Sample records for human cortical bone

  1. Aging and Fracture of Human Cortical Bone and Tooth Dentin

    SciTech Connect (OSTI)

    Ager, Joel; Koester, Kurt J.; Ager III, Joel W.; Ritchie, Robert O.

    2008-05-07T23:59:59.000Z

    Mineralized tissues, such as bone and tooth dentin, serve as structural materials in the human body and, as such, have evolved to resist fracture. In assessing their quantitative fracture resistance or toughness, it is important to distinguish between intrinsic toughening mechanisms which function ahead of the crack tip, such as plasticity in metals, and extrinsic mechanisms which function primarily behind the tip, such as crack bridging in ceramics. Bone and dentin derive their resistance to fracture principally from extrinsic toughening mechanisms which have their origins in the hierarchical microstructure of these mineralized tissues. Experimentally, quantification of these toughening mechanisms requires a crack-growth resistance approach, which can be achieved by measuring the crack-driving force, e.g., the stress intensity, as a function of crack extension ("R-curve approach"). Here this methodology is used to study of the effect of aging on the fracture properties of human cortical bone and human dentin in order to discern the microstructural origins of toughness in these materials.

  2. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  3. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  4. On the effect of x-ray irradiation on the deformation and fracture behavior of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly D.; Launey, Maximilien E.; McDowell, Alastair A.; Ager III, Joel W.; Ritchie, Robert O.

    2010-01-10T23:59:59.000Z

    In situ mechanical testing coupled with imaging using high-energy synchrotron x-ray diffraction or tomography imaging is gaining in popularity as a technique to investigate micrometer and even sub-micrometer deformation and fracture mechanisms in mineralized tissues, such as bone and teeth. However, the role of the irradiation in affecting the nature and properties of the tissue is not always taken into account. Accordingly, we examine here the effect of x-ray synchrotron-source irradiation on the mechanistic aspects of deformation and fracture in human cortical bone. Specifically, the strength, ductility and fracture resistance (both work-of-fracture and resistance-curve fracture toughness) of human femoral bone in the transverse (breaking) orientation were evaluated following exposures to 0.05, 70, 210 and 630 kGy irradiation. Our results show that the radiation typically used in tomography imaging can have a major and deleterious impact on the strength, post-yield behavior and fracture toughness of cortical bone, with the severity of the effect progressively increasing with higher doses of radiation. Plasticity was essentially suppressed after as little as 70 kGy of radiation; the fracture toughness was decreased by a factor of five after 210 kGy of radiation. Mechanistically, the irradiation was found to alter the salient toughening mechanisms, manifest by the progressive elimination of the bone's capacity for plastic deformation which restricts the intrinsic toughening from the formation 'plastic zones' around crack-like defects. Deep-ultraviolet Raman spectroscopy indicated that this behavior could be related to degradation in the collagen integrity.

  5. Age-related changes in the plasticity and toughness of human cortical bone at multiple length-scales

    SciTech Connect (OSTI)

    Zimmermann, Elizabeth A.; Schaible, Eric; Bale, Hrishikesh; Barth, Holly D.; Tang, Simon Y.; Reichert, Peter; Busse, Bjoern; Alliston, Tamara; Ager III, Joel W.; Ritchie, Robert O.

    2011-08-10T23:59:59.000Z

    The structure of human cortical bone evolves over multiple length-scales from its basic constituents of collagen and hydroxyapatite at the nanoscale to osteonal structures at nearmillimeter dimensions, which all provide the basis for its mechanical properties. To resist fracture, bone’s toughness is derived intrinsically through plasticity (e.g., fibrillar sliding) at structural-scales typically below a micron and extrinsically (i.e., during crack growth) through mechanisms (e.g., crack deflection/bridging) generated at larger structural-scales. Biological factors such as aging lead to a markedly increased fracture risk, which is often associated with an age-related loss in bone mass (bone quantity). However, we find that age-related structural changes can significantly degrade the fracture resistance (bone quality) over multiple lengthscales. Using in situ small-/wide-angle x-ray scattering/diffraction to characterize sub-micron structural changes and synchrotron x-ray computed tomography and in situ fracture-toughness measurements in the scanning electron microscope to characterize effects at micron-scales, we show how these age-related structural changes at differing size-scales degrade both the intrinsic and extrinsic toughness of bone. Specifically, we attribute the loss in toughness to increased non-enzymatic collagen cross-linking which suppresses plasticity at nanoscale dimensions and to an increased osteonal density which limits the potency of crack-bridging mechanisms at micron-scales. The link between these processes is that the increased stiffness of the cross-linked collagen requires energy to be absorbed by “plastic” deformation at higher structural levels, which occurs by the process of microcracking.

  6. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly; Zimmermann, Elizabeth; Schaible, Eric; Tang, Simon; Alliston, Tamara; Ritchie, Robert

    2011-08-19T23:59:59.000Z

    Bone comprises a complex structure of primarily collagen, hydroxyapatite and water, where each hierarchical structural level contributes to its strength, ductility and toughness. These properties, however, are degraded by irradiation, arising from medical therapy or bone-allograft sterilization. We provide here a mechanistic framework for how irradiation affects the nature and properties of human cortical bone over a range of characteristic (nano to macro) length-scales, following x-­ray exposures up to 630 kGy. Macroscopically, bone strength, ductility and fracture resistance are seen to be progressively degraded with increasing irradiation levels. At the micron-­scale, fracture properties, evaluated using in-situ scanning electron microscopy and synchrotron x-ray computed micro-tomography, provide mechanistic information on how cracks interact with the bone-matrix structure. At sub-micron scales, strength properties are evaluated with in-situ tensile tests in the synchrotron using small-/wide-angle x-ray scattering/diffraction, where strains are simultaneously measured in the macroscopic tissue, collagen fibrils and mineral. Compared to healthy bone, results show that the fibrillar strain is decreased by ~40% following 70 kGy exposures, consistent with significant stiffening and degradation of the collagen. We attribute the irradiation-­induced deterioration in mechanical properties to mechanisms at multiple length-scales, including changes in crack paths at micron-­scales, loss of plasticity from suppressed fibrillar sliding at sub-­micron scales, and the loss and damage of collagen at the nano-­scales, the latter being assessed using Raman and Fourier-Transform-Infrared spectroscopy and a fluorometric assay.

  7. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    E-Print Network [OSTI]

    Barth, Holly

    2012-01-01T23:59:59.000Z

    in   bone   strength.   Osteoporosis  Int    2006;17:319-­??fragility   in   aging,   osteoporosis,   and   diabetes  mellitus.  Osteoporosis  Int    2010;21:195-­??214.  

  8. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  9. autogenous cortical bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  10. autopod cortical bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  11. The Effects of Obesity on Murine Cortical Bone

    E-Print Network [OSTI]

    Martin, Sophi

    2010-01-01T23:59:59.000Z

    3 1.3 – Factors in the Obesity – Fracture Risk24 ii 3.1 – Childhood obesity and fracturexiv CHAPTER 1 – Introduction to Obesity and Cortical

  12. Effect of cryo-induced microcracks on microindentation of hydrated cortical bone tissue

    SciTech Connect (OSTI)

    Yin Ling, E-mail: ling.yin@jcu.edu.au [School of Engineering, James Cook University, Townsville, QLD 4811 (Australia); Venkatesan, Sudharshan [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia); Webb, Daryl [Electron Microscopy Unit, Australian National University, Canberra, ACT 0200 (Australia); Kalyanasundaram, Shankar; Qin Qinghua [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia)

    2009-08-15T23:59:59.000Z

    Microcracks accumulate in cortical bone tissue as a consequence of everyday cyclic loading. However, it remains unclear to what extent microdamage accumulation contributes to an increase in fracture risk. A cryo-preparation technique was applied to induce microcracks in cortical bone tissue. Microcracks with lengths up to approximately 20 {mu}m, which were initiated mainly on the boundaries of haversian canals, were observed with cryo-scanning electron microscopy. A microindentation technique was applied to study the mechanical loading effect on the microcracked hydrated bone tissue. The microindentation patterns were section-scanned using confocal laser scanning microscopy to understand the deformation and bone damage mechanisms made by mechanical loading. The results show that there was no significant difference with respect to microhardness between the original and microcracked hydrated cortical bone tissues (ANOVA, p > 0.05). The cryo-induced microcracks in the bone tissue were not propagated further under the mechanical loads applied. The deformation mechanism of the microcracked cortical bone tissue was plastic deformation, not brittle fracture.

  13. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    of the effect of two testing methods, torsion and three-point bending, on the mechanical strength of the rat femur and the changes in strength due to ovariectomy. From these tests, little change in cortical bone properties for the OVX rats compared to the Sham...

  14. Children cortical bone characterisation: the ultrasonic J.-P. Berteaua

    E-Print Network [OSTI]

    Boyer, Edmond

    infantile osteo-pathologies. That is why there is a strong interest in the characterisation of the growing specific location (close to cancerous cells) or cadaveric bone. They indicate a lower Young's modulus

  15. A representation of changing heading direction in human cortical areas pVIP and CSv

    E-Print Network [OSTI]

    Royal Holloway, University of London

    Running title: Changing heading direction in the human brain Keywords: egomotion; f1 A representation of changing heading direction in human cortical in the environment, we continually change direction. Much work has examined how the brain

  16. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes | NationalCurriculum IntroductionInvestor14,566Irradiation

  17. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes | NationalCurriculum

  18. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the Key

  19. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the KeyIrradiation Effects

  20. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the KeyIrradiation

  1. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the

  2. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is theIrradiation Effects on

  3. In Vivo Evaluation of the Presence of Bone Marrow in Cortical Porosity in Postmenopausal Osteopenic Women

    E-Print Network [OSTI]

    Goldenstein, Janet; Kazakia, Galateia; Majumdar, Sharmila

    2010-01-01T23:59:59.000Z

    bone resorption in osteoporosis. Calcif. Tissue Int. Augat,Porosity in Women with Osteoporosis. Vienna, Austria:porosity in women with osteoporosis. J. Bone Miner. Res.

  4. ancient human bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reich, David 159 OsteoConduct: Wireless Body-Area Communication based on Bone Conduction Energy Storage, Conversion and Utilization Websites Summary: , Measurement, Human Factors....

  5. Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence of cortical fixation

    E-Print Network [OSTI]

    Guerraoui, Rachid

    Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence Keywords: Screw fixation Pullout force Calcium phosphate cement Osteoporotic bone a b s t r a c with cement. Previous studies have shown that bone augmentation with Calcium Phosphate (CaP) cement

  6. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  7. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  8. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat 

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    In this study, two mechanical testing procedures were developed to test the strength of cancellous bone from the proximal tibia of the rat, the "punch method" and the "whole slice method". These were used to quantify the effect of ovariectomy on rat...

  9. Cortical visual processing is temporally dispersed by luminance in human subjects

    E-Print Network [OSTI]

    Cortical visual processing is temporally dispersed by luminance in human subjects Thomas Kammer Abstract Increasing the intensity of a stimulus such as luminance results in faster processing the luminance of the spots from 1 to 1000 cd/m2 . The data show that processing time as a function of intensity

  10. r Human Brain Mapping 32:382396 (2011) r CENTS: Cortical Enhanced Neonatal Tissue

    E-Print Network [OSTI]

    Utah, University of

    2011-01-01T23:59:59.000Z

    r Human Brain Mapping 32:382­396 (2011) r CENTS: Cortical Enhanced Neonatal Tissue Segmentation-quality magnetic resonance (MR) images of neonatal brains is largely ham- pered by their characteristically small head size and insufficient tissue contrast. As a result, subsequent image processing and analysis

  11. The harmful effects of late-onset alcohol consumption on cortical bone in aged rats 

    E-Print Network [OSTI]

    Bowlin, Julie Lee

    2001-01-01T23:59:59.000Z

    to determine bone chemistry and morphological parameters. The effects of alcohol consumption, the aging process and caloric restriction were examined after obtaining results from this experiment. From the results found, it is evident that alcohol does have a...

  12. Differential Maintenance of Cortical and Cancellous Bone Strength Following Discontinuation of

    E-Print Network [OSTI]

    Ritchie, Robert

    and with combination of osteoporosis medications are needed to improve our treatment of osteoporosis. ß 2011 American; RALOXIFENE Introduction A number of drugs offer some protection against post- menopausal bone loss and nonvertebral fractures in postmenopausal osteoporosis.(3) While bisphosphonates such as ALN may accumulate

  13. Correlation of mechanical viscoelastic properties to microstructure of equine cortical bone tissue

    E-Print Network [OSTI]

    Ayers, Andrew Kerr

    1995-01-01T23:59:59.000Z

    , there is a fair amount of subjectivity that is involved when deciding borderline grid points The current investigation used a diff'erent method in which an image analysis program, Optimas 4 2, is used to threshold the image of the bone In this procedure...

  14. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials 

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  15. Generation of human cortical neurons from a new immortal fetal neural stem cell line

    SciTech Connect (OSTI)

    Cacci, E. [Laboratory of Neural Stem Cell Biology, Section of Restorative Neurology, Lund Strategic Research Center for Stem Cell Biology and Cell Therapy, BMC B10, Klinikgatan 26, University Hospital, SE-221 84 Lund (Sweden); Villa, A. [Laboratory of Human Neural Stem Cell Research, Center of Molecular Biology Severo Ochoa, Lab CX-450, Autonomous University of Madrid, 28049 Madrid (Spain); Parmar, M. [Division of Neurobiology, Wallenberg Neuroscience Center, Lund University, BMC A11, SE-221 84 Lund (Sweden); Cavallaro, M. [Laboratory of Neural Stem Cell Biology, Section of Restorative Neurology, Lund Strategic Research Center for Stem Cell Biology and Cell Therapy, BMC B10, Klinikgatan 26, University Hospital, SE-221 84 Lund (Sweden); Mandahl, N. [Department of Laboratory Medicine, Section of Clinical Genetics, University Hospital, SE-221 85 Lund (Sweden); Lindvall, O. [Laboratory of Neurogenesis and Cell Therapy, Section of Restorative Neurology, Wallenberg Neuroscience Center, Lund Strategic Research Center for Stem Cell Biology and Cell Therapy, University Hospital, SE-221 84 Lund (Sweden); Martinez-Serrano, A. [Laboratory of Human Neural Stem Cell Research, Center of Molecular Biology Severo Ochoa, Lab CX-450, Autonomous University of Madrid, 28049 Madrid (Spain); Kokaia, Z. [Laboratory of Neural Stem Cell Biology, Section of Restorative Neurology, Lund Strategic Research Center for Stem Cell Biology and Cell Therapy, BMC B10, Klinikgatan 26, University Hospital, SE-221 84 Lund (Sweden)]. E-mail: Zaal.Kokaia@med.lu.se

    2007-02-01T23:59:59.000Z

    Isolation and expansion of neural stem cells (NSCs) of human origin are crucial for successful development of cell therapy approaches in neurodegenerative diseases. Different epigenetic and genetic immortalization strategies have been established for long-term maintenance and expansion of these cells in vitro. Here we report the generation of a new, clonal NSC (hc-NSC) line, derived from human fetal cortical tissue, based on v-myc immortalization. Using immunocytochemistry, we show that these cells retain the characteristics of NSCs after more than 50 passages. Under proliferation conditions, when supplemented with epidermal and basic fibroblast growth factors, the hc-NSCs expressed neural stem/progenitor cell markers like nestin, vimentin and Sox2. When growth factors were withdrawn, proliferation and expression of v-myc and telomerase were dramatically reduced, and the hc-NSCs differentiated into glia and neurons (mostly glutamatergic and GABAergic, as well as tyrosine hydroxylase-positive, presumably dopaminergic neurons). RT-PCR analysis showed that the hc-NSCs retained expression of Pax6, Emx2 and Neurogenin2, which are genes associated with regionalization and cell commitment in cortical precursors during brain development. Our data indicate that this hc-NSC line could be useful for exploring the potential of human NSCs to replace dead or damaged cortical cells in animal models of acute and chronic neurodegenerative diseases. Taking advantage of its clonality and homogeneity, this cell line will also be a valuable experimental tool to study the regulatory role of intrinsic and extrinsic factors in human NSC biology.

  16. The bending and dynamic mechanical properties of cortical bone: the effects of sodium fluoride and the relationship to physical properties 

    E-Print Network [OSTI]

    McCurdy-Rahn, Megan Calista

    1998-01-01T23:59:59.000Z

    Bone is a complex organic composite material. The graphics. interface between the mineral and organic phases of bone is significant both to medicine and to the biokinetics, a field which seeks to create advanced synthetic materials by copying...

  17. Human Cementum Protein 1 induces expression of bone and cementum proteins by human gingival fibroblasts

    SciTech Connect (OSTI)

    Carmona-Rodriguez, Bruno [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Alvarez-Perez, Marco Antonio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Narayanan, A. Sampath [Department of Pathology, School of Medicine, UW, Seattle (United States); Zeichner-David, Margarita [Center for Craniofacial Molecular Biology, School of Dentistry, USC, Los Angeles (United States); Reyes-Gasga, Jose [Instituto de Fisica, UNAM (Mexico); Molina-Guarneros, Juan [Facultad de Medicina, UNAM (Mexico); Garcia-Hernandez, Ana Lilia [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Suarez-Franco, Jose Luis [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Chavarria, Ivet Gil [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Villarreal-Ramirez, Eduardo [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Arzate, Higinio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico)]. E-mail: harzate@servidor.unam.mx

    2007-07-06T23:59:59.000Z

    We recently presented evidence showing that a human cementoblastoma-derived protein, named Cementum Protein 1 (CEMP1) may play a role as a local regulator of cementoblast differentiation and cementum-matrix mineralization. This protein was shown to be expressed by cementoblasts and progenitor cells localized in the periodontal ligament. In this study we demonstrate that transfection of CEMP1 into human gingival fibroblasts (HGF) induces mineralization and expression of bone and cementum-matrix proteins. The transfected HGF cells had higher alkaline phosphatase activity and proliferation rate and they expressed genes for alkaline phosphatase, bone sialoprotein, osteocalcin, osteopontin, the transcription factor Runx2/Cbfa1, and cementum attachment protein (CAP). They also produced biological-type hydroxyapatite. These findings indicate that the CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and that it might have a potential function in cementum and bone formation.

  18. Three-dimensional terahertz computed tomography of human bones

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    spectroscopy cannot rival with dual energy x-ray absorptiometry (DEXA) to identify the bone mineral density

  19. Measuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT imaging.

    E-Print Network [OSTI]

    Piana, Michele

    ; 7 CNR-SPIN. Genova. Italy Running Head: PET/CT measurement of bone marrow volume AddressMeasuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT to chemotherapy. Keywords: PET/CT; bone marrow imaging; image processing. #12;2 Introduction Bone marrow (BM

  20. The true toughness of human cortical bone measured with realistically short cracks

    E-Print Network [OSTI]

    Ritchie, Robert

    crack-resistance curves. We find that after only 500 µm of cracking, the driving force for crack. However, the toughness in the longitudinal orientation, where cracks tend to follow the cement lines mechanisms, which act primarily in the crack wake to `shield' the crack from the applied driving force

  1. Neural correlates of auditory perceptual organization measured with direct cortical recordings in humans

    E-Print Network [OSTI]

    Dykstra, Andrew R. (Andrew Richard)

    2011-01-01T23:59:59.000Z

    One of the primary functions of the human auditory system is to separate the complex mixture of sound arriving at the ears into neural representations of individual sound sources. This function is thought to be crucial for ...

  2. DESIGN OF FOAM COVERING FOR ROBOTIC ARMS TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone

    E-Print Network [OSTI]

    Bone, Gary

    , and robot and human velocities. The impact experiments are performed with an apparatus simulating the humanDESIGN OF FOAM COVERING FOR ROBOTIC ARMS TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone@mcmaster.ca ABSTRACT Unintentional physical human-robot contact is becoming more common as robots operate in closer

  3. Nanomechanics and ultrastructural studies of cortical bone : fundamental insights regarding structure-function, mineral-organic force mechanics interactions, and heterogeneity

    E-Print Network [OSTI]

    Tai, Kuangshin

    2007-01-01T23:59:59.000Z

    Although the mechanics of bone has been studied extensively at the micro- and macro-scale, the nano-scopic level is perhaps the most illuminating as this is the length scale at which the individual constituents interact. ...

  4. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  5. A multiscale mechanobiological model of bone remodelling predicts site-specific bone loss in the femur during osteoporosis and mechanical disuse

    E-Print Network [OSTI]

    Lerebours, C; Scheiner, S; Pivonka, P

    2015-01-01T23:59:59.000Z

    We propose a multiscale mechanobiological model of bone remodelling to investigate the site-specific evolution of bone volume fraction across the midshaft of a femur. The model includes hormonal regulation and biochemical coupling of bone cell populations, the influence of the microstructure on bone turnover rate, and mechanical adaptation of the tissue. Both microscopic and tissue-scale stress/strain states of the tissue are calculated from macroscopic loads by a combination of beam theory and micromechanical homogenisation. This model is applied to simulate the spatio-temporal evolution of a human midshaft femur scan subjected to two deregulating circumstances: (i) osteoporosis and (ii) mechanical disuse. Both simulated deregulations led to endocortical bone loss, cortical wall thinning and expansion of the medullary cavity, in accordance with experimental findings. Our model suggests that these observations are attributable to a large extent to the influence of the microstructure on bone turnover rate. Mec...

  6. The significance of crack-resistance curves to the mixed-mode fracture toughness of human cortical bone

    E-Print Network [OSTI]

    Zimmermann, Elizabeth A.

    2010-01-01T23:59:59.000Z

    a dotted blue line, while the direction of the driving forcedriving force (G max ) and weakest microstructural resistance (along the cement linesdriving force and the preferred microstructural paths (generally along the cement lines)

  7. Human {beta}-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old

    SciTech Connect (OSTI)

    Beraud-Colomb, E. [Genetique Medicale et Developpement, Marseille (France)]|[Laboratoire d`Anthropologie, Marseille (France); Maroc, N. [Genetique Medicale et Developpement, Marseille (France); Roubin, R. [Institut Paoli-Calmettes, Marseille (France)] [and others

    1995-12-01T23:59:59.000Z

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the P-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for P-globin frameworks by sequencing through two variable positions and for a polymorphic (AT){sub x}(T){sub y} microsatellite 500 bp upstream of the P-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible. 34 refs., 3 figs., 2 tabs.

  8. Journal of Biomechanics 41 (2008) 10621068 Nonlinear ultrasound can detect accumulated damage in human bone

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    due to the fact that osteoporosis and bone fragility are increasingly widespread diseases. Fracture increases exponentially with age, with a significant increase corresponding to the beginning of menopause

  9. High-speed photography of compressed human trabecular bone correlates whitening to microscopic damage

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of trabecular bone is mainly motivated by the huge impact of osteoporosis in post-menopausal women and the aged is mainly motivated by the reduction of bone strength due to osteoporosis, a systemic skeletal disease [10.elsevier.com/locate/engfracmech #12;comes with a concomitant increase of fracture risk. Post-menopausal women and the elderly

  10. High-Speed Photography of Human Trabecular Bone during Compression Philipp J. Thurner1

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of this research is motivated by the immense costs of health care and social impacts due to osteoporosis in post-menopausal women and the aged. Osteoporosis results in bone loss and change of trabecular architecture, causing of osteoporosis, a systemic, skeletal disease2 , which comes with a reduction of bone strength and a concomitant

  11. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, S.C.; Meinken, G.E.; Mausner, L.F.; Atkins, H.L.

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients. 5 figs.

  12. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, Suresh C. (Setauket, NY); Meinken, George E. (Middle Island, NY); Mausner, Leonard F. (Stony Brook, NY); Atkins, Harold L. (Setauket, NY)

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients.

  13. Temperature Measurement During Polymerization of Bone Cement in Percutaneous Vertebroplasty: An In Vivo Study in Humans

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment (IRCC), Interventional Radiology Unit (Italy); Kanika, Khanna; Murphy, Kieran [Johns Hopkins Hospital, Radiology and Radiological Science (United States); Eminefendic, Haris [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy); Masala, Salvatore ['Tor Vergata' University General Hospital, Department of Diagnostic Imaging, Molecular Imaging, Interventional Radiology and Radiotherapy (Italy); Regge, Daniele [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy)

    2009-05-15T23:59:59.000Z

    Aim of the study was to 'in vivo' measure temperature, during percutaneous vertebroplasty (PV), within a vertebral body injected with different bone cements. According to the declaration of Helsinki, 22 women (60-80 years; mean, 75 years) with painful osteoporotic vertebral collapse underwent bilateral transpedicular PV on 22 lumbar vertebrae. Two 10-G vertebroplasty needles were introduced into the vertebra under digital fluoroscopy; a 16-G radiofrequency thermoablation needle (Starburst XL; RITA Medical System Inc., USA), carrying five thermocouples, was than coaxially inserted. Eleven different bone cements were injected and temperatures were measured every 30 s until temperatures dropped under 45{sup o}C. After the thermocouple needle was withdrawn, bilateral PV was completed with cement injection through the vertebroplasty needle. Unpaired Student's t-tests, Kruskal-Wallis test, and Wilcoxon signed rank test were used to evaluate significant differences (p < 0.05) in peak temperatures, variations between cements, and clinical outcome. All procedures were completed without complications, achieving good clinical outcomes (p < 0.0001). Regarding average peak temperature, cements were divided into three groups: A (over 60{sup o}C), B (from 50{sup o} to 60{sup o}C), and C (below 50{sup o}C). Peak temperature in Group A (86.7 {+-} 10.7{sup o}C) was significantly higher (p = 0.0172) than that in Groups B (60.5 {+-} 3.7{sup o}C) and C (44.8 {+-} 2.6{sup o}C). The average of all thermocouples showed an extremely significant difference (p = 0.0002) between groups. None of the tested cements maintained a temperature {>=}45{sup o}C for more than 30 min. These data suggest that back-pain improvement is obtained not by thermal necrosis but by mechanical consolidation only. The relative necrotic thermal effect in vertebral metastases seems to confirm that analgesia must be considered the main intent of PV.

  14. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  15. HEMATOPOIESIS Soluble factor cross-talk between human bone marrow-derived hematopoietic and

    E-Print Network [OSTI]

    Zandstra, Peter W.

    for studying the regulation of mesengenesis by HCs. Accordingly, an in vitro model capable of maintaining system was developed that allows manipulation of the growth of both mesenchymal and hematopoietic human compo- nents.1-6 Although self-regulation within the hematopoietic niche is undoubtedly critical, it has

  16. On the Estimation of Bone Status Rasmus Paulsen

    E-Print Network [OSTI]

    Osteoporosis Diagnostics. The subject of this thesis is medical image analysis with special attention to X Reinhold Paulsen Keywords Osteoporosis, bone status, radius, contact radiographs, cortical geometry, en algorithm developed by Torsana Osteoporosis Diagnostics. A simulated bone is made by simulated x

  17. The safety and efficacy of an injectable bone substitute in dental sockets demonstrated in a human clinical trial

    E-Print Network [OSTI]

    Boyer, Edmond

    in a water-soluble cellulose polymer carrier phase. It was used for filling bone defects after tooth extractions in eleven patients. The first objective of the study was to investigate the safety of the filler of the implanted areas were harvested and analyzed by using micro-computed tomography, non-decalcified histology

  18. Sleep Dynamics and Seizure Control in a Mesoscale Cortical Model

    E-Print Network [OSTI]

    Lopour, Beth Ann

    2009-01-01T23:59:59.000Z

    Contributions . . . . . . . . . 2 Mesoscale Cortical Modelstates in h e from the mesoscale cortical model, here- afterand Seizure Control in a Mesoscale Cortical Model by Beth

  19. Fibroblast growth factor 2 inhibits up-regulation of bone morphogenic proteins and their receptors during osteoblastic differentiation of human mesenchymal stem cells

    SciTech Connect (OSTI)

    Biver, Emmanuel, E-mail: ebiver@yahoo.fr [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Soubrier, Anne-Sophie [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Thouverey, Cyril [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland)] [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Cortet, Bernard [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Broux, Odile [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)] [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Caverzasio, Joseph [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland)] [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Hardouin, Pierre [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)] [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)

    2012-11-02T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer FGF modulates BMPs pathway in HMSCs by down-regulating BMP/BMPR expression. Black-Right-Pointing-Pointer This effect is mediated by ERK and JNK MAPKs pathways. Black-Right-Pointing-Pointer Crosstalk between FGF and BMPs must be taken into account in skeletal bioengineering. Black-Right-Pointing-Pointer It must also be considered in the use of recombinant BMPs in orthopedic and spine surgeries. -- Abstract: Understanding the interactions between growth factors and bone morphogenic proteins (BMPs) signaling remains a crucial issue to optimize the use of human mesenchymal stem cells (HMSCs) and BMPs in therapeutic perspectives and bone tissue engineering. BMPs are potent inducers of osteoblastic differentiation. They exert their actions via BMP receptors (BMPR), including BMPR1A, BMPR1B and BMPR2. Fibroblast growth factor 2 (FGF2) is expressed by cells of the osteoblastic lineage, increases their proliferation and is secreted during the healing process of fractures or in surgery bone sites. We hypothesized that FGF2 might influence HMSC osteoblastic differentiation by modulating expressions of BMPs and their receptors. BMP2, BMP4, BMPR1A and mainly BMPR1B expressions were up-regulated during this differentiation. FGF2 inhibited HMSCs osteoblastic differentiation and the up-regulation of BMPs and BMPR. This effect was prevented by inhibiting the ERK or JNK mitogen-activated protein kinases which are known to be activated by FGF2. These data provide a mechanism explaining the inhibitory effect of FGF2 on osteoblastic differentiation of HMSCs. These crosstalks between growth and osteogenic factors should be considered in the use of recombinant BMPs in therapeutic purpose of fracture repair or skeletal bioengineering.

