National Library of Energy BETA

Sample records for hilton head island

  1. Submitted to and accepted for the Expert Systems in Production and Operations Management Conference, Hilton Head, South Carolina, 1990

    E-Print Network [OSTI]

    McLaren, Bruce Martin

    Conference, Hilton Head, South Carolina, 1990 TEST+: The Extension of an Application Shell For Turbine a unique and powerful solution to the diagnosis of turbine generators. #12;2 1 Introduction As a variety+ in the turbine-generator domain. Features of this domain motivated a particular set of system requirements

  2. Introducing the Market to High-performance Building on Hilton Head Island

    SciTech Connect (OSTI)

    Rudd, Armin

    2007-12-01

    The whole-house performance approach described here builds a framework of principals,options, and plan for quality execution of producing high-performance homes.

  3. Summit Location Announced: Hilton Anaheim, California

    Broader source: Energy.gov [DOE]

    The 2014 SunShot Grand Challenge Summit will be held at the Hilton Anaheim in Anaheim, California from May 19-22.

  4. Commercial Flounder Gigging Hilton M. Floyd

    E-Print Network [OSTI]

    Commercial Flounder Gigging By Hilton M. Floyd UNITED STATES DEPARTMENT OF THE iNTERIOR FIS H AN DK ernan, Director Commercial Flounder Gigging By HILTON M. FLOYD Fishery Leaflet 586 Washington, D.C. February 1966 #12;Methods Gear .. Gig Lights Wood fire Oil light CONTENTS Electric light. Gasoline lante rn

  5. 11th HEAD Meeting March 14, 2010 Big Island, Hawaii ChaMPlane Galactic Bulge Latitude

    E-Print Network [OSTI]

    11th HEAD Meeting March 1­4, 2010 Big Island, Hawaii ChaMPlane Galactic Bulge Latitude Survey, Hilo, HI 96720 U.S.A. http://hea-www.harvard.edu/ChaMPlane/ Zhao/CfA ChaMPlane 1 #12;11th HEAD Meeting observation "Limiting Window", a low extinction window closest to the SgrA* with Av=3.9. We also completed

  6. Solid-State Sensor and Actuator Workshop '98, Hilton Head Island (1998). DEVELOPMENT OF AN IN NOVATIVE FLIP-CHIP BONDING

    E-Print Network [OSTI]

    Oh, Kwang W.

    1998-01-01

    in many packaging schemes. This is due to the advantages of improved reliability, lower costs, and higher ABSTRACT Using micromachining techniques with thick photore- sists, an innovative conductive polymer flip), and a lower bonding temperature (~170 o C). This new bonding technique has high potential to replace conven

  7. Downlight Demonstration Program: Hilton Columbus Downtown

    SciTech Connect (OSTI)

    Davis, Robert G.; Perrin, Tess E.

    2014-05-13

    The U.S. Department of Energy (DOE) estimates that there were about 700 million downlight luminaires installed in residential and commercial buildings in the U.S. as of 2012, with light-emitting diode (LED) luminaires representing less than 1% of this installed base. Downlight luminaires using conventional incandescent, halogen, and compact fluorescent lamps have lower efficacies and shorter expected lifetimes than comparable LED systems, but the lower initial cost of the conventional technology and the uncertainties associated with the newer LED technology have restricted widespread adoption of LED downlight luminaires. About 278 tBtu of energy could be saved annually if LED luminaires were to saturate the downlight market, equating to an annual energy cost savings of $2.6 billion. This report summarizes an evaluation of LED recessed downlight luminaires in the guest rooms at the Hilton Columbus Downtown hotel in Columbus, OH. The facility opened in October of 2012, and the U.S. Department of Energy (DOE) conducted a post-occupancy assessment of the facility in January–March of 2014. Each of the 484 guest rooms uses seven 15 W LED downlights: four downlights in the entry and bedroom and three downlights in the bathroom. The 48 suites use the seven 15 W LED downlights and additional fixtures depending on the space requirements, so that in total the facility has more than 3,700 LED downlights. The downlights are controlled through wall-mounted switches and dimmers. A ceiling-mounted vacancy sensor ensures that the bathroom luminaires are turned off when the room is not occupied.

  8. Final work plan for targeted investigation at Hilton, Kansas.

    SciTech Connect (OSTI)

    LaFreniere, L. M.; Environmental Science Division

    2007-08-28

    This Work Plan outlines the scope of a targeted investigation to update the status of carbon tetrachloride contamination in groundwater associated with grain storage operations at Hilton, Kansas. The Commodity Credit Corporation (CCC), an agency of the U.S. Department of Agriculture (USDA), operated a grain storage facility in Hilton during the 1950s and 1960s. At the time of the CCC/USDA operation in Hilton, grain storage facilities (CCC/USDA and private) were located along the both sides of the former Union Pacific railroad tracks (Figure 1.1). The main grain storage structures were on or near the railroad right-of-way. The proposed targeted investigation, to be conducted by Argonne National Laboratory on the behalf of CCC/USDA, will supplement Argonne's Phase I and Phase II investigations in 1996-1997. The earlier investigations erroneously focused on an area east of the railroad property where the CCC/USDA did not operate, specifically on a private grain storage facility. In addition, the investigation was limited in scope, because access to railroad property was denied (Argonne 1997a,b). The hydrogeologic system at Hilton is potentially complex.

  9. Fusion Energy Sciences Advisory Committee Meeting Gaithersburg Hilton

    E-Print Network [OSTI]

    Fusion Energy Sciences Advisory Committee Meeting Gaithersburg Hilton 620 Perry Parkway Director for Fusion Energy Sciences 10:20 Meeting Agenda and Logistics Professor Stewart Prager, FESAC. N. Anne Davies, Associate Director for Fusion Energy Sciences 12:30 Lunch 01:30 OMB Perspective Joel

  10. ISLANDER

    Energy Science and Technology Software Center (OSTI)

    003251WKSTN00 Genomic Island Identification Software v 1.0  http://bioinformatics.sandia.gov/software 

  11. Next Generation Luminaire (NGL) Downlight Demonstration Project, Hilton Columbus Downtown

    SciTech Connect (OSTI)

    Davis, R. G.; Perrin, T. E.

    2014-09-30

    At the Hilton Columbus Downtown hotel in Ohio, DOE's Better Buildings Alliance conducted a demonstration of Next Generation Luminaires-winning downlights installed in all guest rooms and suites prior to the hotel's 2012 opening. After a post-occupancy assessment, the LED downlights not only provided the aesthetic appearance and dimming functionality desired, but also provided 50% energy savings relative to a comparable CFL downlight and enabled the lighting power to be more than 20% below that allowed by code.

  12. Village of Hilton, New York (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:StandardsMichiganHilton, New York (Utility Company)

  13. Guest Room Lighting at the Hilton Columbus Downtown

    SciTech Connect (OSTI)

    2014-06-30

    At the Hilton Columbus Downtown hotel in Ohio, DOE's Better Buildings Alliance conducted a demonstration of Next Generation Luminaires-winning downlights installed in all guest rooms and suites prior to the hotel's 2012 opening. After a post-occupancy assessment, the LED downlights not only provided the aesthetic appearance and dimming functionality desired, but also provided 50% energy savings relative to a comparable CFL downlight and enabled the lighting power to be more than 20% below that allowed by code. This document is a summary case study of the report.

  14. CARBON MANAGEMENT TECHNOLOGY CONFERENCE OCTOBER 21-23, 2013 Hilton Alexandria Old Town Alexandria, Virginia Page 1

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    CARBON MANAGEMENT TECHNOLOGY CONFERENCE OCTOBER 21-23, 2013· Hilton Alexandria Old Town· Alexandria) on Mt. Simon sandstone (USA) #12;CARBON MANAGEMENT TECHNOLOGY CONFERENCE OCTOBER 21-23, 2013· Hilton techniques are considered to be expedient tools for CO2-risk management. Reservoir pressure

  15. we are Hospitality The Conrad N. Hilton College of Hotel and Restaurant

    E-Print Network [OSTI]

    Glasser, Adrian

    and Barron Hilton Distinguished Chair Learn more about us at www.hrm.uh.edu or contact us at 713-743-2446 #12/AA institution. Learn more about us at www.hrm.uh.edu or contact the Dean's Office at 713-743-2607. #12;

  16. Author's personal copy Wading bird guano contributes to Hg accumulation in tree island soils

    E-Print Network [OSTI]

    Ma, Lena

    . The mean Hg concentration in surface soils of ghost tree islands was low and similar to marsh soil. For live tree islands, Hg concentrations in the surface head region were considerably greater than those Everglades typically consists of head, middle and tail re- gions (Mason and Valk, 2002). The head is the most

  17. Guidance, Navigation and Control Conference, August 16-19 2007, Hilton Head, South Carolina Long Distance/Duration Trajectory Optimization for

    E-Print Network [OSTI]

    Langelaan, Jack W.

    System and air data sensors to enable exploitation of atmospheric energy using thermals, wave by small and micro unin- habited aerial vehicles. It combines a prediction of wind field with a trajectory planner, a decision-making block, a low-level flight controller and sensors such as Global Positioning

  18. Ascension Island

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    U.S. Air Force Space Command - Ascension Island Personnel from the Power Systems Engineering Department, in conjunction with the U.S. Air Force, U.S. Navy, and other partners,...

  19. symposium summary: Island biogeography

    E-Print Network [OSTI]

    Triantis, Kostas A.

    2011-01-01

    aspects of the island systems that were not  considered  in variation across island systems.   However,  island  area system  under  study  is  highly  pre? dictable  from  the  pre?extinction  composition  of  communities,  with  island 

  20. Christina Martos Hilton

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D BGene NetworkNuclearDNP 2008 1 Neutrino InteractionsTopMartos

  1. Christina Martos Hilton

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits &BradburyMayARM-0501 MarineCenterChris Tracy About

  2. US Virgin Islands-Energy Development in Island Nations (EDIN...

    Open Energy Info (EERE)

    US Virgin Islands-Energy Development in Island Nations (EDIN) Pilot Project Jump to: navigation, search Logo: US Virgin Islands-Energy Development in Island Nations (EDIN) Pilot...

  3. Department Head Resource Portal

    E-Print Network [OSTI]

    Salvaggio, Carl

    1 Department Head Resource Portal CREATING DEPARTMENT GOALS A goal is a condition we envision;2 Department Head Resource Portal NO DO YOU HAVE IT? YES ffff Achieve Preserve Avoid Eliminate NO DO YOU HAVE

  4. Department Head Resource Portal

    E-Print Network [OSTI]

    Salvaggio, Carl

    1 Department Head Resource Portal NEW EMPLOYEE CHECKLIST New Staff Member Name: Department: Start Appearance expectations (e.g., business casual) #12;2 Department Head Resource Portal First Day Prep://myinfo.rit.edu (pay stub, benefits info, emergency contact, etc) Emergency exits #12;3 Department Head Resource Portal

  5. Island Energy Snapshots

    Office of Energy Efficiency and Renewable Energy (EERE)

    These energy snapshots highlight the energy landscape of islands in the Caribbean and the surrounding area.

  6. Pacific Island Energy Snapshots

    Broader source: Energy.gov [DOE]

    These energy snapshots highlight the energy landscape of islands in the Pacific and the surrounding area.

  7. Caribbean Island Energy Snapshots

    Office of Energy Efficiency and Renewable Energy (EERE)

    These energy snapshots highlight the energy landscape of islands in the Caribbean and the surrounding area.

  8. Bottom head assembly

    DOE Patents [OSTI]

    Fife, A.B.

    1998-09-01

    A bottom head dome assembly is described which includes, in one embodiment, a bottom head dome and a liner configured to be positioned proximate the bottom head dome. The bottom head dome has a plurality of openings extending there through. The liner also has a plurality of openings extending there through, and each liner opening aligns with a respective bottom head dome opening. A seal is formed, such as by welding, between the liner and the bottom head dome to resist entry of water between the liner and the bottom head dome at the edge of the liner. In the one embodiment, a plurality of stub tubes are secured to the liner. Each stub tube has a bore extending there through, and each stub tube bore is coaxially aligned with a respective liner opening. A seat portion is formed by each liner opening for receiving a portion of the respective stub tube. The assembly also includes a plurality of support shims positioned between the bottom head dome and the liner for supporting the liner. In one embodiment, each support shim includes a support stub having a bore there through, and each support stub bore aligns with a respective bottom head dome opening. 2 figs.

  9. Maneuvering impact boring head

    DOE Patents [OSTI]

    Zollinger, W.T.; Reutzel, E.W.

    1998-08-18

    An impact boring head may comprise a main body having an internal cavity with a front end and a rear end. A striker having a head end and a tail end is slidably mounted in the internal cavity of the main body so that the striker can be reciprocated between a forward position and an aft position in response to hydraulic pressure. A compressible gas contained in the internal cavity between the head end of the striker and the front end of the internal cavity returns the striker to the aft position upon removal of the hydraulic pressure. 8 figs.

