, and regulation. Final report

    SciTech Connect (OSTI)

    McInerney, J.D.; Micikas, L.B.

    1996-08-31

    The Human Genome Project is a large, internationally coordinated effort in biological research directed at creating a detailed map of human DNA. This report describes the access of information, management, and regulation of the project. The project led to the development of an instructional module titled The Human Genome Project: Biology, Computers, and Privacy, designed for use in high school biology classes. The module consists of print materials and both Macintosh and Windows versions of related computer software-Appendix A contains a copy of the print materials and discs containing the two versions of the software.

  20. When the debate over whether to fund a human genome project flowered in the late 1980s, one of the scientific

    E-Print Network [OSTI]

    Sinha, Himanshu

    When the debate over whether to fund a human genome project flowered in the late 1980s, one with genotyping were rapidly swept aside, and the Human Genome Project was realized in a few years. Over the past approach to a genome project was molecular genetics as usual: first identify a region of the genome

  1. Doug Brutlag 2015 Sequencing the Human Genome

    E-Print Network [OSTI]

    Brutlag, Doug

    Project: Should we do it? · Service, R. F. (2001). The human genome: Objection #1: big biology is bad://www.elec-intro.com/m13-cloning #12;© Doug Brutlag 2015 Public Human Genome Project Strategy Published in Nature 15 The Human Genome Project: How should we do it? · Weber, J. L., & Myers, E. W. (1997). Human whole-genome

  2. Getting the Word Out on the Human Genome Project: A Course for Physicians

    SciTech Connect (OSTI)

    Sara L. Tobin

    2004-09-29

    Our project, ''Getting the Word Out on the Human Genome Project: A Course for Physicians,'' presented educational goals to convey the power and promise of the Human Genome Program to a variety of professional, educational, and public audiences. Our initial goal was to provide practicing physicians with a comprehensive multimedia tool to update their skills in the genomic era. We therefore created the multimedia courseware, ''The New Genetics: Courseware for Physicians. Molecular Concepts, Applications, and Ramifications.'' However, as the project moved forward, several unanticipated audiences found the courseware to be useful for instruction and for self-education, so an additional edition of the courseware ''The New Genetics: Medicine and the Human Genome. Molecular Concepts, Applications, and Ramifications'' was published simultaneously with the physician version. At the time that both versions of the courseware were being completed, Stanford's Office of Technology Licensing opted not to commercialize the courseware and offered a license-back agreement if the authors founded a commercial business. The authors thus became closely involved in marketing and sales, and several thousand copies of the courseware have been sold. Surprisingly, the non-physician version has turned out to be more in demand, and this has led us in several new directions, most of which involve undergraduate education. These are discussed in detail in the Report.

  3. Consortium biology in immunology: the perspective from the Immunological Genome Project.

    E-Print Network [OSTI]

    Benoist, C; Lanier, L; Merad, M; Mathis, D

    2012-01-01

    significance, the Human Genome Project (1990–2003) is1990s against the Human Genome Project 5 , and more recentlycompletion of the Human Genome Project, Eric Lander argued

  4. Entrepreneurial experiments in science policy: Analyzing the Human Genome Project

    E-Print Network [OSTI]

    Huang, Kenneth G.

    We re-conceptualize the role of science policy makers, envisioning and illustrating their move from being simple investors in scientific projects to entrepreneurs who create the conditions for entrepreneurial experiments ...

  5. Human Genome Program

    SciTech Connect (OSTI)

    Not Available

    1993-01-01

    The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

  6. Shotgun coverage of human genome computing

    E-Print Network [OSTI]

    Eddy, Sean

    take about 1.5 million pages. The Human Genome Project would not be possible if our revolution were-author collection of chapters on the various uses of computing in the Human Genome Project. Peculiarly absent fromShotgun coverage of human genome computing Human Genome Computing, Second Edition edited by Martin

  7. The human genome project: Information management, access, and regulation. Technical progress report, 1 April--31 August 1993

    SciTech Connect (OSTI)

    McInerney, J.D.; Micikas, L.B.

    1993-09-10

    Efforts are described to prepare educational materials including computer based as well as conventional type teaching materials for training interested high school and elementary students in aspects of Human Genome Project.

  8. The Human Genome Project and Mental Retardation: An Educational Program. Final Progress Report

    SciTech Connect (OSTI)

    Davis, Sharon

    1999-05-03

    The Arc, a national organization on mental retardation, conducted an educational program for members, many of whom have a family member with a genetic condition causing mental retardation. The project informed members about the Human Genome scientific efforts, conducted training regarding ethical, legal and social implications and involved members in issue discussions. Short reports and fact sheets on genetic and ELSI topics were disseminated to 2,200 of the Arc's leaders across the country and to other interested individuals. Materials produced by the project can e found on the Arc's web site, TheArc.org.

  9. GDB - Human Genome Database final report

    SciTech Connect (OSTI)

    Talbot, C. Conover, Jr.

    2002-01-08

    This is the DOE final report for the GDB, Human Genome Database, project at the Johns Hopkins University.

  10. ELSI Bibliography: Ethical legal and social implications of the Human Genome Project

    SciTech Connect (OSTI)

    Yesley, M.S.

    1993-11-01

    This second edition of the ELSI Bibliography provides a current and comprehensive resource for identifying publications on the major topics related to the ethical, legal and social issues (ELSI) of the Human Genome Project. Since the first edition of the ELSI Bibliography was printed last year, new publications and earlier ones identified by additional searching have doubled our computer database of ELSI publications to over 5600 entries. The second edition of the ELSI Bibliography reflects this growth of the underlying computer database. Researchers should note that an extensive collection of publications in the database is available for public use at the General Law Library of Los Alamos National Laboratory (LANL).

  11. Understanding our genetic inheritance: The US Human Genome Project, The first five years FY 1991--1995

    SciTech Connect (OSTI)

    1990-04-01

    The Human Genome Initiative is a worldwide research effort with the goal of analyzing the structure of human DNA and determining the location of the estimated 100,000 human genes. In parallel with this effort, the DNA of a set of model organisms will be studied to provide the comparative information necessary for understanding the functioning of the human genome. The information generated by the human genome project is expected to be the source book for biomedical science in the 21st century and will by of immense benefit to the field of medicine. It will help us to understand and eventually treat many of the more than 4000 genetic diseases that affect mankind, as well as the many multifactorial diseases in which genetic predisposition plays an important role. A centrally coordinated project focused on specific objectives is believed to be the most efficient and least expensive way of obtaining this information. The basic data produced will be collected in electronic databases that will make the information readily accessible on convenient form to all who need it. This report describes the plans for the U.S. human genome project and updates those originally prepared by the Office of Technology Assessment (OTA) and the National Research Council (NRC) in 1988. In the intervening two years, improvements in technology for almost every aspect of genomics research have taken place. As a result, more specific goals can now be set for the project.

  12. Biology for Students: Bioinformatics The Human Genome Project (HGP) is an international effort to determine the biochemical code for

    E-Print Network [OSTI]

    Weng, Zhiping

    Biology for Students: Bioinformatics The Human Genome Project (HGP) is an international effort and their regulatory elements that serve as the blueprint of human biology. The HGP has generated massive data and their interactions), which have also resulted from the HGP. The HGP will have major impacts on understanding

  13. The code of codes: Scientific and social issues in the human genome project

    SciTech Connect (OSTI)

    Kevles, D.J.; Hood, L.

    1992-01-01

    The US Human Genome Project (HGP) may be the first coordinated scientific endeavor to formally address the social consequences of its scientific research program. From its beginning, the HGP has reserved approximately 3%-5% of the overall scientific budget for study of the ethical, social, and legal implications of the use of the information that the project's research will generate. This book reflects the interdisciplinary approach of the HGP, presenting both scientific perspectives and commentary on social and ethical issues. It is notable that the content of this book is more heavily weighted toward consideration of the latter than is the HGP itself; fully two-thirds of the book consists of essays with historical and ethical themes. This diverse collection affords an opportunity to compare and contrast the thoughts of individuals who are considering the implications of this genetic research from very different disciplines and perspectives.

  14. The human genome project and novel aspects of cytochrome P450 research

    SciTech Connect (OSTI)

    Ingelman-Sundberg, Magnus . E-mail: maging@ki.se

    2005-09-01

    Currently, 57 active cytochrome P450 (CYP) genes and 58 pseudogenes are known to be present in the human genome. Among the genes discovered by initiatives in the human genome project are CYP2R1, CYP2W1, CYP2S1, CYP2U1 and CYP3A43, the latter apparently encoding a pseudoenzyme. The function, polymorphism and regulation of these genes are still to be discovered to a great extent. The polymorphism of drug metabolizing CYPs is extensive and influences the outcome of drug therapy causing lack of response or adverse drug reactions. The basis for the differences in the global distribution of the polymorphic variants is inactivating gene mutations and subsequent genetic drift. However, polymorphic alleles carrying multiple active gene copies also exist and are suggested in case of CYP2D6 to be caused by positive selection due to development of alkaloid resistance in North East Africa about 10,000-5000 BC. The knowledge about the CYP genes and their polymorphisms is of fundamental importance for effective drug therapy and for drug development as well as for understanding metabolic activation of carcinogens and other xenobiotics. Here, a short review of the current knowledge is given.

  15. A Possible Genome To Architecture Project (GenToA) [The Meta-Genome Project?

    E-Print Network [OSTI]

    Sloman, Aaron

    concern about the Human Genome project, comparing it with buying a book written in a language nobodyA Possible Genome To Architecture Project (GenToA) [The Meta-Genome Project?] Installed: 2 Aug 2010 can a genome specify an information-processing architecture that grows itself guided by interaction

  16. Human genome. 1993 Program report

    SciTech Connect (OSTI)

    Not Available

    1994-03-01

    The purpose of this report is to update the Human Genome 1991-92 Program Report and provide new information on the DOE genome program to researchers, program managers, other government agencies, and the interested public. This FY 1993 supplement includes abstracts of 60 new or renewed projects and listings of 112 continuing and 28 completed projects. These two reports, taken together, present the most complete published view of the DOE Human Genome Program through FY 1993. Research is progressing rapidly toward 15-year goals of mapping and sequencing the DNA of each of the 24 different human chromosomes.

  17. The resounding success of the Human Genome Project (HGP) is largely the result of early investments in the

    E-Print Network [OSTI]

    Mitra, Rob

    REVIEWS The resounding success of the Human Genome Project (HGP) is largely the result of early,through the parallelization, automation and refinement of established sequencing methods, the HGP motivated a 100-fold).The relevance and utility of high-throughput sequencing and sequencing centres in the wake of the HGP

  18. Meeting Report. Assessing Human Germ-Cell Mutagenesis in the Post-Genome Era: A Celebration of the Legacy of William Lawson (Bill) Russell

    E-Print Network [OSTI]

    2006-01-01

    the landmark Human Genome Project (HGP) and its relationshipworking on the Human Genome Project and the Online Mendelianthat presaged the Human Genome Project (listed below) and

  19. Assembly and Analysis of Extended Human Genomic Contig Regions

    E-Print Network [OSTI]

    Rouchka, Eric

    @ibc.wustl.edu; states@ibc.wustl.edu Abstract The Human Genome Project (HGP) has led to the deposit of human genomic The U.S. Human Genome Project, coordinated by the United States Department of Energy (DOEAssembly and Analysis of Extended Human Genomic Contig Regions Eric C. Rouchka and David J. States

  20. Spheres of influence: Ethical, legal, and social issues of the Human Genome Project: What to do with what we know

    SciTech Connect (OSTI)

    Pellerin, C. )

    1994-01-01

    Since fiscal year 1991, the U.S. Human Genome Project has spent $170.6 million in federal funds to help isolate genes associated with Huntington's disease, amyotrophic lateral sclerosis, neurofibromatosis types 1 and 2, myotonic dystrophy, and fragile X syndrome and to localize genes that predispose people to breast cancer, colon cancer, hypertension, diabetes, and Alzheimer's disease. Now come the hard part. Biology's 21st century megaproject starts to look relatively manageable compared to another challenge facing the enterprise: sorting out ethical, legal, and social issues associated with using this information. [open quotes]The Human Genome Project,[close quotes] wrote Senior Editor Barbara Jasny in the October 1 Science editorial, stretches [open quotes]the limits of the technology and the limits of our ability to ethically and rationally apply genetic information to our lives.[close quotes

  1. RASMUS NIELSEN he goal of the 1000 Genomes Project1

    E-Print Network [OSTI]

    Nielsen, Rasmus

    RASMUS NIELSEN T he goal of the 1000 Genomes Project1 is to find most of the variants in the human's take a step back. A decade ago, the reference copy of the human genome was sequenced3 of the human genome, therefore, a second phase of human genomics emerged

  2. Massively parallel processing on the Intel Paragon system: One tool in achieving the goals of the Human Genome Project

    SciTech Connect (OSTI)

    Ecklund, D.J.

    1993-12-31

    A massively parallel computing system is one tool that has been adopted by researchers in the Human Genome Project. This tool is one of many in a toolbox of theories, algorithms, and systems that are used to attack the many questions posed by the project. A good tool functions well when applied alone to the problem for which it was devised. A superior tool achieves its solitary goal, and supports and interacts with other tools to achieve goals beyond the scope of any individual tool. The author believes that Intel`s massively parallel Paragon{trademark} XP/S system is a superior tool. This paper presents specific requirements for a superior computing tool for the Human Genome Project (HGP) and shows how the Paragon system addresses these requirements. Computing requirements for HGP are based on three factors: (1) computing requirements of algorithms currently used in sequence homology, protein folding, and database insertion/retrieval; (2) estimates of the computing requirements of new applications arising from evolving biological theories; and (3) the requirements for facilities that support collaboration among scientists in a project of this magnitude. The Paragon system provides many hardware and software features that effectively address these requirements.

  3. Whitehead Policy Symposium. The Human Genome Project: Science, law, and social change in the 21st century

    SciTech Connect (OSTI)

    Nichols, E.K.

    2000-02-17

    Advances in the biomedical sciences, especially in human genomics, will dramatically influence law, medicine, public health, and many other sectors of our society in the decades ahead. The public already senses the revolutionary nature of genomic knowledge. In the US and Europe, we have seen widespread discussions about genetic discrimination in health insurance; privacy issues raised by the proliferation of DNA data banks; the challenge of interpreting new DNA diagnostic tests; changing definitions of what it means to be healthy; and the science and ethics of cloning animals and human beings. The primary goal of the Whitehead/ASLME Policy Symposium was to provide a bridge between the research community and professionals, who were just beginning to grasp the potential impact of new genetic technologies on their fields. The ''Human Genome Project: Science, Law, and Social Change in the 21st Century'' initially was designed as a forum for 300-500 physicians, lawyers, consumers, ethicists, and scientists to explore the impact of new genetic technologies and prepare for the challenges ahead.

  4. The New World of Human Genetics: A dialogue between Practitioners & the General Public on Ethical, Legal & Social Implications of the Human Genome Project

    SciTech Connect (OSTI)

    Schofield, Amy

    2014-12-08

    The history and reasons for launching the Human Genome project and the current uses of genetic human material; Identifying and discussing the major issues stemming directly from genetic research and therapy-including genetic discrimination, medical/ person privacy, allocation of government resources and individual finances, and the effect on the way in which we perceive the value of human life; Discussing the sometimes hidden ethical, social and legislative implications of genetic research and therapy such as informed consent, screening and preservation of genetic materials, efficacy of medical procedures, the role of the government, and equal access to medical coverage.

  5. Optimizing the BACEnd Strategy for Sequencing the Human Genome

    E-Print Network [OSTI]

    Shamir, Ron

    University, Tel Aviv, 69978, Israel. 1 #12; 1 Introduction With the Human Genome Project moving from the map sequencing has become central. The classical strategy set forth by the founders of the Human Genome ProjectOptimizing the BAC­End Strategy for Sequencing the Human Genome Richard M. Karp \\Lambda Ron Shamir

  6. The Consensus Coding Sequence (Ccds) Project: Identifying a Common Protein-Coding Gene Set for the Human and Mouse Genomes

    E-Print Network [OSTI]

    Kellis, Manolis

    Effective use of the human and mouse genomes requires reliable identification of genes and their products. Although multiple public resources provide annotation, different methods are used that can result in similar but ...

  7. Use of Optical Mapping to Aid in Assembly and Finishing of Human Microbiome Genome Projects

    SciTech Connect (OSTI)

    Wagner, Trevor [OpGen, Inc

    2010-06-03

    Trevor Wagner of OpGen, Inc. discusses the use of optical mapping to validate the assembly of HMP genomes on June 3, 2010 at the "Sequencing, Finishing, Analysis in the Future" meeting in Santa Fe, NM

  8. Human Genome: DOE Origins

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHigh energyHighlandWorkshop-SummerHow is theHughHumanHuman Genome

  9. An information and dialogue conference on the human genome project (HGP) for the minority communities in the state of Louisiana

    SciTech Connect (OSTI)

    1999-06-01

    Zeta Phi Beta Sorority National Educational Foundation, in cooperation with Xavier University of New Orleans, and the New Orleans District Office of the United States Equal Employment Opportunity Commission, held the Information and Dialogue Conference on the Human Genome Project for the Minority Communities in the State of Louisiana on April 16-17, 1999. The Conference was held on the campus of Xavier University in New Orleans. Community leaders, government officials, minority professional and social organizations leaders, religious leaders, persons from the educational and academic community, and students were invited. Conference objectives included bringing HGP information and a focus in the minority community on the project, in clear and understandable terms, to spread the work in the minority community about the project; to explore the likely positive implications with respect to health care and related matters; to explore possible negative results and strategies to meet them; to discuss the social, legal, and ethical implications; and to facilitate minority input into the HGP as it develops.

  10. Human Genome Education Program

    SciTech Connect (OSTI)

    Richard Myers; Lane Conn

    2000-05-01

    The funds from the DOE Human Genome Program, for the project period 2/1/96 through 1/31/98, have provided major support for the curriculum development and field testing efforts for two high school level instructional units: Unit 1, ''Exploring Genetic Conditions: Genes, Culture and Choices''; and Unit 2, ''DNA Snapshots: Peaking at Your DNA''. In the original proposal, they requested DOE support for the partial salary and benefits of a Field Test Coordinator position to: (1) complete the field testing and revision of two high school curriculum units, and (2) initiate the education of teachers using these units. During the project period of this two-year DOE grant, a part-time Field-Test Coordinator was hired (Ms. Geraldine Horsma) and significant progress has been made in both of the original proposal objectives. Field testing for Unit 1 has occurred in over 12 schools (local and non-local sites with diverse student populations). Field testing for Unit 2 has occurred in over 15 schools (local and non-local sites) and will continue in 12-15 schools during the 96-97 school year. For both curricula, field-test sites and site teachers were selected for their interest in genetics education and in hands-on science education. Many of the site teachers had no previous experience with HGEP or the unit under development. Both of these first-year biology curriculum units, which contain genetics, biotechnology, societal, ethical and cultural issues related to HGP, are being implemented in many local and non-local schools (SF Bay Area, Southern California, Nebraska, Hawaii, and Texas) and in programs for teachers. These units will reach over 10,000 students in the SF Bay Area and continues to receive support from local corporate and private philanthropic organizations. Although HGEP unit development is nearing completion for both units, data is still being gathered and analyzed on unit effectiveness and student learning. The final field testing result from this analysis will contribute to the final revisions of each unit during the second-year of this grant.

  11. Finishing the euchromatic sequence of the human genome

    E-Print Network [OSTI]

    Brutlag, Doug

    foundation for biomedical research in the decades ahead. The Human Genome Project (HGP) was launched in 1990 this component of the HGP. In February 2001, the IHGSC15 and Celera Genomics16 each reported draft sequences

  12. DOE human genome program contractor-grantee workshop VI

    SciTech Connect (OSTI)

    NONE

    1997-10-01

    Research is presented from the workshop on the Human Genome Project. Topics include sequencing, genetic mapping, informatics, ethical and legal issues, and infrastructure.

  13. Sequencing the Human Genome http://biochem118.stanford.edu/

    E-Print Network [OSTI]

    Brutlag, Doug

    Human Genome Project: Should we do it? · Service, R. F. (2001). The human genome: Objection #1: big Human Genome Project: How should we do it? · Weber, J. L., & Myers, E. W. (1Sequencing the Human Genome http://biochem118.stanford.edu/ Doug Brutlag, Professor Emeritus

  14. DOE Joint Genome Institute 2008 Progress Report

    E-Print Network [OSTI]

    Gilbert, David

    2009-01-01

    completion of the Human Genome Project, sequencing and itsimagined when the Human Genome Project first began. Accord-genes. Instead, the Human Genome Project found that hu- mans

  15. NIST Update NIST Human Identity Project Team

    E-Print Network [OSTI]

    NIST Update NIST Human Identity Project Team National Institute of Standards and Technology Standard Set (ESS) STRs using the CEPH human genome diversity panel, Forensic Sci. Int. Genet. (2010), doi

  16. A special report on the human genome Biology 2.0

    E-Print Network [OSTI]

    Weimer, Westley

    A special report on the human genome Biology 2.0 A decade after the human-genome project, writes was to sequence the human genome, all 3 billion genetic letters of it, and thus--as headline writers put it, in the form of Dr Collins's International Human Genome Sequencing Consortium. There was the promise

  17. Ethical issues in international collaborative research on the human genome: The HGP and the HGDP

    SciTech Connect (OSTI)

    Knoppers, B.M.; Hirtle, M.; Lormeau, S.

    1996-06-01

    This special feature describes the ethical issues in international collaborative research on the human genome, both regarding the Human Genome Project (HGP), which is concerned with genetic mapping, and the Human Genome Diversity Project (HGDP), which is an effort to document the genetic variation of the human species worldwide. 88 refs.

  18. Human MutationSPECIAL ARTICLE Planning the Human Variome Project: The Spain Report

    E-Print Network [OSTI]

    : The remarkable progress in characterizing the human genome sequence, exemplified by the Human Genome ProjectHuman MutationSPECIAL ARTICLE Planning the Human Variome Project: The Spain Reportà Jim Kaput,1yz-Sook Yoo,93 on behalf of contributors to the Human Variome Project Planning Meeting 1 Division

  19. Genome-scale reconstruction and analysis of eukaryotic metabolic networks

    E-Print Network [OSTI]

    Hurlen, Natalie Christine

    2006-01-01

    803. Leja, D. , Human Genome Project Timeline, 38-72.jpg,p. Illustration of Human Genome Project Timeline. Varki,Human Genome Project. ..

  20. Lifeasweknowit To understand the human genome, researchers must spread their wings to all branches of life.

    E-Print Network [OSTI]

    Pratt, Vaughan

    and a worm to its ENCODE project, which aims to catalogue all the functional parts of the human genome is moving more forcefully into purely human genomics. The biggest new projects recently announcedLifeasweknowit To understand the human genome, researchers must spread their wings to all branches

  1. An integrated encyclopedia of DNA elements in the human genome

    E-Print Network [OSTI]

    Altshuler, Robert Charles

    The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of ...

  2. Distinguishing protein-coding and noncoding genes in the human genome

    E-Print Network [OSTI]

    Kellis, Manolis

    ) Although the Human Genome Project was completed 4 years ago, the catalog of human protein-coding genesDistinguishing protein-coding and noncoding genes in the human genome Michele Clamp* , Ben Fry An accurate catalog of the protein-coding genes encoded in the human genome is fundamental to the study

  3. Finishing the Human Genome http://biochem118.stanford.edu/

    E-Print Network [OSTI]

    Brutlag, Doug

    ;Public Human Genome Project Strategy http://www.nhgri.nih.gov/ #12;Celera Scaffolds #12;Chromosome 8Finishing the Human Genome http://biochem118.stanford.edu/ Doug Brutlag, Professor Emeritus:Public vs. Celera #12;Finishing Strategy for the Public Genome Project #12;Finished Sequence in 2004

  4. Computational Approaches Towards Human Genome Annotation

    E-Print Network [OSTI]

    Singh, Jaswinder Pal

    Computational Approaches Towards Human Genome Annotation Mark Gerstein Molecular Biophysics of the human genome. My talk will be concerned with topics within this area, in particular annotating pseudogenes (protein fossils) in the genome. I will discuss a comprehensive pseudogene identification pipeline

  5. From Benefit Sharing to Power Sharing: Partnership Governance in Population Genomics Research

    E-Print Network [OSTI]

    Winickoff, David E

    2008-01-01

    failures of the Human Genome Diversity Project, communitysampling, and the Human Genome Diversity Project eventuallyCommunity of the Human Genome Diversity Project, ‘Proposed

  6. Allele-specific gene regulation in humans

    E-Print Network [OSTI]

    Maynard, Nathaniel David

    2008-01-01

    1 Introduction The Human Genome Project has provided thefrom clones and the human genome project have revealed thatVariation The Human Genome Project provided scientists with

  7. An integrated map of genetic variation from 1,092 human genomes

    E-Print Network [OSTI]

    Altshuler, David

    By characterizing the geographic and functional spectrum of human genetic variation, the 1000 Genomes Project aims to build a resource to help to understand the genetic contribution to disease. Here we describe the genomes ...

  8. A map of human genome variation from population-scale sequencing

    E-Print Network [OSTI]

    Lander, Eric S.

    The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation as a foundation for investigating the relationship between genotype and phenotype. Here we present results of the pilot ...

  9. ORFeome projects: gateway between genomics and omics Jean-Francois Rual, David E Hill and Marc Vidal

    E-Print Network [OSTI]

    tag HGP Human Genome Project HT-Y2H high-throughput yeast two-hybrid ORF open reading frame ORFeome Genome Project (HGP) [5] provides the backbone information to drastically change this situation. Complete

  10. The Human Microbiome Project: A Community Resource for the Healthy Human Microbiome

    E-Print Network [OSTI]

    Gevers, Dirk

    The Human Microbiome Project (HMP) [1],[2] is a concept that was long in the making. After the Human Genome Project, interest grew in sequencing the “other genome" of microbes carried in and on the human body [3],[4]. ...

  11. Genomic Comparisons of Humans and Chimpanzees

    E-Print Network [OSTI]

    Genomic Comparisons of Humans and Chimpanzees Ajit Varki1 and David L. Nelson2 1 Glycobiology, anthropogeny, genetics, evolution, hominid Abstract The genome consists of the entire DNA present of the chimpanzee genome is now available, providing opportunities to better understand genetic contributions

  12. On the sequencing of the human genome Robert H. Waterston*

    E-Print Network [OSTI]

    Batzoglou, Serafim

    . The international Human Ge- nome Project (HGP) used the hierarchical shotgun approach, whereas Celera Genomics their own WGS data. Instead, they decomposed the HGP's assembled se- quence into a ``perfect tiling path the assembly was anchored to the human ge- nome and conclude that the process primarily depended on the HGP

  13. Mapping our genes: The genome projects: How big, how fast

    SciTech Connect (OSTI)

    none,

    1988-04-01

    For the past 2 years, scientific and technical journals in biology and medicine have extensively covered a debate about whether and how to determine the function and order of human genes on human chromosomes and when to determine the sequence of molecular building blocks that comprise DNA in those chromosomes. In 1987, these issues rose to become part of the public agenda. The debate involves science, technology, and politics. Congress is responsible for /open quotes/writing the rules/close quotes/ of what various federal agencies do and for funding their work. This report surveys the points made so far in the debate, focusing on those that most directly influence the policy options facing the US Congress. Congressional interest focused on how to assess the rationales for conducting human genome projects, how to fund human genome projects (at what level and through which mechanisms), how to coordinate the scientific and technical programs of the several federal agencies and private interests already supporting various genome projects, and how to strike a balance regarding the impact of genome projects on international scientific cooperation and international economic competition in biotechnology. OTA prepared this report with the assistance of several hundred experts throughout the world. 342 refs., 26 figs., 11 tabs.

  14. Information and dialogue conference on the human genome project for the minority communities in the state of Louisiana

    SciTech Connect (OSTI)

    1999-04-17

    Conference objectives included bringing HGP information and a focus in the minority community on the project, in clear and understandable terms, to spread the work in the minority community about the project; to explore the likely positive implications with respect to health care and related matters; to explore possible negative results and strategies to meet them; to discuss the social, legal, and ethical implications; and to facilitate minority input into the HGP as it develops.

  15. Human-mouse comparative genomics: successes and failures to reveal functional regions of the human genome

    SciTech Connect (OSTI)

    Pennacchio, Len A.; Baroukh, Nadine; Rubin, Edward M.

    2003-05-15

    Deciphering the genetic code embedded within the human genome remains a significant challenge despite the human genome consortium's recent success at defining its linear sequence (Lander et al. 2001; Venter et al. 2001). While useful strategies exist to identify a large percentage of protein encoding regions, efforts to accurately define functional sequences in the remaining {approx}97 percent of the genome lag. Our primary interest has been to utilize the evolutionary relationship and the universal nature of genomic sequence information in vertebrates to reveal functional elements in the human genome. This has been achieved through the combined use of vertebrate comparative genomics to pinpoint highly conserved sequences as candidates for biological activity and transgenic mouse studies to address the functionality of defined human DNA fragments. Accordingly, we describe strategies and insights into functional sequences in the human genome through the use of comparative genomics coupled wit h functional studies in the mouse.

  16. Initial sequencing and analysis of the human genome

    E-Print Network [OSTI]

    Boetticher, Gary D.

    Initial sequencing and analysis of the human genome International Human Genome Sequencing. ............................................................................................................................................................................................................................................................................ The human genome holds an extraordinary trove of information about human development, physiology, medicine a draft sequence of the human genome. We also present an initial analysis of the data, describing some

  17. Insights from Human/Mouse genome comparisons

    SciTech Connect (OSTI)

    Pennacchio, Len A.

    2003-03-30

    Large-scale public genomic sequencing efforts have provided a wealth of vertebrate sequence data poised to provide insights into mammalian biology. These include deep genomic sequence coverage of human, mouse, rat, zebrafish, and two pufferfish (Fugu rubripes and Tetraodon nigroviridis) (Aparicio et al. 2002; Lander et al. 2001; Venter et al. 2001; Waterston et al. 2002). In addition, a high-priority has been placed on determining the genomic sequence of chimpanzee, dog, cow, frog, and chicken (Boguski 2002). While only recently available, whole genome sequence data have provided the unique opportunity to globally compare complete genome contents. Furthermore, the shared evolutionary ancestry of vertebrate species has allowed the development of comparative genomic approaches to identify ancient conserved sequences with functionality. Accordingly, this review focuses on the initial comparison of available mammalian genomes and describes various insights derived from such analysis.

  18. DOE Human Genome Program contractor-grantee workshop

    SciTech Connect (OSTI)

    1996-01-01

    This volume contains the proceedings for the DOE Human Genome Program`s Contractor-Grantee Workshop V held in Sante Fe, New Mexico January 28, February 1, 1996. Presentations were divided into sessions entitled Sequencing; Mapping; Informatics; Ethical, Legal, and Social Issues; and Infrastructure. Reports of individual projects described herein are separately indexed and abstracted for the database.

  19. Editorial: Human and Evolutionary Genomics Human Genomics has, from its outset, included a great deal of evolutionary analysis. The

    E-Print Network [OSTI]

    Pollock, David

    Editorial: Human and Evolutionary Genomics Human Genomics has, from its outset, included a great genomics. This inclusion is the result of an obvious trend in the field of genomics to incorporate more. The world now has over one hundred complete bacterial genomes, and with human, roundworm, multiple

  20. Genome Project Standards in a New Era of Sequencing

    SciTech Connect (OSTI)

    GSC Consortia; HMP Jumpstart Consortia; Chain, P. S. G.; Grafham, D. V.; Fulton, R. S.; FitzGerald, M. G.; Hostetler, J.; Muzny, D.; Detter, J. C.; Ali, J.; Birren, B.; Bruce, D. C.; Buhay, C.; Cole, J. R.; Ding, Y.; Dugan, S.; Field, D.; Garrity, G. M.; Gibbs, R.; Graves, T.; Han, C. S.; Harrison, S. H.; Highlander, S.; Hugenholtz, P.; Khouri, H. M.; Kodira, C. D.; Kolker, E.; Kyrpides, N. C.; Lang, D.; Lapidus, A.; Malfatti, S. A.; Markowitz, V.; Metha, T.; Nelson, K. E.; Parkhill, J.; Pitluck, S.; Qin, X.; Read, T. D.; Schmutz, J.; Sozhamannan, S.; Strausberg, R.; Sutton, G.; Thomson, N. R.; Tiedje, J. M.; Weinstock, G.; Wollam, A.

    2009-06-01

    For over a decade, genome 43 sequences have adhered to only two standards that are relied on for purposes of sequence analysis by interested third parties (1, 2). However, ongoing developments in revolutionary sequencing technologies have resulted in a redefinition of traditional whole genome sequencing that requires a careful reevaluation of such standards. With commercially available 454 pyrosequencing (followed by Illumina, SOLiD, and now Helicos), there has been an explosion of genomes sequenced under the moniker 'draft', however these can be very poor quality genomes (due to inherent errors in the sequencing technologies, and the inability of assembly programs to fully address these errors). Further, one can only infer that such draft genomes may be of poor quality by navigating through the databases to find the number and type of reads deposited in sequence trace repositories (and not all genomes have this available), or to identify the number of contigs or genome fragments deposited to the database. The difficulty in assessing the quality of such deposited genomes has created some havoc for genome analysis pipelines and contributed to many wasted hours of (mis)interpretation. These same novel sequencing technologies have also brought an exponential leap in raw sequencing capability, and at greatly reduced prices that have further skewed the time- and cost-ratios of draft data generation versus the painstaking process of improving and finishing a genome. The resulting effect is an ever-widening gap between drafted and finished genomes that only promises to continue (Figure 1), hence there is an urgent need to distinguish good and poor datasets. The sequencing institutes in the authorship, along with the NIH's Human Microbiome Project Jumpstart Consortium (3), strongly believe that a new set of standards is required for genome sequences. The following represents a set of six community-defined categories of genome sequence standards that better reflect the quality of the genome sequence, based on our collective understanding of the different technologies, available assemblers, and the varied efforts to improve upon drafted genomes. Due to the increasingly rapid pace of genomics we avoided the use of rigid numerical thresholds in our definitions to take into account the types of products achieved by any combination of technology, chemistry, assembler, or improvement/finishing process.

