Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Office of Legacy Management (LM)

NY NY 17.8 Prepared by Oak Ridge Associated Universities Prepgred for Office of Operationaf Safety U.S. Department of Energy Ezrt /ur / POST REMEDIAL ACTION SURVEY PROPERTY OF MODERN LANDFILL, INC. FORMER LOOW SITE LEWISTON, NEW YORK J.D. BERGER R a d i o l o g l c a l S t t e A s s e s s r n e n t P r o g r a m M a n p o t a e r E d u c a t l o n , R e s e a r c h , a n d T r a l n i n g D l v i s l o n FINAL REPORT January 1982 POST REIEDIAT ACTION SURVBY PROPERTY OF }TODBRN I.AIIDPILL' INC. rONGB LOOTI SITE LEIIISTOI, NEI{ YORK Prepared for U.S. Department of Eaergy J . D . B e r g e r P r o j e c t S t a f f R.D. Coudra C.F. Rienke P.[. Frane C.F. 9legver [f.0. Eelton L.A. Young Prepered by Radiological Site Aseessuent Progrm Dlanpower Educatioor Researchr and Training Diviaion Oak Ridge Acaociated Univereitiea Oak Ridger Tenneggee 37830 FINAL REPORT January 1982 Thls report ls based on work performed under contract number DB-AC05-760RO0033 wlth


DOE - Office of Legacy Management -- Buffalo NY Site - NY 54  

NLE Websites -- All DOE Office Websites (Extended Search)

Buffalo NY Site - NY 54 Buffalo NY Site - NY 54 FUSRAP Considered Sites Buffalo, NY Alternate Name(s): Bliss & Laughlin Steel Company Niagara Cold Drawn Steel Corporation Ramco Steel Incorporated NY.54-1 NY.54-4 Location: 110 Hopkins Street, Buffalo, New York NY.54-1 Historical Operations: Machined and straightened uranium rods as subcontracted work from National Lead Company, an AEC contractor. NY.54-3 NY.54-4 LTSM012601 Eligibility Determination: Eligible NY.54-4 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.54-6 NY.54-7 NY.54-8 LTSM012601 Site Status: Certified- Certification Basis and Certification Statement BLS000001 LTSM012152 LTSM012584 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Category:Syracuse, NY | Open Energy Information  

Open Energy Info (EERE)

Syracuse, NY Syracuse, NY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Syracuse, NY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Syracuse NY Consolidated Edison Co-NY Inc.png SVFullServiceRestauran... 70 KB SVQuickServiceRestaurant Syracuse NY Consolidated Edison Co-NY Inc.png SVQuickServiceRestaura... 70 KB SVHospital Syracuse NY Consolidated Edison Co-NY Inc.png SVHospital Syracuse NY... 66 KB SVLargeHotel Syracuse NY Consolidated Edison Co-NY Inc.png SVLargeHotel Syracuse ... 69 KB SVLargeOffice Syracuse NY Consolidated Edison Co-NY Inc.png SVLargeOffice Syracuse... 68 KB SVMediumOffice Syracuse NY Consolidated Edison Co-NY Inc.png SVMediumOffice Syracus... 67 KB SVMidriseApartment Syracuse NY Consolidated Edison Co-NY Inc.png


Category:Rochester, NY | Open Energy Information  

Open Energy Info (EERE)

Rochester, NY Rochester, NY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Rochester, NY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Rochester NY Consolidated Edison Co-NY Inc.png SVFullServiceRestauran... 70 KB SVQuickServiceRestaurant Rochester NY Consolidated Edison Co-NY Inc.png SVQuickServiceRestaura... 71 KB SVHospital Rochester NY Consolidated Edison Co-NY Inc.png SVHospital Rochester N... 65 KB SVLargeHotel Rochester NY Consolidated Edison Co-NY Inc.png SVLargeHotel Rochester... 69 KB SVLargeOffice Rochester NY Consolidated Edison Co-NY Inc.png SVLargeOffice Rocheste... 67 KB SVMediumOffice Rochester NY Consolidated Edison Co-NY Inc.png SVMediumOffice Rochest... 67 KB SVMidriseApartment Rochester NY Consolidated Edison Co-NY Inc.png


DOE - Office of Legacy Management -- New York, NY, Site - NY 61  

Office of Legacy Management (LM)

York, NY, Site - NY 61 York, NY, Site - NY 61 FUSRAP Considered Sites New York, NY Alternate Name(s): Baker and Williams Warehouses Ralph Ferrara Company Warehouses Ralph Ferrara, Inc. NY.61-2 Location: 513-519, 521-527, and 529-535 West 20th Street, New York, New York NY.61-3 Historical Operations: Received and stored uranium ores and concentrates for MED. NY.61-5 NY.61-6 NY.61-7 Eligibility Determination: Eligible NY.61-1 NY.61-2 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.61-3 NY.61-4 NY.61-8 NY.61-9 NY.61-10 Site Status: Certified - Certification Basis, Federal Register Notice Included NY.61-11 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP Also see New York, New York, Site


DOE - Office of Legacy Management -- Niagara Falls Storage Site NY - NY 17  

Office of Legacy Management (LM)

Niagara Falls Storage Site NY - NY Niagara Falls Storage Site NY - NY 17 FUSRAP Considered Sites Niagara Falls Storage Site, NY Alternate Name(s): Lake Ontario Ordnance Works (LOOW) Niagara Falls Storage Site (NFSS) DOE-Niagara Falls Storage Site NY.17-1 NY.17-3 Location: Lewiston, New York NY.17-5 Historical Operations: Stored, shipped, and buried radioactive equipment and waste for MED and AEC containing uranium, radium, and thorium. Contains Interim Waste Containment Structure. NY.17-1 NY.17-2 NY.17-14 Eligibility Determination: Eligible NY.17-4 Radiological Survey(s): Assessment Surveys NY.17-3 NY.17-5 NY.17-6 NY.17-7 NY.17-8 NY.17-9 NY.17-10 NY.17-11 NY.17-12 NY.17-14 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. NY.17-13 NY.17-14 NY.17-15 NY.17-16 USACE Website Long-term Care Requirements: To be determined upon completion.


ACIM-~ NY.49  

Office of Legacy Management (LM)

' ' h:. ,,, ,_" , ACIM-~ NY.49 .,. i MEMORANDUM TO: FILE DATE FE: __~-tt_c~7' e_-_~-~------- --------- "%Kf-- ---- ---i------- Current: ~~~~~~--------__---_______ xf yee, date contacted- IVPE OF OPERATION f- ------------- Research & Development 0 Production scale testing 0 Pilot Scale 0 Bench Scale Process z Theoretical Studies Sample 84 Analysis 0 Production 0 Disposal/Storage a Facility Type 0 Manufacturing 0 University 0 Research Organization 0 Government Sponsored Fat a Other ------------------ c] Prime 0 Other information (i.e., co 0 Subcontractor + fixed fee, unit price, 0 Purchase Order time & material, +x:) G-----------^-------------- . ~~~~-----____~-~----------~ Contract/Purchase Order # ---------------------------------


NY-%-3 P  

Office of Legacy Management (LM)

NY-%-3 NY-%-3 P m F P F ?- P m ?- c m P P CII (I pl F F- 3?r -J-J-. _- /, i ;. / 0 Aerospace Report No. ATR-82 (796344-2 i Aq, is y !i,' Evaluation of the 1943Hto# 1946 ilid Liquid Effluent Discharge From the Linde Air Products Company Ceramics Plant December 198 I Prepared for Office of Operational Safety Assistant Secretary for Environmental Protection, Safety, and Emergency Preparedness U.S. DEPARTMENT OF ENERGY Prepared by Environment and Conservation Directorate Eastern Technical Division THE AEROSPACE CORPORATION Germantown, Maryland Contract No. DE-ACOP-81EV10532 I- ,- A e r o s p a c e R e p o r t N o . A T R - 8 2 ( 7 9 6 3 - 0 4 ) - 2 E V A L U A T IO N O F T H E 1 9 4 3 - T O - 1 9 4 6 L IQ U ID E F F L U E N T D IS C H A R G E F R O M T H E L INDE A IR P R O D U C T S C O M P A N Y C E R A M ICS P L A N T D e c e m b e r 1 9 8 1 P r e p a r e d for O


DOE - Office of Legacy Management -- Guterl Specialty Steel - NY 12  

Office of Legacy Management (LM)

Guterl Specialty Steel - NY 12 Guterl Specialty Steel - NY 12 FUSRAP Considered Sites Guterl Specialty Steel, NY Alternate Name(s): Simonds Saw and Steel Co. Guterl Steel Allegheny Ludlum Steel Corp. NY.12-1 NY.12-2 Location: Ohio Street and Route 95, Lockport, New York NY.12-12 Historical Operations: Performed rolling mill operations on natural uranium and thorium metal. NY.12-6 NY.12-7 Eligibility Determination: NY.12-11 Radiological Survey(s): Assessment Surveys NY.12-1 NY.12-4 NY.12-8 NY.12-9 NY.12-12 Site Status: Cleanup pending by U.S. Army Corps of Engineers. NY.12-10 NY.12-11 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Guterl Specialty Steel, NY NY.12-1 - ORNL Letter; Cottrell to Turi; Radiological Survey of the


DOE - Office of Legacy Management -- Colonie - NY 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Considered Sites > Colonie - NY 06 Considered Sites > Colonie - NY 06 FUSRAP Considered Sites Colonie, NY Alternate Name(s): Colonie Interim Storage Site National Lead Industries NY.06-1 Location: 1130 Central Avenue, Colonie, New York NY.06-1 Historical Operations: Fabricated and processed uranium metal for the AEC, resulting in contamination from thorium and natural, enriched, and depleted uranium. NY.06-1 NY.06-4 NY.06-5 Eligibility Determination: Eligible NY.06-2 NY.06-3 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.06-6 NY.06-7 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. NY.06-8 NY.06-9 NY.06-10 NY.06-11 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Colonie, NY Colonie Site Aerial Photograph


Western NY Energy LLC | Open Energy Information  

Open Energy Info (EERE)

search Name Western NY Energy LLC Place Mount Morris, New York Zip 14510 Product Bioethanol producer. References Western NY Energy LLC1 LinkedIn Connections CrunchBase...


DOE - Office of Legacy Management -- Niagara Falls Vicinity Properties NY -  

Office of Legacy Management (LM)

Niagara Falls Vicinity Properties Niagara Falls Vicinity Properties NY - NY 17 FUSRAP Considered Sites Niagara Falls Vicinity Properties, NY Alternate Name(s): Lake Ontario Ordnance Works (LOOW) Niagara Falls Storage Site (NFSS) DOE-Niagara Falls Storage Site NY.17-1 NY.17-3 Location: Lewiston , New York NY.17-5 Historical Operations: Stored, shipped, and buried radioactive equipment and waste for MED and AEC containing uranium, radium, and thorium. Portions of the former site are privately owned, creating a "site" for the vicinity properties. NY.17-1 NY.17-2 NY.17-14 Eligibility Determination: Eligible NY.17-4 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.17-3 NY.17-5 NY.17-6 NY.17-7 NY.17-8 NY.17-9 NY.17-10 NY.17-11 NY.17-12 NY.17-14 Site Status: Certification Basis, including Federal Register Notice for 23 properties. Cleanup in progress for additional 3 VPs. NY.17-13


Sylvania Corporation, Hicksville, NY and Bayside, NY – Addendum to July 8, 2004  

Energy.gov (U.S. Department of Energy (DOE))

Sylvania Corporation, Hicksville, NY and Bayside, NY – Addendum to July 8, 2004, additional_sylvania.pdf memorandum Date: October 6, 2004 Reply to Attn of: Department of Energy Headquarters FOIA...


NY.O-20- I  

Office of Legacy Management (LM)

; I.-' ; I.-' NY.O-20- I ' 3% 3 MEMORANDUM TO: FILE FKOM: An&x?! w311E? SUHYECT: .Elimination of Pyroferric Co. New Yor SITE ALT NAME: EYE&XCLG f2!Y2~!2Y 621 E. 216th St. CITY: N__ew_ yw-r; STATE: N__V _ok!kEKm. Past: P_rrof_errrLc Go: current: Qwner contacted X yes no; if yes, date co Past owner2 IYE OE C)PEEux!N g Research et Develapment Faci - Production scale testing x M XX - Experimental tests U - Henoh.Scale Process R - Theoretical Studies Gove - Sample % Analysis 0 Production Disposal/Storage "t acted 1 1/10/G iz 17 -&49s300 move !d t li ari ty TYPO "i e+i "! "7 Prime Othe X Subcontractor Furcharje Order r: + fixed time 8: n k, Elr( NY NATE NI?IME: P_YD2fC Inter" Contract/Purchase Order # 33482 with AMF ----- ---- ---


Rig 'dzin Tshe dbang mchog grub (1761-1829) et la constitution du rNying ma rgyud 'bum de sDe dge  

E-Print Network (OSTI)

les textes en une collection à ‘Ug palung, le fief de la lignée Zur3. Un article plus récent encore de Mi Nyag Thubbstan chos dar fait le point sur les diverses versions existantes, mentionnantd’ailleurs un certain nombre d’entre elles qui ne sont... and the Bai-ro- rgyud-‘bum”, p. 9. 4 Mi nyag Thub bstan chos dar, “rNying ma rgyud 'bum gyi mtshams sbyor”, passim. 5 Voir Achard, “ La liste des Tantras du rNying ma’i rgyud ‘bum selon l’édition établie par Kun mkhyen ‘Jigs med gling pa”, Revue d...

Achard, Jean-Luc



DOE - Office of Legacy Management -- Bethlehem Steel Corporation - NY 02  

Office of Legacy Management (LM)

Bethlehem Steel Corporation - NY 02 Bethlehem Steel Corporation - NY 02 FUSRAP Considered Sites Site: BETHLEHEM STEEL CORPORATION (NY.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Lackawanna , New York NY.02-1 Evaluation Year: 1985 NY.02-2 Site Operations: Conducted high temperature alpha-phase rolling tests on uranium metal in the 1950s. NY.02-3 Site Disposition: Eliminated - Radiation levels below criteria NY.02-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.02-3 Radiological Survey(s): Yes NY.02-4 NY.02-5 Site Status: Eliminated from consideration under FUSRAP NY.02-6 Also see Documents Related to BETHLEHEM STEEL CORPORATION NY.02-1 - Bethlehem Steel Corp. Letter; Subject: Completed Access


DOE - Office of Legacy Management -- Syracuse University - NY 29  

Office of Legacy Management (LM)

Syracuse University - NY 29 Syracuse University - NY 29 FUSRAP Considered Sites Site: SYRACUSE UNIVERSITY (NY.29) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Syracuse , New York NY.29-1 Evaluation Year: 1994 NY.29-2 Site Operations: Activities included work with uranium oxide and the precipitation of thorium iodate from homogeneous solution. NY.29-1 NY.29-3 NY.29-4 Site Disposition: Eliminated - Potential for contamination remote NY.29-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium NY.29-3 NY.29-4 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to SYRACUSE UNIVERSITY NY.29-1 - AEC Memorandum; Belmore to Rodden; Request for Uranium


Category:New York, NY | Open Energy Information  

Open Energy Info (EERE)

York, NY York, NY Jump to: navigation, search Go Back to PV Economics By Location Media in category "New York, NY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant New York NY Consolidated Edison Co-NY Inc.png SVFullServiceRestauran... 70 KB SVQuickServiceRestaurant New York NY Consolidated Edison Co-NY Inc.png SVQuickServiceRestaura... 71 KB SVHospital New York NY Consolidated Edison Co-NY Inc.png SVHospital New York NY... 64 KB SVLargeHotel New York NY Consolidated Edison Co-NY Inc.png SVLargeHotel New York ... 68 KB SVLargeOffice New York NY Consolidated Edison Co-NY Inc.png SVLargeOffice New York... 67 KB SVMediumOffice New York NY Consolidated Edison Co-NY Inc.png SVMediumOffice New Yor... 67 KB SVMidriseApartment New York NY Consolidated Edison Co-NY Inc.png


DOE - Office of Legacy Management -- Memorial Hospital - NY 0...  

Office of Legacy Management (LM)

Memorial Hospital - NY 0-16 FUSRAP Considered Sites Site: MEMORIAL HOSPITAL (NY.0-16 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name:...


Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Million Cubic Feet) Niagara Falls, NY Natural Gas Pipeline Exports...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Niagara Falls, NY Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Niagara Falls, NY Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Niagara Falls, NY Natural Gas Pipeline...


DOE - Office of Legacy Management -- Columbia University - NY...  

Office of Legacy Management (LM)

NY.03-3 Site Operations: Early research and development -- nuclear chain reaction (fission) and gaseous diffusion during the 1940s. NY.03-4 Site Disposition: Eliminated -...


Buffalo, NY Liquefied Natural Gas Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Buffalo, NY Liquefied Natural Gas Exports to Canada (Dollars per Thousand Cubic Feet) Buffalo, NY Liquefied Natural Gas Exports to Canada (Dollars per Thousand Cubic Feet) Decade...


Massena, NY Natural Gas Pipeline Exports to Canada (Million Cubic...  

Annual Energy Outlook 2012 (EIA)

View History: Monthly Annual Download Data (XLS File) Massena, NY Natural Gas Pipeline Exports to Canada (Million Cubic Feet) Massena, NY Natural Gas Pipeline Exports to Canada...


Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area (Redirected from New York Area - NY NJ CT PA) Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026


DOE - Office of Legacy Management -- Electromet Corporation - NY 04  

Office of Legacy Management (LM)

Electromet Corporation - NY 04 Electromet Corporation - NY 04 FUSRAP Considered Sites Site: Electromet Corporation (NY.04 ) Eliminated from consideration under FUSRAP - Referred to US EPA and New York State Designated Name: Not Designated Alternate Name: None Location: 4625 Royal Avenue , Niagara Falls , New York NY.04-1 Evaluation Year: 1985 NY.04-2 NY.04-3 Site Operations: Cast zirconium sponge into ingots in the 1950s. NY.04-4 Site Disposition: Eliminated - No Authority NY.04-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Zirconium NY.04-4 Radiological Survey(s): Yes NY.04-6 Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA and New York State NY.04-2 Also see Documents Related to Electromet Corporation


DOE - Office of Legacy Management -- Hooker Chemical Co - NY 05  

Office of Legacy Management (LM)

Hooker Chemical Co - NY 05 Hooker Chemical Co - NY 05 FUSRAP Considered Sites Site: Hooker Chemical Co. (NY.05) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Occidental Chemical Corporation Hooker Electrochemical Corporation NY.05-1 NY.05-2 Location: Niagara Falls , New York NY.05-3 Evaluation Year: 1985 NY.05-1 NY.05-2 Site Operations: Design, engineering, construction, equipping and operation of a plant for the manufacture of Product 45 (xylene hexachloride); MFL (Miller's fluorolubricant); P-45Cl; and recovered P-45Cl2 from residues produced in the manufacture of P-45Cl; used hydrochloric acid (a byproduct of the P-45 Program) in the chemical processing of uranium-bearing slag as a precursor to recovery. NY.05-2 NY.05-4 Site Disposition: Eliminated - Radiation levels below criteria NY.05-1


DOE - Office of Legacy Management -- New York University - NY 50  

Office of Legacy Management (LM)

University - NY 50 University - NY 50 FUSRAP Considered Sites Site: NEW YORK UNIVERSITY (NY.50) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.50-1 Evaluation Year: 1987 NY.50-1 Site Operations: Activities were related to equipment development. Counters and a small quantity of uranium oxide were provided by the AEC for work under contract AT(30-1)-1256. NY.50-2 NY.50-3 NY.50-4 NY.50-1 Site Disposition: Eliminated - Potential for contamination considered remote - Limited quantity of radioactive material used at this site NY.50-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.50-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Gleason Works - NY 55  

Office of Legacy Management (LM)

Gleason Works - NY 55 Gleason Works - NY 55 FUSRAP Considered Sites Site: GLEASON WORKS (NY.55 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Rochester , New York NY.55-1 Evaluation Year: 1994 NY.55-2 Site Operations: Metal fabrication operations - Rolled uranium metal. NY.55-1 Site Disposition: Eliminated - Potential for contamination considered remote NY.55-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.55-1 Radiological Survey(s): Health and Safety Monitoring NY.55-1 NY.55-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to GLEASON WORKS NY.55-1 - NLO Report; Klein to Quigley; Trip Report to the Gleason Works, Rochester, New York on October 30 Thru November 10, 1961; December


Upstate NY Power Corp | Open Energy Information  

Open Energy Info (EERE)

energy Product Developer of clean energy projects in New York State, including wind and transmission assets. References Upstate NY Power Corp1 LinkedIn Connections CrunchBase...