  10. Maneuvering impact boring head

    DOE Patents [OSTI]

    Zollinger, W. Thor (Idaho Falls, ID); Reutzel, Edward W. (Idaho Falls, ID)

    1998-01-01

    An impact boring head may comprise a main body having an internal cavity with a front end and a rear end. A striker having a head end and a tail end is slidably mounted in the internal cavity of the main body so that the striker can be reciprocated between a forward position and an aft position in response to hydraulic pressure. A compressible gas contained in the internal cavity between the head end of the striker and the front end of the internal cavity returns the striker to the aft position upon removal of the hydraulic pressure.

  11. Island Energy Snapshots

    Broader source: Energy.gov [DOE]

    These energy snapshots highlight the energy landscape of islands in the Caribbean, the Pacific, and the surrounding area.

  12. Arctic ice islands

    SciTech Connect (OSTI)

    Sackinger, W.M.; Jeffries, M.O.; Lu, M.C.; Li, F.C.

    1988-01-01

    The development of offshore oil and gas resources in the Arctic waters of Alaska requires offshore structures which successfully resist the lateral forces due to moving, drifting ice. Ice islands are floating, a tabular icebergs, up to 60 meters thick, of solid ice throughout their thickness. The ice islands are thus regarded as the strongest ice features in the Arctic; fixed offshore structures which can directly withstand the impact of ice islands are possible but in some locations may be so expensive as to make oilfield development uneconomic. The resolution of the ice island problem requires two research steps: (1) calculation of the probability of interaction between an ice island and an offshore structure in a given region; and (2) if the probability if sufficiently large, then the study of possible interactions between ice island and structure, to discover mitigative measures to deal with the moving ice island. The ice island research conducted during the 1983-1988 interval, which is summarized in this report, was concerned with the first step. Monte Carlo simulations of ice island generation and movement suggest that ice island lifetimes range from 0 to 70 years, and that 85% of the lifetimes are less then 35 years. The simulation shows a mean value of 18 ice islands present at any time in the Arctic Ocean, with a 90% probability of less than 30 ice islands. At this time, approximately 34 ice islands are known, from observations, to exist in the Arctic Ocean, not including the 10-meter thick class of ice islands. Return interval plots from the simulation show that coastal zones of the Beaufort and Chukchi Seas, already leased for oil development, have ice island recurrences of 10 to 100 years. This implies that the ice island hazard must be considered thoroughly, and appropriate safety measures adopted, when offshore oil production plans are formulated for the Alaskan Arctic offshore. 132 refs., 161 figs., 17 tabs.

  13. Functional Heads and Interpretation 

    E-Print Network [OSTI]

    Adger, David

    on interpretation is a subsidiary concern.The argument of the thesis goes as follows: firstly, reference must be made to both an independently projecting functional head Agr and to a level of discourse representation in order to adequately analyse the phenomenon...

  14. Catalina Island Soapstone Manufacture

    E-Print Network [OSTI]

    Wlodarski, Robert J

    1979-01-01

    Catalina Island Soapstone Manufacture ROBERT J. WLODARSKIsome artifact of native manufacture. That stone is a "hard"Peabody Museum. Method and Manufacture of Several Articles

  15. Basaltic island sand provenance

    SciTech Connect (OSTI)

    Marsaglia, K.M. . Dept. of Geological Sciences)

    1992-01-01

    The Hawaiian Islands are an ideal location to study basaltic sand provenance in that they are a series of progressively older basaltic shield volcanoes with arid to humid microclimates. Sixty-two sand samples were collected from beaches on the islands of Hawaii, Maui, Oahu and Kauai and petrographically analyzed. The major sand components are calcareous bioclasts, volcanic lithic fragments, and monomineralic grains of dense minerals and plagioclase. Proportions of these components vary from island to island, with bioclastic end members being more prevalent on older islands exhibiting well-developed fringing reef systems and volcanic end members more prevalent on younger, volcanically active islands. Climatic variations across the island of Hawaii are reflected in the percentage of weathered detritus, which is greater on the wetter, northern side of the island. The groundmass of glassy, basaltic lithics is predominantly black tachylite, with lesser brown sideromelane; microlitic and lathwork textures are more common than holohyaline vitric textures. Other common basaltic volcanic lithic fragments are holocrystalline aggregates of silt-sized pyroxene or olivine, opaque minerals and plagioclase. Sands derived from alkalic lavas are texturally and compositionally indistinguishable from sands derived from tholeiitic lavas. Although Hawaiian basaltic sands overlap in composition with magmatic arc-derived sands in terms of their relative QFL, QmPK and LmLvLs percentages, they are dissimilar in that they lack felsic components and are more enriched in lathwork volcanic lithic fragments, holocrystalline volcanic lithic fragments, and dense minerals.

  16. Geohydrology of Enewetak Atoll islands and reefs

    SciTech Connect (OSTI)

    Buddemeier, R.W.

    1981-05-06

    Extensive tidal studies in island wells and the lagoon at Enewetak Atoll have shown that island ground water dynamics are controlled by a layered aquifer system. The surface aquifer of unconsolidated Holocene material extends to a depth of approximately 15 m, and has a hydraulic conductivity K = 60 m/day. From 15 to 60 m (approximate lagoon depth) the reef structure consists of successive layers of altered Pleistocene materials, with bulk permeability substantially higher than that of the surface aquifer. Because of wave set-up over the windward reef and the limited pass area for outflow at the south end of the atoll, lagoon tides rise in phase with the ocean tides but fall later than the ocean water level. This results in a net lagoon-to-ocean head which can act as the driving force for outflow through the permeable Pleistocene aquifer. This model suggests that fresh water, nutrients or radioactive contaminants found in island ground water or reef interstitial water may be discharged primarily into the ocean rather than the lagoon. Atoll island fresh water resources are controlled by recharge, seawater dilution due to vertical tidal mixing between the surface and deeper aquifers, and by loss due to entrainment by the outflowing water in the deeper aquifers. Estimated lagoon-ot-ocean transit times through the deep aquifer are on the order of a few years, which corresponds well to the freshwater residence time estimates based on inventory and recharge. Islands in close proximity to reef channels have more fresh ground water than others, which is consistent with a locally reduced hydraulic gradient and slower flow through the Pleistocene aquifers.

  17. Eddies as Offshore Foraging Grounds for Melon-headed Whales (Peponocephala electra)

    E-Print Network [OSTI]

    Hawai'i at Manoa, University of

    Eddies as Offshore Foraging Grounds for Melon- headed Whales (Peponocephala electra) Phoebe, NOAA 5School of Fisheries and Ocean Sciences, University of Alaska Fairbanks and Alaska SeaLife Center eddies occur frequently in the lee of the Hawaiian Islands ­ Formed and sustained by easterly trade winds

  18. Island Tools and Trainings

    Office of Energy Efficiency and Renewable Energy (EERE)

    Islands can use the tools below to gather data for decision makers and run scenarios on potential energy investments. Tailored trainings provide in-person, onsite guidance and best practices for implementing clean energy solutions.

  19. Island Wide Management Corporation

    Office of Legacy Management (LM)

    9 1986 Island Wide Management Corporation 3000 Marcus Avenue Lake Success, New York 11042 Dear Sir or Madam: I am sending you this letter and the enclosed information as you have...

  20. Reactor pressure vessel vented head

    DOE Patents [OSTI]

    Sawabe, J.K.

    1994-01-11

    A head for closing a nuclear reactor pressure vessel shell includes an arcuate dome having an integral head flange which includes a mating surface for sealingly mating with the shell upon assembly therewith. The head flange includes an internal passage extending therethrough with a first port being disposed on the head mating surface. A vent line includes a proximal end disposed in flow communication with the head internal passage, and a distal end disposed in flow communication with the inside of the dome for channeling a fluid therethrough. The vent line is fixedly joined to the dome and is carried therewith when the head is assembled to and disassembled from the shell. 6 figures.

  1. Urban Surfaces and Heat Island Mitigation Potentials

    E-Print Network [OSTI]

    Akbari, Hashem

    2008-01-01

    Finster. 2000. “The Urban Heat Island, Photochemical Smog,2001. “EPA/NASA Urban Heat Island Pilot Project,” GlobalSystem Urban Surfaces and Heat Island Mitigation Potentials

  2. book review: Everything changes – especially on islands

    E-Print Network [OSTI]

    Sfenthourakis, Spyros

    2012-01-01

    forth, affecting different island systems at varying rates.clever choice of islands as model systems for their theoryof insular systems around the globe, they select nine island

  3. A new golden era in island biogeography

    E-Print Network [OSTI]

    Fernandez-Palacios, Jose Maria; Kueffer, Christoph; Drake, Donald

    2015-01-01

    Insular woodiness on the Canary Islands: a remarkable caseevery five days in the Canary Islands (Martín Esquivel et

  4. PSEG Long Island- Net Metering

    Broader source: Energy.gov [DOE]

    Although PSEG Long Island’s net metering policy is not governed by the State’s net metering law, the provisions are similar to the State law. Net metering is available for residential, non-reside...

  5. Long Island Solar Farm

    SciTech Connect (OSTI)

    Anders, R.

    2013-05-01

    The Long Island Solar Farm (LISF) is a remarkable success story, whereby very different interest groups found a way to capitalize on unusual circumstances to develop a mutually beneficial source of renewable energy. The uniqueness of the circumstances that were necessary to develop the Long Island Solar Farm make it very difficult to replicate. The project is, however, an unparalleled resource for solar energy research, which will greatly inform large-scale PV solar development in the East. Lastly, the LISF is a superb model for the process by which the project developed and the innovation and leadership shown by the different players.

  6. GREEN HOMES LONG ISLAND

    E-Print Network [OSTI]

    Kammen, Daniel M.

    energy bill, reduce your carbon footprint... at little or no cost to you. #12;A Message From Supervisor energy-efficient and reduce our community's carbon footprint. Why do we call it Long Island Green Homes to yourevery day. By making basic improvements to yourevery day home, you can reduce your carbon footprint

  7. Assateague Island is Changing

    E-Print Network [OSTI]

    Boynton, Walter R.

    and longshore currents closing inlets over time, future breaches and new inlets are inevitable as sea level to shape and move Assateague Island. Former US Coast Guard Station Toms Cove Chincoteague Inlet Atlantic To reduce the National Seashore's carbon footprint and demonstrate the use of alternative energy, solar

  8. HARMONIC FUNCTIONS FOR SEA-SURFACE TEMPERATURES AND SALINITIES, KOKO HEAD, OAHU, 1956-69, AND SEA-SURFACE

    E-Print Network [OSTI]

    HARMONIC FUNCTIONS FOR SEA-SURFACE TEMPERATURES AND SALINITIES, KOKO HEAD, OAHU, 1956-69, AND SEA-SURFACE TEMPERATURES, CHRISTMAS ISLAND, 1954-69 GUNTHER It SECKEL' AND MARIAN Y. Y. YONG' ABSTRACT Harmonic functions, with daily sampling, are on average 0.07° C. Harmonic analysis spanning the entire sampling duration shows

  9. Heater head for stirling engine

    DOE Patents [OSTI]

    Corey, John A. (R.D. #2, Box 101 E, North Troy, NY 12182)

    1985-07-09

    A monolithic heater head assembly which augments cast fins with ceramic inserts which narrow the flow of combustion gas and obtains high thermal effectiveness with the assembly including an improved flange design which gives greater durability and reduced conduction loss.

  10. HeadLock: Wide-Range Head Pose Estimation for Low Resolution Video

    E-Print Network [OSTI]

    Roy, Deb

    HeadLock: Wide-Range Head Pose Estimation for Low Resolution Video Philip DeCamp B-Range Head Pose Estimation for Low Resolution Video by Philip DeCamp Submitted to the Program in Media Arts on data mining technologies to extract head pose information from low resolution video recordings. Head

  11. OROZCO et al.: HEAD POSE CLASSIFICATION IN CROWDED SCENES 1 Head Pose Classification in Crowded Scenes

    E-Print Network [OSTI]

    Gong, Shaogang

    attempts have been made on head pose estimation in low-resolution images by treating the problem as a multi for head pose classification given low resolution images. In their approach, 360 head pose in c 2009OROZCO et al.: HEAD POSE CLASSIFICATION IN CROWDED SCENES 1 Head Pose Classification in Crowded

  12. WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Thompson Island June 1, 2003 ­ August 31, 2003 Prepared for Massachusetts...................................................................................................................... 9 Wind Speed Time Series............................................................................................................. 9 Wind Speed Distribution

  13. WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Thompson Island December 1, 2003 ­ February 29, 2004 Prepared for Massachusetts.................................................................................................................... 11 Wind Speed Time Series........................................................................................................... 11 Wind Speed Distribution

  14. WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Thompson Island March 1, 2003 ­ May 31, 2003 Prepared for Massachusetts Technology...................................................................................................................... 9 Wind Speed Time Series............................................................................................................. 9 Wind Speed Distributions

  15. WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Thompson Island September 1, 2003 ­ November 30, 2003 Prepared for Massachusetts...................................................................................................................... 9 Wind Speed Time Series............................................................................................................. 9 Wind Speed Distribution

  16. WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Thompson Island March 1, 2004 ­ May 31, 2004 Prepared for Massachusetts Technology...................................................................................................................... 9 Wind Speed Time Series............................................................................................................. 9 Wind Speed Distribution

  17. WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Thompson Island June 1, 2004 ­ August 31, 2004 Prepared for Massachusetts...................................................................................................................... 9 Wind Speed Time Series............................................................................................................. 9 Wind Speed Distribution

  18. Minnesota Nuclear Profile - Prairie Island

    U.S. Energy Information Administration (EIA) Indexed Site

    Prairie Island" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...