  1. On the Immortality of Television Sets: "Function" in the Human Genome According to the Evolution-Free Gospel

    E-Print Network [OSTI]

    Graur, Dan

    at providing a "parts list" for the human genome (ENCODE Project Consortium 2004). The latest batch of ENCODEOn the Immortality of Television Sets: "Function" in the Human Genome According to the Evolution that more than 80% of the human genome is functional. This claim flies in the face of current

  2. The Genome Database Organism-centered listing of available genomic sequence records and projects

    E-Print Network [OSTI]

    Levin, Judith G.

    The Genome Database Organism-centered listing of available genomic sequence records and projects http://www.ncbi.nlm.nih.gov/genome National Center for Biotechnology Information · National Library | NCBI Genome | Last Update August 19, 2013 Contact: info@ncbi.nlm.nih.gov Scope Since 2011, the Genome

  3. Human genetic-epidemiologic association analysis via allelic composition and DNA sequence similarity methods : applications to blood-based gene expression biomarkers of disease

    E-Print Network [OSTI]

    Wessel, Jennifer

    2006-01-01

    J Schork, Chair The Human Genome Project, and related DNAresult of the Human Genome Project 1, 2 , the Internationalsecond generation” Human Genome Project – was initiated,

  4. Planning the Genome Institute's Future

    E-Print Network [OSTI]

    Botstein, David

    floors of a house, resting on a foundation of the Human Genome Project, with "Genomics to Society" on top planning that society will realize the scientific and public health benefits of the Human Genome Project. It has been a genome community tradi- tion since before there was a Human Genome Project, and NHGRI

  5. nGASP - the nematode genome annotation assessment project

    SciTech Connect (OSTI)

    Coghlan, A; Fiedler, T J; McKay, S J; Flicek, P; Harris, T W; Blasiar, D; Allen, J; Stein, L D

    2008-12-19

    While the C. elegans genome is extensively annotated, relatively little information is available for other Caenorhabditis species. The nematode genome annotation assessment project (nGASP) was launched to objectively assess the accuracy of protein-coding gene prediction software in C. elegans, and to apply this knowledge to the annotation of the genomes of four additional Caenorhabditis species and other nematodes. Seventeen groups worldwide participated in nGASP, and submitted 47 prediction sets for 10 Mb of the C. elegans genome. Predictions were compared to reference gene sets consisting of confirmed or manually curated gene models from WormBase. The most accurate gene-finders were 'combiner' algorithms, which made use of transcript- and protein-alignments and multi-genome alignments, as well as gene predictions from other gene-finders. Gene-finders that used alignments of ESTs, mRNAs and proteins came in second place. There was a tie for third place between gene-finders that used multi-genome alignments and ab initio gene-finders. The median gene level sensitivity of combiners was 78% and their specificity was 42%, which is nearly the same accuracy as reported for combiners in the human genome. C. elegans genes with exons of unusual hexamer content, as well as those with many exons, short exons, long introns, a weak translation start signal, weak splice sites, or poorly conserved orthologs were the most challenging for gene-finders. While the C. elegans genome is extensively annotated, relatively little information is available for other Caenorhabditis species. The nematode genome annotation assessment project (nGASP) was launched to objectively assess the accuracy of protein-coding gene prediction software in C. elegans, and to apply this knowledge to the annotation of the genomes of four additional Caenorhabditis species and other nematodes. Seventeen groups worldwide participated in nGASP, and submitted 47 prediction sets for 10 Mb of the C. elegans genome. Predictions were compared to reference gene sets consisting of confirmed or manually curated gene models from WormBase. The most accurate gene-finders were 'combiner' algorithms, which made use of transcript- and protein-alignments and multi-genome alignments, as well as gene predictions from other gene-finders. Gene-finders that used alignments of ESTs, mRNAs and proteins came in second place. There was a tie for third place between gene-finders that used multi-genome alignments and ab initio gene-finders. The median gene level sensitivity of combiners was 78% and their specificity was 42%, which is nearly the same accuracy as reported for combiners in the human genome. C. elegans genes with exons of unusual hexamer content, as well as those with many exons, short exons, long introns, a weak translation start signal, weak splice sites, or poorly conserved orthologs were the most challenging for gene-finders.

  6. The HapMap project has raised high hopes for mapping genetic determinants of complex human

    E-Print Network [OSTI]

    Rosenberg, Noah

    The HapMap project has raised high hopes for mapping genetic determinants of complex human disease for mapping studies in human populations around the world. The HapMap project has characterized haplotype structures across the genome for four human populations with the goal of enabling genome-wide sets of SNPs

  7. Human Genome Research: Decoding DNA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D.Food Drive HolidayHoursaUS Dept ofHui-YuanHuman

  8. The Emergence of ActualThe Emergence of Actual Human Disease as a Model forHuman Disease as a Model for

    E-Print Network [OSTI]

    Boguski, Mark S.

    Gene + Chromose + Chromosomome +e + ""icsics"" == GenomicsGenomics 1990 Human Genome Project launched1990 Human Genome Project launched 1998 Human Genome Project1998 Human Genome Project acceleratedaccelerated for human." Jacques Monod, c. 1961 David Botstein, 1988 #12;G. Rubin et al. (2000) Comparative Genomics

  9. Using Genomics to Study Human Biology and Disease

    SciTech Connect (OSTI)

    Myers, Ricard M.

    2005-04-06

    The Human Genome Project culminated in April 2003 with the finished DNA sequence of all of the human chromosomes. This book of information, particularly in conjunction with the genome sequences of many other organisms, has already begun to revolutionize the way that biomedical scientists study our species. The identification of essentially all of our genes has provided a template upon which researchers can discover basic processes that govern cells, organs, and the whole organism, and to understand the fundamental causes of the diseases that occur when something goes wrong with a gene or a set of genes. The Genome Project has already made it possible to identify the genes that are defective in more than 1,000 rare inherited diseases, and these discoveries have helped to understand the mechanisms of the more common forms of these disorders. This understanding of primary defects in diseases - which is translated as mutations in genes that encode proteins that serve specific functions - is transforming the way that biotechnology and pharmaceutical companies identify drug targets, and a few notable cases have already had a striking impact on specific diseases. In addition, it has become clear that the differential response to drugs in human populations is heavily influenced by genes, and a whole field called pharmacogenetics has begun to identify these genetic factors. Such knowledge will allow physicians to prescribe drugs targeted to each individual, with the potential to increase efficacy and decrease side-effects. Determining the DNA sequence of the human genome and identifying the genes has been an exciting endeavor, but we are only just beginning to understand the treasures present in all of our DNA. My presentation will briefly describe the road we took to get the sequence, as well as the tools that we are developing to unlock its secrets.

  10. Project ATHENA creates surrogate human organ systems

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Project ATHENA creates surrogate human organ systems Project ATHENA creates surrogate human organ systems The development of miniature surrogate human organs, coupled with highly...

  11. Defining functional DNA elements in the human genome

    E-Print Network [OSTI]

    Kellis, Manolis

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements ...

  12. Report of the second Human Genome Diversity workshop

    SciTech Connect (OSTI)

    1992-12-31

    The Second Human Genome Diversity Workshop was successfully held at Penn State University from October 29--31, 1992. The Workshop was essentially organized around 7 groups, each comprising approximately 10 participants, representing the sampling issues in different regions of the world. These groups worked independently, using a common format provided by the organizers; this was adjusted as needed by the individual groups. The Workshop began with a presentation of the mandate to the participants, and of the procedures to be followed during the workshop. Dr. Feldman presented a summary of the results from the First Workshop. He and the other organizers also presented brief comments giving their perspective on the objectives of the Second Workshop. Dr. Julia Bodmer discussed the study of European genetic diversity, especially in the context of the HLA experience there, and of plans to extend such studies in the coming years. She also discussed surveys of world HLA laboratories in regard to resources related to Human Genome Diversity. Dr. Mark Weiss discussed the relevance of nonhuman primate studies for understanding how demographic processes, such as mate exchange between local groups, affected the local dispersion of genetic variation. Primate population geneticists have some relevant experience in interpreting variation at this local level, in particular, with various DNA fingerprinting methods. This experience may be relevant to the Human Genome Diversity Project, in terms of practical and statistical issues.

  13. The Emergence of ActualThe Emergence of Actual Human Disease as a Model forHuman Disease as a Model for

    E-Print Network [OSTI]

    Boguski, Mark S.

    + Chromosomome +e + ""icsics"" == GenomicsGenomics 1990 Human Genome Project launched1990 Human Genome Project launched 1998 Human Genome Project1998 Human Genome Project acceleratedaccelerated 20002000 ""DraftThe Emergence of ActualThe Emergence of Actual Human Disease as a Model forHuman Disease as a Model

  14. Personal Genomics, Personalized Medicine,

    E-Print Network [OSTI]

    Napp, Nils

    /Science Translational Medicine panel discussion; MLA 2012 #12;Timeline: Human Genome Sequence HSLS, U.Pitt 1995 2014 2000 2003 2007 2007 2010 Human Genome Draft Sequence Complete Human Reference Genome Individual Human of a free living organism: Haemophilus Influenzae #12;Personal Genome Project HSLS, U.Pitt #12;Why get

  15. Evolutionary Genomics of Life in (and from) the Sea

    E-Print Network [OSTI]

    Boore, Jeffrey L.

    2009-01-01

    built for the Human Genome Project (Lander et al. , 2001;developed for the Human Genome Project can now best behuman genome, and nearly all of this is directed at projects

  16. Published 12 March 2014 1 Human Genome Variation

    E-Print Network [OSTI]

    Cai, Long

    technologies, including interactive browsing and efficient data- and text-mining. Journal Details Editor of Tokyo Editorial office: Human Genome Variation Editorial Office Nature Publishing Group Chiyoda Building

  17. Reconstructing the Genomic Architecture of Ancestral Mammals: Lessons From Human,

    E-Print Network [OSTI]

    Batzoglou, Serafim

    Reconstructing the Genomic Architecture of Ancestral Mammals: Lessons From Human, Mouse, and Rat Genomes Guillaume Bourque,1 Pavel A. Pevzner,2 and Glenn Tesler3,4 1 Centre de Recherches Mathe of Mathematics, University of California­San Diego, La Jolla, California 92093, USA Recent analysis of genome

  18. Finishing The Euchromatic Sequence Of The Human Genome

    SciTech Connect (OSTI)

    Rubin, Edward M.; Lucas, Susan; Richardson, Paul; Rokhsar, Daniel; Pennacchio, Len

    2004-09-07

    The sequence of the human genome encodes the genetic instructions for human physiology, as well as rich information about human evolution. In 2001, the International Human Genome Sequencing Consortium reported a draft sequence of the euchromatic portion of the human genome. Since then, the international collaboration has worked to convert this draft into a genome sequence with high accuracy and nearly complete coverage. Here, we report the result of this finishing process.The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers {approx}99% of the euchromatic genome and is accurate to an error rate of {approx}1 event per 100,000 bases. Many of the remaining euchromatic gaps are associated with segmental duplications and will require focused work with new methods. The near-complete sequence, the first for a vertebrate, greatly improves the precision of biological analyses of the human genome including studies of gene number,birth and death. Notably, the human genome seems to encode only20,000-25,000 protein-coding genes. The genome sequence reported here should serve as a firm foundation for biomedical research in the decades ahead.

  19. Mapping the Human Reference Genome's Missing Sequence by Three-Way Admixture in Latino Genomes

    E-Print Network [OSTI]

    McCarroll, Steve

    ARTICLE Mapping the Human Reference Genome's Missing Sequence by Three-Way Admixture in Latino Genomes Giulio Genovese,1,2,3,* Robert E. Handsaker,2,3 Heng Li,2,3 Eimear E. Kenny,4,5,6,7,8 and Steven A. McCarroll1,2,3,* A principal obstacle to completing maps and analyses of the human genome involves

  20. Human Genome Program Image Gallery (from genomics.energy.gov)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    This collection contains approximately 240 images from the genome programs of DOE's Office of Science. The images are divided into galleries related to biofuels research, systems biology, and basic genomics. Each image has a title, a basic citation, and a credit or source. Most of the images are original graphics created by the Genome Management Information System (GMIS). GMIS images are recognizable by their credit line. Permission to use these graphics is not needed, but please credit the U.S. Department of Energy Genome Programs and provide the website http://genomics.energy.gov. Other images were provided by third parties and not created by the U.S. Department of Energy. Users must contact the person listed in the credit line before using those images. The high-resolution images can be downloaded.

  1. The Cancer Genome Atlas Pan-Cancer analysis project

    E-Print Network [OSTI]

    Lander, Eric S.

    The Cancer Genome Atlas (TCGA) Research Network has profiled and analyzed large numbers of human tumors to discover molecular aberrations at the DNA, RNA, protein and epigenetic levels. The resulting rich data provide a ...

  2. Statistical Challenges in Functional Genomics Paola Sebastiani and Marco Ramoni

    E-Print Network [OSTI]

    Spang, Rainer

    in Functional Genomics 1. The Human Genome Project The Human Genome Project (HGP) is a multi-year effort in 1990, the HGP is expected to render its final results in 2005, but the staggering technological

  3. Fuzzy Genome Sequence Assembly for Single and Environmental Genomes

    E-Print Network [OSTI]

    Nicolescu, Monica

    and to the first genome sequence as- sembly, Bacteriophage X174 [38]. In 1990 the Human Genome Project in 2003, two years before its projected date. #12;2 Sara Nasser, et al In 1993 The Institute for Genome advancements in technology that lead the to complete sequencing of the Human Genome and the H. influenzae

  4. Predicting Tissue-Specific Enhancers in the Human Genome

    SciTech Connect (OSTI)

    Pennacchio, Len A.; Loots, Gabriela G.; Nobrega, Marcelo A.; Ovcharenko, Ivan

    2006-07-01

    Determining how transcriptional regulatory signals areencoded in vertebrate genomes is essential for understanding the originsof multi-cellular complexity; yet the genetic code of vertebrate generegulation remains poorly understood. In an attempt to elucidate thiscode, we synergistically combined genome-wide gene expression profiling,vertebrate genome comparisons, and transcription factor binding siteanalysis to define sequence signatures characteristic of candidatetissue-specific enhancers in the human genome. We applied this strategyto microarray-based gene expression profiles from 79 human tissues andidentified 7,187 candidate enhancers that defined their flanking geneexpression, the majority of which were located outside of knownpromoters. We cross-validated this method for its ability to de novopredict tissue-specific gene expression and confirmed its reliability in57 of the 79 available human tissues, with an average precision inenhancer recognition ranging from 32 percent to 63 percent, and asensitivity of 47 percent. We used the sequence signatures identified bythis approach to assign tissue-specific predictions to ~;328,000human-mouse conserved noncoding elements in the human genome. Byoverlapping these genome-wide predictions with a large in vivo dataset ofenhancers validated in transgenic mice, we confirmed our results with a28 percent sensitivity and 50 percent precision. These results indicatethe power of combining complementary genomic datasets as an initialcomputational foray into the global view of tissue-specific generegulation in vertebrates.

  5. Flourishing and Discordance: On Two Modes of Human Science Engagement with Synthetic Biology

    E-Print Network [OSTI]

    Stavrianakis, Anthony

    2012-01-01

    just as with the Human Genome Project, dedicated researchELSI) model of the Human Genome Project and the ‘lab study’ELSI) model of the Human Genome Project. ELSI. Remediations

  6. Divide and (epigenetic) rule: Chromatin domains as functional and structural units of genomes

    E-Print Network [OSTI]

    Giri, Ranjit K.

    of these in development, differentiation, and disease are also discussed. 1. The Genome era The Human Genome Project the genome sequencing projects revealed, that the total number of genes in human genome was not more than produced a refer- ence sequence of the euchromatic human genome, which was the first major genome sequenced

  7. Beyond The Human Genome: What's Next? (LBNL Summer Lecture Series)

    ScienceCinema (OSTI)

    Rokhsar, Daniel

    2014-05-06

    UC Berkeley's Daniel Rokhsar and his colleagues were instrumental in contributing the sequences for three of the human body's chromosomes in the effort to decipher the blueprint of life- the completion of the DNA sequencing of the human genome. Now he is turning to the structure and function of genes in other organisms, some of them no less important to the planet's future than the human map. Hear the latest in this lecture from Lawrence Berkeley National Laboratory.

  8. Materials Project: A Materials Genome Approach

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Ceder, Gerbrand [MIT; Persson, Kristin [LBNL

    Technological innovation - faster computers, more efficient solar cells, more compact energy storage - is often enabled by materials advances. Yet, it takes an average of 18 years to move new materials discoveries from lab to market. This is largely because materials designers operate with very little information and must painstakingly tweak new materials in the lab. Computational materials science is now powerful enough that it can predict many properties of materials before those materials are ever synthesized in the lab. By scaling materials computations over supercomputing clusters, this project has computed some properties of over 80,000 materials and screened 25,000 of these for Li-ion batteries. The computations predicted several new battery materials which were made and tested in the lab and are now being patented. By computing properties of all known materials, the Materials Project aims to remove guesswork from materials design in a variety of applications. Experimental research can be targeted to the most promising compounds from computational data sets. Researchers will be able to data-mine scientific trends in materials properties. By providing materials researchers with the information they need to design better, the Materials Project aims to accelerate innovation in materials research.[copied from http://materialsproject.org/about] You will be asked to register to be granted free, full access.

  9. COMPUTATIONAL GENOMICS: MAPPING, COMPARISON, AND ANNOTATION OF GENOMES

    E-Print Network [OSTI]

    address key issues in the different stages of genome research: planning of a genome sequencing project areas: (1) In relation to the early stages of a genome project, we address physical mapping, and we structure and sequence analysis of orthologous human and mouse genomic regions, and develop ROSETTA

  10. GenomeView: a next-generation genome browser Thomas Abeel1,2,3,

    E-Print Network [OSTI]

    Gent, Universiteit

    of NGS is the re-sequencing of genomes, such as the 1000 human genomes project (http://www .1000genomes.org/) or the 1001 Arabidopsis genome project (http://www.1001genomes.org/). Genome (re)sequencing is importantGenomeView: a next-generation genome browser Thomas Abeel1,2,3, *, Thomas Van Parys1,2 , Yvan Saeys

  11. Prediction of Membrane Proteins in Post-Genomic Era

    E-Print Network [OSTI]

    Kihara, Daisuke

    by the report that the human genome sequencing project has been completed [1,2]. Beyond the human genome, a surge of world-wide genome projects in the last decade have been producing complete genome sequences1 Prediction of Membrane Proteins in Post-Genomic Era Daisuke Kihara1* & Minoru Kanehisa2 1) Donald

  12. Genomic mosaicism in the human brain

    E-Print Network [OSTI]

    Westra, Jurjen Willem

    2008-01-01

    Zlokovic BV (2008) The blood-brain barrier in health andmosaicism in the human brain ………………………………………. Chapter Threethe Alzheimer’s disease brain ………………………………. Chapter Five DNA

  13. The Genomes On Line Database (GOLD) in 2009: status of genomic and metagenomic projects and their associated metadata

    SciTech Connect (OSTI)

    Liolios, Konstantinos; Chen, Amy; Mavromatis, Konstantinos; Tavernarakis, Nektarios; Hugenholtz, Phil; Markowitz, Victor; Kyrpides, Nikos C.

    2009-09-01

    The Genomes On Line Database (GOLD) is a comprehensive resource for centralized monitoring of genome and metagenome projects worldwide. Both complete and ongoing projects, along with their associated metadata, can be accessed in GOLD through precomputed tables and a search page. As of September 2009, GOLD contains information for more than 5800 sequencing projects, of which 1100 have been completed and their sequence data deposited in a public repository. GOLD continues to expand, moving toward the goal of providing the most comprehensive repository of metadata information related to the projects and their organisms/environments in accordance with the Minimum Information about a (Meta)Genome Sequence (MIGS/MIMS) specification.

  14. The Genomes On Line Database (GOLD) in 2007: status of genomic and metagenomic projects and their associated metadata

    SciTech Connect (OSTI)

    Fenner, Marsha W; Liolios, Konstantinos; Mavromatis, Konstantinos; Tavernarakis, Nektarios; Kyrpides, Nikos C.

    2007-12-31

    The Genomes On Line Database (GOLD) is a comprehensive resource of information for genome and metagenome projects world-wide. GOLD provides access to complete and ongoing projects and their associated metadata through pre-computed lists and a search page. The database currently incorporates information for more than 2900 sequencing projects, of which 639 have been completed and the data deposited in the public databases. GOLD is constantly expanding to provide metadata information related to the project and the organism and is compliant with the Minimum Information about a Genome Sequence (MIGS) specifications.

  15. Meeting Report. Assessing Human Germ-Cell Mutagenesis in the Post-Genome Era: A Celebration of the Legacy of William Lawson (Bill) Russell

    E-Print Network [OSTI]

    2006-01-01

    landmark Human Genome Project (HGP) and its relationship toMoyzis explained that the HGP initially arose out of concernHowever, with time, the HGP changed its focus to concentrate

  16. Human genome program report. Part 1, overview and progress

    SciTech Connect (OSTI)

    1997-11-01

    This report contains Part 1 of a two-part report to reflect research and progress in the U.S. Department of Energy Human Genome Program from 1994 through 1996, with specified updates made just before publication. Part 1 consists of the program overview and report on progress.

  17. Human genome program report. Part 2, 1996 research abstracts

    SciTech Connect (OSTI)

    1997-11-01

    This report contains Part 2 of a two-part report to reflect research and progress in the US Department of Energy Human Genome Program from 1994 through 1996, with specified updates made just before publication. Part 2 consists of 1996 research abstracts. Attention is focused on the following: sequencing; mapping; informatics; ethical, legal, and social issues; infrastructure; and small business innovation research.

  18. Data mining and the human genome

    SciTech Connect (OSTI)

    Abarbanel, Henry [The MITRE Corporation, McLean, VA (US). JASON Program Office; Callan, Curtis [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dally, William [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dyson, Freeman [The MITRE Corporation, McLean, VA (US). JASON Program Office; Hwa, Terence [The MITRE Corporation, McLean, VA (US). JASON Program Office; Koonin, Steven [The MITRE Corporation, McLean, VA (US). JASON Program Office; Levine, Herbert [The MITRE Corporation, McLean, VA (US). JASON Program Office; Rothaus, Oscar [The MITRE Corporation, McLean, VA (US). JASON Program Office; Schwitters, Roy [The MITRE Corporation, McLean, VA (US). JASON Program Office; Stubbs, Christopher [The MITRE Corporation, McLean, VA (US). JASON Program Office; Weinberger, Peter [The MITRE Corporation, McLean, VA (US). JASON Program Office

    2000-01-07

    As genomics research moves from an era of data acquisition to one of both acquisition and interpretation, new methods are required for organizing and prioritizing the data. These methods would allow an initial level of data analysis to be carried out before committing resources to a particular genetic locus. This JASON study sought to delineate the main problems that must be faced in bioinformatics and to identify information technologies that can help to overcome those problems. While the current influx of data greatly exceeds what biologists have experienced in the past, other scientific disciplines and the commercial sector have been handling much larger datasets for many years. Powerful datamining techniques have been developed in other fields that, with appropriate modification, could be applied to the biological sciences.

  19. Identification and analysis of functional elements in 1% of the human genome by

    E-Print Network [OSTI]

    Lieb, Jason

    ARTICLES Identification and analysis of functional elements in 1% of the human genome by the ENCODE frommultiple,diverseexperimentsperformedonatargeted 1%ofthe human genome as part of the pilot phase and computational analyses. Together, our results advance the collective knowledge about human genome function

  20. Newly discovered young CORE-SINEs in marsupial genomes Maruo Munemasa a

    E-Print Network [OSTI]

    Austin, Christopher C.

    of the human genome project, the contribution of SINEs to the human genome has been clarified in detail genome projects have uncovered a large part of genomic component of various groups, several repetitive of various mammals with respect to SINEs. Recent comprehensive genome sequencing projects have allowed us

  1. Genome MedicineGenome Medicine This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted

    E-Print Network [OSTI]

    ) is a key tool in genomics, in particular to study inherited and acquired human genetic disorders [1]. Multiple projects now aim at mapping the human genetic variation on a large scale, such as the 1,000 Genomes Project [2], the UK 100 k Genome Project [3], or the Genome of the Netherlands [4]. Meanwhile

  2. BIOL 430 Genome Evolution 2015 -draft syllabus Tuesdays and Thursdays, 8:00 9:30 (section 102) or 9:30 -10:50 (section 101)

    E-Print Network [OSTI]

    Wood, Spencer

    concepts and discoveries in genomics and genome evolution to human disease to receive immediate feedback on their answers. Genomics computer project and write browsers, genome project sites, gene expression sites and databases, databases

  3. DOE Human Genome Program report of the second contractor-grantee workshop

    SciTech Connect (OSTI)

    Not Available

    1991-08-01

    The number of genome-funded projects has increased rapidly, and the Human Genome Initiative has grown into a flourishing program, with a complementary counterpart at the National Institutes of Health. The impact of the Human Genome Project on science and society will be substantial as significant achievements become frequent occurrences. New physical mapping strategies have allowed our national laboratories and university grantees to move ahead in a timely manner, and development of innovative approaches to determining the base sequence of chromosomes is proceeding at an encouraging rate. Our computational capabilities are improving. New networking workstations and methods of inputting and analyzing mapping and sequencing data are being developed to allow investigators easy access to data from major databanks. Investigations are under way into the ethical, legal, and social implications of the use of data generated by this program. Program management needs, such as project coordination and the desire to create an environment in which the program's investigators could interact, formed the basis for this workshop. The 1991 workshop had many stimulating presentations, and numerous collaborative efforts have developed, but we anticipate that its successor, scheduled for the all of 1992, will provide additional concepts, strategies, and technologies that are not yet imagined and that are based on multidisciplinary interactions. This document provides the abstracts of all talks and poster sessions.

  4. Genomes to Life Project Quartely Report October 2004.

    SciTech Connect (OSTI)

    Heffelfinger, Grant S.; Martino, Anthony; Rintoul, Mark Daniel; Geist, Al; Gorin, Andrey; Xu, Ying; Palenik, Brian

    2005-02-01

    This SAND report provides the technical progress through October 2004 of the Sandia-led project, %22Carbon Sequestration in Synechococcus Sp.: From Molecular Machines to Hierarchical Modeling,%22 funded by the DOE Office of Science Genomes to Life Program. Understanding, predicting, and perhaps manipulating carbon fixation in the oceans has long been a major focus of biological oceanography and has more recently been of interest to a broader audience of scientists and policy makers. It is clear that the oceanic sinks and sources of CO2 are important terms in the global environmental response to anthropogenic atmospheric inputs of CO2 and that oceanic microorganisms play a key role in this response. However, the relationship between this global phenomenon and the biochemical mechanisms of carbon fixation in these microorganisms is poorly understood. In this project, we will investigate the carbon sequestration behavior of Synechococcus Sp., an abundant marine cyanobacteria known to be important to environmental responses to carbon dioxide levels, through experimental and computational methods. This project is a combined experimental and computational effort with emphasis on developing and applying new computational tools and methods. Our experimental effort will provide the biology and data to drive the computational efforts and include significant investment in developing new experimental methods for uncovering protein partners, characterizing protein complexes, identifying new binding domains. We will also develop and apply new data measurement and statistical methods for analyzing microarray experiments. Computational tools will be essential to our efforts to discover and characterize the function of the molecular machines of Synechococcus. To this end, molecular simulation methods will be coupled with knowledge discovery from diverse biological data sets for high-throughput discovery and characterization of protein-protein complexes. In addition, we will develop a set of novel capabilities for inference of regulatory pathways in microbial genomes across multiple sources of information through the integration of computational and experimental technologies. These capabilities will be applied to Synechococcus regulatory pathways to characterize their interaction map and identify component proteins in these - 4 - pathways. We will also investigate methods for combining experimental and computational results with visualization and natural language tools to accelerate discovery of regulatory pathways. The ultimate goal of this effort is develop and apply new experimental and computational methods needed to generate a new level of understanding of how the Synechococcus genome affects carbon fixation at the global scale. Anticipated experimental and computational methods will provide ever-increasing insight about the individual elements and steps in the carbon fixation process, however relating an organism's genome to its cellular response in the presence of varying environments will require systems biology approaches. Thus a primary goal for this effort is to integrate the genomic data generated from experiments and lower level simulations with data from the existing body of literature into a whole cell model. We plan to accomplish this by developing and applying a set of tools for capturing the carbon fixation behavior of complex of Synechococcus at different levels of resolution. Finally, the explosion of data being produced by high-throughput experiments requires data analysis and models which are more computationally complex, more heterogeneous, and require coupling to ever increasing amounts of experimentally obtained data in varying formats. These challenges are unprecedented in high performance scientific computing and necessitate the development of a companion computational infrastructure to support this effort. More information about this project, including a copy of the original proposal, can be found at www.genomes-to-life.org Acknowledgment We want to gratefully acknowledge the contributions of the GTL Project Te

  5. THE STATUS OF STRUCTURAL GENOMICS DEFINED THROUGH THE ANALYSIS OF CURRENT TARGETS AND

    E-Print Network [OSTI]

    Krebs, Werner G.

    on to the human genome project. This is interpreted to mean a large-scale project, with scientific, engineering of the human genome project were relatively well defined ­ sequence the 3 billion nucleotides comprising the human #12;genome and define all open reading frames ­ the goals advanced for structural genomics

  6. Hippocrates and Helices The Importance of Integrating Genomics, Epigenomics, and Personalized Medicine into Systems

    E-Print Network [OSTI]

    Brutlag, Doug

    Hippocrates and Helices The Importance of Integrating Genomics, Epigenomics, and Personalized an increased emphasis on personalized medicine. Succinctly, medical educators should integrate genomics of the Human Genome Project: personalized medical disciplines, particularly genomic medicine and epigenomic

  7. Unlocking the Secrets of the Genome

    E-Print Network [OSTI]

    Celniker, Susan E.

    The primary objective of the Human Genome Project was to produce high-quality sequences not just for the human genome but also for those of the chief model organisms: Escherichia coli, yeast (Saccharomyces cerevisiae), ...

  8. RNA-programmed genome editing in human cells Martin Jinek1

    E-Print Network [OSTI]

    Doudna, Jennifer A.

    1 RNA-programmed genome editing in human cells Martin Jinek1 , Alexandra East2 , Aaron endonuclease stimulates site-specific genome editing in human cells. #12; 2 Abstract Type II at the 3' end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome

  9. An initial strategy for the systematic identification of functional elements in the human genome by

    E-Print Network [OSTI]

    Miller, Webb

    An initial strategy for the systematic identification of functional elements in the human genome*§ , Eric S. Lander , James C. Mullikin*§ **, and Michele Clamp ** *Genome Technology Branch and §NISC, National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892; Broad

  10. Defining Genome Project Standards in a New Era of Sequencing

    SciTech Connect (OSTI)

    Chain, Patrick [DOE-JGI

    2009-05-27

    Patrick Chain of the DOE Joint Genome Institute gives a talk on behalf of the International Genome Sequencing Standards Consortium on the need for intermediate genome classifications between "draft" and "finished"

  11. Developing Grid-based Systems for Microbial Genome Comparisons: The Microbase Project

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    Developing Grid-based Systems for Microbial Genome Comparisons: The Microbase Project Anil Wipat, University of Newcastle upon Tyne Abstract Comparative analysis of genomes allows the rich source of biological genome sequence data to be most efficiently exploited. However, the rate at which microbial

  12. Human Resources Organizational Readiness Project: An Overview

    E-Print Network [OSTI]

    Finzi, Adrien

    and easily interface with SAP software Managed by a special Human Resources project team Will be undertaken in close coordination with the BUworks program team HR Organizational Readiness Project BUworks / SAP of SAP Enhanced data security within the new system Current job "system" is 30 years old ­ it must

  13. Master Degree Project in Evolutionary Genomics Identification and characterization of the genetic basis of reproductive isolation is

    E-Print Network [OSTI]

    Uppsala Universitet

    Master Degree Project in Evolutionary Genomics ! ! Background Identification and characterization in genome sequencing technology and analysis has opened up avenues for speciation genetic research also in species with previously uncharacterized genomes. These advancements hold promise of helping in unraveling

  14. Genomes to life project quarterly report June 2004.

    SciTech Connect (OSTI)

    Heffelfinger, Grant S.