DOE - Office of Legacy Management -- Rensslaer Polytechnic Institute - NY  

Office of Legacy Management (LM)

Rensslaer Polytechnic Institute - Rensslaer Polytechnic Institute - NY 18 FUSRAP Considered Sites Site: RENSSLAER POLYTECHNIC INSTITUTE (NY.18 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Troy , New York NY.18-1 Evaluation Year: 1987 NY.18-1 Site Operations: Research activities involving small quantities of radioactive materials in a controlled environment - under AEC license. NY.18-1 Site Disposition: Eliminated - Potential for residual contamination considered remote NY.18-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not Specified NY.18-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to RENSSLAER POLYTECHNIC INSTITUTE


DOE - Office of Legacy Management -- Seneca Army Depot - NY 11  

NLE Websites -- All DOE Office Websites (Extended Search)

Seneca Army Depot - NY 11 Seneca Army Depot - NY 11 FUSRAP Considered Sites Site: SENECA ARMY DEPOT (NY.11 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Romulus , New York Evaluation Year: 1985 NY.11-2 NY.11-3 Site Operations: Eleven bunkers were used to store approximately 2,000 drums of pitchblende ore in the early 1940's. The bunkers were returned to munitions storage service after removal of the ore drums. NY.11-4 Site Disposition: Eliminated - Referred to The Department of the Army NY.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Pitchblende Ore NY.11-3 Radiological Survey(s): Yes NY.11-5 Site Status: Eliminated from consideration under FUSRAP NY.11-2 Also see Documents Related to SENECA ARMY DEPOT


DOE - Office of Legacy Management -- Radiation Applications Inc - NY 57  

NLE Websites -- All DOE Office Websites (Extended Search)

Radiation Applications Inc - NY 57 Radiation Applications Inc - NY 57 FUSRAP Considered Sites Site: RADIATION APPLICATIONS, INC. ( NY.57 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: RAI NY.57-1 Location: 370 Lexington Avenue , New York , New York NY.57-3 Evaluation Year: 1991 NY.57-4 Site Operations: Developed foam separation techniques and proposed investigations to remove cesium and strontium from fission product waste solutions. No indication that a substantial quantity of radioactive material was involved. NY.57-3 NY.57-5 Site Disposition: Eliminated - Potential for contamination considered remote NY.57-4 Radioactive Materials Handled: None Indicated NY.57-1 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated


DOE - Office of Legacy Management -- Love Canal - NY 24  

Office of Legacy Management (LM)

Love Canal - NY 24 Love Canal - NY 24 FUSRAP Considered Sites Site: LOVE CANAL (NY.24 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None NY.24-1 Location: Region running from Old Military Road from the 16-acre rectangular piece of land in the southeast corner of Niagara Falls into the Township of Lewiston , Niagara Falls , New York NY.24-3 Evaluation Year: 1987 NY.24-1 Site Operations: Chemical storage and disposal. NY.24-1 NY.24-3 Site Disposition: Eliminated - No residual radioactive material found NY.24-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): Yes NY.24-5 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to LOVE CANAL


DOE - Office of Legacy Management -- Markite Co - NY 49  

Office of Legacy Management (LM)

Markite Co - NY 49 Markite Co - NY 49 FUSRAP Considered Sites Site: MARKITE CO. (NY.49 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 155 Waverly Place , New York , New York NY.49-1 Evaluation Year: 1987 NY.49-2 Site Operations: Conducted experiments with very small amounts of uranium and thorium. NY.49-2 Site Disposition: Eliminated - Handled limited amounts of radioactive materials - Potential for contamination remote NY.49-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium NY.49-2 NY.49-3 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MARKITE CO. NY.49-1 - AEC Memorandum; Morgan to Youngs; Accountability at


Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026


DOE - Office of Legacy Management -- National Carbon Co - NY 48  

Office of Legacy Management (LM)

Carbon Co - NY 48 Carbon Co - NY 48 FUSRAP Considered Sites Site: NATIONAL CARBON CO (NY.48) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.48-1 Evaluation Year: 1987 NY.48-2 Site Operations: Produced graphite for the MED/AEC. NY.48-1 NY.48-2 NY.48-3 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote - No indication that radioactive material was used on the site NY.48-2 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to NATIONAL CARBON CO NY.48-1 - AEC Letter; Crenshaw to National Carbon Company (Attn.:


DOE - Office of Legacy Management -- Buflovak Co - NY 56  

Office of Legacy Management (LM)

Buflovak Co - NY 56 Buflovak Co - NY 56 FUSRAP Considered Sites Site: Buflovak Co. (NY.56 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1543 Fillmore Ave. , Buffalo , New York NY.56-1 Evaluation Year: 1991 NY.56-2 Site Operations: Research and testing with uranium raffinate. NY.56-1 Site Disposition: Eliminated - Possibility for contamination considered remote due to scope of tests conducted and indication of cleanup operations after tests NY.56-1 NY.56-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Raffinate NY.56-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Buflovak Co.


DOE - Office of Legacy Management -- Sylvania Corning Plant - NY 19  

Office of Legacy Management (LM)

Plant - NY 19 Plant - NY 19 FUSRAP Considered Sites Sylvania-Corning, NY Alternate Name(s): Sylvania Electric Products, Inc. Sylvania Corp. NY.19-1 NY.19-4 Location: Cantiaque Road, Hicksville, Long Island, New York NY.19-5 Historical Operations: Pilot-scale production of powdered metal uranium slugs for AEC's Hanford reactor. NY.19-4 Eligibility Determination: Eligible Radiological Survey(s): Assessment Survey NY.19-3 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Sylvania-Corning, NY Historical documents may contain links which are no longer valid or to outside sources. LM can not attest to the accuracy of information provided by these links. Please see the Leaving LM Website page for more details.


DOE - Office of Legacy Management -- Staten Island Warehouse - NY 22  

Office of Legacy Management (LM)

Staten Island Warehouse - NY 22 Staten Island Warehouse - NY 22 FUSRAP Considered Sites Staten Island Warehouse, NY Alternate Name(s): Archer-Daniels Midland Company NY.22-3 Location: 2393 Richmond Terrace, Port Richmond, New York NY.22-2 Historical Operations: Stored pitchblende (high-grade uranium ore), which was purchased by the MED for the first atomic bomb. NY.22-3 Eligibility Determination: Eligible Radiological Survey(s): Assessment Survey NY.22-5 Site Status: Referred by DOE, evaluation in progess by U.S. Army Corps of Engineers. USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Staten Island Warehouse, NY NY.22-1 - MED Trip Report Summary; Authors: Ruhoff (Corps of Engineers) and Geddes (Stone & Webster); Subject: Trip to New York;

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- American Railway Express Office - NY  

Office of Legacy Management (LM)

Railway Express Office - Railway Express Office - NY 0-03 FUSRAP Considered Sites Site: American Railway Express Office (NY.0-03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: American Railway Express (Downtown) , New York , New York NY.0-03-1 Evaluation Year: 1987 NY.0-03-1 Site Operations: None - Involved with a fire during transport of uranium scrap. NY.0-03-2 Site Disposition: Eliminated - Potential for contamination remote NY.0-03-1 NY.0-03-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium scrap NY.0-03-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP NY.0-03-1 Also see Documents Related to American Railway Express Office


DOE - Office of Legacy Management -- Ledoux and Co - NY 37  

NLE Websites -- All DOE Office Websites (Extended Search)

Ledoux and Co - NY 37 Ledoux and Co - NY 37 FUSRAP Considered Sites Site: LEDOUX AND CO. (NY.37 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 155 Avenue of the Americas , New York , New York NY.37-1 Evaluation Year: 1987 NY.37-1 Site Operations: Prime contractor to AEC, African Metals. LeDoux handled radioactive materials under this contract at other locations; records indicate that radioactive materials were not sent to the New York office. NY.37-1 Site Disposition: Eliminated - Potential for contamination considered remote - Radioactive materials were not handled NY.37-2 NY.37-3 Radioactive Materials Handled: No NY.37-2 Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated


DOE - Office of Legacy Management -- Polytechnic Institute of Brooklyn - NY  

Office of Legacy Management (LM)

Polytechnic Institute of Brooklyn - Polytechnic Institute of Brooklyn - NY 0-19 FUSRAP Considered Sites Site: NY.0-19 (POLYTECHNIC INSTITUTE OF BROOKLYN) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.0-19-1 Evaluation Year: 1987 NY.0-19-1 Site Operations: Research and development involving only small quantities of radiological material in a controlled environment. NY.0-19-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-19-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not specified NY.0-19-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to NY.0-19 NY.0-19-1 - Aerospace Letter; Young to Wallo; Subject: Elimination


US MidAtl NY Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MidAtl NY MidAtl NY Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl NY Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl NY Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl NY Expenditures dollars ELECTRICITY ONLY average per household * New York households consume an average of 103 million Btu per year, 15% more than the U.S. average. * Electricity consumption in New York homes is much lower than the U.S. average, because many households use other fuels for major energy end uses like space heating, water heating, and cooking. Electricity costs are closer to the national average due to higher than average electricity prices in the state.


US MidAtl NY Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MidAtl NY MidAtl NY Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl NY Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl NY Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl NY Expenditures dollars ELECTRICITY ONLY average per household * New York households consume an average of 103 million Btu per year, 15% more than the U.S. average. * Electricity consumption in New York homes is much lower than the U.S. average, because many households use other fuels for major energy end uses like space heating, water heating, and cooking. Electricity costs are closer to the national average due to higher than average electricity prices in the state.


DOE - Office of Legacy Management -- Sacandaga - NY 51  

Office of Legacy Management (LM)

New York NY.51-1 Evaluation Year: 1992 NY.51-2 Site Operations: Plant operated by General Electric during period spanning 1947 to 1951. Facilities housed studies involving radar,...


DOE - Office of Legacy Management -- Linde Air Products Division - NY 08  

NLE Websites -- All DOE Office Websites (Extended Search)

Division - NY 08 Division - NY 08 FUSRAP Considered Sites Linde Air Products Division - Towanda, NY Alternate Name(s): Praxair Linde Aire Products Div. of Union Carbide Corp. Linde Ceramics Plant Uranium Refinery, Linde Site NY.08-4 Location: East Park Drive and Woodward, Tonawanda, New York NY.08-5 Historical Operations: Processed uranium compounds for MED and AEC. Includes Towanda Landfill as a VP. NY.08-1 NY.08-2 Eligibility Determination: Eligible NY.08-9 Radiological Survey(s): Assessment Surveys NY.08-3 NY.08-5 NY.08-6 NY.08-7 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. NY.08-8 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Linde FUSRAP Site Documents Related to Linde Air Products Division - Towanda, NY


,"Massena, NY Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Massena, NY Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Champlain, NY Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Champlain, NY Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"Waddington, NY Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Waddington, NY Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...



Office of Legacy Management (LM)

AFRICAN .METALS~ C~RPO~~XON AFRICAN .METALS~ C~RPO~~XON 41 BROAD STREET . i. ,,J iI: : LE OCT 2 2 1945 NlZWYORK4,N.Y. :October 5, 1945. Af-2-a L.: I.__: '../ . ._ The Area Engineer, U.S. Engineer Office, P.O. BOX 42, Station F., New York 16, N.Y. Gentlemen: Contract W-7405 eng-4. Reference is made to your letter EIDM A-33 MS of August 27th, 1945. Contract W-7405 eng-4 called for the delivery of 100 T of M-31, the M308 content of which was sold to you, whereas we reserved all rights to the R-l contained therein. We hereby certify that the liability of the Gouvernment in connection with the M308 contained--has .3*,., been completely fulfilled, and that the R-l%ontained has been returned to us in accordance with separate contract entered into between this Corporation and the Eldorado


DOE - Office of Legacy Management -- Naval Supply Depot AEC Warehouse - NY  

Office of Legacy Management (LM)

Supply Depot AEC Warehouse - Supply Depot AEC Warehouse - NY 36 FUSRAP Considered Sites Site: NAVAL SUPPLY DEPOT, AEC WAREHOUSE (NY.36) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Building 546 , Scotia , New York NY.36-1 Evaluation Year: 1987 NY.36-1 Site Operations: This facility served as a storage and transshipment point for feed materials between the Hanford and commercial metal fabricators in the northeastern states. NY.36-1 NY.36-2 NY.36-3 Site Disposition: Eliminated - Referred to DOD NY.36-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium Metals NY.36-1 NY.36-2 NY.36-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD NY.36-1


Northern Westchester Energy Action Consortium (NY) | Open Energy  

Open Energy Info (EERE)

Energy Action Consortium (NY) Energy Action Consortium (NY) Jump to: navigation, search Logo: Northern Westchester Energy Action Consortium (NY) Name Northern Westchester Energy Action Consortium (NY) Address PO Box 681 Place Somers, New York Zip 10589 Region Northeast - NY NJ CT PA Area Year founded 2009 Website http://www.nweac.org Coordinates 41.3278772°, -73.6948234° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.3278772,"lon":-73.6948234,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Property:EIA/861/IsoNy | Open Energy Information  

Open Energy Info (EERE)

IsoNy IsoNy Jump to: navigation, search Property Name ISO_NY Property Type Boolean Description Indicates that the organization conducts operations in the NY ISO region [1] References ↑ "EIA Form EIA-861 Final Data File for 2010 - 861 Webfile Layout for 2010.doc" Pages using the property "EIA/861/IsoNy" Showing 25 pages using this property. (previous 25) (next 25) A AES Eastern Energy LP + true + AP Holdings LLC + true + Agway Energy Services, LLC + true + B Bath Electric Gas & Water Sys + true + Bluerock Energy, Inc. + true + C Central Hudson Gas & Elec Corp + true + City of Salamanca, New York (Utility Company) + true + City of Sherrill, New York (Utility Company) + true + City of Watertown, New York (Utility Company) + true +


DOE - Office of Legacy Management -- Tonawanda North Units 1 and 2 - NY 10  

NLE Websites -- All DOE Office Websites (Extended Search)

Tonawanda North Units 1 and 2 - NY Tonawanda North Units 1 and 2 - NY 10 FUSRAP Considered Sites Tonawanda North, NY, Units 1 and 2 Alternate Name(s): Ashland #1 and Ashland #2 Haist Property Seaway Area D Rattlesnake Creek NY.10-1 Location: State Highway 266, east of Interstate Highway 190, Tonawanda, NY NY.10-4 Historical Operations: Served as a repository for refined uranium and vanadium residues containing thorium and radium, generated by Linde Air Products. NY.10-4 NY.10-5 NY.10-6 NY.10-7 NY.10-9 Eligibility Determination: Eligible NY.10-1 NY.10-2 NY.10-3 Radiological Survey(s): Assessment Survey NY.10-4 Site Status: Certified - Certification Basis, Declaration of Completion Included NY.10-11 NY.10-13 NY.10-14 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOE - Office of Legacy Management -- Radium Chemical Co Inc - NY 60  

NLE Websites -- All DOE Office Websites (Extended Search)

Radium Chemical Co Inc - NY 60 Radium Chemical Co Inc - NY 60 FUSRAP Considered Sites Site: RADIUM CHEMICAL CO., INC (NY.60 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.60-1 Evaluation Year: 1987 NY.60-1 Site Operations: Commercial Producer of Radium. NY.60-1 Site Disposition: Eliminated - Commercial site - EPA cleanup project NY.60-1 Radioactive Materials Handled: Yes NY.60-1 Primary Radioactive Materials Handled: Radium NY.60-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to RADIUM CHEMICAL CO., INC NY.60-1 - Memorandum; A. Wallo to the File; Subject: FUSRAP review and elimination of the Radium Chemical Co. site in New York, NY; November


DOE - Office of Legacy Management -- Utica Street Warehouse - NY 0-23  

Office of Legacy Management (LM)

Street Warehouse - NY 0-23 Street Warehouse - NY 0-23 FUSRAP Considered Sites Site: UTICA STREET WAREHOUSE (NY.0-23) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 240 West Utica Street , Buffalo , New York NY.0-23-2 Evaluation Year: 1987 NY.0-23-1 Site Operations: Stored and rebarrelled uranium process residues from operations at Linde. NY.0-23-3 Site Disposition: Eliminated - Original building demolished. Current land use - Parking facility. Potential for residual radioactive contamination considered remote. NY.0-23-1 Radioactive Materials Handled: Yes NY.0-23-1 Primary Radioactive Materials Handled: Natural Uranium Process Residues NY.0-23-1 Radiological Survey(s): None Indicated NY.0-23-1 Site Status: Eliminated from consideration under FUSRAP NY.0-23-1


DOE - Office of Legacy Management -- Eastman Kodak Laboratory - NY 0-09  

Office of Legacy Management (LM)

Eastman Kodak Laboratory - NY 0-09 Eastman Kodak Laboratory - NY 0-09 FUSRAP Considered Sites Site: Eastman Kodak Laboratory (NY.0-09 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Eastman Kodak Rochester Lab NY.0-09-1 Location: Rochester , New York NY.0-09-1 Evaluation Year: 1987 NY.0-09-1 NY.0-09-2 Site Operations: Research and development with natural uranium solutions in 1943. NY.0-09-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-09-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.0-09-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Eastman Kodak Laboratory NY.0-09-1 - Memorandum/Checklist; Wallo to the File; Subject:


DOE - Office of Legacy Management -- Simmons Machine and Tool Inc - NY 35  

NLE Websites -- All DOE Office Websites (Extended Search)

Simmons Machine and Tool Inc - NY Simmons Machine and Tool Inc - NY 35 FUSRAP Considered Sites Site: SIMMONS MACHINE AND TOOL, INC (NY.35) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1000 North Broadway , Albany , New York NY.35-1 Evaluation Year: 1987 NY.35-2 Site Operations: Tested equipment and machined uranium to test the equipment (one time event). NY.35-1 NY.35-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope and duration of activity performed at the site NY.35-2 NY.35-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.35-1 NY.35-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


DOE - Office of Legacy Management -- ACF Industries Inc - NY...  

Office of Legacy Management (LM)

Subject: Support of Findings and Determination - ACF Production Contract; February 15, 1954 NY.13-3 - AEC Letter; Donnelly to Pittman; Subject: Contaminated Ex-AEC-Owned or Leased...


Los Alamos technology to be featured on CSI: NY  

NLE Websites -- All DOE Office Websites (Extended Search)

device developed at Los Alamos National Laboratory will be used in an episode of Crime Scene Investigation-New York (CSI: NY) scheduled to air at 9 p.m. Mountain Daylight...


Yi-Jen Chiang Polytechnic University, NY, USA  

E-Print Network (OSTI)

Yi-Jen Chiang Xiang Lu Polytechnic University, NY, USA (appeared in Eurographics, Sept. 2003) #12] does not capture genus-change-only events) 1. Classify all vertices as critical / non-critical [Chiang

Chiang, Yi-Jen


RenewableNY - An Industrial Energy Conservation Initiative  

SciTech Connect

The New York Industrial Retention Network (NYIRN) manages the RenewableNY program to assist industrial companies in New York City to implement energy efficiency projects. RenewableNY provides companies with project management assistance and grants to identify opportunities for energy savings and implement energy efficiency projects. The program helps companies identify energy efficient projects, complete an energy audit, and connect with energy contractors who install renewable energy and energy efficient equipment. It also provides grants to help cover the costs of installation for new systems and equipment. RenewableNY demonstrates that a small grant program that also provides project management assistance can incentivize companies to implement energy efficiency projects that might otherwise be avoided. Estimated savings through RenewableNY include 324,500 kWh saved through efficiency installations, 158 kW of solar energy systems installed, and 945 thm of gas avoided.

Lubarr, Tzipora



Niagara Falls, NY Natural Gas Pipeline Imports From Canada ...  

U.S. Energy Information Administration (EIA)

Niagara Falls, NY Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 9,497: 6,894: 4,421: 2,459 ...


DOE - Office of Legacy Management -- Allegheny-Ludlum Steel Corp - NY 0-02  

Office of Legacy Management (LM)

Allegheny-Ludlum Steel Corp - NY Allegheny-Ludlum Steel Corp - NY 0-02 FUSRAP Considered Sites Site: ALLEGHENY-LUDLUM STEEL CORP. (NY.0-02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Al-Tech Specialty Steel NY.0-02-1 Location: Watervliet and Dunkirk , New York NY.0-02-1 Evaluation Year: 1985 NY.0-02-2 Site Operations: Processed uranium metal for the AEC in the early 1950s; rolled uranium billets into rods. NY.0-02-3 Site Disposition: Eliminated - Potential for contamination remote - Confirmed by radiological survey NY.0-02-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal NY.0-02-3 Radiological Survey(s): Yes NY.0-02-4 Site Status: Eliminated from consideration under FUSRAP Also see


DOE - Office of Legacy Management -- Lucius Pitkin - NY 0-15  

Office of Legacy Management (LM)

Lucius Pitkin - NY 0-15 Lucius Pitkin - NY 0-15 FUSRAP Considered Sites Site: Lucius Pitkin (NY.0-15 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 47 Fulton Street , New York , New York NY.0-15-1 Evaluation Year: 1987 NY.0-15-1 Site Operations: No MED or AED work done at this site. Contractor supervised activities at Middlesex Sampling Plant in Middlesex, NJ such as assaying, sampling and weighing of ore. NY.0-15-1 NY.0-15-2 Site Disposition: Eliminated - No radioactive material handled at this site NY.0-15-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None NY.0-15-1 NY.0-15-2 Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP Also see


DOE - Office of Legacy Management -- American Machine and Foundry Co - NY  

NLE Websites -- All DOE Office Websites (Extended Search)

Machine and Foundry Co - Machine and Foundry Co - NY 26 FUSRAP Considered Sites Site: American Machine and Foundry Co ( NY.26 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Lutheran Medical Center NY.26-1 Location: Second Avenue and 56th Street , Brooklyn , New York NY.26-2 Evaluation Year: 1992 NY.26-1 Site Operations: 1951 - 1954 conducted metal fabrication operation on uranium and thorium metals. NY.26-3 NY.26-4 Site Disposition: Eliminated - Potential for contamination considered remote based on results of radiological monitoring and sampling and extensive renovation of the site NY.26-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium and Thorium metal NY.26-1 Radiological Survey(s): Yes NY.26-5


DOE - Office of Legacy Management -- Union Mines Development Corp - NY 0-22  

Office of Legacy Management (LM)

Mines Development Corp - NY Mines Development Corp - NY 0-22 FUSRAP Considered Sites Site: UNION MINES DEVELOPMENT CORP. (NY.0-22) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Union Carbide NY.0-22-1 Location: New York , New York NY.0-22-1 Evaluation Year: 1987 NY.0-22-1 Site Operations: The company owned uranium mines or reserves located in the western U.S. NY.0-22-1 Site Disposition: Eliminated - No reason to believe radioactive material was used at this site NY.0-22-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated NY.0-22-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to UNION MINES DEVELOPMENT CORP.