  20. arm bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone Engineering Websites Summary: , and robot and human velocities. The impact experiments are performed with an apparatus...

  1. The effects of adult-onset alcoholism on cortical bone

    E-Print Network [OSTI]

    Moe, Atha Louise

    2001-01-01T23:59:59.000Z

    -fed liquid control diet or rat pellet chow for either 8 or 14 weeks. An additional group of animals (alcohol cessation and pair-fed cessation) was fed the alcohol diet for 8 weeks with pair-fed partners receiving the liquid control diet. These animals were...

  2. Independent measurement of femoral cortical thickness and cortical bone density using clinical CT

    E-Print Network [OSTI]

    Treece, G. M.; Gee, A. H.

    2014-12-05T23:59:59.000Z

    to measure, there is often an unequivocal need to be able to decompose it into its constituent parts. For example, in studying the effects of osteoporosis treatment with two different drugs, Teriparatide (Poole et al., 2011) and Denosumab (Poole et al., 2012a...

  3. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  4. DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process.

    E-Print Network [OSTI]

    Boyer, Edmond

    in the prostate cancer bone metastasis process. Mori K.1, 2, * , Le Goff B. 1, 2 , Charrier C. 1, 2 , Battaglia S cells, thus facilitating prostate cancer metastasis development in bone. We confirm that RANKL is a factor that facilitates metastasis to bone by acting as an activator of both osteoclasts and RANK

  5. Spectral Analysis and Connectivity of Porous Microstructures in Bone

    E-Print Network [OSTI]

    Golden, Kenneth M.

    that quantifies brine connectivity and its thermal evolution can also help assess the impact of osteoporosis on trabecular structure. Central to our approach is the spectral measure of a composite material, which contains, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  6. Calibration Human Voxel Phantoms for In Vivo Measurement of ''2 sup 4 sup 1 Am in Bone at the Whole Body Counter Facility of CIEMAT

    E-Print Network [OSTI]

    Moraleda, M; Navarro, J F; Navarro, T

    2002-01-01T23:59:59.000Z

    The Whole Body Counting facility of CIEMAT is capable of carrying out In-Vivo measurements of radionuclides emitting X-rays and low energy gamma radiation internally deposited in the body. The system to use for this purpose consists of flour Low energy Germanium (LeGe) Camberra detectors working in the energy range from 10 to 1000 keV. Physical phantoms with a known contamination in the organ of interest are normally used for the calibration of the LEGe detection system. In this document we present a calibration method using the Monte Carlo technique (MCNP4C) over a voxel phantom obtained from a computerized tomography of a real human head. The phantom consists of 104017 (43x59x41) cubic voxels, 4 mn on each side, os specific tissues, but for this simulation only two types are taken into account: adipose tissue and hard bone. The skull is supposed to be contaminated with ''241 Am and the trajectories of the photons are simulated till they reach the germanium detectors. The detectors were also simulated in det...

  7. attenuates bone cancer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    human bone were studied via the small scale mechanical loading test. Failure analysis was conducted... Jang, Eunhwa 2012-10-19 19 ORIGINAL ARTICLE JBMR Cancer Treatment...

  8. atrofia cortical posterior: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  9. abrogated cortical porosity: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  10. auditiva aferente cortical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  11. adreno cortical enzyme: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  12. adrenal cortical adenoma: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  13. abnormal cortical development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  14. amygdala-orbitofrontal cortical functional: Topics by E-print...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  15. accumbens cortical glutamate: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  16. adrenal cortical carcinoma: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  17. affect mandibular cortical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  18. acute renal cortical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  19. Gyrification from constrained cortical expansion

    E-Print Network [OSTI]

    Tuomas Tallinen; Jun Young Chung; John S. Biggins; L. Mahadevan

    2015-03-12T23:59:59.000Z

    The exterior of the mammalian brain - the cerebral cortex - has a conserved layered structure whose thickness varies little across species. However, selection pressures over evolutionary time scales have led to cortices that have a large surface area to volume ratio in some organisms, with the result that the brain is strongly convoluted into sulci and gyri. Here we show that the gyrification can arise as a nonlinear consequence of a simple mechanical instability driven by tangential expansion of the gray matter constrained by the white matter. A physical mimic of the process using a layered swelling gel captures the essence of the mechanism, and numerical simulations of the brain treated as a soft solid lead to the formation of cusped sulci and smooth gyri similar to those in the brain. The resulting gyrification patterns are a function of relative cortical expansion and relative thickness (compared with brain size), and are consistent with observations of a wide range of brains, ranging from smooth to highly convoluted. Furthermore, this dependence on two simple geometric parameters that characterize the brain also allows us to qualitatively explain how variations in these parameters lead to anatomical anomalies in such situations as polymicrogyria, pachygyria, and lissencephalia.

  20. Elevated extracellular calcium increases expression of bone morphogenetic protein-2 gene via a calcium channel and ERK pathway in human dental pulp cells

    SciTech Connect (OSTI)

    Tada, Hiroyuki [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Nemoto, Eiji, E-mail: e-nemoto@umin.ac.jp [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Kanaya, Sousuke; Hamaji, Nozomu; Sato, Hisae; Shimauchi, Hidetoshi [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)

    2010-04-16T23:59:59.000Z

    Dental pulp cells, which have been shown to share phenotypical features with osteoblasts, are capable of differentiating into odontoblast-like cells and generating a dentin-like mineral structure. Elevated extracellular Ca{sup 2+}Ca{sub o}{sup 2+} has been implicated in osteogenesis by stimulating the proliferation and differentiation of osteoblasts; however, the role of Ca{sub o}{sup 2+} signaling in odontogenesis remains unclear. We found that elevated Ca{sub o}{sup 2+} increases bone morphogenetic protein (BMP)-2 gene expression in human dental pulp cells. The increase was modulated not only at a transcriptional level but also at a post-transcriptional level, because treatment with Ca{sup 2+} increased the stability of BMP-2 mRNA in the presence of actinomycin D, an inhibitor of transcription. A similar increase in BMP-2 mRNA level was observed in other human mesenchymal cells from oral tissue; periodontal ligament cells and gingival fibroblasts. However, the latter cells exhibited considerably lower expression of BMP-2 mRNA compared with dental pulp cells and periodontal ligament cells. The BMP-2 increase was markedly inhibited by pretreatment with an extracellular signal-regulated kinase (ERK) inhibitor, PD98059, and partially inhibited by the L-type Ca{sup 2+} channels inhibitor, nifedipine. However, pretreatment with nifedipine had no effect on ERK1/2 phosphorylation triggered by Ca{sup 2+}, suggesting that the Ca{sup 2+} influx from Ca{sup 2+} channels may operate independently of ERK signaling. Dental pulp cells do not express the transcript of Ca{sup 2+}-sensing receptors (CaSR) and only respond slightly to other cations such as Sr{sup 2+} and spermine, suggesting that dental pulp cells respond to Ca{sub o}{sup 2+} to increase BMP-2 mRNA expression in a manner different from CaSR and rather specific for Ca{sub o}{sup 2+} among cations.

  1. Computer modeling approach for microsphere-packed bone scaffold Pallavi Lal, Wei Sun*

    E-Print Network [OSTI]

    Sun, Wei

    bone graft [5,6], for structural and human cellular assessment of scaffolds for bone repair [7 modeling approach for constructing a three-dimensional microsphere-packed bone graft structure is presented packing model to determine the number of microspheres packed in a synthesized bone graft. The pore size

  2. Modeling Cortical Plasticity Based on Adapting Lateral Interaction

    E-Print Network [OSTI]

    A neural network model called LISSOM for the cooperative self-organization of afferent and lateral connections in cortical maps is applied to modeling cortical plasticity. After self-organization, the LISSOM maps are in a dynamic equilibrium with the input, and reorganize like the cortex in response to simulated cortical lesions and intracortical microstimulation. The model predicts that adapting lateral interactions are fundamental to cortical reorganization, and suggests techniques to hasten recovery following sensory cortical surgery.

  3. Sex Differences in Long Bone Fatigue Using a Rat Model Luisa D. Moreno,1

    E-Print Network [OSTI]

    Waldman, Stephen D.

    response to fatigue, we also determined the creep that occurred during the fatigue test. From the creep progress (Fig. 1). Caler and Carter32 studied cortical bone creep behavior during fatigue testing. When adaptation. From these results, we hypothesized that creep was the underlying mechanism that accounted

  4. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  5. Spectral analysis and connectivity of porous microstructures in bone Kenneth M. Golden , N. Benjamin Murphy, Elena Cherkaev

    E-Print Network [OSTI]

    Cherkaev, Elena

    also help assess the impact of osteoporosis on trabecular structure. Central to our approach- structures, ranging from a solid network of connected trabeculae containing numerous connected pores, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  6. Development of high strength hydroxyapatite for bone tissue regeneration using nanobioactive glass composites

    SciTech Connect (OSTI)

    Shrivastava, Pragya; Dalai, Sridhar; Vijayalakshmi, S. [Centre for Research in Nanotechnology and Science, IIT Bombay (India); Sudera, Prerna; Sivam, Santosh Param [Amity Institute of Nanotechnology, Amity University, Noida, Uttar Pradesh-201303 (India); Sharma, Pratibha [Dept of Energy Science and Engineering, IIT Bombay (India)

    2013-02-05T23:59:59.000Z

    With an increasing demand of biocompatible bone substitutes for the treatment of bone diseases and bone tissue regeneration, bioactive glass composites are being tested to improvise the osteoconductive as well as osteoinductive properties. Nanobioactive glass (nBG) composites, having composition of SiO{sub 2} 70 mol%, CaO 26 mol % and P{sub 2}O{sub 5} 4 mol% were prepared by Freeze drying method using PEG-PPG-PEG co-polymer. Polymer addition improves the mechanical strength and porosity of the scaffold of nBG. Nano Bioactive glass composites upon implantation undergo specific reactions leading to the formation of crystalline hydroxyapatite (HA). This is tested in vitro using Simulated Body Fluid (SBF). This high strength hydroxyapatite (HA) layer acts as osteoconductive in cellular environment, by acting as mineral base of bones, onto which new bone cells proliferate leading to new bone formation. Strength of the nBG composites as well as HA is in the range of cortical and cancellous bone, thus proving significant for bone tissue regeneration substitutes.

  7. Electromagnetic signature of human cortical dynamics during wakefulness and sleep

    E-Print Network [OSTI]

    Destexhe, Alain

    . . . . . . . . . . . . . . . . . . . . . . . . . . 29 3 #12;4 2.2 From micro-scale to meso-scale to macro-scale . . . . . . . . . . . . . . . . . 30 2

  8. age-related cortical cataract: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  9. attention-related cortical functional: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  10. Sequential High-Impact, Free-Fall Loading and Zoledronic Acid as a Novel Pre-Treatment for Disuse-Induced Bone Loss 

    E-Print Network [OSTI]

    Boudreaux, Ramon

    2014-03-31T23:59:59.000Z

    -43). While dual-energy X-ray absorptiometry (DXA) yields two- dimensional outcomes, such as areal BMD (aBMD), QCT is capable of producing three- dimensional and compartment-specific (cortical and cancellous) properties of bone (e.g., volumetric BMD [v...

  11. FRACTAL COMPLEXITY OF THE HUMAN CORTEX IS INCREASED IN WILLIAMS SYNDROME

    E-Print Network [OSTI]

    Thompson, Paul

    FRACTAL COMPLEXITY OF THE HUMAN CORTEX IS INCREASED IN WILLIAMS SYNDROME 1 Paul M. Thompson, 1 algorithm to measure the fractal dimension, or complexity, of the human cerebral cortex. Cortical complexity, the proposed fractal dimension takes into account the full 3D cortical surface geometry, and is independent

  12. Correlation of mechanical viscoelastic properties to microstructure of equine cortical bone tissue 

    E-Print Network [OSTI]

    Ayers, Andrew Kerr

    1995-01-01T23:59:59.000Z

    Dynamic Mechanical Analysis (DMA) has long been used as a method of determining viscoelastic mechanical properties of polymeric materials. More recently, DMA has been used for characterizing the fiber/matrix interface in composite materials...

  13. Influence of viscoelastic and viscous absorption on ultrasonic wave propagation in cortical bone: application to axial

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and the surrounding soft tissues are attenuating media, which might affect the radiofrequency signals measured systems and media, 43.20.Mv Waveguides, wave propagation in tubes and ducts, 43.20.Px Transient radiation and scattering, 43.40.Rj Radiation from vibrating structures into fluid media, 43.35.Pt Surface waves in solids

  14. The harmful effects of late-onset alcohol consumption on cortical bone in aged rats

    E-Print Network [OSTI]

    Bowlin, Julie Lee

    2001-01-01T23:59:59.000Z

    This study looked at the effects of late-onset alcohol consumption for 8 weeks on the aged rat model (15 months old). Thirty 15 month old female Fisher 344 rats were divided into three diet groups: Alcohol (n=9), pair-fed (n=9), and pellet (n=6...

  15. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  16. DYNAMICS OF NEURONAL ACTIVATION AND INTERACTIONS IN CORTICAL FRONTAL

    E-Print Network [OSTI]

    cortices of behaving monkeys, by using micro-electrode arrays. The monkeys performed a sensorimotor task relation between similarity in the single cells' preferred directions (PD) and their pair-wise correlation

  17. Ena/VASP Proteins Regulate Cortical Neuronal Positioning

    E-Print Network [OSTI]

    Goh, Keow Lin

    Development of the multilayered cerebral cortex involves extensive regulated migration of neurons arising from the deeper germinative layers of the mammalian brain [1]. The anatomy and formation of the cortical layers has ...

  18. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    Walton Lucas, B.S., Lipscomb University Co-Chairs of Advisory Committee: Dr. Harry Hogan Dr. Susan Bloomfield The mechanical properties of the cancellous bone in the laboratory rat animal model... the cortical shell for 50 slices in a region starting ~0.5 mm below the most proximal portion of the growth plate for each animal. Images were binarized (threshold of 100 on a 0-255 scale) and the following parameters were assessed for the three- dimensional...

  19. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    on Bone During Extended Bed Rest (Human) Only a few long-term bed rest investigations have successfully mitigated bone loss with exercise paradigms. Combined supine flywheel resistive and treadmill exercise during 90-day bed rest in young men... novel rodent resistance exercise device using flywheel technology was used by Fluckey et al (57) to demonstrate the effects of maximal voluntary squats, performed during suspension, on changes in metaphyseal bone mass. The flywheel exercise protocol...

  20. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  1. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  2. APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO-MECHANICS ON THE IBM SP

    E-Print Network [OSTI]

    California at Berkeley, University of

    APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO,5 Abstract. Accurate micro-finite element analyses of whole bones require the solution of large sets architectures. Key words. multigrid, trabecular bone, human vertebral body, finite element method, massively

  3. The effects of alcohol consumption after menopause on bone regulating hormones

    E-Print Network [OSTI]

    Blaschke, Dawn Lewis

    1999-01-01T23:59:59.000Z

    The goal of this project was to determine if the alcohol-associated increase in osteopenia as observed in ovariectomized rats, which simulated human females after menopause, was due to the elect of alcohol on hormones that regulate bone metabolism...

  4. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  5. Auditory cortical neuron response dierences under isourane versus pentobarbital anesthesia

    E-Print Network [OSTI]

    Wang, Xiaoqin

    Auditory cortical neuron response di¡erences under iso£urane versus pentobarbital anesthesia Steven pentobarbital anesthesia in a within subject study control design. Initial microelectrode recordings were made under isoflurane anesthesia. After a several hour washout period, recordings were repeated at spatially

  6. Cortical Hemisphere Registration Via Large Deformation Diffeomorphic Metric Curve

    E-Print Network [OSTI]

    Qiu, Anqi

    on the relation between individual brains and the atlas. This is a powerful approach allowing us to study a largeCortical Hemisphere Registration Via Large Deformation Diffeomorphic Metric Curve Mapping Anqi Qiu1 Science, Johns Hopkins University Abstract. We present large deformation diffeomorphic metric curve

  7. Mathematics and biophysics of cortical microtubules in plants

    E-Print Network [OSTI]

    Allard, Jun

    Mathematics and biophysics of cortical microtubules in plants by Jun Allard A THESIS SUBMITTED;Abstract Microtubules confined to the two-dimensional cortex of elongating plant cells must form a parallel membrane-anchor densities in different plants, including Arabidopsis cells and Tobacco cells. ii #12;Table

  8. R326 Dispatch Nuclear migration: Cortical anchors for cytoplasmic dynein

    E-Print Network [OSTI]

    dynein, and provide a critical link in understanding the basis of nuclear migration in yeast. The nuclearR326 Dispatch Nuclear migration: Cortical anchors for cytoplasmic dynein Kerry Bloom Nuclear body that rolls around at random inside the sack of a eukaryotic cell. Controlled nuclear movements

  9. CASE REPORT Open Access Prognostic value of cortically induced motor

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    CASE REPORT Open Access Prognostic value of cortically induced motor evoked activity by TMS) showing total absence of motor activity evoked by transcranial magnetic stimulation (TMS) of spared regions of the left motor cortex, but near-to-complete recovery of motor abilities in the affected hand

  10. 476 THE NEUROSCIENTIST Cortical Hierarchy Copyright 2004 Sage Publications

    E-Print Network [OSTI]

    Jouve, Bertrand

    476 THE NEUROSCIENTIST Cortical Hierarchy Copyright © 2004 Sage Publications ISSN 1073­8584 Understanding how the cerebral cortex processes infor­ mation is a major aim of neurobiology today with impor­directed projections that stem from infragranular layer neurons and terminate outside of layer 4. These findings were

  11. Brain Image Registration Using CorticallyBrain Image Registration Using Cortically Constrained Harmonic MappingsConstrained Harmonic Mappings

    E-Print Network [OSTI]

    Leahy, Richard M.

    Harmonic MappingsConstrained Harmonic Mappings Anand A Joshi1, David W Shattuck2, Paul M Thompson2 and Richard M Leahy1 Subcortical Structure AIR Harmonic HAMMER Harmonic +Intensity Left Thalamus 0.79 0.68 0. Extrapolation of the surface map to the entire cortical volume by a harmonic map. 3. Refinement of the harmonic

  12. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . · Mini-project on bone nodule formation. · Neutron scattering on whole bone. · Analysis of bone explants

  13. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  14. J Bone Miner Res . Author manuscript Fracture risk prediction using BMD and clinical risk factors in early

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,651 peri- and early post-menopausal women (mean age (± SD): 54 4 yr) with a mean follow-up period of 13 Density ; Female ; Fractures, Bone ; etiology ; Humans ; Middle Aged ; Osteoporosis, Postmenopausal definition of osteoporosis ( ), i.e. a bone mineral density (BMD) value less than 2.5 standard deviations

  15. Synthetic reverberating activity patterns embedded in networks of cortical neurons

    E-Print Network [OSTI]

    Roni Vardi; Avner Wallach; Evi Kopelowitz; Moshe Abeles; Shimon Marom; Ido Kanter

    2012-03-26T23:59:59.000Z

    Synthetic reverberating activity patterns are experimentally generated by stimulation of a subset of neurons embedded in a spontaneously active network of cortical cells in-vitro. The neurons are artificially connected by means of conditional stimulation matrix, forming a synthetic local circuit with a predefined programmable connectivity and time-delays. Possible uses of this experimental design are demonstrated, analyzing the sensitivity of these deterministic activity patterns to transmission delays and to the nature of ongoing network dynamics.

  16. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Mun˜oz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  17. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M.  2002.  “Bone  Diagenesis:  An  Overview  of  2000.  “Patterns  of  Diagenesis  in  Bone  I:  The  element  Studies  of  Diagenesis  in  Prehistoric  Bone. ”  

  18. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  19. From genes to folds: a review of cortical gyrification theory

    E-Print Network [OSTI]

    Ronan, Lisa; Fletcher, Paul C

    2014-12-16T23:59:59.000Z

    REVIEW From genes to folds: a review of cortical gyrification theory Lisa Ronan • Paul C. Fletcher Received: 5 September 2014 / Accepted: 6 December 2014 #2; The Author(s) 2014. This article is published with open access at Springerlink.com Abstract... microcephaly. Curr Opin Neurol 14:151 Nonaka-Kinoshita M, Reillo I, Artegiani B, Martinez-Martinez MA, Nelson M, Borrell V, Calegari F (2013) Regulation of cerebral cortex size and folding by expansion of basal progenitors. EMBO J 32:1817–1828 O’Leary DDM, Chou...

  20. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  1. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ­ this is why it is often called

  2. Distinct roles for inhibitory neuron subtypes in cortical circuits : an examination of their structure, function, and connectivity

    E-Print Network [OSTI]

    Runyan, Caroline A. (Caroline Anne)

    2012-01-01T23:59:59.000Z

    Parvalbumin-containing (PV+) neurons and somatostatin-containing (SOM+) neurons are two key cortical inhibitory cell classes that are poised to play distinct computational roles in cortical circuits: PV+ neurons form ...

  3. CORTICAL BRAIN SURFACE MAPPING FOR STUDYING PARTIAL VOLUME EFFECTS IN BRAIN FDG PET IMAGES

    E-Print Network [OSTI]

    Thompson, Paul

    CORTICAL BRAIN SURFACE MAPPING FOR STUDYING PARTIAL VOLUME EFFECTS IN BRAIN FDG PET IMAGES Hillary PET images is confounded by tissue atrophy and partial volume effects, especially in patients-based cortical brain surface mapping technique to account for partial volume effects on brain FDG PET images

  4. Organization of cortical areas in central and peripheral visual fields as revealed by graph theory analysis

    E-Print Network [OSTI]

    Jouve, Bertrand

    1 Organization of cortical areas in central and peripheral visual fields as revealed by graph theory analysis Kenneth Knoblauch, Bertrand Jouve, Arnaud Falchier, Laetitia Cirilli and Henry Kennedy patterns of connections between visual areas so as to determine the prin­ ciples of cortical organization

  5. Predicting hip fracture type with cortical bone mapping (CBM) in the Osteoporotic Fractures in Men (MrOS) study

    E-Print Network [OSTI]

    Treece, Graham M.; Gee, Andrew H.; Tonkin, Carol; Ewing, Susan K.; Cawthon, Peggy M.; Black, Dennis M.; Poole, Kenneth E. S.; Osteoporotic Fractures in Men Study

    2015-03-18T23:59:59.000Z

    Hip fracture risk is known to be related to material properties of the proximal femur, but fracture prediction studies adding richer quantitative computed tomography (QCT) measures to dual energy X-ray (DXA)-based methods have shown limited...

  6. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  7. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  8. The Wnt Co-receptor LRP5 Is Essential for Skeletal Mechanotransduction but Not for the Anabolic Bone

    E-Print Network [OSTI]

    - of-function mutations in LRP5 cause the human skeletal disease osteoporosis-pseudoglioma syndrome com- ponent of the skeletal fragility phenotype in individuals affected with osteoporosis in the regulation of bone mass and strength. For example, the autosomal recessive human disease osteoporosis

  9. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  10. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  11. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  12. Hydroxyapatite-binding peptides for bone growth and inhibition

    DOE Patents [OSTI]

    Bertozzi, Carolyn R. (Berkeley, CA); Song, Jie (Shrewsbury, MA); Lee, Seung-Wuk (Walnut Creek, CA)

    2011-09-20T23:59:59.000Z

    Hydroxyapatite (HA)-binding peptides are selected using combinatorial phage library display. Pseudo-repetitive consensus amino acid sequences possessing periodic hydroxyl side chains in every two or three amino acid sequences are obtained. These sequences resemble the (Gly-Pro-Hyp).sub.x repeat of human type I collagen, a major component of extracellular matrices of natural bone. A consistent presence of basic amino acid residues is also observed. The peptides are synthesized by the solid-phase synthetic method and then used for template-driven HA-mineralization. Microscopy reveal that the peptides template the growth of polycrystalline HA crystals .about.40 nm in size.

  13. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fränzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bäuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  14. Kinetic trajectory decoding using motor cortical ensembles Andrew H. Fagg1

    E-Print Network [OSTI]

    Fagg, Andrew H.

    0 Kinetic trajectory decoding using motor cortical ensembles Andrew H. Fagg1 , Greg Ojakangas2, Norman, OK 2 Dept. of Physics, Drury University 3 Dept. of Physiology, Northwestern University, Chicago

  15. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santé et de la Recherche Médicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  16. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  17. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  18. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  19. Sensitivity of the Human Binaural Cortical Steady State Response to Interaural Level Differences

    E-Print Network [OSTI]

    response. Design: Auditory steady state responses at 4 and 8 Hz were recorded to 4 Hz cycles of interaural

  20. Tracking cortical entrainment in neural activity: Auditory processes in human temporal cortex

    E-Print Network [OSTI]

    Thwaites, Andrew; Nimmo-Smith, Ian; Fonteneau, Elisabeth; Patterson, Roy D.; Buttery, Paula; Marslen-Wilson, William D.

    2015-02-10T23:59:59.000Z

    MNE (Hämäläinen and Ilmoniemi, 1994), neuro-anatomically constrained by MRI images obtained using a GRAPPA 3D MPRAGE sequence (TR=2250ms; TE = 2.99ms; flip-angle = 9?; acceleration factor = 2) on a 3T Tim Trio (Siemens, Erlangen, Germany) with 1mm...

  1. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  2. Evaluation of Bone Fixation Implants 

    E-Print Network [OSTI]

    Perkins, Luke 1990-

    2012-12-10T23:59:59.000Z

    This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

  3. Evaluation of Bone Fixation Implants

    E-Print Network [OSTI]

    Perkins, Luke 1990-

    2012-12-10T23:59:59.000Z

    This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

  4. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  5. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  6. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  7. A Switching Kalman Filter Model for the Motor Cortical Coding of Hand Motion

    E-Print Network [OSTI]

    Bienenstock, Elie

    A Switching Kalman Filter Model for the Motor Cortical Coding of Hand Motion Wei Wu Michael J present a Switching Kalman Filter Model (SKFM) for the real-time inference of hand kinematics from a separate test set is achieved using the Switching Kalman Filter (SKF) algorithm. Quantitative results show

  8. Slow Cortical Dynamics and the Accumulation of Information over Long Timescales

    E-Print Network [OSTI]

    Hasson, Uri

    Neuron Article Slow Cortical Dynamics and the Accumulation of Information over Long Timescales to identify brain regions that accumulate information over short and long timescales and to characterize movie, indicating that these regions accumulate information over relatively long time periods (several

  9. Development/Plasticity/Repair Disrupted ERK Signaling during Cortical Development Leads

    E-Print Network [OSTI]

    Development/Plasticity/Repair Disrupted ERK Signaling during Cortical Development Leads to Abnormal disorders arising from copy number variations in the ERK (extracellular signal-regulated kinase) MAP that these changes are due to ERK-dependent dysregulation of cyclin D1 and p27Kip1 , resulting in cell cycle

  10. Regulated Nuclear Trafficking of the Homeodomain Protein Otx1 in Cortical Neurons

    E-Print Network [OSTI]

    McConnell, Susan

    Regulated Nuclear Trafficking of the Homeodomain Protein Otx1 in Cortical Neurons Y. Alex Zhang,1 in the rat ventricular zone, and remains cytoplasmic as neurons migrate and begin to differentiate. Nuclear, that the N-terminus of Otx1 is nec- essary for nuclear import, and that a putative nuclear localization

  11. Detecting Cortical Surface Regions in Structural MR Data Biswajit Bose1,

    E-Print Network [OSTI]

    Fisher III, John

    Detecting Cortical Surface Regions in Structural MR Data Biswajit Bose1, , John Fisher1 , Bruce on a challenging ex-vivo structural MR dataset for detection of Brodmann area 17. 1. Introduction Detection-resolution MR volume. Figure 1 shows a slice through structural MR data of the primary vi- sual cortex, where BA

  12. Reply: Lithium and Increased Cortical Gray Matter--More Tissue or More Water?

    E-Print Network [OSTI]

    Thompson, Paul

    Reply: Lithium and Increased Cortical Gray Matter--More Tissue or More Water? To the Editor: W e. Regenold voices some disappointment that we did not determine whether an increase in brain tissue water patients. Although lithium's effects on body water homeostasis (2) are important to consider, the absence

  13. Cortical Enhanced Tissue Segmentation of Neonatal Brain MR Images Acquired by a Dedicated Phased Array Coil

    E-Print Network [OSTI]

    Utah, University of

    Cortical Enhanced Tissue Segmentation of Neonatal Brain MR Images Acquired by a Dedicated Phased Carolina at Chapel Hill Abstract The acquisition of high quality MR images of neonatal brains is largely hampered by their characteristically small head size and low tissue contrast. As a result, subsequent image

  14. Computational subunits of visual cortical neurons revealed by artificial neural networks

    E-Print Network [OSTI]

    Lau, Brian

    Computational subunits of visual cortical neurons revealed by artificial neural networks Brian Lau neurons of the cat to spatiotemporal random-bar stimuli and trained artificial neural networks to predict with a simple functional model for complex cells and demonstrate the usefulness of the neural network method

  15. age-related cortical brain: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    age-related cortical brain First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Role of microstructure in...