  19. Rotating head and piston engine

    SciTech Connect (OSTI)

    Gomm, T.J.; Messick, N.C.

    1992-07-21

    This patent describes a rotary piston combustion engine. It comprises a housing means, an engine block housing a single toroidal bore, a piston carrier ring spaced outwardly along the entire perimeter of the toroidal bore with at least one finger extending inwardly for piston attachment, a power transfer cylinder, a power output shaft, an auxiliary shaft with driven gearing means meshing with the driving gearing means, a rotating head with windows for piston passage, a trapezoidal porting means in the engine block and in the rotating head, an exhaust port means.

  20. The BWR lower head response during a large-break LOCA with core damage

    SciTech Connect (OSTI)

    Alammar, M.A. [GPU Nuclear Corp., Parsippany, NJ (United States)

    1996-12-31

    Some of the important issues in severe accident management guidelines development deal with estimating the time to lower head vessel failure after core damage and the time window available for water injection that would prevent vessel failure. These issues are obviously scenario dependent, but bounding estimates are needed. The scenario chosen for this purpose was a design-basis accident (DBA) loss-of-coolant accident (LOCA) because it was one of the contributors to the Oyster Creek containment failure frequency. Oyster Creek is a 1930-MW(thermal) boiling water reactor (BWR)-2. The lower head response models have improved since the Three Mile Island unit 2 (TMI-2) vessel investigation project (VIP) results became known, specifically the addition of rapid- and slow-cooling models. These mechanisms were found to have taken place in the TMI-2 lower head during debris cooldown and were important contributors in preventing vessel failure.

  1. Bainbridge Island Data Dashboard | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    The data dashboard for Bainbridge Island, a partner in the U.S. Department of Energy's Better Buildings Neighborhood Program. Bainbridge Island Data Dashboard More Documents &...

  2. Geology and geochemistry of the Geyser Bight Geothermal Area, Umnak Island, Aleutian Islands, Alaska

    SciTech Connect (OSTI)

    Nye, C.J. (Alaska Univ., Fairbanks, AK (USA). Geophysical Inst. Alaska Dept. of Natural Resources, Fairbanks, AK (USA). Div. of Geological and Geophysical Surveys); Motyka, R.J. (Alaska Dept. of Natural Resources, Juneau, AK (USA). Div. of Geological and Geophysical Surveys); Turner, D.L. (Alaska Univ., Fairbanks, AK (USA). Geophysical Inst.); Liss, S.A. (Alaska Dept. of Natural Resources, Fairba

    1990-10-01

    The Geyser Bight geothermal area is located on Umnak Island in the central Aleutian Islands. It contains one of the hottest and most extensive areas of thermal springs and fumaroles in Alaska, and is only documented site in Alaska with geysers. The zone of hot springs and fumaroles lies at the head of Geyser Creek, 5 km up a broad, flat, alluvial valley from Geyser Bight. At present central Umnak is remote and undeveloped. This report describes results of a combined program of geologic mapping, K-Ar dating, detailed description of hot springs, petrology and geochemistry of volcanic and plutonic rock units, and chemistry of geothermal fluids. Our mapping documents the presence of plutonic rock much closer to the area of hotsprings and fumaroles than previously known, thus increasing the probability that plutonic rock may host the geothermal system. K-Ar dating of 23 samples provides a time framework for the eruptive history of volcanic rocks as well as a plutonic cooling age.

  3. Issues in Scalable Island Multicast

    E-Print Network [OSTI]

    Chan, Shueng-Han Gary

    Systems The Scalable Island Multicast protocol integrates Internet Protocol multicast and overlay deliveryDeployment Issues in Scalable Island Multicast for Peer-to-Peer Streaming Xing Jin Oracle USA Ho an important Inter- net application. In a P2P-streaming system, co- operative peers organize into an overlay

  4. Enjebi Island dose assessment

    SciTech Connect (OSTI)

    Robison, W.L.; Conrado, C.L.; Phillips, W.A.

    1987-07-01

    We have updeated the radiological dose assessment for Enjebi Island at Enewetak Atoll using data derived from analysis of food crops grown on Enjebi. This is a much more precise assessment of potential doses to people resettling Enjebi Island than the 1980 assessment in which there were no data available from food crops on Enjebi. Details of the methods and data used to evaluate each exposure pathway are presented. The terrestrial food chain is the most significant potential exposure pathway and /sup 137/Cs is the radionuclide responsible for most of the estimated dose over the next 50 y. The doses are calculated assuming a resettlement date of 1990. The average wholebody maximum annual estimated dose equivalent derived using our diet model is 166 mremy;the effective dose equivalent is 169 mremy. The estimated 30-, 50-, and 70-y integral whole-body dose equivalents are 3.5 rem, 5.1 rem, and 6.2 rem, respectively. Bone-marrow dose equivalents are only slightly higher than the whole-body estimates in each case. The bone-surface cells (endosteal cells) receive the highest dose, but they are a less sensitive cell population and are less sensitive to fatal cancer induction than whole body and bone marrow. The effective dose equivalents for 30, 50, and 70 y are 3.6 rem, 5.3 rem, and 6.6 rem, respectively. 79 refs., 17 figs., 24 tabs

  5. Zeroth-order inversion of transient head observations

    E-Print Network [OSTI]

    Vasco, D.W.

    2008-01-01

    Conversely, low-frequency variations in head, such as asensitivities al­ low one to invert transient head waveformswhich utilize low frequency information, such as static head

  6. Analyzing pulse from head motions in video

    E-Print Network [OSTI]

    Balakrishnan, Guha

    2014-01-01

    We extract heart rate and beat lengths from videos by measuring subtle head oscillations that accompany the cardiac cycle. Our method tracks features on the head, temporally filters their trajectories and performs principal ...

  7. Automatic Head Motion Prediction from Speech Data 

    E-Print Network [OSTI]

    Hofer, Gregor; Shimodaira, Hiroshi

    2007-01-01

    In this paper we present a novel approach to generate a sequence of head motion units given some speech. The modelling approach is based on the notion that head motion can be divided into a number of short homogeneous ...

  8. Sealed head access area enclosure

    DOE Patents [OSTI]

    Golden, Martin P. (Trafford, PA); Govi, Aldo R. (Greensburg, PA)

    1978-01-01

    A liquid-metal-cooled fast breeder power reactor is provided with a sealed head access area enclosure disposed above the reactor vessel head consisting of a plurality of prefabricated structural panels including a center panel removably sealed into position with inflatable seals, and outer panels sealed into position with semipermanent sealant joints. The sealant joints are located in the joint between the edge of the panels and the reactor containment structure and include from bottom to top an inverted U-shaped strip, a lower layer of a room temperature vulcanizing material, a separator strip defining a test space therewithin, and an upper layer of a room temperature vulcanizing material. The test space is tapped by a normally plugged passage extending to the top of the enclosure for testing the seal or introducing a buffer gas thereinto.

  9. Two-fluid magnetic island dynamics in slab geometry: Determination of the island phase velocity

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    into helical magnetic islands. Such islands de- grade plasma confinement because heat and particles are ableTwo-fluid magnetic island dynamics in slab geometry: Determination of the island phase velocity R Phys. Plasmas 12, 122308 (2005); 10.1063/1.2141928 Two-fluid magnetic island dynamics in slab geometry

  10. EIS-0006: Wind Turbine Generator System, Block Island, Rhode Island

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy prepared this EIS to evaluate the environmental impacts of installing and operating a large experimental wind turbine, designated the MOD-OA, which is proposed to be installed on a knoll in Rhode Island's New Meadow Hill Swamp, integrated with the adjacent Block Island Power Company power plant and operated to supply electricity to the existing utility network.

  11. No Company Is An Island 

    E-Print Network [OSTI]

    Maddox, A.

    1989-01-01

    No company is an island. Utilities and their industrial customers are discovering that collaboration can breed opportunity while isolation can lead to ruin. Inter company relationships have changed over recent years and HL&P and its customers...

  12. The macroecology of island floras

    E-Print Network [OSTI]

    Weigelt, Patrick

    2015-01-01

    Ecology, 58, 445-449. Cabral, J.S. , Weigelt, P. , Kissling,among their islands (?) (Cabral et al. 2014). My colleagues?-diversity of vascular plants (Cabral et al. 2014). In the

  13. Sustaining Sherman Island: A Water Management and Agricultural Diversification System

    E-Print Network [OSTI]

    Fischer, Richard

    2011-01-01

    system for Sherman Island and any Delta system must considera Saltwater Barrier System at Sherman Island. ” May 8. Deltagrown on Sherman Island with this system: artichokes,

  14. HeadLock : wide-range head pose estimation for low resolution video

    E-Print Network [OSTI]

    DeCamp, Philip (Philip James)

    2008-01-01

    This thesis focuses on data mining technologies to extract head pose information from low resolution video recordings. Head pose, as an approximation of gaze direction, is a key indicator of human behavior and interaction. ...

  15. Hilton Alexandria Mark Center Shuttle Schedule

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and our last departure from the hotel is 10:30 pm, to Pentagon City MallMetro (on the blue and yellow line) and Ronald Reagan Washington National Airport The van arrives at...

  16. Geothermal Direct Use Technology & Marketplace Hilton Garden...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (Paul Brophy) 12:00-1:30 p.m. Luncheon and Presentation on Geothermal Experience in Iceland 1:30 p.m. - Geothermal Marketplace (in the Eastern U.S.) Discussion Lead - Jay Egg,...

  17. Alexandria Hilton Shuttle Schedule | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A sCOLONYDepartmentand Staff EngagementHAMC Shuttle

  18. Energy Department Helps Advance Island Clean Energy Goals (Fact...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department Helps Advance Island Clean Energy Goals U.S. Virgin Islands Signs Solar Deal Worth 65 Million Like many islands around the world, the U.S. Virgin Islands (USVI) is...

  19. Deferred Imitation of Human Head Movements by an Active Stereo Vision Head

    E-Print Network [OSTI]

    Demiris, Yiannis

    Deferred Imitation of Human Head Movements by an Active Stereo Vision Head J. Demiriszy, S the possibilities for efficient social learning through observation and imitation, is chal­ lenging since on the deferred imitation of human head movements. 1 Introduction Robots of the near future are expected

  20. Offshore Wind Turbines - Estimated Noise from Offshore Wind Turbine, Monhegan Island, Maine: Environmental Effects of Offshore Wind Energy Development

    SciTech Connect (OSTI)

    Aker, Pamela M.; Jones, Anthony M.; Copping, Andrea E.

    2010-11-23

    Deep C Wind, a consortium headed by the University of Maine will test the first U.S. offshore wind platforms in 2012. In advance of final siting and permitting of the test turbines off Monhegan Island, residents of the island off Maine require reassurance that the noise levels from the test turbines will not disturb them. Pacific Northwest National Laboratory, at the request of the University of Maine, and with the support of the U.S. Department of Energy Wind Program, modeled the acoustic output of the planned test turbines.

  1. REAP Islanded Grid Wind Power Conference

    Broader source: Energy.gov [DOE]

    Hosted by Renewable Energy Alaska Project, this three-day conference will show attendees how to learn, network, and share information on wind systems in island and islanded grid environments through expert panel discussions, stakeholder dialogue, and training.

  2. REAP Islanded Grid Wind Power Conference

    Broader source: Energy.gov [DOE]

    Hosted by Renewable Energy Alaska Project, this three-day conference will show attendees how to learn, network, and share information on wind systems in island and islanded grid environments...

  3. Market Update: New England Islanded Grids

    Office of Energy Efficiency and Renewable Energy (EERE)

    Join the Islanded Grid Resource Center (IGRC) for our upcoming webinar highlighting the islanded grid communities along the New England coast that are exploring their options for reducing high...

  4. Mass Wasting in the Western Galapagos Islands 

    E-Print Network [OSTI]

    Hall, Hillary

    2012-10-19

    Oceanic island volcanoes such as those in the Hawaiian, Canary and Galapagos Islands are known to become unstable, causing failures of the subaerial and submarine slopes of the volcanic edifices. These mass wasting events appear to be the primary...

  5. Small island biogeography in the Gulf of California: lizards, the subsidized island

    E-Print Network [OSTI]

    Wait, D. Alexander

    Small island biogeography in the Gulf of California: lizards, the subsidized island biogeography the subsidized island biogeography (SIB) hypothesis, which predicts that spatial subsidies may cause insular. Methods To evaluate the SIB hypothesis, we first identified subsidized and unsubsidized islands based

  6. A household carbon footprint calculator for islands: Case study of the United States Virgin Islands

    E-Print Network [OSTI]

    Kammen, Daniel M.