DOE - Office of Legacy Management -- Fordham University - NY 0-12  

Office of Legacy Management (LM)

Fordham University - NY 0-12 Fordham University - NY 0-12 FUSRAP Considered Sites Site: Fordham University (NY.0-12 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.0-12-1 Evaluation Year: 1987 NY.0-12-1 Site Operations: Research and development involving small quantities of radioactive material in a controlled environment NY.0-12-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-12-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not Specified NY.0-12-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Fordham University NY.0-12-1 - Aerospace Letter; Young to Wallo; Subject: Elimination


DOE - Office of Legacy Management -- Floyd Bennett Field - NY 0-11  

Office of Legacy Management (LM)

Floyd Bennett Field - NY 0-11 Floyd Bennett Field - NY 0-11 FUSRAP Considered Sites Site: Floyd Bennett Field (NY.0-11 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Naval Air Station NY.0-11-1 Location: Buildings 67 and 69 , Brooklyn , New York NY.0-11-1 Evaluation Year: 1987 NY.0-11-1 Site Operations: The Air station was considered by the AEC but was not used. NY.0-11-1 Site Disposition: Eliminated - No involvement with MED/AEC operations NY.0-11-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Floyd Bennett Field NY.0-11-1 - Memorandum/Checklist; Wallo to the File; Subject: Elimination of Floyd Bennett Field; December 7, 1987


DOE - Office of Legacy Management -- Wolff-Alport and Co - NY 30  

Office of Legacy Management (LM)

Wolff-Alport and Co - NY 30 Wolff-Alport and Co - NY 30 FUSRAP Considered Sites Site: Wolff-Alport and Co (NY.30) Eliminated from consideration under FUSRAP - Referred to US EPA Region II and New York City Department of Health Designated Name: Not Designated Alternate Name: None Location: 1127 Irving Avenue , Brooklyn , New York NY.30-1 Evaluation Year: 1987 NY.30-1 Site Operations: Commercial operation -- sold thorium residues to the AEC, which in turn shipped the residues to Maywood for storage. NY.30-2 Site Disposition: Eliminated - No Authority NY.30-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium NY.30-2 Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA Region II and New York City Department of Health NY.30-1


DOE - Office of Legacy Management -- Frederick Flader Inc - NY 0-13  

NLE Websites -- All DOE Office Websites (Extended Search)

Frederick Flader Inc - NY 0-13 Frederick Flader Inc - NY 0-13 FUSRAP Considered Sites Site: Frederick Flader, Inc. (NY.0-13 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Frederick Flader Division of Eaton Manufacturing Co. NY.0-13-1 Location: 583 Division Street , N. Tonawanda , New York NY.0-13-1 Evaluation Year: 1987 NY.0-13-1 Site Operations: Provided consulting services and supported development of auxiliary equipment related to nuclear power NY.0-13-1 Site Disposition: Eliminated NY.0-13-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated NY.0-13-1 Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Frederick Flader, Inc.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Town of Brookhaven STATE: NY Town of Brookhaven STATE: NY PROJECT EECBG (S) - Brookhaven (NY): Henrietta Acampora Recreation Center TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA-0000013 DE-EE0000688 GFO-0000688-002 Based on my review of the information concerning tbe proposed action, as NEPA Compliance Officer (autborized under DOE Order 4St.tA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy. demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Consolidated Edison Co-NY Inc | Open Energy Information  

Open Energy Info (EERE)

NY Inc NY Inc Jump to: navigation, search Name Consolidated Edison Co-NY Inc Place New York, New York Service Territory New York Website www.coned.com Green Button Reference Page www.whitehouse.gov/sites/ Green Button Committed Yes Utility Id 4226 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Consolidated Edison Company of New York, Inc. Smart Grid Demonstration


DOE - Office of Legacy Management -- Wilson Warehouse - NY 64  

Office of Legacy Management (LM)

Wilson Warehouse - NY 64 Wilson Warehouse - NY 64 FUSRAP Considered Sites Site: Wilson Warehouse (NY.64) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


DOE - Office of Legacy Management -- Pfohl Brothers Landfill - NY 66  

Office of Legacy Management (LM)

Pfohl Brothers Landfill - NY 66 Pfohl Brothers Landfill - NY 66 FUSRAP Considered Sites Site: Pfohl Brothers Landfill (NY.66 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Five-Year Review Report Pfohl Brothers Landfill Superfund Site Erie County Town of Cheektowaga, New York EPA REGION 2 Congressional District(s): 30 Erie Cheektowaga NPL LISTING HISTORY Documents Related to Pfohl Brothers Landfill Historical documents may contain links which are no longer valid or to outside sources. LM can not attest to the accuracy of information provided by these links. Please see the Leaving LM Website page for more details.

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Consolidated Edison Co-NY Inc | Open Energy Information  

Open Energy Info (EERE)

Consolidated Edison Co-NY Inc Consolidated Edison Co-NY Inc (Redirected from ConEdison) Jump to: navigation, search Name Consolidated Edison Co-NY Inc Place New York, New York Service Territory New York Website www.coned.com Green Button Landing Page www.coned.com/customercen Green Button Reference Page www.whitehouse.gov/blog/2 Green Button Implemented Yes Utility Id 4226 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now!


Business Council of Westchester County (NY) | Open Energy Information  

Open Energy Info (EERE)

of Westchester County (NY) of Westchester County (NY) Jump to: navigation, search Name Business Council of Westchester County (NY) Address 108 Corporate Park Drive, Suite 101 Place White Plains, New York Zip 10604 Sector Services Product Green Power Marketer Website http://www.westchesterny.org/ Coordinates 41.0200884°, -73.7206631° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.0200884,"lon":-73.7206631,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ho-Ho-Kus, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ho-Ho-Kus, New Jersey: Energy Resources Ho-Ho-Kus, New Jersey: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.9964864°, -74.101253° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.9964864,"lon":-74.101253,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- Linde Air Products Div - Buffalo - NY  

Office of Legacy Management (LM)

Linde Air Products Div - Buffalo - Linde Air Products Div - Buffalo - NY 65 FUSRAP Considered Sites Site: LINDE AIR PRODUCTS DIV. BUFFALO (NY.65 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Linde Chandler Street Plant NY.65-1 Location: Buffalo , New York NY.65-1 Evaluation Year: 1987 NY.65-1 Site Operations: Developed and produced non-radioactive material for the Oak Ridge Gaseous Diffusion Plant under contract with the AEC. NY.65-2 Site Disposition: Eliminated - No indication that radioactive materials were used at the site NY.65-3 Radioactive Materials Handled: No NY.65-1 Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Long Island College of Medicine - NY  

Office of Legacy Management (LM)

Long Island College of Medicine - Long Island College of Medicine - NY 0-14 FUSRAP Considered Sites Site: Long Island College of Medicine (NY.0-14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.0-14-1 Evaluation Year: 1987 NY.0-14-1 Site Operations: Performed research utilizing small quantities of radioactive materials in a controlled environment. NY.0-14-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-14-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not Specified NY.0-14-1 Radiological Survey(s): None Indicated NY.0-14-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Long Island College of Medicine


DOE - Office of Legacy Management -- Colorado Fuel and Iron - NY 0-08  

Office of Legacy Management (LM)

Fuel and Iron - NY 0-08 Fuel and Iron - NY 0-08 FUSRAP Considered Sites Site: Colorado Fuel and Iron (NY.0-08 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Watervliet , New York NY.0-08-1 Evaluation Year: 1987 NY.0-08-1 Site Operations: Site was a contractor to DuPont. Exact nature of operations is not clear. No records to indicate that radioactive materials were handled at the site. NY.0-08-1 Site Disposition: Eliminated NY.0-08-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Colorado Fuel and Iron NY.0-08-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Assessment of Summer RBOB Supply for NY & CT  

Gasoline and Diesel Fuel Update (EIA)

Update of Summer Reformulated Gasoline Supply Update of Summer Reformulated Gasoline Supply Assessment for New York and Connecticut May 5, 2004 In October 2003, EIA published a review of the status of the methyl tertiary butyl ether (MTBE) ban transition in New York (NY) and Connecticut (CT) 1 that noted significant uncertainties in gasoline supply for those States for the summer of 2004. To obtain updated information, EIA spoke to major suppliers to the two States over the past several months as the petroleum industry began the switch from winter- to summer-grade gasoline. As discussed on our earlier report, the NY and CT bans on MTBE mainly affect reformulated gasoline (RFG), which in recent years has been provided by domestic refineries on the East Coast (PADD 1) and imports. Our recent findings indicate that


Characterization of TiOxNy nanoparticles embedded in HfOxNy as charge trapping nodes for nonvolatile memory device applications  

Science Conference Proceedings (OSTI)

Silicon-oxide-nitride-oxide-silicon devices with nanoparticles (NPs) as charge trapping nodes (CTNs) are important to provide enhanced performance for nonvolatile memory devices. To study these topics, the TiO"xN"y metal oxide NPs embedded in the HfO"xN"y ... Keywords: Charge trapping nodes, HfOxNy, Nanoparticles, Nonvolatile memory devices, TiOxNy

Chien-Wei Liu; Chin-Lung Cheng; Kuei-Shu Chang-Liao; Jin-Tsong Jeng; Bau-Tong Dai; Chen-Pang Tsai




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Trends, seasonal cycles and synpotic scale episodes of halocarbons observed in Ny-Ålesund, Spitsbergen.  

E-Print Network (OSTI)

??A study of the important gases in the air at the Ny-Ålesund measuring station at Svalbard is presented in this thesis. The monitoring station is… (more)

Fjæraa, Ann Mari



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Renewable Energy Network of Entrepreneurs in Western New York RENEW NY |  

Open Energy Info (EERE)

Network of Entrepreneurs in Western New York RENEW NY Network of Entrepreneurs in Western New York RENEW NY Jump to: navigation, search Name Renewable Energy Network of Entrepreneurs in Western New York (RENEW NY) Place Rochester, New York Zip 14623 Sector Renewable Energy Product US-based incubator fund, Renewable Energy Network of Entrepreneurs in Western New York, helps early stage renewable energy companies to start and grow in Western New York. References Renewable Energy Network of Entrepreneurs in Western New York (RENEW NY)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Energy Network of Entrepreneurs in Western New York (RENEW NY) is a company located in Rochester, New York . References ↑ "Renewable Energy Network of Entrepreneurs in Western New York


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


The Measurement of OH and HO2 in the Atmosphere  

Science Conference Proceedings (OSTI)

Measurements of the OH and HO2 radicals form stringent tests of our knowledge of atmospheric photochemistry. Owing to the extremely low concentrations of these species, their determination has posed a considerable experimental challenge; but now, ...

David R. Crosley



miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Solar system tests of Ho?ava-Lifshitz gravity  

E-Print Network (OSTI)

Recently, a renormalizable gravity theory with higher spatial derivatives in four dimensions was proposed by Ho\\v{r}ava. The theory reduces to Einstein gravity with a non-vanishing cosmological constant in IR, but it has improved UV behaviors. The spherically symmetric black hole solutions for an arbitrary cosmological constant, which represent the generalization of the standard Schwarzschild-(A)dS solution, has also been obtained for the Ho\\v{r}ava-Lifshitz theory. The exact asymptotically flat Schwarzschild type solution of the gravitational field equations in Ho\\v{r}ava gravity contains a quadratic increasing term, as well as the square root of a fourth order polynomial in the radial coordinate, and it depends on one arbitrary integration constant. The IR modified Ho\\v{r}ava gravity seems to be consistent with the current observational data, but in order to test its viability more observational constraints are necessary. In the present paper we consider the possibility of observationally testing Ho\\v{r}ava gravity at the scale of the Solar System, by considering the classical tests of general relativity (perihelion precession of the planet Mercury, deflection of light by the Sun and the radar echo delay) for the spherically symmetric black hole solution of Ho\\v{r}ava-Lifshitz gravity. All these gravitational effects can be fully explained in the framework of the vacuum solution of the gravity. Moreover, the study of the classical general relativistic tests also constrain the free parameter of the solution.

Tiberiu Harko; Zoltan Kovács; Francisco S. N. Lobo



DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Integrys Energy Services of N.Y., Inc. | Open Energy Information  

Open Energy Info (EERE)

Services of N.Y., Inc. Services of N.Y., Inc. (Redirected from Integrys) Jump to: navigation, search Name Integrys Energy Services of N.Y., Inc. Place New York Utility Id 21258 Utility Location Yes Ownership R ISO NY Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0625/kWh Commercial: $0.0809/kWh Industrial: $0.0631/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Integrys_Energy_Services_of_N.Y.,_Inc.&oldid=410875


HO #10 NRES 725: Plant Phys. Ecology Spring 2013 From Lambers et al. (2008)  

E-Print Network (OSTI)

HO #10 NRES 725: Plant Phys. Ecology Spring 2013 From Lambers et al. (2008) CO2 #12;HO #11 NRES 725: Plant Phys. Ecology Spring 2013 From Lambers et al. (2008) From Sage (1994) Photosynthesis Research 27:605-617 #12;HO #12 NRES 725: Plant Phys. Ecology Spring 2013 From Larcher (1995) Fom Lambers et al. (2008) #12

Nowak, Robert S.


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Submit Your Ideas for the NY Energy Data Jam | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam June 19, 2013 - 11:03am Q&A What idea would you present at the Data Jam? Join the Conversation Addthis Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Alex Cohen Alex Cohen Senior Digital Information Strategist How can I participate? Even if you cannot attend in person, we still want you to participate. Help us by starting the conversation. Email us at newmedia@hq.doe.gov and tell us your idea. Tweet questions to @ENERGY with the hashtag #EnergyJam.


New York Battery and Energy Storage Technology Consortium NY BEST | Open  

Open Energy Info (EERE)

Storage Technology Consortium NY BEST Storage Technology Consortium NY BEST Jump to: navigation, search Name New York Battery and Energy Storage Technology Consortium (NY-BEST) Place Albany, New York Zip 12203 Product Albany-based project of NYSERDA promoting battery and energy storage in New York. Coordinates 42.707237°, -89.436378° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.707237,"lon":-89.436378,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE Awards Small Business Contract for West Valley NY Services | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Contract for West Valley NY Services Contract for West Valley NY Services DOE Awards Small Business Contract for West Valley NY Services September 26, 2012 - 12:00pm Addthis Media Contact Bill Taylor bill.taylor@srs.gov 803-952-8564 CINCINNATI - The Department of Energy (DOE) today awarded a task order (contract) to Chenega Global Services, LLC of Anchorage, Alaska, for administrative and technical support services at the West Valley Demonstration Project, West Valley, New York. The contract has a one-year performance period with a value of $1.3 million, and contains two one-year extension options with a total value of $4.12 million. Chenega Global Services is a certified small and disadvantaged business under the Small Business Administration. The West Valley Demonstration Project is a former commercial nuclear fuel


Weatherization Subgrantees Reach More N.Y. Homes | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Subgrantees Reach More N.Y. Homes Subgrantees Reach More N.Y. Homes Weatherization Subgrantees Reach More N.Y. Homes April 22, 2010 - 4:37pm Addthis Lindsay Gsell Thanks to funds from the Recovery Act, New York expanded its network of weatherization subgrantees. The state has added nine additional subgrantees to its network of 66 community-based organizations that provide energy conservation services on a local level. New York's Division of Housing and Community Renewal received slightly more than $100 million for Weatherization Assistance Program in 2009, a significant increase from its previous annual allotment of approximately $60 million. In addition to this increase in annual funding, DHCR also received $394 million in WAP stimulus funding from the Recovery Act. "New York's success has been built on a network of sub grantees and


DOE - Office of Legacy Management -- West Milton Reactor Site - NY 21  

Office of Legacy Management (LM)

Milton Reactor Site - NY 21 Milton Reactor Site - NY 21 FUSRAP Considered Sites Site: West Milton Reactor Site (NY.21) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


Submit Your Ideas for the NY Energy Data Jam | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam June 19, 2013 - 11:03am Q&A What idea would you present at the Data Jam? Join the Conversation Addthis Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Alex Cohen Alex Cohen Senior Digital Information Strategist How can I participate? Even if you cannot attend in person, we still want you to participate. Help us by starting the conversation. Email us at newmedia@hq.doe.gov and tell us your idea. Tweet questions to @ENERGY with the hashtag #EnergyJam.


DOE - Office of Legacy Management -- Pier 38 - NY 0-18  

Office of Legacy Management (LM)

Pier 38 - NY 0-18 Pier 38 - NY 0-18 FUSRAP Considered Sites Site: Pier 38 (NY.0-18 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Interacting Dark Energy in Ho?ava-Lifshitz Cosmology  

E-Print Network (OSTI)

In the usual Ho\\v{r}ava-Lifshitz cosmological models, the scalar field is responsible for dark matter. Using an additional scalar field, Saridakis \\cite{sari} has formulated Ho\\v{r}ava-Lifshitz cosmology with an effective dark energy sector. In the paper \\cite{sari} the scalar fields do not interact with each other, here we extend this work to the interacting case, where matter scalar field $\\phi$ interact with dark energy scalar field $\\sigma$. We will show that in contrast with \\cite{sari}, where $\\sigma$-filed is absent, we can obtain $w_d ^{\\rm eff}dark energy presenting phantom behaviour. This behaviour is pure effect of the interaction.

M R Setare



Evaporation Time of Ho?ava Gravity Black Holes  

Science Conference Proceedings (OSTI)

Recently it has been a lot of interest in the theory proposed by Ho?ava because is a remormalizable theory of gravity and may be a candidate for the UV completion of Einstein gravity. In the present work we study thermodynamical properties of black hole type solutions in this setup. In particular we are able to obtain times of evaporation for black hole solution in this formalism.

S. Pérez?Payán; M. Sabido



Joint Metering and Conflict Resolution in Air Traffic Control Jerome Le Ny  

E-Print Network (OSTI)

Joint Metering and Conflict Resolution in Air Traffic Control Jerome Le Ny and George J. Pappas programming. A key feature of this approach is its ability to also take into account various metering and metering in order to support this task. This paper addresses this problem by presenting a trajectory

Plotkin, Joshua B.


A parameterization of the Fermat curves satisfying x^(2N)+y^(2N)=1  

E-Print Network (OSTI)

Note that the family of closed curves C_N={(x,y)\\in R^2;x^(2N)+y^(2N)=1} for N=1,2,3,... approaches the boundary of [-1,1]^2 as N \\to \\infty. In this paper we exhibit a natural parameterization of these curves and generalize to a larger class of equations.

Kerry M. Soileau



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


File:USDA-CE-Production-GIFmaps-NY.pdf | Open Energy Information  

Open Energy Info (EERE)

NY.pdf NY.pdf Jump to: navigation, search File File history File usage New York Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 324 KB, MIME type: application/pdf) Description New York Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States New York External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:19, 27 December 2010 Thumbnail for version as of 16:19, 27 December 2010 1,650 × 1,275 (324 KB) MapBot (Talk | contribs) Automated bot upload


MHK Projects/GCK Technology Shelter Island NY US | Open Energy Information  

Open Energy Info (EERE)

Shelter Island NY US Shelter Island NY US < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.0682,"lon":-72.3387,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- Pfaltz and Bauer Inc - New York - NY  

Office of Legacy Management (LM)

New York - New York - NY 45 FUSRAP Considered Sites Site: Pfaltz and Bauer Inc - New York (NY.45) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


File:EIA-Appalach1-NY-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

EIA-Appalach1-NY-BOE.pdf EIA-Appalach1-NY-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, New York Area Oil and Gas Fields By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 12.75 MB, MIME type: application/pdf) Description Appalachian Basin, New York Area Oil and Gas Fields By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States New York File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


SiO2 aerogel film as a novel intermetal dielectric Moon-Ho Jo, Hyung-Ho Park,a)  

E-Print Network (OSTI)

SiO2 aerogel film as a novel intermetal dielectric Moon-Ho Jo, Hyung-Ho Park,a) Dong-Joon Kim, Sang, cross talk, and interconnection delay in the deep submicron device regime. SiO2 aerogel is one of the successful fabrication of a SiO2 aerogel film as well as its material properties and electrical properties

Jo, Moon-Ho


Affirmatively furthering fair housing : overcoming barriers to implementation of the Westchester County, NY false claims case settlement  

E-Print Network (OSTI)

Westchester County, NY was sued by the Anti-Discrimination Center of Metro New York, Inc. (ADC) under the False Claims Act for allegedly failing to meet its Affirmatively Further Fair Housing obligation for Community ...