  16. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  17. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  18. Evidence for Interhemispheric Processing of Inputs From the Hands in Human S2 and PV

    E-Print Network [OSTI]

    Krubitzer, Leah A.

    Evidence for Interhemispheric Processing of Inputs From the Hands in Human S2 and PV ELIZABETH S2 and PV. J Neurophysiol 85: 2236­2244, 2001. In the present investigation, we identified cortical somatosensory (S2) and the parietal ventral (PV) areas, was significantly larger for bilateral stimulation than

  19. Supplementary Information for Amygdala Volume and Social Network Size in Humans

    E-Print Network [OSTI]

    Barrett, Lisa Feldman

    1 Supplementary Information for Amygdala Volume and Social Network Size in Humans Kevin C. Bickart1 of cortical thickness and Social Network Size. Nature Neuroscience: doi:10.1038/nn.2724 #12;3 Supplementary intracranial volume) as independent variables and social network characteristics as dependent variables

  20. Bisphosphonates and Bone diseases: past, present and future Bisphosphonates are stable analogues of the naturally-occuring inorganic

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget's disease of bone

  1. Engineered nanomedicine for myeloma and bone microenvironment targeting

    E-Print Network [OSTI]

    Swami, Archana

    Bone is a favorable microenvironment for tumor growth and a frequent destination for metastatic cancer cells. Targeting cancers within the bone marrow remains a crucial oncologic challenge due to issues of drug availability ...

  2. Cellular and molecular immunotherapeutics derived from the bone marrow stroma

    E-Print Network [OSTI]

    Parekkadan, Biju

    2008-01-01T23:59:59.000Z

    The bone marrow contains a multipotent stromal cell, commonly referred to as a mesenchymal stem cell (MSC). There has been recent interest in the clinical use of MSCs for cell-based therapy because: (1) bone marrow aspiration ...

  3. Original article Analysis of muscle and bone weight variation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . The commonalities ranged from 0.76 (drumstick muscle) to 0.92 (neck bone) and the uniqueness (special size factors and drumstick bone factors. The correlation coefficient between the first factor score and carcass muscle was 0

  4. Two-dimensional ultrasonic computed tomography of growing bones.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Two-dimensional ultrasonic computed tomography of growing bones. P. Lasaygues, E. Franceschini, R: Ultrasonic Computed Tomography, Bone imaging, Born approximation, iterative distorted method I. INTRODUCTION imaging process, using ultrasonic computed tomography. Although this method is known to provide

  5. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  6. Bone loss during energy restriction: mechanistic role of leptin 

    E-Print Network [OSTI]

    Baek, Kyunghwa

    2009-05-15T23:59:59.000Z

    ), dual energy X-ray absorptiometry (DEXA) and mechanical testing. As a whole body measure, biochemical markers of bone turnover can be used to quantify changes in bone formation (e.g., osteocalcin, OC) and bone resorption (e.g., deoxypyridonoline...

  7. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  8. INVEST IN YOUR BONES Daily Activities

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Daily Activities Leaflet 3 Another osteoporosis prevention step to decrease lifestyle. Let's see how you can do that. If you have osteoporosis, follow carefully the activity program. Remember the following about osteoporosis: is largely preventable and treatable is a serious

  9. Nanoscale Surface Topography to Guide Bone Growth

    E-Print Network [OSTI]

    Nanoscale Surface Topography to Guide Bone Growth P R O J E C T L E A D E R : Jirun Sun (American T S Designed and fabricated devices with nanoscale surface topography. Controlled cell alignment by varying the height and aspect ratio of the surface features. R E F E R E N C E Exploring cellular contact guidance

  10. The cortical organization of audio-visual sentence comprehension: an fMRI study at 4 Tesla

    E-Print Network [OSTI]

    The cortical organization of audio-visual sentence comprehension: an fMRI study at 4 Tesla Cheryl M Tesla. Participants viewed the face and upper body of a speaker via a video screen while listening

  11. Examining Associations between Emotional Facial Expressions, Relative Left Frontal Cortical Activity, and Task Persistence

    E-Print Network [OSTI]

    Price, Thomas

    2012-10-19T23:59:59.000Z

    -Chairs of Committee, Eddie Harmon-Jones Brandon J. Schmeichel Committee Members, Rebecca Schlegel Kelly Haws Head of Department, Ludy Benjamin August 2012 Major Subject: Psychology iii ABSTRACT Examining Associations between Emotional... Facial Expressions, Relative Left Frontal Cortical Activity, and Task Persistence. (August 2012) Thomas Franklin Price V, B.A., Gettysburg College Chair of Advisory Committee: Dr. Eddie Harmon-Jones Past research associated relative left frontal...

  12. Approach- and Withdrawal-Oriented Responses to Social Rejection: The Role of Asymmetrical Frontal Cortical Activity

    E-Print Network [OSTI]

    Peterson, Carly Kathryn

    2011-02-22T23:59:59.000Z

    A Thesis by CARLY KATHRYN PETERSON Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved by: Chair of Committee, Eddie Harmon... Cortical Activity. (December 2009) Carly Kathryn Peterson, B.A., University of Wisconsin ? Madison Chair of Advisory Committee: Dr. Eddie Harmon-Jones Ostracism arouses negative affect. However, little is known about variables that influence...

  13. Scaling self-organizing maps to model large cortical networks

    E-Print Network [OSTI]

    2004-01-01T23:59:59.000Z

    Self-organizing computational models with specific intracortical connections can explain many functional features of visual cortex, such as topographic orientation and ocular dominance maps. However, due to their computational requirements, it is difficult to use such detailed models to study large-scale phenomena like object segmentation and binding, object recognition, tilt illusions, optic flow, and fovea periphery interaction. This paper introduces two techniques that make large simulations practical. First, a set of general linear scaling equations for the RF-LISSOM self-organizing model is derived and shown to result in quantitatively equivalent maps over a wide range of simulation sizes. This capability makes it possible to debug small simulations and then scale them up to larger simulations only when needed. The scaling equations also facilitate the comparison of biological maps and parameters between individuals and species with different brain region sizes. Second, the equations are combined into a new growing map method called GLISSOM, which dramatically reduces the memory and computational requirements of large self-organizing networks. With GLISSOM it should be possible to simulate all of human V1 at the single-column level using existing supercomputers, making detailed computational study of large-scale phenomena possible.

  14. Evaluation of Radiation Dose Effects on Rat Bones Using Synchrotron Radiation Computed Microtomography

    SciTech Connect (OSTI)

    Nogueira, Liebert Parreiras; Braz, Delson [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Barroso, Regina Cely [Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Almeida, Carlos Eduardo de; Andrade, Cherley Borba [Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Tromba, Giuliana [Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2011-12-13T23:59:59.000Z

    In this work, we investigated the consequences of irradiation in the femora and ribs of rats submitted to radiation doses of 5 Gy. Three different sites in femur specimens (head, distal metaphysis and distal epiphysis) and one in ribs (ventral) were imaged using synchrotron radiation microcomputed tomography to assess trabecular bone microarchitecture. Histomorphometric quantification was calculated directly from the 3D microtomographic images using synchrotron radiation. The 3D microtomographic images were obtained at the SYRMEP (SYnchrotron Radiation for MEdical Physics) beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. A better understanding of the biological interactions that occur after exposure to photon radiation is needed in order to optimize therapeutic regimens and facilitate development and strategies that decrease radiation-induced side effects in humans. Results showed significant differences between irradiated and non-irradiated specimens, mostly in head and distal metaphysis bone sites.

  15. Modeling aspects of human memory for scientific study.

    SciTech Connect (OSTI)

    Caudell, Thomas P. (University of New Mexico); Watson, Patrick (University of Illinois - Champaign-Urbana Beckman Institute); McDaniel, Mark A. (Washington University); Eichenbaum, Howard B. (Boston University); Cohen, Neal J. (University of Illinois - Champaign-Urbana Beckman Institute); Vineyard, Craig Michael; Taylor, Shawn Ellis; Bernard, Michael Lewis; Morrow, James Dan; Verzi, Stephen J.

    2009-10-01T23:59:59.000Z

    Working with leading experts in the field of cognitive neuroscience and computational intelligence, SNL has developed a computational architecture that represents neurocognitive mechanisms associated with how humans remember experiences in their past. The architecture represents how knowledge is organized and updated through information from individual experiences (episodes) via the cortical-hippocampal declarative memory system. We compared the simulated behavioral characteristics with those of humans measured under well established experimental standards, controlling for unmodeled aspects of human processing, such as perception. We used this knowledge to create robust simulations of & human memory behaviors that should help move the scientific community closer to understanding how humans remember information. These behaviors were experimentally validated against actual human subjects, which was published. An important outcome of the validation process will be the joining of specific experimental testing procedures from the field of neuroscience with computational representations from the field of cognitive modeling and simulation.

  16. Electron microscopic observations of the adrenal cortical cells of young albino rats after near-lethal doses of chronic gamma irradiation

    E-Print Network [OSTI]

    Riggs, James C

    1968-01-01T23:59:59.000Z

    8. Section of normal spongiocyte indicating the position of an endothelial cell io relation to cortical cells 31 9. Cortical cells from an irradiated animal 33 10. Tubular cristae mitochondriales from an irradiated animal 35 11. Vacuolatioo...ELECTRON MICROSCOPIC OBSERVATIONS OP THE ADRENAL CORTICAL CELLS OF YOUNG ALBINO RATS AFTER NEAR-LETHAL DOSES OP CHRONIC GAK'IA IRRADIATION A Thesis by JAMES CRAIG RIGGS Submitted to the Graduate College of the Texas A&M University...

  17. Interactions between microenvironment and cancer cells in two animal models of bone metastasis

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Interactions between microenvironment and cancer cells in two animal models of bone metastasis of characteristics leading to osteoclastogenesis only in the bone microenvironment. Key words: Bone metastasis;3 INTRODUCTION Bone is a preferential site for metastasis in different types of cancer. Bone metastases induce

  18. CX3CR1 Is Expressed by Prostate Epithelial Cells and Androgens Regulate the Levels of CX3CL1/Fractalkine in the Bone Marrow

    E-Print Network [OSTI]

    Fatatis, Alessandro

    CX3CR1 Is Expressed by Prostate Epithelial Cells and Androgens Regulate the Levels of CX3CL1 human osteoblasts in vitro. Thus, the interaction of fractalkine with its receptor CX3CR1 could play a crucial role in vivo by directing circulating prostate cancer cells to the bone. We found that although CX

  19. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimer’s Disease and Bone Loss Bone health is an important issue in aging and AD. Osteoporosis–related fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  20. Bone Cancer Rates in Dinosaurs Compared with Modern Vertebrates

    E-Print Network [OSTI]

    L. C. Natarajan; A. L. Melott; B. M. Rothschild; L. D. Martin

    2007-10-16T23:59:59.000Z

    Data on the prevalence of bone cancer in dinosaurs is available from past radiological examination of preserved bones. We statistically test this data for consistency with rates extrapolated from information on bone cancer in modern vertebrates, and find that there is no evidence of a different rate. Thus, this test provides no support for a possible role of ionizing radiation in the K-T extinction event.

  1. allowing normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    assays. Correlations of fluoride levels between normal bone near the Nancy Medina; Chester W. Douglass; Gary M. Whitford; Robert N. Hoover; Thomas R. Fears 6 Differential...

  2. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    their results, the researchers recommended that vitamin D levels be checked and kept on well--balanced levels to maintain the structural integrity of bones and avoid...

  3. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

  4. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    present and that diagenesis (chemical exchange between therisk assessment. Diagenesis, or the chemical exchangeto assess the level of diagenesis in a bone without chemical

  5. Odor recognition and segmentation by coupled olfactory bulb and cortical networks

    E-Print Network [OSTI]

    Li, Z; Li, Zhaoping; Hertz, John

    1999-01-01T23:59:59.000Z

    We present a model of a coupled system of the olfactory bulb and cortex. Odor inputs to the epithelium are transformed to oscillatory bulbar activities. The cortex recognizes the odor by resonating to the bulbar oscillating pattern when the amplitude and phase patterns from the bulb match an odor memory stored in the intracortical synapses. We assume a cortical structure which transforms the odor information in the oscillatory pattern to a slow DC feedback signal to the bulb. This feedback suppresses the bulbar response to the pre-existing odor, allowing subsequent odor objects to be segmented out for recognition.

  6. Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Bala Krishnamoorthy, Department of Mathematics, Washington State University

    E-Print Network [OSTI]

    Krishnamoorthy, Bala

    1 Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Strength Bala to failure in axial compression. Predictive variables included age, gender, bone mineral density (BMD mineral density, spine surgery. #12;3 Introduction The allograft bone industry is guided by practices

  7. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  8. Quantity and Quality of Trabecular Bone in the Femur Are Enhanced by a Strongly Anabolic, Noninvasive

    E-Print Network [OSTI]

    serve as the basis for a biomechanically based intervention for osteoporosis. To evaluate intervention for osteoporosis. (J Bone Miner Res 2002;17:349­357) Key words: osteoporosis, osteogenic, anabolic, bone formation, bone quality, osteogenic INTRODUCTION OSTEOPOROSIS, A disease characterized

  9. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    Bone marrow production of lung cells: the impact of G-CSF,bone marrow to reconstitute lung epithelium. Am. J. Respirof Bone Marrow Cells into Lung Cells Mark S. Dooner 1 *,

  10. Role of middle-ear inertial component of bone conduction in chinchilla

    E-Print Network [OSTI]

    Chhan, David

    2013-01-01T23:59:59.000Z

    Bone conduction describes the mechanisms that produce a hearing sensation when the skull bones are subjected to vibration. Multiple components and pathways have been suggested to contribute to total bone-conducted sound. ...

  11. Simultaneous demonstrations of neuropeptide Y gene expression and peptide storage in single neurons of the human brain

    SciTech Connect (OSTI)

    Chan-Palay, V.; Yasargil, G.; Hamid, Q.; Polak, J.M.; Palay, S.L.

    1988-05-01T23:59:59.000Z

    A combination of in situ hybridization for neuropeptide Y mRNA that used a /sup 32/P-labeled complementary RNA probe and immunocytochemistry with polyclonal antibodies against neuropeptide Y were applied to human cortical brain samples to simultaneously localize neuropeptide Y and its mRNA. These two techniques allowed simultaneous identification of neuropeptide Y gene expression and peptide storage in single neutrons of the human brain.

  12. Mechanical bone strength in the proximal tibia 

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    KNEE REPLACEMENT 3 2. 1 Mechanics of the Knee 2. 1. 1 knee Structure. 2. 1. 2 Bone Strength of Proximal Tibia. 2. 2 Total Knee Replacement. '2. 3 Research Prospective III MECHANICS OF MATERIALS. . 3 3 5 7 8 10 3. 1 Normal Stress and Strain... Specimens. 4. 1. 2 Mechanical Test. . 4. 2 Statistical Analysis. . . . . . . . . . . . . 18 18 18 19 V RESULTS AND CONCLUSIONS. 20 5. 1 Results. . 20 5. 2 Discussion and Conclusions. Page 24 REFERENCES. 27 VITA. 29 LIST OF FIGURES FIGURE 2. 1...

  13. WOMEN'S GLOBAL HEALTH INSTITUTE NUTR59000/BMS59800: WOMEN'SHEALTH:BONE

    E-Print Network [OSTI]

    /remodeling, mechanics;Tools of assessment Epidemiology of osteoporosis Development of peak bone mass ­ nutrition/exercise Adult Bone: Women's reproductive choices ­ oral contraceptives, pregnancy, lactation Menopause: Biology

  14. Novel Techniques for High-Resolution Functional Imaging of Trabecular Bone

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    associated with osteoporosis (1, 2). Osteoporosis results in bone loss and deterioration in trabecular a primary endpoint in osteoporosis diagnosis and monitoring. Where strong correlations between bone density

  15. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Interpreting Bone Loss and Osteoporosis in Past Populations.2005. How many women have osteoporosis? Journal of Bone and1987. Postmenopausal osteoporosis: single screening method

  16. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  17. Involvement of ERK in NMDA receptor-independent cortical neurotoxicity of hydrogen sulfide

    SciTech Connect (OSTI)

    Kurokawa, Yuko; Sekiguchi, Fumiko; Kubo, Satoko; Yamasaki, Yoshiko; Matsuda, Sachi; Okamoto, Yukari; Sekimoto, Teruki; Fukatsu, Anna; Nishikawa, Hiroyuki [Division of Pharmacology and Pathophysiology, Kinki University School of Pharmacy, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan)] [Division of Pharmacology and Pathophysiology, Kinki University School of Pharmacy, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan); Kume, Toshiaki [Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Kyoto University, 46-29 Yoshida-shimoadachi-cho, Sakyo-ku, Kyoto 606-8501 (Japan)] [Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Kyoto University, 46-29 Yoshida-shimoadachi-cho, Sakyo-ku, Kyoto 606-8501 (Japan); Fukushima, Nobuyuki [Division of Molecular Neurobiology, Department of Life Sciences, Kinki University School of Science and Engineering, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan)] [Division of Molecular Neurobiology, Department of Life Sciences, Kinki University School of Science and Engineering, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan); Akaike, Akinori [Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Kyoto University, 46-29 Yoshida-shimoadachi-cho, Sakyo-ku, Kyoto 606-8501 (Japan)] [Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Kyoto University, 46-29 Yoshida-shimoadachi-cho, Sakyo-ku, Kyoto 606-8501 (Japan); Kawabata, Atsufumi, E-mail: kawabata@phar.kindai.ac.jp [Division of Pharmacology and Pathophysiology, Kinki University School of Pharmacy, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan)] [Division of Pharmacology and Pathophysiology, Kinki University School of Pharmacy, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan)

    2011-11-04T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer Hydrogen sulfide causes NMDA receptor-independent neurotoxicity in mouse fetal cortical neurons. Black-Right-Pointing-Pointer Activation of ERK mediates the toxicity of hydrogen sulfide. Black-Right-Pointing-Pointer Apoptotic mechanisms are involved in the hydrogen-induced cell death. -- Abstract: Hydrogen sulfide (H{sub 2}S), a gasotransmitter, exerts both neurotoxicity and neuroprotection, and targets multiple molecules including NMDA receptors, T-type calcium channels and NO synthase (NOS) that might affect neuronal viability. Here, we determined and characterized effects of NaHS, an H{sub 2}S donor, on cell viability in the primary cultures of mouse fetal cortical neurons. NaHS caused neuronal death, as assessed by LDH release and trypan blue staining, but did not significantly reduce the glutamate toxicity. The neurotoxicity of NaHS was resistant to inhibitors of NMDA receptors, T-type calcium channels and NOS, and was blocked by inhibitors of MEK, but not JNK, p38 MAP kinase, PKC and Src. NaHS caused prompt phosphorylation of ERK and upregulation of Bad, followed by translocation of Bax to mitochondria and release of mitochondrial cytochrome c, leading to the nuclear condensation/fragmentation. These effects of NaHS were suppressed by the MEK inhibitor. Our data suggest that the NMDA receptor-independent neurotoxicity of H{sub 2}S involves activation of the MEK/ERK pathway and some apoptotic mechanisms.

  18. Controlling the Bone Marrow Dynamics in Cancer Chemotherapy

    E-Print Network [OSTI]

    Ledzewicz, Urszula

    Professor Award 1 #12;find optimal strategies for chemotherapy treatments of the cancer, where Controlling the Bone Marrow Dynamics in Cancer Chemotherapy Urszula Ledzewicz1 and Heinz Sch In the paper a mathematical model for the growth of the bone marrow under cell-cycle specific cancer

  19. Microcapsule-Induced Toughening of Bone Cement Gina M. Miller

    E-Print Network [OSTI]

    Sottos, Nancy R.

    27 Microcapsule-Induced Toughening of Bone Cement Gina M. Miller Senior in Aerospace Engineering R. White, and TAM Prof. Nancy R. Sottos Acrylic bone cement is the primary material used cement, it may be possible to extend the lifetime of the implant, thus reducing the occurrence

  20. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages · Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  1. Bone motion analysis from dynamic MRI: acquisition and tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    overload, impingement or femoral head instability. For both the diagnosis and the surgical planningBone motion analysis from dynamic MRI: acquisition and tracking Benjamin Gilles1 , Rosalind Perrin2 methods in order to auto- matically extract active bone kinematics from multi-slice real-time dy- namic

  2. Biomechanics in bone tissue engineering Dominique P. Pioletti*

    E-Print Network [OSTI]

    Guerraoui, Rachid

    such a procedure truly is, we report, in Figure 1(a), the particular case of a posterior surgical approachBiomechanics in bone tissue engineering Dominique P. Pioletti* Laboratory of Biomechanical 18 January 2010) Biomechanics may be considered as central in the development of bone tissue

  3. Protocadherin-7 induces bone metastasis of breast cancer

    SciTech Connect (OSTI)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China)] [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China)] [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05T23:59:59.000Z

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  4. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  5. 24 IEEE TRANSACTIONS ON NEURAL SYSTEMS AND REHABILITATION ENGINEERING, VOL. 16, NO. 1, FEBRUARY 2008 Cortical Neural Prosthesis Performance Improves

    E-Print Network [OSTI]

    Yu, Byron

    2008 Cortical Neural Prosthesis Performance Improves When Eye Position Is Monitored Aaron P. Batista that can improve prosthesis performance is to ac- count for the direction of gaze in the operation of the prosthesis. This proposal stems from recent discoveries that the direction of gaze influences neural activity

  6. Relation between hydrogen isotopic ratios of bone collagen and rain

    SciTech Connect (OSTI)

    Cormie, A.B.; Schwarcz, H.P. (McMaster Univ., Hamilton, Ontario (Canada)); Gray, J. (Univ. of Alberta, Edmonton (Canada))

    1994-01-01T23:59:59.000Z

    The hydrogen isotopic value ([delta]D) of deer bone collagen is related to both [delta]D of rain during the growing season and growing season relative humidity (RH). With correction for the effects of RH, bone [delta]D is related to growing season rain [delta]D in a simple manner with a slope of 1.0. This indicates that, with RH correction, there are no additional sources of bias in the [delta]D of bone due to unaccounted for biologic or climatic effects. Due to a low sensitivity of bone [delta]D to RH effects, both yearly and growing season rain [delta]D can be estimated with considerable accuracy (R = 0.97 and R = 0.96) from bone collagen [delta]D and [delta][sup 15]N. Here, [delta][sup 15]N is used to correct bone [delta]D for the effects of RH. From these estimates of rain [delta]D, it may then be possible to evaluate temperature since the [delta]D of rain primarily reflects local temperature. Therefore, the measurement of bone collagen [delta]D has good potential for evaluating paleoclimates.

  7. The effects of low environmental cadmium exposure on bone density

    SciTech Connect (OSTI)

    Trzcinka-Ochocka, M., E-mail: ochocka@imp.lodz.pl [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Jakubowski, M. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Szymczak, W. [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland) [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland); Insitute of Psychology, University of Lodz (Poland); Janasik, B.; Brodzka, R. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)

    2010-04-15T23:59:59.000Z

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction ({beta}{sub 2}M-U RBP, NAG), glomerular dysfunction (Alb-U and {beta}{sub 2}M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  8. Processing of hydroxylapatite coatings on titanium alloy bone prostheses

    DOE Patents [OSTI]

    Nastasi, Michael A. (Espanola, NM); Levine, Timothy E. (Santa Clara, CA); Mayer, James W. (Phoenix, AZ); Pizziconi, Vincent B. (Phoenix, AZ)

    1998-01-01T23:59:59.000Z

    Processing of hydroxylapatite sol-gel films on titanium alloy bone prostheses. A method utilizing non-line-of-sight ion beam implantation and/or rapid thermal processing to provide improved bonding of layers of hydroxylapatite to titanium alloy substrates while encouraging bone ingrowth into the hydroxylapatite layers located away from the substrate, is described for the fabrication of prostheses. The first layer of hydroxylapatite is mixed into the substrate by the ions or rapidly thermally annealed, while subsequent layers are heat treated or densified using ion implantation to form layers of decreasing density and larger crystallization, with the outermost layers being suitable for bone ingrowth.

  9. ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone

    E-Print Network [OSTI]

    Price, Paul A.

    ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone Po-Yu Chen · Damon the hierarchical structure of mineral in mature bone. A method to completely deproteinize bone without altering of mineral and protein constituents. SEM revealed that bone minerals are fused together and form a sheet

  10. Interactive Separation of Segmented Bones in CT Volumes Using Graph Cut

    E-Print Network [OSTI]

    Ju, Tao

    mask customized to the shape of the bone, such as the femoral head. However, creat- ing masks for bones of different methodology have been reported for bone segmen- tation (see a recent survey in [1]). DueInteractive Separation of Segmented Bones in CT Volumes Using Graph Cut Lu Liu, David Raber, David

  11. Bone density and geometry in juvenile racehorses fed differing amounts of minerals

    E-Print Network [OSTI]

    Nolan, Meghan Muire

    2002-01-01T23:59:59.000Z

    designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

  12. Prediction of the elastic modulus of the trabecular bone based on X-ray computed tomography

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . INTRODUCTION The investigation of the mechanical properties of trabe- cular bone presents a major challenge

  13. Evaluation of radionuclide bone-imaging for the early detection of sepsis in a model of equine neonatal osteomyelitis

    E-Print Network [OSTI]

    Taylor, James Rutledge

    1986-01-01T23:59:59.000Z

    method of detecting bone abnormalities. The two main factors determining the degree of radiopharmaceutical uptake in bones, and thereby assessing the functional integrity of bone, have been identified as bone blood flow and bone turnover rates.... The resultant infection and induced metabolic changes should produce a positive Technetium-99m MDP ( Tc-MDP) 99m bone scan, a positive scan using Indium-111-oxine labeled leukocytes and radiographic changes characterized by decreased bone density . Seven...

  14. autotaxin controls bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 3 Akt1 in Osteoblasts and Osteoclasts Controls Bone Remodeling University of Kansas -...

  15. On the Mechanistic Origins of Toughness in Bone

    E-Print Network [OSTI]

    Launey, Maximilien E.

    One of the most intriguing protein materials found in nature is bone, a material composed of assemblies of tropocollagen molecules and tiny hydroxyapatite mineral crystals that form an extremely tough, yet lightweight, ...

  16. Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics E.M.van Aken 1107895 of the joint and to relieve the pain, a prosthesis to replace the glenoid of the shoulder joint is an option

  17. affects bone tissue: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  18. acute bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  19. abnormal bone growth: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  20. abnormally high bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  1. acute bone crises: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  2. anorganic bone clinical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  3. abnormal bone development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  4. absorptiometry bone densitometer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  5. alveolar bone cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  6. acute bone infarcts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  7. acellular bone explants: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  8. adverse events bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    marrow disease Daldrup-Link, H E; Henning, T; Link, T M 2007-01-01 316 Bone loss during energy restriction: mechanistic role of leptin Texas A&M University - TxSpace Summary:...

  9. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  10. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  11. ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone

    E-Print Network [OSTI]

    Ritchie, Robert

    ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone in adult rats /Accepted: 3 September 2013 /Published online: 11 April 2014 # International Osteoporosis Foundation and National Osteoporosis Foundation 2014 Abstract Summary We used an osteopenic adult ovariectomized (OVX) rat

  12. areal bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2.2.4 Risk factors 22 2.2.5 Morbidity and mortality 23 2.3 Units Laughlin, Robert B. 103 Rare earth element systematics of fossil bone revealed by LA-ICPMS analysis Environmental...

  13. Modular ‘Click-in-Emulsion’ Bone-Targeted Nanogels

    E-Print Network [OSTI]

    Heller, Daniel A.

    A new class of nanogel demonstrates modular biodistribution and affinity for bone. Nanogels, ~70 nm in diameter and synthesized via an astoichiometric click-chemistry in-emulsion method, controllably display residual, free ...

  14. Trabecular bone dosimetry using a Monte Carlo code

    E-Print Network [OSTI]

    Zuzarte de Mendonca, Anne

    1993-01-01T23:59:59.000Z

    The nuclear medicine community needs radiation ~ dose estimates to patients who are administered radiopharmaceuticals for therapy or diagnosis. These estimates should be as accurate as possible for any organ, and especially for the bone since the bone... of Nuclear Medicine formed a committee to fulfill the needs of the nuclear medicine community to determine the radiation absorbed dose to patients who are athninistered radiopharmaceuticals. The objectives of the Medical Internal Radiation Dose Committee...