    Survey A household carbon footprint calculator for islands: Case study of the United States Virgin xxxx Keywords: Carbon footprint Green house gas emissions Small Island Developing States Island regions the carbon footprint of typical households within the US Virgin Islands. We find the average carbon footprint

  7. Energy Transition Initiative: Island Energy Snapshot - U.S. Virgin Islands (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-03-01

    This profile provides a snapshot of the energy landscape of the U.S. Virgin Islands (USVI) - St. Thomas, St. John, and St. Croix. The Virgin Islands archipelago makes up the northern portion of the Lesser Antilles and the western island group of the Leeward Islands, forming the border between the Atlantic Ocean and the Caribbean Sea.

  8. Research Report Head Up, Foot Down

    E-Print Network [OSTI]

    Barsalou, Lawrence W.

    Research Report Head Up, Foot Down Object Words Orient Attention to the Objects' Typical Location, and object words encode these spatial associa- tions. We tested whether such object words (e.g., head, foot denoting low objects hindered target iden- tification at the bottom of the display. Thus, object words

  9. Islands and Our Renewable Energy Future (Presentation)

    SciTech Connect (OSTI)

    Baring-Gould, I.; Gevorgian, V.; Kelley, K.; Conrad, M.

    2012-05-01

    Only US Laboratory Dedicated Solely to Energy Efficiency and Renewable Energy. High Contribution Renewables in Islanded Power Systems.

  10. ANNUAL FISH PASSAGE REPORT ROCK ISLAND DAM

    E-Print Network [OSTI]

    42) ANNUAL FISH PASSAGE REPORT ROCK ISLAND DAM COLUMBIA RIVER, WASHINGTON 1961 Marine Biological. McKeman, Director ANNUAL FISH PASSAGE REPORT - ROCK ISLAND DAM COLUMBIA RIVER, WASHINGTON, 1961--Fisheries No. 421 Washington, D. C. April 1962 #12;Rock Island Dam, Columbia River, Washington ii #12;CONTENTS

  11. ANNUAL FISH PASSAGE REPORT ROCK ISLAND DAM

    E-Print Network [OSTI]

    ANNUAL FISH PASSAGE REPORT ROCK ISLAND DAM COLUMBIA RIVER, WASHINGTON, 1959 :y .iiJA/i-3ri ^' WUUUi. ANNUAL FISH PASSAGE REPORT - ROCK ISLAND DAM COLUMBIA RIVER, WASHINGTON, 1959 by Paul D. Zimmer, Clifton and observations 10 Summary 13 #12;#12;ANNUAL FISH PASSAGE REPORT - ROCK ISLAND DAM COLUMBIA RIVER, WASHINGTON

  12. ANNUAL FISH PASSAGE REPORT ROCK ISLAND DAM

    E-Print Network [OSTI]

    ANNUAL FISH PASSAGE REPORT ROCK ISLAND DAM COLUMBIA RIVER, WASHINGTON 1960 . SPECIAL SCIENTIFIC ISLAND DAM COLUMBIA RIVER, WASHINGTON, 1960 by Paul D. Zimmer and Clifton C. Davidson United States Fish This annual report of fishway operations at Rock Island Dam in 1960 is dedicated to the memory of co

  13. Annual Fish Passage Report -Rock Island Dam

    E-Print Network [OSTI]

    Annual Fish Passage Report - Rock Island Dam Columbia River, Washington, 1965 By Paul D. Zimmer L. McKeman, Director Annual Fish Passage Report - Rock Island Dam Columbia River, Washington, 1965;#12;Annual Fish Passage Report - Rock Island Dam Columbia River, Washington, 1965 By PAUL D. ZIMMER, Fishery

  14. Marine Bird Ecology & Conservation: The Farallon Islands

    E-Print Network [OSTI]

    Brown, Sally

    11/19/2014 1 Marine Bird Ecology & Conservation: The Farallon Islands Example Some Historical;11/19/2014 2 Charadriformes: gulls, terns Anseriformes: marine ducks, geese and swans Other birds Location of island Distant photo of island #12;11/19/2014 3 Western Gull The gull colony on the marine terrace

  15. Two-fluid magnetic island dynamics in slab geometry. II. Islands interacting with resistive walls or resonant magnetic perturbations

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    magnetic islands. Such islands degrade plasma confinement because heat and particles are able to travelTwo-fluid magnetic island dynamics in slab geometry. II. Islands interacting with resistive walls-fluid magnetic island dynamics in slab geometry: Determination of the island phase velocity Phys. Plasmas 12

  16. Two-fluid magnetic island dynamics in slab geometry. I. Isolated islands Richard Fitzpatrick and Franois L. Waelbroeck

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    magnetic islands. Such islands degrade plasma confinement because heat and particles are able to travelTwo-fluid magnetic island dynamics in slab geometry. I. Isolated islands Richard Fitzpatrick.1063/1.4863498 Two-fluid magnetic island dynamics in slab geometry: Determination of the island phase velocity Phys

  17. A novel active heads-up display for driver assistance.

    E-Print Network [OSTI]

    Doshi, Anup; Cheng, Shinko Yuanhsien; Trivedi, Mohan Manubhai

    2009-01-01

    and P. Green, “The effect of HUD warning location on driverComparison of head-up display (HUD) vs. head-down display (also use heads-up displays (HUDs) to convey information to

  18. Numerical and experimental investigations of the head/disk interface

    E-Print Network [OSTI]

    Duwensee, Maik

    2007-01-01

    Flying Head Slider Bearings in Magnetic Hard Disk Drives.for Flying Head Slider Bearings in Magnetic Storage. ASME J.Warner et al. Magnetic Head Air Bearing Slider. U.S. Patent

  19. Bear Head LNG Corporation and Bear Head LNG (USA), LLC- FE Dkt No. 15-14-NG

    Broader source: Energy.gov [DOE]

    On January 23, 2015, Bear Head LNG Corporation and Bear Head LNG (USA), LLC (together, “Bear Head LNG”), filed an application for long-term, multi-contract authorization to engage in imports from,...

  20. Magnetic island evolution in hot ion plasmas

    SciTech Connect (OSTI)

    Ishizawa, A.; Nakajima, N.; Waelbroeck, F. L.; Fitzpatrick, R.; Horton, W.

    2012-07-15

    Effects of finite ion temperature on magnetic island evolution are studied by means of numerical simulations of a reduced set of two-fluid equations which include ion as well as electron diamagnetism in slab geometry. The polarization current is found to be almost an order of magnitude larger in hot than in cold ion plasmas, due to the strong shear of ion velocity around the separatrix of the magnetic islands. As a function of the island width, the propagation speed decreases from the electron drift velocity (for islands thinner than the Larmor radius) to values close to the guiding-center velocity (for islands of order 10 times the Larmor radius). In the latter regime, the polarization current is destabilizing (i.e., it drives magnetic island growth). This is in contrast to cold ion plasmas, where the polarization current is generally found to have a healing effect on freely propagating magnetic island.

  1. Cooling Boiling in Head Region - PACCAR Integrated Underhood...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Cooling Boiling in Head Region - PACCAR Integrated Underhood Thermal and External Aerodynamics- Cummins Cooling Boiling in Head Region - PACCAR Integrated Underhood Thermal and...

  2. Nanotechnology in Head and Neck Cancer: The Race Is On

    E-Print Network [OSTI]

    El-Sayed, Ivan H.

    2010-01-01

    10.1007/s11912-010-0087-2 Nanotechnology in Head and Neckthe applications of nanotechnology in head and neck cancer,plasmonic gold nanotechnology. Keywords Nanotechnology .

  3. Srinivasan Named Head of NERSC's Computational Systems Group

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Srinivasan Named Head of NERSC's Computational Systems Group Srinivasan Named Head of NERSC's Computational Systems Group August 31, 2011 | Tags: NERSC Jay Srinivasan has been...

  4. Laboratory Demonstration of a New American Low-Head Hydropower...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Laboratory Demonstration of a New American Low-Head Hydropower Turbine Laboratory Demonstration of a New American Low-Head Hydropower Turbine Laboratory Demonstration of a New...

  5. Los Alamos names new head of stockpile manufacturing and support

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New head of stockpile manufacturing and support Los Alamos names new head of stockpile manufacturing and support Carl Beard is the new associate director for stockpile...

  6. KU alumna to head Spencer Research Library

    E-Print Network [OSTI]

    2009-06-18

    12/5/13 KU alumna to head Spencer Research Library www.lib.ku.edu/news/spencer_head_announced.shtml 1/2 The University of Kansas Libraries Libraries Home Articles & Databases Catalog: books & more E-journals Research by Subject Course Reserves... Library Pages A-Z Images KU ScholarWorks KU Digital Collections Hours My Account Request Articles, Books,… Friends & Benefactors Suggestions University of Kansas alumna Beth M. Whittaker will become the next head of KU’s Kenneth Spencer Research Library...

  7. Heater head for a Stirling engine

    SciTech Connect (OSTI)

    Darooka, D.K.

    1988-09-06

    A heater head is described for a compound Stirling engine modules, each including a displacer cylinder coaxially aligned with the displacer cylinder of the other of the engine modules, a displacer piston mounted for reciprocation in the displacer cylinder.

  8. Head & base production optimization : setup time reduction

    E-Print Network [OSTI]

    Guo, Haiqing

    2009-01-01

    At Schlumberger, the make-to-order strategy and number of Head & Base product types (about 1000 types) requires a flexible manufacturing system in which the machine setup is frequent. However, the lengthy CNC machine setup ...

  9. Vacuum compatible miniature CCD camera head

    DOE Patents [OSTI]

    Conder, Alan D. (Tracy, CA)

    2000-01-01

    A charge-coupled device (CCD) camera head which can replace film for digital imaging of visible light, ultraviolet radiation, and soft to penetrating x-rays, such as within a target chamber where laser produced plasmas are studied. The camera head is small, capable of operating both in and out of a vacuum environment, and is versatile. The CCD camera head uses PC boards with an internal heat sink connected to the chassis for heat dissipation, which allows for close(0.04" for example) stacking of the PC boards. Integration of this CCD camera head into existing instrumentation provides a substantial enhancement of diagnostic capabilities for studying high energy density plasmas, for a variety of military industrial, and medical imaging applications.

  10. update: The (often ignored) role of vicariance in evolutionary diversification on oceanic islands

    E-Print Network [OSTI]

    Parent, Christine E.

    2012-01-01

    simplicity  of  island systems, the study of their specific  to  island  systems,  the  evolu? tionary history of  islands  and  island? like  systems  for  studying 

  11. Pathogenicity island mobility and gene content.

    SciTech Connect (OSTI)

    Williams, Kelly Porter

    2013-10-01

    Key goals towards national biosecurity include methods for analyzing pathogens, predicting their emergence, and developing countermeasures. These goals are served by studying bacterial genes that promote pathogenicity and the pathogenicity islands that mobilize them. Cyberinfrastructure promoting an island database advances this field and enables deeper bioinformatic analysis that may identify novel pathogenicity genes. New automated methods and rich visualizations were developed for identifying pathogenicity islands, based on the principle that islands occur sporadically among closely related strains. The chromosomally-ordered pan-genome organizes all genes from a clade of strains; gaps in this visualization indicate islands, and decorations of the gene matrix facilitate exploration of island gene functions. A %E2%80%9Clearned phyloblocks%E2%80%9D method was developed for automated island identification, that trains on the phylogenetic patterns of islands identified by other methods. Learned phyloblocks better defined termini of previously identified islands in multidrug-resistant Klebsiella pneumoniae ATCC BAA-2146, and found its only antibiotic resistance island.

  12. Electro-optic voltage sensor head

    DOE Patents [OSTI]

    Crawford, T.M.; Davidson, J.R.; Woods, G.K.

    1999-08-17

    The invention is an electro-optic voltage sensor head designed for integration with existing types of high voltage transmission and distribution apparatus. The sensor head contains a transducer, which comprises a transducing material in which the Pockels electro-optic effect is observed. In the practice of the invention at least one beam of electromagnetic radiation is routed into the transducing material of the transducer in the sensor head. The beam undergoes an electro-optic effect in the sensor head when the transducing material is subjected to an E-field. The electro-optic effect is observed as a differential phase a shift, also called differential phase modulation, of the beam components in orthogonal planes of the electromagnetic radiation. In the preferred embodiment the beam is routed through the transducer along an initial axis and then reflected by a retro-reflector back substantially parallel to the initial axis, making a double pass through the transducer for increased measurement sensitivity. The preferred embodiment of the sensor head also includes a polarization state rotator and at least one beam splitter for orienting the beam along major and minor axes and for splitting the beam components into two signals which are independent converse amplitude-modulated signals carrying E-field magnitude and hence voltage information from the sensor head by way of optic fibers. 6 figs.