Stein, Julie Iris



Built waterfront through edge, connection, and exchange : reclaiming a waterfront for Greenpoint, a project in Brooklyn, N.Y.  

E-Print Network (OSTI)

Currently the waterfront of Brooklyn N.Y. between the Gowanus Canal of Redhook and the Newton Creek of Greenpoint is predominantly lined with various types of industrial and manufacturing uses. Scattered throughout are ...

Ziesemann, Rodney P. (Rodney Paul), 1967-



Reinterpretation of Sieczka-Ho{\\l}yst financial market model  

E-Print Network (OSTI)

In this work we essentially reinterpreted the Sieczka-Ho{\\l}yst (SH) model to make it more suited for description of real markets. For instance, this reinterpretation made it possible to consider agents as crafty. These agents encourage their neighbors to buy some stocks if agents have an opportunity to sell these stocks. Also, agents encourage them to sell some stocks if agents have an opposite opportunity. Furthermore, in our interpretation price changes respond only to the agents' opinions change. This kind of respond protects the stock market dynamics against the paradox (present in the SH model), where all agents e.g. buy stocks while the corresponding prices remain unchanged. In this work we found circumstances, where distributions of returns (obtained for quite different time scales) either obey power-law or have at least fat tails. We obtained these distributions from numerical simulations performed in the frame of our approach.

Denys, Mateusz; Kutner, Ryszard



Taming the Storage Dragon: The Adventures of HoTMaN  

E-Print Network (OSTI)

HoTMaN (HoT-standby MaNager) is a joint research and development project between MySpace and USC Database Laboratory to design and develop a tool to ensure a 24x7 up-time and ease administration of Terabytes of storage that sits underneath hundreds of database servers. The HoTMaN tool’s innovation and uniqueness is that it can, with a few clicks, perform operational tasks that require hundreds of keyboard strokes by “trusted trained ” experts. With HoTMaN, MySpace can within minutes migrate the relational database(s) of a failed server to a hot-standby. A process that could take over 1 hour and had a high potential for human error is now performed reliably. A database internal to HoTMaN captures all virtual disks, volume and file configurations associated with each SQL Server and candidate hot-standby servers where SQL server processing could be migrated. HoTMaN is deployed in production and its current operational benefits include: (i) enhanced availability of data, and (ii) planned maintenance and patching. In the future, HoTMaN can be extended to migrate relational databases when a server reaches an autonomic threshold. 1

Shahram Gh; Andrew Goodney; Chetan Sharma; Chris Bissell; Felipe Cariño; Naveen Nannapaneni; Alex Wergeles; Aber Whitcomb



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Low energy spin dynamics in the spin ice, Ho2Sn2O7  

SciTech Connect

The magnetic properties of Ho{sub 2}Sn{sub 2}O{sub 7} have been investigated and compared to other spin ice compounds. Although the lattice has expanded by 3% relative to the better studied Ho{sub 2}Ti{sub 2}O{sub 7} spin ice, no significant changes were observed in the high temperature properties, T {approx}> 20 K. As the temperature is lowered and correlations develop, Ho{sub 2}Sn{sub 2}O{sub 7} enters its quantum phase at a slightly higher temperature than Ho{sub 2}Ti{sub 2}O{sub 7} and is more antiferromagnetic in character. Below 80 K a weak inelastic mode associated with the holmium nuclear spin system has been measured. The hyperfine field at the holmium nucleus was found to be {approx}700 T.

Ehlers, Georg [ORNL; Huq, Ashfia [ORNL; Diallo, Souleymane Omar [Oak Ridge National Laboratory (ORNL); Adriano, Cris [ORNL; Rule, K [Helmholtz-Zentrum Berlin; Cornelius, A. L. [University of Nevada, Las Vegas; Fouquet, Peter [Institut Laue-Langevin (ILL); Pagliuso, P G [Instituto de Fisica Gleb Wataghin, Unicamp, Brazil; Gardner, Jason [Indiana University



Magnetic Properties of RB66 (R = Gd, Tb, Ho, Er, and Lu)  

SciTech Connect

We report magnetic susceptibility measurements of RB66 (R = Gd, Tb, Ho, Er, and Lu) boron-rich rare earth containing borides down to 50 mK. The data suggest a spin glass low temperature state for RB66 (R = Gd, Tb, Ho, and Er) with the freezing temperatures below 1 K. The magnetic properties appear to be influenced by the anisotropy of the magnetic moments, probably via the crystalline electric field effects.

Kim, Hyunsoo; Budko, Serguei; ATanatar, Makariy; Avdashchenko, D.V.; Matovnikov, A.V.; Mitroshenkov, N.V.; Novikov, V.V.; Prozorov, Ruslan



Structural, optical and electrical properties of WOxNy filmsdeposited by reactive dual magnetron sputtering  

SciTech Connect

Thin films of tungsten oxynitride were prepared by dual magnetron sputtering of tungsten using argon/oxygen/nitrogen gas mixtures with various nitrogen/oxygen ratios. The presence of even small amounts of oxygen had a great effect not only on the composition but on the structure of WOxNy films, as shown by Rutherford backscattering and x-ray diffraction, respectively. Significant incorporation of nitrogen occurred only when the nitrogen partial pressure exceeded 89 percent of the total reactive gas pressure. Sharp changes in the stoichiometry, deposition rate, room temperature resistivity, electrical activation energy and optical band gap were observed when the nitrogen/oxygen ratio was high.The deposition rate increased from 0.31 to 0.89 nm/s, the room temperature resistivity decreased from 1.65 x 108 to 1.82 x 10-2 ?cm, the electrical activation energy decreased from 0.97 to 0.067 eV, and the optical band gap decreased from 3.19 to 2.94 eV upon nitrogen incorporation into the films. WOxNy films were highly transparent as long as the nitrogen incorporation was low, and were brownish (absorbing) and partially reflecting as nitrogen incorporation became significant.

Mohamed, Sodky H.; Anders, Andre



JOURNAL DE PHYSIQUE Colloque C I, supple'mentau no2-3, Tome 32, Fe'vrier-Mars1971,page C 1 -362 NEUTRON DIFFRACTION STUDY OF Ho, ,-DY,~AND Ho5,-Dy5  

E-Print Network (OSTI)

NEUTRON DIFFRACTION STUDY OF Ho, ,-DY,~AND Ho5,-Dy5 IN AN EXTERNAL MAGNETIC FIELD (*) Q. H. KHAN dans un champ magnktique. Quand le champ est parallele a l'axe a de I'alliage Ho25-Dy75a la temperature-ferromagnttique obliqueferromagni5tiqueparallele a l'axe a. La dquence correspondante trouvee pour un champ parallitle a I'axe b est

Paris-Sud XI, Université de


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper




Office of Legacy Management (LM)

? ? z _ - c 0-e . CRANE CO. 757 THIRD AVENUE NEW YORK. N.Y. THOMAS UNGERLAND ASSOCIATE GENERAL COUNSEL December 14, 1987 James J. Fiore Director Office of Nuclear Energy Department of Energy Washington, D.C. Re: Crane - Indian Orchard Dear M r. Fiore: W e acknowledge receipt of your letter to Paul Hundt, dated September 29, 1987, which requests certain information about Crane's plant site in Indian Orchard, Massachusetts. The plant is not currently operating. Crane was unable to locate any records concerning the machining of uranium in the 1947-48 period for a customer, Brookhaven Labs, at the Indian Orchard, facility. It is believed that the records, which were kept on the second floor at 305 Hamshire Street, Indian Orchard, Massachusetts were moved ten or fifteen years ago


DOE Challenge Home Case Study, Ferguson Design and Construction, Inc., Sagaponak, NY, Custom Home  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ferguson Design & Ferguson Design & Construction, Inc. Sagaponack, NY BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



E-Print Network (OSTI)

of Liters Transported (Source: New Jersey Petroleum Council) Rank Port Liters 1 New York Harbor, NY/NJ 106 Jersey ranks first in the United States in volume of petroleum products handled each year. In addition to the discharge of significant amounts of petroleum hydrocarbons into the waters of the New York/New Jersey region

Brookhaven National Laboratory


LJUPKA ARSOVA 30-65 Steinway Street, Astoria, 11103 NY1-305-582-2559ljarsova@caa.columbia.edu  

E-Print Network (OSTI)

, NY Consultant for anaerobic digestion Nov. 2010- present Clinton Global Initiative- Cason Family Master Thesis research - "Anaerobic digestion of the food waste: current status, problems and alternative" "Microbial populations and their interactions in Anaerobic Digestion reactors" "A CO2-to-CH4 recycle loop


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



The sGang steng-b rNying ma'i rGyud manuscript from Bhutan  

E-Print Network (OSTI)

first folios, itsimply gives the volume identification and pagination in gold ink. 6 Volumes Ka, Pa, Ra, Ha to Ki, Gi, Ci, Chi, Nyi, Thi, Ni, Pi, Bi, and Mi 7 This is unlike the Rig 'dzin edition, where...

Cathy Cantwell; Mayer, Rob



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2012 SG Peer Review - Interoperability of Demand Response Resources in New York - Andre Wellington, ConEd NY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Interoperability of Demand Response Interoperability of Demand Response Resources in NY Andre Wellington Con Edison June 8, 2012 December 2008 Interoperability of Demand Resource Resources in NY Objective Life-cycle Funding ($M) FY08 - FY13 $6.8 million Technical Scope (Insert graphic here) Develop and demonstrate technology required to integrate customer owned resources into the electrical distribution system * Evaluate interconnection designs * Design and install thermal storage plant with enhanced capabilities * Develop AutoDR application for targeted distributed resources 2 December 2008 Needs and Project Targets Develop the technology required to integrate customer owned distributed resources into the distribution system to enable the of deferment capital investments. * Remote dispatch of customer resources



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NEW YORK DEPARTMENT OF PUBLIC SERVICE NEW YORK DEPARTMENT OF PUBLIC SERVICE THREE EMPIRE STATE PLAZA, ALBANY, NY 12223-1350 www.dps.ny.gov PUBLIC SERVICE COMMISSIO~ PETER McGOWAN GARRY A. BROWN General Counsel Chairman PATRICIA L. ACAMPORA MAUREEN F. HARRIS JACLYN A, BRILLING ROBERT E. CURRY JR. Secretary JAMES L. LAROCCA Commissioners January 31, 2012 FILED ELECTRONICALLY @ http://energy.gov/oelcongestion-study-2012 Office of Electricity Delivery and Energy Reliability, OE-20 U.S. Department of Energy 1000 Independence Avenue, SW Washington, D.C. i0585 Re: Preparation ofthe 2012 Congestion Study Dear Sir or Madam: I am writing in response to the Notice of Regional Workshops and Request For Written Comments, 76 Federal Register No. 218, 70122 (November 10,2011). Enclosed please find the comments of


Measurements of OH and HO2 concentrations during the MCMA-2006 field campaign – Part 2: Model comparison and radical budget  

E-Print Network (OSTI)

Measurements of hydroxyl (OH) and hydroperoxy (HO2) radicals were made during the Mexico City Metropolitan Area (MCMA) field campaign as part of the MILAGRO (Megacity Initiative: Local and Global Research Observations) ...

Dusanter, S.


A Multi-Scale Generalization of the HoG and HMAX Image Descriptors for Object Detection  

E-Print Network (OSTI)

Recently, several powerful image features have been proposed whichcan be described as spatial histograms of oriented energy. Forinstance, the HoG, HMAX C1, SIFT, and Shape Context feature allrepresent an input image using ...

Bileschi, Stanley M



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.




E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


ACEEE Summer Study on Energy in Industry, West Point, NY, July 19-22. 1 Benchmarking Approaches: An Alternate Method to Determine Best  

E-Print Network (OSTI)

ACEEE Summer Study on Energy in Industry, West Point, NY, July 19-22. 1 Benchmarking Approaches: An Alternate Method to Determine Best Practice by Examining Plant-Wide Energy Signatures Yogesh Patil and John Seryak, Energy & Resource Solutions, Inc. Kelly Kissock, University of Dayton ABSTRACT Baselining

Kissock, Kelly


Gravitational Collapse With Dark Energy And Dark Matter In Ho?ava-Lifshitz Gravity  

E-Print Network (OSTI)

In this work, the collapsing process of a spherically symmetric star, made of dust cloud, is studied in Ho\\v{r}ava Lifshitz gravity in the background of Chaplygin gas dark energy. Two different classes of Chaplygin gas, namely, New variable modified Chaplygin gas and generalized cosmic Chaplygin gas are considered for the collapse study. Graphs are drawn to characterize the nature and to determine the possible outcome of gravitational collapse. A comparative study is done between the collapsing process in the two different dark energy models. It is found that for open and closed universe, collapse proceeds with an increase in black hole mass, the only constraint being that, relatively smaller values of $\\Lambda$ has to be considered in comparison to $\\lambda$. But in case of flat universe, possibility of the star undergoing a collapse in highly unlikely. Moreover it is seen that the most favourable environment for collapse is achieved when a combination of dark energy and dark matter is considered, both in the presence and absence of interaction. Finally, it is to be seen that, contrary to our expectations, the presence of dark energy does not really hinder the collapsing process in case of Ho\\v{r}ava-Lifshitz gravity.

Prabir Rudra; Ujjal Debnath



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


DOE/EA-1631: Final Environmental Assessment for Department of Energy Loan Guarantee for Beacon Power Corporation Frequency Regulation Facility in Stephentown, NY (February 2009)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31 31 Environmental Assessment for DEPARTMENT OF ENERGY LOAN GUARANTEE FOR BEACON POWER CORPORATION FREQUENCY REGULATION FACILITY IN STEPHENTOWN, N.Y. U.S. Department of Energy Loan Guarantee Program Office Washington, DC 20585 February 2009 FINAL ENVIRONMENTAL ASSESSMENT Environmental Assessment for Department of Energy Loan Guarantee for Beacon Power Corporation Frequency Regulation Facility in Stephentown, N.Y. DOE/EA-1631 TABLE OF CONTENTS LIST OF ACRONYMS iii 1.0 PURPOSE AND NEED 1 1.1 Introduction 1 1.2 Purpose and Need for Agency Action 1 2.0 DESCRIPTION OF PROPOSED ACTION AND NO ACTION ALTERNATIVE 3 2.1 Location 3 2.2 Proposed Action 3 2.2.1 Flywheel 3 2.2.2 Project Elements 4 2.2.3 Project Systems 5 2.2.4 Construction


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Program on Technology Innovation: Oxy-Fired CFB with CO2 Capture and Storage at Jamestown (NY) Board of Public Utilities  

Science Conference Proceedings (OSTI)

Oxy-combustion of coal has been proposed as a way of reducing the costs of capturing CO2 (at a purity sufficient for geological storage) from coal-fired steam-electric power plants. To date, only lab and test-stand studies have been conducted, focusing primarily on the combustion process. The next major development step is to field an integrated oxy-coal power plant. Such a project has been proposed and is being developed for deployment at the Jamestown (NY) Board of Public Utilities (BPU) Carlson Genera...


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Time scale of the fission process in the reaction 50A MeV 20Ne + 165Ho  

E-Print Network (OSTI)

The pre-scission time in the de-excitation of highly excited 178W produced in the reaction of 2ONe + 165Ho at 50A MeV was determined as a function of fission fragment mass asymmetry. The techniques employed used the pre-scission and post scission multiplicities of alpha particles, measured in coincidence with the fission fragments, to determine excitation energy of the fissioning nucleus at scission. Then the fission time was evaluated using statistical model calculations. It was found for a compound system of mass 178 amu and excitation energy of 580 MeV that the fission time is [ ] 1 x 10-20 s regardless of the asymmetry.

Mdeiwayeh, Nader



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Static magnetic response of clusters in Co_{0.2}Zn_{0.8}Fe_{1.95}Ho_{0.05}O_{4} spinel oxide  

E-Print Network (OSTI)

Earlier investigation of Co_{0.2}Zn_{0.8}Fe_{1.95}Ho_{0.05}O_{4} spinel has shown the existence of "super-ferromagnetic " clusters containing Fe^{3+} and Ho^{3+} ions along with small size clusters of Fe^{3+} ions (Bhowmik et al, J. Magn. Magn. Mater. {247}, 83 (2002)). Here, We report the static magnetic response of these clusters. The experimental data suggests some interesting magnetic features, such as, enhancement of magnetization; re-entrant magnetic transitions with paramagnetic to ferromagnetic state below 225 K and ferromagnetic to spin glass state below 120 K; appearance of field induced ferromagnetism. We also observe an unusual maximum in the thermoremanent magnetization (TRM) vs temperature data. Our measurements suggest that this unusuality in TRM is related to the blocking of "super-ferromagnetic" clusters ,out of the ferromagnetic state, along their local anisotropy axis.

R. N. Bhowmik; R. Ranganathan; R. Nagarajan



On the gravitational Chern-Simons action as entropy functional for three-manifolds, and the demystification of the Ho?ava-Lifshitz gravity  

E-Print Network (OSTI)

We determine the more general geometrical flow in the space of metrics corresponding to the steepest descent for the three-dimensional gravitational Chern-Simons action, extending the results previously considered in Class. Quantum Grav. 25 (2008) 165019, and reveling another trouble with the four dimensional Ho\\v{r}ava-Lifshitz gravity introduced in Phys. Rev. D 79, 084008 (2009), and JHEP 0903, 020 (2009), which attempts to be a candidate for an UV completion of Einstein general relativity.

R. Cartas-Fuentevilla



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


New line classifications in Ho I based on high-precision hyperfine-structure measurement of low levels  

Science Conference Proceedings (OSTI)

Doppler-free laser-fluorescence and laser-rf double-resonance studies have been made of the hyperfine structure (hfs) of four strong, previously unclassified visible lines in Ho I; all are shown to connect with low levels. The hfs of the 4f/sup 11/6s/sup 2/ /sup 4/I/sub 11/2,9/2/ levels is measured in detail, allowing evaluation of the dipole (a/sup 01/, a/sup 12/, a/sup 10/) and quadrupole (b/sup 02/,b/sup 11/,b/sup 13/) hfs radial integrals. The results are in close agreement with the ab initio values of Lindgren and Rosen (Case Stud. Atom. Phys. 4, 93--292 (1974). The value found for b/sup 02/ in the 4f/sup 11/6s/sup 2/ configuration is in reasonable agreement with that of Wyart and Camus (Physica 93C, 227-236 (1978)), thereby confirming their finding of a substantial dependence of this parameter on the number of 4f electrons in the core.

Childs, W.J.; Cok, D.R.; Goodman, L.S.



Circular geodesics of naked singularities in the Kehagias-Sfetsos metric of Ho\\v{r}ava's gravity  

E-Print Network (OSTI)

We discuss photon and test-particle orbits in the Kehagias-Sfetsos (KS) metric. For any value of the Ho\\v{r}ava parameter $\\omega$, there are values of the gravitational mass $M$ for which the metric describes a naked singularity, and this is always accompanied by a vacuum "antigravity sphere" on whose surface a test particle can remain at rest (in a zero angular momentum geodesic), and inside which no circular geodesics exist. The observational appearance of an accreting KS naked singularity in a binary system would be that of a quasi-static spherical fluid shell surrounded by an accretion disk, whose properties depend on the value of $M$, but are always very different from accretion disks familiar from the Kerr-metric solutions. The properties of the corresponding circular orbits are qualitatively similar to those of the Reissner-Nordstr\\"om naked singularities. When event horizons are present, the orbits outside the Kehagias-Sfetsos black hole are qualitatively similar to those of the Schwarzschild metric.

Vieira, Ronaldo S S; Klu?niak, W\\lodek; Stuchlík, Zden?k; Abramowicz, Marek



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



The long term dynamics of the solar radiative zone associated to new results from SoHO and young solar analogs  

E-Print Network (OSTI)

The Standard Solar Model (SSM) is no more sufficient to interpret all the observations of the radiative zone obtained with the SoHO satellite. We recall our present knowledge of this internal region and compare the recent results to models beyond the SSM assumptions. Then we discuss the missing processes and quantify some of them in using young analog observations to build a more realistic view of our star. This progress will be useful for solar-like stars observed by COROT and KEPLER.

Sylvaine Turck-Chieze; Sebastien Couvidat; Antonio Eff-Darwich; Vincent Duez; Rafael A. Garcia; Stephane Mathis; Savita Mathur; Laurent Piau; David Salabert



Ny historia?; A new history?.  

E-Print Network (OSTI)

?? This essay aims to examine how three active history teachers in the upper secondary school interprets the new course plan for history in gy11.… (more)

Axelsson, Christofer




NLE Websites -- All DOE Office Websites (Extended Search)

ataTechnologySpecificUnitedStatesWindHighResolutionNewYorkWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for New York at a 50...


Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...



Yeon Ho Kim  

Science Conference Proceedings (OSTI)

... Group. Education: Ph.D., Chemistry, The University of Texas at Austin, Austin, Texas, (2007) Advisor: David A. Vanden Bout. ...


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Overcoming phase instability of RBaCo2O5+ (R = Y and Ho) by Sr substitution for application as cathodes in solid oxide fuel cells  

Science Conference Proceedings (OSTI)

Phase instabilities of the RBaCo2O5+ (R = Y and Ho) layered-perovskites and their decompositions into RCoO3 and BaCoO3-z at 800 oC in air were investigated. This will restrict their high temperature applications such as cathodes in solid oxide fuel cell (SOFC). However, appropriate amount of Sr substitution ( 60 % for R = Y and 70 % for R = Ho) for Ba successfully stabilized the R(Ba1-xSrx)Co2O5+ phase at elevated temperatures. This can be explained by decreasing oxygen vacancies at R-O layer, decreasing R-O bonding length, and consequent improvement of structural integrity. In addition, the Sr substitution (x = 0.6 - 1.0) for Ba provided added benefit with respect to the chemical stability against Ce0.8Gd0.2O1.9 (GDC) electrolyte, which is a critical requirement for the cathodes in SOFC. Among the various compositions investigated, the Y(Ba0.3Sr0.7)Co2O5+ + GDC composite cathode delivered the optimum electrochemical performances with a stable phase demonstrating the potential as a cathode in SOFC.

Kim, Jung-Hyun [ORNL; Young Nam, Kim [University of Texas at Austin; Bi, Zhonghe [ORNL; Manthiram, Arumugam [University of Texas at Austin; Paranthaman, Mariappan Parans [ORNL; Huq, Ashfia [ORNL



Geometric phase effects in the resonance spectrum, state-to-state transition probabilities and bound state spectrum of HO{sub 2}  

SciTech Connect

The general vector potential (gauge theory) approach for including geometric phase effects in accurate 3D quantum scattering calculations in hyperspherical coordinates is applied to low-energy H+O{sub 2} collisions using our new more accurate DIM (Diatomics In Molecules) potential energy surface. The newly developed hybrid DVR/FBR (Discrete Variable Representation/Finite Basis Representation) numerical technique is used to include geometric phase effects due to the C{sub 2v} conical intersection in HO{sub 2}. The scattering results for zero total angular momentum (J=0) computed both with and without the geometric phase show significant differences in the resonance energies and lifetimes. Significant differences in the state-to-state transition probabilities are also observed. The results indicate that geometric phase effects must be included for H+O{sub 2} scattering even at low energies. All 249 vibrational energies of HO{sub 2}({sup 2}A{sup {prime}{prime}}) (J=0) are computed both with and without the geometric phase. Due to the localized nature of the bound state wavefunctions, no geometric phase effects are observed in the vibrational energies even in the high-lying states near dissociation. {copyright} {ital 1997 American Institute of Physics.}

Kendrick, B.; Pack, R.T. [Theoretical Division (T-12, MS-B268), Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)



GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G ...


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Results of the radiological survey at the former Herring-Hall-Marvin Safe Company (3rd floor), 1550 Grand Boulevard, Hamilton, Ohio (HO001)  

SciTech Connect

At the request of the US Department of Energy (DOE), a group from the Oak Ridge National Laboratory conducted a radiological survey at the former Herring-Hall-Marvin Safe Company (third floor), 1550 Grand Boulevard, Hamilton, Ohio (HO001) in August 1993. The purpose of the survey was to determine whether the property was contaminated with radioactive residues, principally {sup 238}U, derived from the former Manhattan Engineer District project. The survey included gamma scans; direct and transferable measurements of alpha, beta, and gamma radiation levels; and debris sampling for radionuclide analyses. Results of the survey demonstrated {sup 238}U surface contamination in excess of the DOE criteria for surface contamination. The third floor was generally contaminated over 25 percent of its area with isolated spots in the remaining area. Although three isolated spots of contamination were found in areas other than on the third floor (in the same southeastern comer of the facility), they were remediated by sampling. Based on the survey results, this site is recommended for remediation.

Murray, M.E.; Johnson, C.A.



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Cko.rtef' -, CtIOr4rt...tt. G~P:s (ITfS'rHO) u.t A,8,C,D~Jisf."c{ por..f,s  

E-Print Network (OSTI)

,)t. (..-) ~\\1\\Ct. (hfo{'" rt.. -....1. O.Ms Wt ,et1'"" (b-s),+ (t"1.--i:\\t... rr..'t ·...( s",,"(r,··d= fit. Stl~ Cko.rtef' -, CtIOr4rt...tt. G~P:s ~~~1 (ITfS'rHO) u.t A,8,C,D~Jisf."c{ por..f,s 011\\" ';f\\f. I i ~"o\\ ""'"",t...&. "",... r. I. ,_ . ...J... Urdc. ""~~"t lUi""~A .J- ..:v.(~ ·· c...e.t e't.."'

Li, Kin-Yin



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Microsoft Word - FUSRAP Colonie NY.rtf  

Office of Legacy Management (LM)

Colonie Interim Storage Site Colonie Interim Storage Site (CISS) Colonie, New York FACT SHEET Jan 2004 DESCRIPTION: The site consists of a total area of 11.2 acres plus 56 vicinity properties. The site was owned and operated by National Lead Industries (NL) from 1937-1984. The facility was used for electroplating and manufacturing various components from uranium and thorium. Radioactive materials released from the plant exhaust stacks spread to site buildings, portions of the grounds, and 56 commercial and residential vicinity properties (VPs). NL also dumped contaminated casting sand into the former Patroon Lake. The New York State Supreme Court shut down the NL plant in 1984. AUTHORIZATION/PROJECT DESCRIPTION: Responsibility for the Colonie site was assigned to the U.S. Department of Energy (DOE) as a decontamination research and development project by the U.S.


Microsoft Word - NY.17-16.doc  

Office of Legacy Management (LM)

Printed with soy ink on recycled paper Printed with soy ink on recycled paper Department of Energy Washington, DC 20585 Ms. Judith Leithner Project Manager, Buffalo District U.S. Army Corps of Engineers Department of the Army 1776 Niagara Street Buffalo, New York 14207-3199 Dear Ms. Leithner: This is in reference to the Niagara Falls Storage Site (NFSS) Vicinity Properties E', E, and G located in Lewiston, New York. In accordance with the terms of the March 1999 Memorandum of Understanding (MOU) between the Department of Energy (DOE) and the U.S. Army Corps of Engineers (U.S. ACE), DOE is in the process of completing closure documentation for several sites remediated by DOE prior to assignment of the Formerly Utilized Sites Remedial Action Program (FUSRAP) to the U.S. ACE. Under contract to the U.S. ACE (U.S. ACE Contract


AER NY Kinetics LLC | Open Energy Information  

Open Energy Info (EERE)

Database. This company is involved in the following MHK Projects: Ogdensburg Kinetic Energy Project This article is a stub. You can help OpenEI by expanding it. Retrieved...



E-Print Network (OSTI)

fully reflected in the price they pay at the pump. Voters are overwhelmingly opposed to a pay raise of voters lay the blame at the feet of the President and the oil companies but it is clear they are looking-third of voters don't think they'd see any relief at the pump and another 43 percent think they'd only see about


Waddington, NY Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

2007 2008 2009 2010 2011 View History Pipeline Volumes 0 0 0 0 30,731 2007-2011 Pipeline Prices -- -- -- -- 4.71 2007...


Massena, NY Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Offshore Wind in NY State (New York)  

Energy.gov (U.S. Department of Energy (DOE))

NYSERDA has expressed support for the development of offshore wind and committed funding to several publicly-available assessments that measure the potential energy benefits and environmental...


Livscykelbaserad miljövärdering av en ny kontorsbyggnad.  

E-Print Network (OSTI)

?? This Master’s Thesis aims to illustrate in what ways the two Swedish environmental assessment tools, the Environmental Load Profile and EcoEffect differ and if… (more)

Brick, Karolina



Waddington, NY Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

422,315 395,758 349,980 267,227 231,831 241,506 1996-2012 Pipeline Prices 7.57 9.42 4.60 5.44 4.99 3.87...


Acceleration Of Wound Healing Ny Photodynamic Therapy  

DOE Patents (OSTI)

Disclosed is a method for accelerating wound healing in a mammal. The method includes identifying an unhealed wound site or partially-healed wound site in a mammal; administering a photosensitizer to the mammal; waiting for a time period wherein the photosensitizer reaches an effective tissue concentration at the wound site; and photoactivating the photosensitizer at the wound site. The dose of photodynamic therapy is selected to stimulate the production of one or more growth factor by cells at the wound site, without causing tissue destruction.

Hasan, Tayyaba (Arlington, MA); Hamblin, Michael R. (Revere, MA); Trauner, Kenneth (Sacramento, CA)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Decay properties of long-lived isomers in the odd-odd N=81 nucleus {sup 146}Tb compared to the {sup 148}Ho and {sup 150}Tm nuclei  

Science Conference Proceedings (OSTI)

Excited states of the {sup 146}Tb nucleus have been studied using {gamma}-ray and electron spectroscopy in off-beam and in-beam modes following {sup 112}Sn({sup 40}Ar,3n3p) reaction with the use of the OSIRIS-II, HPGe detector array and the conversion electron spectrometer. The multipolarity of the 343 keV transition deexciting the (7{sup -}) level in {sup 146}Tb shows mainly an E2 nature and the first excited state above the 23 s isomer is assigned as a (5{sup -},6{sup -}) state. The log ft values have been deduced for 11 {beta}{sup +}/EC transitions populating excited states in {sup 146}Gd. The systematic behavior of spins and parities of the long-lived levels at 0+x keV and the first excited states above them in the N=81 isotones {sup 146}Tb, {sup 148}Ho, and {sup 150}Tm is discussed.

Kownacki, J.; Kisielinski, M. [Heavy Ion Laboratory, University of Warsaw, Warsaw (Poland); Andrzej Soltan Institute for Nuclear Studies, Swierk (Poland); Droste, Ch.; Morek, T.; Ruchowska, E.; Grodner, E. [Institute of Experimental Physics, Faculty of Physics, University of Warsaw, Warsaw (Poland); Lieder, R. M. [Institut fuer Kernphysik Forschungszentrum Juelich, Juelich (Germany); Kowalczyk, M.; Wrzosek-Lipska, K.; Hadynska-KlePk, K.; Mierzejewski, J. [Heavy Ion Laboratory, University of Warsaw, Warsaw (Poland); Institute of Experimental Physics, Faculty of Physics, University of Warsaw, Warsaw (Poland); Andrzejewski, J.; Perkowski, J. [Faculty of Physics, University of Lodz, Lodz Poland (Poland); Napiorkowski, P. J.; Zielinska, M.; Kordyasz, A.; Srebrny, J. [Heavy Ion Laboratory, University of Warsaw, Warsaw (Poland); Korman, A. [The Andrzej Soltan Institute for Nuclear Studies, Swierk (Poland)



Evaluation of S-values and dose distributions for {sup 90}Y, {sup 131}I, {sup 166}Ho, and {sup 188}Re in seven lobes of the rat liver  

Science Conference Proceedings (OSTI)

Purpose: Rats have been widely used in radionuclide therapy research for the treatment of hepatocellular carcinoma (HCC). This has created the need to assess rat liver absorbed radiation dose. In most dose estimation studies, the rat liver is considered as a homogeneous integrated target organ with a tissue composition assumed to be similar to that of human liver tissue. However, the rat liver is composed of several lobes having different anatomical and chemical characteristics. To assess the overall impact on rat liver dose calculation, the authors use a new voxel-based rat model with identified suborgan regions of the liver. Methods: The liver in the original cryosectional color images was manually segmented into seven individual lobes and subsequently integrated into a voxel-based computational rat model. Photon and electron particle transport was simulated using the MCNPX Monte Carlo code to calculate absorbed fractions and S-values for {sup 90}Y, {sup 131}I, {sup 166}Ho, and {sup 188}Re for the seven liver lobes. The effect of chemical composition on organ-specific absorbed dose was investigated by changing the chemical composition of the voxel filling liver material. Radionuclide-specific absorbed doses at the voxel level were further assessed for a small spherical hepatic tumor. Results: The self-absorbed dose for different liver lobes varied depending on their respective masses. A maximum difference of 3.5% was observed for the liver self-absorbed fraction between rat and human tissues for photon energies below 100 keV. {sup 166}Ho and {sup 188}Re produce a uniformly distributed high dose in the tumor and relatively low absorbed dose for surrounding tissues. Conclusions: The authors evaluated rat liver radiation doses from various radionuclides used in HCC treatments using a realistic computational rat model. This work contributes to a better understanding of all aspects influencing radiation transport in organ-specific radiation dose evaluation for preclinical therapy studies, from tissue composition to organ morphology and activity distribution.

Xie Tianwu; Liu Qian; Zaidi, Habib [Britton Chance Center for Biomedical Photonics, Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China) and Key Laboratory of Biomedical Photonics of Ministry of Education, Huazhong University of Science and Technology, Wuhan 430074 (China); Britton Chance Center for Biomedical Photonics, Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China); Key Laboratory of Biomedical Photonics of Ministry of Education, Huazhong University of Science and Technology, Wuhan 430074 (China) and Division of Nuclear Medicine and Molecular Imaging, Geneva University Hospital, CH-1211 Geneva (Switzerland); Division of Nuclear Medicine and Molecular Imaging, Geneva University Hospital, CH-1211 Geneva (Switzerland); Geneva Neuroscience Center, Geneva University, CH-1211 Geneva (Switzerland) and Department of Nuclear Medicine and Molecular Imaging, University Medical Center Gronigen, University of Groningen, 9700 RB Groningen (Netherlands)



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada




Office of Legacy Management (LM)

one work day and provisions made for the employee to take a shower on company time. B. Wool Clothing In departments where sulphuric acid is used 1.n process work wool clothing is...


Microsoft Word - NY17-15 01-50.rtf  

Office of Legacy Management (LM)

OR/20722-84 OR/20722-84 Formerly Utilized Sites Remedial Action Program (FUSRAP) Contract No. DE-ACO5-810R20722 POST-REMEDIAL ACTION REPORT FOR THE NIAGARA FALLS STORAGE SITE VICINITY PROPERTIES - 1983 AND 1984 Lewiston, New York December 1986 Bechtel National, Inc. This report was prepared as an account of work sponsored by the United States Government. Neither the United States nor the United States Department of Energy, nor any of their employees, nor any of their contractors, subcontractors, or their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness or usefulness of any information, apparatus, product disclosed, or represents that its use would not infringe privately owned rights.


William H. Schlesinger Cary Institute of Ecosystem Studies, Millbrook, NY  

E-Print Network (OSTI)

used in drilling and fracking · Recent increase in permit fee to fund new DEP enforcement · Permit fluids ­ return fluids from fracking ­ mixture of water, sand and chemicals Production fluids ­ fluids, manganese, barium, arsenic, etc.) Surfactants/detergents Total suspended solids Oil/Grease Fracking


Methane Gas Utilization Project from Landfill at Ellery (NY)  

DOE Green Energy (OSTI)

Landfill Gas to Electric Energy Generation and Transmission at Chautauqua County Landfill, Town of Ellery, New York. The goal of this project was to create a practical method with which the energy, of the landfill gas produced by the decomposing waste at the Chautauqua County Landfill, could be utilized. This goal was accomplished with the construction of a landfill gas to electric energy plant (originally 6.4MW and now 9.6MW) and the construction of an inter-connection power-line, from the power-plant to the nearest (5.5 miles) power-grid point.

Pantelis K. Panteli



Nancy Ide, Jean Vronis Vassar College (Poughkeepsie, NY)  

E-Print Network (OSTI)

for encoding a wide range of dictionaries, and is flexible enough to accomodate many esoteric dictionaries

Ide, Nancy


Mill Seat Landfill Bioreactor Renewable Green Power (NY)  

DOE Green Energy (OSTI)

for end use. A landfill gas to energy facility was also previously constructed at the site, which utilized generator engines, designed to be powered with landfill methane gas, to produce electricity, to be utilized on site and to be sold to the utility grid. The landfill gas generation rate at the site had exceeded the capacity of the existing generators, and the excess landfill gas was therefore being burned at a candlestick flare for destruction. The funded project consisted of the procurement and installation of two (2) additional 800 KW Caterpillar 3516 generator engines, generator sets, switchgear and ancillary equipment.

Barton & Loguidice, P.C.



Grand Island, NY Natural Gas Imports by Pipeline from Canada  

Gasoline and Diesel Fuel Update (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...


Champlain, NY Natural Gas Imports by Pipeline from Canada  

Gasoline and Diesel Fuel Update (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...


Niagara Falls, NY Natural Gas Imports by Pipeline from Canada  

Annual Energy Outlook 2012 (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...


DOE - Office of Legacy Management -- Colonie - NY 06  

Office of Legacy Management (LM)

Site Fairfield Site Falls City Site Fernald Preserve Gasbuggy Site General Atomics Geothermal Gnome-Coach Site Grand Junction Sites Granite City Site Green River Site Gunnison...


Mill Seat Landfill Bioreactor Renewable Green Power (NY)  

Science Conference Proceedings (OSTI)

The project was implemented at the Mill Seat landfill located in the Town of Bergen, Monroe County, New York. The landfill was previously equipped with a landfill gas collection system to collect methane gas produced by the bioreactor landfill and transport it to a central location for end use. A landfill gas to energy facility was also previously constructed at the site, which utilized generator engines, designed to be powered with landfill methane gas, to produce electricity, to be utilized on site and to be sold to the utility grid. The landfill gas generation rate at the site had exceeded the capacity of the existing generators, and the excess landfill gas was therefore being burned at a candlestick flare for destruction. The funded project consisted of the procurement and installation of two (2) additional 800 KW Caterpillar 3516 generator engines, generator sets, switchgear and ancillary equipment.

Barton & Loguidice, P.C.


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE))

The Department of Energy (DOE) and Department of Homeland Security (DHS), in coordination with the Federal Bureau of Investigation, the Federal Energy Regulatory Commission's Office of Energy Infrastructure Security, the Electricity Sector Information Sharing and Analysis Center (ES-ISAC), North American Electricity Reliability Corporation (NERC), and industry experts, will conduct a series of briefings across the country with electricity sector owners and operators, and local law enforcement on the physical security of electricity substations.


143 Caldwell Hall Ithaca, NY 14853-2602  

E-Print Network (OSTI)

a conference in Washington, D.C., may receive $225). Awards will not, under any circumstances, exceed $675 Manitoba 335 Ontario (Toronto, Ottawa) 335 Quebec (Montreal) 235 Central & South America 675 Washington, DC will need to be picked up at the cashier's window in 260 Day Hall. If a student does not attend

Keinan, Alon


143 Caldwell Hall Ithaca, NY 14853-2602  

E-Print Network (OSTI)

in Washington, D.C., may receive $225). Awards will not, under any circumstances, exceed $675. The Graduate Manitoba 335 Ontario (Toronto, Ottawa) 335 Quebec (Montreal) 235 Central & South America 675 Washington, DC up at the cashier's window in 260 Day Hall. If a student does not attend the conference, s/he should

Walter, M.Todd


The Wellness Center 365 Fifth Ave. New York, NY 10016  

E-Print Network (OSTI)

to student · Episodic Treatment for Acute Health Problems · Routine Physical Exams · Laboratory Services.817.1602 wellness@gc.cuny.edu www.tinyurl.com/gcwellness Table of Contents Student Health Services · Health Workshops and Special Events *A note on costs Laboratory fees as well as screening costs

Dennehy, John



NLE Websites -- All DOE Office Websites (Extended Search)

DOE legislation. Rational for determination: The Town of Brookhaven will be performing an energy audit and associated recommended retrofit work (possibly including some renewables...


Fortlpande miljanalys vid SLU Ny metod fr bedmning av aluminiumrisker  

E-Print Network (OSTI)

.cory@ma.slu.se www.ma.slu.se (1) Neil Cory et al. (2004). "Application of WHAM to nationale scale environmental


New York, NY Vehicle Purchase & Infrastructure Development Incentives...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Authority (NYSERDA) administers the New York City Private Fleet Alternative FuelElectric Vehicle Program (Program) in cooperation with New York City Department of...


Champlain, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.29 3.40 3.53 3.68 2000's 3.86 4.03 4.17 4.34 4.53 4.81 5.04 5.23 5.63 5.21 2010's 6.02 6.11...


Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Dollars ...  

U.S. Energy Information Administration (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: NA: NA: 2000's: NA: 2.49: 5.04: 6.77: 6.99----- 2010's--4.76: 4.08-


Massena, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 6.63 6.67 7.13 6.84 6.97 5.92 5.48 6.42 5.84 4.29 4.30 5.81 2012 6.07 5.83 5.26 5.21 5.09 5.16 5.01 5.21 5.29 6.03 6.64...


Champlain, NY Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 16,104 16,669 15,258 17,171 2000's 17,436 17,329 16,904 12,579 16,502 17,142 17,721 17,666...