  15. X-band EPR imaging as a tool for gradient dose reconstruction in irradiated bones

    SciTech Connect (OSTI)

    Leveque, Philippe; Godechal, Quentin; Bol, Anne; Trompier, Francois; Gallez, Bernard [Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Molecular Imaging and Experimental Radiotherapy Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Institut de Surete Nucleaire et de Radioprotection, F-92262 Fontenay-aux-Roses (France); Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium)

    2009-09-15T23:59:59.000Z

    Purpose: Various tools are currently available for dose reconstruction in individuals after accidental exposure to ionizing radiation. Among the available biological analyses, Monte Carlo simulations, and biophysical methods, such as electron paramagnetic resonance (EPR), the latter has proved its usefulness for retrospective dosimetry. Although EPR spectroscopy is probably the most sensitive technique, it does not provide spatial dosimetric data. This information is, however, highly desirable when steep dose gradient irradiations are involved. The purpose of this work was to explore the possibilities of EPR imaging (EPRI) for spatial dose reconstruction in irradiated biological material. Methods: X-band EPRI was used to reconstruct ex vivo the relative dose distribution in human bone samples and hydroxyapatite phantoms after irradiation with brachytherapy seeds or x rays. Three situations were investigated: Homogeneous, stepwise gradient, and continuous gradient irradiation. Results: EPRI gave a faithful relative spin density distribution in bone samples and in hydroxyapatite phantoms. Measured dose ratios were in close agreement with the actual delivered dose ratios. EPRI was able to distinguish the dose gradients induced by two different sources ({sup 125}I and {sup 192}Ir). However, the measured spatial resolution of the system was 1.9 mm and this appeared to be a limiting factor. The method could be improved by using new signal postprocessing strategies. Conclusions: This study demonstrates that EPRI can be used to assess the regional relative dose distribution in irradiated bone samples. The method is currently applicable to ex vivo measurements of small size samples with low variation in tissue density but is likely to be adapted for in vivo application using L-band EPRI.

  16. EFFECT OF DIETARY GLYCOMACROPEPTIDE AND CHOLESTEROL ON CORTICAL GANGLIOSIDE- AND GLYCOPROTEIN-BOUND N-ACETYLNEURAMINIC ACID IN YOUNG RATS

    E-Print Network [OSTI]

    Kary, Susan Ann

    2009-04-29T23:59:59.000Z

    , acylneuraminate pyruvate-lyase, is present in both bacteria and mammals. However, bacteria that express acylneuraminate pyruvate-lyase do not 8 synthesize Neu5Ac, and this enzyme is absent from mammalian tissues that continuously produce sialic acids (18... EFFECT OF DIETARY GLYCOMACROPEPTIDE AND CHOLESTEROL ON CORTICAL GANGLIOSIDE- AND GLYCOPROTEIN-BOUND N- ACETYLNEURAMINIC ACID IN YOUNG RATS by Susan A. Kary B.G.S., University of Kansas, 2006 Submitted to the graduate degree...

  17. Opiate activity in the rat prefrontal cortex: modulation of ventral tegmental area dopaminergic influence on cortical efferent neurons

    E-Print Network [OSTI]

    St. Mary, John Steven

    1986-01-01T23:59:59.000Z

    OPIATE ACTIVITY IN THE RAT PREFRONTAL CORTEX: MODULATION OF VENTRAL TEGMENTAL AREA DOPAMINERGIC INFLUENCE ON CORTICAL EFFERENT NEURONS A Thesis by JOHN STEVEN ST. MARY Submitted to the Graduate College of Texas A&M University in partial... Thesis by JOHN STEVEN ST. MARY Approved as to style and content by: Steven Peterson (Chairman of Committee) Robert Matthews (- '" j'pj") Ger a ((~Fe g (Mem er) George Chion (Member) December 1986 ABSTRACT Opiate Activity in the Rat...

  18. Common variants in the region around Osterix are associated with bone mineral density and growth in childhood

    E-Print Network [OSTI]

    Peltonen, Leena

    Peak bone mass achieved in adolescence is a determinant of bone mass in later life. In order to identify genetic variants affecting bone mineral density (BMD), we performed a genome-wide association study of BMD and related ...

  19. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  20. Methods for identifying cancellous bone specimen location and size for the Reduced Platen Compression Test 

    E-Print Network [OSTI]

    Cowen, Kyle Ray

    2013-02-22T23:59:59.000Z

    , and stimuli on the skeleton and its ability to perform these everyday functions. The current state of bone testing is focused on understanding the mechanical properties of bone through use of traditional mechanical testing procedures such as three point...

  1. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    properties of proximal tibia were measured using in vivo peripheral quantitative CT. Bone formation rate was quantified on the periosteal the surface by standard bone histomorphometry after intraperitoneal injections of calcein. There was a significant main...

  2. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces 

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to bone surfaces. Although only plutonium was used in the evaluation of this model, any bone surface-seeking, alpha-emitting nuclide, and any class compound, can be used with this model....

  3. Apatite-polymer composites for the controlled delivery of bone morphogenetic proteins

    E-Print Network [OSTI]

    Yong, Tseh-Hwan

    2005-01-01T23:59:59.000Z

    Current treatment of bone defects due to trauma, cancer, or degenerative spine diseases involves the implantation of a bone graft. Autografts, which are harvested from the patient's own body, are associated with problems ...

  4. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    translates into molecular osteogenic signals in bone cells is unknown. Radiation exposure is another potent inducer of bone loss, namely observed on Earth in the clinical setting following radiotherapy procedures. It is expected that long duration space...

  5. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training 

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    Young and ovariectomized animals eating diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs) exhibit enhanced bone formation and decrease bone loss, respectively. Eicosapentaenoic acid, an n-3 PUFA found in fish ...

  6. Detection of bone disease in dogs by radioisotope scanning

    E-Print Network [OSTI]

    Morris, Earl Louis

    1971-01-01T23:59:59.000Z

    f = fractional abundance 6 = cross section thermal neutron f1~ &t (1-e ) = decay factor The usual method of administration of radio- isotopes is intravenously but some have been given orally. 4 high bone to tissue ratio must be achieved... is limited by their availability because they must be produced close to where they will be used. MATERIALS AND METHODS The use of 2 radioactive isotopes for bone scanning in dogs was studied. Sr and Sr were 85 87m selected as the isotopes to be studied...

  7. Measurement of bone mineral content in caged and active cats 

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    errors but these can be reduced by using two different x-ray energies. Dual energy CT operates on a basis similar to dual photon absorptiometry (explained below). The difference in attenuation between tissue and bone is greater for a lower energy... to act as a soft tissue equivalent (35). Effects of fat and soft tissue are decreased when dual energy CT is used (33). Data from each of the two different photon energies are combined and result in images of soft tissue and bone mineral regions. Beam...

  8. The effects of eccentric training on muscle-bone function

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 1999 Major Subject: Kinesiology THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Subinitted to the Office of Graduate Studies of Texas A8iM University in partial fulfillment of the requirements...

  9. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    . While we cannot measure bone stress in vivo, we can visualize bone metabolic activity using 18 F NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate whether subjects. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: patellofemoral pain; 18 F NaF PET/CT; bone

  10. Is decreased bone mineral density associated with development of scoliosis? A bipedal osteopenic rat model

    E-Print Network [OSTI]

    Dede, Ozgur; Akel, Ibrahim; Demirkiran, Gokhan; Yalcin, Nadir; Marcucio, Ralph; Acaroglu, Emre

    2011-01-01T23:59:59.000Z

    more time standing erect. Dual energy X-ray absorbtiometry (acid; DEXA: Dual energy X-ray absorptiometry; BMD: Bone

  11. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  12. Augmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep

    E-Print Network [OSTI]

    Guerraoui, Rachid

    replacement, where significant bone loss can be found either under the tibial tray or in the femoral partAugmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep U March 2010 Keywords: Biocomposite Bone substitute In vivo Poly(L-lactic acid) b-Tricalcium phosphate a b

  13. Design and validation of automated femoral bone morphology measurements in cerebral palsy

    E-Print Network [OSTI]

    Lee, Jehee

    Design and validation of automated femoral bone morphology measurements in cerebral palsy Noyeol, Seoul, South Korea #12;Abstract Accurate quantification of bone morphology is important for monitoring an automatic bone morphology measurement method using one or two radiographs. The study focused on 4

  14. A method for calibration of bone driver transducers to measure the mastoid impedance Reggie Weecea

    E-Print Network [OSTI]

    Allen, Jont

    bone vibrator transducers for clinical measurements, the transfer of energy from the bone driver by known masses. This absolute calibration is based upon a circuit model of the driver, describing specialized equipment not available in the clinic, and a refined bone driver circuit model is proposed

  15. A Graph-based Approach for Computational Model of Bone Microstructure

    E-Print Network [OSTI]

    Buffalo, State University of New York

    azhang@buffalo.edu ABSTRACT Osteoporosis, a condition in which bones become fragile and more likely bone due to osteoporosis. The diagnosis of osteoporosis is commonly done by tests that measure for the diagnosis of osteoporosis are limited due to the lack of good measurements of bone quality. In this paper

  16. Modelling by percolation theory of the behaviour of natural coral used as bone substitute.

    E-Print Network [OSTI]

    Boyer, Edmond

    Modelling by percolation theory of the behaviour of natural coral used as bone substitute. Y the resorption and ossification of natural coral implanted in bones. The first step of the process.barbotteau@qse.tohoku.ac.jp) #12;Modelling by percolation theory of the behaviour of natural coral used as bone substitute.2 1

  17. Histologic Comparison of Regenerate Bone Produced from Dentate Versus Edentulous Transport Discs in Bone Transport Distraction Osteogenesis

    E-Print Network [OSTI]

    Sevilla Gaitan, Carlos

    2013-12-10T23:59:59.000Z

    and the recipient bone segment (Nagashima, Rondon-Newby et al. 2012). Histologic examination of the midline tissues was performed in the present study to establish whether or not bony union has occurred. Main Goal The main goal of this study was to analyze... emphasis on characteristics related to the quality and quantity of the new regenerate bone formed (Zapata, Halvachs et al. 2011; Zapata, Opperman et al. 2011; Nagashima, Rondon-Newby et al. 2012). Nagashima et al. concluded that after four weeks...

  18. Evolution of Matrix and Bone -Carboxyglutamic Acid Proteins in Vertebrates*

    E-Print Network [OSTI]

    Price, Paul A.

    or reconstructed through the use of comparative genomics and data mining. These sequences were compared with available annotated sequences (a total of 48 complete or nearly complete sequences, 28 BGPs and 20 MGPs of biological functions such as skeletogenesis and bone maintenance (BGP and MGP), hemostasis (prothrombin, clot

  19. FSH Directly Regulates Bone Mass Yuanzhen Peng,1

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    .01.051 SUMMARY Postmenopausal osteoporosis, a global public health problem, has for decades been attributed and function. We suggest that high circulating FSH causes hypogonadal bone loss. INTRODUCTION Osteoporosis., 1993; Manolagas and Jilka, 1995). After menopause, resorption significantly exceeds formation

  20. Invest in Your Bones Osteoporosis--The Silent Disease

    E-Print Network [OSTI]

    Invest in Your Bones Osteoporosis--The Silent Disease Leaflet 2 Osteoporosis, a painful of State Health Services, 2008). Osteoporosis is preventable and/or treatable. Accordingly, osteoporosis of height, and chronic back pain. Hip fracture, the most serious consequence of osteoporosis, threatens one

  1. The effects of eccentric training on muscle-bone function 

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    , mechanical testing at this site showed greater tibiae stiffness in the exercised bone than that of the OVX group (+28.5%). No significant differences were found in tibial ultimate load to fracture, ultimate strength or modulus of elasticity. In summary...

  2. Splenic concentration of bone imaging agents in functional asplenia

    SciTech Connect (OSTI)

    Dhekne, R.D.

    1981-07-01T23:59:59.000Z

    Three cases of sickle cell disease associated with functional asplenia are described. The spleen was not visualized on routine Tc-99m-sulfur colloid scan. The bone scan performed with Tc-99m-phosphate compounds revealed abnormal splenic activity in all three cases. The previous case reports and the literature on this subject are reviewed.

  3. Metastatic calcification of the stomach imaged on a bone scan

    SciTech Connect (OSTI)

    Goldstein, R.; Ryo, U.Y.; Pinsky, S.M.

    1984-10-01T23:59:59.000Z

    A whole body bone scan obtained on a 21-year-old woman with sickle cell disease and chronic renal failure showed localization of the radionuclide diffusely in the stomach. The localization of the radionuclide represented metastatic calcification of the stomach caused by secondary hyperparathyroidism.

  4. Random lasing in bone tissue Qinghai Song,1

    E-Print Network [OSTI]

    Kim, Young L.

    of Biomedical Engineering, Purdue University, West Lafayette, Indiana 47907, USA 2 School of Electrical, 2010; posted March 26, 2010 (Doc. ID 122271); published April 28, 2010 Owing to the low-loss and high and deformation mecha- nisms in bone still remain relatively unexplored, in part, due to current technical

  5. Human Ecology Human ecology Research

    E-Print Network [OSTI]

    Wang, Z. Jane

    Channel, Latin America. STUDIOS Architecture. #12;HUMAN ECOLOGY · APRIL 2005 1 Lisa Staiano-Coico, Ph Frey spins a green alternative for textiles. Fibers from rapidly renewable materials

  6. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency 

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    mechanically loaded by a unique four-point loading machine three times per week. After six weeks of treatment, all animals were sacrificed, both tibia removed and tested for bone mineral density (BMD) by dual energy X-ray absorptiometry, stiffness and ultimate...

  7. Humans as the third evolutionary stage of biosphere engineering of rivers

    E-Print Network [OSTI]

    Williams, Mark; Zalasiewicz, Jan; Davies, Neil; Mazzini, Ilaria; Goiran, Jean-Philippe; Kane, Stephanie

    2015-03-20T23:59:59.000Z

    of the coeval evolution of the terrestrial plant biosphere and its sedimentological and geomorphological impact on river systems have been summarized by Davies and Gibling (2010, 2013). The preserved sedimentary record suggests that many rivers... potsherds, wood fragments and bone that signal human activity (Mazzini et al., 2011, fig. 2). The sedimentological and geomorphological effects of human settlement on river systems can be profound and are often associated with enforced changes...

  8. Nukbone® promotes proliferation and osteoblastic differentiation of mesenchymal stem cells from human amniotic membrane

    SciTech Connect (OSTI)

    Rodríguez-Fuentes, Nayeli; Rodríguez-Hernández, Ana G. [Depto. Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico City 04510 (Mexico)] [Depto. Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico City 04510 (Mexico); Enríquez-Jiménez, Juana [Depto. Biología de la Reproducción, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), México City 14000 (Mexico)] [Depto. Biología de la Reproducción, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), México City 14000 (Mexico); Alcántara-Quintana, Luz E. [Subd. de Investigación, Centro Nacional de la Transfusión Sanguínea, Secretaria de Salud, Mexico City 07370 (Mexico)] [Subd. de Investigación, Centro Nacional de la Transfusión Sanguínea, Secretaria de Salud, Mexico City 07370 (Mexico); Fuentes-Mera, Lizeth [Depto. Biología Molecular e Histocompatibilidad, Hospital General “Dr. Manuel Gea González”, México City 4800 (Mexico)] [Depto. Biología Molecular e Histocompatibilidad, Hospital General “Dr. Manuel Gea González”, México City 4800 (Mexico); Piña-Barba, María C. [Depto. Materiales Metálicos y Cerámicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico)] [Depto. Materiales Metálicos y Cerámicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico); Zepeda-Rodríguez, Armando [Depto. Biología Celular y Tisular, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico)] [Depto. Biología Celular y Tisular, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico); and others

    2013-05-10T23:59:59.000Z

    Highlights: •Nukbone showed to be a good scaffold for adhesion, proliferation and differentiation of stem cells. •Nukbone induced osteoblastic differentiation of human mesenchymal stem cells. •Results showed that Nukbone offer an excellent option for bone tissue regeneration due to properties. -- Abstract: Bovine bone matrix Nukbone® (NKB) is an osseous tissue-engineering biomaterial that retains its mineral and organic phases and its natural bone topography and has been used as a xenoimplant for bone regeneration in clinics. There are not studies regarding its influence of the NKB in the behavior of cells during the repairing processes. The aim of this research is to demonstrate that NKB has an osteoinductive effect in human mesenchymal stem cells from amniotic membrane (AM-hMSCs). Results indicated that NKB favors the AM-hMSCs adhesion and proliferation up to 7 days in culture as shown by the scanning electron microscopy and proliferation measures using an alamarBlue assay. Furthermore, as demonstrated by reverse transcriptase polymerase chain reaction, it was detected that two gene expression markers of osteoblastic differentiation: the core binding factor and osteocalcin were higher for AM-hMSCs co-cultured with NKB in comparison with cultivated cells in absence of the biomaterial. As the results indicate, NKB possess the capability for inducing successfully the osteoblastic differentiation of AM-hMSC, so that, NKB is an excellent xenoimplant option for repairing bone tissue defects.

  9. EVALUATION OF COMPRESSION TESTING METHODS FOR THE CORTICAL RING IN THE DISTAL FEMUR METAPHYSIS OF ADULT MALE RATS 

    E-Print Network [OSTI]

    Bishop, Ryan

    2012-04-26T23:59:59.000Z

    . Finkelstein JS, Butler JP, Cleary RL, Neer RM 1994 Compar- ison of four methods for cross-calibrating dual-energy X-ray absorptiometers to eliminate systematic errors when upgrading equipment. J Bone Miner Res 9:1945?1952. 3. Peel NFA, Eastell R 1995...

  10. Identification of a hypoxic population of bone marrow cells

    SciTech Connect (OSTI)

    Allalunis, M.J.; Chapman, J.D.; Turner, A.R.

    1983-02-01T23:59:59.000Z

    A technique using collagenase has been devised to release and separate, with reproducibility, hematopoietic cells (HC) from various microenvironments of mouse femurs. HC were assayed by an in vitro gel culture technique used traditionally to score granulocyte-macrophage precursor cells (CFU-C). CFU-C which resided in the medullary cavity and endosteal regions were sensitive to ionizing radiation and resistant to misonidazole (MISO) cytotoxicity. CFU-C which resided within the compact bone were resistant to ionizing radiation and sensitive to the cytotoxic action of MISO. These results suggest that HC which reside in the bone are hypoxic and retain clonogenic potential. When animals were exposed to various treatments with MISO followed by myelotoxic doses of cyclophosphamide (CTX) or total body irradiation (TBI), the LD/sub 50/ of both agents was significantly reduced. This result suggests that a hypoxic component of HC could be important in the regenerative process within the marrow after such myelotoxic trauma.

  11. Research report Axon growth and recovery of function supported by human bone marrow

    E-Print Network [OSTI]

    Fischer, Itzhak

    may be donor-dependent. Similarly, a battery of behavioral tests showed partial recovery in some highlight the need for establishing adequate characterization, including the development of relevant, and characterization. As a 0006-8993/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j

  12. The effect of continuous infusion of human parathyroid hormone on bone architecture in female mice

    E-Print Network [OSTI]

    Eisenberg, Rahel E. (Rahel Esther)

    2009-01-01T23:59:59.000Z

    This research sought to create an animal model of secondary hyperparathyroidism through continuous infusion of parathyroid hormone (PTH) in adult female mice, and to subsequently study the catabolic effects of PTH. Osmotic ...

  13. On the multiscale origins of fracture resistance in human bone and its biological degradation

    E-Print Network [OSTI]

    Zimmermann, Elizabeth A.

    2012-01-01T23:59:59.000Z

    and   its  biological  degradation   DISCLAIMER   This  and   its  biological  degradation   E.  A.  Zimmermanntissue  fails  due  to  degradation  of  the  collagen  

  14. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    by US Composite (West Palm Beach, Florida). The silicone was manufactured by General Electric Company (Huntersvile, North Carolina, USA) and purchased at local commercial supplier. The geopolymer was made of Metakaolin (MetaMax®, BASF catalysts LLC...

  15. The Ductility of Human Jaw Bone Attached to a Tooth | Stanford...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    regime. Local functional adaptations can result in unfavorable and poorly understood clinical outcomes such as an increased range of tooth motion or ankylosis of a tooth....

  16. The petrous portion of the human temporal bone: potential for forensic individuation

    E-Print Network [OSTI]

    Wiersema, Jason Matthew

    2009-06-02T23:59:59.000Z

    the results within the framework of Bayesian theory in light of recent rulings regarding the admissibility of forensic testimony. The data used in this research were collected from axial CT images of the cranium. Two sets of images were collected for each...

  17. The Ductility of Human Jaw Bone Attached to a Tooth | Stanford Synchrotron

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposedPAGESafetyTed5,Audit Report

  18. Exposure to cadmium and persistent organochlorine pollutants and its association with bone mineral density and markers of bone metabolism on postmenopausal women

    SciTech Connect (OSTI)

    Rignell-Hydbom, A., E-mail: anna.rignell-hydbom@med.lu.se [Department of Occupational and Environmental Medicine, Lund University (Sweden); Skerfving, S.; Lundh, T.; Lindh, C.H. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Elmstahl, S. [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden)] [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden); Bjellerup, P. [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden)] [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden); Juensson, B.A.G.; Struemberg, U. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Akesson, A. [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)] [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)

    2009-11-15T23:59:59.000Z

    Environmental contaminants such as cadmium and persistent organochlorine pollutants have been proposed as risk factors of osteoporosis, and women may be at an increased risk. To assess associations between exposure to cadmium and two different POPs (2,2',4,4',5,5'-hexachlorobiphenyl CB-153, 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene p,p'-DDE), on one hand, and bone effects, on the other, in a population-based study among postmenopausal (60-70 years) Swedish women with biobanked blood samples. The study included 908 women and was designed to have a large contrast of bone mineral densities, measured with a single photon absorptiometry technique in the non-dominant forearm. Biochemical markers related to bone metabolism were analyzed in serum. Exposure assessment was based on cadmium concentrations in erythrocytes and serum concentrations of CB-153 and p,p'-DDE. Cadmium was negatively associated with bone mineral density and parathyroid hormone, positively with the marker of bone resorption. However, this association disappeared after adjustment for smoking. The major DDT metabolite (p,p'-DDE) was positively associated with bone mineral density, an association which remained after adjustment for confounders, but the effect was weak. There was no evidence that the estrogenic congener (CB-153) was associated with any of the bone markers. In conclusion, no convincing associations were observed between cadmium and POPs, on one hand, and bone metabolism markers and BMD, on the other.

  19. A comparative histological study of fossil and recent bone tissues

    E-Print Network [OSTI]

    Enlow, Donald H.

    1955-01-01T23:59:59.000Z

    ? scopic inspection. A wet section, as viewed during trial grinding examinations, will appear more transparent than the dried, finished mount. Any of the standard laboratory abrasives, such as finely powdered carborundum, polishing alumina, or powdered... by hand with the bone section in direct contact with the revolving surface of a power-driven lap wheel. Finely powdered abrasive, such as carborundum or cleansing pov/der, is applied in the form of water paste to the wheel. Periodic inspection under a...

  20. Effects of hyperparathyroidism and calcium on bone healing

    E-Print Network [OSTI]

    Hubbard, Gene Borden

    1975-01-01T23:59:59.000Z

    lesions, blood chemistry data and microscopic examination of bone, The citations on the following pages follow the style of the Sutrnaf. 0$ She. Amuck'. can Vetenanacq Medx. caf. Ass acL aX&0n. CHAPTER II LITERATURE REVIEW Trauma has traditionally...- parathyroidism; however, lameness disappeared in horses fed a standard ration containing 0. 52; calcium and 0. 45+ phosphorus. The case history of a man with hyperparathyroidism in which the main clinical feature was multiple nonuniting 7 fractures has been...

  1. Porous coatings from wire mesh for bone implants

    DOE Patents [OSTI]

    Sump, Kenneth R. (Richland, WA)

    1986-01-01T23:59:59.000Z

    A method of coating areas of bone implant elements and the resulting implant having a porous coating are described. Preselected surface areas are covered by a preform made from continuous woven lengths of wire. The preform is compressed and heated to assure that diffusion bonding occurs between the wire surfaces and between the surface boundaries of the implant element and the wire surfaces in contact with it. Porosity is achieved by control of the resulting voids between the bonded wire portions.

  2. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate: patellofemoral pain; 18 F NaF PET/CT; bone metabolic activity Patellofemoral pain syndrome is often characterized the specific regions of tracer uptake. 18 F NaF PET/CT is an alter- native to Tc-99m MDP bone scintigraphy

  3. Frontal and orbital bone infarctions causing periorbital swelling in patients with sickle cell anemia

    SciTech Connect (OSTI)

    Garty, I.; Koren, A.; Garzozi, H.

    1984-10-01T23:59:59.000Z

    Two cases of unilateral and bilateral periorbital hematomas occurred in patients with sickle cell anemia. The cause of periorbital swelling in these cases was found to be orbital and frontal bone infarctions, respectively, diagnosed by technetium Tc 99m medronate bone scintigraphy. To our knowledge, periorbital bone infarction, as a part of the differential diagnosis of periorbital hematoma and as part of the possible ocular manifestations in patients with sickle cell anemia, has not previously been described.

  4. Plasticity in cortical neuron properties: Modeling the effects of an NMDA antagonist and a GABA agonist during visual deprivation

    E-Print Network [OSTI]

    1998-01-01T23:59:59.000Z

    Infusion of a GABA agonist (Reiter & Stryker, 1988) and infusion of an NMDA receptor antagonist (Bear et al., 1990), in the primary visual cortex of kittens during monocular deprivation, shifts ocular dominance toward the closed eye, in the cortical region near the infusion site. This reverse ocular dominance shift has been previously modeled by variants of a covariance synaptic plasticity rule (Bear et al., 1990; Clothiaux et al., 1991; Miller et al., 1989; Reiter & Stryker, 1988). Kasamatsu et al. (1997, 1998) showed that infusion of an NMDA receptor antagonist in adult cat primary visual cortex changes ocular dominance distribution, reduces binocularity, and reduces orientation and direction selectivity. This paper presents a novel account of the effects of these pharmacological treatments, based on the EXIN synaptic plasticity rules (Marshall, 1995), which include both an instar afferent excitatory and an outstar lateral inhibitory rule. Functionally, the EXIN plasticity rules enha...

  5. Preparation and characterization of calcium phosphate ceramics and Composites as bone substitutes

    E-Print Network [OSTI]

    Zhang, Xing

    2007-01-01T23:59:59.000Z

    bone. Natural porous calcium carbonate skeletons, coral andconversion of calcium carbonate marine skeletons in (NH 4 )conversions of calcium carbonate skeletons (e.g. coral,

  6. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    risk of vertebral osteoporosis compared to men with noto identify patients with osteoporosis. Keywords Bone loss .associated with COPD, osteoporosis is believed to affect 36%

  7. Humboldtian Science, Creole Meteorology, and the Discovery of Human-Caused Climate Change in Northern South America

    E-Print Network [OSTI]

    Cushman, Gregory T.

    2011-01-01T23:59:59.000Z

    they are more fanatical." On the long walk south to Lima, Humboldt passed many signs of abandoned irrigation works, and he was especially struck by a barren field near the mouth of the Santa River covered with human bones, mummi­ fied body parts, and crushed...

  8. Patterns of Practice of Palliative Radiotherapy in Africa, Part 1: Bone and Brain Metastases

    SciTech Connect (OSTI)

    Sharma, Vinay [Johannesburg Hospital, University of Witwatersrand, Johannesburg (South Africa)], E-mail: sharmav@medicine.wits.ac.za; Gaye, Papa Macoumba M.Med. [Institut Curie, Hopital Aristide le Dentec, Univesite Cheikh Anta Diop de Dakar, Dakar (Senegal); Wahab, Sherif Abdel [Ain Shams University, Abbasia, Cairo (Egypt); Ndlovu, Ntokozo [Medical School, Radiotherapy Centre, Harare (Zimbabwe); Ngoma, Twalib [Ocean Road Hospital, Ocean Road Cancer Institute, Dar Es Salaam (Tanzania); Vanderpuye, Verna [Korle Bu Teaching Hospital, Accra (Ghana); Sowunmi, Anthonia [Teaching Hospital, University of Lagos, Surulere, Lagos (Nigeria); Kigula-Mugambe, Joseph [Radiotherapy Department, Makerere University, Kampala (Uganda); Jeremic, Branislav [International Atomic Energy Agency, Vienna (Austria)

    2008-03-15T23:59:59.000Z

    Purpose: To provide data on the pattern of practice of palliative radiotherapy (RT) on the African continent. Methods and Materials: A questionnaire was distributed to participants in a regional training course of the International Atomic Energy Agency in palliative cancer care and sent by e-mail to other institutions in Africa. Requested information included both infrastructure and human resources available and the pattern of RT practice for metastatic and locally advanced cancers. Results: Of 35 centers contacted, 24 (68%) completed the questionnaire. Although RT is used by most centers for most metastatic cancers, liver and lung metastases are treated with chemotherapy. Of 23 centers, 14 (61%) had a single RT regimen as an institutional policy for treating painful bone metastases, but only 5 centers (23%) of 23 used 8 Gy in 1 fraction. Brain metastases were being treated by RT to the whole brain to 30 Gy in 10 fractions, either exclusively (n = 13, 56%) or in addition to the use of 20 Gy in 5 fractions (n = 3, 14%). Conclusion: Radiotherapy is a major component of treatment of cancer patients in African countries. There is consensus among few centers for treatment schedules for almost all sites regarding time and dose-fractionation characteristics of RT regimens used and/or indications for the use of RT in this setting.