    2005-01-01

    This SAND report provides the technical progress through June 2004 of the Sandia-led project, ''Carbon Sequestration in Synechococcus Sp.: From Molecular Machines to Hierarchical Modeling'', funded by the DOE Office of Science Genomes to Life Program. Understanding, predicting, and perhaps manipulating carbon fixation in the oceans has long been a major focus of biological oceanography and has more recently been of interest to a broader audience of scientists and policy makers. It is clear that the oceanic sinks and sources of CO{sub 2} are important terms in the global environmental response to anthropogenic atmospheric inputs of CO{sub 2} and that oceanic microorganisms play a key role in this response. However, the relationship between this global phenomenon and the biochemical mechanisms of carbon fixation in these microorganisms is poorly understood. In this project, we will investigate the carbon sequestration behavior of Synechococcus Sp., an abundant marine cyanobacteria known to be important to environmental responses to carbon dioxide levels, through experimental and computational methods. This project is a combined experimental and computational effort with emphasis on developing and applying new computational tools and methods. Our experimental effort will provide the biology and data to drive the computational efforts and include significant investment in developing new experimental methods for uncovering protein partners, characterizing protein complexes, identifying new binding domains. We will also develop and apply new data measurement and statistical methods for analyzing microarray experiments. Computational tools will be essential to our efforts to discover and characterize the function of the molecular machines of Synechococcus. To this end, molecular simulation methods will be coupled with knowledge discovery from diverse biological data sets for high-throughput discovery and characterization of protein-protein complexes. In addition, we will develop a set of novel capabilities for inference of regulatory pathways in microbial genomes across multiple sources of information through the integration of computational and experimental technologies. These capabilities will be applied to Synechococcus regulatory pathways to characterize their interaction map and identify component proteins in these pathways. We will also investigate methods for combining experimental and computational results with visualization and natural language tools to accelerate discovery of regulatory pathways. The ultimate goal of this effort is develop and apply new experimental and computational methods needed to generate a new level of understanding of how the Synechococcus genome affects carbon fixation at the global scale. Anticipated experimental and computational methods will provide ever-increasing insight about the individual elements and steps in the carbon fixation process, however relating an organism's genome to its cellular response in the presence of varying environments will require systems biology approaches. Thus a primary goal for this effort is to integrate the genomic data generated from experiments and lower level simulations with data from the existing body of literature into a whole cell model. We plan to accomplish this by developing and applying a set of tools for capturing the carbon fixation behavior of complex of Synechococcus at different levels of resolution. Finally, the explosion of data being produced by high-throughput experiments requires data analysis and models which are more computationally complex, more heterogeneous, and require coupling to ever increasing amounts of experimentally obtained data in varying formats. These challenges are unprecedented in high performance scientific computing and necessitate the development of a companion computational infrastructure to support this effort.

  15. Unlocking the secrets of the genome Despite the successes of genomics, little is known about how genetic information produces complex

    E-Print Network [OSTI]

    Kellis, Manolis

    Unlocking the secrets of the genome Despite the successes of genomics, little is known about how genomes could change that. T he primary objective of the Human Genome Project was to produce high- quality sequences not just for the human genome but also for those of the chief model organisms:Escherichia coli

  16. GenomePro -Processing Genomic Files Of All Sizes Technical Report FIU-SCIS-2015-01-20-1

    E-Print Network [OSTI]

    Robinson, Michael

    to further understand not only our humane genome but any life form genome. Keywords ­ Gigabytes, Terabytes, Genome, Sub-Sequence, I.INTRODUCTION The Genome Project, started in 1990 and completed in April 2003, sequenced the human genome producing files of about 3.2 Gigabytes. During the next 10 years a new sequencing

  17. Initial sequencing and comparative analysis of the mouse genome

    E-Print Network [OSTI]

    Hardison, Ross C.

    and knockin techniques17­22 . For these and other reasons, the Human Genome Project (HGP) recognized from its ........................................................................................................................................................................................................................... The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome comparative analysis of the mouse and human genomes, describing some of the insights that can be gleaned from

  18. Evolving Genomic Metaphors: A New Look at the Language of DNA

    E-Print Network [OSTI]

    Avise, John

    of the genome as a "book of life" helped to focus and sell the human genome sequencing project. However reconnoitered in the human genome project, because the results were truly incredible. The intergenic wilderness sequences of the human genome have nailed the coffin shut on that caricature: The coding "beads" make up

  19. Comparative Genomics of Transcriptional Control in the Human Malaria Parasite Plasmodium falciparum

    E-Print Network [OSTI]

    Arnold, Jonathan

    Comparative Genomics of Transcriptional Control in the Human Malaria Parasite Plasmodium falciparum Richard M.R. Coulson,1,3 Neil Hall,2 and Christos A. Ouzounis1 1 Computational Genomics Group10 1SD, United Kingdom; 2 The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus

  20. REVIEW Open Access Unraveling genomic variation from next

    E-Print Network [OSTI]

    and at a lower cost. Based on the first Sanger sequencing technique, the Human Genome Project (1990­ 2003 accurate and less expensive, the 1000 Human Genome Project [4] was launched (January 2008). The main scope), allowed the release of the first human reference genome by determining the se- quence of ~3 billion base

  1. A Genomic Portrait of Human Microsatellite Variation Bret A. Payseur,*,1

    E-Print Network [OSTI]

    Payseur, Bret

    of SNP variation, with marked heterogeneity among classes of loci. The proportion of variable lociA Genomic Portrait of Human Microsatellite Variation Bret A. Payseur,*,1 Peicheng Jing,1 and Ryan J are beginning to reveal the scope and pattern of human genomic variation. Although single nucleotide

  2. The Data Center (DC) Genome project is a collaborative effort with Microsoft Research

    E-Print Network [OSTI]

    Amir, Yair

    DC Genome The Data Center (DC) Genome project is a collaborative effort with Microsoft Research the efficiency of data center operations and thus minimize their environmental impact. Data center energy about carbon footprints and climate change. Lack of visibility into the data center's operating

  3. Universitt Project EURAT

    E-Print Network [OSTI]

    Heermann, Dieter W.

    of individual people in far less time today than at the conclusion of the Human Genome Project in 2003 (Collins of Whole Human Genome Sequencing" Position Paper Cornerstones for an ethiCally and legally informed Pra 60 61 63 65 67 69 70 71 73 88 96 100 #12;4 5Ethical and Legal Aspects of Whole Human Genome

  4. 388 nature genetics volume 22 august 1999 A YAC-based physical map of the mouse genome

    E-Print Network [OSTI]

    Boguski, Mark S.

    goals of the Human Genome Project1. Here we report the results of a project at the Whitehead Institute of approximately 92% of the mouse genome. We also report the results of a project at the MRC UK Mouse Genome Centre assembling a physical map of the human genome3. The STSs used for screening came from several sources: simple

  5. Examining the Current Problems of Whole Genome Comparison: A Review

    E-Print Network [OSTI]

    Examining the Current Problems of Whole Genome Comparison: A Review Biochemistry 218 Project://www.ncbi.nlm.nih.gov/Genbank/genbankstats.html). The first two publications of microbial whole genome sequencing projects were published in 1995. Only six. Bacterial genomes consist mostly (85-95 %) of coding sequence, the human genome encodes only ~3%, while

  6. |Research Focus In search of the minimal Escherichia coli genome

    E-Print Network [OSTI]

    Conway, Tyrrell

    for a `second human genome project' to compile an inventory of the genomes of the human microflora, Stanley|Research Focus In search of the minimal Escherichia coli genome Darren J. Smalley, Marvin Whiteley and Tyrrell Conway Advanced Center for Genome Technology, The University of Oklahoma, Norman, OK 73019

  7. Enhancing a Genome Database Using the XSB Tabled Logic Programming System

    E-Print Network [OSTI]

    Davulcu, Hasan

    goal of the Human Genome Project 1] is to construct detailed physical maps of the human genome Research at the Whitehead Institute in MIT is engaged in several large-scale genome mapping projectsEnhancing a Genome Database Using the XSB Tabled Logic Programming System Hasan Davulcu I

  8. ANTH 376: GENOMICS & ANTHROPOLOGY 4 credit hours (satisfies an SC requirement)

    E-Print Network [OSTI]

    1 ANTH 376: GENOMICS & ANTHROPOLOGY 4 credit hours (satisfies an SC variation, health and evolution. Extended Course Description The Human Genome Project and recent advances in genome sequencing techniques have made it possible

  9. A Model of the Statistical Power of Comparative Genome Sequence Analysis

    E-Print Network [OSTI]

    Batzoglou, Serafim

    by their evolutionary conservation [1,2,3]. It will be instrumental for achieving the goal of the Human Genome Project to comprehensively identify functional elements in the human genome [4]. How many comparative genome sequences do we not contribute significant information to human genome analysis? Since sequencing is expensive and capacity

  10. EA-0856: Construction and Operation of a Human Genome Laboratory at Lawrence Berkeley Laboratory Berkeley, California

    Broader source: Energy.gov [DOE]

    This EA evaluates the environmental impacts of a proposal to construct and operate a new laboratory for consolidation of current and future activities of the Human Genome Center at the U.S....

  11. DOE Human Genome Program: Contractor-Grantee Workshop IV, November 13--17, 1994, Santa Fe, New Mexico

    SciTech Connect (OSTI)

    Not Available

    1994-10-01

    This volume contains the proceedings of the fourth Contractor-Grantee Workshop for the Department of Energy (DOE) Human Genome Program. Of the 204 abstracts in this book, some 200 describe the genome research of DOE-funded grantees and contractors located at the multidisciplinary centers at Lawrence Berkeley Laboratory, Lawrence Livermore National Laboratory, and Los Alamos National Laboratory; other DOE-supported laboratories; and more than 54 universities, research organizations, and companies in the United States and abroad. Included are 16 abstracts from ongoing projects in the Ethical, Legal, and Social Issues (ELSI) component, an area that continues to attract considerable attention from a wide variety of interested parties. Three abstracts summarize work in the new Microbial Genome Initiative launched this year by the Office of Health and Environmental Research (OHER) to provide genome sequence and mapping data on industrially important microorganisms and those that live under extreme conditions. Many of the projects will be discussed at plenary sessions held throughout the workshop, and all are represented in the poster sessions.

  12. METHOD Open Access A standard variation file format for human

    E-Print Network [OSTI]

    Yandell, Mark

    was originally developed during the human genome project to compare human genome annotations [17]. ImportantlyMETHOD Open Access A standard variation file format for human genome sequences Martin G Reese1 data. The 10Gen dataset, ten human genomes in GVF format, is freely available for com- munity analysis

  13. A Preprocessor for Shotgun Assembly of Large Genomes Michael Roberts, Brian R. Hunt, and James A. Yorke

    E-Print Network [OSTI]

    Maryland at College Park, University of

    Weber and Myers [23] proposed that the entire human genome, with a length of 3 billion bases, could and the Berkeley Drosophila Genome Project achieved a shotgun assembly of the bulk of the Drosophila genome's sequence. In 2001, Celera [21] announced the successful whole-genome shotgun assembly of the human genome

  14. nature methods | VOL.7 NO.9 | SEPTEMBER 2010 | 661 human proteome `encyclopedia'. However, many in the

    E-Print Network [OSTI]

    Cai, Long

    to the Human Genome Project, a large- scale project is needed to catalyze further technology development proteome that will drive proteomics research forward for the benefit of all. The Human Genome Project research is performed. A systematic project to characterize the protein products of the human genome

  15. Corey Clemons Genomics and Medicine

    E-Print Network [OSTI]

    Brutlag, Doug

    the Human Genome Project was completed. The goal of the HGP was to sequence the entire human genome in order to the private sector.i One unintended consequence of the HGP is that it actually challenged previously held with previously misunderstood conditions and ailments. Some practical uses of the HGP are the development

  16. The Human Microbiome Project (HMP) and the Data Analysis and Coordination Center (DAAC) portal to the HMP (GSC8 Meeting)

    ScienceCinema (OSTI)

    Weinstock, George [Washington University School of Medicine]; Wortman, Jennifer [University of Maryland School of Medicine

    2011-04-29

    The Genomic Standards Consortium was formed in September 2005. It is an international, open-membership working body which promotes standardization in the description of genomes and the exchange and integration of genomic data. The 2009 meeting was an activity of a five-year funding "Research Coordination Network" from the National Science Foundation and was organized held at the DOE Joint Genome Institute with organizational support provided by the JGI and by the University of California - San Diego. George Weinstock from Washington University School of Medicine talks about the Human Microbiome Project (HMP) followed briefly by Jennifer Wortman from the University of Maryland School of Medicine on the Data Analysis and Coordination Center (DACC) portal to the HMP at the Genomic Standards Consortium's 8th meeting at the DOE JGI in Walnut Creek, Calif. on Sept. 9, 2009.

  17. The Human Microbiome Project (HMP) and the Data Analysis and Coordination Center (DAAC) portal to the HMP (GSC8 Meeting)

    SciTech Connect (OSTI)

    Weinstock, George; Wortman, Jennifer

    2009-09-09

    The Genomic Standards Consortium was formed in September 2005. It is an international, open-membership working body which promotes standardization in the description of genomes and the exchange and integration of genomic data. The 2009 meeting was an activity of a five-year funding "Research Coordination Network" from the National Science Foundation and was organized held at the DOE Joint Genome Institute with organizational support provided by the JGI and by the University of California - San Diego. George Weinstock from Washington University School of Medicine talks about the Human Microbiome Project (HMP) followed briefly by Jennifer Wortman from the University of Maryland School of Medicine on the Data Analysis and Coordination Center (DACC) portal to the HMP at the Genomic Standards Consortium's 8th meeting at the DOE JGI in Walnut Creek, Calif. on Sept. 9, 2009.

  18. The genomic complexity of primary human prostate cancer

    E-Print Network [OSTI]

    Carter, Scott L.

    Prostate cancer is the second most common cause of male cancer deaths in the United States. However, the full range of prostate cancer genomic alterations is incompletely characterized. Here we present the complete sequence ...

  19. FCTO Projects and the Materials Genome Initiative Webinar

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    non-precious functional materials. The electrochemical conditions are relevant to fuel cells. Project Technical Approach & Example Results * Theory-guided HiTp evaluation...

  20. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    SciTech Connect (OSTI)

    Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

    2011-12-15

    We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

  1. Automated whole-genome multiple alignment of rat, mouse, and human

    SciTech Connect (OSTI)

    Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna

    2004-07-04

    We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: <7% of the rat contigs are aligned to multiple places in human and 97% of all alignments with human sequence > 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

  2. Bioinformatics for the human microbiome project

    E-Print Network [OSTI]

    Gevers, Dirk

    Microbes inhabit virtually all sites of the human body, yet we know very little about the role they play in our health. In recent years, there has been increasing interest in studying human-associated microbial communities, ...

  3. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    SciTech Connect (OSTI)

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.

    2006-07-06

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  4. JGI Fungal Genomics Program

    E-Print Network [OSTI]

    Grigoriev, Igor V.

    2012-01-01

    JGI Fungal Genomics Program Igor V. Grigoriev 1 Lawrenceof California. JGI Fungal Genomics Program Contact: IgorJGI). Its key project, the Genomics Encyclopedia of Fungi,

  5. Genome Wide Evaluation of Normal Human Tissue in Response to...

    Office of Scientific and Technical Information (OSTI)

    Wide Evaluation of Normal Human Tissue in Response to Controlled, In vivo Low-Dose Low LET Ionizing Radiation Exposure: Pathways and Mechanisms Final Report, September 2013 Rocke,...

  6. Project 3 Integrative Genomics (IG) Objective: To give a presentation of about 40-90 minutes duration at the end of the week covering the

    E-Print Network [OSTI]

    Goldschmidt, Christina

    Project 3 ­ Integrative Genomics (IG) Objective: To give a presentation of about 40-90 minutes duration at the end of the week covering the key aspects of the integrative genomics, which is the combined) "Integrative Genomics and Functional Explanation" downloadable from http://www.stats.ox.ac.uk/research/genome

  7. 10.1101/gr.5574907Access the most recent version at doi: 2007 17: 910-916Genome Res.

    E-Print Network [OSTI]

    Iyer, Vishy

    in the human genome. However, whole genome ChIP-chip analysis is still technically challenging in vertebrates networks. [Supplemental material is available online at www.genome.org.] The ENCODE project has suggested that a larger fraction of the human genome than previously suspected may be transcription- ally active (The

  8. Comparative Genomic Analysis of Human Fungal Pathogens Causing Paracoccidioidomycosis

    E-Print Network [OSTI]

    Holder, Jason W.

    Paracoccidioides is a fungal pathogen and the cause of paracoccidioidomycosis, a health-threatening human systemic mycosis endemic to Latin America. Infection by Paracoccidioides, a dimorphic fungus in the order Onygenales, ...

  9. Analysis of alterations in the human cancer genome

    E-Print Network [OSTI]

    Carter, Scott L. (Scott Lambert)

    2011-01-01

    Aneuploidy, an abnormal complement of chromosomes, is present in approximately 90% of human malignancies. Despite over 100 years of research, many questions remain regarding the contribution of aneuploidy to the cancer ...

  10. A Population-Genetic Perspective on the Similarities and Differences Among Worldwide Human Populations

    E-Print Network [OSTI]

    Rosenberg, Noah

    with the genome-wide microsatellites of the Human Genome Diver- sity Project/Centre d'Etude du Polymorphisme individuals in one group from those in other groups? 3. Of the genetic variants that exist in the human genome using the alleles in his or her genome? 6. What events in human evolutionary history are responsible

  11. Sequencing and Analyses of All Known Human Rhinovirus Genomes

    E-Print Network [OSTI]

    Claire M. Fraser-Liggett,4 Stephen B. Liggett3 Infection by human rhinovirus (HRV) is a major cause. These revealed conserved motifs; clade-specific diversity, including a potential newly identified species (HRV-based epidemiologic studies and antiviral or vaccine development. H uman rhinovirus (HRV), the disease agent

  12. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    SciTech Connect (OSTI)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  13. Understanding Historical Human Migration Patterns and Interbreeding (JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)

    SciTech Connect (OSTI)

    Willerslev, Eske [University of Copenhagen] [University of Copenhagen

    2012-03-21

    Eske Willerslev from the University of Copenhagen on "Understanding Historical Human Migration Patterns and Interbreeding Using the Ancient Genomes of a Palaeo-Eskimo and an Aboriginal Australian" at the 7th Annual Genomics of Energy & Environment Meeting on March 21, 2012 in Walnut Creek, California.

  14. Understanding Historical Human Migration Patterns and Interbreeding (JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)

    ScienceCinema (OSTI)

    Willerslev, Eske [University of Copenhagen

    2013-01-15

    Eske Willerslev from the University of Copenhagen on "Understanding Historical Human Migration Patterns and Interbreeding Using the Ancient Genomes of a Palaeo-Eskimo and an Aboriginal Australian" at the 7th Annual Genomics of Energy & Environment Meeting on March 21, 2012 in Walnut Creek, California.

  15. SeqEntropy: Genome-Wide Assessment of Repeats for Short Read Sequencing

    E-Print Network [OSTI]

    Chen, Chaur-Chin

    analysis of human genome [1] and for rapid full genome sequencing and typing of various organisms. The 1000 Genomes Project, launched in 2008, bSeqEntropy: Genome-Wide Assessment of Repeats for Short Read Sequencing Hsueh-Ting Chu1,2 , William

  16. DOE/ER-0382 THE HUMAN GENOME INITIATIVE OF THE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalent Bonding Low-Cost2 DOE HQSiteo n n e v i l l e2Q)1382 THE HUMAN

  17. Project ATHENA creates surrogate human organ systems

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeedingProgramExemptions |(Conference) | SciTech ConnectProject ATHENA creates

  18. Project ATHENA creates surrogate human organ systems

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-Rich Matricesstudents working1999-2000University 4 -Project

  19. Population Genomics Objective: To give a presentation of about 40-90 minutes duration at the end of the week covering the key aspects

    E-Print Network [OSTI]

    Goldschmidt, Christina

    Population Genomics Objective: To give a presentation of about 40-90 minutes duration at the end of the week covering the key aspects of the population genomics of humans. This 1000 genomes project is devoted to the exciting project, where the genomes of a 1000 individuals are to be sequenced in the next

  20. Population structure in a comprehensive genomic data set on human microsatellite variation Trevor J. Pemberton

    E-Print Network [OSTI]

    Rosenberg, Noah

    Population structure in a comprehensive genomic data set on human microsatellite variation Trevor J.5 Proportion of loci with 0 shared alleles identical in state (p0 ) Proportionoflociwith2shared allelesidenticalinstate(p2 ) 0.1 0.3 0.4 0 0.1 0.2 0.3 0.4 0.5 0.2 0.5 Proportion of loci with 0 shared alleles identical

  1. Privacy in the Genomic Era Muhammad Naveed*

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    with the announcement twelve years ago that the Human Genome Project (HGP) had completed its goals [Guttmacher at the advent of the HGP. In parallel with this trend there has been significant progress on understanding

  2. Sir --The policy on release of unpublished data from large genome centres has

    E-Print Network [OSTI]

    Salzberg, Steven

    , journals and journal reviewers. The Human Genome Project has been a spectacularly successful demonstration analysis of the results of the sequencing project". This reflects the real concern of the genome centresSir -- The policy on release of unpublished data from large genome centres has generated

  3. The chromosome folding problem: How to organize a 2 meter genome into a 20 micron nucleus?

    E-Print Network [OSTI]

    Poonen, Bjorn

    ;#12;#12;#12;Why study chromosome organization? #12;Human genome project-- now that we know our ATCGs, what do they mean? #12;Goal: Develop a parts list of functional elements in the human genome httpsThe chromosome folding problem: How to organize a 2 meter genome into a 20 micron nucleus? #12

  4. Genome-wide Single-Cell Analysis of Recombination Activity and De Novo

    E-Print Network [OSTI]

    Quake, Stephen R.

    an individual human's genome is edited by these two processes. Here, we describe a high-throughput method model organisms. However, it has been unclear how an individual human's genome is edited during-Boege et al., 2006). The 1000 Genome Project measured the mutation rate in two family trios (Conrad et al

  5. Assessing human rights impacts in corporate development projects

    SciTech Connect (OSTI)

    Salcito, Kendyl; University of Basel, P.O. Box, CH-4003 Basel; NomoGaia, 1900 Wazee Street, Suite 303, Denver, CO 80202; NewFields, LLC, Denver, CO 80202 ; Utzinger, Jürg; University of Basel, P.O. Box, CH-4003 Basel ; Weiss, Mitchell G.; Münch, Anna K.; Singer, Burton H.; Krieger, Gary R.; Wielga, Mark; NewFields, LLC, Denver, CO 80202

    2013-09-15

    Human rights impact assessment (HRIA) is a process for systematically identifying, predicting and responding to the potential impact on human rights of a business operation, capital project, government policy or trade agreement. Traditionally, it has been conducted as a desktop exercise to predict the effects of trade agreements and government policies on individuals and communities. In line with a growing call for multinational corporations to ensure they do not violate human rights in their activities, HRIA is increasingly incorporated into the standard suite of corporate development project impact assessments. In this context, the policy world's non-structured, desk-based approaches to HRIA are insufficient. Although a number of corporations have commissioned and conducted HRIA, no broadly accepted and validated assessment tool is currently available. The lack of standardisation has complicated efforts to evaluate the effectiveness of HRIA as a risk mitigation tool, and has caused confusion in the corporate world regarding company duties. Hence, clarification is needed. The objectives of this paper are (i) to describe an HRIA methodology, (ii) to provide a rationale for its components and design, and (iii) to illustrate implementation of HRIA using the methodology in two selected corporate development projects—a uranium mine in Malawi and a tree farm in Tanzania. We found that as a prognostic tool, HRIA could examine potential positive and negative human rights impacts and provide effective recommendations for mitigation. However, longer-term monitoring revealed that recommendations were unevenly implemented, dependent on market conditions and personnel movements. This instability in the approach to human rights suggests a need for on-going monitoring and surveillance. -- Highlights: • We developed a novel methodology for corporate human rights impact assessment. • We piloted the methodology on two corporate projects—a mine and a plantation. • Human rights impact assessment exposed impacts not foreseen in ESIA. • Corporations adopted the majority of findings, but not necessarily immediately. • Methodological advancements are expected for monitoring processes.

  6. Prepublication data sharing Rapid release of prepublication data has served the field of genomics well. Attendees at

    E-Print Network [OSTI]

    Eddy, Sean

    accessible website at the time of a paper's publication1 . OneofthelessonsfromtheHumanGenome Project (HGP. The principles for rapid release of genome- sequence data from the HGP were formulated atameetingheldin

  7. Genomic structure, promoter sequence, and revised translation of human homeobox gene HLX1

    SciTech Connect (OSTI)

    Kennedy, M.A.; Rayner, J.C.; Morris, C.M.

    1994-07-15

    The human homeobox gene HLX1 appears to be involved in hemopoietic development and may represent a candidate gene for various developmental or hemopoietic disorders. The authors have isolated genomic clones for the gene, determined its intron-exon organization, and confirmed its map location on chromosome 1q41-q42. The transcription initiation sites of HLX1 were identified, and DNA sequences upstream of these sites were established. Finally, several differences between the genomic sequence and the published cDNA sequence were noted. Translation based on this revised sequence gives rise to a putative protein with 86.5% homology to the product of the murine Hlx gene. 44 refs., 5 figs.

  8. The Neandertals and Us: What does it take to make us humans?

    E-Print Network [OSTI]

    ,000 and 1 day The human Genome Project #12;Comparative Genomics 4-6 MYA 6-8 MYA 12-16 MYA 2-3 MYA #12 on the Neanderthal genome project. · Meyer M, ..., Slatkin M, Reich D, Kelso J, Pääbo S. A high-coverage genome Denisova. This is the first high-coverage archaic genome, and the first time a new extinct human species

  9. Large-scale discovery and validation of functional elements in the human genome

    E-Print Network [OSTI]

    Kellis, Manolis

    A report on the genomics workshop 'Identification of Functional Elements in Mammalian Genomes', Cold Spring Harbor, New York, 11-13 November 2004.

  10. Defining Genome Project Standards in a New Era of Sequencing (GSC8 Meeting)

    ScienceCinema (OSTI)

    Chain, Patrick [DOE JGI

    2011-04-28

    The Genomic Standards Consortium was formed in September 2005. It is an international, open-membership working body which promotes standardization in the description of genomes and the exchange and integration of genomic data. The 2009 meeting was an activity of a five-year funding "Research Coordination Network" from the National Science Foundation and was organized held at the DOE Joint Genome Institute with organizational support provided by the JGI and by the University of California - San Diego.

  11. Genome Improvement at JGI-HAGSC

    SciTech Connect (OSTI)

    Grimwood, Jane: Schmutz, Jeremy, J.: Myers, Richard, M.

    2012-03-03

    Since the completion of the sequencing of the human genome, the JGI has rapidly expanded its scientific goals in several DOE mission-relevant areas. At the JGI-HAGSC, we have kept pace with this rapid expansion of projects with our focus on assessing, assembling, improving and finishing eukaryotic whole genome shotgun (WGS) projects for which the shotgun sequence is generated at the Production Genomic Facility (JGI-PGF). We follow this by combining the draft WGS with genomic resources generated at JGI-HAGSC or in collaborator laboratories (including BAC end sequences, genetic maps and FLcDNA sequences) to produce an improved draft sequence. For eukaryotic genomes important to the DOE mission, we then add further information from directed experiments to produce reference genomic sequences that are publicly available for any scientific researcher. Also, we have continued our program for producing BAC-based finished sequence, both for adding information to JGI genome projects and for small BAC-based sequencing projects proposed through any of the JGI sequencing programs. We have now built our computational expertise in WGS assembly and analysis and have moved eukaryotic genome assembly from the JGI-PGF to JGI-HAGSC. We have concentrated our assembly development work on large plant genomes and complex fungal and algal genomes.

  12. Genome-Wide siRNA-Based Functional Genomics of Pigmentation Identifies Novel Genes and Pathways That Impact Melanogenesis in Human Cells

    E-Print Network [OSTI]

    2008-01-01

    siRNA-Based Functional Genomics of Pigmentation Identifiespoorly understood. Functional genomics based on RNA-mediatedof RNAi-based functional genomics to identify novel genes,

  13. An assessment of health educators' likelihood of adopting genomic competencies for the public health workforce 

    E-Print Network [OSTI]

    Chen, Lei-Shih

    2009-05-15

    , the National Institutes of Health (NIH) announced the completion of the Human Genome Project (HGP). The project represents a milestone in human history, as advanced genomic technologies/information can offer insight into specific diseases and may help.... Certainly, genomics is going to have a profound impact on the public health practice of the future?? 10 Yet in the wake of its completion, the HGP also raised new and non-trivial public health issues. These include, but are not restricted to...

  14. Genome-scale reconstruction and analysis of eukaryotic metabolic networks

    E-Print Network [OSTI]

    Hurlen, Natalie Christine

    2006-01-01

    the Human Genome Project (HGP) has been closely intertwinedled the effort to launch the HGP while he was a scientist atPresident Bill Clinton for his HGP efforts, and has made

  15. 10.1101/gr.074187.107Access the most recent version at doi: 2008 18: 1020-1029 originally published online April 14, 2008Genome Res.

    E-Print Network [OSTI]

    Nielsen, Rasmus

    . Applying this method to data from the Celera human genome sequencing and SNP discovery project, we obtain estimates of nucleotide diversity in windows spanning the human genome and show that the diversity online April 14, 2008Genome Res. Ines Hellmann, Yuan Mang, Zhiping Gu, et al. sequences from multiple

  16. The Unseen Genome: Gems among the Junk Just when scientists thought they had DNA almost figured out, they are discovering in

    E-Print Network [OSTI]

    Jacob, Eshel Ben

    celebrated the 50th anniversary of the discovery of the double helix, and the Human Genome Project announced to humans. The genome is home to many more actors than just the protein-coding genes. The extentThe Unseen Genome: Gems among the Junk Just when scientists thought they had DNA almost figured out

  17. DIVERSITY PROJECTS DEVELOPMENT FUND Sponsored by the Office of the Vice Chancellor for Human Resources Management

    E-Print Network [OSTI]

    Johnson Jr.,, Ray

    DIVERSITY PROJECTS DEVELOPMENT FUND Sponsored by the Office of the Vice Chancellor for Human The Diversity Projects Development Fund (DPDF) was established by the Office of the Vice Chancellor for Human provides administrative oversight to the Diversity Projects Development Fund. Vice Chancellor Gloriana

  18. Cortical Projection Topography of the Human Splenium: Hemispheric Asymmetry and Individual Differences

    E-Print Network [OSTI]

    Gazzaniga, Michael

    Cortical Projection Topography of the Human Splenium: Hemispheric Asymmetry and Individual topography of the human splenium. Homotopic and heterotopic connections were revealed between the splenium difficult to trace the cortical projection topographies of long white matter fiber tracts of the human brain

  19. Complete genome sequence of Gordonia bronchialis type strain (3410T)

    SciTech Connect (OSTI)

    Ivanova, N; Sikorski, Johannes; Jando, Marlen; Lapidus, Alla L.; Nolan, Matt; Glavina Del Rio, Tijana; Tice, Hope; Copeland, A; Cheng, Jan-Fang; Chen, Feng; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Mavromatis, K; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Chain, Patrick S. G.; Saunders, Elizabeth H; Han, Cliff; Detter, J C; Brettin, Thomas S; Rohde, Manfred; Goker, Markus; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C

    2010-01-01

    Gordonia bronchialis Tsukamura 1971 is the type species of the genus. G. bronchialis is a human-pathogenic organism that has been isolated from a large variety of human tissues. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of the family Gordoniaceae. The 5,290,012 bp long genome with its 4,944 protein-coding and 55 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  20. Identification of Human Gene Core Promoters Michael Q. Zhang1

    E-Print Network [OSTI]

    supplement at http://www.genome.org.] As the Human Genome Project enters its large-scale sequencing phaseIdentification of Human Gene Core Promoters in Silico Michael Q. Zhang1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 USA Identification of the 5 -end of human genes requires

  1. DNA is an identifier. We are not defined by our genome, but our DNA is ours and we can be identified through it.

    E-Print Network [OSTI]

    Church, George M.

    concern throughout the history of human sequencing. The Human Genome Project (HGP) has placed inception as part of the HGP in 1989. In 1983, the US President's Commission for the Study of Ethical

  2. Approaches to advancing quantitative human health risk assessment of environmental chemicals in the post-genomic era

    SciTech Connect (OSTI)

    Chiu, Weihsueh A.; Euling, Susan Y.; Scott, Cheryl Siegel; Subramaniam, Ravi P.

    2013-09-15

    The contribution of genomics and associated technologies to human health risk assessment for environmental chemicals has focused largely on elucidating mechanisms of toxicity, as discussed in other articles in this issue. However, there is interest in moving beyond hazard characterization to making more direct impacts on quantitative risk assessment (QRA) — i.e., the determination of toxicity values for setting exposure standards and cleanup values. We propose that the evolution of QRA of environmental chemicals in the post-genomic era will involve three, somewhat overlapping phases in which different types of approaches begin to mature. The initial focus (in Phase I) has been and continues to be on “augmentation” of weight of evidence — using genomic and related technologies qualitatively to increase the confidence in and scientific basis of the results of QRA. Efforts aimed towards “integration” of these data with traditional animal-based approaches, in particular quantitative predictors, or surrogates, for the in vivo toxicity data to which they have been anchored are just beginning to be explored now (in Phase II). In parallel, there is a recognized need for “expansion” of the use of established biomarkers of susceptibility or risk of human diseases and disorders for QRA, particularly for addressing the issues of cumulative assessment and population risk. Ultimately (in Phase III), substantial further advances could be realized by the development of novel molecular and pathway-based biomarkers and statistical and in silico models that build on anticipated progress in understanding the pathways of human diseases and disorders. Such efforts would facilitate a gradual “reorientation” of QRA towards approaches that more directly link environmental exposures to human outcomes.