  13. Cruise the CANARY ISLAND CELEBRATION DAY BY DAY ITINERARY

    E-Print Network [OSTI]

    Toronto, University of

    Cruise the CANARY ISLAND CELEBRATION DAY BY DAY ITINERARY: Day 1 ~ Depart for Rome, Italy Day 10 ~ Arrecife, Canary Islands Day 11 ~ Santa Cruz de Tenerife, Canary Islands Day 12 ~ Madeira and Casablanca, Morocco; Arrecife and Santa Cruz de Tenerife, Canary Islands; and Funchal, Madeira Island

  14. A signature for turbulence driven magnetic islands

    SciTech Connect (OSTI)

    Agullo, O.; Muraglia, M.; Benkadda, S. [Aix-Marseille Université, CNRS, PIIM, UMR 7345 Marseille (France); France-Japan Magnetic Fusion Laboratory, LIA 336 CNRS, Marseille (France); Poyé, A. [Univ. Bordeaux, CNRS, CEA, CELIA (Centre Lasers Intenses et Applications), UMR 5107, F-33405 Talence (France); Yagi, M. [Plasma Theory and Simulation Gr., JAEA, Rokkasho (Japan); Garbet, X. [IRFM, CEA, St-Paul-Lez-Durance 13108 (France); Sen, A. [Institute for Plasma Research, Bhat, Gandhinagar 382428 (India)

    2014-09-15

    We investigate the properties of magnetic islands arising from tearing instabilities that are driven by an interchange turbulence. We find that such islands possess a specific signature that permits an identification of their origin. We demonstrate that the persistence of a small scale turbulence maintains a mean pressure profile, whose characteristics makes it possible to discriminate between turbulence driven islands from those arising due to an unfavourable plasma current density gradient. We also find that the island poloidal turnover time, in the steady state, is independent of the levels of the interchange and tearing energy sources. Finally, we show that a mixing length approach is adequate to make theoretical predictions concerning island flattening in the island rotation frame.

  15. Energy Transition Initiative, Island Energy Snapshot - British Virgin Islands (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-03-01

    This profile provides a snapshot of the energy landscape of the British Virgin Islands (BVI), one of three sets of the Virgin Island territories in an archipelago making up the northern portion of the Lesser Antilles.

  16. San Miguel Island, Channel Islands National Park, California | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing Tool FitsProjectData Dashboard RutlandSTEAB's PrioritiesFuelof Energy Miguel Island,

  17. ANNUAL WIND DATA REPORT Thompson Island

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    ANNUAL WIND DATA REPORT Thompson Island March 1, 2002 ­ February 28, 2003 Prepared.................................................................................................................... 11 Wind Speed Time Series........................................................................................................... 11 Wind Speed Distributions

  18. WIND DATA REPORT Deer Island Outfall

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Deer Island Outfall August 18, 2003 ­ December 4, 2003 Prepared for Massachusetts...................................................................................................................... 7 Wind Speed Time Series............................................................................................................. 7 Wind Speed Distributions

  19. WIND DATA REPORT Deer Island Parking Lot

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Deer Island Parking Lot May 1, 2003 ­ July 15, 2003 Prepared for Massachusetts...................................................................................................................... 7 Wind Speed Time Series............................................................................................................. 7 Wind Speed Distributions

  20. Lessons Learned in Islands | Department of Energy

    Energy Savers [EERE]

    Learn how Barbados successfully overcame market barriers to widespread implementation of solar water heaters. U.S. Virgin Islands Clears the Way for Unprecedented Levels of Solar...

  1. Island Tools and Trainings | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    potential energy investments. Tailored trainings provide in-person, onsite guidance and best practices for implementing clean energy solutions. Tools Island Energy Scenario Tool...

  2. Coastal mesoscale changes on Matagorda Island 

    E-Print Network [OSTI]

    Lariscy, Kevin William

    2001-01-01

    and the dune systems. The data indicates that Matagorda Island is currently experiencing a net aggradational phase, as part of a geomorphic system undergoing dynamic equilibrium....

  3. Pennsylvania Nuclear Profile - Three Mile Island

    U.S. Energy Information Administration (EIA) Indexed Site

    Three Mile Island" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...

  4. Nauru Island Effect Detection Data Set

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Long, Chuck

    2010-07-15

    During Nauru99 it was noted that the island was producing small clouds that advected over the ARM site. The Nauru Island Effect Study was run for 1.5 years and the methodology developed to detect the occurrence. Nauru ACRF downwelling SW, wind direction, and air temperature data are used, along with downwelling SW data from Licor radiometers located on the southern end of the island near the airport landing strip. A statistical analysis and comparison of data from the two locations is used to detect the likely occurrence of an island influence on the Nauru ACRF site data

  5. Nauru Island Effect Detection Data Set

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Long, Chuck

    During Nauru99 it was noted that the island was producing small clouds that advected over the ARM site. The Nauru Island Effect Study was run for 1.5 years and the methodology developed to detect the occurrence. Nauru ACRF downwelling SW, wind direction, and air temperature data are used, along with downwelling SW data from Licor radiometers located on the southern end of the island near the airport landing strip. A statistical analysis and comparison of data from the two locations is used to detect the likely occurrence of an island influence on the Nauru ACRF site data

  6. Climate change: Effects on reef island resources

    SciTech Connect (OSTI)

    Oberdorfer, J.A.; Buddemeier, R.W.

    1988-06-27

    The salinity, depth, quantity, and reliability of fresh groundwater resources on coral reef islands and coastlines are environmentally important parameters. Groundwater influences or controls the terrestrial flora, salinity, and nutrient levels in the near-shore benthic environment, the rate and nature of sediment diagenesis, and the density of human habitation. Data from a number of Indo-Pacific reef islands suggest that freshwater inventory is a function of rainfall and island dimensions. A numerical model (SUTRA) has been used to simulate the responses of atoll island groundwater to changes in recharge (precipitation), sea level, and loss of island area due to flooding. The model has been calibrated for Enjebi Island, Enewetak Atoll, where a moderately permeable, water-table aquifer overlies a high-permeability formation. Total freshwater inventory is a monotonic but nonlinear function of recharge. If recharge and island area are constant, rising sea level increases the inventory of fresh water by increasing the useful volume of the aquifer above the high-permeability zone. Flooding of land area reduces the total freshwater inventory approximately in proportion to the loss of recharge area. The most significant results of the model simulation, however, are the findings that the inventory of low-salinity water (and by extrapolation, potable water) is disproportionately sensitive to changes in recharge, island dimensions, or recharge. Island freshwater resources may therefore be unexpectedly vulnerable to climate change.

  7. ZABULIS et al.: 3D HEAD POSE ESTIMATION FROM MULTIPLE DISTANT VIEWS 1 3D head pose estimation from multiple

    E-Print Network [OSTI]

    Zabulis, Xenophon

    imaging, despite the low-resolution appearance of subjects. 1 Introduction 3D head pose estimation. In such situations, a human head is imaged in relatively low resolution, illumination artifacts are frequentZABULIS et al.: 3D HEAD POSE ESTIMATION FROM MULTIPLE DISTANT VIEWS 1 3D head pose estimation from

  8. Peer review of the Three Mile Island Unit 2 Vessel Investigation Project metallurgical examinations

    SciTech Connect (OSTI)

    Bohl, R.W.; Gaydos, R.G.; Vander Voort, G.F.; Diercks, D.R. [Argonne National Lab., IL (United States)

    1994-07-01

    Fifteen samples recovered from the lower head of the Three Mile Island (TMI) Unit 2 nuclear reactor pressure vessel were subjected to detailed metallurgical examinations by the Idaho National Engineering Laboratory (INEL), with supporting work carried out by Argonne National Laboratory (ANL) and several of the European participants. These examinations determined that a portion of the lower head, a so-called elliptical ``hot spot`` measuring {approx}0.8 {times} 1 m, reached temperatures as high as 1100{degrees}C during the accident and cooled from these temperatures at {approx}10--100{degrees}C/min. The remainder of the lower head was found to have remained below the ferrite-toaustenite transformation temperature of 727{degrees}C during the accident. Because of the significance of these results and their importance to the overall analysis of the TMI accident, a panel of three outside peer reviewers, Dr. Robert W. Bohl, Mr. Richard G. Gaydos, and Mr. George F. Vander Voort, was formed to conduct an independent review of the metallurgical analyses. After a thorough review of the previous analyses and examination of photo-micrographs and actual lower head specimens, the panel determined that the conclusions resulting from the INEL study were fundamentally correct. In particular, the panel reaffirmed that four lower head samples attained temperatures as high as 1100{degrees}C, and perhaps as high as 1150--1200{degrees}C in one case, during the accident. They concluded that these samples subsequently cooled at a rate of {approx}50--125{degrees}C/min in the temperature range of 600--400{degrees}C, in good agreement with the original analysis. The reviewers also agreed that the remainder of the lower head samples had not exceeded the ferrite-to-austenite transformation temperature during the accident and suggested several refinements and alternative procedures that could have been employed in the original analysis.

  9. Most Workers Who Suffer Head Injuries- Were Not Wearing Head Protection

    Broader source: Energy.gov [DOE]

    A survey by the U.S. Department of Labor’s Bureau of Labor Statistics (BLS) of accidents and injuries noted that most workers who suffered impact injuries to the head were not wearing head protection. In addition, the same survey showed that the majority of workers were injured while performing their normal jobs at their regular worksites.

  10. Training and Certification of Lock Operators IMTS Heads-up Paper Heads-up Paper

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Training and Certification of Lock Operators IMTS Heads-up Paper 1 Heads-up Paper Training called "Training and Certification of Lock and Dam Operators." Interested individuals can send ideas of the Training and Certification program. Examples of what will be in those draft documents are as follows

  11. Morphological barrier island changes and recovery of dunes after Hurricane Dennis, St. George Island, Florida

    E-Print Network [OSTI]

    Fagherazzi, Sergio

    Morphological barrier island changes and recovery of dunes after Hurricane Dennis, St. George September 2009 Keywords: Dune recovery LiDAR Overwash Hurricane Dennis Barrier island During the summer of the barrier island are analyzed, along with the short-term post-storm recovery of secondary dunes. Results

  12. Architecture of the Mediator head module

    SciTech Connect (OSTI)

    Imasaki, Tsuyoshi; Calero, Guillermo; Cai, Gang; Tsai, Kuang-Lei; Yamada, Kentaro; Cardelli, Francesco; Erdjument-Bromage, Hediye; Tempst, Paul; Berger, Imre; Kornberg, Guy Lorch; Asturias, Francisco J.; Kornberg, Roger D.; Takagi, Yuichiro (Stanford); (Indiana-Med); (EMBL); (Scripps); (MSKCC)

    2011-09-06

    Mediator is a key regulator of eukaryotic transcription, connecting activators and repressors bound to regulatory DNA elements with RNA polymerase II (Pol II). In the yeast Saccharomyces cerevisiae, Mediator comprises 25 subunits with a total mass of more than one megadalton (refs 5, 6) and is organized into three modules, called head, middle/arm and tail. Our understanding of Mediator assembly and its role in regulating transcription has been impeded so far by limited structural information. Here we report the crystal structure of the essential Mediator head module (seven subunits, with a mass of 223 kilodaltons) at a resolution of 4.3 angstroms. Our structure reveals three distinct domains, with the integrity of the complex centred on a bundle of ten helices from five different head subunits. An intricate pattern of interactions within this helical bundle ensures the stable assembly of the head subunits and provides the binding sites for general transcription factors and Pol II. Our structural and functional data suggest that the head module juxtaposes transcription factor IIH and the carboxy-terminal domain of the largest subunit of Pol II, thereby facilitating phosphorylation of the carboxy-terminal domain of Pol II. Our results reveal architectural principles underlying the role of Mediator in the regulation of gene expression.

  13. Rhode Island to Build First Offshore Wind Farm

    Office of Energy Efficiency and Renewable Energy (EERE)

    Block Island, a small town with only 1,000 full-time, residents, is the site for a big project, when it will become home to Rhode Island’s first offshore wind farm.

  14. Countermeasures to Urban Heat Islands: A Global View

    E-Print Network [OSTI]

    Meier, Alan

    2006-01-01

    the urban heat island and justify countermeasures. Thus, theand southern Europe. The heat island (and air pollution)that reduce the heat island and cool a city make sense

  15. PROJECT DESCRIPTION The Texas Rookery Islands project would restore

    E-Print Network [OSTI]

    Horizon Oil Spill Natural Resource Damage Assessment Texas Rookery Islands Galveston Bay and East of the rookery islands would take into consideration methods to protect the islands from land loss associated

  16. Countermeasures to Urban Heat Islands: A Global View

    E-Print Network [OSTI]

    Meier, Alan

    2006-01-01

    Countermeasures to Urban Heat Islands: A Global View Alanurban climate is the phenomenon of the urban heat island.The urban heat island phenomenon was first observed over one

  17. Energy Transition Initiative, Island Energy Snapshot - Grenada (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-03-01

    This profile provides a snapshot of the energy landscape of Grenada - a small island nation consisting of the island of Grenada and six smaller islands in the southeastern Caribbean Sea - three of which are inhabited: Grenada, Carriacou, and Petite Martinique.