  9. Bone mineral density and blood metals in premenopausal women

    SciTech Connect (OSTI)

    Pollack, A.Z., E-mail: pollacka@mail.nih.gov [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Mumford, S.L. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Wactawski-Wende, J. [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States)] [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States); Yeung, E.; Mendola, P.; Mattison, D.R.; Schisterman, E.F. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)

    2013-01-15T23:59:59.000Z

    Exposure to metals, specifically cadmium, lead, and mercury, is widespread and is associated with reduced bone mineral density (BMD) in older populations, but the associations among premenopausal women are unclear. Therefore, we evaluated the relationship between these metals in blood and BMD (whole body, total hip, lumbar spine, and non-dominant wrist) quantified by dual energy X-ray absorptiometry in 248 premenopausal women, aged 18-44. Participants were of normal body mass index (mean BMI 24.1), young (mean age 27.4), 60% were white, 20% non-Hispanic black, 15% Asian, and 6% other race group, and were from the Buffalo, New York region. The median (interquartile range) level of cadmium was 0.30 {mu}g/l (0.19-0.43), of lead was 0.86 {mu}g/dl (0.68-1.20), and of mercury was 1.10 {mu}g/l (0.58-2.00). BMD was treated both as a continuous variable in linear regression and dichotomized at the 10th percentile for logistic regression analyses. Mercury was associated with reduced odds of decreased lumbar spine BMD (0.66, 95% confidence interval: 0.44, 0.99), but overall, metals at environmentally relevant levels of exposure were not associated with reduced BMD in this population of healthy, reproductive-aged women. Further research is needed to determine if the blood levels of cadmium, lead, and mercury in this population are sufficiently low that there is no substantive impact on bone, or if effects on bone can be expected only at older ages.

  10. Zhejiang Bone New Material Technology Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit withTianlinPapers HomeXuanenYongzhouYunnanZhangye LonghuiZhejiang Bone New

  11. Bone status in high levels cyclists J Clin Densitom. 2012 Jan-Mar;15(1):103-7. Evaluation of the Bone Status in High-Level Cyclists

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    health Organization has defined osteoporosis in post-menopausal women as a T-score value less than -2) defines a "low bone density". In post-menopausal women as well as in elderly in general, results are more

  12. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    Alcohol consumption is occurring in the younger generation. It has been found that the sooner people started drinking the shorter they are. Alcohol has also been shown to reduce peak bone mass. Alcohol inhibits osteoblastic proliferation which...

  13. The effect of alcohol on the bone growth spurt of rats at a time equivalent to adolescent females

    E-Print Network [OSTI]

    Chaffin, Catherine Lee

    1997-01-01T23:59:59.000Z

    . The trabecular bone that remained was widely separated and reduced in thickness. These changes are similar to those observed in osteoporosis. The cause and mechanism of the reduced bone volume after alcohol abuse remains unclear. Alcohol consumption at an early...

  14. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival

    E-Print Network [OSTI]

    Brown, Myles

    for post-menopausal osteoporosis (Sambrook and Cooper, 2006). Estrogen and ERs are important for bone and Musculoskeletal Biology, Wyeth Research, Collegeville, PA, USA Estrogen deficiency in menopause is a major cause of osteoporosis in women. Estrogen acts to maintain the appropriate ratio between bone-forming osteoblasts

  15. Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum But Not Cells

    E-Print Network [OSTI]

    Price, Paul A.

    Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum mineralization in the absence of cells. For this model, we utilized EDTA- decalcified new-born rat tibias with the cartilaginous ends intact, allowing us to visually determine the spec- ificity of mineralization within the bone

  16. Correlating mechanical properties of cancellous bone in the rat with various density measures 

    E-Print Network [OSTI]

    Ramaswamy, Ramya

    2004-09-30T23:59:59.000Z

    , and to correlate the mechanical properties of the rodent cancellous bone with the various density measures. Analytical studies were made to assess the effect of the size and shape of the platen based on the values from mechanical testing of the cancellous bone...

  17. Calcium balance and bone density in immature horses fed a high protein diet

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    . Blood samples, feces, and urine were collected during the 116-day study to determine any diet effect on pH and mineral balance. Radiographs were made of the left third metacarpal (MCIII) to determine bone density via radiographic bone aluminum...

  18. Targeting bone-microenvironment-tumour cell interactions : IGF-1 receptor kinase inhibitors. 

    E-Print Network [OSTI]

    Logan, John Gordon

    2012-11-30T23:59:59.000Z

    Bone metastases are a frequent clinical complication associated with cancer. The aim of this PhD thesis was to set up a model system for the study of tumour cell – bone cell interactions in vitro, ex vivo and in vivo and ...

  19. Bone Motion Analysis From Dynamic MRI: Ac-quisition and Tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    of mechanical overload, impingement or femoral head instability. For both diagnosis and surgical planning, an acBone Motion Analysis From Dynamic MRI: Ac- quisition and Tracking INTRODUCTION Periacetabular- curate estimate of hip joint bone motion is required. Orthopedists can use animated 3D models, prior

  20. Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1)

    E-Print Network [OSTI]

    Chetverikov, Dmitry

    Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1) Istv surfaces reconstructed from MR volumes are shown. 1 Outline of the project One of our current projects steps of bone surface reconstruction from CT/MR slice images. 2 Main steps of reconstruction 2.1

  1. Research Paper A method for calibration of bone driver transducers to measure the mastoid

    E-Print Network [OSTI]

    Allen, Jont

    vibrator transducers for clinical measurements, the transfer of energy from the bone driver depends. This absolute calibration is based upon a circuit model of the driver, describing it with three frequency in the clinic, and a refined bone driver circuit model is proposed to better capture the observed behaviors. Ã?

  2. Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent

    E-Print Network [OSTI]

    Butler, Samantha

    Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent Regulates, Toronto, Ontario, Canada M5G 1X8 Commissural spinal axons extend away from the roof plate (RP) in response to the dorsal midline and are generated by the bone morphogenetic proteins (BMPs) in the roof plate (RP) (Liem

  3. Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis

    E-Print Network [OSTI]

    Toledo, University of

    Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis Beata secondary osteoporosis. Risk factors for development of TZD-induced secondary osteoporosis are gender (women healing in T2DM patients on TZD therapy. Keywords Diabetes . Thiazolidinediones . Bone . Osteoporosis

  4. A multi-scale bone study to estimate the risk of fracture related to osteoporosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A multi-scale bone study to estimate the risk of fracture related to osteoporosis Abdelwahed' Orléans, 8, Rue Léonard de Vinci 45072 Orléans, France Objective: Osteoporosis is a disease marked. Bone fractures caused by the osteoporosis become increasingly important goal for both clinicians

  5. Classification and volumetric analysis of temporal bone pneumatization using cone beam computed tomography

    E-Print Network [OSTI]

    Terasaki, Mark

    bone pneumatization in adults using cone beam computed tomography (CBCT) scans. Study Design. A total Oral Pathol Oral Radiol 2014;117:376-384) The advances in cone beam computed tomography (CBCT) overClassification and volumetric analysis of temporal bone pneumatization using cone beam computed

  6. Finite-Element Analysis of Biting Behavior and Bone Stress in the

    E-Print Network [OSTI]

    Dumont, Elizabeth R.

    Finite-Element Analysis of Biting Behavior and Bone Stress in the Facial Skeletons of Bats biting behavior and bite force data gathered in the field with finite-element (FE) analysis. Our FE words: biting behavior; bone stress; adaptation; finite-ele- ment analysis; Chiroptera Mammal evolution

  7. Bone marrow transplantation after the Chernobyl nuclear accident

    SciTech Connect (OSTI)

    Baranov, A.; Gale, R.P.; Guskova, A.; Piatkin, E.; Selidovkin, G.; Muravyova, L.; Champlin, R.E.; Danilova, N.; Yevseeva, L.; Petrosyan, L. (Institute of Biophysics of the Ministry of Health and Clinical Hospital, Moscow (USSR))

    1989-07-27T23:59:59.000Z

    On April 26, 1986, an accident at the Chernobyl nuclear power station in the Soviet Union exposed about 200 people to large doses of total-body radiation. Thirteen persons exposed to estimated total-body doses of 5.6 to 13.4 Gy received bone marrow transplants. Two transplant recipients, who received estimated doses of radiation of 5.6 and 8.7 Gy, are alive more than three years after the accident. The others died of various causes, including burns (the cause of death in five), interstitial pneumonitis (three), graft-versus-host disease (two), and acute renal failure and adult respiratory distress syndrome (one). There was hematopoietic (granulocytic) recovery in nine transplant recipients who could be evaluated, six of whom had transient partial engraftment before the recovery of their own marrow. Graft-versus-host disease was diagnosed clinically in four persons and suspected in two others. Although the recovery of endogenous hematopoiesis may occur after exposure to radiation doses of 5.6 to 13.4 Gy, we do not know whether it is more likely after the transient engraftment of transplanted stem cells. Because large doses of radiation affect multiple systems, bone marrow recovery does not necessarily ensure survival. Furthermore, the risk of graft-versus-host disease must be considered when the benefits of this treatment are being weighed.

  8. For cortical bone, important changes of the elastic properties values have been clearly shown in ageing but not in childhood, furthermore recent works considered osteoporosis as a pediatric disease with geriatric consequences

    E-Print Network [OSTI]

    Boyer, Edmond

    in ageing but not in childhood, furthermore recent works considered osteoporosis as a pediatric disease

  9. Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a

    E-Print Network [OSTI]

    Ariza Moreno, Pilar

    Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a , H descubrimientos s/n 41092 Seville (Spain) a jsanz@us.es, b helgaem@gmail.com, c mpariza@us.es Keywords: Bone-cement of the last XX century. Normally, implant is fixed to bone by means of a polymer material known as bone cement

  10. Estimation of the 3D self-similarity parameter of trabecular bone from its 2D projection

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of osteoporosis is mainly based on dual energy X-ray absorptiometry which amounts to measuring bone mass

  11. EARLY PREVENTIVE EFFECTS OF RISEDRONATE IN A RAT MODEL WITH MASSIVE BONE LOSS DUE TO ORCHIDECTOMY AND

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and disuse induced osteoporosis. ORX and BTX models were combined to see if their effects were cumulative on trabecular bone mass and bone architecture. KEY WORDS: Osteoporosis Orchidectomy Disuse Risedronate Bone-remodeling rate is observed in women after menopause or surgica

  12. Computational analysis of whole body CT documents a bone structure alteration in adult advanced chronic lymphocytic leukemia

    E-Print Network [OSTI]

    Piana, Michele

    progression. PET/CT images were analyzed using dedicated software, able to recognize an external 2-pixel bone ring whose Hounsfield coefficient served as cut off to recognize trabecular and compact bone. PET/CT of the disease. Keywords: Image Analysis, Bone Marrow, Skeletal Structure, ACLL, PET/CT #12;3 Introduction

  13. Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells

    SciTech Connect (OSTI)

    Timper, Katharina [Department of Research, University Hospital, Basel (Switzerland); Seboek, Dalma [Department of Research, University Hospital, Basel (Switzerland); Eberhardt, Michael [Department of Research, University Hospital, Basel (Switzerland); Linscheid, Philippe [Department of Research, University Hospital, Basel (Switzerland); Christ-Crain, Mirjam [Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland); Keller, Ulrich [Department of Research, University Hospital, Basel (Switzerland); Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland); Mueller, Beat [Department of Research, University Hospital, Basel (Switzerland); Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland); Zulewski, Henryk [Department of Research, University Hospital, Basel (Switzerland) and Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland)]. E-mail: henryk.zulewski@unibas.ch

    2006-03-24T23:59:59.000Z

    Mesenchymal stem cells (MSC) from mouse bone marrow were shown to adopt a pancreatic endocrine phenotype in vitro and to reverse diabetes in an animal model. MSC from human bone marrow and adipose tissue represent very similar cell populations with comparable phenotypes. Adipose tissue is abundant and easily accessible and could thus also harbor cells with the potential to differentiate in insulin producing cells. We isolated human adipose tissue-derived MSC from four healthy donors. During the proliferation period, the cells expressed the stem cell markers nestin, ABCG2, SCF, Thy-1 as well as the pancreatic endocrine transcription factor Isl-1. The cells were induced to differentiate into a pancreatic endocrine phenotype by defined culture conditions within 3 days. Using quantitative PCR a down-regulation of ABCG2 and up-regulation of pancreatic developmental transcription factors Isl-1, Ipf-1, and Ngn3 were observed together with induction of the islet hormones insulin, glucagon, and somatostatin.

  14. Human-machine interactions

    DOE Patents [OSTI]

    Forsythe, J. Chris (Sandia Park, NM); Xavier, Patrick G. (Albuquerque, NM); Abbott, Robert G. (Albuquerque, NM); Brannon, Nathan G. (Albuquerque, NM); Bernard, Michael L. (Tijeras, NM); Speed, Ann E. (Albuquerque, NM)

    2009-04-28T23:59:59.000Z

    Digital technology utilizing a cognitive model based on human naturalistic decision-making processes, including pattern recognition and episodic memory, can reduce the dependency of human-machine interactions on the abilities of a human user and can enable a machine to more closely emulate human-like responses. Such a cognitive model can enable digital technology to use cognitive capacities fundamental to human-like communication and cooperation to interact with humans.

  15. Increased copy number for methylated maternal 15q duplications leads to changes in gene and protein expression in human cortical samples

    E-Print Network [OSTI]

    Scoles, Haley A; Urraca, Nora; Chadwick, Samuel W; Reiter, Lawrence T; LaSalle, Janine M

    2011-01-01T23:59:59.000Z

    15q. Am J Med Genet 6. Battaglia A: The inv dup (15) orAm J Hum Genet 1997, 8. Battaglia A: The inv dup(15) or

  16. Jefferson Lab Man Donates Bone Marrow to Save 12-Year-Old Boy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to MCV where he was admitted for the overnight procedure. He received a general anesthesia; then the doctors extracted two liters of bone marrow from his body. The life-saving...

  17. Discovery of novel anti-inflammatory proteins inspired by bone marrow mesenchymal stem cell secretions

    E-Print Network [OSTI]

    Milwid, Jack Miles

    2011-01-01T23:59:59.000Z

    Bone marrow mesenchymal stem cells (MSCs) may soon become the first FDA-approved stem cell therapy for autoimmune and inflammatory disease. Our lab originally hypothesized that much of the therapeutic activity of MSCs may ...

  18. Investigation of bone response to implant materials by electron microscopy and computer simulation

    E-Print Network [OSTI]

    Wang, Hao, 1974-

    2004-01-01T23:59:59.000Z

    (cont.) implementation of this scintigraphic method for quantitative studies of osteoblast-mediated mineralization in vitro. A 2-D truss finite element model is used to study the remodeling of trabecular bone. Using strain ...

  19. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity 

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    of the series was conducted at Brookhaven National Laboratory. To quantify the impact of the abovementioned countermeasures and space radiation on bone, mechanical testing, peripheral quantitative computed tomography, micro-computed tomography, histomorphometry...

  20. Longitudinal ultrasound measurement of the equine third metacarpal bone as a predictor of mechanical testing properties 

    E-Print Network [OSTI]

    Dyer, Stephanie Ann

    1999-01-01T23:59:59.000Z

    diagnostic technique to identify the onset of bucked shins. The purpose of this study was to determine if the longitudinal speed of sound as measured by Soundscan 2000[] was an appropriate predictor of bone strength characterized by mechanical testing...

  1. Methods and modeling for the reduced platen compression of cancellous bone in the rodent proximal tibia 

    E-Print Network [OSTI]

    Rogers, William Elliott

    2002-01-01T23:59:59.000Z

    This study focused on the reduced platen compression (RPC) test of cancellous bone in the rodent proximal tibia. The objective was to improve methods for this mechanical test, specifically in the areas of specimen location, specimen preparation...

  2. Immobilized sonic hedgehog N-terminal signaling domain enhances differentiation of bone marrow-derived

    E-Print Network [OSTI]

    Schaffer, David V.

    , and immobilized onto interpenetrating polymer network (IPN) surfaces also grafted with a bone sialoprotein presented to cells using an intrinsically nonfouling interpenetrating polymer network (IPN).12,13 In spite

  3. attenuates bone cancer-induced: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2007-01-01 300 MR imaging of therapy-induced changes of bone marrow University of California eScholarship Repository Summary: Treatment effects due to irradiation, chemotherapy...

  4. Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone

    E-Print Network [OSTI]

    Yuen, Evelyn P

    2013-04-19T23:59:59.000Z

    (induced by feeding a high iron diet) and gamma radiation exposure would independently increase markers of oxidative stress and markers of oxidative damage and result in loss of bone mass, with the combined treatment having additive or synergistic effects...

  5. Pretreatment levels of bone turnover and the antifracture efficacy of alendronate: The fracture intervention trial

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in postmenopausal osteoporosis. Cal- cif Tissue Int 65:359–in postmeno- pausal osteoporosis. J Bone Miner Res 12:624–among women without osteoporosis at baseline. Although they

  6. Race/ethnic differences in bone mineral densities in older men

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    the Baltimore men’s osteoporosis study. J Bone Miner Res 13.center genetic study of osteoporosis. Osteoporos Int 17:125–Leung Jockey Club Centre for Osteoporosis Care and Control,

  7. Self-assembling peptide hydrogels modulate in vitro chondrogenesis of bovine bone marrow stromal cells

    E-Print Network [OSTI]

    Kopesky, Paul Wayne

    Our objective was to test the hypothesis that self-assembling peptide hydrogel scaffolds provide cues that enhance the chondrogenic differentiation of bone marrow stromal cells (BMSCs). BMSCs were encapsulated within two ...

  8. Factors Affecting the Mechanical Behavior of Bone Subrata Saha, Ph.D.

    E-Print Network [OSTI]

    Gilbert, Robert P.

    Factors Affecting the Mechanical Behavior of Bone by Subrata Saha, Ph.D. Research Professor-mail: subrata.saha@downstate.edu ABSTRACT The load carrying capacity of our skeletal system depends

  9. Non-invasive shock wave stimulated periosteum for bone tissue engineering

    E-Print Network [OSTI]

    Kearney, Cathal (Cathal John)

    2011-01-01T23:59:59.000Z

    The cambium cells of the periosteum, which are known osteoprogenitor cells, have limited suitability for clinical applications of bone tissue engineering due to their low cell number (2-5 cells thick). Extracorporeal shock ...

  10. Analysis of a Fossil Bone from the Archaeological Settlement Malu Rosu, Romania by Accelerator Mass Spectrometry

    E-Print Network [OSTI]

    Agata Olariu; Ion V. Popescu; Ragnar Hellborg; Kristina Stenström; Mikko Faarinen; Per Persson; Bengt Erlandsson; Göran Skog; Emilian Alexandrescu

    2001-03-13T23:59:59.000Z

    A fossil bone from the archaeological site Malu Rosu Giurgiu, in Romania has been analyzed by accelerator mass spectrometry to estimate its age by determining its $^{14}$C content. The radiocarbon age of the bone is in agreement with the date obtained by the method for age determination, based on fluorine content. This is the first radiocarbon dating for the final Neolithic period, for this archaeological settlement in the Romanian region.

  11. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck 

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ESTIMATING CANCELLOIJS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1998 Major Subject: Mechanical Engineering ESTIMATING CANCELLOUS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to Texas Ai8:M University...

  12. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone 

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    (Member) John E. Bauer (Chair of Nutrition) Bryan H. Johnson (Department Head) August 2001 Major: Nutrition ABSTRACT Analyzing the Effects of Alcohol on IGF-I in Bone and Plasma and on IGF-I mRNA in the Liver and Bone. (August 2001) Christina... different effector pathways to increase proliferation at the growth plate (Klaus et al. , 1998). Therefore Vitamin D may not have an effect on IGF-I. Alcoholics have decreased plasma 25-hydroxyvitamin D which is an indicator of Vitamin D status (Peris et...

  13. Human Resources Assistant

    Broader source: Energy.gov [DOE]

    This position is located in the Headquarters (HQ) Operations Division of the Office of the Chief Human Capital Officer in Washington, DC. The Division provides a full range of human capital...

  14. Patenting Human Evolution

    E-Print Network [OSTI]

    Torrance, Andrew W.

    2008-06-01T23:59:59.000Z

    to thorough analysis and debate prior to the imminent arrival of human genetic enhancement technologies. Otherwise, patent law may drive human evolution in directions either unplanned - or worse - undesired....

  15. "Bone Softening," a Practical Way to Utilize Small Fish

    E-Print Network [OSTI]

    . Even in Japan, where per-capita fish consumption is about 5 times that of the United States, small tons in 1986) is used primarily for fish meal rather than for direct human consumption. Looking for ways to increase direct consumption of sar dines and other small fishes, Japanese researchers

  16. Effect of 710 nm visible light irradiation on neurite outgrowth in primary rat cortical neurons following ischemic insult

    SciTech Connect (OSTI)

    Choi, Dong-Hee [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of) [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of); Department of Medical Science, Konkuk University School of Medicine, Seoul (Korea, Republic of); Lee, Kyoung-Hee; Kim, Ji-Hye; Kim, Moon Young [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of)] [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of); Lim, Jeong Hoon [Department of Rehabilitation Medicine, Konkuk University School of Medicine, Seoul (Korea, Republic of) [Department of Rehabilitation Medicine, Konkuk University School of Medicine, Seoul (Korea, Republic of); Rehabilitation Medicine, Division of Neurology, Department of Medicine, National University Hospital, National University Health System (Singapore); Lee, Jongmin, E-mail: leej@kuh.ac.kr [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of) [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of); Department of Rehabilitation Medicine, Konkuk University School of Medicine, Seoul (Korea, Republic of)

    2012-06-01T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer 710 nm wavelength light (LED) has a protective effect in the stroke animal model. Black-Right-Pointing-Pointer We determined the effects of LED irradiation in vitro stroke model. Black-Right-Pointing-Pointer LED treatment promotes the neurite outgrowth through MAPK activation. Black-Right-Pointing-Pointer The level of synaptic markers significantly increased with LED treatment. Black-Right-Pointing-Pointer LED treatment protects cell death in the in vitro stroke model. -- Abstract: Objective: We previously reported that 710 nm Light-emitting Diode (LED) has a protective effect through cellular immunity activation in the stroke animal model. However, whether LED directly protects neurons suffering from neurodegeneration was entirely unknown. Therefore, we sought to determine the effects of 710 nm visible light irradiation on neuronal protection and neuronal outgrowth in an in vitro stroke model. Materials and methods: Primary cultured rat cortical neurons were exposed to oxygen-glucose deprivation (OGD) and reoxygenation and normal conditions. An LED array with a peak wavelength of 710 nm was placed beneath the covered culture dishes with the room light turned off and were irradiated accordingly. LED treatments (4 min at 4 J/cm{sup 2} and 50 mW/cm{sup 2}) were given once to four times within 8 h at 2 h intervals for 7 days. Mean neurite density, mean neurite diameter, and total fiber length were also measured after microtubule associated protein 2 (MAP2) immunostaining using the Axio Vision program. Synaptic marker expression and MAPK activation were confirmed by Western blotting. Results: Images captured after MAP2 immunocytochemistry showed significant (p < 0.05) enhancement of post-ischemic neurite outgrowth with LED treatment once and twice a day. MAPK activation was enhanced by LED treatment in both OGD-exposed and normal cells. The levels of synaptic markers such as PSD 95, GAP 43, and synaptophysin significantly increased with LED treatment in both OGD-exposed and normal cells (p < 0.05). Conclusion: Our data suggest that LED treatment may promote synaptogenesis through MAPK activation and subsequently protect cell death in the in vitro stroke model.

  17. Human Functional Brain Imaging

    E-Print Network [OSTI]

    Rambaut, Andrew

    Human Functional Brain Imaging 1990­2009 September 2011 Portfolio Review #12;2 | Portfolio Review: Human Functional Brain ImagingThe Wellcome Trust is a charity registered in England and Wales, no's role in supporting human functional brain imaging and have informed `our' speculations for the future

  18. integration division Human Systems

    E-Print Network [OSTI]

    integration division Human Systems Eye-Movement Metrics: Non-Intrusive Quantitative Tools for Monitoring Human Visual Performance Objective Approach Impact A reliable quantitative yet non-intrusive methodologies that provide quantitative yet non-intrusive measures of human visual performance for use

  19. Automated simulation of areal bone mineral density assessment in the distal radius from high-resolution peripheral quantitative computed tomography

    E-Print Network [OSTI]

    Burghardt, A. J.; Kazakia, G. J.; Link, T. M.; Majumdar, S.

    2009-01-01T23:59:59.000Z

    Bone mineral density . DXA . HR-pQCT . Osteoporosis .Simulation Introduction Osteoporosis is a conditionclinical assessment of osteoporosis status were identified

  20. Electron Microscopy and Analytical X-ray Characterization of Compositional and Nanoscale Structural Changes in Fossil Bone

    E-Print Network [OSTI]

    Boatman, Elizabeth

    2012-01-01T23:59:59.000Z

    of questions surrounding the diagenesis and fossilization ofthe consequences of diagenesis for that particular feature (on the concept of bone diagenesis and how it relates to

  1. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecânica e Gestão Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  2. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    SciTech Connect (OSTI)

    Anne, Jennifer [Univ. of Manchester (United Kingdom); Edwards, Nicholas P. [Univ. of Manchester (United Kingdom); Wogelius, Roy A. [Univ. of Manchester (United Kingdom); Tumarkin-Deratzian, Allison R. [Temple Univ., Philadelphia, PA (United States); Sellers, William I. [Univ. of Manchester (United Kingdom); van Veelen, Arjen [Univ. of Manchester (United Kingdom); Bergmann, Uwe [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Sokaras, Dimosthenis [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Alonso-Mori, Roberto [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Ignatyev, Konstantin [Diamond Light Source (United Kingdom); Egerton, Victoria M. [Univ. of Manchester (United Kingdom); Manning, Phillip L. [Univ. of Manchester (United Kingdom)

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimens (decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.

  3. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Anne, Jennifer; Edwards, Nicholas P.; Wogelius, Roy A.; Tumarkin-Deratzian, Allison R.; Sellers, William I.; van Veelen, Arjen; Bergmann, Uwe; Sokaras, Dimosthenis; Alonso-Mori, Roberto; Ignatyev, Konstantin; et al

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimensmore »(decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.« less

  4. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    SciTech Connect (OSTI)

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States)] [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)] [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15T23:59:59.000Z

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (?17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results for external calibrations exhibited much larger RMS errors than size matched internal calibration. Use of an average body size external-to-internal calibration correction factor reduced the errors to closer to those for internal calibration. RMS errors of less than 30% or about 0.01 for the bone and 0.1 for the red marrow volume fractions would likely be satisfactory for human studies. Such accuracies were achieved for 3 × 3 segmentation of 5 mm slice images for: (a) internal calibration with 4 times dose for all size body phantoms, (b) internal calibration with 2 times dose for the small and medium size body phantoms, and (c) corrected external calibration with 4 times dose and all size body phantoms. Conclusions: Phantom studies are promising and demonstrate the potential to use dual energy quantitative CT to estimate the spatial distributions of red marrow and bone within the vertebral spongiosa.

  5. Crack Propagation in Bone on the Scale of Mineralized Collagen Fibrils : Role of Polymers with Sacrificial Bonds and Hidden Length

    E-Print Network [OSTI]

    Wenyi Wang; Ahmed Elbanna

    2014-08-04T23:59:59.000Z

    Sacrificial bonds and hidden length (SBHL) in structural molecules provide a mechanism for energy dissipation at the nanoscale. It is hypothesized that their presence leads to greater fracture toughness than what is observed in materials without such features. Here, we investigate this hypothesis using a simplified model of a mineralized collagen fibril sliding on a polymeric interface with SBHL systems. A 1D coarse-grained nonlinear spring-mass system is used to model the fibril. Rate-and-displacement constitutive equations are used to describe the mechanical properties of the polymeric system. The model quantifies how the interface toughness increases as a function of polymer density and number of sacrificial bonds. Other characteristics of the SBHL system, such as the length of hidden loops and the strength of the bonds, are found to influence the results. The model also gives insight into the variations in the mechanical behavior in response to physiological changes, such as the degree of mineralization of the collagen fibril and polymer density in the interfibrillar matrix. The model results provide constraints relevant for bio-mimetic material design and multiscale modeling of fracture in human bone.