  3. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes

    E-Print Network [OSTI]

    Kellis, Manolis

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating ...

  4. Draft Genome Sequences of Six Enterohepatic Helicobacter Species Isolated from Humans and One from Rhesus Macaques

    E-Print Network [OSTI]

    Shen, Zeli

    Draft genome sequences of seven enterohepatic Helicobacter species, H. bilis, H. canadensis, H. canis, H. cinaedi, H. winghamensis, H. pullorum, and H. macacae, are presented. These isolates were obtained from clinical ...

  5. Phenotypic and Genomic Analysis of Hypervirulent Human-associated Bordetella bronchiseptica

    E-Print Network [OSTI]

    2012-01-01

    complex IV B. bronchisep- tica strains share common genomic7], and B. bronchisep- tica isolates are known to havefeature of the B. bronchisep- tica T3SS. A549 cells, derived

  6. GC Composition of the Human Genome: In Search of Isochores Netta Cohen,*1

    E-Print Network [OSTI]

    Graur, Dan

    , and Dan Graurà *School of Computing, University of Leeds, Leeds, United Kingdom; Department of Zoology the label ``isochore.'' These putative isochores are nonuniformly scattered throughout the genome and cover

  7. Trans-Study Projection of Genomic Biomarkers in Analysis of Oncogene Deregulation and Breast Cancer

    E-Print Network [OSTI]

    West, Mike

    , to animal model experiments, to human outcome studies and clinical trials. The question of how to translate experiments, and the in vivo context is gene expression studies with data generated from human breast tumours Abstract In cancer studies as in many areas of human disease research, gene expression microarray technol

  8. Supplementary information for "Genetic structure of human populations" Sample, markers, and genotypes: The data set that we analyzed differs from the HGDP-CEPH Human

    E-Print Network [OSTI]

    Rosenberg, Noah

    individuals #1287-1296 sampled from northern China by the Chinese Human Genome Diversity Project. "Han, and genotypes: The data set that we analyzed differs from the HGDP-CEPH Human Genome Diversity Cell Line PanelSupplementary information for "Genetic structure of human populations" Methods Sample, markers

  9. Assessing corporate project impacts in changeable contexts: A human rights perspective

    SciTech Connect (OSTI)

    Salcito, Kendyl; Singer, Burton H.; Krieger, Gary R.; Weiss, Mitchell G.; Wielga, Mark; Utzinger, Jürg

    2014-07-01

    Project-level impact assessment was originally conceived as a snapshot taken in advance of project implementation, contrasting current conditions with a likely future scenario involving a variety of predicted impacts. Current best practice guidance has encouraged a shift towards longitudinal assessments from the pre-project stage through the implementation and operating phases. Experience and study show, however, that assessment of infrastructure-intensive projects rarely endures past the project's construction phase. Negative consequences for environmental, social and health outcomes have been documented. Such consequences clarify the pressing need for longitudinal assessment in each of these domains, with human rights impact assessment (HRIA) as an umbrella over, and critical augmentation of, environmental, social and health assessments. Project impacts on human rights are more closely linked to political, economic and other factors beyond immediate effects of a company's policy and action throughout the project lifecycle. Delineating these processes requires an adequate framework, with strategies for collecting longitudinal data, protocols that provide core information for impact assessment and guidance for adaptive mitigation strategies as project-related effects change over time. This article presents general principles for the design and implementation of sustained, longitudinal HRIA, based on experience assessing and responding to human rights impact in a uranium mining project in Malawi. The case study demonstrates the value of longitudinal assessment both for limiting corporate risk and improving human welfare. - Graphical abstract: Assessing changes in human rights condition as affected by both project and context, over time. - Highlights: • Corporate capital projects affect human rights in myriad ways. • Ongoing, longitudinal impact assessment techniques are needed. • We present an approach for conducting longitudinal human rights impact assessment. • Our methodology allows distinguishing corporate impacts from contextual changes. • Promptly observing context changes and impacts enables companies to react nimbly.

  10. Phylogenetic Inference Using Whole Genomes

    E-Print Network [OSTI]

    Phylogenetic Inference Using Whole Genomes Bruce Rannala1 and Ziheng Yang2 1 Genome Center.yang@ucl.ac.uk Annu. Rev. Genomics Hum. Genet. 2008. 9:217­31 First published online as a Review in Advance on June 3, 2008 The Annual Review of Genomics and Human Genetics is online at genom.annualreviews.org This article

  11. C. PROJECT DESCRIPTION 1. List of Participants

    E-Print Network [OSTI]

    Pasternack, Gregory B.

    , 1989), yet there are excellent examples in such efforts as the Manhattan Project, NASA's Apollo MoonC. PROJECT DESCRIPTION 1. List of Participants Name Role* Institution/Org.** Expertise Previous Program, and the Human Genome Project (Fogg and LaBolle, 2006). The driving force behind each

  12. Human Genome data analyzed by an evolutionary method suggests a decrease in cerebral protein-synthesis rate as cause of schizophrenia and an increase as antipsychotic mechanism

    E-Print Network [OSTI]

    Hans W. M. Moises

    2015-03-24

    The Human Genome Project (HGP) provides researchers with the data of nearly all human genes and the challenge to use this information for elucidating the etiology of common disorders. A secondary Darwinian method was applied to HGP and other research data to approximate and possibly unravel the etiology of schizophrenia. The results indicate that genetic and epigenetic variants of genes involved in signal transduction, transcription and translation - converging at the protein-synthesis rate (PSR) as common final pathway - might be responsible for the genetic susceptibility to schizophrenia. Environmental (e.g. viruses)and/or genetic factors can lead to cerebral PSR (CPSR) deficiency. The CPSR hypothesis of schizophrenia and antipsychotic mechanism explains 96% of the major facts of schizophrenia, reveals links between previously unrelated facts, integrates many hypotheses, and implies that schizophrenia should be easily preventable and treatable, partly by immunization against neurotrophic viruses and partly by the development of new drugs which selectively increase CPSR. Part of the manuscript has been published in a modified form as "The glial growth factors deficiency and synaptic destabilization hypothesis of schizophrenia" in BMC Psychiatry available online at http://www.biomedcentral.com/1471-244X/2/8/

  13. Human Evolutionary Genetics Robert Trivers The recent explosion of work on human genomics has produced an astonishing

    E-Print Network [OSTI]

    Chen, Kuang-Yu

    .H. et al. 2007. Diet and the evolution of human amylase gene copy number variation. Nature Genetics 39

  14. Genomics of emerging infectious disease: A PLoS collection.

    E-Print Network [OSTI]

    Eisen, Jonathan A; MacCallum, Catriona J

    2009-01-01

    Origins and evolutionary genomics of the 2009 swine-originan Infectious Diseases Genomics Project predict and preventRavel J (2009) The role of genomics in the identification,

  15. Genomic signatures of human and animal disease in the zoonotic pathogen Streptococcus suis

    E-Print Network [OSTI]

    Weinert, Lucy A.; Chaudhuri, Roy R.; Wang, Jinhong; Peters, Sarah E.; Corander, Jukka; Jombart, Thibaut; Baig, Abiyad; Howell, Kate J.; Vehkala, Minna; Välimäki, Niko; Harris, David; Chieu, Tran Thi Bich; Chau, Nguyen Van Vinh; Campbell, James; Schultsz, Constance; Parkhill, Julian; Bentley, Stephen D.; Langford, Paul R.; Rycroft, Andrew N.; Wren, Brendan W.; Farrar, Jeremy; Baker, Stephen; Hoa, Ngo Thi; Holden, Matthew T. G.; Tucker, Alexander W.; Maskell, Duncan J.; BRaDP1T Consortium

    2015-03-31

    Carbohydrate transport and metabolism Amino-acid transport and metabolism Translation, ribosomal structure and biogenesis Defense mechanisms Inorganic ion transport and metabolism Energy production and conversion Post-translational modification, protein... populations. Finally, this study highlights the value of undertaking microbial genome analysis studies across broader populations that encompass different hosts, geography and, importantly, defined clinical phenotypes. Methods Sampling of isolates...

  16. Comparative Analysis of Korean Human Gut Microbiota by Barcoded Pyrosequencing

    E-Print Network [OSTI]

    Bae, Jin-Woo

    @khu.ac.kr Introduction After the completion of the Human Genome Project (HGP), many scientists were disappointed of human health and disease. Therefore, after the HGP, Human Microbiome Project (HMP) was initiated to fill a gap between our current understanding derived from HGP and actual physiological phenomenon

  17. Boston University Office of the Executive Vice President Human Resources Organizational Readiness Project

    E-Print Network [OSTI]

    Finzi, Adrien

    in a coordinated format required by the SAP enterprise resource planning (ERP) system. The collection of this data Project represents an important first step in the successful launch of SAP and modernizing our human Project To: Vice Presidents, Deans, Directors and Department Heads From: Joseph P. Mercurio, Executive

  18. NIST Update: Projects that the Human Identity Team are

    E-Print Network [OSTI]

    HID Project Team National Institute of Standards and Technology Seventh Annual Advanced DNA Technical and NIST Office of Law Enforcement Standards Points of view are those of the authors and do not necessarily of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified

  19. Project IV Summary: The human capital intervention evaluations undertaken in Projects I through III

    E-Print Network [OSTI]

    Chen, Zhongping

    , health-risk behavior. The current project would address the ultimate "so childhood are predictive of adult labor market outcomes and of avoiding serious adult crime as well as the role of health risk teen behaviors on adult

  20. Chromosome region-specific libraries for human genome analysis. Final progress report, 1 March 1991--28 February 1994

    SciTech Connect (OSTI)

    Kao, F.T.

    1994-04-01

    The objectives of this grant proposal include (1) development of a chromosome microdissection and PCR-mediated microcloning technology, (2) application of this microtechnology to the construction of region-specific libraries for human genome analysis. During this grant period, the authors have successfully developed this microtechnology and have applied it to the construction of microdissection libraries for the following chromosome regions: a whole chromosome 21 (21E), 2 region-specific libraries for the long arm of chromosome 2, 2q35-q37 (2Q1) and 2q33-q35 (2Q2), and 4 region-specific libraries for the entire short arm of chromosome 2, 2p23-p25 (2P1), 2p21-p23 (2P2), 2p14-p16 (wP3) and 2p11-p13 (2P4). In addition, 20--40 unique sequence microclones have been isolated and characterized for genomic studies. These region-specific libraries and the single-copy microclones from the library have been used as valuable resources for (1) isolating microsatellite probes in linkage analysis to further refine the disease locus; (2) isolating corresponding clones with large inserts, e.g. YAC, BAC, P1, cosmid and phage, to facilitate construction of contigs for high resolution physical mapping; and (3) isolating region-specific cDNA clones for use as candidate genes. These libraries are being deposited in the American Type Culture Collection (ATCC) for general distribution.

  1. Institute for Plant Genomics and Biotechnology GENOMICS AND BIOTECHNOLOGY

    E-Print Network [OSTI]

    Institute for Plant Genomics and Biotechnology GENOMICS AND BIOTECHNOLOGY A multidisciplinary organization, the Institute for Plant Genomics and Biotechnology is a composed of faculty members representing projects at the Institute for Plant Genomics and Biotechnology include the development of transgenic plants

  2. Two ancient human genomes reveal Polynesian ancestry among the indigenous Botocudos of Brazil

    E-Print Network [OSTI]

    Malaspinas, A.-S.; Lao, O.; Schroeder, H.; Rasmussen, M.; Raghavan, M.; Moltke, I.; Campos, P. F.; Santana Sagredo, F.; Rasmussen, S.; Gonçalves, V. F.; Albrechtsen, A.; Allentoft, M. E.; Johnson, P. L. F.; Li, M.; Reis, S.; Bernardo, D. V.; DeGiorgio, M.; Duggan, A. T.; Bastos, M.; Wang, Y.; Stenderup, J.; Moreno-Mayar, J. V.; Brunak, S.; Sicheritz-Ponten, T.; Hodges, E.; Hannon, G. J.; Orlando, L.; Price, T. D.; Jensen, J. D.; Nielsen, R.; Heinemeier, J.; Olsen, J.; Rodrigues-Carvalho, C.; Lahr, M. Mirazón; Neves, W.; Kayser, M.; Higham, T.; Stoneking, M.; Pena, S. D. J.; Willerslev, E.

    2014-11-03

    . Wang15,16, J. Stenderup1, J.V. Moreno-Mayar1, S. Brunak7, T. Sicheritz-Ponten7, E. Hodges17, G. J. Hannon17, L. Orlando1, T. D. Price18, J. D. Jensen19, R. Nielsen1,15, J. Heinemeier20, J. Olsen20, C. Rodrigues-Carvalho12, M. Mirazón Lahr21, W. Neves... -Xavier Ricaut, Tiago Antao, Melanie Capredon, Clement Sambo, Chantal Radimilahy, Jean-Aime Rakotoarisoa, Roger M. Blench, et al. Genome-wide evidence of Austronesian-Bantu admixture and cultural reversion in a hunter-gatherer group of Madagascar Proc. Natl...

  3. Complete genome sequencing of a multidrug-resistant and human-invasive Salmonella enterica serovar Typhimurium strain of the emerging sequence type 213 genotype

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Calva, Edmundo; Silva, Claudia; Zaidi, Mussaret B.; Sanchez-Flores, Alejandro; Estrada, Karel; Silva, Genivaldo G. Z.; Soto-Jiménez, Luz M.; Wiesner, Magdalena; Fernández-Mora, Marcos; Edwards, Robert A.; et al

    2015-06-18

    Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 was isolated in 2005 in the state of Yucatán, Mexico, from a human systemic infection. The YU39 strain is representative of the multidrug-resistant emergent sequence type 213 (ST213) genotype. The YU39 complete genome is composed of a chromosome and seven plasmids.

  4. 10. international mouse genome conference

    SciTech Connect (OSTI)

    Meisler, M.H.

    1996-12-31

    Ten years after hosting the First International Mammalian Genome Conference in Paris in 1986, Dr. Jean-Louis Guenet presided over the Tenth Conference at the Pasteur Institute, October 7--10, 1996. The 1986 conference was a satellite to the Human Gene Mapping Workshop and had approximately 50 attendees. The 1996 meeting was attended by 300 scientists from around the world. In the interim, the number of mapped loci in the mouse increased from 1,000 to over 20,000. This report contains a listing of the program and its participants, and two articles that review the meeting and the role of the laboratory mouse in the Human Genome project. More than 200 papers were presented at the conference covering the following topics: International mouse chromosome committee meetings; Mutant generation and identification; Physical and genetic maps; New technology and resources; Chromatin structure and gene regulation; Rate and hamster genetic maps; Informatics and databases; and Quantitative trait analysis.

  5. Immortalization of normal human mammary epithelial cells in two steps by direct targeting of senescence barriers does not require gross genomic alterations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Garbe, James C.; Vrba, Lukas; Sputova, Klara; Fuchs, Laura; Novak, Petr; Brothman, Arthur R.; Jackson, Mark; Chin, Koei; LaBarge, Mark A.; Watts, George; et al

    2014-10-29

    Telomerase reactivation and immortalization are critical for human carcinoma progression. However, little is known about the mechanisms controlling this crucial step, due in part to the paucity of experimentally tractable model systems that can examine human epithelial cell immortalization as it might occur in vivo. We achieved efficient non-clonal immortalization of normal human mammary epithelial cells (HMEC) by directly targeting the 2 main senescence barriers encountered by cultured HMEC. The stress-associated stasis barrier was bypassed using shRNA to p16INK4; replicative senescence due to critically shortened telomeres was bypassed in post-stasis HMEC by c-MYC transduction. Thus, 2 pathologically relevant oncogenic agentsmore »are sufficient to immortally transform normal HMEC. The resultant non-clonal immortalized lines exhibited normal karyotypes. Most human carcinomas contain genomically unstable cells, with widespread instability first observed in vivo in pre-malignant stages; in vitro, instability is seen as finite cells with critically shortened telomeres approach replicative senescence. Our results support our hypotheses that: (1) telomere-dysfunction induced genomic instability in pre-malignant finite cells may generate the errors required for telomerase reactivation and immortalization, as well as many additional “passenger” errors carried forward into resulting carcinomas; (2) genomic instability during cancer progression is needed to generate errors that overcome tumor suppressive barriers, but not required per se; bypassing the senescence barriers by direct targeting eliminated a need for genomic errors to generate immortalization. Achieving efficient HMEC immortalization, in the absence of “passenger” genomic errors, should facilitate examination of telomerase regulation during human carcinoma progression, and exploration of agents that could prevent immortalization.« less

  6. Immortalization of normal human mammary epithelial cells in two steps by direct targeting of senescence barriers does not require gross genomic alterations

    SciTech Connect (OSTI)

    Garbe, James C.; Vrba, Lukas; Sputova, Klara; Fuchs, Laura; Novak, Petr; Brothman, Arthur R.; Jackson, Mark; Chin, Koei; LaBarge, Mark A.; Watts, George; Futscher, Bernard W.; Stampfer, Martha R.

    2014-10-29

    Telomerase reactivation and immortalization are critical for human carcinoma progression. However, little is known about the mechanisms controlling this crucial step, due in part to the paucity of experimentally tractable model systems that can examine human epithelial cell immortalization as it might occur in vivo. We achieved efficient non-clonal immortalization of normal human mammary epithelial cells (HMEC) by directly targeting the 2 main senescence barriers encountered by cultured HMEC. The stress-associated stasis barrier was bypassed using shRNA to p16INK4; replicative senescence due to critically shortened telomeres was bypassed in post-stasis HMEC by c-MYC transduction. Thus, 2 pathologically relevant oncogenic agents are sufficient to immortally transform normal HMEC. The resultant non-clonal immortalized lines exhibited normal karyotypes. Most human carcinomas contain genomically unstable cells, with widespread instability first observed in vivo in pre-malignant stages; in vitro, instability is seen as finite cells with critically shortened telomeres approach replicative senescence. Our results support our hypotheses that: (1) telomere-dysfunction induced genomic instability in pre-malignant finite cells may generate the errors required for telomerase reactivation and immortalization, as well as many additional “passenger” errors carried forward into resulting carcinomas; (2) genomic instability during cancer progression is needed to generate errors that overcome tumor suppressive barriers, but not required per se; bypassing the senescence barriers by direct targeting eliminated a need for genomic errors to generate immortalization. Achieving efficient HMEC immortalization, in the absence of “passenger” genomic errors, should facilitate examination of telomerase regulation during human carcinoma progression, and exploration of agents that could prevent immortalization.

  7. Genome patent fight erupts

    SciTech Connect (OSTI)

    Roberts, L.

    1991-10-11

    At a Congressional briefing while describing a new project to sequence partially every gene active in the human brain, it was made known that the National Institutes of Health was planning to file patent applications on 1,000 of these sequences a month. The scheme has engendered a firestorm of criticism from genome scientists and project officials alike. The critics argue that these sequences probably can't be patented in the first place - and even if they can, they shouldn't be. The plan would undercut patent protection for those who labor long and hard at the real task of elucidating the function of the proteins encoded by the genes, thereby driving industry away from developing inventions based on that work.

  8. Genome informatics: Requirements and challenges

    SciTech Connect (OSTI)

    Robbins, R.J.

    1993-12-31

    Informatics of some kind will play a role in every aspect of the Human Genome Project (HGP); data acquisition, data analysis, data exchange, data publication, and data visualization. What are the real requirements and challenges? The primary requirement is clear thinking and the main challenge is design. If good design is lacking, the price will be failure of genome informatics and ultimately failure of the genome project itself. Scientists need good designs to deliver the tools necessary for acquiring and analyzing DNA sequences. As these tools become more efficient, they will need new tools for comparative genomic analyses. To make the tools work, the scientists will need to address and solve nomenclature issues that are essential, if also tedious. They must devise systems that will scale gracefully with the increasing flow of data. The scientists must be able to move data easily from one system to another, with no loss of content. As scientists, they will have failed in their responsibility to share results, should repeating experiments ever become preferable to searching the literature. Their databases must become a new kind of scientific literature and the scientists must develop ways to make electronic data publishing as routine as traditional journal publishing. Ultimately, they must build systems so advanced that they are virtually invisible. In summary, the HGP can be considered the most ambitious, most audacious information-management project ever undertaken. In the HGP, computers will not merely serve as tools for cataloging existing knowledge. Rather, they will serve as instruments, helping to create new knowledge by changing the way the scientists see the biological world. Computers will allow them to see genomes, just as radio telescopes let them see quasars and electron microscopes let them see viruses.

  9. Mammalian comparative genomics and epigenomics

    E-Print Network [OSTI]

    Mikkelsen, Tarjei Sigurd, 1978-

    2009-01-01

    The human genome sequence can be thought of as an instruction manual for our species, written and rewritten over more than a billion of years of evolution. Taking a complete inventory of our genome, dissecting its genes ...

  10. Complete genome sequence of Cellulomonas flavigena type strain (134T)

    SciTech Connect (OSTI)

    Abt, Birte; Foster, Brian; Lapidus, Alla L.; Clum, Alicia; Sun, Hui; Pukall, Rudiger; Lucas, Susan; Glavina Del Rio, Tijana; Nolan, Matt; Tice, Hope; Cheng, Jan-Fang; Pitluck, Sam; Liolios, Konstantinos; Ivanova, N; Mavromatis, K; Ovchinnikova, Galina; Pati, Amrita; Goodwin, Lynne A.; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Rohde, Manfred; Goker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2010-01-01

    Cellulomonas flavigena (Kellerman and McBeth 1912) Bergey et al. 1923 is the type species of the genus Cellulomonas of the actinobacterial family Cellulomonadaceae. Members of the genus Cellulomonas are of special interest for their ability to degrade cellulose and hemicellulose, particularly with regard to the use of biomass as an alternative energy source. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the genus Cellulomonas, and next to the human pathogen Tropheryma whipplei the second complete genome sequence within the actinobacterial family Cellulomonadaceae. The 4,123,179 bp long single replicon genome with its 3,735 protein-coding and 53 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  11. Scientists call for antibody 'bar code' system to follow Human Genome

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-ThroughputUpcoming ReleaseSecurityPediatricNOAA(SC)Science (SC)ofProject

  12. Gray, W. D. (2003). Cognitive factors in homeland defense: The role of human factors in the novel intelligence from massive data (NIMD) project, Human Factors and Ergonomics Society (pp. 1017-1018). Santa Monica, CA: Human

    E-Print Network [OSTI]

    Gray, Wayne

    2003-01-01

    intelligence from massive data (NIMD) project, Human Factors and Ergonomics Society (pp. 1017-1018). Santa Monica, CA: Human Factors and Ergonomics Society. COGNITIVE FACTORS IN HOMELAND DEFENSE: THE ROLE

  13. Long term culture of genome-stable bipotent progenitor cells from adult human liver

    E-Print Network [OSTI]

    Huch, Meritxell; Gehart, Helmuth; van Boxtel, Ruben; Hamer, Karien; Blokzijl, Francis; Verstegen, Monique M. A.; Ellis, Ewa; van Wenum, Martien; Fuchs, Sabine A.; de Ligt, Joep; van de Wetering, Marc; Sasaki, Nobuo; Boers, Susanne J.; Kemperman, Hans; de Jonge, Jeroen; Ijzermans, Jan N. M.; Niewenhuis, Edward; Hoekstra, Ruurdtje; Strom, Stephen; Vries, Robert R. G.; van der Laan, Luc J. W.; Cuppen, Edwin; Clevers, Hans

    2014-12-18

    , S.K., Larson, J.J., Yawn, B., Therneau, T.M., and Kim, W.R. (2013). Underestimation of liver-related mortality in the United States. Gastroenterology 145, 375- 382 e371-372. Baker, D.E., Harrison, N.J., Maltby, E., Smith, K., Moore, H.D., Shaw, P... .J., Heath, P.R., Holden, H., and Andrews, P.W. (2007). Adaptation to culture of human embryonic stem cells and oncogenesis in vivo. Nat Biotechnol 25, 207-215. Barker, N., Huch, M., Kujala, P., van de Wetering, M., Snippert, H.J., van Es, J.H., Sato, T...

  14. Evolutionary Genomics of Life in (and from) the Sea

    SciTech Connect (OSTI)

    Boore, Jeffrey L.; Dehal, Paramvir; Fuerstenberg, Susan I.

    2006-01-09

    High throughput genome sequencing centers that were originally built for the Human Genome Project (Lander et al., 2001; Venter et al., 2001) have now become an engine for comparative genomics. The six largest centers alone are now producing over 150 billion nucleotides per year, more than 50 times the amount of DNA in the human genome, and nearly all of this is directed at projects that promise great insights into the pattern and processes of evolution. Unfortunately, this data is being produced at a pace far exceeding the capacity of the scientific community to provide insightful analysis, and few scientists with training and experience in evolutionary biology have played prominent roles to date. One of the consequences is that poor quality analyses are typical; for example, orthology among genes is generally determined by simple measures of sequence similarity, when this has been discredited by molecular evolutionary biologists decades ago. Here we discuss the how genomes are chosen for sequencing and how the scientific community can have input. We describe the PhIGs database and web tools (Dehal and Boore 2005a; http://PhIGs.org), which provide phylogenetic analysis of all gene families for all completely sequenced genomes and the associated 'Synteny Viewer', which allows comparisons of the relative positions of orthologous genes. This is the best tool available for inferring gene function across multiple genomes. We also describe how we have used the PhIGs methods with the whole genome sequences of a tunicate, fish, mouse, and human to conclusively demonstrate that two rounds of whole genome duplication occurred at the base of vertebrates (Dehal and Boore 2005b). This evidence is found in the large scale structure of the positions of paralogous genes that arose from duplications inferred by evolutionary analysis to have occurred at the base of vertebrates.

  15. Genome Science and Personalized Cancer Treatment

    ScienceCinema (OSTI)

    Gray, Joe

    2010-01-08

    August 4, 2009 Berkeley Lab lecture: Results from the Human Genome Project are enabling scientists to understand how individual cancers form and progress. This information, when combined with newly developed drugs, can optimize the treatment of individual cancers. Joe Gray, director of Berkeley Labs Life Sciences Division and Associate Laboratory Director for Life and Environmental Sciences, will focus on this approach, its promise, and its current roadblocks ? particularly with regard to breast cancer.

  16. Genome Science and Personalized Cancer Treatment

    SciTech Connect (OSTI)

    Gray, Joe

    2009-08-07

    August 4, 2009 Berkeley Lab lecture: Results from the Human Genome Project are enabling scientists to understand how individual cancers form and progress. This information, when combined with newly developed drugs, can optimize the treatment of individual cancers. Joe Gray, director of Berkeley Labs Life Sciences Division and Associate Laboratory Director for Life and Environmental Sciences, will focus on this approach, its promise, and its current roadblocks — particularly with regard to breast cancer.

  17. Genome Science and Personalized Cancer Treatment

    SciTech Connect (OSTI)

    Gray, Joe

    2009-08-04

    Summer Lecture Series 2009: Results from the Human Genome Project are enabling scientists to understand how individual cancers form and progress. This information, when combined with newly developed drugs, can optimize the treatment of individual cancers. Joe Gray, director of Berkeley Labs Life Sciences Division and Associate Laboratory Director for Life and Environmental Sciences, will focus on this approach, its promise, and its current roadblocks — particularly with regard to breast cancer.

  18. Evolutionary genomics of divergence and adaptation within the model fungi Neurospora crassa and Neurospora tetrasperma

    E-Print Network [OSTI]

    Ellison, Christopher

    2011-01-01

    Taylor JW. 2011. Population genomics and local adaptation inpromise of population genomics: from genotyping to genomeera. Annual Review of Genomics and Human Genetics 11:265-89.

  19. Clustering and Registration of Functional Data with Applications in Time Course Genomics Data

    E-Print Network [OSTI]

    Zhang, Yafeng

    2014-01-01

    of Clustering Methods for Time Course Genomics Data . .Methods for Time Course Genomics Data. To be submitted S.human subjects. BMC Genomics, 13, 2012. 636. Kongming Wang

  20. The Nuremberg Code subverts human health and safety by requiring animal modeling

    E-Print Network [OSTI]

    Greek, Ray; Pippus, Annalea; Hansen, Lawrence A

    2012-01-01

    the Human Genome Project ( HGP) [54,55] and other spin-offprojects. Prior to the HGP, scientists thought the number ofscientists involved in the HGP were looking for an estimated

  1. A User's Guide to the Encyclopedia of DNA Elements The ENCODE Project Consortium"

    E-Print Network [OSTI]

    A User's Guide to the Encyclopedia of DNA Elements (ENCODE) The ENCODE Project Consortium" * Abstract The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology

  2. Extreme Genomics By Scouring the Genomes of 50 HIV-Resistant People, Study

    E-Print Network [OSTI]

    Dolbow, John

    Extreme Genomics By Scouring the Genomes of 50 HIV-Resistant People, Study Takes Aim at Rare Gene Genome Variation, and his colleagues think that the complete genome sequences of those fortunate few against the viral strain that usually infects humans. That's because the CCR5 protein is Extreme Genomics

  3. Complete genome sequence of Anaerococcus prevotii type strain (PC1T)

    SciTech Connect (OSTI)

    LaButti, Kurt; Pukall, Rudiger; Steenblock, Katja; Glavina Del Rio, Tijana; Tice, Hope; Copeland, A; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Ivanova, N; Mavromatis, K; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Chain, Patrick S. G.; Saunders, Elizabeth H; Brettin, Tom; Detter, J. Chris; Han, Cliff; Barry, Kerrie; Goker, Markus; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla L.

    2009-01-01

    Anaerococcus prevotii (Foubert and Douglas 1948) Ezaki et al. 2001 is the type species of the genus, and is of phylogenetic interest because of its arguable assignment to the provisionally arranged family Peptostreptococcaceae . A. prevotii is an obligate anaerobic coccus, usually arranged in clumps or tetrads. The strain, whose genome is described here, was originally isolated from human plasma; other strains of the species were also isolated from clinical specimen. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of a member of the genus. Next to Finegoldia magna, A. prevotii is only the second species from the family Peptostreptococcaceae for which a complete genome sequence is described. The 1,998,633 bp long genome (chromosome and one plasmid) with its 1852 protein-coding and 61 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  4. Asymmetric projections of the arcuate fasciculus to the temporal cortex underlie lateralized language function in the human brain

    E-Print Network [OSTI]

    Takaya, Shigetoshi

    The arcuate fasciculus (AF) in the human brain has asymmetric structural properties. However, the topographic organization of the asymmetric AF projections to the cortex and its relevance to cortical function remain unclear. ...

  5. 'Sifting the significance from the data' - the impact of high-throughput genomic technologies on human genetics and health care

    E-Print Network [OSTI]

    Clarke, Angus J.; Cooper, David N.; Krawczak, Michael; Tyler-Smith, Chris; Wallace, Helen M.; Wilkie, Andrew O. M.; Raymond, Frances L.; Chadwick, Ruth; Craddock, Nick; John, Ros; Gallacher, John; Chiano, Mathias

    2012-08-02

    and ageing), and in response to environmental challenges (diet, stress). To this end, a number of ingenious genome-wide, high- throughput technologies have been developed. Some are based on the ability to selectively capture methylated fragments of the genome... consumes too much energy or mis- conceived arguments lead to the inappropriate applica- tion of theory in policy and practise across various walks of life, most especially psychiatry, education and the law. Second, and despite a full acceptance...

  6. Gene Action and Cellular Function in Parasitic Protozoa Genomics and post-genomics in parasitology: genome babble or

    E-Print Network [OSTI]

    Schnaufer, Achim

    Gene Action and Cellular Function in Parasitic Protozoa Genomics and post-genomics in parasitology: genome babble or a real opportunity? K. Gull1 School of Biological Sciences, University of Manchester, 2.205 Stopford Building, Oxford Road, Manchester M13 9PT, U.K. Abstract The genome projects represent one

  7. Dr. Mae Jemison is the principal for the 100 Year Starship Project, which envisions human travel beyond our solar system

    E-Print Network [OSTI]

    Collins, Gary S.

    , such as projects using satellite technology for healthcare delivery in West Africa and solar dish Stirling enginesDr. Mae Jemison is the principal for the 100 Year Starship Project, which envisions human travel beyond our solar system to another star within the next 100 years. Her leadership and vision provide

  8. Human Genome: DOE Origins

    Office of Scientific and Technical Information (OSTI)

    under the aegis of the ... DOE. ... In 1985, DeLisi took the reins of DOE's Office of Health and Environmental Research OHER, the program that supported most Biology in the...

  9. Yangzhong Tang Functional Genomics Platform@ Whitehead Institute

    E-Print Network [OSTI]

    Sabatini, David M.

    Yangzhong Tang Functional Genomics Platform@ Whitehead Institute June 1st, 2015 Entering the CRISPR-Cas9 Era #12;Outline · The Human Genome o Basics and timeline o Exponential increase in genomic data o How to use the big data for biological discoveries · Functional Genomics · CRISPR-Cas systems o

  10. The common ground of genomics and systems biology

    E-Print Network [OSTI]

    Conesa, Ana; Mortazavi, Ali

    2014-01-01

    8/S2. Authors’ details Genomics of Gene Expression Lab,systems biology. Annu Rev. Genomics Hum. Genet 2001, 2:343-projection strategies. Genomics 2008, 92(6):373-83. 31.