Massena, NY Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 13,642 12,927 9,184 7,258 2000's 7,309 6,931 7,662 6,817 7,357 6,989 6,588 6,887 6,588 5,730...


Waddington, NY Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 35,222 28,023 21,841 13,715 12,079 14,620 21,184 14,405 12,504 15,162 18,131 24,944 2012 30,005 25,448 20,375 12,699...


Champlain, NY Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,825 1,988 1,676 394 292 100 462 224 178 189 214 751 2012 1,070 862 537 288 186 347 644 403 427 469 640 892 2013 1,174...


Waddington, NY Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 5.32 5.46 5.14 5.14 5.20 5.22 5.22 5.00 4.71 4.55 4.32 4.20 2012 4.31 3.57 3.26 2.86 2.76 3.03 3.43 3.52 3.46 3.77 5.25...


Waddington, NY Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 288,807 295,568 293,234 324,400 2000's 337,989 290,981 285,188 296,989 331,234 349,230 406,033...


Massena, NY Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 873 767 704 412 240 192 197 188 135 37 53 167 2012 573 505 424 324 197 201 211 179 174 224 418 562 2013 588 581 537 346 91...


Grand Island, NY Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 42,832 42,302 44,981 33,140 2000's 49,012 95,639 110,417 76,421 66,612 92,474 80,907 88,886...


Waddington, NY Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 0 0 0 2010's 0 30,731 38,791...


Champlain, NY Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 7.34 6.56 5.91 5.40 5.47 5.45 5.64 5.26 4.94 4.57 4.49 4.78 2012 5.18 4.34 3.70 2.84 3.04 3.46 4.07 3.84 3.85 4.32 6.07...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Massena, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.92 3.04 2.78 2.81 2000's 4.25 4.96 4.08 6.08 7.06 9.34 8.95 7.78 9.69 6.85 2010's 6.48 6.55...


Waddington, NY Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 580 1,310 2,522 3,252 3,026 2,668 2,170 2,445 2,379 2,066 5,121 3,191 2012 898 4,000 6,745 4,975 2,721 1,978 1,202 2,306...


Waddington, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.92 2.82 2.38 2.54 2000's 4.24 4.81 3.60 5.81 6.51 9.38 7.62 7.57 9.42 4.60 2010's 5.44 4.99...


Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 734: 660: 860: 860: 194: 307: 295: 1,107: 376: 151: 415: 576: 2012: 583: 468: 175: 58: 8,823: 13,281: 2013 ...


U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 To Canada 70,735 81,695 75,846 66,473 68,325 69,733 1973-2013 Eastport, ID 6 2011-2013 Calais, ME 2,021 1,528 433 652 122 185 2011-2013 Detroit, MI 3,571 4,430 3,769 3,933 4,131 3,885 2011-2013 Marysville, MI 2,983 1,470 995 1,856 1,521 1,400 2011-2013 Sault Ste. Marie, MI 1,531 1,171 935 1,231 849 911 2011-2013 St. Clair, MI 43,917 56,075 54,114 42,609 45,524 47,795 2011-2013 Noyes, MN 76 171 316 1,331 447 445 2011-2013 Babb, MT 2011-2011 Havre, MT 184 188 174 177 183 166 2011-2013 Pittsburg, NH 2011-2013 Grand Island, NY 47 20 10 10 11 2011-2013 Massena, NY 2012-2012 Niagara Falls, NY 13,738 13,789 13,174 13,904 13,939 13,022 2011-2013 Waddington, NY



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...



Annual Energy Outlook 2012 (EIA)



Google Maps -highland hospital rochester new york http://maps.google.com/ 1 of 2 9/29/05 13:21  

E-Print Network (OSTI)

Google Maps - highland hospital rochester new york http://maps.google.com/ 1 of 2 9/29/05 13 Hospital: Gift Shop 1000 South Ave, Rochester, NY 14620 (585) 341-8040 - 1.4 mi S Google Maps highland hospital rochester new york #12;Google Maps - highland hospital rochester new york http://maps.google

Richmond, Michael W.


U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The�¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Solar System tests of Ho?ava-Lifshitz black holes  

E-Print Network (OSTI)

In the present paper we consider the possibility of observationally testing Horava gravity at the scale of the Solar System, by considering the classical tests of general relativity (perihelion precession of the planet Mercury, deflection of light by the Sun and the radar echo delay) for the Kehagias-Sfetsos asymptotically flat black hole solution of Horava-Lifshitz gravity. All these gravitational effects can be fully explained in the framework of the vacuum solution of Horava gravity, and it is shown that the analysis of the classical general relativistic tests severely constrain the free parameter of the solution.

Francisco S. N. Lobo; Tiberiu Harko; Zoltán Kovács



FAGE Determination of Tropospheric HO and H02  

Science Conference Proceedings (OSTI)

FAGE (fluorescence assay with gas expansion) was developed as a sensitive technique for the detection of low-concentration free radicals in the atmosphere. The application of FAGE to tropospheric hydroxyl (H0) and hydroperoxyl (H02) radicals has ...

T. M. Hard; L. A. George; R. J. O'Brien



Ho-Ling Hwang - Research Staff - Center for Transportation Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Support Systems Motor Fuel Consumption Models National Intermodal Bottlenecks Evaluation Tool (IBET) Temporary Losses of Highway Capacity Study (TLC) Estimating International...


Funding for state, city, and county governments in the state includes:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NY NY New York Total Sum City, County, and SEO Allocations All $175,122,300 NY New York State Energy Office $29,760,600 NY Albany City $1,104,000 NY Amherst City $1,052,700 NY Babylon City $1,545,200 NY Binghamton City $204,200 NY Brookhaven City $4,141,200 NY Buffalo City $2,736,900 NY Cheektowaga City $718,800 NY Clarkstown City $751,300 NY Clay City $515,100 NY Clifton Park City $149,200 NY Colonie City $661,900 NY Freeport City $173,100 NY Greece City $831,900 NY Greenburgh City $186,000 NY Hamburg City $187,300 NY Hempstead City $4,577,700 NY Hempstead City $479,800 NY Henrietta City $213,700 NY Huntington City $1,725,200 NY Irondequoit City $440,000 NY Islip City $3,026,100 NY


NETL: NEPA Categorical Exclusions - January 2012 to March 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

2 to March 2012 2 to March 2012 Archive (November 2009 - December 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 3/29/2012 High Efficiency Colloidal Quantum Dot Phosphors (New Location) University of Buffalo Amherst, NY EE/PMC/BETD Y 3/29/2012 Recovery Act - Clean Energy Coalition Michigan Green Fleets (Summary CX) Prime: Clean Energy Coalition Sub: Multiple Ann Arbor, MI EE/PMC/PVT Y 3/29/2012 New York State Alternative Fuel Vehicle & Infrastructure Deployment Prime: NYSERDA Sub: Village of Minoa Minoa, NY EE/PMC/PVT Y 3/29/2012 New York State Alternative Fuel Vehicle & Infrastructure Deployment Prime: NYSERDA Sub: Roosevelt Island Roosevelt Island, NY EE/PMC/PVT Y 3/29/2012 JDC Phosphate Prime: State of Florida



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78


Los linajes de transmision de Nyag bla Padma bdud'dul  

E-Print Network (OSTI)

tradición a los que hetenido acceso. Entre los lamas más reconocidos de la transmisión de Padma bdud ’dul(tanto en el papel de maestros como de discípulos) hay que destacar mDomkhyen brtse Ye shes rdo rje, Mi ’gyur nam mkha’i rdo rje, rDza dPal sprulRin po... importantes, tanto por la singularidad de estos personajes —posesores de un gran carisma en la orden rNying ma pa — como por lasenseñanzas y consejos que dieron al joven yogui. Mi ’gyur nam mkha’ rdo rje (1793-?), cuarta encarnación de rDzogs chenPadma rig...

Aguillar, Oriol



Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



File:EIA-Appalach1-NY-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, New York Area Oil and Gas Fields By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 12.86 MB, MIME type: application/pdf) Description Appalachian Basin, New York Area Oil and Gas Fields By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States New York File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


Sylvania Corning Plant/Former Sylvania Electric Products Facility Hicksville, NY  

E-Print Network (OSTI)

characterization is required for identification. Size and Weight Reduction Through the Use of Depleted Uranium of depleted uranium as a result of enrichment processes. The cost of disposing of this mate- rial has been estimated from $240million to 1.5 billion. Finding a practi- cal use for the depleted uranium would save

US Army Corps of Engineers


THERMAL PROPERTIES AND PROCESSES D Hillel, Columbia University, New York, NY, USA  

E-Print Network (OSTI)

be the infiltration of warm waste water (from, e.g., a power plant) into an initially cold soil. Conduction, the third influences biological processes such as seed germination, seedling emergence and growth, root development- lengths, is proportional to the fourth power of the absolute temperature Tof the body's surface. This law


Thermal sludge dryer demonstration: Bird Island Wastewater Treatment Plant, Buffalo, NY. Final report  

DOE Green Energy (OSTI)

The Buffalo Sewer Authority (BSA), in cooperation with the New York State Energy Research and Development Authority (Energy Authority), commissioned a demonstration of a full scale indirect disk-type sludge dryer at the Bird Island Wastewater Treatment Plant (BIWWTP). The purpose of the project was to determine the effects of the sludge dryer on the sludge incineration process at the facility. Sludge incineration is traditionally the most expensive, energy-intensive unit process involving solids handling at wastewater treatment plants; costs for incineration at the BIWWTP have averaged $2.4 million per year. In the conventional method of processing solids, a series of volume reduction measures, which usually includes thickening, digestion, and mechanical dewatering, is employed prior to incineration. Usually, a high level of moisture is still present within sewage sludge following mechanical dewatering. The sludge dryer system thermally dewaters wastewater sludge to approximately 26%, (and as high as 38%) dry solids content prior to incineration. The thermal dewatering system at the BIWWTP has demonstrated that it meets its design requirements. It has the potential to provide significant energy and other cost savings by allowing the BSA to change from an operation employing two incinerators to a single incinerator mode. While the long-term reliability of the thermal dewatering system has yet to be established, this project has demonstrated that installation of such a system in an existing treatment plant can provide the owner with significant operating cost savings.




Wastetoenergy an important topic to explore Albany Times Union Albany NY  

E-Print Network (OSTI)

waste daily, have minimal emissions equal to those of a few cars. Europe provides heat and electricity

Columbia University



E-Print Network (OSTI)

, Universidade Estadual de Campinas, C.P. 6154, CEP 13083-970, SP, Brazil 3 Suzano Papel e Celulose Research and better process monitoring is recommended. ACKNOWLEDGMENTS Support from Suzano Papel e Celulose

Ferreira, Márcia M. C.


Scott M. Kaufman US Project Manager The Carbon Trust Brooklyn, NY January 2009 -present  

E-Print Network (OSTI)

using SimaPro software; waste data collection and analysis; waste treatment technologies; political and direction for research. Crafted strategy for data collection and analysis from waste management partners aspects of fieldwork, including operation of front-end loader for composting, truck loading, and potting


Microsoft Word - PowerBridgeNY Sample Pre-Proposal Questions  

We also recommend that you read the evaluation criteria that the judges will be using as guidance for how you answer ... and supports innovations in the clean energy ...



E-Print Network (OSTI)

of material properties to be modified as a result of exposure to radiation is an important consideration, the application which most interests the international physics community is the prospects for the production: · Thermal management o Target melting o Target vaporization o Heat removal · Radiation o Radiation

McDonald, Kirk


File:EIA-Appalach1-NY-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

GAS.pdf GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, New York Area Oil and Gas Fields By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 12.75 MB, MIME type: application/pdf) Description Appalachian Basin, New York Area Oil and Gas Fields By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States New York File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael




Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID™ - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment– assists in planning and analysis of potential risks


Investigation of Micro- and Macro-Scale Transport Processes for Improved Fuel Cell Performance - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Jon P. Owejan (Primary Contact), Matthew Mench, Michael Hickner, Satish Kandlikar, Thomas Trabold, Jeffrey Gagliardo, Anusorn Kongkanand, Wenbin Gu, Paul Nicotera General Motors 10 Carriage Street Honeoye Falls, NY 14472 Phone: (585) 953-5558 Email: jon.owejan@gm.com DOE Managers HQ: Donna Ho Phone: (202) 586-8000 Email: Donna.Ho@ee.doe.gov GO: David Peterson Phone: (720) 356-1747 Email: David.Peterson@go.doe.gov Technical Advisor John Kopasz Phone: (630) 252-7531 Email: kopasz@anl.gov Contract Number: DE-EE0000470 Subcontractors: * Penn State University, University Park, PA * University of Tennessee, Knoxville, TN


Air-Cooled Stack Freeze Tolerance - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report Dave Hancock Plug Power Inc. 968 Albany Shaker Rd Latham, NY 12110 Phone: (518) 782-7700 Email: david_hancock@plugpower.com DOE Managers HQ: Donna Ho Phone: (202) 586-8000 Email: Donna.Ho@ee.doe.gov GO: Reginald Tyler Phone: (720) 356-1805 Email: Reginald.Tyler@go.doe.gov Technical Advisor Walt Podolski Phone: (630) 252-7558 Email: podolski@anl.gov Contract Number: DE-EE0000473 Subcontractor: Ballard Power Systems, Burnaby, British Columbia, Canada Project Start Date: June 1, 2009 Project End Date: November 15, 2011 Fiscal Year (FY) 2012 Objectives Advance the state of the art in technology for air-cooled * proton exchange membrane (PEM) fuel cell stacks and related GenDrive(tm) material handling application fuel


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


An Assessment of Suburban-Targeted Transit Service Strategies in the United States  

E-Print Network (OSTI)


Cervero, Robert; Dunzo, Mark



University of Kansas Department of Environment, Health & Safety  

E-Print Network (OSTI)

Storage Cabinets Flammable / Combustible Acids / Corrosives Compressed Gas, Vented Y N NY NY Y N NY NY NY: Centrifuge, (high- or ultra- speed) Distillation Equipment Solvent Still High Risk Electrical ( >25

Peterson, Blake R.



E-Print Network (OSTI)

of fig. 5). For 27°, the projection on the E * axis is shownis also shown. The projection on the ordinate represents the

McDonald, R.J.



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


2012 SG Peer Review - Recovery Act: Secure Interoperable Open Smart Grid Demonstration Project - Tom Magee, ConEd NY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Demonstration Project Demonstration Project Patricia Robison Con Edison June 8, 2012 December 2008 Smart Grid Demonstration Project Objective Life-cycle Funding FY10 - FY13 $45.4 m Technical Scope (Insert graphic here) 2 *Integrate Legacy and Smart Grid information systems *Integrate external DR into distribution grid systems: - EV/Battery storage - Building Management Systems (BMS) - Standby generation - Photovoltaic Demonstrate secure interoperable services between utility distribution systems and customer owned distributed resources (DR) December 2008 Needs and Project Targets Integrate customer owned resources into distribution operations to enable customer participation and defer capital investment *Integrate DR resources into operator platform *Implement secure communications to DR resources


58-25 Queens Blvd., Woodside, NY 11377 T: (718) 204-7077; (800) 627-1244  

E-Print Network (OSTI)

of Christendom ­ the tomb where Christ was buried and was resurrected. Exit via the Damascus Gate and continue beverages. · Laundry and other items of a personal nature. · Personal, trip cancellation, accident Tax/Customs Fees/Security Charge. · Optional insurance coverage is available for Baggage, Accident

Marsh, David

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Design Intern: New York, NY Global Green USA's Coalition for Resource Recovery is an industry working group dedicated to generating  

E-Print Network (OSTI)

, and locally recover wasted food to power the city with green energy. For more information visit thecorr working group dedicated to generating business value through turning waste into assets. The Coalition identifies and promotes effective waste diversion technologies and programs through conducting pilot programs

Colorado at Boulder, University of


A corporate fitness center : an example for the reuse of the Empire Stores, Brooklyn, N.Y.  

E-Print Network (OSTI)

The proliferation of over 500 fitness programs for the employees of American corporations marks a turning point for the way American corporations regard employee and corporate health. Typically, sports facilities were the ...

Georgopulos, Diane Theodora




E-Print Network (OSTI)

year as a pathology resident at Sinai Hospital in Baltimore. After receiving his master's degree from began his academic career at Stanford University in the Department of Pharmacology in 1973, and joined Foundation Commonwealth Fund Exxon Mobil Foundation Fleischmann Family Fund Mary Moody Northen Endowment

Vermont, University of


NY/NJ distributed wind power field verification project. Quarterly report for the period November - December 1999  

DOE Green Energy (OSTI)

This report details the Significant Accomplishments for this quarter. The accomplishments are: (1) began preparations for host site installations; and (2) data acquisition system installation at the National Wind Technology Center (NWTC) near Boulder, CO.

Putnam, Robert Jr.



Assessment of microbial processes on radionuclide mobility in shallow land burial. [West Valley, NY; Beatty, Nevada; Maxey Flats, Kentucky  

Science Conference Proceedings (OSTI)

The impact of microbial metabolism of the organic substituents of low level radioactive wastes on radionuclide mobility in disposal sites, the nature of the microbial transformations involved in this metabolism and the effect of the prevailing environmental parameters on the quantities and types of metabolic intermediates accumulated were examined. Since both aerobic and anaerobic periods can occur during trench ecosystem development, oxidation capacities of the microbial community in the presence and absence of oxygen were analyzed. Results of gas studies performed at three commercial low level radioactive waste disposal sites were reviewed. Several deficiencies in available data were determined. Further research needs are suggested. This assessment has demonstrated that the biochemical capabilities expressed within the low level radioactive waste disposal site are common to a wide variety of soil bacteria. Hence, assuming trenches would not be placed in sites with such extreme abiotic conditions that all microbial activity is precluded, the microbial populations needed for colonization and decomposition of the organic waste substances are readily provided from the waste itself and from the soil of existing and any proposed disposal sites. Indeed, considering the ubiquity of occurrence of the microorganisms responsible for waste decomposition and the chemical nature of the organic waste material, long-term prevention of biodecomposition is difficult, if not impossible.

Colombo, P.; Tate, R.L. III; Weiss, A.J.



Proceedings of NAACL HLT 2007, pages 324331, Rochester, NY, April 2007. c 2007 Association for Computational Linguistics  

E-Print Network (OSTI)

of the one­rotational 2 \\Gamma (6; 3; 2) SDS: (1; 0; 1)(0; 2; 4), then we only have two options here; either construction for a BIBD(31; 6; 1) (i.e., [1; 5; 11; 24; 25; 27]) yields the fol­ lowing 6 \\Gamma (31; 5; 4) SDS: [1; 5; \\Gamma11; \\Gamma24; \\Gamma25]; [1; \\Gamma5; 11; \\Gamma24; \\Gamma27]; [\\Gamma1; 5; 11; \\Gamma25


Neutron contribution to CaF2:Mn thermoluminescent dosimeter response in mixed (n/y) field environments.  

SciTech Connect

Thermoluminescent dosimeters (TLDs), particularly CaF{sub 2}:Mn, are often used as photon dosimeters in mixed (n/{gamma}) field environments. In these mixed field environments, it is desirable to separate the photon response of a dosimeter from the neutron response. For passive dosimeters that measure an integral response, such as TLDs, the separation of the two components must be performed by postexperiment analysis because the TLD reading system cannot distinguish between photon- and neutron-produced response. Using a model of an aluminum-equilibrated TLD-400 (CaF{sub 2}:Mn) chip, a systematic effort has been made to analytically determine the various components that contribute to the neutron response of a TLD reading. The calculations were performed for five measured reactor neutron spectra and one theoretical thermal neutron spectrum. The five measured reactor spectra all have experimental values for aluminum-equilibrated TLD-400 chips. Calculations were used to determine the percentage of the total TLD response produced by neutron interactions in the TLD and aluminum equilibrator. These calculations will aid the Sandia National Laboratories-Radiation Metrology Laboratory (SNL-RML) in the interpretation of the uncertainty for TLD dosimetry measurements in the mixed field environments produced by SNL reactor facilities.

DePriest, Kendall Russell; Griffin, Patrick Joseph



Neutron Contribution to CaF2:Mn Thermoluminescent Dosimeter Response in Mixed (n/y) Field Environments  

SciTech Connect

Thermoluminescent dosimeters (TLDs), particularly CaF{sub 2}:Mn, are often used as photon dosimeters in mixed (n/{gamma}) field environments. In these mixed field environments, it is desirable to separate the photon response of a dosimeter from the neutron response. For passive dosimeters that measure an integral response, such as TLDs, the separation of the two components must be performed by post-experiment analysis because the TLD reading system cannot distinguish between photon and neutron produced response. Using a model of an aluminum-equilibrated TLD-400 chip, a systematic effort has been made to analytically determine the various components that contribute to the neutron response of a TLD reading. The calculations were performed for five measured reactor neutron spectra and one theoretical thermal neutron spectrum. The five measured reactor spectra all have dosimetry quality experimental values for aluminum-equilibrated TLD-400 chips. Calculations were used to determined the percentage of the total TLD response produced by neutron interactions in the TLD and aluminum equilibrator. These calculations will aid the Sandia National Laboratories-Radiation Metrology Laboratory (SNL-RML) in the interpretation of the uncertainty for TLD dosimetry measurements in the mixed field environments produced by SNL reactor facilities.