  6. Mapping Callosal Morphology in Early-and Late-Onset Elderly Depression: An Index of Distinct Changes in Cortical

    E-Print Network [OSTI]

    Thompson, Paul

    MRI data, novel mesh-based geometrical modeling methods were applied to compare the midsagittal of California at Los Angeles, Los Angeles, CA, USA; 3 Department of Biomedical Sciences & Biotechnologies Institute for Neuroscience and Human Behavior, University of California at Los Angeles, Los Angeles, CA, USA

  7. Clinical Assessment of Percutaneous Radiofrequency Ablation for Painful Metastatic Bone Tumors

    SciTech Connect (OSTI)

    Kojima, Hiroyuki, E-mail: kojimah@takii.kmu.ac.jp; Tanigawa, Noboru; Kariya, Shuji; Komemushi, Atsushi; Shomura, Yuzo; Sawada, Satoshi [Kansai Medical University Takii Hospital, Department of Radiology (Japan)

    2006-12-15T23:59:59.000Z

    Purpose. To investigate the pain-alleviating effects of radiofrequency ablation (RFA) on metastatic bone tumors in relation to tumor size, combined therapy, and percent tumor necrosis rate following RFA. Methods. Subjects comprised 24 patients with 28 painful metastatic bone tumors. A 17G internally cooled electrode was inserted into the tumor for CT guidance and ablation was performed. Bone cement was injected following RFA for 4 tumors involving a weight-bearing bone, while 5 tumors were treated using combined RFA and external irradiation. Percent necrosis rate of the tumor was measured using contrast-enhanced computed tomography 1 week after RFA. Results. Improvement in the visual analog scale (VAS) score was 4.6 {+-} 2.2 for large tumors (>5 cm, n = 12), 3.7 {+-} 1.8 for medium-sized tumors (3.1-5.0 cm, n = 11), and 3.5 {+-} 1.7 for small tumors ({<=}3 cm, n = 4), with no significant differences noted among tumor sizes. Improvement in the VAS score was 3.5 {+-} 1.3 for the 4 tumors in the RFA + bone cement group, 3.2 {+-} 1.9 for the 5 tumors in the RFA + radiation therapy group, and 4.8 {+-} 2.2 for the 18 tumors in the RFA group. No significant differences were identified between groups. The improvement in the VAS score was 3.8 {+-} 2.3, 4.0 {+-} 1.9, and 4.7 {+-} 2.6 in patients with tumor necrosis rates of 0-49%, 50-74%, and 75-100%, respectively. No significant association was observed among these three groups. Conclusion. Percutaneous RFA therapy was effective in relieving pain due to metastatic bone tumors. No relationships appear to exist between initial response and tumor size, combined therapy, and percent tumor necrosis.

  8. Development of a three-dimensional in vitro model to study the effect of vitamin D on bone metastatic breast cancer

    E-Print Network [OSTI]

    Li, Danda

    2011-08-31T23:59:59.000Z

    Breast cancer has a high prevalence among women and most patients suffer from metastasis to bone. The mechanisms involved in breast cancer bone metastasis are poorly understood. Three-dimensional (3D) tissue culture systems are becoming a focus...

  9. Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone D. Farlay, G. Panczer, C. Rey, P. D. Delmas

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone Mineral D. Farlay, G in "Journal of Bone and Mineral Metabolism 2010;28(4):433-45" DOI : 10.1007/s00774-009-0146-7 #12;Abstract The purpose of this study was to test the hypothesis that mineral maturity and crystallinity index are two

  10. Wavelet based characterization of ex vivo vertebral trabecular bone structure with 3T MRI compared to microCT

    SciTech Connect (OSTI)

    Krug, R; Carballido-Gamio, J; Burghardt, A; Haase, S; Sedat, J W; Moss, W C; Majumdar, S

    2005-04-11T23:59:59.000Z

    Trabecular bone structure and bone density contribute to the strength of bone and are important in the study of osteoporosis. Wavelets are a powerful tool to characterize and quantify texture in an image. In this study the thickness of trabecular bone was analyzed in 8 cylindrical cores of the vertebral spine. Images were obtained from 3 Tesla (T) magnetic resonance imaging (MRI) and micro-computed tomography ({micro}CT). Results from the wavelet based analysis of trabecular bone were compared with standard two-dimensional structural parameters (analogous to bone histomorphometry) obtained using mean intercept length (MR images) and direct 3D distance transformation methods ({micro}CT images). Additionally, the bone volume fraction was determined from MR images. We conclude that the wavelet based analyses delivers comparable results to the established MR histomorphometric measurements. The average deviation in trabecular thickness was less than one pixel size between the wavelet and the standard approach for both MR and {micro}CT analysis. Since the wavelet based method is less sensitive to image noise, we see an advantage of wavelet analysis of trabecular bone for MR imaging when going to higher resolution.

  11. Revised estimates of electron absorbed fractions and radionuclide S-values in trabecular bone

    E-Print Network [OSTI]

    Parry, Robert Alan

    1995-01-01T23:59:59.000Z

    of trabecular bone in the skeleton. (Adapted from ICRP 1975). 45 Table 5. 3. Relative weights of dry bones as percentages of total skeleton. (Adapted from ICRP 1975), 45 Table 5. 4. Fractional distribution of red marrow in the skeleton. (Adapted from ICRP... Table 6. 3. Average and maximum beta-particle energy for selected radionuclides. 69 Table 6. 4. S-values for sources in the marrow (in mGy'A4Bq 's '). Target: Marrow 7l Table 6. 5. S-values for sources in the marrow (in mGyMBq 's ') Target...

  12. HQ- Human Resources Operations

    Broader source: Energy.gov [DOE]

    HQs Human Recources Operations delivers services, including position management, recruitment, staffing and classification, and reduction in force at Headquarters.  Click the "Contacts" Link to find...

  13. Cancellous Bone Properties and Matrix Content of TGF-?2 and IGF-I in Human Tibia: A Pilot Study

    E-Print Network [OSTI]

    Yeni, Yener N.; Dong, X. Neil; Zhang, Bingbing; Gibson, Gary J.; Fyhrie, David P.

    2009-01-01T23:59:59.000Z

    in osteoblasts results in an osteoporosis-like phenotype. Jconsiderable, permanent osteoporosis in the affected knee. Jgeneric susceptibility to osteoporosis in postmenopausal

  14. Dynamic T{sub 2}-mapping during magnetic resonance guided high intensity focused ultrasound ablation of bone marrow

    SciTech Connect (OSTI)

    Waspe, Adam C.; Looi, Thomas; Mougenot, Charles; Amaral, Joao; Temple, Michael; Sivaloganathan, Siv; Drake, James M. [Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Philips Healthcare Canada, Markham, ON, L6C 2S3 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Department of Applied Mathematics, University of Waterloo, Waterloo, ON, N2L 3G1 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada)

    2012-11-28T23:59:59.000Z

    Focal bone tumor treatments include amputation, limb-sparing surgical excision with bone reconstruction, and high-dose external-beam radiation therapy. Magnetic resonance guided high intensity focused ultrasound (MR-HIFU) is an effective non-invasive thermotherapy for palliative management of bone metastases pain. MR thermometry (MRT) measures the proton resonance frequency shift (PRFS) of water molecules and produces accurate (<1 Degree-Sign C) and dynamic (<5s) thermal maps in soft tissues. PRFS-MRT is ineffective in fatty tissues such as yellow bone marrow and, since accurate temperature measurements are required in the bone to ensure adequate thermal dose, MR-HIFU is not indicated for primary bone tumor treatments. Magnetic relaxation times are sensitive to lipid temperature and we hypothesize that bone marrow temperature can be determined accurately by measuring changes in T{sub 2}, since T{sub 2} increases linearly in fat during heating. T{sub 2}-mapping using dual echo times during a dynamic turbo spin-echo pulse sequence enabled rapid measurement of T{sub 2}. Calibration of T{sub 2}-based thermal maps involved heating the marrow in a bovine femur and simultaneously measuring T{sub 2} and temperature with a thermocouple. A positive T{sub 2} temperature dependence in bone marrow of 20 ms/ Degree-Sign C was observed. Dynamic T{sub 2}-mapping should enable accurate temperature monitoring during MR-HIFU treatment of bone marrow and shows promise for improving the safety and reducing the invasiveness of pediatric bone tumor treatments.

  15. IBMS BoneKEy. 2009 April;6(4):132-149 http://www.bonekey-ibms.org/cgi/content/full/ibmske;6/4/132

    E-Print Network [OSTI]

    and osteoporosis, yet uniquely ­ without targeting the resident fat or bone cell. IBMS BoneKEy. 2009 April;6(4):132-149. ©2009 International Bone & Mineral Society Introduction Osteoporosis and obesity, two of the most billion dollars in annual health service costs. (1) Osteoporosis, a disease characterized by diminished

  16. Human Functional Brain Imaging

    E-Print Network [OSTI]

    Rambaut, Andrew

    Human Functional Brain Imaging 1990­2009 September 2011 Portfolio Review Summary Brain Imaging #12 Dale ­ one of our first Trustees. Understanding the brain remains one of our key strategic aims today three-fold: · to identify the key landmarks and influences on the human functional brain imaging

  17. Protection of Human Subjects

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-05-15T23:59:59.000Z

    To establish DOE procedures and responsibilities for implementing the policy and requirements set forth in 10 CFR Part 745, Protection of Human Subjects, ad in DOE P 443.1, Policy on the Protection of Human Subjects. Cancels DOE O 1300.3. Canceled by DOE O 443.1A.

  18. Protection of Human Subjects

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-12-20T23:59:59.000Z

    The order establishes Department of Energy (DOE) procedures and responsibilities for implementing the policy and requirements set forth in 10 Code of Federal Regulations (CFR) Part 745, Protection of Human Subjects; and in DOE P 443.1A, Protection of Human Subjects, dated 12-20-07. Cancels DOE O 443.1. Canceled by DOE O 443.1B.

  19. Beliefs about Human Extinction

    SciTech Connect (OSTI)

    Tonn, Bruce Edward [ORNL

    2009-11-01T23:59:59.000Z

    This paper presents the results of a web-based survey about futures issues. Among many questions, respondents were asked whether they believe humans will become extinct. Forty-five percent of the almost 600 respondents believe that humans will become extinct. Many of those holding this believe felt that humans could become extinct within 500-1000 years. Others estimated extinction 5000 or more years into the future. A logistic regression model was estimated to explore the bases for this belief. It was found that people who describe themselves a secular are more likely to hold this belief than people who describe themselves as being Protestant. Older respondents and those who believe that humans have little control over their future also hold this belief. In addition, people who are more apt to think about the future and are better able to imagine potential futures tend to also believe that humans will become extinct.

  20. Localization of neuropeptide Y mRNA in neurons of human cerebral cortex by means of in situ hybridization with a complementary RNA probe

    SciTech Connect (OSTI)

    Terenghi, G.; Polak, J.M.; Hamid, Q.; O'Brien, E.; Denny, P.; Legon, S.; Dixon, J.; Minth, C.D.; Palay, S.L.; Yasargil, G.

    1987-10-01T23:59:59.000Z

    The distribution of mRNA encoding neuropeptide Y (NPY) in neurons of the normal human cerebral cortex in surgical biopsy specimens and postmortem brain was studied in situ hybridization techniques. A /sup 32/P-labeled complementary RNA (cRNA) probe was used on cryostat sections of 13 formaldehyde-fixed cortical biopsy specimens. Hybridization to NPY mRNA was found in all samples: after autoradiography, discrete deposits of silver granules were observed on neuronal cell bodies abundantly distributed in the deep layers of the cortex, particularly laminae IV and VI, and on smaller cell bodies in the white matter. The localization of the neurons hybridized for NPY mRNA was comparable to that of NPY-immunoreactive cells as shown in sections from the same tissue blocks immunostained by using NPY antibodies. The specificity of the in situ hybridization technique was confirmed by blot hybridization analysis of electrophoretically fractionated RNA. This study clearly demonstrated the consistent localization of NPY gene transcription and expression in normal human cortical neurons.

  1. School of Architecture, Design and the Built Environment Project Title: Artificial bone for prosthetic hip joints

    E-Print Network [OSTI]

    Evans, Paul

    formation by the Additive Manufacturing (AM) direct printing process. The artificial bone must and the development of new additive manufacturing techniques for medical devices. The group has active links and structural gradients into the prosthesis. It is envisioned this could involve the use of additively

  2. Nonlinear resonant ultrasound spectroscopy (NRUS) applied to damage assessment in bone

    E-Print Network [OSTI]

    Alamos National Laboratory of the University of California, Los Alamos, New Mexico 87545 Received 25 May NRUS is a resonance-based technique exploiting the significant nonlinear behavior of damaged materials obtained through the measurement of bone mineral density BMD obtained from x-ray densitometric techniques.1

  3. In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone

    E-Print Network [OSTI]

    Weiss, Lee E.

    In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone tissue engineering Kacey G. Marra,1 Jeffrey W. Szem,2 Prashant N. Kumta,3 Paul A. DiMilla,4 Lee E. Weiss5 1 14 April 1999 Abstract: Blends of biodegradable polymers, poly(capro- lactone) and poly

  4. Estimated number of women likely to benefit from bone mineral density measurement in France

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ; Menopause Introduction The prevalence of osteoporosis is rising, most notably in postmenopausal women years of age with risk factors for osteoporosis likely to lead to bone mineral density measurement, an investigation reimbursed by the French national health insurance system in patients at risk for osteoporosis

  5. Feeding Bone Meal to Range Cattle on the Coastal Plains of Texas : Preliminary Report.

    E-Print Network [OSTI]

    Schmidt, H.

    1926-01-01T23:59:59.000Z

    TO RANGE CATTLE 15 Ullllt deca espc T : (Figure 4), or a piece of old hide that has not yet completely yed. Occasionally an animal may be seen licking on the partially ~sed bones of a foul-smelling carcass. he facts related above have probably been...

  6. 1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling of Bones

    E-Print Network [OSTI]

    Gefen, Amit

    1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling*, Member, IEEE Abstract--This paper presents a feasibility study of drilling in fresh wet bone tissue in vitro using the microwave drill method [Jerby et al., 2002], toward testing its applicability

  7. 3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views

    E-Print Network [OSTI]

    3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views B. Nikkhahe of the femur and 97 % of the model femur shaft less than 2 mm from the CT scan. Also the femoral head visualization of the femur including the femoral collumn and condyles is important for the clinician in a number

  8. Changes in bone morphology and composition following long-term alcohol consumption

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 months. The rats were...

  9. Bone ingrowth in a shoulder prosthesis E.M.van Aken

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis E.M.van Aken 1107895 emvanaken@hotmail.com Delft, 2006 and to relief the pain, a prosthesis to replace the glenoid of the shoulder joint is an option. The shoulder. The prosthesis, often made of stainless steal combined with polyethylene, re- #12;4 places this glenoid cavity

  10. A method for calibration of bone driver transducers to measure the mastoid Reggie Weece a

    E-Print Network [OSTI]

    Allen, Jont

    2010 Available online xxxx a b s t r a c t When using bone vibrator transducers for clinical a circuit model of the driver, describing it with three frequency-dependent parameters. Once these three circuit model is proposed to better capture the observed behaviors. Ã? 2010 Published by Elsevier B.V. 1

  11. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    The objective of this experiment was to examine the effect of late-onset alcohol abuse on aged bone using the rat model. Thirty female Fischer 344 rats were separated by weights into one of four groups: baseline, alcohol-fed, pair-fed, and pellet...

  12. Calcium balance and bone density in immature horses fed a high protein diet 

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    is easy and non-invasive, the variability among horses is quite high, and thus it is best used for observations of changes in bone density over time for a specific animal. Computer assisted tomography (CAT scan) and dual energy x-ray 7...

  13. From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia

    E-Print Network [OSTI]

    From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia MARINA FAERMAN,1* ALMUT identification; Y chromosome polymorphic markers; sickle cell anemia ABSTRACT The potential and reliability sample, which represented a documented case of sickle cell anemia. -globin gene sequences obtained from

  14. Microfluidic purification and analysis of hematopoietic stem cells from bone Romana Schirhagl,a

    E-Print Network [OSTI]

    Zare, Richard N.

    Microfluidic purification and analysis of hematopoietic stem cells from bone marrow Romana to separate them from a whole-marrow sample. A microfluidic device was fabricated using an integrated membrane are restricted by the limited availability of stem cell sources.2,3 We believe that microfluidics can be used

  15. BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA AND CT

    E-Print Network [OSTI]

    Valero-Cuevas, Francisco

    BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA, osteoporosis is frequently overdiagnosed in children when using dual-energy x-ray absorptiometry (DXA osteoporosis in pediatric populations. (J Pediatr 2005;146:776-9) D ual-energy x-ray absorptiometry (DXA

  16. On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone

    E-Print Network [OSTI]

    Frey, Pascal

    On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone Peter Arbenz on complicated domains composed of often hundreds of millions of voxel elements. The finite element analysis finite element (FE) analysis. The approach based on the FE analysis leads to linear systems of equations

  17. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to recalculate integrated activity over fifty years, U, values, as a function of intake for use in dose calculations for plutonium deposit on bone surfaces. These values were compared with those in ICRP-30 and showed a substantial decrease in the estimated dose...

  18. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling 

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    . Recent data gathered from crew members on the International Space Station (ISS) illustrates the significant losses of bone mineral density (BMD) and geometry of the femoral neck (15). Dual-energy x-ray absorptiometry (DXA) and QCT scans were taken...

  19. Changes in bone morphology and composition following long-term alcohol consumption 

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 ...

  20. A 3D Statistical Shape Model Of The Pelvic Bone For Segmentation

    E-Print Network [OSTI]

    Andrzejak, Artur

    patient models from 3D image data. Within the setting of a hybrid system (applicator plus MR tomograph. Left: hybrid system (MRT plus applicator), Right: MRT slice image from the abdomen with pelvic bone. 1 on heating up affected tissue compartments to temperatures above 42 degree Celsius without damaging

  1. UNIVERSITY OF CALIFORNIA, SANTA CRUZ Humanities Academic Human Resources

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    UNIVERSITY OF CALIFORNIA, SANTA CRUZ Humanities Academic Human Resources VOLUNTARY WORKLOAD/or Spring ____ Quarter(s) Funding Source: ________________________________________ (Salary adjustments

  2. Human Pathogen Importation Importing "Human" Pathogens from Outside Canada

    E-Print Network [OSTI]

    Human Pathogen Importation Importing "Human" Pathogens from Outside Canada 1) Permits be obtained from the Public Health Agency Canada (PHAC) to facilitate customs clearance. 2) If a permit

  3. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    SciTech Connect (OSTI)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17T23:59:59.000Z

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates ?-catenin and RUNX2. -- Abstract: Wnt/?-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of ?-catenin and RUNX2, as well as inhibiting the nuclear translocation of ?-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  4. Associate Vice President Human Resources

    E-Print Network [OSTI]

    Arnold, Jonathan

    Associate Vice President Human Resources Enjoy Athens! Great schools Affordable housing Eclectic Vice President for Human Resources. This position reports directly to the Vice President for Finance and Administration and provides leadership for the University's human resources programs and services

  5. Human Resources Simon Fraser University

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Human Resources Simon Fraser University Administrative and Professional Staff Job Description A. Identification Position Number: 31482 Position Title: Administrative Assistant (Human Resources Liaison) Name guidance, direction, coordination and effective management and implementation of SFU's Human Resources

  6. Special Issue on Human Computing

    E-Print Network [OSTI]

    Nijholt, Anton

    The seven articles in this special issue focus on human computing. Most focus on two challenging issues in human computing, namely, machine analysis of human behavior in group interactions and context-sensitive modeling.

  7. Parahippocampal and retrosplenial contributions to human spatial

    E-Print Network [OSTI]

    Epstein, Russell A.

    navigational tasks and also during passive viewing of navigationally relevant stimuli such as environmental parahippocampal and retro- splenial cortices [4­10], regions that also respond strongly during passive viewing' or `house' area [13,14,22], its response to buildings is smaller than the response to scenes [11

  8. Global Environmental Change and Human Security

    E-Print Network [OSTI]

    Kunnas, Jan

    2011-01-01T23:59:59.000Z

    with human rights, human security or environmental change ifEnvironmental Change and Human Security By Matthew, RichardChange and Human Security. Cambridge, Massachusetts &

  9. The Evolution of Human Cooperation

    E-Print Network [OSTI]

    Gintis, Herbert; Doebeli, Michael; Flack, Jessica

    2012-01-01T23:59:59.000Z

    684 Gintis, H. 2011. The Evolution of Human Cooperation.misunderstandings about cultural evolution. Human Nat. 19,Feldman, M. , 1981. Cultural Evolution. Princeton University

  10. Human Resource Management Delegation

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1996-06-28T23:59:59.000Z

    The notice is to clarifies and updates existing Human Resource Management Delegation Authorities and the levels to which they are delegated. Expired 6-28-97. Does not cancel any directives.

  11. Protection of Human Subjects

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-12-20T23:59:59.000Z

    The Policy is to establish DOE-specific principles for the protection of human subjects involved in DOE research. Cancels DOE P 443.1. Canceled by DOE O 443.1B

  12. Protection of Human Subjects

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-05-15T23:59:59.000Z

    The purpose of this Policy is to establish DOE-specific policy for the protection of human subjects involved in DOE research. Canceled by DOE P 443.1A.

  13. Human Reliability Program Overview

    SciTech Connect (OSTI)

    Bodin, Michael

    2012-09-25T23:59:59.000Z

    This presentation covers the high points of the Human Reliability Program, including certification/decertification, critical positions, due process, organizational structure, program components, personnel security, an overview of the US DOE reliability program, retirees and academia, and security program integration.

  14. Developing Human Performance Measures

    SciTech Connect (OSTI)

    Jeffrey Joe; Bruce Hallbert; Larry Blackwood; Donald Dudehoeffer; Kent Hansen

    2006-05-01T23:59:59.000Z

    Through the reactor oversight process (ROP), the U.S. Nuclear Regulatory Commission (NRC) monitors the performance of utilities licensed to operate nuclear power plants. The process is designed to assure public health and safety by providing reasonable assurance that licensees are meeting the cornerstones of safety and designated crosscutting elements. The reactor inspection program, together with performance indicators (PIs), and enforcement activities form the basis for the NRC’s risk-informed, performance based regulatory framework. While human performance is a key component in the safe operation of nuclear power plants and is a designated cross-cutting element of the ROP, there is currently no direct inspection or performance indicator for assessing human performance. Rather, when human performance is identified as a substantive cross cutting element in any 1 of 3 categories (resources, organizational or personnel), it is then evaluated for common themes to determine if follow-up actions are warranted. However, variability in human performance occurs from day to day, across activities that vary in complexity, and workgroups, contributing to the uncertainty in the outcomes of performance. While some variability in human performance may be random, much of the variability may be attributed to factors that are not currently assessed. There is a need to identify and assess aspects of human performance that relate to plant safety and to develop measures that can be used to successfully assure licensee performance and indicate when additional investigation may be required. This paper presents research that establishes a technical basis for developing human performance measures. In particular, we discuss: 1) how historical data already gives some indication of connection between human performance and overall plant performance, 2) how industry led efforts to measure and model human performance and organizational factors could serve as a data source and basis for a framework, 3) how our use of modeling and simulation techniques could be used to develop and validate measures of human performance, and 4) what the possible outcomes are from this research as the modeling and simulation efforts generate results.

  15. Adult equine bone-marrow stromal cells produce a cartilage-like ECM superior to animal-matched adult chondrocytes

    E-Print Network [OSTI]

    Kisiday, John D.

    Our objective was to evaluate the age-dependent mechanical phenotype of bone marrow stromal cell- (BMSC-) and chondrocyte-produced cartilage-like neo-tissue and to elucidate the matrix-associated mechanisms which generate ...

  16. Rational design to control multipotent stromal cell migration for applications in bone tissue engineering and injury repair

    E-Print Network [OSTI]

    Wu, Shan, Ph. D. Massachusetts Institute of Technology

    2011-01-01T23:59:59.000Z

    Multipotent stromal cells derived from bone marrow hold great potential for tissue engineering applications because of their ability to home to injury sites and to differentiate along mesodermal lineages to become osteocytes, ...

  17. Regional geologic characterization of the Second Bone Spring Sandstone, Delaware basin, Lea and Eddy Counties, New Mexico

    E-Print Network [OSTI]

    Downing, Amanda Beth

    2001-01-01T23:59:59.000Z

    The Bone Spring Formation is a series of interbedded siliciclastics and carbonates that were deposited in the Delaware basin during the Leonardian (Early Permian). It consists of the First, Second and Third Carbonate and the First, Second and Third...

  18. Adaptations of Trabecular Bone to Low Magnitude Vibrations Result in More Uniform Stress and Strain Under Load

    E-Print Network [OSTI]

    magnitude mechanical stimuli 10 microstrain induced at high frequencies are anabolic to trabe- cular bone strain or stress , the resultant stresses and strains within trabe- culae were more uniformly distributed

  19. Gary M. Bone, Andrew Lambert and Mark Edwards Abstract This paper describes the development of a novel

    E-Print Network [OSTI]

    Bone, Gary

    Gary M. Bone, Andrew Lambert and Mark Edwards Abstract ­ This paper describes the development from the top of a pile was described by Taylor, Blake and Cox [3]. They used a wrist-mounted camera

  20. Effect of dietary calcium and phosphorus levels on performance and bone development of large-framed developing boars

    E-Print Network [OSTI]

    Robinson, Robert Glen

    1975-01-01T23:59:59.000Z

    in determining bone strength. His expertise and willingness to help on short notice many times under adverse conditions will always be remembered. Special recognition is also due and gratefully given to personal friends Darrell Knabe and Edward Gregg...

  1. Potential commercial application of a bi-layer bone-ligament regeneration scaffold to anterior cruciate ligament replacement

    E-Print Network [OSTI]

    Li, Jessica C. (Jessica Ching-Yi)

    2006-01-01T23:59:59.000Z

    A business model was created in order to explore the commercial application of a bi-layer bone-ligament scaffold to the treatment of torn anterior cruciate ligaments (ACL) requiring replacement. The two main keys in producing ...

  2. Computational Mechanics manuscript No. (will be inserted by the editor)

    E-Print Network [OSTI]

    Boyer, Edmond

    applied to a simple case of fatigue dam- age and a real cortical bone microstructure. A significant in a reduction in strength and stiffness and can lead to bone failure incrementally through the process is to repair inadapted cortical bone by resorbing it then forming new one to prevent it from failure

  3. CONSTRUCTING VIRTUAL HUMAN LIFE SIMULATIONS

    E-Print Network [OSTI]

    Kallmann, Marcelo

    , Virtual Environments, Behavioral Animation, Object Interaction, Python. 1. INTRODUCTION Virtual humanCONSTRUCTING VIRTUAL HUMAN LIFE SIMULATIONS Marcelo Kallmann, Etienne de Sevin and Daniel Thalmann human life simulations. Our main goal is to have virtual human actors living and working autonomously

  4. Intra-arterial Autologous Bone Marrow Cell Transplantation in a Patient with Upper-extremity Critical Limb Ischemia

    SciTech Connect (OSTI)

    Madaric, Juraj, E-mail: jurmad@hotmail.com [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia)] [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia); Klepanec, Andrej [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia); Mistrik, Martin [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia)] [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia); Altaner, Cestmir [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia)] [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia); Vulev, Ivan [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)

    2013-04-15T23:59:59.000Z

    Induction of therapeutic angiogenesis by autologous bone marrow mononuclear cell transplantation has been identified as a potential new option in patients with advanced lower-limb ischemia. There is little evidence of the benefit of intra-arterial cell application in upper-limb critical ischemia. We describe a patient with upper-extremity critical limb ischemia with digital gangrene resulting from hypothenar hammer syndrome successfully treated by intra-arterial autologous bone marrow mononuclear cell transplantation.

  5. Characterization of host lymphoid cells in antibody-facilitated bone marrow chimeras

    SciTech Connect (OSTI)

    McCarthy, S.A.; Griffith, I.J.; Gambel, P.; Francescutti, L.H.; Wegmann, T.G.

    1985-07-01T23:59:59.000Z

    The authors have produced stable murine antibody-facilitated (AF) chimeras by the simultaneous injection of P1 bone marrow cells and anti-P2 monoclonal antibody into normal (unirradiated) adult (P1 X P2)F1 recipients. These AF chimeras are healthy, long-lived, and exhibit no overt signs of graft-versus-host disease. They are immunocompetent and tolerant of host, P2-encoded alloantigens. Donor cell engraftment and takeover, monitored by glucosephosphate isomerase isozyme patterns, is usually complete (greater than 95%) in the peripheral blood, bone marrow, and hemopoietic stem cell compartments of long-term (greater than 3 months posttransplantation) AF chimeras. The authors report here, however, that splenic, lymph node, and thymic leukocytes of AF chimeras represent donor/host chimeric populations. Spleen cell populations of AF chimeras exhibit substantial chimera-to-chimera variation in the preponderant residual host cell type(s) present. Interpretations of the implications of these findings are discussed.

  6. Treatment of Extraspinal Painful Bone Metastases with Percutaneous Cementoplasty: A Prospective Study of 50 Patients

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment, Interventional Radiology Unit (Italy); Ortega, Cinzia; Grignani, Giovanni [Institute for Cancer Research and Treatment, Oncology Unit (Italy); DeBernardi, Felicino [Institute for Cancer Research and Treatment, Anesthesiology Unit (Italy); Regge, Daniele [Institute for Cancer Research and Treatment, Radiology Unit (Italy)

    2008-11-15T23:59:59.000Z

    The aim of this study was to assess the efficacy of percutaneous cementoplasty (PC) with polymethylmethacrylate (PMMA) in painful extravertebral lytic bone metastases not responding to conventional therapy. Fifty patients (25 females), mean age 64.7 {+-} 11.2 years, underwent PC after giving informed consent. Procedures were performed under fluoroscopy (1/50) or combined fluoroscopy-CT (49/50) guidance in local anesthesia or under deep sedation in 7 patients with large metastases who underwent radiofrequency thermoablation (RFA) in the same session. Seventy lesions were treated (1-6 per patient; average, 1.4 {+-} 0.9), arranging in size from 1 to 10 cm (average, 3.6 {+-} 2.1 cm). Mean volume of PMMA per lesion was 5.9 {+-} 3.2 ml (range, 1.5-15.0 ml). Pain was prospectively evaluated on an 11-point visual analog scale (VAS) before and after the procedure (follow-up, 15 to 36 months). Mean VAS score dropped from 9.1 {+-} 1.2 (range: 6-10) to 2.1 {+-} 2.5 (range: 0-9). Mean VAS difference was 7.0 {+-} 2.3 (range, 1-10; p < 0.0001, Wilcoxon signed rank test). Forty-seven of the 50 patients (94%) suspended narcotic drugs, in 22 (44%) pain was controlled with a nonsteroidal anti-inflammatory drug, in 25 (50%) analgesic therapy was suspended, and 13 of 50 (26%) had complete pain regression. In 3 of the 50 patients (6%) pain was not improved. No statistical difference between osteoplasty and osteoplasty plus RFA was found (p = 0.8338, Mann-Whitney test). No complications arose during the procedure. Two patients with metastases in the femoral diaphysis reported a fracture 1 month after treatment. PC is effective to obtain pain regression in painful bone metastases not responding to conventional analgesic therapy; bone consolidation cannot be obtained in the diaphysis of long weight-bearing bones.