  11. Accelerating Read Mapping with FastHASH

    E-Print Network [OSTI]

    Xin, Hongyi; Lee, Donghyuk; Hormozdiari, Farhad; Yedkar, Samihan; Mutlu, Onur; Alkan, Can

    2013-01-01

    within the current human genome project assembly. Genome Res4. 2. 1000 Genomes Project Consortium: A map of human genomea human genome sequenced within the 1000 Genomes Project.

  12. THE CAMPAIGN FOR UC SANTA CRUZ THE GENOMICS

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    THE CAMPAIGN FOR UC SANTA CRUZ THE GENOMICS INSTITUTE #12;T he promise of genomics to revolutionize. We imagine a future in which genomic data is a tool for fighting diseases--from childhood cancer Genome Project to today's effort to create international protocols for sharing and interpreting genomic

  13. Genome mappers have a hot time at Cold Spring Harbor

    SciTech Connect (OSTI)

    Nowak, R.

    1995-05-26

    This is a report on the Genome Mapping and Sequencing meeting from 10-14 May 1995. Debate included how to start the final stage of the Human Genome Project (HGP) - large scale sequencing and the problem of funding. Major accomplishments of the HGP are summarized briefly including: maps of at least two chromosomes, 16 and 19, are in the final difficult stage and will be the first to be completely sequenced; evidence is being refined on the myotonic dystrophy gen; and an attempt to fashion a silicon chip to detect specific DNA sequences.

  14. Population genomics20-02-2009 Antnio Rodrigues; Bruno Santos / 59 Population Genomics

    E-Print Network [OSTI]

    Goldschmidt, Christina

    Population genomics20-02-2009 António Rodrigues; Bruno Santos / 59 Population Genomics 1 António Rodrigues (PDBC 2008) Bruno Santos (PDBC 2008) #12;Population genomics20-02-2009 António Rodrigues; Bruno Santos / 59 Contents 2 2 1000 genome project 1 Motivation and Introduction New generation sequencing

  15. Initial sequencing and comparative analysis of the mouse genome

    E-Print Network [OSTI]

    Eddy, Sean

    Initial sequencing and comparative analysis of the mouse genome Mouse Genome Sequencing Consortium ........................................................................................................................................................................................................................... The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome collaboration to produce a high-quality draft sequence of the mouse genome. We also present an initial

  16. Complete genome sequence of Leptotrichia buccalis type strain (C-1013-bT)

    SciTech Connect (OSTI)

    Ivanova, N; Gronow, Sabine; Lapidus, Alla L.; Copeland, A; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Saunders, Elizabeth H; Bruce, David; Goodwin, Lynne A.; Detter, J. Chris; Han, Cliff; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Mavromatis, K; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Chain, Patrick S. G.; Rohde, Christine; Goker, Markus; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2009-01-01

    Leptotrichia buccalis (Robin 1853) Trevisan 1879 is the type species of the genus, and is of phylogenetic interest because of its isolated location in the sparsely populated and neither taxonomically nor genomically adequately accessed family 'Leptotrichiaceae' within the phylum 'Fusobacteria'. Species of Leptotrichia are large, fusiform, non-motile, non-sporulating rods, which often populate the human oral flora. L. buccalis is anaerobic to aerotolerant, and saccharolytic. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the order 'Fusobacteriales' and no more than the second sequence from the phylum 'Fusobacteria'. The 2,465,610 bp long single replicon genome with its 2306 protein-coding and 61 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  17. Complete genome sequence of Leptotrichia buccalis type strain (C-1013-bT)

    SciTech Connect (OSTI)

    Ivanova, Natalia; Gronow, Sabine; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Saunders, Liz; Bruce, David; Goodwin, Lynne; Brettin, Thomas; Detter, John C.; Han, Cliff; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Rohde, Christine; Goker, Markus; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Leptotrichia buccalis (Robin 1853) Trevisan 1879 is the type species of the genus, and is of phylogenetic interest because of its isolated location in the sparsely populated and neither taxonomically nor genomically adequately accessed family 'Leptotrichiaceae' within the phylum 'Fusobacteria'. Species of Leptotrichia are large fusiform non-motile, non-sporulating rods, which often populate the human oral flora. L. buccalis is anaerobic to aerotolerant, and saccharolytic. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the order 'Fusobacteriales' and no more than the second sequence from the phylum 'Fusobacteria'. The 2,465,610 bp long single replicon genome with its 2306 protein-coding and 61 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. Genome Science and Personalized Cancer Treatment (LBNL Summer Lecture Series)

    ScienceCinema (OSTI)

    Gray, Joe

    2011-04-28

    Summer Lecture Series 2009: Results from the Human Genome Project are enabling scientists to understand how individual cancers form and progress. This information, when combined with newly developed drugs, can optimize the treatment of individual cancers. Joe Gray, director of Berkeley Labs Life Sciences Division and Associate Laboratory Director for Life and Environmental Sciences, will focus on this approach, its promise, and its current roadblocks ? particularly with regard to breast cancer.

  19. Genome Science and Personalized Cancer Treatment (LBNL Summer Lecture Series)

    SciTech Connect (OSTI)

    Gray, Joe

    2009-08-04

    Summer Lecture Series 2009: Results from the Human Genome Project are enabling scientists to understand how individual cancers form and progress. This information, when combined with newly developed drugs, can optimize the treatment of individual cancers. Joe Gray, director of Berkeley Labs Life Sciences Division and Associate Laboratory Director for Life and Environmental Sciences, will focus on this approach, its promise, and its current roadblocks — particularly with regard to breast cancer.

  20. Strategies and tools for whole genome alignments

    SciTech Connect (OSTI)

    Couronne, Olivier; Poliakov, Alexander; Bray, Nicolas; Ishkhanov,Tigran; Ryaboy, Dmitriy; Rubin, Edward; Pachter, Lior; Dubchak, Inna

    2002-11-25

    The availability of the assembled mouse genome makespossible, for the first time, an alignment and comparison of two largevertebrate genomes. We have investigated different strategies ofalignment for the subsequent analysis of conservation of genomes that areeffective for different quality assemblies. These strategies were appliedto the comparison of the working draft of the human genome with the MouseGenome Sequencing Consortium assembly, as well as other intermediatemouse assemblies. Our methods are fast and the resulting alignmentsexhibit a high degree of sensitivity, covering more than 90 percent ofknown coding exons in the human genome. We have obtained such coveragewhile preserving specificity. With a view towards the end user, we havedeveloped a suite of tools and websites for automatically aligning, andsubsequently browsing and working with whole genome comparisons. Wedescribe the use of these tools to identify conserved non-coding regionsbetween the human and mouse genomes, some of which have not beenidentified by other methods.

  1. Report on {open_quotes}inspection of human subject research in intelligence and intelligence-related projects{close_quotes}

    SciTech Connect (OSTI)

    1996-01-16

    Executive Order 12333, {open_quotes}United States Intelligence Activities,{close_quotes} (1) designates the Department`s intelligence element as a member of the Intelligence Community, and (2) states that no agency within the Intelligence community shall sponsor, contract for or conduct research on human subjects except in accordance with guidelines issued by the Department of Health and Human Services. The Federal policy for the Protection of Human Subjects, which was based on Department of Health and Human Services regulations, was promulgated in Title 10 Code of Federal Regulations Part 745 by the Department of Energy. The purpose of this inspection was to review the internal control procedures used by the Office of Nonproliferation and National Security to manage selected intelligence and intelligence-related projects that involve human subject research.

  2. GOLD: The Genomes Online Database

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Kyrpides, Nikos; Liolios, Dinos; Chen, Amy; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor; Bernal, Alex

    Since its inception in 1997, GOLD has continuously monitored genome sequencing projects worldwide and has provided the community with a unique centralized resource that integrates diverse information related to Archaea, Bacteria, Eukaryotic and more recently Metagenomic sequencing projects. As of September 2007, GOLD recorded 639 completed genome projects. These projects have their complete sequence deposited into the public archival sequence databases such as GenBank EMBL,and DDBJ. From the total of 639 complete and published genome projects as of 9/2007, 527 were bacterial, 47 were archaeal and 65 were eukaryotic. In addition to the complete projects, there were 2158 ongoing sequencing projects. 1328 of those were bacterial, 59 archaeal and 771 eukaryotic projects. Two types of metadata are provided by GOLD: (i) project metadata and (ii) organism/environment metadata. GOLD CARD pages for every project are available from the link of every GOLD_STAMP ID. The information in every one of these pages is organized into three tables: (a) Organism information, (b) Genome project information and (c) External links. [The Genomes On Line Database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata, Konstantinos Liolios, Konstantinos Mavromatis, Nektarios Tavernarakis and Nikos C. Kyrpides, Nucleic Acids Research Advance Access published online on November 2, 2007, Nucleic Acids Research, doi:10.1093/nar/gkm884]

    The basic tables in the GOLD database that can be browsed or searched include the following information:

    • Gold Stamp ID
    • Organism name
    • Domain
    • Links to information sources
    • Size and link to a map, when available
    • Chromosome number, Plas number, and GC content
    • A link for downloading the actual genome data
    • Institution that did the sequencing
    • Funding source
    • Database where information resides
    • Publication status and information

    (Specialized Interface)

  3. Data Management Plan (p. 1 of 2) The proposed project will include human subjects data consisting of background demographic

    E-Print Network [OSTI]

    Tipple, Brett

    Data Management Plan (p. 1 of 2) The proposed project will include human subjects data consisting of background demographic information and a variety of data related to gait and balance, and it will be conducted at the University of Utah. The University of Utah will be the primary caretaker of the data

  4. DOE Humanities Projects Announced | U.S. DOE Office of Science...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    National Endowment for the Humanities External link to facilitate access to high performance computing resources for research in the Humanities. At the Supercomputing 2008...

  5. The context and content of the human genome project and the American eugenics movement: An analytical, case study approach

    E-Print Network [OSTI]

    Mandel, Sarah M

    1993-01-01

    atomic weapons and mustard gas. When the United Statesbe felt for years to come. Mustard gas had also been seen to

  6. The Human Genome Project and other biological research efforts are creating an avalanche of new data about the chemical makeu

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnicalInformation FederatedInformationTITLE: AUTHOR(S)Patterns, andI. Overview

  7. Genome Biology 2005, 6:312 commentreviewsreportsdepositedresearchinteractionsinformationrefereedresearch

    E-Print Network [OSTI]

    Kellis, Manolis

    Genome Biology 2005, 6-mail: bbernst@fas.harvard.edu. Manolis Kellis. E-mail: manoli@mit.edu Published: 1 March 2005 Genome Biology- tium, which aims to identify a comprehensive `Encyclopedia of DNA elements' in the human genome [http

  8. Genome duplications (polyploidy) / ancientGenome duplications (polyploidy) / ancient genome duplications (genome duplications (paleopolyploidypaleopolyploidy))

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Genome duplications (polyploidy) / ancientGenome duplications (polyploidy) / ancient genome duplications (genome duplications (paleopolyploidypaleopolyploidy)) Mechanism? e.g. a diploid cell undergoes;Paramecium genome duplicationsParamecium genome duplications #12;Comparison of two scaffolds originating from

  9. Re-inventing Hoodia: Patent Law, Epistemic Citizenship, and the Making of Difference in South Africa

    E-Print Network [OSTI]

    Foster, Laura

    2012-01-01

    Opportunity for the Human Genome Project." Genomics 11: 490-Advances from the Human Genome Project have enabled theespecially the Human Genome Diversity Project, ushered in

  10. Personalized medicine: selected Web resources

    E-Print Network [OSTI]

    Stimson, Nancy F

    2009-01-01

    pharmacogenomics, genomics; Human Genome Project; Web site;the completion of the Human Genome Project in 2003, interest10001618] Human Genome Project, NHGRI [http://

  11. Molluscan Evolutionary Genomics

    E-Print Network [OSTI]

    Simison, W. Brian

    2010-01-01

    59179 Molluscan Evolutionary Genomics W. Brian Simison andBoore Molluscan Evolutionary Genomics W. Brian Simison andL. Boore Evolutionary Genomics Department, DOE Joint Genome

  12. Human genetics education for middle and secondary science teachers. Third annual report, April 1, 1994--March 30, 1995

    SciTech Connect (OSTI)

    Collins, D.L.; Segebrecht, L.; Schimke, R.N.

    1994-12-01

    This project is designed to increase teachers` knowledge of the Human Genome Project (HGP) with a focus on the ethical, legal and social implications of genetic technology. The project provides educators with the newest information on human genetics including applications of genetic technology, updated teaching resources and lesson plans, peer teaching ideas to disseminate genetic information to students and other educators, and established liaisons with genetic professionals.

  13. Human Subjects: The human subject approval for this project will not have occurred at the time of application

    E-Print Network [OSTI]

    Finley Jr., Russell L.

    of such research activities. The types of IRB reviews are based on the type of protocol that is submitted. The HIC Research Protection Program (HRPP)" for research involving human participants and is briefly summarized participant research. These include the regulations from DHHS [45 CFR 46] and its subparts, the FDA

  14. Complete genome sequence of Segniliparus rotundus type strain (CDC 1076T)

    SciTech Connect (OSTI)

    Sikorski, Johannes; Lapidus, Alla L.; Copeland, A; Misra, Monica; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Jando, Marlen; Schneider, Susan; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Ivanova, N; Mavromatis, K; Chen, Amy; Palaniappan, Krishna; Chertkov, Olga; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Detter, J. Chris; Han, Cliff; Rohde, Manfred; Goker, Markus; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2010-01-01

    Segniliparus rotundus Butler 2005 is the type species of the genus Segniliparus, which is cur-rently the only genus in the corynebacterial family Segniliparaceae. This family is of large in-terest because of a novel late-emerging genus-specific mycolate pattern. The type strain has been isolated from human sputum and is probably an opportunistic pathogen. Here we de-scribe the features of this organism, together with the complete genome sequence and anno-tation. This is the first completed genome sequence of the family Segniliparaceae. The 3,157,527 bp long genome with its 3,081 protein-coding and 52 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  15. Complete genome sequence of Nocardiopsis dassonvillei type strain (IMRU 509T)

    SciTech Connect (OSTI)

    Sun, Hui; Lapidus, Alla L.; Nolan, Matt; Lucas, Susan; Glavina Del Rio, Tijana; Tice, Hope; Cheng, Jan-Fang; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne A.; Pitluck, Sam; Pagani, Ioanna; Ivanova, N; Mavromatis, K; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Djao, Olivier Duplex; Rohde, Manfred; Sikorski, Johannes; Goker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2010-01-01

    Nocardiopsis dassonvillei (Brocq-Rousseau 1904) Meyer 1976 is the type species of the genus Nocardiopsis, which in turn is the type genus of the family Nocardiopsaceae. This species is of interest because of its ecological versatility. Members of N. dassonvillei have been isolated from a large variety of natural habitats such as soil and marine sediments, from different plant and animal materials as well as from human patients. Moreover, representatives of the genus Nocardiopsis participate actively in biopolymer degradation. This is the first complete genome sequence in the family Nocardiopsaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 6,543,312 bp long genome consist of a 5.77 Mbp chromosome and a 0.78 Mbp plasmid and with its 5,570 protein-coding and 77 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  16. Genome Engineering

    SciTech Connect (OSTI)

    Voytas, Dan [University of Minnesota

    2014-03-20

    Dan Voytas, University of Minnesota, at the 9th Annual Genomics of Energy & Environment Meeting on March 20, 2014 in Walnut Creek, Calif

  17. Evolution studied through protein structural domains

    E-Print Network [OSTI]

    Yang, Song

    2007-01-01

    genomics: beyond the human genome project. Nat Genet, 1999.33, 34], like the human genome project that sequenced the

  18. Effects of genome-wide copy number variation on expression in mammalian cells

    E-Print Network [OSTI]

    Wang, Richard T; Ahn, Sangtae; Park, Christopher C; Khan, Arshad H; Lange, Kenneth; Smith, Desmond J

    2011-01-01

    al: An STS-based radiation hybrid map of the human genome.Milan D, et al: Radiation hybrid map of the porcine genomeA: A comprehensive radiation hybrid map of the bovine genome

  19. 12 IEEE TRANSACTIONS ON NANOTECHNOLOGY, VOL. 1, NO. 1, MARCH 2002 Scanning the Controls: Genomics and

    E-Print Network [OSTI]

    12 IEEE TRANSACTIONS ON NANOTECHNOLOGY, VOL. 1, NO. 1, MARCH 2002 Scanning the Controls: Genomics and topological complexity is the complexity of the genome itself, consisting of about one billion basepairs. The Human Genome Proj

  20. Evolution and comparative genomics of subcellular specializations: EST sequencing of Torpedo electric organ

    E-Print Network [OSTI]

    Vertes, Akos

    Evolution and comparative genomics of subcellular specializations: EST sequencing of Torpedo discovery Open reading frame (ORF) Uncharacterized open reading frames (ORFs) in human genomic sequence Elsevier B.V. All rights reserved. 1. Introduction The availability of complete genomic sequences

  1. Estonian Genome Project Andres Metspalu

    E-Print Network [OSTI]

    Brutlag, Doug

    of DNA based diagnosis and personalized treatment methods to achieve better service at lower cost - 65 years l Life expectancy / females ­ 75 years l GDP per capita $5900 l GDP growth 6% (for2001) #12

  2. Federally-Funded Research and Development Centers and Universities: Roles and Influence on STI Policy Decision-Making in the United States

    E-Print Network [OSTI]

    SHANK, Charles V.

    2013-01-01

    initiatives—the Human Genome Project, x-ray synchrotronto fit the project initiative. The Human Genome ProjectThe Human Genome Project was the culmination of several

  3. SNP Calling Using Genotype Model Selection on High-Throughput Sequencing Data

    E-Print Network [OSTI]

    Murillo, Gabriel Hiroshi

    2012-01-01

    Institute. The human genome project comple- tion: Frequentlycommunity, the Human Genome Project (HGP) was finished inmain goals of the human genome project was to create a human

  4. The diploid genome sequence of an Asian Jun Wang1,2,3,4

    E-Print Network [OSTI]

    Nielsen, Rasmus

    ARTICLES The diploid genome sequence of an Asian individual Jun Wang1,2,3,4 *, Wei Wang1 present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped

  5. Considerations Related To Human Intrusion In The Context Of Disposal Of Radioactive Waste-The IAEA HIDRA Project

    SciTech Connect (OSTI)

    Seitz, Roger; Kumano, Yumiko; Bailey, Lucy; Markley, Chris; Andersson, Eva; Beuth, Thomas

    2014-01-09

    The principal approaches for management of radioactive waste are commonly termed ‘delay and decay’, ‘concentrate and contain’ and ‘dilute and disperse’. Containing the waste and isolating it from the human environment, by burying it, is considered to increase safety and is generally accepted as the preferred approach for managing radioactive waste. However, this approach results in concentrated sources of radioactive waste contained in one location, which can pose hazards should the facility be disrupted by human action in the future. The International Commission on Radiological Protection (ICRP), International Atomic Energy Agency (IAEA), and Organization for Economic Cooperation and Development/Nuclear Energy Agency (OECD/NEA) agree that some form of inadvertent human intrusion (HI) needs to be considered to address the potential consequences in the case of loss of institutional control and loss of memory of the disposal facility. Requirements are reflected in national regulations governing radioactive waste disposal. However, in practice, these requirements are often different from country to country, which is then reflected in the actual implementation of HI as part of a safety case. The IAEA project on HI in the context of Disposal of RadioActive waste (HIDRA) has been started to identify potential areas for improved consistency in consideration of HI. The expected outcome is to provide recommendations on how to address human actions in the safety case in the future, and how the safety case may be used to demonstrate robustness and optimize siting, design and waste acceptance criteria within the context of a safety case.

  6. DOE Joint Genome Institute 2008 Progress Report

    SciTech Connect (OSTI)

    Gilbert, David

    2009-03-12

    While initially a virtual institute, the driving force behind the creation of the DOE Joint Genome Institute in Walnut Creek, California in the Fall of 1999 was the Department of Energy's commitment to sequencing the human genome. With the publication in 2004 of a trio of manuscripts describing the finished 'DOE Human Chromosomes', the Institute successfully completed its human genome mission. In the time between the creation of the Department of Energy Joint Genome Institute (DOE JGI) and completion of the Human Genome Project, sequencing and its role in biology spread to fields extending far beyond what could be imagined when the Human Genome Project first began. Accordingly, the targets of the DOE JGI's sequencing activities changed, moving from a single human genome to the genomes of large numbers of microbes, plants, and other organisms, and the community of users of DOE JGI data similarly expanded and diversified. Transitioning into operating as a user facility, the DOE JGI modeled itself after other DOE user facilities, such as synchrotron light sources and supercomputer facilities, empowering the science of large numbers of investigators working in areas of relevance to energy and the environment. The JGI's approach to being a user facility is based on the concept that by focusing state-of-the-art sequencing and analysis capabilities on the best peer-reviewed ideas drawn from a broad community of scientists, the DOE JGI will effectively encourage creative approaches to DOE mission areas and produce important science. This clearly has occurred, only partially reflected in the fact that the DOE JGI has played a major role in more than 45 papers published in just the past three years alone in Nature and Science. The involvement of a large and engaged community of users working on important problems has helped maximize the impact of JGI science. A seismic technological change is presently underway at the JGI. The Sanger capillary-based sequencing process that dominated how sequencing was done in the last decade is being replaced by a variety of new processes and sequencing instruments. The JGI, with an increasing number of next-generation sequencers, whose throughput is 100- to 1,000-fold greater than the Sanger capillary-based sequencers, is increasingly focused in new directions on projects of scale and complexity not previously attempted. These new directions for the JGI come, in part, from the 2008 National Research Council report on the goals of the National Plant Genome Initiative as well as the 2007 National Research Council report on the New Science of Metagenomics. Both reports outline a crucial need for systematic large-scale surveys of the plant and microbial components of the biosphere as well as an increasing need for large-scale analysis capabilities to meet the challenge of converting sequence data into knowledge. The JGI is extensively discussed in both reports as vital to progress in these fields of major national interest. JGI's future plan for plants and microbes includes a systematic approach for investigation of these organisms at a scale requiring the special capabilities of the JGI to generate, manage, and analyze the datasets. JGI will generate and provide not only community access to these plant and microbial datasets, but also the tools for analyzing them. These activities will produce essential knowledge that will be needed if we are to be able to respond to the world's energy and environmental challenges. As the JGI Plant and Microbial programs advance, the JGI as a user facility is also evolving. The Institute has been highly successful in bending its technical and analytical skills to help users solve large complex problems of major importance, and that effort will continue unabated. The JGI will increasingly move from a central focus on 'one-off' user projects coming from small user communities to much larger scale projects driven by systematic and problem-focused approaches to selection of sequencing targets. Entire communities of scientists working in a particular field, such as feeds

  7. Functional genomics as a window on radiation stress signaling Sally A Amundson*,1

    E-Print Network [OSTI]

    Functional genomics as a window on radiation stress signaling Sally A Amundson*,1 , Michael Bittner 20892, USA; 2 National Human Genome Research Institute, National Institutes of Health, Bethesda, MD before the completion of the human genome draft sequence, a number of techniques for genomic expression

  8. A World Institute for a Sustainable Humanity The Energy Project Community Action Partnership Association of Idaho

    E-Print Network [OSTI]

    power system funds that pay for low-income energy efficiency as part of demand-side resource acquisition District XI Human Resource Council, Inc. NW Energy Coalition South Central of developing the energy efficiency provisions of the 7th Northwest Power and Conservation Plan, the Council

  9. JGI Fungal Genomics Program

    E-Print Network [OSTI]

    Grigoriev, Igor V.

    2011-01-01

    View Supports functional genomics, user data deposition andJGI Fungal Genomics Program Igor V. Grigoriev 1 DOE Jointof California. JGI Fungal Genomics Program Contact: Igor

  10. Fungal Genomics Program

    E-Print Network [OSTI]

    Grigoriev, Igor

    2012-01-01

    strains Comparative genomics and transcriptomics of xyloseFungal Genomics Program Igor Grigoriev 1 * (complex communities Fungal Genomics Program Igor Grigoriev

  11. Complete genome sequence of the bile-resistant pigment- producing anaerobe Alistipes finegoldii type strain (AHN2437T)

    SciTech Connect (OSTI)

    Mavromatis, K; Stackebrandt, Erko; Munk, Christine; Lapidus, Alla L.; Nolan, Matt; Lucas, Susan; Hammon, Nancy; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxanne; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Pagani, Ioanna; Ivanova, N; Mikhailova, Natalia; Huntemann, Marcel; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Rohde, Manfred; Gronow, Sabine; Goker, Markus; Detter, J. Chris; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Woyke, Tanja

    2013-01-01

    Alistipes finegoldii Rautio et al. 2003 is one of five species of Alistipes with a validly pub- lished name: family Rikenellaceae, order Bacteroidetes, class Bacteroidia, phylum Bacteroidetes. This rod-shaped and strictly anaerobic organism has been isolated mostly from human tissues. Here we describe the features of the type strain of this species, together with the complete genome sequence, and annotation. A. finegoldii is the first member of the genus Alistipes for which the complete genome sequence of its type strain is now available. The 3,734,239 bp long single replicon genome with its 3,302 protein-coding and 68 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  12. Non-contiguous finished genome sequence of the opportunistic oral pathogen Prevotella multisaccharivorax type strain (PPPA20T)

    SciTech Connect (OSTI)

    Pati, Amrita; Gronow, Sabine; Lu, Megan; Lapidus, Alla L.; Nolan, Matt; Lucas, Susan; Hammon, Nancy; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Pagani, Ioanna; Mavromatis, K; Mikhailova, Natalia; Huntemann, Marcel; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Detter, J. Chris; Brambilla, Evelyne-Marie; Rohde, Manfred; Goker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Ivanova, N

    2011-01-01

    Prevotella multisaccharivorax Sakamoto et al. 2005 is a species of the large genus Prevotella, which belongs to the family Prevotellaceae. The species is of medical interest because its members are able to cause diseases in the human oral cavity such as periodontitis, root caries and others. Although 77 Prevotella genomes have already been sequenced or are targeted for sequencing, this is only the second completed genome sequence of a type strain of a species within the genus Prevotella to be published. The 3,388,644 bp long genome is assembled in three non-contiguous contigs, harbors 2,876 protein-coding and 75 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  13. Selecting Genomes for Reconstruction of Ancestral Genomes

    E-Print Network [OSTI]

    Zhang, Louxin

    Selecting Genomes for Reconstruction of Ancestral Genomes Guoliang Li1 , Jian Ma2 , and Louxin. It is often impossible to sequence all descendent genomes to reconstruct an ancestral genome. In addition, more genomes do not neces- sarily give a higher accuracy for the reconstruction of ancestral character

  14. A High-Resolution Map of Human Evolutionary Constraint Using 29 Mammals

    E-Print Network [OSTI]

    Mag Washietl, Stefan

    The comparison of related genomes has emerged as a powerful lens for genome interpretation. Here we report the sequencing and comparative analysis of 29 eutherian genomes. We confirm that at least 5.5% of the human genome ...

  15. Comparative genomics in acid mine drainage biofilm communities reveals metabolic and structural differentiation of co-occurring archaea

    E-Print Network [OSTI]

    2013-01-01

    co-occurring archaea. BMC Genomics 2013 14:485. Submit yourgenomes. Yelton et al. BMC Genomics 2013, 14:485 http://work was supported by DOE Genomics: GTL project Grant No.

  16. Electrolyte Genome Could Be Battery Game-Changer

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Be Battery Game-Changer Electrolyte Genome Could Be Battery Game-Changer The Materials Project screens molecules to accelerate electrolyte discovery April 15, 2015 Julie Chao,...

  17. JGI Fungal Genomics Program Grigoriev, Igor V. 99; BIOFUELS;...

    Office of Scientific and Technical Information (OSTI)

    Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  18. Genomic Encyclopedia of Fungi Grigoriev, Igor 59 BASIC BIOLOGICAL...

    Office of Scientific and Technical Information (OSTI)

    Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  19. Genomic Encyclopedia of Fungi (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  20. JGI Fungal Genomics Program (Technical Report) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  1. Screening Assessment of Potential Human-Health Risk from Future Natural-Gas Drilling Near Project Rulison in Western Colorado

    SciTech Connect (OSTI)

    Daniels Jeffrey I.,Chapman Jenny B.

    2012-01-01

    The Project Rulison underground nuclear test was conducted in 1969 at a depth of 8,400 ft in the Williams Fork Formation of the Piceance Basin, west-central Colorado (Figure 1). The U.S. Department of Energy Office of Legacy Management (LM) is the steward of the site. Their management is guided by data collected from past site investigations and current monitoring, and by the results of calculations of expected behavior of contaminants remaining in the deep subsurface. The purpose of this screening risk assessment is to evaluate possible health risks from current and future exposure to Rulison contaminants so the information can be factored into LM's stewardship decisions. For example, these risk assessment results can inform decisions regarding institutional controls at the site and appropriate monitoring of nearby natural-gas extraction activities. Specifically, the screening risk analysis can provide guidance for setting appropriate action levels for contaminant monitoring to ensure protection of human health.

  2. Complete genome sequence of Tsukamurella paurometabola type strain (no. 33T)

    SciTech Connect (OSTI)

    Munk, Christine; Lapidus, Alla L.; Lucas, Susan; Nolan, Matt; Tice, Hope; Cheng, Jan-Fang; Glavina Del Rio, Tijana; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Huntemann, Marcel; Ivanova, N; Mavromatis, K; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Tapia, Roxanne; Han, Cliff; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Brettin, Thomas S; Yasawong, Montri; Brambilla, Evelyne-Marie; Rohde, Manfred; Sikorski, Johannes; Goker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2011-01-01

    Tsukamurella paurometabola corrig. (Steinhaus 1941) Collins et al. 1988 is the type species of the genus Tsukamurella, which is the type genus to the family Tsukamurellaceae. The spe- cies is not only of interest because of its isolated phylogenetic location, but also because it is a human opportunistic pathogen with some strains of the species reported to cause lung in- fection, lethal meningitis, and necrotizing tenosynovitis. This is the first completed genome sequence of a member of the genus Tsukamurella and the first genome sequence of a member of the family Tsukamurellaceae. The 4,479,724 bp long genome contains a 99,806 bp long plasmid and a total of 4,335 protein-coding and 56 RNA genes, and is a part of the Ge- nomic Encyclopedia of Bacteria and Archaea project.

  3. Pacifically Possessed : : Scientific Production and Native Hawaiian Critique of the "Almost White" Polynesian Race

    E-Print Network [OSTI]

    Arvin, Maile Renee

    of a National Human Genome Project. ” Anthropology Today 15,of a National Human Genome Project. ” Anthropology Today 15,Luca. “The Human Genome Diversity Project: Past, Present and

  4. Quality Control: The Implications of Negative Genetic Selection and Pre-Birth Genetic Enhancement

    E-Print Network [OSTI]

    McConnel, Brooke

    2006-01-01

    J. Mehlman, The Human Genome Project and the Courts: Genemedically possible, the Human Genome Project 5 (HGP) intendsInstitute of Health. Human Genome Project Information,

  5. Intellectual Property

    E-Print Network [OSTI]

    Gallagher, William T

    2008-01-01

    2005), ‘The Human Genome Diversity Project: The Politics of2005), ‘The Human Genome Diversity Project: The Politics ofthe controversial Human Genome Diversity Project, a research

  6. Bioethics and Medical Issues in Literature

    E-Print Network [OSTI]

    Stripling, Mahala Yates

    2013-01-01

    establishes the Human Genome Project; Margaret Edson writesthe publicly-financed Human Genome Project announces it hasIn the case of the Human Genome Project, which promises

  7. A novel method for estimating the functional connectome from neural activity /

    E-Print Network [OSTI]

    Henderson, Gavin D.