  18. The dynamics of genetic and morphological variation on volcanic islands

    E-Print Network [OSTI]

    Thorpe, Roger Stephen

    : volcanism; phylogeography; geographical variation; natural selection; Canary islands; Tarentola 1 and Canary islands). It has been argued that population extinctions, recolonizations and associ- ated a role in shaping geographical variation. The islands of the Canary Archipelago provide an excellent

  19. Contradiction and grammar : the case of weak islands

    E-Print Network [OSTI]

    Abrusán, Márta

    2007-01-01

    This thesis is about weak islands. Weak islands are contexts that are transparent to some but not all operator-variable dependencies. For this reason, they are also sometimes called selective islands. Some paradigmatic ...

  20. Head assembly for multiposition borehole extensometer

    DOE Patents [OSTI]

    Frank, Donald N. (Livermore, CA)

    1983-01-01

    A head assembly for a borehole extensometer and an improved extensometer for measuring subsurface subsidence. A plurality of inflatable anchors provide discrete measurement points. A metering rod is fixed to each of the anchors which are displaced when subsidence occurs, thereby translating the attached rod. The head assembly includes a sprocket wheel rotatably mounted on a standpipe and engaged by a chain which is connected at one end to the metering rod and at the other end to a counterweight. A second sprocket wheel connected to the standpipe also engages the chain and drives a connected potentiometer. The head assembly converts the linear displacement of the metering rod to the rotary motion of the second sprocket wheel, which is measured by the potentiometer, producing a continuous electrical output.

  1. news: Bern Convention group of experts on European island biological diversity: an international network to preserve island biodiversity

    E-Print Network [OSTI]

    Borges, Paulo A. V.

    2009-01-01

    by the Government of Canary Islands at Tenerife (1-3 Octoberthe Gov- ernments of Canary Islands, Azores and Madeira inAzores, Madeira and Canary Islands (Macaronesia), Balearic

  2. Compact organic vapor jet printing print head

    DOE Patents [OSTI]

    Forrest, Stephen R; McGraw, Gregory

    2013-12-24

    A first device is provided. The first device includes a print head, and a first gas source hermetically sealed to the print head. The print header further includes a first layer comprising a plurality of apertures, each aperture having a smallest dimension of 0.5 to 500 microns. A second layer is bonded to the first layer. The second layer includes a first via in fluid communication with the first gas source and at least one of the apertures. The second layer is made of an insulating material.

  3. Energy Office Grant Helps the Virgin Islands Environmental Resource...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the Virgin Islands Environmental Resource Station Install Solar Panels, Improve Efficiency, and Cut Monthly Energy Use Nearly 30% Energy Office Grant Helps the Virgin Islands...

  4. YOU ARE CORDIALLY INVITED 2011 Long Island

    E-Print Network [OSTI]

    Chen, Tsuhan

    and success of the green industry on Long Island. Thanks to Fred Soviero, this year's Leader's Forum, country sausage, seasoned potatoes, coffee, tea, and assorted fruit juices. Following breakfast, the two, and announcements to New York's green industry. Thanks to the Friends of Long Island Horticulture and the NSLGA

  5. Long Island Solar Farm Project Overview

    E-Print Network [OSTI]

    Ohta, Shigemi

    . Project Developer/Owner/Operator: Long Island Solar Farm, LLC (BP Solar & MetLife) Purchaser of Power: Long Island Power Authority (LIPA) purchases 100 percent of the LISF project output Destination to the annual usage of ~ 4,500 homes LISF Power Purchase Agreement (PPA) Term with LIPA: 20 years Estimated

  6. ames Kroes University of Rhode Island

    E-Print Network [OSTI]

    Rhode Island, University of

    and Transportation Systems for Sustainable Communities. What can we learn and how can it be applied in Rhode Island of completed page authorized (art. 5/94) Researching Design and Transportation Systems for Sustainable Island, Dept. of Landscape Architecture, address, Rodman Hall Rm 201, Kingston, RI 02881 (401) 874

  7. Clean Waters of Rhode Island Primary Investigators

    E-Print Network [OSTI]

    Rhode Island, University of

    Clean Waters of Rhode Island Primary Investigators Harold Knickle Donald Gray #12;Final Report Clean Waters of Rhode Island By Harold Knickle and Donald Gray Department of Chemical Engineering professionals in the clean water field as well as to educate graduate and undergraduate student in the scope

  8. Judith Sheine Professor and Department Head

    E-Print Network [OSTI]

    Design Studio 1983-87 New York Institute of Technology, Center for Architecture, Old Westbury, NY Adjunct of Technology; Pratt Institute; School of Architecture, Marnes-la-Vallee, France; Southern California InstituteJudith Sheine Professor and Department Head Department of Architecture School of Architecture

  9. Area Activation 1 Running Head: AREA ACTIVATION

    E-Print Network [OSTI]

    Pomplun, Marc

    Area Activation 1 Running Head: AREA ACTIVATION Advancing Area Activation towards a General Model at Boston 100 Morrissey Boulevard Boston, MA 02125-3393 USA Phone: 617-287-6485 Fax: 617-287-6433 e. Without great effort, human observers clearly outperform every current artificial vision system in tasks

  10. First Person -- George Neil Named Head of FEL Program (Inside...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    first-person-george-neil-named-head-fel-program-inside-business First Person -- George Neil By Lakeshia Artis, Inside Business March 3, 2008 George Neil, head of the Free-Electron...

  11. Gas cushion control of OVJP print head position

    DOE Patents [OSTI]

    Forrest, Stephen R

    2014-10-07

    An OVJP apparatus and method for applying organic vapor or other flowable material to a substrate using a printing head mechanism in which the print head spacing from the substrate is controllable using a cushion of air or other gas applied between the print head and substrate. The print head is mounted for translational movement towards and away from the substrate and is biased toward the substrate by springs or other means. A gas cushion feed assembly supplies a gas under pressure between the print head and substrate which opposes the biasing of the print head toward the substrate so as to form a space between the print head and substrate. By controlling the pressure of gas supplied, the print head separation from the substrate can be precisely controlled.

  12. The Galapagos Islands: a Laboratory for the Study

    E-Print Network [OSTI]

    Geist, Dennis

    - ...) Kauai Oahu Mauai Hawaii Easter Island Azores (Terceira, Pico) Canaries (Teneri e) Cabo Verde (Fogo

  13. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    areas. In the U. S. Virgin Islands rain water harvesting and seawater desalination are the principal

  14. Colour Invariant Head Pose Classification in Low Resolution Video

    E-Print Network [OSTI]

    Oxford, University of

    Colour Invariant Head Pose Classification in Low Resolution Video Ben Benfold and Ian Reid,ian}@robots.ox.ac.uk Abstract This paper presents an algorithm for the classification of head pose in low res- olution video, a pose estimation from a low resolution head image can be used to determine whether or not a close

  15. Real Time Head Pose Estimation from Consumer Depth Cameras

    E-Print Network [OSTI]

    Wolberg, George

    for estimating location and orientation of a person's head, from depth data acquired by a low quality device. OurReal Time Head Pose Estimation from Consumer Depth Cameras Gabriele Fanelli1 , Thibaut Weise2 and the variance of the head position and orientation. We evaluate three different approaches to jointly take

  16. Optimized electrode positions and stimulation patterns in head EIT

    E-Print Network [OSTI]

    Adler, Andy

    . One key challenge is the low distinguishability of head EIT. In this paper, we develop a strategy1 Optimized electrode positions and stimulation patterns in head EIT Yasin Mamatjan1 , Sujin Ahn2 potential for imaging of the head to image cerebral edema and stroke, and to assist the EEG inverse problem

  17. Numerical Simulations of the Island-Induced Circulations over the Island of Hawaii during HaRP

    E-Print Network [OSTI]

    Chen, Yi-Leng

    Numerical Simulations of the Island-Induced Circulations over the Island of Hawaii during HaRP YANG YANG AND YI-LENG CHEN Department of Meteorology, SOEST, University of Hawaii at Manoa, Honolulu, Hawaii island-scale circulations over the island of Hawaii during the Hawaiian Rainband Project (HaRP, 11 July

  18. Surface treatment of magnetic recording heads

    DOE Patents [OSTI]

    Komvopoulos, K.; Brown, I.G.; Wei, B.; Anders, S.; Anders, A.; Bhatia, S.C.

    1995-12-19

    Surface modification of magnetic recording heads using plasma immersion ion implantation and deposition is disclosed. This method may be carried out using a vacuum arc deposition system with a metallic or carbon cathode. By operating a plasma gun in a long-pulse mode and biasing the substrate holder with short pulses of a high negative voltage, direct ion implantation, recoil implantation, and surface deposition are combined to modify the near-surface regions of the head or substrate in processing times which may be less than 5 min. The modified regions are atomically mixed into the substrate. This surface modification improves the surface smoothness and hardness and enhances the tribological characteristics under conditions of contact-start-stop and continuous sliding. These results are obtained while maintaining original tolerances. 15 figs.

  19. Surface treatment of magnetic recording heads

    DOE Patents [OSTI]

    Komvopoulos, K.; Brown, I.G.; Wei, B.; Anders, S.; Anders, A.; Bhatia, C.S.

    1998-11-17

    Surface modification of magnetic recording heads using plasma immersion ion implantation and deposition is disclosed. This method may be carried out using a vacuum arc deposition system with a metallic or carbon cathode. By operating a plasma gun in a long-pulse mode and biasing the substrate holder with short pulses of a high negative voltage, direct ion implantation, recoil implantation, and surface deposition are combined to modify the near-surface regions of the head or substrate in processing times which may be less than 5 min. The modified regions are atomically mixed into the substrate. This surface modification improves the surface smoothness and hardness and enhances the tribological characteristics under conditions of contact-start-stop and continuous sliding. These results are obtained while maintaining original tolerances. 22 figs.

  20. Surface treatment of magnetic recording heads

    DOE Patents [OSTI]

    Komvopoulos, Kyriakos (Orinda, CA); Brown, Ian G. (Berkeley, CA); Wei, Bo (Albany, CA); Anders, Simone (Albany, CA); Anders, Andre (Albany, CA); Bhatia, Singh C. (Morgan Hill, CA)

    1995-01-01

    Surface modification of magnetic recording heads using plasma immersion ion implantation and deposition is disclosed. This method may be carried out using a vacuum arc deposition system with a metallic or carbon cathode. By operating a plasma gun in a long-pulse mode and biasing the substrate holder with short pulses of a high negative voltage, direct ion implantation, recoil implantation, and surface deposition are combined to modify the near-surface regions of the head or substrate in processing times which may be less than 5 min. The modified regions are atomically mixed into the substrate. This surface modification improves the surface smoothness and hardness and enhances the tribological characteristics under conditions of contact-start-stop and continuous sliding. These results are obtained while maintaining original tolerances.

  1. Surface treatment of magnetic recording heads

    DOE Patents [OSTI]

    Komvopoulos, Kyriakos (Orinda, CA); Brown, Ian G. (Berkeley, CA); Wei, Bo (Albany, CA); Anders, Simone (Albany, CA); Anders, Andre (Albany, CA); Bhatia, C. Singh (Morgan Hill, CA)

    1998-01-01

    Surface modification of magnetic recording heads using plasma immersion ion implantation and deposition is disclosed. This method may be carried out using a vacuum arc deposition system with a metallic or carbon cathode. By operating a plasma gun in a long-pulse mode and biasing the substrate holder with short pulses of a high negative voltage, direct ion implantation, recoil implantation, and surface deposition are combined to modify the near-surface regions of the head or substrate in processing times which may be less than 5 min. The modified regions are atomically mixed into the substrate. This surface modification improves the surface smoothness and hardness and enhances the tribological characteristics under conditions of contact-start-stop and continuous sliding. These results are obtained while maintaining original tolerances.

  2. Solar School Program in Reunion Island 

    E-Print Network [OSTI]

    David, M.; Adelard, L.

    2004-01-01

    Because of its particular geographic situation and relatively high altitude (3069 meters), Reunion Island is composed of a very large amount of micro-climates which have a direct impact on buildings' comfort, energy ...

  3. Community Redevelopment Case Study: Jekyll Island

    Broader source: Energy.gov [DOE]

    Presentation—given at the April 2012 Federal Utility Partnership Working Group (FUPWG) meeting—features photos from a case study about Jekyll Island's community redevelopment project in Georgia.

  4. US Virgin Islands renewable energy future

    E-Print Network [OSTI]

    Oldfield, Brian (Brian K.)

    2013-01-01

    The US Virgin Islands must face drastic changes to its electrical system. There are two problems with electricity production in the USVI-it's dirty and it's expensive. Nearly one hundred percent of the electricity in these ...