  7. Bone Implant Interface Investigation by Synchrotron Radiation X-Ray Microfluorescence

    SciTech Connect (OSTI)

    Calasans-Maia, M. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Sales, E.; Lopes, R. T. [Nuclear Instrumentation Laboratory-PEN/COPPE, Federal Univeristy of Rio de Janeiro, Rio de Janeiro 21941-914, RJ (Brazil); Granjeiro, J. M. [Department of Cell and Molecular Biology, Fluminense Federal University, Niteroi 24030-900, RJ (Brazil); Lima, I. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Department of Mechanical Engineering and Energy, Rio de Janeiro State University, Regional Campus-Polytechnic Institute-Alberto Rangel, s/n, Vila Nova, room 308, 28630-050, Nova Friburgo, RJ (Brazil)

    2010-04-06T23:59:59.000Z

    Zinc is known to play a relevant role in growth and development; it has stimulatory effects on in vitro and in vivo bone formation and an inhibitory effect on in vitro osteoclastic bone resorption. The inorganic component of the bone tissue is nonstoichiometric apatite; changes in the composition of hidroxyapatite are subject of studies in order to improve the tissue response after implantation. The objective of this study was to investigate the effect of 0.5% zinc-containing hydroxyapatite in comparison to hydroxyapatite on osseous repair of rabbit's tibia. Cylinders (2x6 mm) of both materials were produced according to the specification of the International Organization for Standardization. Ethics Commission on Teaching and Research in Animals approved this project (HUAP-195/06). Fifteen White New Zealand rabbits were submitted to general anesthesia and two perforations (2 mm) were made in each tibia for implantation of zinc-containing hydroxyapatite cylinders (left tibia) and hydroxyapatite cylinders (right tibia). After 1, 2 and 4 weeks, the animals were killed and one fragment of each tibia with the cylinder was collected and embedded in a methacrylate-based resin and cut into slices (approx200 {mu}m thickness), parallel to the implant's long axis with a precision diamond saw for Synchrotron Radiation X-ray Microfluorescence investigation. The accomplishment of the standard procedures helped the planning, execution and the comparative analysis of the results. The chemical and physical properties of the biomaterials were modified after its implantation and the incorporation of zinc. Both materials are biocompatible and promote osteoconduction and favored bone repair.

  8. The Relation of Lime and Phosphoric Acid to the Growth and Bone Development of White Rats.

    E-Print Network [OSTI]

    Blum, J. K. (Joseph Kelly)

    1931-01-01T23:59:59.000Z

    LIBRARY, A & M COLLEGE. CAMPUS. TEXAS AGRICULTURAL EXPERIMENT STATION A. B. CONNER, DIRECTOR College Station, Brazos County, Texas BULLETIN NO. 441 DECEMBER, 1931 DIVISION OF CHEMISTRY The Relation of Lime and Phosphoric Acid to the Growth... and Bone Development of White Rats 2 ., .t .I* .-. /.' AGRICULTURAL AND MECHANICAL COLLEGE OF TEXAS--. .. T. 0. WALTON, President ..- STATION STAFF+ ADMINISTRATION: VETERINARY SCIENCE: A B. CONNER M S. Director *M. FRANCIS, D. V. M., Chief. R: E...

  9. Automatic detection of bone fragments in poultry using multi-energy x-rays

    DOE Patents [OSTI]

    Gleason, Shaun S. (Knoxville, TN); Paulus, Michael J. (Knoxville, TN); Mullens, James A. (Knoxville, TN)

    2002-04-09T23:59:59.000Z

    At least two linear arrays of x-ray detectors are placed below a conveyor belt in a poultry processing plant. Multiple-energy x-ray sources illuminate the poultry and are detected by the detectors. Laser profilometry is used to measure the poultry thickness as the x-ray data is acquired. The detector readout is processed in real time to detect the presence of small highly attenuating fragments in the poultry, i.e., bone, metal, and cartilage.

  10. Functional Interference Clusters in Cancer Patients With Bone Metastases: A Secondary Analysis of RTOG 9714

    SciTech Connect (OSTI)

    Chow, Edward, E-mail: Edward.Chow@sunnybrook.c [Odette Cancer Centre, Toronto, ON (Canada); James, Jennifer [RTOG Statistical Center, Philadelphia, PA (United States); Barsevick, Andrea [Fox Chase Cancer Center, Cheltenham, PA (United States); Hartsell, William [Good Samaritan Cancer Center, Downers Grove, IL (United States); Ratcliffe, Sarah [University of Pennsylvania School of Medicine, Philadelphia, PA (United States); Scarantino, Charles [Rex Healthcare Cancer Center, Raleigh, NC (United States); Ivker, Robert [Newark Beth Israel Medical Center, Newark, NJ (Israel); Roach, Mack [UCSF Comprehensive Cancer Center, San Francisco, CA (United States); Suh, John [Cleveland Clinic Foundation, Cleveland, OH (United States); Petersen, Ivy [Mayo Clinic, Rochester, MN (United States); Konski, Andre [Fox Chase Cancer Center, Cheltenham, PA (United States); Demas, William [Akron City Hospital Cancer Care Center, Inc., Akron, OH (United States); Bruner, Deborah [Abramson Cancer Center, Philadelphia, PA (United States)

    2010-04-15T23:59:59.000Z

    Purpose: To explore the relationships (clusters) among the functional interference items in the Brief Pain Inventory (BPI) in patients with bone metastases. Methods: Patients enrolled in the Radiation Therapy Oncology Group (RTOG) 9714 bone metastases study were eligible. Patients were assessed at baseline and 4, 8, and 12 weeks after randomization for the palliative radiotherapy with the BPI, which consists of seven functional items: general activity, mood, walking ability, normal work, relations with others, sleep, and enjoyment of life. Principal component analysis with varimax rotation was used to determine the clusters between the functional items at baseline and the follow-up. Cronbach's alpha was used to determine the consistency and reliability of each cluster at baseline and follow-up. Results: There were 448 male and 461 female patients, with a median age of 67 years. There were two functional interference clusters at baseline, which accounted for 71% of the total variance. The first cluster (physical interference) included normal work and walking ability, which accounted for 58% of the total variance. The second cluster (psychosocial interference) included relations with others and sleep, which accounted for 13% of the total variance. The Cronbach's alpha statistics were 0.83 and 0.80, respectively. The functional clusters changed at week 12 in responders but persisted through week 12 in nonresponders. Conclusion: Palliative radiotherapy is effective in reducing bone pain. Functional interference component clusters exist in patients treated for bone metastases. These clusters changed over time in this study, possibly attributable to treatment. Further research is needed to examine these effects.

  11. An experimental study of diffusional properties of small ions and nonelectrolytes in compact bone 

    E-Print Network [OSTI]

    Bilge, Huseyin Fertac

    1978-01-01T23:59:59.000Z

    in mineralized tissue is lacking, and no direct measurement of the diffusion coefficient in bone has been reported. RESEARCH OBJECTIVES The overall objective of this investigation was to experimentally determine selected passive mass transport properties... The objective of the research reported was tn determine the diffu- sion coefficients of Na , urea, and glucose and permeability of water through compact hone. The methodology used involved construction of diffusion cells for controlled diffusion...

  12. Growth and bone development in weanling quarter horses fed diets supplemented with sodium zeolite-A

    E-Print Network [OSTI]

    Frey, Kimberly Suzanne

    1991-01-01T23:59:59.000Z

    ) possibly due to SZA's high ion-exchange capabilities (Roland, 1985; Miles, 1986); however, natural zeolites have not been shown to improve egg shell quality especially in diets low in calcium (Nakaue and Koelliker, 1981). This could be due...GROWTH AND BONE DEVELOPMENT IN WEANLING QUARTER HORSES FED DIETS SUPPLEMENTED WITH SODIUM ZEOLITE-A A Thesis by KIMBERLY SUZANNE FREY Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

  13. Immunization with FSH? fusion protein antigen prevents bone loss in a rat ovariectomy-induced osteoporosis model

    SciTech Connect (OSTI)

    Geng, Wenxin; Yan, Xingrong; Du, Huicong; Cui, Jihong; Li, Liwen, E-mail: liven@nwu.edu.cn; Chen, Fulin, E-mail: chenfl@nwu.edu.cn

    2013-05-03T23:59:59.000Z

    Highlights: •A GST-FSH fusion protein was successfully expressed in E. coli. •Immunization with GST-FSH antigen can raise high-titer anti-FSH polyclonal sera. •Anti-FSH polyclonal sera can neutralize osteoclastogenic effect of FSH in vitro. •FSH immunization can prevent bone loss in a rat osteoporosis model. -- Abstract: Osteoporosis, a metabolic bone disease, threatens postmenopausal women globally. Hormone replacement therapy (HTR), especially estrogen replacement therapy (ERT), is used widely in the clinic because it has been generally accepted that postmenopausal osteoporosis is caused by estrogen deficiency. However, hypogonadal ? and ? estrogen receptor null mice were only mildly osteopenic, and mice with either receptor deleted had normal bone mass, indicating that estrogen may not be the only mediator that induces osteoporosis. Recently, follicle-stimulating hormone (FSH), the serum concentration of which increases from the very beginning of menopause, has been found to play a key role in postmenopausal osteoporosis by promoting osteoclastogenesis. In this article, we confirmed that exogenous FSH can enhance osteoclast differentiation in vitro and that this effect can be neutralized by either an anti-FSH monoclonal antibody or anti-FSH polyclonal sera raised by immunizing animals with a recombinant GST-FSH? fusion protein antigen. Moreover, immunizing ovariectomized rats with the GST-FSH? antigen does significantly prevent trabecular bone loss and thereby enhance the bone strength, indicating that a FSH-based vaccine may be a promising therapeutic strategy to slow down bone loss in postmenopausal women.

  14. CANDU human performance analysis

    SciTech Connect (OSTI)

    Walker, I.

    1987-01-01T23:59:59.000Z

    An evaluation of human performance is presented in this paper in the context of the operational safety management system. To focus on problems, an experience review program has been developed to establish trends, demonstrate the degree of compliance with standards, and determine the causes of poor performance. The primary method by which the experience review takes place is significant event reporting (SER). A significant event is an incident that causes an undesirable effect on safety, product quality, environmental protection, or product cost. In spite of advanced technology and the degree of automation of the Canada deuterium uranium (CANDU) design, mistakes and malfunctions to occur. Considerable effort has been made to prevent or reduce the incidence of error. The Institute of Nuclear Power Operations developed a system to analyze human error, called the Human Performance Evaluation System (HPES). To encourage an open exchange of information, the system is anonymous and nonpunitive. All data gathered during HPES evaluations are kept confidential.

  15. Human MSH2 protein

    DOE Patents [OSTI]

    de la Chapelle, Albert (Helsingfors, FI); Vogelstein, Bert (Baltimore, MD); Kinzler, Kenneth W. (Baltimore, MD)

    1997-01-01T23:59:59.000Z

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  16. Human MSH2 protein

    DOE Patents [OSTI]

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-01-07T23:59:59.000Z

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  17. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab GroupHuman Resources Human Resources

  18. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab GroupHuman Resources Human Resources

  19. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab GroupHuman Resources Human

  20. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab GroupHuman Resources Human print

  1. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab GroupHuman Resources Human

  2. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab GroupHuman Resources HumanAppraisal

  3. Human Processing (Position Paper)

    E-Print Network [OSTI]

    Chang, Edward Y.

    and describe remaining challenges in the area (Section 6). 2. MOTIVATING EXAMPLE "Priam," the editor below, we explain how Priam might go about accomplishing this task. Figure 1: Basic Buyer human. The programmer (Priam) writes a normal program. 2. That program can, in the course of execution, create HTML

  4. Adsorption of Human Papillomavirus 16 to live human sperm

    E-Print Network [OSTI]

    Ribbeck, Katharina

    Human Papillomaviruses (HPVs) are a diverse group of viruses that infect the skin and mucosal tissues of humans. A high-risk subgroup of HPVs is associated with virtually all cases of cervical cancer [1]–[3]. High-risk ...

  5. Assessment of trabecular bone structure using MDCT: comparison of 64- and 320-slice CT using HR-pQCT as the reference standard

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    slice MDCT . HR-pQCT . Osteoporosis . Structure analysis .bone Introduction Osteoporosis is defined as a systemicmethod in current osteoporosis diagnosis is the assessment

  6. Policy on Human Subjects Research Policy on Human Subjects

    E-Print Network [OSTI]

    Sridhar, Srinivas

    Policy on Human Subjects Research 10/15/2014 Policy on Human Subjects Research I. Purpose and Scope requirements that the rights and welfare of human subjects receive adequate protection. This policy applies, except that research conducted or assigned as part of their coursework is governed by the Policy

  7. Sequential Causal Learning in Humans and Rats

    E-Print Network [OSTI]

    Lu, Hongjing; Rojas, Randall R.; Beckers, Tom; Yuille, Alan

    2008-01-01T23:59:59.000Z

    selection, to a human experiment that employed pretraining (group (white) in human experiment by Beckers et al. (2005).set used for the human experiments, we increased the

  8. Sequential Causal Learning in Humans and Rats

    E-Print Network [OSTI]

    Hongjing Lu; Randall R. Rojas; Tom Beckers; Alan Yuille

    2011-01-01T23:59:59.000Z

    selection, to a human experiment that employed pretraining (group (white) in human experiment by Beckers et al. (2005).set used for the human experiments, we increased the

  9. Expression of T cell antigen receptor genes in the thymus of irradiated mice after bone marrow transplantation

    SciTech Connect (OSTI)

    Matsuzaki, G.; Yoshikai, Y.; Kishihara, K.; Nomoto, K.

    1988-01-15T23:59:59.000Z

    Sequential appearance of the expression of T cell antigen receptor genes was investigated in the thymus of irradiated mice at the early stage after transplantation of Thy-1 congeneic H-2 compatible allogeneic bone marrow cells. The first cells to repopulate the thymus on day 7 after bone marrow transplantation were intrathymic radioresistant T cell precursors, which expanded mainly to CD4+CD8+ host-type thymocytes by day 14. A high level of gamma gene expression but a much reduced level of alpha and beta gene expression were detected in the host-type thymocytes on day 7. During regeneration of these cells, gamma-chain messages fell to low level and alpha and beta mRNA levels increased. The thymus of the recipients began to be repopulated by donor-derived T cells about 2 wk after bone marrow transplantation and was almost completely replaced by the third week. An ordered expression of gamma then beta and alpha-chain gene transcript was also observed in the donor-type thymocytes at the early stage after bone marrow transplantation. The use of thymocytes at early stage in whole-body irradiated bone marrow chimera provides a pertinent source for investigating the molecular mechanism of T cell differentiation in adult thymus.

  10. Human Capital Management Accountability Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2008-08-01T23:59:59.000Z

    The Order establishes requirements, roles and responsibilities for the Human Capital Management Accountability Program (HCMAP) for human resources programs and personnel and ensures that human capital activities are regulatory and procedurally compliant with Federal statutes and Departmental policies. Does not cancel other directives.

  11. Understanding Human Experience Henry Kautz

    E-Print Network [OSTI]

    Kautz, Henry

    Understanding Human Experience Henry Kautz One of the earliest goals of research in artificial intelligence was to create systems that can interpret and understand day to day human experience. Early work on the goal of building systems that understand human experience. Each of the previous barriers is weakened

  12. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis 

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: . Wayn ampson (Co-Chair of Committee) Joanne R. Lupton (Co-Chair of Committee) kfa A. Hog (Member) John E. Bauer ( air of Faculty of Nutrition) Brya . hn (Head... dehydrated within a vacuum by an ethanol gradient of 70 10 to 100'/o over four days, followed by two-24-hour acetone steps, and then embedded in methyl methacrylate. " Using a Jung Polycut E microtome (Leica, Germany), the plastic-embedded bones were...

  13. A parametric analysis of bone fixation plates on fractured equine third metacarpal

    E-Print Network [OSTI]

    Ray, Donald Reagan

    1970-01-01T23:59:59.000Z

    of metallic materials, were also being investigated and tried clinically. The earliesr types of metal plates to be used were made of nickel-steel, iron, or silver (1). These early plates were generally attached to the fractured Numbers in parentheses...A P~TRIC ANALYSIS OI' BONE FIXATION PLATES ON FRACTURED EQUINE THIRD lKTACARPAL A Thesis by Donald Reagan Ray Submitted to tnk Graduate College of Texas A&N University in partial fulfillment of the requirement for the degree of MASTER...

  14. Biochemical markers of bone modeling and remodeling in juvenile racehorses at varying mineral intakes

    E-Print Network [OSTI]

    Eller, Elena Maria

    2007-09-17T23:59:59.000Z

    . Resorption begins with recruitment of preosteoclasts, followed by differentiation into mature osteoclasts that then attach to the skeletal surface (Kleerekoper, 1996). During resorption (or demineralization) mineral is removed from the skeleton creating a... levels in the diet not be allowed to exceed Ca levels as ratios of Ca:P less than 1:1 appear to inhibit Ca absorption (NRC, 1989). Although Mg does not comprise as great a percentage of bone as do both Ca and P, 60% of the Mg in the body 8...

  15. Expression of human cytokines dramatically improves reconstitution of specific human-blood lineage cells in humanized mice

    E-Print Network [OSTI]

    Chen, Qingfeng

    Adoptive transfer of human hematopoietic stem cells (HSCs) into mice lacking T, B and natural killer (NK) cells leads to development of human-blood lineage cells in the recipient mice (humanized mice). Although human B ...

  16. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    SciTech Connect (OSTI)

    Gao Donghong [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States); Mondal, Tapan K. [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States); Lawrence, David A. [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States)]. E-mail: lawrencd@wadsworth.org

    2007-07-01T23:59:59.000Z

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) {+-} PbCl{sub 2}. At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS {+-} Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-{alpha} levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway.

  17. Essential requirement of I-A region-identical host bone marrow or bone marrow-derived cells for tumor neutralization by primed L3T4+ T cells

    SciTech Connect (OSTI)

    Ozawa, H.; Iwaguchi, T.; Kataoka, T.

    1987-12-01T23:59:59.000Z

    The antitumor activity of Meth A-hyperimmunized BALB/c mouse spleen cells (Meth A-Im-SPL) was assayed by the Winn test in H-2 incompatible bone marrow chimeras in closed colony CD-1 (nu/nu), inbred DDD/1(nu/nu) (H-2s), or inbred BALB/c(nu/nu) (H-2d) mice as recipients. We found that Meth A-Im-SPL suppressed Meth A growth in the chimera nude mice which were reconstituted with bone marrow cells of the H-2d haplotype (i.e., BALB/c, DBA/2 and B10.D2), but not in the chimeras which were reconstituted with bone marrow cells of the H-2a, H-2b, or H-2k haplotype (i.e., B10.A, B10, and B10.BR). These results suggested that H-2 restriction occurred between Meth A-Im-SPL and bone marrow or bone marrow-derived cells in tumor neutralization. Furthermore, Meth A-Im-SPL did not suppress Meth 1 tumors (antigenically distinct from Meth A tumors) in the presence or absence of mitomycin C-treated Meth A in a Winn assay. These results suggested that there is tumor specificity in the effector phase as well as in the induction phase. The phenotype of the effectors in the Meth A-Im-SPL was Thy-1.2+ and L3T4+, because Meth A-Im-SPL lost their antitumor activity with pretreatment with anti-Thy-1.2 monoclonal antibody (mAb) and complement or anti-L3T4 mAb and complement, but not with anti-Lyt-2.2 mAb and complement or complement alone. Positively purified L3T4+ T cells from Meth A-Im-SPL (Meth A-Im-L3T4), obtained by the panning method, suppressed the tumor growth in the chimera nude mice which were reconstituted with bone marrow cells of B10.KEA2 mice (that were I-A region-identical with Meth A-Im-L3T4 cells but not others in H-2) as well as B10.D2 cells (that were fully identical with Meth A-Im-L3T4 cells in H-2). We conclude that Meth A-Im-SPL (L3T4+) neutralized the tumors in collaboration with I-A region-identical host bone marrow or bone marrow-derived cells, and the neutralization was not accompanied by the bystander effect.

  18. Human Resources Organizational Development and Training 1

    E-Print Network [OSTI]

    Dennett, Daniel

    Human Resources Organizational Development and Training 1 Development Guide for Tufts Leadership Competencies Human Resources Training, Learning and Development Copyright © 2013 Tufts University Developed with Copperbeech Group Inc. #12;Human Resources Training, Learning and Development 2 #12;Human Resources Training

  19. Activity Recognition for Natural Human Robot Interaction

    E-Print Network [OSTI]

    Ravindran, Balaraman

    Activity Recognition for Natural Human Robot Interaction Addwiteey Chrungoo1 , SS Manimaran between humans and robots. While humans can distinguish between communicative actions and activities of daily living, robots cannot draw such inferences effectively. To allow intuitive human robot interaction

  20. PIA - Human Resources - Personal Information Change Request ...

    Office of Environmental Management (EM)

    PIA - Human Resources - Personal Information Change Request - Idaho National Engineering Laboratory PIA - Human Resources - Personal Information Change Request - Idaho National...

  1. The Human Equation

    E-Print Network [OSTI]

    Natale, Michael J.

    the smaller cloaked vessel before she had a chance to de-cloak and fire, the Enterprise had virtually disabled the scoutship. Now, the innocent people on Omnicron I could at least get a break from the barrage of disrupter fire from orbit, and the Enterprise... into destroying the Klingon vessel. But, if they were going to threaten innocents on Omnicron I, then the Enterprise could play the role of executioner adequately. "Mr. Sulu, fire main phasers!" "Locking phasers.....firing, sir!" The Human Equation Page...

  2. Human portable preconcentrator system

    DOE Patents [OSTI]

    Linker, Kevin L. (Albuquerque, NM); Bouchier, Francis A. (Albuquerque, NM); Hannum, David W. (Albuquerque, NM); Rhykerd, Jr., Charles L. (Albuquerque, NM)

    2003-01-01T23:59:59.000Z

    A preconcentrator system and apparatus suited to human portable use wherein sample potentially containing a target chemical substance is drawn into a chamber and through a pervious screen. The screen is adapted to capture target chemicals and then, upon heating, to release those chemicals into the chamber. Chemicals captured and then released in this fashion are then carried to a portable chemical detection device such as a portable ion mobility spectrometer. In the preferred embodiment, the means for drawing sample into the chamber comprises a reversible fan which, when operated in reverse direction, creates a backpressure that facilitates evolution of captured target chemicals into the chamber when the screen is heated.

  3. Human Genome Program

    SciTech Connect (OSTI)

    Not Available

    1993-01-01T23:59:59.000Z

    The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

  4. Mentoring Human Performance - 12480

    SciTech Connect (OSTI)

    Geis, John A.; Haugen, Christian N. [CALIBRE Systems, Inc., Alexandria, Virginia (United States)

    2012-07-01T23:59:59.000Z

    Although the positive effects of implementing a human performance approach to operations can be hard to quantify, many organizations and industry areas are finding tangible benefits to such a program. Recently, a unique mentoring program was established and implemented focusing on improving the performance of managers, supervisors, and work crews, using the principles of Human Performance Improvement (HPI). The goal of this mentoring was to affect behaviors and habits that reliably implement the principles of HPI to ensure continuous improvement in implementation of an Integrated Safety Management System (ISMS) within a Conduct of Operations framework. Mentors engaged with personnel in a one-on-one, or one-on-many dialogue, which focused on what behaviors were observed, what factors underlie the behaviors, and what changes in behavior could prevent errors or events, and improve performance. A senior management sponsor was essential to gain broad management support. A clear charter and management plan describing the goals, objectives, methodology, and expected outcomes was established. Mentors were carefully selected with senior management endorsement. Mentors were assigned to projects and work teams based on the following three criteria: 1) knowledge of the work scope; 2) experience in similar project areas; and 3) perceived level of trust they would have with project management, supervision, and work teams. This program was restructured significantly when the American Reinvestment and Recovery Act (ARRA) and the associated funding came to an end. The program was restructured based on an understanding of the observations, attributed successes and identified shortfalls, and the consolidation of those lessons. Mentoring the application of proven methods for improving human performance was shown effective at increasing success in day-to-day activities and increasing confidence and level of skill of supervisors. While mentoring program effectiveness is difficult to measure, and return on investment is difficult to quantify, especially in complex and large organizations where the ability to directly correlate causal factors can be challenging, the evidence presented by Sydney Dekker, James Reason, and others who study the field of human factors does assert managing and reducing error is possible. Employment of key behaviors-HPI techniques and skills-can be shown to have a significant impact on error rates. Our mentoring program demonstrated reduced error rates and corresponding improvements in safety and production. Improved behaviors are the result, of providing a culture with consistent, clear expectations from leadership, and processes and methods applied consistently to error prevention. Mentoring, as envisioned and executed in this program, was effective in helping shift organizational culture and effectively improving safety and production. (authors)

  5. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab Group Gets 10JeffersonHuman Resources

  6. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab Group Gets 10JeffersonHuman

  7. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab Group Gets 10JeffersonHumanAppraisal

  8. Jefferson Lab Human Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 InvestigationLab Group Gets 10JeffersonHumanAppraisalHR

  9. ARM - Human Causes

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006Datastreamstwrcam40m DocumentationJanuary 9, 2009 [Events, FeatureListGeneral ChangesFieldVisitorListHuman

  10. Evaluation of Transverse, Bodily Tooth Movement and Its Effects on the Surrounding Hard Tissue

    E-Print Network [OSTI]

    Capps, Chad Jason

    2014-05-01T23:59:59.000Z

    Orthodontic expansion has been associated with uncontrolled tipping and alveolar bone loss. Recent research evaluating orthodontic expansion has shown osteoblastic activity on the buccal cortical bone apical to the dehiscence. We hypothesize...

  11. Trichodermin induces cell apoptosis through mitochondrial dysfunction and endoplasmic reticulum stress in human chondrosarcoma cells

    SciTech Connect (OSTI)

    Su, Chen-Ming [Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan (China); Wang, Shih-Wei [Department of Medicine, Mackay Medical College, New Taipei City, Taiwan (China); Lee, Tzong-Huei [Graduate Institute of Pharmacognosy, Taipei Medical University, Taipei, Taiwan (China); Tzeng, Wen-Pei [Graduate Institute of Sports and Health, National Changhua University of Education, Changhua, Taiwan (China); Hsiao, Che-Jen [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Liu, Shih-Chia [Department of Orthopaedics, Mackay Memorial Hospital, Taipei, Taiwan (China); Tang, Chih-Hsin, E-mail: chtang@mail.cmu.edu.tw [Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan (China); Department of Pharmacology, School of Medicine, China Medical University, Taichung, Taiwan (China); Department of Biotechnology, College of Health Science, Asia University, Taichung, Taiwan (China)

    2013-10-15T23:59:59.000Z

    Chondrosarcoma is the second most common primary bone tumor, and it responds poorly to both chemotherapy and radiation treatment. Nalanthamala psidii was described originally as Myxosporium in 1926. This is the first study to investigate the anti-tumor activity of trichodermin (trichothec-9-en-4-ol, 12,13-epoxy-, acetate), an endophytic fungal metabolite from N. psidii against human chondrosarcoma cells. We demonstrated that trichodermin induced cell apoptosis in human chondrosarcoma cell lines (JJ012 and SW1353 cells) instead of primary chondrocytes. In addition, trichodermin triggered endoplasmic reticulum (ER) stress protein levels of IRE1, p-PERK, GRP78, and GRP94, which were characterized by changes in cytosolic calcium levels. Furthermore, trichodermin induced the upregulation of Bax and Bid, the downregulation of Bcl-2, and the dysfunction of mitochondria, which released cytochrome c and activated caspase-3 in human chondrosarcoma. In addition, animal experiments illustrated reduced tumor volume, which led to an increased number of terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells and an increased level of cleaved PARP protein following trichodermin treatment. Together, this study demonstrates that trichodermin is a novel anti-tumor agent against human chondrosarcoma cells both in vitro and in vivo via mitochondrial dysfunction and ER stress. - Highlights: • Trichodermin induces chondrosarcoma apoptosis. • ER stress is involved in trichodermin-induced cell death. • Trichodermin induces chondrosarcoma death in vivo.