    2013-01-01

    1.4.2 The Human Genome Project . . . . . . .connectomes The Human Genome Project Recently, science hasever undertaken is the Human Genome Project. Orig- inally

  8. A Vital Legacy - Biological and Environmental Research in the Atomic Age

    E-Print Network [OSTI]

    Vaughan editor, Douglas

    2010-01-01

    Consequence: The Human Genome Project A Heritage of Geneticsprograms as the Human Genome Project and the U.S. Globalboundless promise. The Human Genome Project, for example, is

  9. The Path of the Blind Watchmaker: A Model of Evolution

    E-Print Network [OSTI]

    Poggio, Andrew Anthony

    2011-01-01

    Patrinos. (2003). The Human Genome Project: Lessons fromScience, 300, 286-90. Human Genome Project. Functional andinitiation of the Human Genome Project, the cost to sequence

  10. NELL-1 regulates BMSC osteogenic and adipogenic differentiation by interacting with Integrin and regulating cell focal adhesion

    E-Print Network [OSTI]

    Chung, Jong Uk

    2012-01-01

    that was part of the Human Genome Project; they were firstinitially found in the Human Genome Project but detected inexons using the Human Genome project [3]. The homologous

  11. Health Citizenship: Essays in Social Medicine and Biomedical Politics

    E-Print Network [OSTI]

    Porter, Dorothy PhD

    2011-01-01

    Issues in the Human Genome Project (Cambridge, Mass. ,Nurture, and the Human Genome Project,” in Daniel J. KevlesIssues in the Human Genome Project (Cambridge, Mass. ,

  12. Attachment Processes and Gene-Environment Interactions: Testing Two Initial Hypotheses Regarding the Relationship Between Attachment, and Methylation of the Glucocorticoid Receptor Gene (NR3C1) and the Serotonin Transporter Gene (SLC6A4)

    E-Print Network [OSTI]

    Jones-Mason, Karen Marie

    2011-01-01

    Energy (DOE) (2006). Human Genome Project Information: Thescience behind the human genome project. Doegenomes.org.sci/techresources/human_genome/project/info.shtml. De Kloet,

  13. The use of 'race' as a variable in biomedical research

    E-Print Network [OSTI]

    Efstathiou, Sophia

    2009-01-01

    involved in the Human Genome Project (HGP) whose chaptergenetic research. The Human Genome Project devoted 3% of itsand Mapping The Human Genome Project (HGP) started in 1990

  14. Native Americans and Type 2 Diabetes: The Discourse of Predisposition and its Politics

    E-Print Network [OSTI]

    McGuire, Laurette Ann

    2012-01-01

    such as the Human Genome Project and the GenographicJoanne 2004 The Human Genome Diversity Project: “Peoples”, “Trouble with the Human Genome Diversity Project. Molecular

  15. Integrated Microfluidic Systems for Genetic Analysis

    E-Print Network [OSTI]

    Cronier, Samantha Anne

    2011-01-01

    sequencing for the Human Genome Project. This 13-year megacompletion of the Human Genome Project. 17-7173 Thistool employed for the Human Genome project, and despite the

  16. Intellectual Property and eScience

    E-Print Network [OSTI]

    Burk, DL

    2007-01-01

    on Properties of the Human Genome Project (pp. 97–122). SanStreet meets the human genome project: Intellectual propertycollaboratory? ’’ The human genome mapping project and the

  17. Fifth Annual RECOMB Satellite Workshop on Comparative Genomics

    E-Print Network [OSTI]

    Fainman, Yeshaiahu

    Fifth Annual RECOMB Satellite Workshop on Comparative Genomics September 16-18, 2007 First RECOMB Oliver A. Ryder (Zoological Society of San Diego) Genomics and Bioinformatics: Applications) Accelerated and Biased Nucleotide Evolution in the Human Genome Rick Wilson (Washington University, St. Louis

  18. Current developments in genomics challenge the established framework of

    E-Print Network [OSTI]

    Church, George M.

    Current developments in genomics challenge the established framework of biomedical ethics because the empirical facts of the genomic science change too fast for the reflections of ethics to keep pace with for pragmatic moral guidance1 . Recent revelations about the human genome, such as the abundance of copy

  19. Genomic analysis of the horse Y chromosome 

    E-Print Network [OSTI]

    Santani, Avni Bhawan

    2005-02-17

    Stallion fertility is of significant economic importance in the multibillion dollar equine industry. Presently, the underlying genetic causes of infertility in stallions are unknown. Analysis of the human genome has shown that in more than 25...

  20. Toward an Integrated BAC Library Resource for Genome Sequencing and Analysis

    SciTech Connect (OSTI)

    Simon, M. I.; Kim, U.-J.

    2002-02-26

    We developed a great deal of expertise in building large BAC libraries from a variety of DNA sources including humans, mice, corn, microorganisms, worms, and Arabidopsis. We greatly improved the technology for screening these libraries rapidly and for selecting appropriate BACs and mapping BACs to develop large overlapping contigs. We became involved in supplying BACs and BAC contigs to a variety of sequencing and mapping projects and we began to collaborate with Drs. Adams and Venter at TIGR and with Dr. Leroy Hood and his group at University of Washington to provide BACs for end sequencing and for mapping and sequencing of large fragments of chromosome 16. Together with Dr. Ian Dunham and his co-workers at the Sanger Center we completed the mapping and they completed the sequencing of the first human chromosome, chromosome 22. This was published in Nature in 1999 and our BAC contigs made a major contribution to this sequencing effort. Drs. Shizuya and Ding invented an automated highly accurate BAC mapping technique. We also developed long-term collaborations with Dr. Uli Weier at UCSF in the design of BAC probes for characterization of human tumors and specific chromosome deletions and breakpoints. Finally the contribution of our work to the human genome project has been recognized in the publication both by the international consortium and the NIH of a draft sequence of the human genome in Nature last year. Dr. Shizuya was acknowledged in the authorship of that landmark paper. Dr. Simon was also an author on the Venter/Adams Celera project sequencing the human genome that was published in Science last year.

  1. Complete genome sequence of Arcanobacterium haemolyticum type strain (11018T)

    SciTech Connect (OSTI)

    Yasawong, Montri; Teshima, Hazuki; Lapidus, Alla L.; Nolan, Matt; Lucas, Susan; Glavina Del Rio, Tijana; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Ivanova, N; Mavromatis, K; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Rohde, Manfred; Sikorski, Johannes; Pukall, Rudiger; Goker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2010-01-01

    Vulcanisaeta distributa Itoh et al. 2002 belongs to the family Thermoproteaceae in the phylum Crenarchaeota. The genus Vulcanisaeta is characterized by a global distribution in hot and acidic springs. This is the first genome sequence from a member of the genus Vulcanisaeta and seventh genome sequence in the family Thermoproteaceae. The 2,374,137 bp long genome with its 2,544 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  2. Genomic Sequence Comparisons, 1987-2003 Final Report

    SciTech Connect (OSTI)

    George M. Church

    2004-07-29

    This project was to develop new DNA sequencing and RNA and protein quantitation methods and related genome annotation tools. The project began in 1987 with the development of multiplex sequencing (published in Science in 1988), and one of the first automated sequencing methods. This lead to the first commercial genome sequence in 1994 and to the establishment of the main commercial participants (GTC then Agencourt) in the public DOE/NIH genome project. In collaboration with GTC we contributed to one of the first complete DOE genome sequences, in 1997, that of Methanobacterium thermoautotropicum, a species of great relevance to energy-rich gas production.

  3. COMPARATIVE ANALYSIS OF GENE PREDICTION METHODS AND DEVELOPMENT OF A FUNGAL GENOME DATABASE SYSTEM

    E-Print Network [OSTI]

    Moriyama, Etsuko

    COMPARATIVE ANALYSIS OF GENE PREDICTION METHODS AND DEVELOPMENT OF A FUNGAL GENOME DATABASE SYSTEM;COMPARATIVE ANALYSIS OF GENE PREDICTION METHODS AND DEVELOPMENT OF A FUNGAL GENOME DATABASE SYSTEM Skanth genome projects have been planned and some new draft genomes have been recently completed. Multiple gene

  4. Goals: Understand how evolution works through gradual changes over time. Correlate DNA sequence conservation with evolution.

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    understanding of evolution of species? 5) Genomics and Human Genome Project What is a genome? What is the human genome project? Mystery Sequences 1 ­ 18 #1 GCTTACGACCATATCACGTTGAATGCACGCCATCCCGTCCGATCTGGCAAGTTAAGCAAC

  5. Genome Analyses and Supplement Data from the International Populus Genome Consortium (IPGC)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    International Populus Genome Consortium (IPGC)

    The sequencing of the first tree genome, that of Populus, was a project initiated by the Office of Biological and Environmental Research in DOE’s Office of Science. The International Populus Genome Consortium (IPGC) was formed to help develop and guide post-sequence activities. The IPGC website, hosted at the Oak Ridge National Laboratory, provides draft sequence data as it is made available from DOE Joint Genome Institute, genome analyses for Populus, lists of related publications and resources, and the science plan. The data are available at http://www.ornl.gov/sci/ipgc/ssr_resource.htm.

  6. HumanMouse Gene Identification by Comparative Evidence Integration and

    E-Print Network [OSTI]

    Pavlovic, Vladimir

    The identification of genes in the human genome remains a challenge, as the actual predictions appear to disagree of genes in the human genome by using a reference, such as mouse genome. However, this comparative genome. In particular, it is not clear whether the mouse is at the correct evolutionary distance from

  7. Complete genome sequence of Capnocytophaga ochracea type strain (VPI 2845T)

    SciTech Connect (OSTI)

    Mavromatis, K; Gronow, Sabine; Saunders, Elizabeth H; Land, Miriam L; Lapidus, Alla L.; Copeland, A; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Bruce, David; Tice, Hope; Cheng, Jan-Fang; Goodwin, Lynne A.; Pitluck, Sam; Pati, Amrita; Ivanova, N; Chen, Amy; Palaniappan, Krishna; Chain, Patrick S. G.; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Brettin, Thomas S; Detter, J. Chris; Han, Cliff; Bristow, James; Goker, Markus; Eisen, Jonathan; Markowitz, Victor; Kyrpides, Nikos C; Klenk, Hans-Peter; Hugenholtz, Philip

    2009-01-01

    Capnocytophaga ochracea (Pr vot et al. 1956) Leadbetter et al. 1982 is the type species of the genus Capnocytophaga. It is of interest because of its location in the Flavobacteriaceae, a genomically not yet charted family within the order Flavobacteriales. The species grows as fusiform to rod shaped cells which tend to form clumps and are able to move by gliding. C. ochracea is known as a capnophilic (CO2-requiring) organism with the ability to grow under anaerobic as well as aerobic conditions (oxygen concentration larger than 15%), here only in the presence of 5% CO2. Strain VPI 2845T, the type strain of the species, is portrayed in this report as a gliding, Gram-negative bacterium, originally isolated from a human oral cavity. Here we describe the features of this organism, together with the complete genome se-quence, and annotation. This is the first completed genome sequence from the flavobacterial genus Capnocytophaga, and the 2,612,925 bp long single replicon genome with its 2193 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  8. Complete genome sequence of Capnocytophaga ochracea type strain (VPI 2845T)

    SciTech Connect (OSTI)

    Mavromatis, Konstantinos; Gronow, Sabine; Saunders, Elizabeth; Land, Miriam; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice1, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Pati, Amrita; Ivanova, Natalia; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Brettin, Thomas; Detter, John C.; Han, Cliff; Bristow, James; Goker, Markus; Rohde, Manfred; Eisen, Jonathan A.; Markowitz, Victor; Kyrpides, Nikos C.; Klenk, Hans-Peter; Hugenholtz, Philip

    2009-05-20

    Capnocytophaga ochracea (Prevot et al. 1956) Leadbetter et al. 1982 is the type species of the genus Capnocytophaga. It is of interest because of its location in the Flavobacteriaceae, a genomically yet uncharted family within the order Flavobacteriales. The species grows as fusiform to rod shaped cells which tend to form clumps and are able to move by gliding. C. ochracea is known as a capnophilic organism with the ability to grow under anaerobic as well as under aerobic conditions (oxygen concentration larger than 15percent), here only in the presence of 5percent CO2. Strain VPI 2845T, the type strain of the species, is portrayed in this report as a gliding, Gram-negative bacterium, originally isolated from a human oral cavity. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first completed genome sequence from the flavobacterial genus Capnocytophaga, and the 2,612,925 bp long single replicon genome with its 2193 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. Wide-cross whole-genome radiation hybrid (WWRH) mapping and identification of cold-responsive genes using oligo-gene microarray analysis in cotton 

    E-Print Network [OSTI]

    Gao, Wenxiang

    2005-02-17

    The first part of this research focused on wide-cross whole-genome radiation hybrid (WWRH) mapping of the cotton (Gossypium) genome. Radiation hybrid mapping has been used extensively to map the genomes of human and certain animal species...

  10. Identification of Genomic Predictors of Response to the CDK4/6 Inhibitor Palbociclib using the UCLATORL Panel of Human Cancer Cell Lines

    E-Print Network [OSTI]

    Conklin, Dylan Francis

    2013-01-01

    invasive epithelial ovarian cancer. Cancer treatment reviewsto breast and ovarian cancer. European journal of cancer 42,locus in advanced human ovarian-cancer. Int J Oncol 6, 129-

  11. Genomic Data and Annotation from the SEED

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Fonstein, Michael; Kogan, Yakov; Osterman, Andrei; Overbeek, Ross; Vonstein, Veronika The Fellowship for Interpretation of Genomes (FIG)

    The SEED Project has been extended to support metagenomic samples and concomitant analytical tools. Moreover, the number of genomes being introduced into SEED is growing very rapidly. Building a framework to support this growth while providing highly accurate annotations is centrally important to SEED. The project’s subsystem-based annotation strategy has become the technological foundation for addressing these challenges.(copied from Appendix 7 of Systems Biology Knowledgebase for a New Era in Biology, A Genomics:GTL Report from the May 2008 Workshop, DOE/SC-0113, Grequrick, S; Fredrickson, J.K.; Stevens, R., Pub March 1, 2009.)

  12. Genomics and Systems Biology

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Genomics and Systems Biology LANL leads the world in computational finishing of microbial genomes Read caption + In 2013, Los Alamos scientist Richard Sayre and his team...

  13. Complete genome sequence of Veillonella parvula type strain (Te3T)

    SciTech Connect (OSTI)

    Gronow, Sabine; Welnitz, Sabine; Lapidus, Alla L.; Nolan, Matt; Ivanova, N; Glavina Del Rio, Tijana; Copeland, A; Chen, Feng; Tice, Hope; Pitluck, Sam; Cheng, Jan-Fang; Saunders, Elizabeth H; Brettin, Thomas S; Han, Cliff; Detter, J. Chris; Bruce, David; Goodwin, Lynne A.; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Pati, Amrita; Mavromatis, K; Mikhailova, Natalia; Chen, Amy; Palaniappan, Krishna; Chain, Patrick S. G.; Rohde, Manfred; Goker, Markus; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lucas, Susan

    2010-01-01

    Veillonella parvula (Veillon and Zuber 1898) Pr vot 1933 is the type species of the genus Veillonella in the family Veillonellaceae within the order Clostridiales. The species V. parvula is of interest because it is frequently isolated from dental plaque in the human oral cavity and can cause opportunistic infections. The species is strictly anaerobic and grows as small cocci which usually occur in pairs. Veillonellae are characterized by their unusual metabolism which is centered on the activity of the enzyme methylmalonyl-CoA decarboxylase. Strain Te3T, the type strain of the species, was isolated from the human intestinal tract. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the large clostridial family Veillonellaceae, and the 2,132,142 bp long single replicon genome with its 1859 protein-coding and 61 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  14. Application of protein and small-molecule microarrays to study stem cell differentiation, cancer growth, and personalized therapy

    E-Print Network [OSTI]

    Teng, Dayu

    2010-01-01

    advancement such as the human genome project has shed lightyears such as the human genome project has made it possible

  15. The role of feedback in signaling dynamics

    E-Print Network [OSTI]

    Longo, Diane Marie

    2009-01-01

    tion of the Human Genome Project in 2003 (InternationalWhile the original Human Genome Project cost billions of

  16. An horizon scan of biogeography

    E-Print Network [OSTI]

    2013-01-01

    A.  (2003) The Human Genome  Project: lessons from large?be? ginning  the  human  genome  project,  criteria  were 

  17. Directed mammalian gene regulatory networks using expression and comparative genomic hybridization microarray data from radiation hybrids

    E-Print Network [OSTI]

    2009-01-01

    generation whole genome-radiation hybrid map spanning theA high- resolution radiation hybrid map of the human genomeRecently we have used radiation hybrids to map loci based on

  18. High quality genome-scale metabolic network reconstruction of mycobacterium tuberculosis and comparison with human metabolic network: application for drug targets identification 

    E-Print Network [OSTI]

    Kalapanulak, Saowalak

    2009-01-01

    Mycobacterium tuberculosis (Mtb), a pathogenic bacterium, is the causative agent in the vast majority of human tuberculosis (TB) cases. Nearly one-third of the world’s population has been affected by TB and annually two ...

  19. Current trends in mapping human genes

    SciTech Connect (OSTI)

    Mckusick, V.A. )

    1991-01-01

    The human is estimated to have at least 50,000 expressed genes (gene loci). Some information is available concerning about 5,000 of these gene loci and about 1,900 have been mapped, i.e., assigned to specific chromosomes (and in most instances particular chromosome regions). Progress has been achieved by a combination of physical mapping (e.g., study of somatic cell hybrids and chromosomal in situ hybridization) and genetic mapping (e.g., genetic linkage studies). New methods for both physical and genetic mapping are expanding the armamentarium. The usefulness of the mapping information is already evident; the spin-off from the Human Genome Project (HGP) begins immediately. the complete nucleotide sequence is the ultimate map of the human genome. Sequencing, although already under way for limited segments of the genome, will await further progress in gene mapping, and in particular creation of contig maps for each chromosome. Meanwhile the technology of sequencing and sequence information handling will be developed.

  20. Genome sequence of Victivallis vadensis ATCC BAA-548, an anaerobic bacterium from the phylum Lentisphaerae, isolated from the human gastro-intestinal tract

    SciTech Connect (OSTI)

    Van Passel, Mark W.J. [Wageningen University and Research Centre, The Netherlands; Kant, Ravi [University of Helsinki; Palva, Airi [University of Helsinki; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Davenport, Karen W. [Los Alamos National Laboratory (LANL); Sims, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Richardson, Paul [U.S. Department of Energy, Joint Genome Institute; De Vos, Willem M. [Wageningen University and Research Centre, The Netherlands; Smidt, Hauke [Wageningen University and Research Centre, The Netherlands; Zoetendal, Erwin G. [Wageningen University and Research Centre, The Netherlands

    2011-01-01

    Victivallis vadensis ATCC BAA-548 represents the first cultured representative from the novel phylum Lentisphaerae, a deep-branching bacterial lineage. Few cultured bacteria from this phylum are known, and V. vadensis therefore represents an important organism for evolutionary studies. V. vadensis is a strictly anaerobic sugar-fermenting isolate from the human gastro-intestinal tract.

  1. The US Department of Energy Joint Genome Institute Microbial Genome Program

    E-Print Network [OSTI]

    Lapidus, Alla

    2005-01-01

    Department of Energy Joint Genome Institute Microbial GenomeDepartment of Energy Joint Genome Institute Microbial Genome

  2. Complete genome sequence of Olsenella uli type strain (VPI D76D-27CT)

    SciTech Connect (OSTI)

    Goker, Markus; Held, Brittany; Lucas, Susan; Nolan, Matt; Yasawong, Montri; Glavina Del Rio, Tijana; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Ivanova, N; Mavromatis, K; Mikhailova, Natalia; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Rohde, Manfred; Sikorski, Johannes; Pukall, Rudiger; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter

    2010-01-01

    Olsenella uli (Olsen et al. 1991) Dewhirst et al. 2001 is the type species of the genus Olsenella, which belongs to the actinobacterial family Coriobacteriaceae. The species is of interest because it is frequently isolated from dental plaque in periodontitis patients and can cause primary endodontic infection. The species is a Gram-positive, non-motile and non-sporulating bacterium. The strain described in this study has been isolated from human gingival crevices in 1982. This is the first completed sequence of the genus Olsenella and the fifth sequence from the family Coriobacteriaceae. The 2,051,896 bp long genome with its 1,795 protein-coding and 55 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Genome sequence analysis of the model grass Brachypodium distachyon: insights into grass genome evolution

    SciTech Connect (OSTI)

    Schulman, Al

    2009-08-09

    Three subfamilies of grasses, the Erhardtoideae (rice), the Panicoideae (maize, sorghum, sugar cane and millet), and the Pooideae (wheat, barley and cool season forage grasses) provide the basis of human nutrition and are poised to become major sources of renewable energy. Here we describe the complete genome sequence of the wild grass Brachypodium distachyon (Brachypodium), the first member of the Pooideae subfamily to be completely sequenced. Comparison of the Brachypodium, rice and sorghum genomes reveals a precise sequence- based history of genome evolution across a broad diversity of the grass family and identifies nested insertions of whole chromosomes into centromeric regions as a predominant mechanism driving chromosome evolution in the grasses. The relatively compact genome of Brachypodium is maintained by a balance of retroelement replication and loss. The complete genome sequence of Brachypodium, coupled to its exceptional promise as a model system for grass research, will support the development of new energy and food crops

  4. Comparative genomic workflow

    E-Print Network [OSTI]

    Rajapakse, Jagath

    his article describes a workflow for identifying conserved patterns in noncoding regions of vertebrate genomes, with an intention of investigating possible functions of the conserved regions. The annotations of genomes are ...

  5. DUKEInstituteForGenomeSciences&Policy Microbes R Us

    E-Print Network [OSTI]

    Richardson, David

    GenomeLIFE DUKEInstituteForGenomeSciences&Policy Microbes R Us Duke Faculty Explore the Microbiome of microbes. The microbial cells in and on our bodies outnumber human cells ten to one. In a contest Systems (GeMS), a new hub of activity inspired by renewed interest in the roles that microbes play

  6. perspectives 960 nature structural biology structural genomics supplement november 2000

    E-Print Network [OSTI]

    Gerstein, Mark

    be related to other information. In the past, for `single-mole- cule' experiments, formal integration. As illus- trated in Figs 1 and 2, the main sources of information to inter-relate with structures are fold genomic information. In particular, a number of companies offer integrated views of the human genome

  7. Advances in Whole Genome

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Advances in Whole Genome Sequencing IMA Public Lecture: Tuesday, May 6, 2003, 7:30 p.m. Moos Tower sequenced genome, the virus Lambda at 50,000 nucleotides, was sequenced via the shotgun method by Sanger that this approach could not be applied to genomes over 100,000 nucleotides long, so a long period followed where

  8. Complete genome sequence of Acidimicrobium ferrooxidans type strain (ICPT)

    SciTech Connect (OSTI)

    Clum, Alicia; Nolan, Matt; Lang, Elke; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Goker, Markus; Spring, Stefan; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Lapidus, Alla

    2009-05-20

    Acidimicrobium ferrooxidans (Clark and Norris 1996) is the sole and type species of the genus, which until recently was the only genus within the actinobacterial family Acidimicrobiaceae and in the order Acidomicrobiales. Rapid oxidation of iron pyrite during autotrophic growth in the absence of an enhanced CO2 concentration is characteristic for A. ferrooxidans. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the order Acidomicrobiales, and the 2,158,157 bp long single replicon genome with its 2038 protein coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. A time-invariant principle of genome evolution Subhajyoti De1

    E-Print Network [OSTI]

    Babu, M. Madan

    A time-invariant principle of genome evolution Subhajyoti De1 and M. Madan Babu1 Medical Research (received for review December 19, 2009) Uncovering general principles of genome evolution that are time genomes that diverged at different times across germ- and somatic-cell lineages: (i) the reference human

  10. Genomics and the Future of Healthcare in the United States Professor Doug Brutlag

    E-Print Network [OSTI]

    Brutlag, Doug

    Genomics and the Future of Healthcare in the United States Jon Canel Professor Doug Brutlag Biochem 118Q Introduction Since the release of a "completed" human genome analysis in 2003, scientists, medical care providers, insurance companies and politicians have all hotly debated the role of genomics

  11. Developmental genomics of the most dangerous animal Matthew P. Scott*

    E-Print Network [OSTI]

    Quake, Stephen R.

    Developmental genomics of the most dangerous animal Matthew P. Scott* Departments of Developmental as far and away the most dangerous animal to humans. Mos- quitoes also transmit numerous other infections

  12. PROJECT 5.A I561 SPRING 2010 VERSION 1.0 SECTION 13043 HumanComputer Interaction Design

    E-Print Network [OSTI]

    Blevis, Eli

    renewal, reuse, & update systems predetermination #12;PROJECT 5.A I561 SPRING 2010 VERSION 1) Sustainability: Misinformation. This plastic water bottle has a label which claims that its manufacturer's use of promoting the use of durable containers like the glass pictured and eliminating the use of single use

  13. SEER Forward Plan for 2013/2014 The SEER project involves understanding a number of natural and human systems which

    E-Print Network [OSTI]

    Bateman, Ian J.

    ; impacts upon water quality; impacts on carbon balance and greenhouse gas emissions; land use effects of natural and human systems which are related to changes to land use. These systems include the drivers bringing together natural and social science models. Methodological improvements in the valuation

  14. The Genome of the Western Clawed Frog Xenopus tropicalis

    SciTech Connect (OSTI)

    Hellsten, Uffe; Harland, Richard M.; Gilchrist, Michael J.; Hendrix, David; Jurka, Jerzy; Kapitonov, Vladimir; Ovcharenko, Ivan; Putnam, Nicholas H.; Shu, Shengqiang; Taher, Leila; Blitz, Ira L.; Blumberg, Bruce; Dichmann, Darwin S.; Dubchak, Inna; Amaya, Enrique; Detter, John C.; Fletcher, Russell; Gerhard, Daniela S.; Goodstein, David; Graves, Tina; Grigoriev, Igor V.; Grimwood, Jane; Kawashima, Takeshi; Lindquist, Erika; Lucas, Susan M.; Mead, Paul E.; Mitros, Therese; Ogino, Hajime; Ohta, Yuko; Poliakov, Alexander V.; Pollet, Nicolas; Robert, Jacques; Salamov, Asaf; Sater, Amy K.; Schmutz, Jeremy; Terry, Astrid; Vize, Peter D.; Warren, Wesley C.; Wells, Dan; Wills, Andrea; Wilson, Richard K.; Zimmerman, Lyle B.; Zorn, Aaron M.; Grainger, Robert; Grammer, Timothy; Khokha, Mustafa K.; Richardson, Paul M.; Rokhsar, Daniel S.

    2009-10-01

    The western clawed frog Xenopus tropicalis is an important model for vertebrate development that combines experimental advantages of the African clawed frog Xenopus laevis with more tractable genetics. Here we present a draft genome sequence assembly of X. tropicalis. This genome encodes over 20,000 protein-coding genes, including orthologs of at least 1,700 human disease genes. Over a million expressed sequence tags validated the annotation. More than one-third of the genome consists of transposable elements, with unusually prevalent DNA transposons. Like other tetrapods, the genome contains gene deserts enriched for conserved non-coding elements. The genome exhibits remarkable shared synteny with human and chicken over major parts of large chromosomes, broken by lineage-specific chromosome fusions and fissions, mainly in the mammalian lineage.

  15. Dynamic Genomes of Eukaryotes and the Maintenance of Genomic Integrity

    E-Print Network [OSTI]

    Katz, Laura

    Dynamic Genomes of Eukaryotes and the Maintenance of Genomic Integrity Eukaryotes specify a genome to be inherited stably, enabling dynamic rearrangements and amplifications of other genomic elements Laura Wegener Parfrey and Laura A. Katz M any biologists assume that eu- karyotic genomes are transmit- ted stably

  16. January 22, 2009 15:48 Proceedings Trim Size: 9in x 6in Kahncamerarevised A PARSIMONY APPROACH TO ANALYSIS OF HUMAN

    E-Print Network [OSTI]

    Raphael, Ben J.

    -mail: {clkahn,braphael}@cs.brown.edu Segmental duplications are abundant in the human genome between segmental duplications in the human genome. 1. Introduction Mammalian genomes consist of many that approximately 5% of the human genome consists of segmental duplications > 1 kb in length with 90% sequence

  17. Webinar: Materials Genome Initative

    Broader source: Energy.gov [DOE]

    Audio recording and text version of the Fuel Cell Technologies Office webinar titled "Materials Genome Initiative," originally presented on December 2, 2014.

  18. Genomics and Systems Biology

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and structural genomics, and applications for such work cover diverse fields such as energy, agriculture, and environmental cleanup. Get Expertise Babetta Marrone Biofuels...

  19. Genomics Division Home

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to the most primitive soil microbe represent a watershed opportunity for biology. The Genomics Division is taking advantage of this wealth of new information. While it is well...

  20. Genome Science/Technologies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    primary focus is to develop technologies to obtain near complete genomes from single cells for the purposes of improved taxonomic identification and determining metabolic...

  1. Insights from twenty years of bacterial genome sequencing

    SciTech Connect (OSTI)

    Land, Miriam L; Hauser, Loren John; Jun, Se Ran; Nookaew, Intawat; Leuze, Michael Rex; Ahn, Tae-Hyuk; Karpinets, Tatiana V; Lund, Ole; Kora, Guruprasad H; Wassenaar, Trudy; Poudel, Suresh; Ussery, David W

    2015-01-01

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative genomics has produced. To date, there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling in less characterized taxonomic groups. The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system provides bacteria with immunity against viruses, which outnumber bacteria by tenfold. How fast can we go? Second-generation sequencing has produced a large number of draft genomes (close to 90 % of bacterial genomes in GenBank are currently not complete); third-generation sequencing can potentially produce a finished genome in a few hours, and at the same time provide methlylation sites along the entire chromosome. The diversity of bacterial communities is extensive as is evident from the genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. Genome sequencing can help in classifying an organism, and in the case where multiple genomes of the same species are available, it is possible to calculate the pan- and core genomes; comparison of more than 2000 Escherichia coli genomes finds an E. coli core genome of about 3100 gene families and a total of about 89,000 different gene families. Why do we care about bacterial genome sequencing? There are many practical applications, such as genome-scale metabolic modeling, biosurveillance, bioforensics, and infectious disease epidemiology. In the near future, high-throughput sequencing of patient metagenomic samples could revolutionize medicine in terms of speed and accuracy of finding pathogens and knowing how to treat them.

  2. Systematics and Taxonomy marc ereshefsky

    E-Print Network [OSTI]

    Ereshefsky, Marc

    in the heady days of the Human Genome Project and other genome projects. Perhaps the organisms of one species

  3. FUNCTIONAL GENOMICS Program of Study

    E-Print Network [OSTI]

    Thomas, Andrew

    FUNCTIONAL GENOMICS Program of Study Research Areas Students Applying Correspondence Graduate Genomics. Students receive training in the biological, physical and computational sciences through of primary institutional affiliation. The Functional Genomics program is administered through the Graduate

  4. Nicole Gurtler Genomics and Medicine

    E-Print Network [OSTI]

    Brutlag, Doug

    Gurtler 1 Nicole Gurtler Genomics and Medicine Final Paper Genomics and Multiple Sclerosis The recent breakthroughs in genomics have contributed greatly to the advancement of multiple sclerosis than previously maintenance-oriented treatments. What is Multiple Sclerosis? "Multiple sclerosis (MS

  5. Enhancer Identification through Comparative Genomics

    E-Print Network [OSTI]

    Visel, Axel; Bristow, James; Pennacchio, Len A.

    2006-01-01

    through Comparative Genomics Axel Visel, James Bristow andWalnut Creek, CA 94598 USA. Genomics Division, MS 84-171,Len A. Pennacchio, Genomics Division, One Cyclotron Road, MS

  6. The Future of Microbial Genomics

    SciTech Connect (OSTI)

    Kyrpides, Nikos [Genome Biology group at the DOE Joint Genome Institute

    2010-06-02

    Nikos Kyrpides, head of the Genome Biology group at the DOE Joint Genome Institute discusses current challenges in the field of microbial genomics on June 2, 2010 at the "Sequencing, Finishing, Analysis in the Future" meeting in Santa Fe, NM

  7. Ginny Scholtes Genomics and Medicine

    E-Print Network [OSTI]

    Brutlag, Doug

    Ginny Scholtes Genomics and Medicine Professor Douglas Brutlag December 2, 2010 How Hard Could It Be? The Integration of Personal Genomics into Medical Practice Personal genomics carries incredible potential to revolutionize the way

  8. Scotts Valley Energy Office and Human Capacity Building that will provide energy-efficiency services and develop sustainable renewable energy projects.

    SciTech Connect (OSTI)

    Anderson, Temashio

    2013-06-28

    The primary goal of this project is to develop a Scotts Valley Energy Development Office (SVEDO). This office will further support the mission of the Tribe's existing leadership position as the DOE Tribal Multi-County Weatherization Energy Program (TMCWEP) in creating jobs and providing tribal homes and buildings with weatherization assistance to increase energy efficiency, occupant comfort and improved indoor air quality. This office will also spearhead efforts to move the Tribe towards its further strategic energy goals of implementing renewable energy systems through specific training, resource evaluation, feasibility planning, and implementation. Human capacity building and continuing operations are two key elements of the SVEDO objectives. Therefore, the project will 1) train and employ additional Tribal members in energy efficiency, conservation and renewable resource analyses and implementation; 2) purchase materials and equipment required to implement the strategic priorities as developed by the Scotts Valley Tribe which specifically include implementing energy conservation measures and alternative energy strategies to reduce energy costs for the Tribe and its members; and 3) obtain a dedicated office and storage space for ongoing SVEDO operations.

  9. Genetic association with overall survival of taxane-treated lung cancer patients - a genome-wide association study in human lymphoblastoid cell lines followed by a clinical association study

    E-Print Network [OSTI]

    Niu, Nifang

    Background: Taxane is one of the first line treatments of lung cancer. In order to identify novel single nucleotide polymorphisms (SNPs) that might contribute to taxane response, we performed a genome-wide association study ...