  5. Biofuel Feedstock Inter-Island Transportation

    E-Print Network [OSTI]

    Biofuel Feedstock Inter-Island Transportation Prepared for the U.S. Department of Energy Office Biofuels Feedstocks Hawaii Natural Energy Institute Desktop Study October 2012 Photographs, from left ........................................................................... 11 Options for liquid biofuel feedstock transport ...........................................................................

  6. PSEG Long Island- Renewable Electricity Goal

    Broader source: Energy.gov [DOE]

    As a municipal utility, the Long Island Power Authority (LIPA) is not obligated to comply with the New York Renewable Portfolio Standard (RPS). The LIPA Board of Trustees has nevertheless decided...

  7. Metromorphosis : evolution on the urban island

    E-Print Network [OSTI]

    Vezina, Kenrick (Kenrick Freitas)

    2011-01-01

    Cities are very much alive. Like islands, they provide a natural testing ground for evolution. With more than half of the world's population living in urban areas now, the influence cities have on the planet's life is ...

  8. Energy Audits on Prince Edward Island 

    E-Print Network [OSTI]

    Hall, N. G.; Gillis, D.

    1980-01-01

    High energy costs and uncertain supplies force industrial operators to seek out energy waste to keep costs down. The Enersave for Industry and Commerce program assists Prince Edward Island industries through an energy audit and grant program. A...

  9. Vision-based head pose estimation and interactivity analysis : algorithms, systems and evaluation

    E-Print Network [OSTI]

    Murphy-Chutorian, Erik Marshall

    2009-01-01

    estimate the low-level location and head movement of meetingup manner, following low-level facial Head Angle: Known HeadJ. Crowley, “Head pose estimation on low resolution images,”

  10. Energy effects of heat-island reduction strategies in Toronto, Canada

    E-Print Network [OSTI]

    Akbari, Hashem; Konopacki, Steven

    2003-01-01

    Energy Effects of Urban Heat Islands and Their Mitigation: aAkbari. Energy Impacts of Heat Island Reduction StrategiesSavings Calculations for Heat Island Reduction Strategies in

  11. Ice flow sensitivity to geothermal heat flux of Pine Island Glacier, Antarctica

    E-Print Network [OSTI]

    Larour, E; Morlighem, M; Seroussi, H; Schiermeier, J; Rignot, E; Rignot, E

    2012-01-01

    to geothermal heat flux of Pine Island Glacier, Antarcticato geothermal heat flux of Pine Island Glacier, Antarctica,Pine Island Glacier, West Antarctica: (a) geothermal heat

  12. Streamlined energy-savings calculations for heat-island reduction strategies

    E-Print Network [OSTI]

    Akbari, Hashem; Konopacki, Steven J.

    2003-01-01

    Savings Calculations for Heat Island Reduction Strategies inNational Laboratory -- Heat Island Group Technical Note.Savings Calculations for Heat-Island Reduction Strategies

  13. Historical Biogeography of the Midriff Islands in the Gulf of California, Mexico

    E-Print Network [OSTI]

    Wilder, Benjamin

    2014-01-01

    predictive, suggesting an island system with ancient humanextinctions seen in island systems around the world. ChapterThese results document an island system with ancient human

  14. Energy effects of heat-island reduction strategies in Toronto, Canada

    E-Print Network [OSTI]

    Akbari, Hashem; Konopacki, Steven

    2003-01-01

    Savings Calculations for Heat Island Reduction Strategies inAkbari. Energy Savings for Heat Island Reduction StrategiesEnergy Effects of Urban Heat Islands and Their Mitigation: a

  15. Opportunities for Saving Energy and Improving Air Quality in Urban Heat Islands

    E-Print Network [OSTI]

    Akbari, Hashem

    2008-01-01

    saving potentials of heat-island reduction strategies,”Special Issue on Urban Heat Islands and Cool Communities,Special Issue on Urban Heat Islands and Cool Communities,

  16. AN EXAMINATION OF MOVEMENTS OF BOTTLENOSE DOLPHINS BETWEEN ISLANDS IN THE HAWAIIAN ISLAND CHAIN

    E-Print Network [OSTI]

    Baird, Robin W.

    of the islands of Hawaii, Oahu, and Kauai. #12;Baird et al. 2002 2 Baird et al. (2001) estimated that only, Maui/Lanai, and Hawaii, in April and May 2002, and compared photographic identities with dolphins individuals identified off the islands of Oahu (29) and Hawaii (11), none had been previously documented

  17. INVASIVE RODENTS ON ISLANDS Avoiding surprise effects on Surprise Island: alien species

    E-Print Network [OSTI]

    Courchamp, Franck

    INVASIVE RODENTS ON ISLANDS Avoiding surprise effects on Surprise Island: alien species control Abstract Eradications of invasive alien species have generally benefited biodiversity. However, without following the sudden removal of an invasive alien that was exerting an ecological force on those species

  18. Integrated head package for top mounted nuclear instrumentation

    DOE Patents [OSTI]

    Malandra, Louis J. (McKeesport, PA); Hornak, Leonard P. (Forest Hills, PA); Meuschke, Robert E. (Monroeville, PA)

    1993-01-01

    A nuclear reactor such as a pressurized water reactor has an integrated head package providing structural support and increasing shielding leading toward the vessel head. A reactor vessel head engages the reactor vessel, and a control rod guide mechanism over the vessel head raises and lowers control rods in certain of the thimble tubes, traversing penetrations in the reactor vessel head, and being coupled to the control rods. An instrumentation tube structure includes instrumentation tubes with sensors movable into certain thimble tubes disposed in the fuel assemblies. Couplings for the sensors also traverse penetrations in the reactor vessel head. A shroud is attached over the reactor vessel head and encloses the control rod guide mechanism and at least a portion of the instrumentation tubes when retracted. The shroud forms a structural element of sufficient strength to support the vessel head, the control rod guide mechanism and the instrumentation tube structure, and includes radiation shielding material for limiting passage of radiation from retracted instrumentation tubes. The shroud is thicker at the bottom adjacent the vessel head, where the more irradiated lower ends of retracted sensors reside. The vessel head, shroud and contents thus can be removed from the reactor as a unit and rested safely and securely on a support.

  19. Sculpting the shape of semiconductor heteroepitaxial islands: fromdots to rods

    SciTech Connect (OSTI)

    Robinson, J.T.; Walko, D.A.; Arms, D.A.; Tinberg, D.S.; Evans,P.G.; Cao, Y.; Liddle, J.A.; Rastelli, A.; Schmidt, O.G.; Dubon, O.D.

    2006-06-20

    In the Ge on Si model heteroepitaxial system, metal patterns on the silicon surface provide unprecedented control over the morphology of highly ordered Ge islands. Island shape including nanorods and truncated pyramids is set by the metal species and substrate orientation. Analysis of island faceting elucidates the prominent role of the metal in promoting growth of preferred facet orientations while investigations of island composition and structure reveal the importance of Si-Ge intermixing in island evolution. These effects reflect a remarkable combination of metal-mediated growth phenomena that may be exploited to tailor the functionality of island arrays in heteroepitaxial systems.

  20. Low Frequency Observations of a Head-Tail Radio Source

    E-Print Network [OSTI]

    Dharam Vir Lal; A. Pramesh Rao

    2004-06-28

    We have mapped the head-tail radio galaxy, 3C 129 at 240 and 610 MHz using the GMRT and studied the detailed morphology and spectral index variations in this object. This is the first attempt to observe a sample of head-tail sources at low frequencies. We find weak spectral steepening as we go away from the head along the jet. The Crosspiece has a spectral index of 0.9 (S$_{\

  1. TAKE AND AVERfI.GE VALUE OF PRIBILOF ISLANDS FUR SEP~ SKINS, 1956-1960 Year Male Female Total

    E-Print Network [OSTI]

    Breeding grounds of the northern fur seals: Robben Island (Kaihyoto or Tyuleniy Island) off Sakhalin

  2. Pacific Islands Fisheries Science Center Ecosystems and Oceanography Division

    E-Print Network [OSTI]

    Hawai'i at Manoa, University of

    Pacific Islands Fisheries Science Center Ecosystems and Oceanography Division Pelagic Fisheries Ecosystems and Oceanography Division Pacific Islands Fisheries Science Center, National Marine Fisheries and Oceanography Division Pelagic Fisheries Research Program Motivation · Juvenile & subadult bigeye aggregates

  3. Pacific Island Fisheries Science Center Ecosystems and Oceanography Division

    E-Print Network [OSTI]

    Hawai'i at Manoa, University of

    Pacific Island Fisheries Science Center Ecosystems and Oceanography Division Pelagic Fisheries Fisheries Science Center, NMFS, NOAA #12;Pacific Island Fisheries Science Center Ecosystems and Oceanography Science Center Ecosystems and Oceanography Division Pelagic Fisheries Research Program Materials

  4. Islanded Grid Wind Power Conference | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Islanded Grid Wind Power Conference Islanded Grid Wind Power Conference March 4, 2015 8:00AM AKST to March 6, 2015 5:00PM AKST Alaska Pacific University 4101 University Drive...

  5. Global isotopic signatures of oceanic island basalts / by

    E-Print Network [OSTI]

    Oschmann, Lynn A

    1991-01-01

    Sr, Nd and Pb isotopic analyses of 477 samples representing 30 islands or island groups, 3 seamounts or seamount chains, 2 oceanic ridges and 1 oceanic plateau [for a total of 36 geographic features] are compiled to form ...

  6. BPA Improves hundreds of acres of habitat on Sauvie Island

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on Sauvie Island 10202015 12:00 AM Tweet Page Content Crews install a 53-foot-long pedestrian bridge over a slough at the Sauvie Island Wildlife Area. The bridge replaces an old...

  7. Prince Edward Island: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    Prince Edward Island: Energy Resources Jump to: navigation, search Name Prince Edward Island, Canada Equivalent URI DBpedia GeoNames ID 6113358 Coordinates 46.333333, -63.5...

  8. Optimizing Cluster Heads for Energy Efficiency in Large-Scale...

    Office of Scientific and Technical Information (OSTI)

    Optimizing Cluster Heads for Energy Efficiency in Large-Scale Heterogeneous Wireless Sensor Networks Gu, Yi; Wu, Qishi; Rao, Nageswara S. V. Hindawi Publishing Corporation None...

  9. Laboratory Demonstration of a New American Low-Head Hydropower...

    Broader source: Energy.gov (indexed) [DOE]

    Demonstration of a New American Low-Head Hydropower Turbine 68bhydrogreensmallhydroch11.ppt More Documents & Publications Real World Demonstration of a New American...

  10. The Use and Destruction of Minoan Stone Bull's Head Rhyta

    E-Print Network [OSTI]

    Rehak, Paul

    1995-01-01

    This study of Minoan bull-head rhyta examines all the surviving fragments and concludes that they were deliberately smashed, probably in some kind of ritual.

  11. Turning heads: The biology of solar tracking in sunflower

    E-Print Network [OSTI]

    Vandenbrink, JP; Brown, EA; Harmer, SL; Blackman, BK

    2014-01-01

    Cessation of solar tracking . . . . . . . . . . . . . . .Solar tracking is not solely driven by the movement of theEcological function(s) of solar tracking and mature head

  12. Council on Environmental Quality - Memorandum for Heads of Federal...

    Open Energy Info (EERE)

    Council on Environmental Quality - Memorandum for Heads of Federal Departments and Agencies Jump to: navigation, search OpenEI Reference LibraryAdd to library Memorandum: Council...

  13. Foster-Glocester Regional School District (Rhode Island) - Financing Profile

    SciTech Connect (OSTI)

    none,

    2008-12-01

    This document is an EnergySmart Schools Financing Profile of Foster-Glocester Regional School District in Rhode Island

  14. Genomic islands predict functional adaptation in marine actinobacteria

    E-Print Network [OSTI]

    Penn, Kevin

    2010-01-01

    Ecological adaptations among bacterial populations have been linked to genomic islands, strain-specific regions of DNA that house

  15. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    to effective ecological balances in island systems. These focus area activities were in addition to its usual

  16. United States Virgin Islands: St. Thomas (Bovoni) & St. Croix (Longford)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Roberts, O.; Andreas, A.

    Two measurement stations to collect wind data to support future wind power generation in the U.S. Virgin Islands.

  17. United States Virgin Islands: St. Thomas (Bovoni) & St. Croix (Longford)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Roberts, O.; Andreas, A.

    1997-01-01

    Two measurement stations to collect wind data to support future wind power generation in the U.S. Virgin Islands.