Application of FACTS Devices to Increase the NY State Central-East/Total-East Interface Transfer Limits  

Science Conference Proceedings (OSTI)

This report presents a discussion of the work and investigations performed to identify a FACTS device or devices suitable for a pilot project on the New York State transmission system. The study concluded that implementation of FACTS devices would offer cost-effective solutions for both near-term and long-term operational concerns.




E-Print Network (OSTI)

wind, solar, and other forms of nonfossil fuel power generation, along with investments in efficiency power generation (one gigaton = one billiontons;onemetricton=2,204pounds.)1 Non­ power-generation uses that coal power is responsible for much of the U.S. power generation-related emissions of PM2.5 (51%), NOx

Vermont, University of


Vacuum vapor deposition of PFPE molecules on CHxNy and CHxFy amorphous carbon surfaces  

Science Conference Proceedings (OSTI)

According to the demand of increasing storage density for the magnetic data storage, a contact recording system is proposed, in which the head constantly makes contact with the disk surface during read/write cycles. In this system a stronger lubricant ...

Masahiro Kawaguchi; Junho Choi; Takahisa Kato



Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

R. Gupta, M. Anerella, J. Cozzolino, R. Gupta, M. Anerella, J. Cozzolino, W. Sampson, Peter Wanderer, BNL, NY USA A Zeller, FRIB, MI, USA Superconducting Magnet Division HTS Quad for FRIB Ramesh Gupta , ..., BNL, Al Zeller, FRIB Slide No. 2 ASC2012 October 10, 2012 Outline * Motivation for HTS magnets in FRIB - HTS is now the baseline design for some critical magnets * First Generation Design - 30 K operation * Second Generation Design - 50 K operation and higher gradient * Summary and future outlook Superconducting Magnet Division HTS Quad for FRIB Ramesh Gupta , ..., BNL, Al Zeller, FRIB Slide No. 3 ASC2012 October 10, 2012 FRIB * Facility for Rare Isotope Beams (FRIB) will create rare isotopes


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


A simple Bayesian estimate of direct RNAi gene regulation events from differential gene expression profiles  

E-Print Network (OSTI)

,13]. * Correspondence: paul.a.wilson@gsk.com 1Computational Biology, GlaxoSmithKline Medicine Research Centre, Gunnels Wood Road, Stevenage, SG1 2NY, UK Full list of author information is available at the end of the article Wilson and Plucinski BMC Genomics 2011, 12... differential expression profile. Hierarchical clustering and heat map representations of the most differentially expressed tran- scripts (Additional File 1 Figure S9) suggest that the KSHV-miR-k12-11 transfected dataset is more similar to the control data than...

Wilson, Paul A; Plucinski, Mathew




E-Print Network (OSTI)

..................................................................................................................89 I. Liste des objets énergétiques........................................................................... 90 I.2. Une liste en référence au programme de 1992 tel-00012001,version1-21Mar2006 #12;10 tel-00012001,version1-21Mar2006 #12;11 M u Nng lng là mt khái

Paris-Sud XI, Université de


Y. Takashima OPTI 340, 2012 HO#1 OPTI 340, Optical Design  

E-Print Network (OSTI)

@optics.arizona.edu Teaching Assistant: Maham Aftab Office Hours: Tuesday, 3.30 ­ 4.30 pm Email: mahamaftab

Arizona, University of


Bilinear Mixed E#ects Models for Dyadic Data Peter D. Ho# #  

E-Print Network (OSTI)

Briefing Service on Afghanistan, Armenia, Azerbaijan, and the former Soviet Republics of Central Asia 6 log(indegree+1) log(outdegree+1) Afghanistan Albania Algeria Armenia Austria Azerbaijan Bahrain Armenia Austria Azerbaijan Bahrain Bangladesh Belarus Belgium Bhutan Bosnia and Herzegovina Brunei

Hoff, Peter


Measuring OH and HO2 in the Troposphere by Laser-Induced Fluorescence at Low Pressure  

Science Conference Proceedings (OSTI)

The hydroxyl radical OH oxidizes many lime gases in the atmosphere. It initiates and then participates in chemical reactions that lead to such phenomena as photochemical smog, acid rain, and stratospheric ozone depletion. Because OH is so ...

William H. Brune; Philip S. Stevens; James H. Mather


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nocardioides basaltis sp. nov., isolated from black Kyoung-Ho Kim,1  

E-Print Network (OSTI)

Tidal flat Saline lake (Antarctica) Groundwater Oil shale Soil Soil *Different results were reported pyridinolyticus sp. nov., a pyridine-degrading bacterium isolated from the oxic zone of an oil shale column. Int J

Bae, Jin-Woo


Results of the radiological survey at Diebold Safe Company, 1550 Grand Boulevard, Hamilton, Ohio (HO001)  

SciTech Connect

At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducted investigative radiological surveys at Diebold Safe Company, 1550 Grand Boulevard, Hamilton, Ohio in 1988 and 1989. The purpose of the surveys was to determine whether the property was contaminated with radioactive residues, principally {sup 238}U. The surveys included gamma scans; direct and transferable measurements of alpha, beta, and gamma radiation levels; and dust, debris, air, and soil sampling for radionuclide analyses. 6 refs., 6 figs., 5 tabs.

Foley, R.D.; Floyd, L.M.



Drop fall-off from the vibrating ceiling Ho-Young Kima)  

E-Print Network (OSTI)

of power plants and HVAC heating, ventilation, and air condi- tioning systems. In most condensation Parafilm surface facing downward. 2 The frequency of a sinusoidal wave, f, from a function generator

Kim, Ho-Young


Variations of the solar granulation motions with height using the GOLF/SoHO experiment  

E-Print Network (OSTI)

Below 1 mHz, the power spectrum of helioseismic velocity measurements is dominated by the spectrum of convective motions (granulation and supergranulation) making it difficult to detect the low-order acoustic modes and the gravity modes. We want to better understand the behavior of solar granulation as a function of the observing height in the solar atmosphere and with magnetic activity during solar cycle 23. We analyze the Power Spectral Density (PSD) of eleven years of GOLF/SOHO velocity-time series using a Harvey-type model to characterize the properties of the convective motions in the solar oscillation power spectrum. We study then the evolution of the granulation with the altitude in the solar atmosphere and with the solar activity. First, we show that the traditional use of a lorentzian profile to fit the envelope of the p modes is not well suitable for GOLF data. Indeed, to properly model the solar spectrum, we need a second lorentzian profile. Second, we show that the granulation clearly evolves with the height in the photosphere but does not present any significant variation with the activity cycle.

S. Lefebvre; R. A. Garcia; S. J. Jimenez-Reyes; S. Turck-Chieze; S. Mathur




E-Print Network (OSTI)

Nitryl Chloride • • Chlorine Nitrate • • • • • • • • •emission from molecular chlorine resonance series excited byused in this work. Chlorine nitrate (ClON0 ) plays a major

Nelson, Herbert Hoffman



Variations of the solar granulation motions with height using the GOLF/SoHO experiment  

E-Print Network (OSTI)

Below 1 mHz, the power spectrum of helioseismic velocity measurements is dominated by the spectrum of convective motions (granulation and supergranulation) making it difficult to detect the low-order acoustic modes and the gravity modes. We want to better understand the behavior of solar granulation as a function of the observing height in the solar atmosphere and with magnetic activity during solar cycle 23. We analyze the Power Spectral Density (PSD) of eleven years of GOLF/SOHO velocity-time series using a Harvey-type model to characterize the properties of the convective motions in the solar oscillation power spectrum. We study then the evolution of the granulation with the altitude in the solar atmosphere and with the solar activity. First, we show that the traditional use of a lorentzian profile to fit the envelope of the p modes is not well suitable for GOLF data. Indeed, to properly model the solar spectrum, we need a second lorentzian profile. Second, we show that the granulation clearly evolves with...

Lefebvre, S; Jiménez-Reyes, S J; Turck-Chièze, S; Mathur, S



Frustrated spin correlations in diluted spin ice Ho2-xLaxTi2O7  

E-Print Network (OSTI)

Acknowledgments ORNL/SNS is managed by UT-Battelle, LLC, forat the Spallation Neutron Source (SNS) in Oak Ridge [23]. Intime of the experiments, SNS was running at 30 Hz, making a

Ehlers, G.




E-Print Network (OSTI)

Laser Energy Measurements When using the Phase-R as the photolysis source, pulse energy measurements were obtained with a Gentec system.

Nelson, Herbert Hoffman



Topologyand its Applications43 (1992)65-81 North-HoEland  

E-Print Network (OSTI)

the intersection of Q with an affine s .xceL which in its turn is the intersection of several irreducible corn

Shapiro, Boris


4th Annual DOE-ERSP PI Meeting: Abstracts  

E-Print Network (OSTI)

Sciences Department, Brookhaven National Lab, Upton, NY (Biology Department, Brookhaven National Lab, Upton, NY, DevDepartment, Brookhaven National Lab, Upton, NY, Safiyh

Hazen, Terry C.



Basic Energy Sciences Directorate  

NLE Websites -- All DOE Office Websites (Extended Search)

andor outreach to the following initiatives: NY State Smart Grid Consortium, NY Battery and Energy Storage Technology (NY-BEST) Teams, and the SBUNYS Small Business...



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................


Categorical Exclusion Determination Form Proposed Action Title: (0675-1534) GE Global Research -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

34) GE Global Research - 34) GE Global Research - Control Enabling Solutions with Ultrathin Strain and Temperature Sensor System for Reduced Battery Life Cycle Cost Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Niskayuna, NY; Ann Arbor, MI; Dearborn, MI Proposed Action Description: Funding will support efforts to develop a a novel sensor system with supporting multi-physics models to increase battery cell lifetime and extend battery range for electric vehicle applications. Proposed work will consist of: (1) development and fabrication a novel multi-measurand sensor capable of measuring strain and temperature across multiple battery cells; (2) performance of strain and temperature testing and development and validation of multi-physics models; (3)



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................


Corrugated Membrane Fuel Cell Structures - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report Stephen Grot Ion Power Incorporated 720 Governor Lea Rd New Castle, DE 19720-5501 Phone: (302) 832 9550 Email: s.grot@ion-power.com DOE Managers HQ: Donna Ho Phone: (202) 586-8000 Email: Donna.Ho@ee.doe.gov GO: Reginald Tyler Phone: (720) 356-1805 Email: Reginald.Tyler@go.doe.gov Technical Advisor Thomas Benjamin Phone: (630) 252-1632 Email: benjamin@anl.gov Subcontractors: * Graftech International Holdings Inc., Parma, OH * General Motors Corporation, Flint, MI Contract Number: DE-EE0000462 Project Start Date: September 1, 2010 Project End Date: February 28, 2014 Fiscal Year (FY) 2012 Objectives

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Liquefied Natural Gas Exports To Brazil  

Annual Energy Outlook 2012 (EIA)

Babb, MT Havre, MT Port of Morgan, MT Pittsburg, NH Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Sweetgrass, MT Total to Chile Sabine Pass, LA Total to...


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Utility Perspective of mCHP  

Science Conference Proceedings (OSTI)

... Market Development ?Dedicated Natural Gas rates for CHP in NY ... Upstate NY ? 29 Mw steam turbine at Healthcare facility ...



From the Frontlines to the Bottom Line: Medical Marijuana, the War on Drugs, and the Drug Policy Reform Movement  

E-Print Network (OSTI)

Experience. Albany, NY: State University of New York Press.Intellectual. Albany, NY: State University of New York

Heddleston, Thomas Reed




Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."


The Greenness of Cities: Carbon Dioxide Emissions and Urban Development  

E-Print Network (OSTI)

Portland, OR Syracuse, NY Albany, NY New York, NY Salt LakeRI Syracuse, NY New York, NY Albany, NY Tacoma, WA Salt LakeTN/A~S Tulsa, OK Albany-Schene~Y MO~L St. New York-Nort~J

Glaeser, Edward L.; Kahn, Matthew E.



Vencon Management Inc | Open Energy Information  

Open Energy Info (EERE)

Vencon Management Inc Vencon Management Inc Address 65 West 55th Street Place New York, New York Zip 10019 Region Northeast - NY NJ CT PA Area Product Venture capital firm investing primarily in green technology Phone number (212) 581-8787 Website http://home.att.net/~vencon/ho Coordinates 40.7627527°, -73.9774459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.7627527,"lon":-73.9774459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Engineer, Sandia National Laboratories | National Nuclear Security...  

National Nuclear Security Administration (NNSA)

Clifford Ho Engineer, Sandia National Laboratories Clifford Ho Clifford Ho Role: Engineer, Sandia National Laboratories Award: Asian American Engineer of the Year Profile: Clifford...

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

Table. 11 Summary of U.S. Natural Gas Exports By Point of Exit, 1998-2002 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Imports and Exports - Table 11 Pipeline (Canada) East Port, ID.............. NA NA NA NA NA NA NA NA 176 4.40 Detroit, MI.................. 24,908 2.26 25,049 2.30 36,007 3.74 35,644 4.57 7,431 3.03 Marysville, MI ............ 3,377 2.17 691 2.47 5,320 2.91 3,651 3.92 NA NA St. Clair, MI ............... 11,397 2.23 11,258 2.51 29,654 3.73 122,293 3.82 164,084 3.42 Noyes, MN ................ NA NA NA NA NA NA NA NA 71 1.99 Babb, MT................... NA NA NA NA NA NA 549 3.55 143 2.28 Havre, MT ................. NA NA 1,510 2.05 1,606 3.25 2,428 3.40 15,892 2.74 Port of Morgan, MT ... NA NA NA NA NA NA NA NA 1 3.47 Niagara Falls, NY ...... NA NA NA NA NA NA 594 2.49 39 5.04 Sumas, WA ............... 208 2.80 NA NA NA NA 1,529 4.44 1,477 2.59 Total..........................


Fast Specification of CycleAccurate Processor Models Felix ShengHo Chang and Alan J. Hu  

E-Print Network (OSTI)

Architecture, Vancouver, British Columbia, June 2000. [4] Doug Burger and Todd M. Austin. The simplescalar tool,ling@cs.utexas.edu Abstract Many speculative microarchitectural techniques such as eager execution, value prediction, pipeline pipeline gating. Using previous confidence estimators, pipeline gating reduces the amount of extra work due

Hu, Alan J.


Stream Register Files with Indexed Access Nuwan Jayasena, Mattan Erez, Jung Ho Ahn, and William J. Dally  

E-Print Network (OSTI)

register file (VRF or SRF) ­ a software-managed on-chip storage structure for sequences of data words

Dally, William J.



E-Print Network (OSTI)

J. P. Meyer, ucHEMK: Scheme for Chemic A Compu li Kinetics,uperformed account for ion ible chemic study a ion. the ozoneion set this lutions the chemic des~ size~ behavior of all

Littlejohn, David



Measurements of the sum of HO2NO2 and CH3O2NO2 in the remote troposphere  

E-Print Network (OSTI)

Measurements of Stratospheric Chlorine and Reactive NitrogenHydrogen, Nitrogen, and Chlorine Radicals – Impli- cations



Vehicle Location and Navigation Systems based on LEDs Grantham Pang, Hugh Liu, Chi-Ho Chan, Thomas Kwan  

E-Print Network (OSTI)

Traffic lights, traffic signal devices, message display boards are being replaced by Light Emitting Diodes for their discussions in meetings. REFERENCES 1. "Audio information system using light-emitting diodes", E. Yang, D. 2. "Light emitting diode dot matrix display system with audio output", G. Pang, S.W. Cheung, T. Kwan

Pang, Grantham


DUAL USE OF LEDS: SIGNALING AND COMMUNICATIONS IN ITS Grantham Pang, Chi-ho Chan, Hugh Liu, Thomas Kwan  

E-Print Network (OSTI)

of light-emitting diodes (LEDs) over incandescent lights is well-supported. This is due to their high construction of LEDs panel and the illuminance of LEDs. CONCLUSIONS In the near future, light-emitting diodes, U.S. Patent Office. 2. "Light emitting diode dot matrix display system with audio output", G. Pang

Pang, Grantham


A life of worry : the cultural politics and phenomenology of anxiety in Ho Chi Minh City, Vietnam  

E-Print Network (OSTI)

humankind or the inevitable fallout of modernity's freedomsinner life and is the fallout from the instability of ourof Confucianism and fallout from political violence that

Tran, Allen L.; Tran, Allen L.




E-Print Network (OSTI)

smog chamber experiments n-butane photo-oxidation, Jesson etthe unimolecular decornposition without added n-butane.The NO n~butane th and is an effective scavenger of OH by

Littlejohn, David



LED Traffic Light as a Communications Device Grantham Pang, Thomas Kwan, Chi-Ho Chan, Hugh Liu.  

E-Print Network (OSTI)

:http://www.eee.hku.hk/~gpang Abstract The visible light from an LED (light emitting diode) traffic light can be modulated and encoded on the description of an audio information system made up of high brightness, visible light emitting diodes (LEDs messages 1. Introduction Recently, high intensity light emitting diodes for traffic signals are available

Pang, Grantham



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energy’s National Nuclear ...


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón  

E-Print Network (OSTI)

May ________. “A vistas la pornografía. ” Primera Hora, 22la medida contra la pornografía. ” El Nuevo Día, 13 Junecomunicación contra la pornografía. ” El Nuevo Día, 16 May

Rivera, Petra Raquel



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón  

E-Print Network (OSTI)

Puertorriqueña. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetón. Based on ethnographic and archival research in San Juan, Puerto Rico,… (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clément Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2013-10084P



NLE Websites -- All DOE Office Websites (Extended Search)

U U Ur rb ba an n A At tm mo os sp ph he er ri ic c O Ob bs se er rv va at to or ry y ( ( U UA AO O) ) F F i ir rs st t P Pl la an nn ni in ng g W Wo or rk ks sh ho op p A Ag ge en nd da a 27-28 January, 2003 HOTELS Please Note: This list is not all-inclusive, but compiled to provide some suggestions. Occupancy at the Government rate is based on availability. The rates vary depending on the time of year, day of the week, number of nights. There are also special rates and packages available at different times of the year. Some hotels offer weekend rates. For an extended list click on this link and search NY: http://www.hotels.com EML is located on the West Side of Manhattan - "lower Manhattan" - Greenwich Village/SoHo area. The following hotels are on the West Side of Manhattan. EML can be reached by subway or taxi. Hotels


La Liste Des Tantras Du rNying Ma'i Rgyud 'bum Selon L'edition Et Ablie Par Kun Mkhyen 'Jigs Med Gling Pa  

E-Print Network (OSTI)

‘gro ba’i rgyud lnga) qui sontcommuns à l’Anuyoga24 et dont la liste concerne les nos. 229, 224, 169, 166 etun Ri bo brtsegs pa’i rgyud qui est non-identifié dans la liste de ‘Jigs med glingpa),xvi. le Recueillement Concentré (Ting ‘dzin rtse gcig, non... ’on pourrait leur en trouver une, ainsi qu’on la fait dans cette présentation. Il faudrait également appliquer à ce schéma celui des clas- sification complexes du Klong sde en Abîme blanc (klong dkar po), noir (klong nag po), diapré (klong khra bo) et infini...

Achard, Jean-Luc



Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network (OSTI)

Alpaugh, Justin Alpaugh, Chelsea Anderson, Thomas Armstrong, Janice Artfitch, Jessica Aulisio, Alex Barree, Patti Linnell, Chelsea Maciborski, Lisa Magulak, Christine Martino, Sarah Martino, Jenna McBride, Andrew Handler Brittney O'Brien Highest Scoring Dogs Kelsey Graham/Brian Franchuk Participants in Beginner

Goldman, Steven A.


Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network (OSTI)

, Stacey Kodack, Jay- son Kolb, Vanessa Lavoie, Patti Lennell, Sarah MacCom- bie, Chelsea Maciborski, Katie Junior Handler - Junior Amanda Weinstein 1st place Alexa Berko 2nd place Katie Flannery 3rd place Elise Schwer 4th place Junior Handler ­ Senior Nathalie Schlosser 1st place Molly Mulrooney 2nd place Kelly

Goldman, Steven A.


The U.S. Department of Energy's Brookhaven National Laboratory P.O. Box 5000, Upton NY 11973 a passion for discovery  

E-Print Network (OSTI)

to find innovative solutions to energy problems. Hydrogen Storage Materials To develop efficient hydrogen also designed a possible hydrogen storage system with a storage capacity of 7.5 percent hydrogen. This will be tested in the future.Aerial view of Brookhaven Lab Hydrogen Energy Solutions at the Nanoscale Purpose

Ohta, Shigemi


Bacterial and Archaea Community Present in the Pine Barrens Forest of Long Island, NY: Unusually High Percentage of Ammonia Oxidizing Bacteria  

Science Conference Proceedings (OSTI)

Of the few preserved areas in the northeast of United States, the soil in the Pine Barrens Forests presents a harsh environment for the microorganisms to grow and survive. In the current study we report the use of clustering methods to scientifically select the sampling locations that would represent the entire forest and also report the microbial diversity present in various horizons of the soil. Sixty six sampling locations were selected across the forest and soils were collected from three horizons (sampling depths). The three horizons were 0-10 cm (Horizon O); 11-25 cm (Horizon A) and 26-40 cm (Horizon B). Based on the total microbial substrate utilization pattern and K-means clustering analysis, the soil in the Pine Barrens Forest can be classified into four distinct clusters at each of the three horizons. One soil sample from each of the four clusters were selected and archaeal and bacterial populations within the soil studied using pyrosequencing method. The results show the microbial communities present in each of these clusters are different. Within the microbial communities present, microorganisms involved in nitrogen cycle occupy a major fraction of microbial community in the soil. High level of diversity was observed for nitrogen fixing bacteria. In contrast, Nitrosovibrio and Nitrosocaldus spp are the single bacterial and archaeal population respectively carrying out ammonia oxidation in the soil.