  10. Genome Clone Libraries and Data from the Integrated Molecular Analysis of Genomes and their Expression (I.M.A.G.E.) Consortium

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The I.M.A.G.E. Consortium was initiated in 1993 by four academic groups on a collaborative basis after informal discussions led to a common vision of how to achieve an important goal in the study of the human genome: the Integrated Molecular Analysis of Genomes and their Expression Consortium's primary goal is to create arrayed cDNA libraries and associated bioinformatics tools, and make them publicly available to the research community. The primary organisms of interest include intensively studied mammalian species, including human, mouse, rat and non-human primate species. The Consortium has also focused on several commonly studied model organisms; as part of this effort it has arrayed cDNAs from zebrafish, and Fugu (pufferfish) as well as Xenopus laevis and X. tropicalis (frog). Utilizing high speed robotics, over nine million individual cDNA clones have been arrayed into 384-well microtiter plates, and sufficient replicas have been created to distribute copies both to sequencing centers and to a network of five distributors located worldwide. The I.M.A.G.E. Consortium represents the world's largest public cDNA collection, and works closely with the National Institutes of Health's Mammalian Gene Collection(MGC) to help it achieve its goal of creating a full-length cDNA clone for every human and mouse gene. I.M.A.G.E. is also a member of the ORFeome Collaboration, working to generate a complete set of expression-ready open reading frame clones representing each human gene. Custom informatics tools have been developed in support of these projects to better allow the research community to select clones of interest and track and collect all data deposited into public databases about those clones and their related sequences. I.M.A.G.E. clones are publicly available, free of any royalties, and may be used by anyone agreeing with the Consortium's guidelines.

  11. Human Subjects Section 6. Protection of Human

    E-Print Network [OSTI]

    Heller, Barbara

    Human Subjects Section 6. Protection of Human Subjects This section is required for applicants answering "yes" to the question "Are human subjects involved?" on the R&R Other Project Information form subjects applicants must provide a justification in this section for the claim that no human subjects

  12. Evolutionary Genomics of Salmonella enterica Subspecies

    E-Print Network [OSTI]

    2013-01-01

    M. 2013. Evolutionary genomics of Salmonella entericaEvolutionary Genomics of Salmonella enterica Subspecies

  13. Evolutionary Genomics of Salmonella enterica Subspecies

    E-Print Network [OSTI]

    2013-01-01

    Evolutionary genomics of Salmonella enterica subspecies.Evolutionary Genomics of Salmonella enterica Subspecies

  14. SciTech Connect: genomics

    Office of Scientific and Technical Information (OSTI)

    genomics Find + Advanced Search Term Search Semantic Search Advanced Search All Fields: genomics Semantic Semantic Term Title: Full Text: Bibliographic Data: Creator Author:...

  15. Sequence modelling and an extensible data model for genomic database

    SciTech Connect (OSTI)

    Li, Peter Wei-Der Lawrence Berkeley Lab., CA )

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS's do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the Extensible Object Model'', to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  16. Sequence modelling and an extensible data model for genomic database

    SciTech Connect (OSTI)

    Li, Peter Wei-Der |

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS`s do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the ``Extensible Object Model``, to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  17. Comparative genomics of the core and accessory genomes of 48 Sinorhizobium strains comprising five genospecies

    E-Print Network [OSTI]

    2013-01-01

    annotation and comparative genomics. Database (Oxford) 2009,et al. : Comparative genomics of the core and accessoryComparative genomics of the core and accessory genomes of 48

  18. VISTA - computational tools for comparative genomics

    SciTech Connect (OSTI)

    Frazer, Kelly A.; Pachter, Lior; Poliakov, Alexander; Rubin,Edward M.; Dubchak, Inna

    2004-01-01

    Comparison of DNA sequences from different species is a fundamental method for identifying functional elements in genomes. Here we describe the VISTA family of tools created to assist biologists in carrying out this task. Our first VISTA server at http://www-gsd.lbl.gov/VISTA/ was launched in the summer of 2000 and was designed to align long genomic sequences and visualize these alignments with associated functional annotations. Currently the VISTA site includes multiple comparative genomics tools and provides users with rich capabilities to browse pre-computed whole-genome alignments of large vertebrate genomes and other groups of organisms with VISTA Browser, submit their own sequences of interest to several VISTA servers for various types of comparative analysis, and obtain detailed comparative analysis results for a set of cardiovascular genes. We illustrate capabilities of the VISTA site by the analysis of a 180 kilobase (kb) interval on human chromosome 5 that encodes for the kinesin family member3A (KIF3A) protein.

  19. History of the DOE Human Genome Program

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHigh energyHighland View school4-TP59.01 C5;44 4OF THEHistory

  20. Since the early 1990s a large amount of effort has focused on determining the complete genomic DNA sequence

    E-Print Network [OSTI]

    Botstein, David

    Since the early 1990s a large amount of effort has focused on determining the complete genomic DNA sequencing. From the determination of the first complete genome sequence of an organism, the bacteriophage X174 (Ref. 2), to the completion of 95% of the human genome sequence3,4, many technical advances

  1. Extracting Strawberry DNA Adapted from http://www.genome.gov/Pages/Education/Modules/StrawberryExtractionInstructions.pdf

    E-Print Network [OSTI]

    Gruber, Jonathan

    Extracting Strawberry DNA Adapted from http://www.genome.gov/Pages/Education/Modules/StrawberryExtractionInstructions.pdf for a group of 5 students with an adult moderator Strawberries have enormous genomes. Humans have two copies of the cell. Strawberries have up to eight copies of each chromosome (octoploid genome). Today, we

  2. Update on Genomic Studies of Algae Paths toward Algal Genomics

    E-Print Network [OSTI]

    Update on Genomic Studies of Algae Paths toward Algal Genomics Arthur R. Grossman* The Carnegie the expression of genes. In this introductory manuscript, I discuss select algae and how genomics is impacting our understanding of these organisms. Four algae for which near-full genome information has become

  3. Update on Genomic Studies of Algae Paths toward Algal Genomics

    E-Print Network [OSTI]

    Update on Genomic Studies of Algae Paths toward Algal Genomics Arthur R. Grossman* The Carnegie of genomic information that is being used to help researchers understand the gene content of organisms, how the expression of genes. In this introductory manuscript, I discuss select algae and how genomics is impacting

  4. Comparative and Functional Genomics Comp Funct Genom 2003; 4: 3136.

    E-Print Network [OSTI]

    Allen, John F.

    Comparative and Functional Genomics Comp Funct Genom 2003; 4: 31­36. Published online in Wiley and mitochondria contain genomes John F. Allen* Plant Biochemistry, Center for Chemistry and Chemical Engineering that the nucleotide sequences of mitochondrial and chloroplast genomes would provide the answer has proved unfounded

  5. Unraveling the 3D genome: genomics tools for multiscale exploration

    E-Print Network [OSTI]

    Straight, Aaron

    Unraveling the 3D genome: genomics tools for multiscale exploration Viviana I. Risca and William J genome and the roles it may play in regulating transcription. Here we review core methods and new tools-scale chromosomal domains, and discuss the emerging pic- ture of the 3D genome that these tools have revealed. Blind

  6. Eukaryotic Genomics Data from the DOE Joint Genome Institute (JGI)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    From the JGI webportal users can choose Eukaryotic genomes from a photo list, access the JGI FTP directories to download data files, use the Tree of Life navigation tool, or choose a genome and go directly to a website specific to that one genome. The individual sites include direct access to download sequence files, BLAST, search, view and navigate the genomic annotations.

  7. The Trichoplax Genome and the Nature of Placozoans

    SciTech Connect (OSTI)

    Srivastava, Mansi; Begovic, Emina; Chapman, Jarrod; Putnam, Nicholas H.; Hellsten, Uffe; Kawashima, Takeshi; Kuo, Alan; Mitros, Therese; Salamov, Asaf; Carpenter, Meredith L.; Signorovitch, Ana Y.; Moreno, Maria A.; Kamm, Kai; Grimwood, Jane; Schmutz, Jeremy; Shapiro, Harris; Grigoriev, Igor V.; Buss, Leo W.; Schierwater, Bernd; Dellaporta, Stephen L.; Rokhsar, Daniel S.

    2008-08-01

    Placozoans are arguably the simplest free-living animals, possibly evoking an early stage in metazoan evolution, yet their biology is poorly understood. Here we report the sequencing and analysis of the {approx}98 million base pair nuclear genome of the placozoan Trichoplax adhaerens. Whole genome phylogenetic analysis suggests that placozoans belong to a 'eumetazoan' clade that includes cnidarians and bilaterians, with sponges as the earliest diverging animals. The compact genome exhibits conserved gene content, gene structure, and synteny relative to the human and other complex eumetazoan genomes. Despite the apparent cellular and organismal simplicity of Trichoplax, its genome encodes a rich array of transcription factor and signaling pathway genes that are typically associated with diverse cell types and developmental processes in eumetazoans, motivating further searches for cryptic cellular complexity and/or as yet unobserved life history stages.

  8. Expansion of the Genomic Encyclopedia of Bacteria and Archaea

    SciTech Connect (OSTI)

    Rinke, Christian; Sczyrba, Alex; Malfatti, Stephanie; Lee, Janye; Cheng, Jan-Fang; Stepanauskas, Ramunas; Eisen, Jonathan A.; Hallam, Steven; Inskeep, William P.; Hedlund, Brian P.; Sievert, Stefan M.; Liu, Wen-Tso; Tsiamis, George; Hugenholtz, Philip; Woyke, Tanja

    2011-03-20

    To date the vast majority of bacterial and archaeal genomes sequenced are of rather limited phylogenetic diversity as they were chosen based on their physiology and/ or medical importance. The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project (Wu et al. 2009) is aimed to systematically filling the gaps of the tree of life with phylogenetically diverse reference genomes. However more than 99percent of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes of these largely mysterious species. These limitations gave rise to the GEBA uncultured project. Here we propose to use single cell genomics to massively expand the Genomic Encyclopedia of Bacteria and Archaea by targeting 80 single cell representatives of uncultured candidate phyla which have no or very few cultured representatives. Generating these reference genomes of uncultured microbes will dramatically increase the discovery rate of novel protein families and biological functions, shed light on the numerous underrepresented phyla that likely play important roles in the environment, and will assist in improving the reconstruction of the evolutionary history of Bacteria and Archaea. Moreover, these data will improve our ability to interpret metagenomics sequence data from diverse environments, which will be of tremendous value for microbial ecology and evolutionary studies to come.

  9. Expansion of the Genomic Encyclopedia of Bacteria and Archaea

    SciTech Connect (OSTI)

    Rinke, Christian; Sczyrba, Alex; Malfatti, Stephanie; Lee, Janey; Cheng, Jan-Fang; Stepanauskas, Ramunas; Eisen, Jonathan A.; Hallam, Steven; Inskeep, William P.; Hedlund, Brian P.; Sievert, Stefan M.; Liu, Wen-Tso; Tsiamis, George; Hugenholtz, Philip; Woyke, Tanja

    2011-06-02

    To date the vast majority of bacterial and archaeal genomes sequenced are of rather limited phylogenetic diversity as they were chosen based on their physiology and/ or medical importance. The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project (Wu et al. 2009) is aimed at systematically filling the gaps of the tree of life with phylogenetically diverse reference genomes. However more than 99 percent of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes of these largely mysterious species. These limitations gave rise to the GEBA uncultured project. Here we propose to use single cell genomics to massively expand the Genomic Encyclopedia of Bacteria and Archaea by targeting 80 single cell representatives of uncultured candidate phyla which have no or very few cultured representatives. Generating these reference genomes of uncultured microbes will dramatically increase the discovery rate of novel protein families and biological functions, shed light on the numerous underrepresented phyla that likely play important roles in the environment, and will assist in improving the reconstruction of the evolutionary history of Bacteria and Archaea. Moreover, these data will improve our ability to interpret metagenomics sequence data from diverse environments, which will be of tremendous value for microbial ecology and evolutionary studies to come.

  10. Complete genome sequence of Ferroglobus placidus AEDII12DO

    SciTech Connect (OSTI)

    Anderson, Iain [U.S. Department of Energy, Joint Genome Institute; Risso, Carla [University of Massachusetts, Amherst; Holmes, Dawn [University of Massachusetts, Amherst; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Lovley, Derek [University of Massachusetts, Amherst; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute

    2011-01-01

    Ferroglobus placidus belongs to the order Archaeoglobales within the archaeal phylum Euryar- chaeota. Strain AEDII12DO is the type strain of the species and was isolated from a shallow marine hydrothermal system at Vulcano, Italy. It is a hyperthermophilic, anaerobic chemoli- thoautotroph, but it can also use a variety of aromatic compounds as electron donors. Here we describe the features of this organism together with the complete genome sequence and anno- tation. The 2,196,266 bp genome with its 2,567 protein-coding and 55 RNA genes was se- quenced as part of a DOE Joint Genome Institute Laboratory Sequencing Program (LSP) project.

  11. The Center for integrative genomics

    E-Print Network [OSTI]

    Kaessmann, Henrik

    The Center for integrative genomics Report 2005­2006 #12;Presentation Director's message 4 Scientific advisory committee 6 Organigram of the CIG 7 research The structure and function of genomes and their evolution alexandrereymond ­ Genome structure and expression 10 henrikKaessmann ­ Evolutionary genomics 12

  12. Genome-Facilitated Analyses of Geomicrobial Processes

    SciTech Connect (OSTI)

    Kenneth H. Nealson

    2012-05-02

    This project had the goal(s) of understanding the mechanism(s) of extracellular electron transport (EET) in the microbe Shewanella oneidensis MR-1, and a number of other strains and species in the genus Shewanella. The major accomplishments included sequencing, annotation, and analysis of more than 20 Shewanella genomes. The comparative genomics enabled the beginning of a systems biology approach to this genus. Another major contribution involved the study of gene regulation, primarily in the model organism, MR-1. As part of this work, we took advantage of special facilities at the DOE: e.g., the synchrotron radiation facility at ANL, where we successfully used this system for elemental characterization of single cells in different metabolic states (1). We began work with purified enzymes, and identification of partially purified enzymes, leading to initial characterization of several of the 42 c-type cytochromes from MR-1 (2). As the genome became annotated, we began experiments on transcriptome analysis under different conditions of growth, the first step towards systems biology (3,4). Conductive appendages of Shewanella, called bacterial nanowires were identified and characterized during this work (5, 11, 20,21). For the first time, it was possible to measure the electron transfer rate between single cells and a solid substrate (20), a rate that has been confirmed by several other laboratories. We also showed that MR-1 cells preferentially attach to cells at a given charge, and are not attracted, or even repelled by other charges. The interaction with the charged surfaces begins with a stimulation of motility (called electrokinesis), and eventually leads to attachment and growth. One of the things that genomics allows is the comparative analysis of the various Shewanella strains, which led to several important insights. First, while the genomes predicted that none of the strains looked like they should be able to degrade N-acetyl glucosamine (NAG), the monomer that makes up chitin, virtually all of the strains were in fact capable. This led to the discovery of a great many new genes involved with chitin and NAG metabolism (7). In a similar vein, a detailed study of the sugar utilization pathway revealed a major new insight into the regulation of sugar metabolism in this genus (19). Systems Biology and Comparative Genomics of the shewanellae: Several publications were put together describing the use of comparative genomics for analyses of the group Shewanella, and these were a logical culmination of our genomic-driven research (10,15,18). Eight graduate students received their Ph.D. degrees doing part of the work described here, and four postdoctoral fellows were supported. In addition, approximately 20 undergraduates took part in projects during the grant period.

  13. Genome Structure Gallery from the Mycobacterium Tuberculosis Structual Genomics Consortium

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The TB Structural Genomics Consortium works with the structures of proteins from M. tuberculosis, analyzing these structures in the context of functional information that currently exists and that the Consortium generates. The database of linked structural and functional information constructed from this project will form a lasting basis for understanding M. tuberculosis pathogenesis and for structure-based drug design. The Consortium's structural and functional information is publicly available. The Structures Gallery makes more than 650 total structures available by PDB identifier. Some of these are not consortium targets, but all are viewable in 3D color and can be manipulated in various ways by Jmol, an open-source Java viewer for chemical structures in 3D from http://www.jmol.org/

  14. Project Year Project Team

    E-Print Network [OSTI]

    Gray, Jeffrey J.

    Project Year 2001 Project Team Faculty: Grace Brush, Geography & Environmental Engineering, Whiting School of Engineering Fellow: Dan Bain, Geography & Environmental Engineering, Whiting School. Through this project, the team proposes to develop a variety of resources: a set of general, web

  15. Genomics, Gene Expression and Other Studies in Soybean Rust

    E-Print Network [OSTI]

    Posada-Buitrago, Martha Lucia

    2005-01-01

    Joint Genome Institute Genomics, Gene Expression and otherRust Martha Lucía Posada-Buitrago Ph.D Genomics DivisionEvolutionary Genomics DOE- Joint Genome Institute Lawrence

  16. Hidden Breakpoints in Genome Alignments

    E-Print Network [OSTI]

    Spang, Rainer

    in Genome Alignments #12;11 Simulated evolution Hidden Breakpoints in Genome Alignments 400 alignments in Genome Alignments #12;13 Simulated evolution Hidden Breakpoints in Genome Alignments 400 alignments genome Sum-of-Pairs: d(A,B) + d(A,C) + d(B,C) argmin {d(A,M) + d(B,M) + d(C,M)} M A C #12;16 Hidden

  17. Tank Waste System Integrated Project Team

    Office of Environmental Management (EM)

    to protect human health, the environment and national security are maintained. Tank Waste System Tank Waste System Integrated Project Team Integrated Project Team Steve...

  18. Nucleomorph genomes: structure, function, origin and evolution

    E-Print Network [OSTI]

    Archibald, John

    Nucleomorph genomes: structure, function, origin and evolution John M. Archibald Summary and four genomes--two nuclear genomes, an endosymbiont- derived plastid genome and a mitochondrial genome derived from the host cell. Like mitochondrial and plastid genomes, the genome of the endosymbiont nucleus

  19. Genomic library construction

    DOE Patents [OSTI]

    Church, George M. (Brookline, MA); Zhang, Kun (San Diego, CA)

    2011-07-26

    Compositions and methods for amplifying nucleic acid sequences from a single cell are provided. Compositions and methods for constructing a genomic library from a single cell are also provided.

  20. Genomic definition of species

    SciTech Connect (OSTI)

    Crkvenjakov, R.; Drmanac, R.

    1991-07-01

    The subject of this paper is the definition of species based on the assumption that genome is the fundamental level for the origin and maintenance of biological diversity. For this view to be logically consistent it is necessary to assume the existence and operation of the new law which we call genome law. For this reason the genome law is included in the explanation of species phenomenon presented here even if its precise formulation and elaboration are left for the future. The intellectual underpinnings of this definition can be traced to Goldschmidt. We wish to explore some philosophical aspects of the definition of species in terms of the genome. The point of proposing the definition on these grounds is that any real advance in evolutionary theory has to be correct in both its philosophy and its science.

  1. Genome Engineering with TAL Effector Nucleases

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Genome Engineering with TAL Effector Nucleases Genome Engineering with TAL Effector Nucleases Print Tuesday, 24 April 2012 09:48 Genome engineering (GE), an emerging discipline in...

  2. Fueling the Future with Fungal Genomics

    E-Print Network [OSTI]

    Grigoriev, Igor V.

    2011-01-01

    JW. 2010. China's fungal genomics initiative: a whitepaper.and Saccharomycotina. BMC Genomics. 8, 325. Bailly J,Harnessing ectomycorrhizal genomics for ecological insights.

  3. VISTA - computational tools for comparative genomics

    E-Print Network [OSTI]

    Frazer, Kelly A.; Pachter, Lior; Poliakov, Alexander; Rubin, Edward M.; Dubchak, Inna

    2004-01-01

    tools for comparative genomics Kelly A. Frazer 1 , LiorBerkeley, CA, 94720 Genomics Division, Lawrence Berkeleymultiple comparative genomics tools and provides users with

  4. Bioinformatics and Genomics Degree Requirements Booklet

    E-Print Network [OSTI]

    dePamphilis, Claude

    Bioinformatics and Genomics Degree Requirements Booklet Fall 2011 #12;- -2 Contents Course Bioinformatics and Genomics Curriculum ------------------------------------------------------ 8 General--------------------------------------------------------------------- 14 #12;- -3 Bioinformatics and Genomics Option (BG

  5. Bioinformatics and Genomics Degree Requirements Booklet

    E-Print Network [OSTI]

    dePamphilis, Claude

    Bioinformatics and Genomics Degree Requirements Booklet Fall 2010 #12;Contents Course Requirements Bioinformatics and Genomics Curriculum -------------------------------------------------------8 General #12;Bioinformatics and Genomics Option (BG

  6. Characterization of evolutionary rates and constraints in three mammalian genomes

    SciTech Connect (OSTI)

    Cooper, Gregory M.; Brudno, Michael; Stone, Eric A.; Dubchak, Inna; Batzoglou, Serafim; Sidow, Arend

    2004-02-15

    We present an analysis of rates and patterns of microevolutionary phenomena that have shaped the human, mouse, and rat genomes since their last common ancestor. We find evidence for a shift in the mutational spectrum between the mouse and rat lineages, with the net effect being a relative increase in GC content in the rat genome. Our estimate for the neutral point substitution rate separating the two rodents is 0.196 substitutions per site, and 0.65 substitutions per site for the tree relating all three mammals. Small insertions and deletions of 1-10 bp in length (''microindels'') occur at approximately 5 percent of the point substitution rate. Inferred regional correlations in evolutionary rates between lineages and between types of sites support the idea that rates of evolution are influenced by local genomic or cell biological context. No substantial correlations between rates of point substitutions and rates of microindels are found, however, implying that the influences that affect these processes are distinct. Finally, we have identified those regions in the human genome that are evolving slowly, which are likely to include functional elements important to human biology. At least 5 percent of the human genome is under substantial constraint, most of which is noncoding.

  7. The Genome Portal of the Department of Energy Joint Genome Institute

    E-Print Network [OSTI]

    Grigoriev, Igor V.

    2014-01-01

    The Genome Portal of the Department of Energy Joint Genome 10.1093/nar/gkr947 The Genome Portal of the Department ofthe web. The JGI Genome Portal (http://genome.jgi.doe.gov)

  8. Accurate Identification of Somatic Mutations in Clinical Tumor Specimens /

    E-Print Network [OSTI]

    Yost, Shawn Eric

    2013-01-01

    genome and thus started the Human Genome Project (HGP).In 2000 the HGP released the first draft of the human genome

  9. Comparative and Functional Genomics Comp Funct Genom 2003; 4: 239245.

    E-Print Network [OSTI]

    Wurtele, Eve Syrkin

    Biology, Iowa State University, Ames IA 50011, USA 2Bioinformatics and Computational Biology Program, Iowa Encyclopedia of Genes and Genomes [9] (KEGG) (http://www.genome.ad.jp/ kegg) provide molecular networks based

  10. Computational genomics : mapping, comparison, and annotation of genomes

    E-Print Network [OSTI]

    Batzoglou, Serafim

    2000-01-01

    The field of genomics provides many challenges to computer scientists and mathematicians. The area of computational genomics has been expanding recently, and the timely application of computer science in this field is ...

  11. Comparative Analysis of Genome Sequences with VISTA

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Dubchak, Inna

    VISTA is a comprehensive suite of programs and databases developed by and hosted at the Genomics Division of Lawrence Berkeley National Laboratory. They provide information and tools designed to facilitate comparative analysis of genomic sequences. Users have two ways to interact with the suite of applications at the VISTA portal. They can submit their own sequences and alignments for analysis (VISTA servers) or examine pre-computed whole-genome alignments of different species. A key menu option is the Enhancer Browser and Database at http://enhancer.lbl.gov/. The VISTA Enhancer Browser is a central resource for experimentally validated human noncoding fragments with gene enhancer activity as assessed in transgenic mice. Most of these noncoding elements were selected for testing based on their extreme conservation with other vertebrates. The results of this enhancer screen are provided through this publicly available website. The browser also features relevant results by external contributors and a large collection of additional genome-wide conserved noncoding elements which are candidate enhancer sequences. The LBL developers invite external groups to submit computational predictions of developmental enhancers. As of 10/19/2009 the database contains information on 1109 in vivo tested elements - 508 elements with enhancer activity.

  12. The complete genome sequence of Chromobacterium violaceum reveals remarkable and exploitable

    E-Print Network [OSTI]

    Eizirik, Eduardo

    bacterial adaptability Brazilian National Genome Project Consortium* Edited by Robert Haselkorn, University in the extant areas of tropical biodiversity around the world. Its complete genome sequence reveals (i) extensive alternative pathways for energy gen- eration, (ii) 500 ORFs for transport-related proteins, (iii

  13. Katarzyna Zabrocka Genomics & Medicine

    E-Print Network [OSTI]

    Brutlag, Doug

    on because of the power struggle between its two extremes. Are we mostly human Nature & Nurture: The Role of Genetics and Environment in Human Disease scientists agree that human development is a result of the interaction between

  14. Kerstin Menne, Ulrich Hofmann Neurowissenschaftliche Datenbanken -eine Herausforderung

    E-Print Network [OSTI]

    Lübeck, Universität zu

    dem Human Genome Project, das Human Brain Project ins Leben gerufen. Das Ziel des Human Brain Project verwandt der des Human Genome Project, das 2003 auslief (http://www.ornl.gov/sci/techresourc es/Human_Genome Hauptziele des Human Genome Project die Entwicklung von Datenbanken und geeigneten Werkzeugen zur Handhabung

  15. Microbial Genomics Data from the DOE Joint Genome Institute (JGI)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    As of March 2008, The Joint Genome Institute has released 296 Prokaryotic microbial sites, with 216 in finished status.

  16. Sequencing of Seven Haloarchaeal Genomes Reveals Patterns of Genomic Flux

    E-Print Network [OSTI]

    Hammerton, James

    Sequencing of Seven Haloarchaeal Genomes Reveals Patterns of Genomic Flux Erin A. Lynch1 , Morgan G. Eisen1,3,12,13 *, Marc T. Facciotti1,3,14 * 1 Microbiology Graduate Group, University of California We report the sequencing of seven genomes from two haloarchaeal genera, Haloferax and Haloarcula

  17. Biohackers. The Politics of Open Science

    E-Print Network [OSTI]

    Delfanti, Alessandro

    2013-01-01

    the race against the Human Genome Project. His shift to opencomply with the Human Genome Project Bermuda Principles,role played by the Human Genome Project and by the Celera

  18. Molecular Mechanisms in Male Sex Determination

    E-Print Network [OSTI]

    Arboleda, Valerie Anne

    2012-01-01

    184 The Role of the Human Genome Project on Disorders of SexThe Role of the Human Genome Project on Disorders of Sexto be feasible. The Human Genome project had its roots in an

  19. Badomics words and the power and peril of the ome-meme

    E-Print Network [OSTI]

    Eisen, Jonathan A

    2012-01-01

    of the past decade: Human genome project failure. http://event-past-decade-human-genome-project-failure. 16. Wade N.SK. July 31, 2010. The Human Genome Project: 10 Years Later,

  20. What's the Use of Race? Investigating the Concept of Race in Higher Education

    E-Print Network [OSTI]

    Johnston, Marc Phillip

    2013-01-01

    i.e. , post-Human Genome Project) era. Constructivistgenomic (i.e. , post-Human Genome Project) and purportedlythe sequencing of the Human Genome Project in 2001. In the

  1. Psychology is a Developmental Science

    E-Print Network [OSTI]

    Greenberg, Gary; Partridge, Ty; Mosack, Victoria; Lambdin, Charles

    2006-01-01

    of the Brain and the Human Genome Project. Both purported toyears later and one Human Genome Project behind us, we areenormous success of the Human Genome Project—one of the most

  2. “What Dr Venter did on his holidays”: exploration, hacking, entrepreneurship in the narratives of the Sorcerer II expedition

    E-Print Network [OSTI]

    Delfanti, Alessandro; Castelfranchi, Yurij; Pitrelli, Nico

    2009-01-01

    the case of the Human Genome Project. New Genetics androle played by the Human Genome Project and by the Celerametaphors linked to the human genome project as a “treasure”

  3. Natural DNA sequencing by synthesis

    E-Print Network [OSTI]

    Roller, Eric E.

    2011-01-01

    completion of the Human Genome Project in 2004, a multitudecompletion of the Human Genome Project in 2004 1-3 . Thisgenerated from the Human Genome Project comes primarily from

  4. Phytozome: a Tool for Green Plant Comparative Genomics

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Phytozome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst green plants. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of release v4.0, Phytozome provides access to nine sequenced and annotated green plant genomes, eight of which have been clustered into gene families at six evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, TAIR, JGI are hyper-linked and searchable. [Copied from the Overview at http://www.phytozome.net/Phytozome_info.php

  5. Next-generation nematode genomes 

    E-Print Network [OSTI]

    Kumar, Sujai

    2013-06-29

    The first metazoan to be sequenced was a nematode (Caenorhabditis elegans), and understanding the genome of this model organism has led to many insights about all animals. Although eleven nematode genomes have been ...

  6. Identifying the conserved network of cis-regulatory sites of a eukaryotic genome

    E-Print Network [OSTI]

    Babu, M. Madan

    that our algorithm should be applicable to much larger genomes, such as the human genome, without reaching algorithms inferring with the regulatory sites. That strategy depends highly on the experiments, so limita- tions in experiments are propagated to the computational methods that infer motifs from the data

  7. Local chromatin structure of heterochromatin regulates repeatedDNA stability, nucleolus structure, and genome integrity

    SciTech Connect (OSTI)

    Peng, Jamy C.

    2007-05-05

    Heterochromatin constitutes a significant portion of the genome in higher eukaryotes; approximately 30% in Drosophila and human. Heterochromatin contains a high repeat DNA content and a low density of protein-encoding genes. In contrast, euchromatin is composed mostly of unique sequences and contains the majority of single-copy genes. Genetic and cytological studies demonstrated that heterochromatin exhibits regulatory roles in chromosome organization, centromere function and telomere protection. As an epigenetically regulated structure, heterochromatin formation is not defined by any DNA sequence consensus. Heterochromatin is characterized by its association with nucleosomes containing methylated-lysine 9 of histone H3 (H3K9me), heterochromatin protein 1 (HP1) that binds H3K9me, and Su(var)3-9, which methylates H3K9 and binds HP1. Heterochromatin formation and functions are influenced by HP1, Su(var)3-9, and the RNA interference (RNAi) pathway. My thesis project investigates how heterochromatin formation and function impact nuclear architecture, repeated DNA organization, and genome stability in Drosophila melanogaster. H3K9me-based chromatin reduces extrachromosomal DNA formation; most likely by restricting the access of repair machineries to repeated DNAs. Reducing extrachromosomal ribosomal DNA stabilizes rDNA repeats and the nucleolus structure. H3K9me-based chromatin also inhibits DNA damage in heterochromatin. Cells with compromised heterochromatin structure, due to Su(var)3-9 or dcr-2 (a component of the RNAi pathway) mutations, display severe DNA damage in heterochromatin compared to wild type. In these mutant cells, accumulated DNA damage leads to chromosomal defects such as translocations, defective DNA repair response, and activation of the G2-M DNA repair and mitotic checkpoints that ensure cellular and animal viability. My thesis research suggests that DNA replication, repair, and recombination mechanisms in heterochromatin differ from those in euchromatin. Remarkably, human euchromatin and fly heterochromatin share similar features; such as repeated DNA content, intron lengths and open reading frame sizes. Human cells likely stabilize their DNA content via mechanisms and factors similar to those in Drosophila heterochromatin. Furthermore, my thesis work raises implications for H3K9me and chromatin functions in complex-DNA genome stability, repeated DNA homogenization by molecular drive, and in genome reorganization through evolution.

  8. Genomics and Systems Biology

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFESOpportunities NuclearlongGeneral Tables The GeneralGenomeGenomics

  9. Comparative Genomics of Mycobacterium Tuberculosis

    E-Print Network [OSTI]

    Brutlag, Doug

    Comparative Genomics of Mycobacterium Tuberculosis #12;My Questions · What is TB ­ What in the literature. · Emphasize that genomics techniques are not limited to hereditary diseases. #12;Methods · Deciphering the biology of Mycobacterium Tuberculosis from the complete genome sequence, Stuart Cole et al

  10. SHORT REVIEW Butterfly genomics eclosing

    E-Print Network [OSTI]

    Beldade, Patrícia

    SHORT REVIEW Butterfly genomics eclosing P Beldade1 , WO McMillan2 and A Papanicolaou3 1 Section to an explosion of genomic data and the emergence of new research avenues. Evolutionary and ecological functional genomics, with its focus on the genes that affect ecological success and adaptation in natural populations

  11. 2012 U.S. Department of Energy: Joint Genome Institute: Progress Report

    SciTech Connect (OSTI)

    Gilbert, David

    2013-01-01

    The mission of the U.S. Department of Energy Joint Genome Institute (DOE JGI) is to serve the diverse scientific community as a user facility, enabling the application of large-scale genomics and analysis of plants, microbes, and communities of microbes to address the DOE mission goals in bioenergy and the environment. The DOE JGI's sequencing efforts fall under the Eukaryote Super Program, which includes the Plant and Fungal Genomics Programs; and the Prokaryote Super Program, which includes the Microbial Genomics and Metagenomics Programs. In 2012, several projects made news for their contributions to energy and environment research.

  12. Complete genome sequence of Sanguibacter keddieii type strain (ST-74T)

    SciTech Connect (OSTI)

    Ivanova, Natalia; Sikorski, Johannes; Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Pati, Amrita; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D'haeseleer, Patrik; Chain, Patrick; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Goker, Markus; Pukall, Rudiger; Klenk, Hans-Peter; Kyrpides, Nikos

    2009-05-20

    Sanguibacter keddieii is the type species of the genus Sanguibacter, the only described genus within the family of Sanguibacteraceae. Phylogenetically, this family is located in the neighbourhood of the genus Oerskovia and the family Cellulomonadaceae within the actinobacterial suborder Micrococcineae. The strain described in this report was isolated from blood of apparently healthy cows. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the family Sanguibacteraceae, and the 4,253,413 bp long single replicon genome with its 3735 protein-coding and 70 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  13. 10.1101/gr.088336.108Access the most recent version at doi: 2009 19: 838-849 originally published online March 11, 2009Genome Res.