  12. Effect of the {delta}-aminolevulinate dehydratase polymorphism on the accumulation of lead in bone and blood in lead smelter workers

    SciTech Connect (OSTI)

    Fleming, D.E.B.; Chettle, D.R. [McMaster Univ., Hamilton, Ontario (Canada). Dept. of Physics and Astronomy] [McMaster Univ., Hamilton, Ontario (Canada). Dept. of Physics and Astronomy; Wetmur, J.G.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)] [Mount Sinai School of Medicine, New York, NY (United States); Robin, J.P. [Noranda Inc., Montreal, Quebec (Canada)] [Noranda Inc., Montreal, Quebec (Canada); Boulay, D.; Richard, N.S. [Brunswick Mining and Smelting Corp. Ltd., Belledune, New Brunswick (Canada). Occupational Health Services] [Brunswick Mining and Smelting Corp. Ltd., Belledune, New Brunswick (Canada). Occupational Health Services; Gordon, C.L.; Webber, C.E. [Hamilton Health Sciences Corp., Hamilton, Ontario (Canada). Dept. of Nuclear Medicine] [Hamilton Health Sciences Corp., Hamilton, Ontario (Canada). Dept. of Nuclear Medicine

    1998-04-01T23:59:59.000Z

    Lead inhibition of the zinc metalloenzyme {delta}-aminolevulinate dehydratase (ALAD) is one of the most sensitive indicators of blood lead levels. Whole blood lead, serum lead, and ALAD genotype were determined for 381 lead smelter workers, including 70 workers expressing the ALAD allele, whose blood lead elevations were observed for more than 20 years of employment. The same employees demonstrated higher serum lead levels. Using a cumulative blood lead index (CBLI) for each worker, based on individual blood lead histories, and in vivo X-ray fluorescence measurements of bone lead to estimate total lead body burden, the slopes of linear relations of bone lead to CBLI were greater for workers homoallelic for ALAD, indicating more efficient uptake of lead from blood into bone. This effect was most significant in calcaneus bone and for workers hired since 1977. Decreased transfer of blood lead into bone in individuals expressing the ALAD allele contrasted with increased blood lead.

  13. Human subjects research handbook: Protecting human research subjects. Second edition

    SciTech Connect (OSTI)

    NONE

    1996-01-30T23:59:59.000Z

    This handbook serves as a guide to understanding and implementing the Federal regulations and US DOE Orders established to protect human research subjects. Material in this handbook is directed towards new and continuing institutional review board (IRB) members, researchers, institutional administrators, DOE officials, and others who may be involved or interested in human subjects research. It offers comprehensive overview of the various requirements, procedures, and issues relating to human subject research today.

  14. 2014 Human Reliability Program Workshop

    Broader source: Energy.gov [DOE]

    Announcing The Human Reliability Program Workshop Sponsored by Office of Security (AU-50), U.S Department of Energy In collaboration with NA, NE, EM and SC

  15. NCSU Human Resources Training & Organizational

    E-Print Network [OSTI]

    2011 NCSU Human Resources Training & Organizational Development Spring & Summer 2011 Learning to Training & Organizational Development's new eLearning Training Catalog. This catalog serves as a central

  16. Protection of Human Research Subjects

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-07-20T23:59:59.000Z

    Changes are made to harmonize the definitions in this Order with those in the Federal regulations for the protection of human subjects (10 CFR Part 745), specifically, splitting the definition "human subject research" into "research" and "human subject," and adopting, verbatim, the definitions of "research" and "human subject" from 10 CFR Part 745 and adding the definition of "generalizable," since the determination of whether a project is "research" in 10 CFR Part 745 hinges on whether the work being conducted is generalizable. Small corrections and updates have been made to the references, links, and organization titles.

  17. Effects of bone marrow-derived cells on monocrotaline-and hypoxia-induced pulmonary hypertension in mice

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    hypertension in mice William Raoul,1 Orianne Wagner-Ballon,6 Guitanouch Saber,1 Anne Hulin,5 Elisabeth Marcos the difference in their effects depends on the mechanism of pulmonary hypertension (PH) remains unknown of monocrotaline (MCT)- induced pulmonary hypertension, Zhao et al. [9] showed that bone marrow-derived endothelial

  18. Prevention of Postmenopausal Bone Loss by a Low-Magnitude, High-Frequency Mechanical Stimuli: A Clinical Trial Assessing Compliance,

    E-Print Network [OSTI]

    , skeleton, aging, menopause, bone, antiresorptive INTRODUCTION OSTEOPOROSIS, A DISEASE CHARACTERIZED, double-blind, and placebo-controlled clinical trial in 70 women, 3­8 years past the menopause, examined the potential for a noninvasive, mechanically mediated intervention for osteoporosis. This non

  19. Bone quality measurements Osteoporos Int. 2011 Aug;22(8):2225-40. New laboratory tools in the assessment

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,version1-1Jul2013 Author manuscript, published in "Osteoporosis International 22, 8 (2011) 2225-2240" DOI Force Microscopy FEA Finite Element Analysis Introduction Fragility fractures due to osteoporosis and affect ~30 % of women after the menopause and ~10 % of men. Dual Energy bone densitometry (DXA) has

  20. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur 

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    .................................................................................................................. 35 3.7.1 Analysis of Mechanical Testing Data .............................................................. 35 3.7.2 Material Properties ........................................................................................... 37 3.7.3 Core....2 Osteoporosis and the Ovariectomized Rat Model .................................................... 5 2.3 Mechanical Testing of Cancellous Bone in Rats ..................................................... 5 2.3.1 Femoral Neck Testing...

  1. Genetic Inactivation of ERK1 and ERK2 in Chondrocytes Promotes Bone Growth and Enlarges the Spinal Canal

    E-Print Network [OSTI]

    Genetic Inactivation of ERK1 and ERK2 in Chondrocytes Promotes Bone Growth and Enlarges the Spinal dysplasia. In mouse models of achondroplasia, recent studies have implicated the ERK MAPK pathway, a pathway and ERK MAPK signaling in chondrocytes also causes premature synchondrosis closure in the cranial base

  2. Anti-CD45 radioimmunotherapy using 211At with bone marrow transplantation prolongs survival in a disseminated murine leukemia model

    SciTech Connect (OSTI)

    Orozco, Johnnie J.; Back, Tom; Kenoyer, Aimee L.; Balkin, Ethan R.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.; Frayo, Shani; Hylarides, Mark; Green, Damian J.; Gopal, Ajay K.; Press, Oliver W.; Pagel, John M.

    2013-05-15T23:59:59.000Z

    Anti-CD45 Radioimmunotherapy using an Alpha-Emitting Radionuclide 211At Combined with Bone Marrow Transplantation Prolongs Survival in a Disseminated Murine Leukemia Model ABSTRACT Despite aggressive chemotherapy combined with hematopoietic cell transplant (HCT), many patients with acute myeloid leukemia (AML) relapse. Radioimmunotherapy (RIT) using antibodies (Ab) labeled primarily with beta-emitting radionuclides has been explored to reduce relapse.

  3. Human portable preconcentrator system

    DOE Patents [OSTI]

    Linker, Kevin L.; Brusseau, Charles A.; Hannum, David W.; Puissant, James G.; Varley, Nathan R.

    2003-08-12T23:59:59.000Z

    A preconcentrator system and apparatus suited to human portable use wherein sample potentially containing a target chemical substance is drawn into a chamber and through a pervious screen. The screen is adapted to capture target chemicals and then, upon heating, to release those chemicals into the chamber. Chemicals captured and then released in this fashion are then carried to a portable chemical detection device such as a portable ion mobility spectrometer. In the preferred embodiment, the means for drawing sample into the chamber comprises a reversible fan which, when operated in reverse direction, creates a backpressure that facilitates evolution of captured target chemicals into the chamber when the screen is heated. The screen can be positioned directly in front of the detector prior to heating to improve detection capability.

  4. Human-computer interface

    DOE Patents [OSTI]

    Anderson, Thomas G.

    2004-12-21T23:59:59.000Z

    The present invention provides a method of human-computer interfacing. Force feedback allows intuitive navigation and control near a boundary between regions in a computer-represented space. For example, the method allows a user to interact with a virtual craft, then push through the windshield of the craft to interact with the virtual world surrounding the craft. As another example, the method allows a user to feel transitions between different control domains of a computer representation of a space. The method can provide for force feedback that increases as a user's locus of interaction moves near a boundary, then perceptibly changes (e.g., abruptly drops or changes direction) when the boundary is traversed.

  5. Human Reliability Program Workshop

    SciTech Connect (OSTI)

    Landers, John; Rogers, Erin; Gerke, Gretchen

    2014-05-18T23:59:59.000Z

    A Human Reliability Program (HRP) is designed to protect national security as well as worker and public safety by continuously evaluating the reliability of those who have access to sensitive materials, facilities, and programs. Some elements of a site HRP include systematic (1) supervisory reviews, (2) medical and psychological assessments, (3) management evaluations, (4) personnel security reviews, and (4) training of HRP staff and critical positions. Over the years of implementing an HRP, the Department of Energy (DOE) has faced various challenges and overcome obstacles. During this 4-day activity, participants will examine programs that mitigate threats to nuclear security and the insider threat to include HRP, Nuclear Security Culture (NSC) Enhancement, and Employee Assistance Programs. The focus will be to develop an understanding of the need for a systematic HRP and to discuss challenges and best practices associated with mitigating the insider threat.

  6. 227Poverty and Human Capability Studies Poverty AND HUMAN

    E-Print Network [OSTI]

    Dresden, Gregory

    227Poverty and Human Capability Studies Poverty AND HUMAN CAPABILIty StUDIeS (Pov) Core FACULty: PROFESSORS BeCKLey*, GOLDSMITH, MARGAND The Shepherd Program for the Interdisciplinary Study of Poverty studies can prepare them as future professionals and citizens to address the problems of poverty

  7. 237Poverty and Human Capability Studies Poverty and Human

    E-Print Network [OSTI]

    Dresden, Gregory

    237Poverty and Human Capability Studies Poverty and Human CaPability StudieS (Pov) Core FaCulty: PROFESSORS beCKley*, GOLDSMITH, MARGAND The Shepherd Program for the interdisciplinary Study of Poverty and graduate studies can prepare them as futureprofessionalsandcitizenstoaddresstheproblems of poverty and how

  8. Simulating human behavior for national security human interactions.

    SciTech Connect (OSTI)

    Bernard, Michael Lewis; Hart, Dereck H.; Verzi, Stephen J.; Glickman, Matthew R.; Wolfenbarger, Paul R.; Xavier, Patrick Gordon

    2007-01-01T23:59:59.000Z

    This 3-year research and development effort focused on what we believe is a significant technical gap in existing modeling and simulation capabilities: the representation of plausible human cognition and behaviors within a dynamic, simulated environment. Specifically, the intent of the ''Simulating Human Behavior for National Security Human Interactions'' project was to demonstrate initial simulated human modeling capability that realistically represents intra- and inter-group interaction behaviors between simulated humans and human-controlled avatars as they respond to their environment. Significant process was made towards simulating human behaviors through the development of a framework that produces realistic characteristics and movement. The simulated humans were created from models designed to be psychologically plausible by being based on robust psychological research and theory. Progress was also made towards enhancing Sandia National Laboratories existing cognitive models to support culturally plausible behaviors that are important in representing group interactions. These models were implemented in the modular, interoperable, and commercially supported Umbra{reg_sign} simulation framework.

  9. Reconstructing Cortical Dynamics with Magnetoencephalography

    E-Print Network [OSTI]

    Dalal, Sarang S.

    2007-01-01T23:59:59.000Z

    of adequately validated meth- ods for reconstructing suchdevelopment of statistical meth- ods used in this chapter,

  10. Reconstructing Cortical Dynamics with Magnetoencephalography

    E-Print Network [OSTI]

    Dalal, Sarang S.

    2007-01-01T23:59:59.000Z

    ciently on modern high performance computing clusters. Thiswell-suited to run on high performance computing clusters. Savailability of high performance computing clusters (e.g. ,

  11. Liquid-Solid Phase Transition Alloy as Reversible and Rapid Molding Bone Cement

    E-Print Network [OSTI]

    Yi, Liting; Liu, Jing

    2013-01-01T23:59:59.000Z

    Bone cement has been demonstrated as an essential restorative material in the orthopedic surgery. However current materials often imply unavoidable drawbacks, such as tissue-cement reaction induced thermal injuries and troublesome revision procedure. Here we proposed an injectable alloy cement to address such problems through its liquid-solid phase transition mechanism. The cement is made of a unique alloy BiInSnZn with a specifically designed low melting point 57.5{\\deg}C. This property enables its rapid molding into various shapes with high plasticity. Some fundamental characteristics including mechanical strength behaviors and phase transition-induced thermal features have been measured to demonstrate the competence of alloy as unconventional cement with favorable merits. Further biocompatible tests showed that this material could be safely employed in vivo. In addition, experiments also found the alloy cement capability as an excellent contrast agent for radiation imaging. Particularly, the proposed alloy...

  12. Suppressor cells in transplantation tolerance. II. maturation of suppressor cells in the bone marrow chimera

    SciTech Connect (OSTI)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-10-01T23:59:59.000Z

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods.

  13. Suppressor cells in transplantation tolerance II. Maturation of suppressor cells in the bone marrow chimera

    SciTech Connect (OSTI)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-10-01T23:59:59.000Z

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods.

  14. Anti-bacterial immunity to Listeria monocytogenes in allogeneic bone marrow chimera in mice

    SciTech Connect (OSTI)

    Onoe, K.; Good, R.A.; Yamamoto, K.

    1986-06-01T23:59:59.000Z

    Protection and delayed-type hypersensitivity (DTH) to the facultative intracellular bacterium Listeria monocytogenes (L.m.) were studied in allogeneic and syngeneic bone marrow chimeras. Lethally irradiated AKR (H-2k) mice were successfully reconstituted with marrow cells from C57BL/10 (B10) (H-2b), B10 H-2-recombinant strains or syngeneic mice. Irradiated AKR mice reconstituted with marrow cells from H-2-compatible B10.BR mice, (BR----AKR), as well as syngeneic marrow cells, (AKR----AKR), showed a normal level of responsiveness to the challenge stimulation with the listeria antigens when DTH was evaluated by footpad reactions. These mice also showed vigorous activities in acquired resistance to the L.m. By contrast, chimeric mice that had total or partial histoincompatibility at the H-2 determinants between donor and recipient, (B10----AKR), (B10.AQR----AKR), (B10.A(4R)----AKR), or (B10.A(5R)----AKR), were almost completely unresponsive in DTH and antibacterial immunity. However, when (B10----AKR) H-2-incompatible chimeras had been immunized with killed L.m. before challenge with live L.m., these mice manifested considerable DTH and resistance to L.m. These observations suggest that compatibility at the entire MHC between donor and recipient is required for bone marrow chimeras to be able to manifest DTH and protection against L.m. after a short-term immunization schedule. However, this requirement is overcome by a preceding or more prolonged period of immunization with L.m. antigens. These antigens, together with marrow-derived antigen-presenting cells, can then stimulate and expand cell populations that are restricted to the MHC (H-2) products of the donor type.

  15. Adaptive differentiation of H-2- and Igh-restricted B lymphocyte in tetraparental bone marrow chimera

    SciTech Connect (OSTI)

    Yamamoto, H.; Bitoh, S.; Fujimoto, S.

    1987-01-15T23:59:59.000Z

    Immunization of BALB/c mice with MOPC-104E myeloma protein induced idiotype-specific enhancing B cells that acted on anti-dextran antibody producing B cells. The enhancing cells have the surface phenotype of B cells. With the use of several H-2 or Igh congenic mice, it was found that the cooperation among B cells was controlled by both the major histocompatibility complex (MHC) and Igh. The capability to generate enhancing B cell activity was analyzed by using tetraparental bone marrow chimeras. (C57BL/6 X BALB/c)F1 mice, for example, were lethally irradiated and were reconstituted with C57BL/6 and BALB/c bone marrow cells. Nine to 12 wk after the reconstitution, the chimeras were immunized with the myeloma protein and were tested for their enhancing B cell activity. After the removal of C57BL/6 origin cells by treatment with anti-H-2b + complement, residual cells exhibited enhancing B cell activity on BALB.B, as well as BALB/c antidextran antibody response. This indicates that the generation of H-2-restricted, idiotype-specific enhancing B cell activity differentiated adaptively so as to recognize foreign MHC as self under chimeric conditions. On the other hand, splenic B cells treated with anti-H-2d + complement did not enhance the responses of BALB/c or BALB.B. Even in a chimeric environment, the B cells of C57BL/6 origin could not obtain the ability to generate enhancing B cell activity upon immunization of the idiotype. The results described here, taken in conjunction with our previous studies, suggest that the Ig heavy chain gene(s) predominantly control the Igh restriction properties of enhancing B cells, and the capability of MHC recognition by B cells is selected under chimeric conditions.

  16. Estradiol influences the mechanical properties of human fetal osteoblasts through cytoskeletal changes

    SciTech Connect (OSTI)

    Muthukumaran, Padmalosini [Department of Bioengineering, National University of Singapore (Singapore)] [Department of Bioengineering, National University of Singapore (Singapore); Lim, Chwee Teck [Department of Bioengineering, National University of Singapore (Singapore) [Department of Bioengineering, National University of Singapore (Singapore); Department of Mechanical Engineering, National University of Singapore (Singapore); Mechanobiology Institute, National University of Singapore (Singapore); Singapore-MIT Alliance for Research and Technology (SMART), National University of Singapore (Singapore); Lee, Taeyong, E-mail: bielt@nus.edu.sg [Department of Bioengineering, National University of Singapore (Singapore)] [Department of Bioengineering, National University of Singapore (Singapore)

    2012-07-06T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer Estradiol induced stiffness changes of osteoblasts were quantified using AFM. Black-Right-Pointing-Pointer Estradiol causes significant decrease in the stiffness of osteoblasts. Black-Right-Pointing-Pointer Decreased stiffness was caused by decreased density of f-actin network. Black-Right-Pointing-Pointer Stiffness changes were not associated with mineralized matrix of osteoblasts. Black-Right-Pointing-Pointer Estradiol increases inherent alkaline phosphatase activity of osteoblasts. -- Abstract: Estrogen is known to have a direct effect on bone forming osteoblasts and bone resorbing osteoclasts. The cellular and molecular effects of estrogen on osteoblasts and osteoblasts-like cells have been extensively studied. However, the effect of estrogen on the mechanical property of osteoblasts has not been studied yet. It is important since mechanical property of the mechanosensory osteoblasts could be pivotal to its functionality in bone remodeling. This is the first study aimed to assess the direct effect of estradiol on the apparent elastic modulus (E{sup Asterisk-Operator }) and corresponding cytoskeletal changes of human fetal osteoblasts (hFOB 1.19). The cells were cultured in either medium alone or medium supplemented with {beta}-estradiol and then subjected to Atomic Force Microscopy indentation (AFM) to determine E{sup Asterisk-Operator }. The underlying changes in cytoskeleton were studied by staining the cells with TRITC-Phalloidin. Following estradiol treatment, the cells were also tested for proliferation, alkaline phosphatase activity and mineralization. With estradiol treatment, E{sup Asterisk-Operator} of osteoblasts significantly decreased by 43-46%. The confocal images showed that the changes in f-actin network observed in estradiol treated cells can give rise to the changes in the stiffness of the cells. Estradiol also increases the inherent alkaline phosphatase activity of the cells. Estradiol induced stiffness changes of osteoblasts were not associated with changes in the synthesized mineralized matrix of the cells. Thus, a decrease in osteoblast stiffness with estrogen treatment was demonstrated in this study, with positive links to cytoskeletal changes. The estradiol associated changes in osteoblast mechanical properties could bear implications for bone remodeling and its mechanical integrity.

  17. The human activity of visualization

    E-Print Network [OSTI]

    Wright, Dawn Jeannine

    Griffin et al 2006 #12;Human-Computer Interaction: Software of the Mind each user has a setThe human activity of visualization cultural and psychological factors in representation; Gibbon 1998; Marcus 2000) conventions and metaphors of Westerners may not hold worldwide colors

  18. The Human Genome Diversity Project

    SciTech Connect (OSTI)

    Cavalli-Sforza, L. [Stanford Univ., CA (United States)

    1994-12-31T23:59:59.000Z

    The Human Genome Diversity Project (HGD Project) is an international anthropology project that seeks to study the genetic richness of the entire human species. This kind of genetic information can add a unique thread to the tapestry knowledge of humanity. Culture, environment, history, and other factors are often more important, but humanity`s genetic heritage, when analyzed with recent technology, brings another type of evidence for understanding species` past and present. The Project will deepen the understanding of this genetic richness and show both humanity`s diversity and its deep and underlying unity. The HGD Project is still largely in its planning stages, seeking the best ways to reach its goals. The continuing discussions of the Project, throughout the world, should improve the plans for the Project and their implementation. The Project is as global as humanity itself; its implementation will require the kinds of partnerships among different nations and cultures that make the involvement of UNESCO and other international organizations particularly appropriate. The author will briefly discuss the Project`s history, describe the Project, set out the core principles of the Project, and demonstrate how the Project will help combat the scourge of racism.

  19. Human Reliability Analysis for Digital Human-Machine Interfaces

    SciTech Connect (OSTI)

    Ronald L. Boring

    2014-06-01T23:59:59.000Z

    This paper addresses the fact that existing human reliability analysis (HRA) methods do not provide guidance on digital human-machine interfaces (HMIs). Digital HMIs are becoming ubiquitous in nuclear power operations, whether through control room modernization or new-build control rooms. Legacy analog technologies like instrumentation and control (I&C) systems are costly to support, and vendors no longer develop or support analog technology, which is considered technologically obsolete. Yet, despite the inevitability of digital HMI, no current HRA method provides guidance on how to treat human reliability considerations for digital technologies.

  20. Application of in vitro erythropoiesis from bone marrow derived progenitors to detect and study genotoxicity

    E-Print Network [OSTI]

    Shuga, Joseph F. (Joseph Francis)

    2007-01-01T23:59:59.000Z

    Assays that predict toxicity are an essential part of drug development and there is a demand for efficient models to better predict human responses. The in vivo micronucleus (MN) assay is a robust toxicity test that assesses ...

  1. Flesh yours, bones mine : the making of the biomedical subject in Turkey

    E-Print Network [OSTI]

    Sanal, Aslihan

    2005-01-01T23:59:59.000Z

    With the emergence of biomedical technologies, human body parts from living or dead donors have become commodities in the international networks of trade. This dissertation tries to understand religious, political and ...

  2. Andrew E. Anderson Department of Bioengineering,

    E-Print Network [OSTI]

    Utah, University of

    of bone geometry, location-dependent cortical thickness and trabecular bone elastic modu- lus, and to assess the sensitivity of FE strain predictions to assumptions regarding cor- tical bone thickness as well as bone and cartilage material properties. A FE model of a cadaveric pelvis was created using

  3. Ideal Observers for Detecting Human Motion: Correspondence Noise

    E-Print Network [OSTI]

    HongJing Lo; Alan Yuille

    2011-01-01T23:59:59.000Z

    psychophysical experiments showed that human performance waspsychophysics experiments to determine how humans performedpsychophysical experiments which are consistent with humans

  4. Guest editorial: Special issue on human computing

    E-Print Network [OSTI]

    Pantic, Maja

    The seven articles in this special issue focus on human computing. Most focus on two challenging issues in human computing, namely, machine analysis of human behavior in group interactions and context-sensitive modeling.

  5. College of Architecture, Arts and Humanities ARCHITECTURE,

    E-Print Network [OSTI]

    Bolding, M. Chad

    College of Architecture, Arts and Humanities COLLEGE OF ARCHITECTURE, ARTS AND HUMANITIES The College of Architecture, Arts and Humanities offers graduate programs in three schools: the School in Architecture; City and Regional Planning; Communication, Technology and Society; Construc- tion Science

  6. 06241 Abstracts Collection Human Motion -Understanding, Modeling,

    E-Print Network [OSTI]

    06241 Abstracts Collection Human Motion - Understanding, Modeling, Capture and Animation. 13th Summary Human Motion - Understanding, Modeling, Capture and Animation. 13th Workshop Reinhard Klette 06241 Human Motion - Understanding, Modeling, Capture and Animation. 13th Workshop "Theoretical

  7. A framework for human microbiome research

    E-Print Network [OSTI]

    Friedman, Jonathan

    A variety of microbial communities and their genes (the microbiome) exist throughout the human body, with fundamental roles in human health and disease. The National Institutes of Health (NIH)-funded Human Microbiome Project ...

  8. Human genome. 1993 Program report

    SciTech Connect (OSTI)

    Not Available

    1994-03-01T23:59:59.000Z

    The purpose of this report is to update the Human Genome 1991-92 Program Report and provide new information on the DOE genome program to researchers, program managers, other government agencies, and the interested public. This FY 1993 supplement includes abstracts of 60 new or renewed projects and listings of 112 continuing and 28 completed projects. These two reports, taken together, present the most complete published view of the DOE Human Genome Program through FY 1993. Research is progressing rapidly toward 15-year goals of mapping and sequencing the DNA of each of the 24 different human chromosomes.

  9. The Politics of Human Rights in Argentina

    E-Print Network [OSTI]

    Brysk, Alison

    2013-01-01T23:59:59.000Z

    Valente,  Marcela.  “Argentina’s  Biggest  Human  Rights  Motor  is  Linked  to  Argentina’s  ‘Dirty  War’”.   New  fortune  of  my  heart.   Argentina's  1985  human  rights  

  10. Changing the Mechanical Properties of PMMA Bone Cement with Nano and Micro Particles Ricardo F. Pinto, Brandon J. Johnson, L. D. Timmie Topoleski

    E-Print Network [OSTI]

    Alonso, Juan J.

    in the vacuum mixer. During the exothermic polymerization of the bone cement, the liquid rubber should testing. Specimens were then retrieved and tested individually in three point bending quasi-static loading

  11. HUMAN NEUROSCIENCE ORIGINAL RESEARCH ARTICLE

    E-Print Network [OSTI]

    McCloskey, Michael

    HUMAN NEUROSCIENCE ORIGINAL RESEARCH ARTICLE published: 03 September 2014 doi: 10.3389/fnhum.2014 identified amnesic, LSJ, who was a skilled amateur violist prior to contract- ing herpes simplex encephalitis

  12. Robot manipulation in human environments

    E-Print Network [OSTI]

    Edsinger, Aaron Ladd, 1972-

    2007-01-01T23:59:59.000Z

    Human environments present special challenges for robot manipulation. They are often dynamic, difficult to predict, and beyond the control of a robot engineer. Fortunately, many characteristics of these settings can be ...

  13. Robot Manipulation in Human Environments

    E-Print Network [OSTI]

    Edsinger, Aaron

    2007-01-16T23:59:59.000Z

    Human environments present special challenges for robot manipulation. They are often dynamic, difficult to predict, and beyond the control of a robot engineer. Fortunately, many characteristics of these settings can be ...

  14. Reservations to human rights treaties 

    E-Print Network [OSTI]

    McCall-Smith, Kasey Lowe

    2012-06-26T23:59:59.000Z

    This thesis examines the default application of the 1969 Vienna Convention on the Law of Treaties reservation rules to reservations to human rights treaties. The contemporary practice of formulating reservations allows ...

  15. Time, Humans and Societal Challenges

    E-Print Network [OSTI]

    16 Human Development Index) is UN measure of well-being. High poverty and population density coincide fuel contribution >80% globally (Quadrillion (1E15) Btu) 1 quad = 1E15 British thermal units = 2.9E11 k

  16. HUMAN RESOURCES SIMON FRASER UNIVERSITY

    E-Print Network [OSTI]

    ) by coordinating budget submissions, estimating and preparing cost projections, liaising with PurchasingHUMAN RESOURCES SIMON FRASER UNIVERSITY ADMINISTRATIVE & PROFESSIONAL JOB DESCRIPTION Position of the position in one or two sentences. Manages the Department's operating, capital, temporary instruction

  17. HUMAN RESOURCES SIMON FRASER UNIVERSITY

    E-Print Network [OSTI]

    funding priorities, budget consideration, application requirements, University policies and proceduresHUMAN RESOURCES SIMON FRASER UNIVERSITY ADMINISTRATIVE & PROFESSIONAL JOB DESCRIPTION Position to Canadian and international funding agencies. The incumbent will assist with the writing and reviewing

  18. ORISE: Human Subjects Research Database

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Human Subjects Research Database Section 10, Part 745 of the Code of Federal Regulations and U.S. Department of Energy (DOE) Orders 443.1 and 481.1 require the maintenance of...

  19. Coördinating human-robot communication

    E-Print Network [OSTI]

    Brööks, Andrëw G. (Brööks Zoz)

    2007-01-01T23:59:59.000Z

    As robots begin to emerge from the cloisters of industrial and military applications and enter the realms of coöperative partners for people, one of the most important facets of human-robot interaction (HRI) will be ...

  20. Contractor Human Resource Management Programs

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1996-09-30T23:59:59.000Z

    The purpose of this directive is to establish Department of Energy (DOE) responsibilities and requirements for the management and oversight of contractor Human Resource Management (HR) programs. Chg 1, 5-8-98; Chg 2, 11-22-09