Shah, V.; Green, T.; Shah, V.; Shah, S.; Kambhampati, M.; Ambrose, J.; Smith, N.; Dowd, S.; McDonnell, K.; Panigrahi, B.



Lei Zuo, Ph.D., Assistant Professor Department of Mechanical Engineering, State Univ. of New York at Stony Brook, NY 11794-2300  

E-Print Network (OSTI)

and Development Authority (NYSERDA #15761), $81,000, PI Lei Zuo, 2010-1011 "Energy Harvesting from Railway, Phase Piezoelectric Single Crystal Multilayer Stacks for Energy Harvesting Transducers (RPSEHT)", T.B. Xu, E.J. Siochi

Zuo, Lei


Deployment of a Tethered-Balloon System for Microphysics and Radiative Measurements in Mixed-Phase Clouds at Ny-Ålesund and South Pole  

Science Conference Proceedings (OSTI)

A tethered-balloon system capable of making microphysical and radiative measurements in clouds is described and examples of measurements in boundary layer stratus clouds in the Arctic and at the South Pole are presented. A 43-m3 helium-filled ...

R. Paul Lawson; Knut Stamnes; Jakob Stamnes; Pat Zmarzly; Jeff Koskuliks; Chris Roden; Qixu Mo; Michael Carrithers; Geoffrey L. Bland




SciTech Connect

BNL is proud to acknowledge all of our 2001 sponsors, with their help and support this has correctly become an oilheat industry conference. It is quite gratifying to see an industry come together to help support an activity like the technology conference, for the benefit of the industry as a whole and to celebrate the beginning of the National Oilheat Research Alliance. This meeting is the fourteenth oil heat industry technology conference to be held since 1984 and the first under a new name, NORA, the National Oilheat research Alliance, and the very first in the new century. The conference is a very important part of the effort in technology transfer, which is supported by the Oilheat Research Program. The Oilheat Research Program at BNL is under the newly assigned program management at the Office of Power Technology within the US DOE. The foremost reason for the conference is to provide a platform for the exchange of information and perspectives among international researchers, engineers, manufacturers, service technicians, and marketers of oil-fired space-conditioning equipment. The conference provides a conduit by which information and ideas can be exchanged to examine present technologies, as well as helping to develop the future course for oil heating advancement. These conferences also serve as a stage for unifying government representatives, researchers, fuel oil marketers, and other members of the oil-heat industry in addressing technology advancements in this important energy use sector. The specific objectives of the conference are to: (1) Identify and evaluate the current state-of-the-art and recommend new initiatives for higher efficiency, a cleaner environment, and to satisfy consumer needs cost-effectively, reliably, and safely; (2) Foster cooperative interactions among federal and industrial representatives for the common goal of sustained economic growth and energy security via energy conservation. Seventeen technical presentations will be made during the two-day program, all related to oil-heat technology and equipment, these will cover a range of research, developmental, and demonstration activities being conducted within the United States and Europe, including: (1) High-flow Fan Atomization Burner (HFAB) Development and Field Trials; (2) Field Test of the Flame Quality Monitor; (3) NORA/DOE/ BNL Oilheat Five-Year Research Plan; (4) US Department of Energy's Building Cooling Heating and Power for Buildings Program; (5) NORA Education Committee Report; (6) Marketing Oil Heat in Europe: A study in contrasts; (7) Diagnosing Burner Problems with Recorded Data ''The solution to any problem is obvious.. . once it is found''; (8) Variable Firing Rate Oil Burner Using Pulse Fuel Flow Control; (9) Oil-Fired Hydronic Heating Appliances with Reduced Electric Power Consumption and Battery Backup; (10) Peep Into The Nozzle Using Computational Fluid Dynamics; (11) Results of a Parametric Investigation of Spray Characteristics Using a HFAB Type Atomizer; (12) Progression and Improvements in the Design of Blue-flame Oil Burners; (13) Biodiesel as a Heating Oil Blend Stock; (14) Lab Tests of Biodiesel Blends in Residential Heating Equipment; (15) Alternative Fuel Oils and the Effect of Selected Properties in Combustion; (16) New York State Premium Low-Sulfur Heating Fuel Marketplace Demonstration; and (17)The Need for a New Fuel Oil Stability Specification.




,"New York Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050NY3","N3010NY3","N3020NY3","N3035NY3","N3045NY3" "Date","Natural Gas Citygate Price in New York (Dollars per Thousand Cubic Feet)","New York Price of...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

site history, site history, cleanup status, and role of the West Valley Citizen Task Force Raymond C. Vaughan, Ph.D. West Valley Citizen Task Force DOE National Transportation Stakeholders Forum Buffalo, May 16, 2013 WEST VALLEY SITE * Only U.S. commercial reprocessing plant (1966-1972) * Owned by NY State; operated by Nuclear Fuel Services * Reprocessed both defense and commercial spent fuel * High worker exposures, poor control of contaminants during period of operation prior to 1980 * Sited on erosion-prone land (glacial fill) in the Great Lakes watershed, about 50 km (30 mi) south of Buffalo * Two onsite burial grounds operated 1963-1975; hold wastes exceeding 10 CFR 61 limits * Onsite source term includes HLW, TRU, LLW, mixed waste (roughly 16 million curies current total)


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Armstrong PepsiCo Teaming Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

Armstrong International, Inc. Pepsi Beverages Company Armstrong International, Inc. Pepsi Beverages Company 816 Maple Street 1 Pepsi Way Three Rivers, MI 49093 Somers, NY 10589 Business: Steam, Air & Hot Water Utility Systems Business: Beverage Bottling Cam Spence Rob Turner Director of Global Food Markets Engineering Director 269-279-3149 914-767-7763 cam@armstronginternational.com Rob.Turner@pepsiamericas.com Armstrong's Complete Thermal Exchange (CTE) technology reduces natural gas consumed by Pepsi Americas by 37% and reduces CO 2 emissions by 4,125 tons/year Project Scope Using CTE technology, Armstrong designed, engineered, and turnkey installed Flo-Direct gas-fired hot water heating systems to complete can/bottle warmer optimizations on thirteen production lines at eight Pepsi facilities.

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NETL: NEPA Categorical Exclusions - July 2011 to September 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to September 2011 1 to September 2011 Archive (November 2009 - July 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 9/30/2011 IGCC Affordability and Availability (Houston) General Electric Company Houston, TX FE/Gasification Division N 9/30/2011 IGCC Affordability and Availability (Schenectady) General Electric Company Schenectady, NY FE/Gasification Division Y 9/30/2011 Geothermal Incentive Program Connecticut Wallingford, CT EE/PMC/IPOD Y 9/29/2011 Midwest Region Alternative Fuels Project Metropolitan Energy Center Kansas City, KS EE/PMC/PVT Y 9/28/2011 Ohio Advanced Transportation Partnership/Roush CleanTech LPG Conversions of Frito Lay Vehicles Clean Fuels Ohio Plymouth Twp., MI EE/PVT/Clean Cities Y 9/28/2011 Ohio Advanced Transportation Partnership/Frito Lay Columbus Propane Fueling Infrastructure Clean Fuels Ohio Columbus, OH EE/PVT/Clean Cities


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Oil-Free Centrifugal Hydrogen Compression Technology Demonstration - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report Hooshang Heshmat Mohawk Innovative Technology, Inc. (MiTi) 1037 Watervliet Shaker Road Albany, NY 12205 Phone: (518) 862-4290 Email: HHeshmat@miti.cc DOE Managers HQ: Erika Sutherland Phone: (202) 586-3152 Email: Erika.Sutherland@ee.doe.gov GO: Katie Randolph Phone: (720) 356-1759 Email: Katie.Randolph@go.doe.gov Contract Number: DE-FG36-08GO18060 Subcontractor: Mitsubishi Heavy Industries, Ltd, Compressor Corporation, Hiroshima, Japan Project Start Date: September 25, 2008 Project End Date: May 30, 2013 Fiscal Year (FY) 2012 Objectives Design a reliable and cost-effective centrifugal compressor for hydrogen pipeline transport and delivery: Eliminate sources of oil/lubricant contamination * Increase efficiency by using high rotational speeds *


Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

site history, site history, cleanup status, and role of the West Valley Citizen Task Force Raymond C. Vaughan, Ph.D. West Valley Citizen Task Force DOE National Transportation Stakeholders Forum Buffalo, May 16, 2013 WEST VALLEY SITE * Only U.S. commercial reprocessing plant (1966-1972) * Owned by NY State; operated by Nuclear Fuel Services * Reprocessed both defense and commercial spent fuel * High worker exposures, poor control of contaminants during period of operation prior to 1980 * Sited on erosion-prone land (glacial fill) in the Great Lakes watershed, about 50 km (30 mi) south of Buffalo * Two onsite burial grounds operated 1963-1975; hold wastes exceeding 10 CFR 61 limits * Onsite source term includes HLW, TRU, LLW, mixed waste (roughly 16 million curies current total)


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Status and outlook for shale gas and tight oil development in the U.S.  

Gasoline and Diesel Fuel Update (EIA)

Joint Forum on US Shale Gas & Pacific Gas Markets Joint Forum on US Shale Gas & Pacific Gas Markets May 14, 2013 | New York, NY By Adam Sieminski, Administrator U.S. Shale Gas 2 Adam Sieminski , May 14, 2013 Domestic production of shale gas has grown dramatically over the past few years Adam Sieminski , May 14, 2013 3 0 5 10 15 20 25 30 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) shale gas production (dry) billion cubic feet per day Sources: LCI Energy Insight gross withdrawal estimates as of March 2013 and converted to dry production estimates with EIA-calculated average gross-to-dry shrinkage factors by state and/or shale play. Shale gas leads growth in total gas production through 2040 to


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


L B L  

NLE Websites -- All DOE Office Websites (Extended Search)

B B L - - 1 8 4 0 2 DE85 0 0 3 4 7 0 REPORT OF THE WORKING GROUP ON CP VIOLATION AND RARE DBCAYS I.W. Cronin ^ " 0 Department of J-hysics, University of Chicago, Chicago, IL 60637 ' '° N.G. Deshpande - s i** 0 Department of Physics, University of Oregon, Eugene, OR 97*03 " G.L.Kane 3 $>>> Department of Physics, University of Michigan, Ann Arbor, MI 48109 ' V.C. Lnth and A.C. Odian 0 e Stanford Linear Accelerator Center, P.O. Box 4349, Stanford, CA 94305 51' * M.E. Machacek ^ ^ ^ Department of Physics, Northeastern University, Boston, MA 02115 F - P 4 i f . e . . . . . . _ .ax l»' Brookhaven National Laboratory, Upton, Long Island, NY 11973 0 a i ci> M.P. Schmidt and J. Slaughter ,, 9^" c Department of Physics, Yale University, New Haven, CT 06511 ^


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5653 5653 Filter Sensing Technologies, Inc. EE Multiple PMC/PVT 1/15/2012 - 1/14/2015 Walter G. Parker Multiple sites - MA, MI, NY & TN Development of Radio Frequency Diesel Particulate Filter Sensor and Controls (SUMMARY CX) Developing computer simulations to guide sensor design, developing sensor prototypes, and conducting engine, bench, and ash loading tests to develop calibrations and validate performance. Walter G. Parker Digitally signed by Walter G. Parker DN: cn=Walter G. Parker, o=DOE NETL, ou=PV&T, email=walter.parker@netl.doe.gov, c=US Date: 2011.11.16 14:30:31 -05'00' 11 16 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.12.06 11:22:29 -05'00'


Memorandum A. J. Rizzo, Chief TO : Operational Safety Branch  

Office of Legacy Management (LM)

j Memorandum A. J. Rizzo, Chief TO / : Operational Safety Branch Harold Glauberman, ?a FROM : Operational Safety Branch ' I DATE: September 30, 1966 REMOVAL OF CONTAMINATED EQUlPMEHT AT THE CANEL FACILITY SUBJECT: MI DDLETOWN, CONNECT I CUT' INTRODUCTION The decision to terminate AEC contract activities at the CANEL facility introduced the need to dispose of radioactively contaminated equipment and materials so as to permit release of the facilities. As a result, -' . the Operational Safety Branch, NY, was requested to perform thenecessary Health Physics surveillance and monitoring functions during the-disassembly, removal and packaging of the contaminated equipment. The actual removal and handling of contaminated equipment was performed by the' AEC.contractor,


EIA Drilling Productivity Report  

U.S. Energy Information Administration (EIA) Indexed Site

Drilling Productivity Report Drilling Productivity Report For Center on Global Energy Policy, Columbia University October 29, 2013 | New York, NY By Adam Sieminski, Administrator The U.S. has experienced a rapid increase in natural gas and oil production from shale and other tight resources Adam Sieminski, EIA Drilling Productivity Report October 29, 2013 2 0 5 10 15 20 25 30 35 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 2000 2002 2004 2006 2008 2010 2012 Eagle Ford (TX) Bakken (MT & ND) Granite Wash (OK & TX) Bonespring (TX Permian) Wolfcamp (TX Permian) Spraberry (TX Permian) Niobrara-Codell (CO) Woodford (OK)

Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- International Rare Metals Refinery Inc  

Office of Legacy Management (LM)

Rare Metals Refinery Rare Metals Refinery Inc - NY 38 FUSRAP Considered Sites Site: International Rare Metals Refinery, Inc. (NY.38 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Canadian Radium and Uranium Corporation NY.38-1 Location: 69 Kisko Avenue , Mt. Kisko , New York NY.38-1 NY.38-3 Evaluation Year: 1987 NY.38-4 Site Operations: Manufactured and distributed radium and polonium products. NY.38-5 Site Disposition: Eliminated - No Authority - Site was a commercial operation not under the jurisdiction of DOE predecessor agencies NY.38-2 NY.38-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Radium, Plutonium NY.38-5 Radiological Survey(s): Yes NY.38-1 NY.38-5 Site Status: Eliminated from consideration under FUSRAP


Drunk On Oil: Russian Foreign Policy 2000-2007  

E-Print Network (OSTI)

Agrees to Send Fuel for Iran Nuclear Plant,” N.Y. Times,Nuclear Fuel to Plant in Iran,” N.Y. Times, Dec. 18, 2007. “Agrees to Send Fuel for Iran Nuclear Plant,” N.Y. Times,

Brugato, Thomas



U.S. LNG Imports from Indonesia  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Australia  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Equatorial Guinea  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Other Countries  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Trinidad/Tobago  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Yemen  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Peru  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. Natural Gas Exports to Mexico  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. Total Exports  

U.S. Energy Information Administration (EIA) Indexed Site

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Nigeria  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Malaysia  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Oman  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Egypt  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Norway  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Algeria  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Brunei  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


The type of calligraphy : writing, print, and technologies of the Arabic alphabet  

E-Print Network (OSTI)

273-282. Albany, NY: State University of New York Press.285-292. Albany, NY: State University of New York Press.Materials. Albany, NY: State University of New York Press.

Osborn, J. R. (Wayne)


Note: This page contains sample records for the topic "ho mi ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Integrated Coastal Resource Management: A Prescription for Sustainable Development  

E-Print Network (OSTI)

culture. Albany, NY: State University of New York Press.and policy. Albany, NY: State University of New York Press.our way out. Albany, NY: State University of New York Press.

English, Brian J.



A Case Study Approachto Understanding Regional Resilience  

E-Print Network (OSTI)

Profile of Western New York. ” Albany, NY: Assembly Ways andNew York. Albany, NY: State University of New York Press.Profile of Western New York. ” (Albany, NY: Assembly Ways

Kathryn A. Foster



Using Segmented Assimilation Theory to Enhance Conceptualization of College Participation  

E-Print Network (OSTI)

pp. 3-17). Albany, NY: State University of New York Press.Universities. Albany, NY: State University of New York121-135). Albany, NY: State University of New York Press.

Nuñez, Anne-Marie



U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC



Office of Legacy Management (LM)

is granted. An exemption may be granted NY State Department of Environmental Conservation and the NY State Department of Health determine the LLRW transport cannot impose a...


DOE - Office of Legacy Management -- Rockefeller Institute for...  

Office of Legacy Management (LM)

Rockefeller Institute for Medical Research - NY 0-21 FUSRAP Considered Sites Site: ROCKEFELLER INSTITUTE FOR MEDICAL RESEARCH (NY.0-21) Eliminated from consideration under FUSRAP...


Local Attractions: 4th Conference on Human Factors and the ...  

Science Conference Proceedings (OSTI)

... New York, NY, 718-293-6000, Yankee Stadium: Home of NY Yankees (45 miles). Bowling, 201-377-8919, Plaza Lanes (10 miles). ...


AmpluseCorporation.pdf | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AmpluseCorporation.pdf More Documents & Publications 2008TransitionCorporateOverviewBookOne.pdf Sylvania Corporation, Hicksville, NY and Bayside, NY WA05062UNITEDTECHNOLOG...


DOE - Office of Legacy Management -- Ferro Metal and Chemical...  

Office of Legacy Management (LM)

Ferro Metal and Chemical Co - NY 42 FUSRAP Considered Sites Site: Ferro Metal & Chemical Co. (NY.42 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated...


DOE - Office of Legacy Management -- Brookhaven National Laboratory...  

Office of Legacy Management (LM)

Brookhaven National Laboratory Buildings 353 354 467 and 468 - NY 14 FUSRAP Considered Sites Site: Brookhaven National Laboratory Buildings 353 354 467 and 468 (NY.14 ) Designated...


Variation in the Aggressive Behavior of the Parthenognetic Lizard (Cnemidophorus uniparens, Teiidae)  

E-Print Network (OSTI)

Bulletin 466, pp. 49-71). Albany, NY: New York State Museum.Bulletin 466, pp. 49-71). Albany, NY: New York State Museum.

Grassman, Mark; Burton, David; Crews, David



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE0000230 New York EE EE0000230 PMCIPOD ARRA 2009 Teresa Jones 2009 Albany, NY NY Revised NIW for Energy Efficiency Program for Municipalities, Schools, Hospitals, Public Colleges...


The High Schools English Learners Need  

E-Print Network (OSTI)

Reform. Albany: State University of New York. Gándara, P. &Reform. Albany, NY: State University of New York Press.Reform. Albany, NY: State University of New York Press.

Gold, Norm; Maxwell-Jolly, Julie



Energy Outlook  

U.S. Energy Information Administration (EIA) Indexed Site

Energy Outlook For NY Energy Forum October 29, 2013 | New York, NY By Adam Sieminski, Administrator Agenda * Winter Fuels Outlook * Drilling Productivity Report * Geopolitical...


DOE - Office of Legacy Management -- Sylvania Corning Nuclear...  

Office of Legacy Management (LM)

Nuclear Corp Inc Sylvania Laboratories - NY 07 FUSRAP Considered Sites Site: SYLVANIA CORNING NUCLEAR CORP., INC., SYLVANIA LABORATORIES (NY.07) Eliminated from consideration under...


Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



DOE - Office of Legacy Management -- Curtiss-Wright Corp Metals Processing  

Office of Legacy Management (LM)

Curtiss-Wright Corp Metals Curtiss-Wright Corp Metals Processing Div - NY 40 FUSRAP Considered Sites Site: Curtiss-Wright Corp., Metals Processing Div. (NY.40 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: Curtiss-Wright Corporation NY.40-1 Location: Buffalo , New York NY.40-1 Evaluation Year: 1987 NY.40-2 Site Operations: Performed casting, forging, and extrusion operations for the U.S. Air Force and the AEC. NY.40-1 NY.40-2 Site Disposition: Eliminated - Referred to DOD NY.40-2 NY.40-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.40-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD NY.40-2



NLE Websites -- All DOE Office Websites (Extended Search)

M i d l a n d B a s i n Claytonville Pennsylvanian reef reservoirs Modified from Galloway, et al. (1983) SACROC LYNN G ARZA KENT STONEW ALL DA W SON TERRY HASKELL KNO X BO RDEN SCURRY FISHER JO NES T AYLO R NO LAN M ITCHELL HO W ARD MARTIN CO KE 0 20 mi 0 30 km QAd4569x Figure 1. Regional Location Map. FACTSHEET FOR PARTNERSHIP FIELD VALIDATION TEST Partnership Name Southwest Regional Partnership on Carbon Sequestration Contacts: DOE/NETL Project Mgr. Name Organization E-Mail William O'Dowd NETL William.ODowd@NETL.DOE.GOV Principal Investigator Reid Grigg / Brian McPherson NMT reid@prrc.nmt.edu / brian@nmt.edu Field Test Information: Field Test Name