    E-Print Network [OSTI]

    Nielsen, Rasmus

    online March 11, 2009Genome Res. Rasmus Nielsen, Melissa J. Hubisz, Ines Hellmann, et al. genes Darwinian and demographic forces affecting human protein coding Material Supplemental http://genome.cshlp.org/content/suppl/2009/04/03/gr.088336.108.DC1.html References http://genome.cshlp.org/content/19/5/838.full

  14. Genome Medicine 2009, 11

    E-Print Network [OSTI]

    Dehene, Frank

    Genome Medicine 2009, 11::88 Correspondence BBrriiddggiinngg tthhee ggaapp bbeettwweeeenn Care Medicine and CRISMA laboratory, University of Pittsburgh School of Medicine, Scaife 602, 3550 Biotechnology Center, University of Torino, Via Nizza 52, I, 10126 Torino, Italy; 10Institutionen för Medicin

  15. GeneJax: A Prototype CAD tool in support of Genome Refactoring

    E-Print Network [OSTI]

    Anand, Ishan

    2006-05-26

    Refactoring is a technique used by computer scientists for improving program design. The Endy Laboratory has adapted this process to make the genomes of biological organisms more amenable to human understanding and design ...

  16. Mining data from 1000 genomes to identify the causal variant in regions under positive selection

    E-Print Network [OSTI]

    Grossman, Sharon Rachel

    The human genome contains hundreds of regions in which the patterns of genetic variation indicate recent positive natural selection, yet for most of these the underlying gene and the advantageous mutation remain unknown. ...

  17. Array CGH and Computational Genome Annotation in Constitutional Cytogenetics: Suggesting Candidate

    E-Print Network [OSTI]

    , Katholieke Universiteit Leuven, Kasteelpark Arenberg 10, B-3001 Heverlee, Belgium, 2 Center for Human; molecular diagnostics; array CGH; data mining; genotype-phenotype correlation Abstract Genome wide array CGH

  18. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  19. Connecting Genomic Alterations to Cancer Biology with Proteomics: The NCI Clinical Proteomic Tumor Analysis Consortium

    SciTech Connect (OSTI)

    Ellis, Matthew; Gillette, Michael; Carr, Steven A.; Paulovich, Amanda G.; Smith, Richard D.; Rodland, Karin D.; Townsend, Reid; Kinsinger, Christopher; Mesri, Mehdi; Rodriguez, Henry; Liebler, Daniel

    2013-10-03

    The National Cancer Institute (NCI) Clinical Proteomic Tumor Analysis Consortium is applying the latest generation of proteomic technologies to genomically annotated tumors from The Cancer Genome Atlas (TCGA) program, a joint initiative of the NCI and the National Human Genome Research Institute. By providing a fully integrated accounting of DNA, RNA, and protein abnormalities in individual tumors, these datasets will illuminate the complex relationship between genomic abnormalities and cancer phenotypes, thus producing biologic insights as well as a wave of novel candidate biomarkers and therapeutic targets amenable to verifi cation using targeted mass spectrometry methods.

  20. Coral Reef Genomics: Developing tools for functional genomics of coral symbiosis

    E-Print Network [OSTI]

    Schwarz, Jodi; Brokstein, Peter; Manohar, Chitra; Coffroth, Mary Alice; Szmant, Alina; Medina, Monica

    2008-01-01

    Coral Reef Genomics: Developing toolsfor functional genomics of coral symbiosis Jodi SCHWARZ 1 ,symbiosis functional genomics cDNA microarray ABSTRACT

  1. Navigating protected genomics data with UCSC Genome Browser in a Box.

    E-Print Network [OSTI]

    2014-01-01

    H. et al. (2013) Integrative Genomics Viewer (IGV):High-performance genomics data visualization andbrowsers for comparative genomics. Bioinformatics. In press.

  2. Communicating results in post-Belmont era biomonitoring studies: Lessons from genetics and neuroimaging research

    E-Print Network [OSTI]

    Morello-Frosch, Rachel; Varshavsky, Julia; Liboiron, Max; Brown, Phil; Brody, Julia G

    2015-01-01

    In the 1990s, the Human Genome Project sequenced a compositeJ. , 2001. The human genome diversity project a case study

  3. What is Bioinformatics?What is Bioinformatics? Mark Boguski, M.D., Ph.D.

    E-Print Network [OSTI]

    Boguski, Mark S.

    #12;The Accelerating Human Genome ProjectThe Accelerating Human Genome Project Nature (September, 1998 1970 1975 1980 1985 1990 1995 2001 Human Genome Project begun National Library of Medicine Rapid DNA Publications DNA sequences DNA Sequencing Invented Human Genome Project Begun The Gap Science (Genome Issue) 15

  4. Computational methods and analyses in comparative genomics and epigenomics

    E-Print Network [OSTI]

    Peng, Qian

    2012-01-01

    promise of comparative genomics in mammals. Science, 286,homology relationships. Genomics, Dehal, P. and Boore, J.to plant comparative genomics. Genome Research, 13(5), 999–

  5. Salt Stress in Desulfovibrio vulgaris Hildenborough: An integrated genomics approach

    E-Print Network [OSTI]

    Mukhopadhyay, Aindrila

    2010-01-01

    2002. Integrating cancer genomics and proteomics in theWeb site for comparative genomics. Genome Res 15:1015-22.Hildenborough: An integrated genomics approach. Aindrila

  6. International Journal of Software Engineering and Knowledge Engineering

    E-Print Network [OSTI]

    Cho, Sung-Bae

    ; ensemble classifier. 1. Introduction The need for whole genome study such as the Human Genomic Project (HGP

  7. POSTDOCTORAL POSITION IN BIOINFORMATICS AND EVOLUTIONARY GENOMICS: Next generation sequencing and analysis of complex polyploid genomes

    E-Print Network [OSTI]

    Rennes, Université de

    POSTDOCTORAL POSITION IN BIOINFORMATICS AND EVOLUTIONARY GENOMICS: Next generation sequencing and analysis of complex polyploid genomes The research group Genome Evolution and Speciation (Team) to work on the analysis of genome and transcriptome sequence data (generated using 454 Roche

  8. Population genomics: Whole-genome analysis of polymorphism and divergence in Drosophila simulans

    E-Print Network [OSTI]

    2007-01-01

    PLoS BIOLOGY Population Genomics: Whole-Genome Analysis ofwww.plosbiology.org Population Genomics of D. simulans Table11 | e310 Population Genomics of D. simulans Table S15. GO

  9. GIS: a web-based genomics information system for efficiently manipulating and accessing genome physical maps 

    E-Print Network [OSTI]

    Chen, Huaming

    2000-01-01

    Biological science has entered the genome era. Global genome integrative physical and genetic mapping promises to revolutionize modern genomics research. To facilitate manipulation and applications of the results from genomics research, many...

  10. A Novel Approach for Comparative Genomics

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A Novel Approach for Comparative Genomics & Annotation Transfer Alban MANCHERON Raluca URICARU Eric is genome comparison good for?" Genome comparison is crucial for genome annotation, regulatory motifs identification, and vaccine design aims at finding genomic regions either specific to or in one

  11. Genome: Unlocking Life's Code for Teachers of

    E-Print Network [OSTI]

    Miller, Scott

    GENOME CODE LIFE'S UNLOCKING Genome: Unlocking Life's Code Educator's Guide for Teachers of Grades Glossary 30 Other Resources 32 What the Exhibit Offers Genomics--the study of the entire genome. It is important that students understand what genomics is and what it teaches us about ourselves and the rest

  12. Original article Neisseria Base: a comparative genomics

    E-Print Network [OSTI]

    Jordan, King

    Original article Neisseria Base: a comparative genomics database for Neisseria meningitidis Lee S, septicemia and in some cases pneumonia. Genomic studies hold great promise for N. meningitidis research genomics database and genome browser that houses and displays publicly available N. meningitidis genomes

  13. LATERAL GENE TRANSFER AND THE HISTORY OF BACTERIAL GENOMES

    SciTech Connect (OSTI)

    Howard Ochman

    2006-02-22

    The aims of this research were to elucidate the role and extent of lateral transfer in the differentiation of bacterial strains and species, and to assess the impact of gene transfer on the evolution of bacterial genomes. The ultimate goal of the project is to examine the dynamics of a core set of protein-coding genes (i.e., those that are distributed universally among Bacteria) by developing conserved primers that would allow their amplification and sequencing in any bacterial taxa. In addition, we adopted a bioinformatic approach to elucidate the extent of lateral gene transfer in sequenced genome.

  14. Computational Molecular Biology Biochem 218 BioMedical Informatics 231

    E-Print Network [OSTI]

    .edu/ Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy) The Human Genome Project #12 Gibson & Muse, A Primer of Genome Science http://www.sinauer.com/genomics/ #12;The Human Genome Project?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=3294162 #12;Public Genome Assembly Process #12;BAC and PAC Libraries in Public Human Genome Project http

  15. A study of the necessary and optimal conditions for success in the most challenging human endeavors : modem day Manhattan Projects are needed for overcoming contemporary global challenges

    E-Print Network [OSTI]

    Chowdhury, Anando A

    2012-01-01

    It is possible to categorize four contemporary challenges as the greatest threats to global well-being and the persistence of humankind. These challenges are global climate and ecological change, poor human health management, ...

  16. Genomic Sciences | Clean Energy | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to clean energy and environmental applications. Multidisciplinary genomic science research and communication resources at ORNL include the following: Plant Systems Biology...

  17. ORISE: Human Subjects Research Database

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in support of the HSRD database: Database maintenance Federal Internet server access Software development Quality assurancequality control Project assistance Human Subjects...

  18. Tissue sampling and standards for vertebrate genomics

    E-Print Network [OSTI]

    2012-01-01

    and standards for vertebrate genomics. GigaScience 2012 1:8.transition to conservation genomics. TIG 2010, 26:177–187.Siemens DH: Ecological genomics––changing perspectives on

  19. Evolutionary Genomics of Salmonella enterica Subspecies

    E-Print Network [OSTI]

    2013-01-01

    M. 2002. Evolutionary genomics of Salmonella: genesubsystems technology. BMC Genomics 9:75. 23. Ochman H,Salmonella enterica. BMC Genomics 12:425. PubMed. 29. Falush

  20. Trichoderma: the genomics of opportunistic success

    E-Print Network [OSTI]

    Druzhinina, Irina S.

    2011-01-01

    of a fungal prey. BMC Genomics 10, 567 (2009). This studythe TrichoEST functional genomics approach. Curr. Genet. 51,in Hypocrea jecorina. BMC Genomics. 9, 430 (2008) Mukherjee,

  1. 10.1101/gr.2227704Access the most recent version at doi: 2004 14: 1014-1024Genome Res.

    E-Print Network [OSTI]

    Schnaufer, Achim

    School of Pathology, University of Oxford, Oxford, OX1 3RE, United Kingdom; 2 School of Biological Sciences, University of Manchester, Manchester, M13 9PT, United Kingdom Most eukaryotic genomes contain, but remain largely absent from genome projects because of difficulties in cloning and sequence assembly

  2. Comparative Genome Structure, Secondary Metabolite, and Effector...

    Office of Scientific and Technical Information (OSTI)

    Genome Structure, Secondary Metabolite, and Effector Coding Capacity across Cochliobolus Pathogens Citation Details In-Document Search Title: Comparative Genome Structure,...

  3. Implications of structural genomics target selection strategies...

    Office of Scientific and Technical Information (OSTI)

    Implications of structural genomics target selection strategies: Pfam5000, whole genome, and random approaches Citation Details In-Document Search Title: Implications of structural...

  4. he dawning of a new decade is an appropriate time to reflect on the tremendous progress that has been

    E-Print Network [OSTI]

    Hoehe, Margret

    decade, when the publica- tion of the Human Genome Project's first draft results was still pending. 47 B genomes in progress: from the Human Genome Project to the Personal Genome Project Jeantine E. Lunshof, Ph Clin Neurosci. 2010;12:47-60. #12;When the Human Genome Project published its draft results on June 26

  5. MOJ Proteomics Bioinform 2014, 1(4): 00023Submit Manuscript | http://medcraveonline.com MOJ Proteomics & Bioinformatics

    E-Print Network [OSTI]

    Brooks, W. Randy

    of the human genome project, academia, government funding agencies and industry have focused on the disease dimension in the human genome project and is likely to hold surprises. Similar to the Thousand Genome with the experience that has been gained from the genome project. The completion of the human genome project was made

  6. he dawning of a new decade is an appropriate time to reflect on the tremendous progress that has been

    E-Print Network [OSTI]

    Church, George M.

    decade, when the publica- tion of the Human Genome Project's first draft results was still pending. B genomes in progress: from the Human Genome Project to the Personal Genome Project Jeantine E. Lunshof, Ph Clin Neurosci. 2010;12:47-60. #12;When the Human Genome Project published its draft results on June 26

  7. ISHI 2013 ENCODE Panel Discussion Reference List ENCODE Project

    E-Print Network [OSTI]

    . (2012). An integrated encyclopedia of DNA elements in the human genome. Nature, 489, 57-74. Response Press). Chapter 9. Biology and genetics of new autosomal STR loci useful for forensic DNA analysis, pp

  8. Complete genome sequence of Catenulispora acidiphila type strain (ID 139908T)

    SciTech Connect (OSTI)

    Copeland, Alex; Lapidus, Alla; Rio, Tijana GlavinaDel; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chertkov, Olga; Brettin, Thomas; Detter, John C.; Han, Cliff; Ali, Zahid; Tindall, Brian J.; Goker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Catenulispora acidiphila Busti et al. 2006 is the type species of the genus Catenulispora, and is of interest because of the rather isolated phylogenetic location of the genomically little studied suborder Catenulisporineae within the order Actinomycetales. C. acidiphilia is known for its acidophilic, aerobic lifestyle, but can also grow scantly under anaerobic conditions. Under regular conditions C. acidiphilia grows in long filaments of relatively short aerial hyphae with marked septation. It is a free living, non motile, Gram-positive bacterium isolated from a forest soil sample taken from a wooded area in Gerenzano, Italy. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the actinobacterial family Catenulisporaceae, and the 10,467,782 bp long single replicon genome with its 9056 protein-coding and 69 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. Complete genome sequence of Coraliomargarita akajimensis type strain (04OKA010-24T)

    SciTech Connect (OSTI)

    Mavromatis, Konstantinos; Abt, Birte; Brambilla, Evelyne; Lapidus, Alla; Copeland, Alex; Desphande, Shweta; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Han, Cliff; Detter, John C.; Woyke, Tanja; Goodwin, Lynne; Pitluck, Sam; Held, Brittany; Brettin, Thomas; Tapia, Roxanne; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Liolios, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Rohde, Manfred; Gö ker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C.

    2010-06-25

    Coraliomargarita akajimensis Yoon et al. 2007 the type species of the genus Coraliomargarita. C. akajimensis is an obligately aerobic, Gram-negative, non-spore-forming, non-motile, spherical bacterium which was isolated from seawater surrounding the hard coral Galaxea fascicularis. C. akajimensis organism is of special interest because of its phylogenetic position in a genomically purely studied area in the bacterial diversity. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the family Puniceicoccaceae. The 3,750,771 bp long genome with its 3,137 protein-coding and 55 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  10. Large-Scale Sequencing: The Future of Genomic Sciences Colloquium

    SciTech Connect (OSTI)

    Margaret Riley; Merry Buckley

    2009-01-01

    Genetic sequencing and the various molecular techniques it has enabled have revolutionized the field of microbiology. Examining and comparing the genetic sequences borne by microbes - including bacteria, archaea, viruses, and microbial eukaryotes - provides researchers insights into the processes microbes carry out, their pathogenic traits, and new ways to use microorganisms in medicine and manufacturing. Until recently, sequencing entire microbial genomes has been laborious and expensive, and the decision to sequence the genome of an organism was made on a case-by-case basis by individual researchers and funding agencies. Now, thanks to new technologies, the cost and effort of sequencing is within reach for even the smallest facilities, and the ability to sequence the genomes of a significant fraction of microbial life may be possible. The availability of numerous microbial genomes will enable unprecedented insights into microbial evolution, function, and physiology. However, the current ad hoc approach to gathering sequence data has resulted in an unbalanced and highly biased sampling of microbial diversity. A well-coordinated, large-scale effort to target the breadth and depth of microbial diversity would result in the greatest impact. The American Academy of Microbiology convened a colloquium to discuss the scientific benefits of engaging in a large-scale, taxonomically-based sequencing project. A group of individuals with expertise in microbiology, genomics, informatics, ecology, and evolution deliberated on the issues inherent in such an effort and generated a set of specific recommendations for how best to proceed. The vast majority of microbes are presently uncultured and, thus, pose significant challenges to such a taxonomically-based approach to sampling genome diversity. However, we have yet to even scratch the surface of the genomic diversity among cultured microbes. A coordinated sequencing effort of cultured organisms is an appropriate place to begin, since not only are their genomes available, but they are also accompanied by data on environment and physiology that can be used to understand the resulting data. As single cell isolation methods improve, there should be a shift toward incorporating uncultured organisms and communities into this effort. Efforts to sequence cultivated isolates should target characterized isolates from culture collections for which biochemical data are available, as well as other cultures of lasting value from personal collections. The genomes of type strains should be among the first targets for sequencing, but creative culture methods, novel cell isolation, and sorting methods would all be helpful in obtaining organisms we have not yet been able to cultivate for sequencing. The data that should be provided for strains targeted for sequencing will depend on the phylogenetic context of the organism and the amount of information available about its nearest relatives. Annotation is an important part of transforming genome sequences into useful resources, but it represents the most significant bottleneck to the field of comparative genomics right now and must be addressed. Furthermore, there is a need for more consistency in both annotation and achieving annotation data. As new annotation tools become available over time, re-annotation of genomes should be implemented, taking advantage of advancements in annotation techniques in order to capitalize on the genome sequences and increase both the societal and scientific benefit of genomics work. Given the proper resources, the knowledge and ability exist to be able to select model systems, some simple, some less so, and dissect them so that we may understand the processes and interactions at work in them. Colloquium participants suggest a five-pronged, coordinated initiative to exhaustively describe six different microbial ecosystems, designed to describe all the gene diversity, across genomes. In this effort, sequencing should be complemented by other experimental data, particularly transcriptomics and metabolomics data, all of which

  11. Project Year Project Team

    E-Print Network [OSTI]

    Gray, Jeffrey J.

    & Sciences Project Title Visualize Physical Principles with Virtual Lab Modules Audience Undergraduate provide easy access to digital information, but don't provide experience with right- hand screws, electric of the last generation of physics students. The result is that today's students don't have an intuitive

  12. Project Year Project Title

    E-Print Network [OSTI]

    Gray, Jeffrey J.

    . Pedagogical Issue One of the challenges in teaching the Introduction to Computer Music course is the lack flow and practices. These resources will provide an online space through which students will be able piece of this project will be an animated studio walkthrough requiring user interaction and providing

  13. SJSU RESEARCH FOUNDATION Project Administration Guide

    E-Print Network [OSTI]

    Su, Xiao

    SJSU RESEARCH FOUNDATION Project Administration Guide SJSU Research Foundation Project Administration Guide June 20111 #12;SJSU RESEARCH FOUNDATION Project Administration Guide June 20112 Table SUBMISSION 7 · III. POST-AWARD SERVICES AND PROJECT ADMINISTRATION 9 · IV. TRAVEL 29 · V. HUMAN RESOURCES 35

  14. Hindawi Publishing Corporation Comparative and Functional Genomics

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    Hindawi Publishing Corporation Comparative and Functional Genomics Volume 2007, Article ID 47304, 7 pages doi:10.1155/2007/47304 Meeting Report eGenomics: Cataloguing Our Complete Genome Collection III, Michigan State University, East Lansing, MI 48824, USA 3 The Institute for Genomic Research, 9712 Medical

  15. Genome Biology 2004, 5:R56 commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation

    E-Print Network [OSTI]

    . Although various genomic datasets are rele-vant to this issue, each dataset provides relatively weak

  16. A Million Cancer Genome Warehouse David Haussler

    E-Print Network [OSTI]

    McAuliffe, Jon

    Warehouse Regional Warehouses Design and Cost to Build and Operate a Million Cancer Genome Warehouse CAPEX

  17. Doug Brutlag 2015 Genomics, Bioinformatics & Medicine

    E-Print Network [OSTI]

    Brutlag, Doug

    in -Amylase Gene Tandem Repeat Arrays Sharp, Cheng & Eichler, Annu. Rev. Genomics Hum. Genet. 2006. 7

  18. A Statistical Framework for Spatial Comparative Genomics

    E-Print Network [OSTI]

    A Statistical Framework for Spatial Comparative Genomics Rose Hoberman May 2007 CMU-CS-07, or the U.S. Government. #12;Keywords: spatial comparative genomics, comparative genomics, gene clusters, max-gap clusters, gene teams, whole genome duplication, paralogons, synteny, ortholog detection #12

  19. SHORT REVIEW Ecological genomics: understanding gene and

    E-Print Network [OSTI]

    Herman, Mike

    SHORT REVIEW Ecological genomics: understanding gene and genome function in the natural environment MC Ungerer, LC Johnson and MA Herman Division of Biology, Ecological Genomics Institute, Kansas State University, Manhattan, KS, USA The field of ecological genomics seeks to understand the genetic mechanisms

  20. Genomic Aspects of Research Involving Polyploid Plants

    SciTech Connect (OSTI)

    Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tschaplinski, Timothy J [ORNL; Wullschleger, Stan D [ORNL; Tuskan, Gerald A [ORNL

    2011-01-01

    Almost all extant plant species have spontaneously doubled their genomes at least once in their evolutionary histories, resulting in polyploidy which provided a rich genomic resource for evolutionary processes. Moreover, superior polyploid clones have been created during the process of crop domestication. Polyploid plants generated by evolutionary processes and/or crop domestication have been the intentional or serendipitous focus of research dealing with the dynamics and consequences of genome evolution. One of the new trends in genomics research is to create synthetic polyploid plants which provide materials for studying the initial genomic changes/responses immediately after polyploid formation. Polyploid plants are also used in functional genomics research to study gene expression in a complex genomic background. In this review, we summarize the recent progress in genomics research involving ancient, young, and synthetic polyploid plants, with a focus on genome size evolution, genomics diversity, genomic rearrangement, genetic and epigenetic changes in duplicated genes, gene discovery, and comparative genomics. Implications on plant sciences including evolution, functional genomics, and plant breeding are presented. It is anticipated that polyploids will be a regular subject of genomics research in the foreseeable future as the rapid advances in DNA sequencing technology create unprecedented opportunities for discovering and monitoring genomic and transcriptomic changes in polyploid plants. The fast accumulation of knowledge on polyploid formation, maintenance, and divergence at whole-genome and subgenome levels will not only help plant biologists understand how plants have evolved and diversified, but also assist plant breeders in designing new strategies for crop improvement.

  1. Genomics and ornithology Scott V. Edwards

    E-Print Network [OSTI]

    Edwards, Scott

    REVIEW Genomics and ornithology Scott V. Edwards Received: 23 September 2007 / Accepted: 27 Genomics is revolutionizing ornithology in the same ways it is reinvigorating other biological disciplines. In this review, I will highlight applications of genomics and genomics technologies to the study of the ecology

  2. Assignment of Orthologous Genes via Genome Rearrangement

    E-Print Network [OSTI]

    Lonardi, Stefano

    Assignment of Orthologous Genes via Genome Rearrangement Xin Chen, Jie Zheng, Zheng Fu, Peng Nan of genomes is a fundamental and challenging problem in comparative genomics. Existing methods that assign sequence similarity and evolutionary events at a genome level, where orthologous genes are assumed

  3. Pseudo Boolean Programming for Partially Ordered Genomes

    E-Print Network [OSTI]

    Fertin, Guillaume

    Pseudo Boolean Programming for Partially Ordered Genomes Sébastien Angibaud1 , Guillaume Fertin1.Angibaud,Guillaume.Fertin}@univ-nantes.fr, thevenin@lri.fr, vialette@univ-mlv.fr Abstract. Comparing genomes of different species is a crucial problem in comparative genomics. Different measures have been proposed to com- pare two genomes: number of common

  4. Chapter 14: Genome Assembly and Annotation Process Annotation of other genomes

    E-Print Network [OSTI]

    Levin, Judith G.

    Chapter 14: Genome Assembly and Annotation Process Paul Kitts Summary Box 1 Annotation of other genomes NCBI may assemble a genome prior to annotation, add annotations to a genome assembled elsewhere, or simply process an annotated genome to produce RefSeqs and maps for display in Map Viewer (Chapter 20

  5. Genomics and vertebrate adaptive radiation: a celebration of the first cichlid genome

    E-Print Network [OSTI]

    Renn, Susan C.P.

    Genomics and vertebrate adaptive radiation: a celebration of the first cichlid genome C. Darrin ``Genomics and Vertebrate Adaptive Radiation: A Celebration of the First Cichlid Genome'' was held the central topic was the genomics of adaptive radiation in cichlid fishes, the symposium integrated speakers

  6. Methods in comparative genomics: genome correspondence, gene identification and motif discovery

    E-Print Network [OSTI]

    Kellis, Manolis

    1 Methods in comparative genomics: genome correspondence, gene identification and motif discovery@mit.edu, nickp@genome.wi.mit.edu, bwb@genome.wi.mit.edu, bab@mit.edu, lander@wi.mit.edu (1) MIT/Whitehead Institute Center for Genome Research, 320 Charles St., Cambridge MA 02139 (2) MIT Computer Science

  7. Growth Temperature and Genome Size in Bacteria Are Negatively Correlated, Suggesting Genomic Streamlining

    E-Print Network [OSTI]

    Wagner, Andreas

    Growth Temperature and Genome Size in Bacteria Are Negatively Correlated, Suggesting Genomic.wagner@ieu.uzh.ch; nsabath@gmail.com. Accepted: March 25, 2013 Abstract Prokaryotic genomes are small and compact. Either this feature is caused by neutral evolution or by natural selection favoring small genomes--genome streamlining

  8. Challenges in Whole-Genome Annotation of Pyrosequenced Eukaryotic Genomes

    SciTech Connect (OSTI)

    Kuo, Alan; Grigoriev, Igor

    2009-04-17

    Pyrosequencing technologies such as 454/Roche and Solexa/Illumina vastly lower the cost of nucleotide sequencing compared to the traditional Sanger method, and thus promise to greatly expand the number of sequenced eukaryotic genomes. However, the new technologies also bring new challenges such as shorter reads and new kinds and higher rates of sequencing errors, which complicate genome assembly and gene prediction. At JGI we are deploying 454 technology for the sequencing and assembly of ever-larger eukaryotic genomes. Here we describe our first whole-genome annotation of a purely 454-sequenced fungal genome that is larger than a yeast (>30 Mbp). The pezizomycotine (filamentous ascomycote) Aspergillus carbonarius belongs to the Aspergillus section Nigri species complex, members of which are significant as platforms for bioenergy and bioindustrial technology, as members of soil microbial communities and players in the global carbon cycle, and as agricultural toxigens. Application of a modified version of the standard JGI Annotation Pipeline has so far predicted ~;;10k genes. ~;;12percent of these preliminary annotations suffer a potential frameshift error, which is somewhat higher than the ~;;9percent rate in the Sanger-sequenced and conventionally assembled and annotated genome of fellow Aspergillus section Nigri member A. niger. Also,>90percent of A. niger genes have potential homologs in the A. carbonarius preliminary annotation. Weconclude, and with further annotation and comparative analysis expect to confirm, that 454 sequencing strategies provide a promising substrate for annotation of modestly sized eukaryotic genomes. We will also present results of annotation of a number of other pyrosequenced fungal genomes of bioenergy interest.

  9. Gold nanoparticles: A Novel Application of Spectral Imaging in Proteomics -Preliminary Results

    E-Print Network [OSTI]

    van Vliet, Lucas J.

    . INTRODUCTION In 2003 the Human Genome Project (HGP) was finally announced to be finished. The goal

  10. BioMed Central Page 1 of 12

    E-Print Network [OSTI]

    Jiang,Tianzi

    and treatment. Background With the successful completion of the Human Genome Project (HGP), we are entering

  11. Machine Learning in DNA Microarray Analysis for Cancer Classification

    E-Print Network [OSTI]

    Cho, Sung-Bae

    such as Human Genomic Project (HGP) is recently increasing because fragmentary knowledge about life phenomenon

  12. Genome-Wide Identification and 3D Modeling of Proteins involved in DNA Damage Recognition and Repair (Final Report)

    SciTech Connect (OSTI)

    Ruben A. Abagyan, PhD

    2004-04-15

    OAK-B135 DNA Damage Recognition and Repair (DDR and R) proteins play a critical role in cellular responses to low-dose radiation and are associated with cancer. the authors have performed a systematic, genome-wide computational analysis of genomic data for human genes involved in the DDR and R process. The significant achievements of this project include: (1) Construction of the computational pipeline for searching DDR and R genes, building and validation of 3D models of proteins involved in DDR and R; (2) Functional and structural annotation of the 3D models and generation of comprehensive lists of suggested knock-out mutations; (3) Important improvement of macromolecular docking technology and its application to predict the DNA-Protein complex conformation; (4) Development of a new algorithm for improved analysis of high-density oligonucleotide arrays for gene expression profiling; (5) Construction and maintenance of the DNA Damage Recognition and Repair Database; and (6) Producing 14 research papers (10 published and 4 in preparation).

  13. Genome-Wide Identification and 3D Modeling of Proteins involved in DNA Damage Recognition and Repair (Final Report)

    SciTech Connect (OSTI)

    Abagyan, Ruben; An, Jianghong

    2005-08-12

    DNA Damage Recognition and Repair (DDR&R) proteins play a critical role in cellular responses to low-dose radiation and are associated with cancer. We have performed a systematic, genome-wide computational analysis of genomic data for human genes involved in the DDR&R process. The significant achievements of this project include: 1) Construction of the computational pipeline for searching DDR&R genes, building and validation of 3D models of proteins involved in DDR&R; 2) Functional and structural annotation of the 3D models and generation of comprehensive lists of suggested knock-out mutations; and the development of a method to predict the effects of mutations. Large scale testing of technology to identify novel small binding pockets in protein structures leading to new DDRR inhibitor strategies 3) Improvements of macromolecular docking technology (see the CAPRI 1-3 and 4-5 results) 4) Development of a new algorithm for improved analysis of high-density oligonucleotide arrays for gene expression profiling; 5) Construction and maintenance of the DNA Damage Recognition and Repair Database; 6) Producing 15 research papers (12 published and 3 in preparation).

  14. Synthetic Genomics: Options for Governance

    E-Print Network [OSTI]

    Garfinkel, Michele

    2007-10-17

    Gene and genome synthesis, that is, constructing long stretches of DNA from constituent chemicals, provides scientists with new and unparalleled capabilities both for understanding biology and for using it for beneficial ...

  15. Genomic neighbourhood and the regulation of gene expression Genomic neighbourhood and transcriptional regulation

    E-Print Network [OSTI]

    Babu, M. Madan

    Genomic neighbourhood and the regulation of gene expression Genomic neighbourhood and transcriptional regulation Subhajyoti De and M. Madan Babu MRC Laboratory of Molecular Biology, Hills Road..................................................................................................................................................................................1 2. Genomic neighbourhood and its influence on gene regulation

  16. Implications of structural genomics target selection strategies: Pfam5000, whole genome, and random approaches

    E-Print Network [OSTI]

    Chandonia, John-Marc; Brenner, Steven E.

    2004-01-01

    SK, Bonanno JB. Structural genomics. Methods Biochem AnalMizuguchi K. Structural genomics: an overview. Prog BiophysSE. A tour of structural genomics. Nat Rev Genet 2001;2(10):

  17. Project Controls

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-03-28

    Project controls are systems used to plan, schedule, budget, and measure the performance of a project/program. The cost estimation package is one of the documents that is used to establish the baseline for project controls. This chapter gives a brief description of project controls and the role the cost estimation package plays.

  18. Comparative genomics reveals diversity among xanthomonads infecting tomato and pepper

    E-Print Network [OSTI]

    2011-01-01

    Potnis et al. : Comparative genomics reveals diversity amongtomato and pepper. BMC Genomics Submit your next manuscriptpv. syringae Potnis et al. BMC Genomics 2011, 12:146 http://

  19. Incorporating Genomics and Bioinformatics across the Life Sciences Curriculum

    E-Print Network [OSTI]

    Ditty, Jayna L.

    2012-01-01

    Page Incorporating Genomics and Bioinformatics across the2007) Discovering Genomics, Proteomics, and Bioinformatics,2003) Public access for teaching genomics, proteomics, and

  20. TOPSAN: a collaborative annotation environment for structural genomics.

    E-Print Network [OSTI]

    Weekes, Dana; Krishna, S; Bakolitsa, Constantina; Wilson, Ian A; Godzik, Adam; Wooley, John

    2010-01-01

    environment for structural genomics Dana Weekes 1† , S Srihigh-throughput structural genomics centers, despite theirbeing determined by structural genomics centers and high-