  18. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    water harvesting are the principal sources of fresh water. Ground water supplies are very limited. WaterVirgin Islands Water Resources Research Institute Annual Technical Report FY 2008 Virgin Islands Water Resources Research Institute Annual Technical Report FY 2008 1 #12;Introduction The Virgin Islands

  19. Azania XLII 2007 East Africa, the Comoros Islands and

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Azania XLII 2007 East Africa, the Comoros Islands and Madagascar before the sixteenth century interior and on outlying islands (Comoros, Madagascar) or were composed of lower classes in urban expansion and private enterprise. #12;16 East Africa, the Comoros Islands and Madagascar before

  20. A Distributed Generation Control Architecture for Islanded AC Microgrids

    E-Print Network [OSTI]

    Dominguez-Garcia, Alejandro

    1 A Distributed Generation Control Architecture for Islanded AC Microgrids Stanton T. Cady, Student in islanded ac microgrids with both synchronous generators and inverter-interfaced power supplies. Although they are smaller and have lower ratings, the generation control objectives for an islanded microgrid are similar

  1. Recommendations for Technologies for Microgrids on the Big Island

    E-Print Network [OSTI]

    Recommendations for Technologies for Microgrids on the Big Island Prepared for U.S. Department Island microgrids By Sentech, Inc. Bethesda, Maryland And University of Hawaii Hawaii Natural Energy for technologies to be used in future installation of Big Island microgrids Subtask 2.2 Deliverable #4 Prepared By

  2. Bridge-Node Selection and Loss Recovery in Island Multicast

    E-Print Network [OSTI]

    Chan, Shueng-Han Gary

    Bridge-Node Selection and Loss Recovery in Island Multicast W.-P. Ken Yiu K.-F. Simon Wong S multicast-capable domains (the so-called islands) while overlay connections are used to bridge islands. In the previously proposed scheme, the number of ping measurements to find good bridge-nodes is at least

  3. INV Spring, 2009 1 CANARY ISLANDS (see Atlantic Ocean)

    E-Print Network [OSTI]

    INV Spring, 2009 1 UPD 5/6/15 CANARY ISLANDS (see Atlantic Ocean) 1950 1:100,000 Lanzarote 1950 1:130,000 International travel maps, Canary Islands = Mapas internacionales de viaje, Islas Canarias (bc) - International Nacional 9126/C1/100/1950- 1:100,000 Canary Islands (6 sheets) Mapa Militar: 1 - de la Isla de Hierro 2

  4. Stomach contents of cetaceans stranded in the Canary Islands 19962006

    E-Print Network [OSTI]

    Pierce, Graham

    Stomach contents of cetaceans stranded in the Canary Islands 1996­2006 r. fernandez1 , m.b. santos2, Kogiidae and Ziphiidae, stranded between 1996 and 2006 in the Canary Islands. Cephalopod mandibles (beaks teuthophagous whales. Keywords: feeding, Canary Islands, cetaceans, cephalopods, plastic Submitted 5 August 2008

  5. ORIGINAL PAPER Bird pollination of Canary Island endemic plants

    E-Print Network [OSTI]

    Chittka, Lars

    ORIGINAL PAPER Bird pollination of Canary Island endemic plants Jeff Ollerton & Louise Cranmer /Accepted: 29 September 2008 # Springer-Verlag 2008 Abstract The Canary Islands are home to a guild Bird vision . Canary Islands . Mutualism . Pollinator. Tenerife Introduction The endemic flora

  6. ORIGINAL PAPER Bird pollination of Canary Island endemic plants

    E-Print Network [OSTI]

    Chittka, Lars

    ORIGINAL PAPER Bird pollination of Canary Island endemic plants Jeff Ollerton & Louise Cranmer) was an effective pollinator of these species. Keywords Bird vision . Canary Islands . Mutualism . Pollinator. Tenerife Introduction The endemic flora of the Canary Islands, situated off the west coast of North Africa

  7. The maximal body massarea relationship in island mammals

    E-Print Network [OSTI]

    Gonzalez, Andrew

    mass­area relationship for four island systems, to test the hypothesis that community relaxationORIGINAL ARTICLE The maximal body mass­area relationship in island mammals Virginie Millien1, 20 islands in the Sea of Corte´s and the seven continents). Replotting their data with area

  8. The Island Metaphor Bill Tomlinson, Eric Baumer, Man Lok Yau

    E-Print Network [OSTI]

    Tomlinson, Bill

    , ebaumer, mlyau } @uci.edu Abstract This paper presents an "Island Metaphor" for interactions with systems of a software system. The Island Metaphor is not applicable to, nor appropriate for, every system. HoweverThe Island Metaphor Bill Tomlinson, Eric Baumer, Man Lok Yau University of California, Irvine { wmt

  9. Title: Satellite Streetview: Prince Edward Island Data Creator /

    E-Print Network [OSTI]

    Title: Satellite Streetview: Prince Edward Island Data Creator / Copyright Owner: DMTI Spatial Inc: N/A Abstract: Satellite images generated for cities and/or regions in Prince Edward Island.. Areas: N/A Keywords (Place): Canada; Prince Edward Island; Charlottetown Keywords (Subject): Aerial Images

  10. Head Observation Organizer (HObO)

    SciTech Connect (OSTI)

    Steven Predmore

    2008-03-06

    The Head Observation Organizer, HObO, is a computer program that stores and manages measured ground-water levels. HObO was developed to help ground-water modelers compile, manage, and document water-level data needed to calibrate ground-water models. Well-construction and water-level data from the U.S. Geological Survey National Water Database (NWIS) easily can be imported into HObO from the NWIS web site (NWISWeb). The water-level data can be flagged to determine which data will be included in the calibration data set. The utility program HObO_NWISWeb was developed to simplify the down loading of well and water-level data from NWISWeb. An ArcGIS NWISWeb Extension was developed to retrieve site information from NWISWeb. A tutorial is presented showing the basic elements of HObO.

  11. Observation of energetic electrons within magnetic islands

    E-Print Network [OSTI]

    Loss, Daniel

    , University of New Hampshire, Durham, New Hampshire 03824, USA 2 National Astronomical Observatory of Japan, 2 that energetic electron fluxes peak at sites of compressed density within islands, which imposes a new constraint, show that electrons are primarily accelerated at the X line or separatrices (see Fig. 1) by electric

  12. Philippine Islands: a tectonic railroad siding

    SciTech Connect (OSTI)

    Gallagher, J.J. Jr.

    1984-09-01

    In 1976, significant quantities of oil were discovered offshore northwest of Palawan Island by a Philippine-American consortium led by Philippines-Cities Service Inc. This was the first commercial oil found in the Philippine Islands. Other exploration companies had decided that there was no commercial oil in the Philippines. They fell prey to a situation Wallace E. Pratt, who began his career in 1909 in the Philippines, later described: There are many instances where our knowledge, supported in some cases by elaborate and detailed studies has convinced us that no petroleum resources were present in areas which subsequently became sites of important oil fields. Some explorers are blinded by the negative implications of the same knowledge that successful explorers use to find important oil fields. The Palawan discoveries are examples of successful use of knowledge. Recognition that the Philippine Islands are a tectonic railroad siding may be the key to future exploration success. These islands are continental fragments, each with its own individual geologic characteristics, that have moved from elsewhere to their present positions along a major strike-slip zone. Play concepts can be developed in the Philippines for continental fragments in each of the three major present-day tectono-stratigraphic systems that are dominated by strike-slip, but include subduction and extension tectonics, with both carbonate and clastic sediments.

  13. Asian American and Pacific Islander Heritage Month

    Broader source: Energy.gov [DOE]

    A celebration of Asians and Pacific Islanders in the United States. The month of May was chosen to commemorate the immigration of the first Japanese to the United States on May 7, 1843, and to mark the anniversary of the completion of the transcontinental railroad on May 10, 1869. The majority of the workers who laid the tracks were Chinese immigrants.

  14. Aleutian Pribilof Islands Association- 2010 Project

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Aleutian Pribilof Islands Association, Inc. (APIA) will conduct on-site weatherization and energy conservation education and a home energy and safety review in the communities of Akutan, Atka, False Pass, King Cove, Nelson Lagoon, Nikolski, Sand Point, St. George, St. Paul, and Unalaska.

  15. Energy Transition Initiative: Islands Playbook (Book)

    SciTech Connect (OSTI)

    Not Available

    2015-01-01

    The Island Energy Playbook (the Playbook) provides an action-oriented guide to successfully initiating, planning, and completing a transition to an energy system that primarily relies on local resources to eliminate a dependence on one or two imported fuels. It is intended to serve as a readily available framework that any community can adapt to organize its own energy transition effort.

  16. Will Iceland be an island forever?

    E-Print Network [OSTI]

    Karlsson, Brynjar

    Will Iceland be an island forever? Potential interconnection of the Icelandic power system. Germany and energy security is going to be a bigger issue in energy policy than before. Iceland, Qatar and other countries with stranded power are far off the trend line due to hydro and geothermal in Iceland and gas

  17. PUERTO RICO / U.S. VIRGIN ISLANDS

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    of Rhode Island University of Connecticut University of Delaware University of Maryland College Park AMERICAN SAMOA HAWAII ALASKA Northwest Indian College Diné College Navajo Technical College D-Q University Tribal College Haskell Indian Nations University Oglala Lakota College Si Tanka Univ. Sisseton Wahpeton

  18. ROSS ISLAND BRIDGE SW GIBBS ST

    E-Print Network [OSTI]

    Chapman, Michael S.

    ROSS ISLAND BRIDGE SW GIBBS ST SW PORTER ST SW HOOKER ST SW PORTER ST SW MEADE ST SW ARTHUR STSW ARTHUR ST SW WOODS ST SW WOODS ST GIBBS ST PEDESTRIAN BRIDGE SW LANE ST SW PENNOYER ST SW ABERNETHY ST SW BANCROFT ST SW BANCROFT ST SW THOMAS ST SW ABERNETHY ST SW LOWELL ST SW THOMAS ST SW KELLY AVE SWMOODYAVE

  19. Within-island differentiation and between-island homogeneity: non-equilibrium population structure in the seaweed

    E-Print Network [OSTI]

    in the seaweed Cladophoropsis membranacea (Chlorophyta) in the Canary Islands HAN J. VAN DER STRATE1, 2 , LOUIS stone model at larger spatial scales. In the present survey, 23 sites were sampled in the Canary Islands among the Canary Islands regardless of how geographic distances were computed. Only when the Canary

  20. Corey Casper, MD Head, Program in Global Oncology

    E-Print Network [OSTI]

    Brent, Roger

    Corey Casper, MD Head, Program in Global Oncology Member, Vaccine and Infectious Disease and Public of Washington Dr. Casper focuses on infection-related cancers and cancer in low-resource settings. He is the Head of the Program in Global Oncology at the Fred Hutchinson Cancer Research Center, where he is also

  1. Stable p-Type Conduction from Sb-Decorated Head-to-Head Basal Plane Inversion Domain Boundaries in ZnO Nanowires

    E-Print Network [OSTI]

    Wang, Xudong

    Stable p-Type Conduction from Sb-Decorated Head-to-Head Basal Plane Inversion Domain Boundaries of WisconsinMadison, Madison, Wisconsin 53706, United States ABSTRACT: We report that Sb-decorated head-to-head-type dopant due to low dopant solubility, native donor defects, and large acceptor ionization energies has

  2. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.

    2010-01-01

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  3. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.

    2010-08-09

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  4. Abstract: In this paper, we propose a fast and practical head pose estimation scheme for eye-head controlled

    E-Print Network [OSTI]

    Daume III, Hal

    -head controlled human computer interface with non-constrained background. The method we propose uses complete a novel image-based human computer interface controlled by eye and head, which is a subtask]. Conventional human computer interaction techniques such as keyboard and mouse are considered as bottlenecks

  5. The fate of the Juan de Fuca plate: Implications for a Yellowstone plume head

    E-Print Network [OSTI]

    Xue, Mei; Allen, Richard A.

    2007-01-01

    for a mantle plume head is the unusual low velocity layerthe plume head material is expected to have a low velocitylow velocity anomaly is comparable with that expected for plume head

  6. Vision-based head pose estimation and interactivity analysis : algorithms, systems and evaluation

    E-Print Network [OSTI]

    Murphy-Chutorian, Erik Marshall

    2009-01-01

    1.3 Head Pose Estimation Methods . . . . . .Chapter 1 A Survey of Head Pose Estimation in Computer 1.11.4 Head Pose Estimation Comparisons . . . . . . . . 1.4.1

  7. Scalable Low-head Axial-type Venturi-flow Energy Scavenger |...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Scalable Low-head Axial-type Venturi-flow Energy Scavenger Scalable Low-head Axial-type Venturi-flow Energy Scavenger Scalable Low-head Axial-type Venturi-flow Energy Scavenger...

  8. Heading off the permanent oil crisis

    SciTech Connect (OSTI)

    MacKenzie, J.J.

    1996-11-01

    The 1996 spike in gasoline prices was not a signal of any fundamental worldwide shortage of crude oil. But based on a review of many studies of recoverable crude oil that have been published since the 1950s, it looks as though such a shortfall is now within sight. With world demand for oil growing at 2 percent per year, global production is likely to peak between the years 2007 and 2014. As this time approaches, we can expect prices to rise markedly and, most likely, permanently. Policy changes are needed now to ease the transition to high-priced oil. Oil production will continue, though at a declining rate, for many decades after its peak, and there are enormous amounts of coal, oil sands, heavy oil, and oil shales worldwide that could be used to produce liquid or gaseous substitutes for crude oil, albeit at higher prices. But the facilities for making such synthetic fuels are costly to build and environmentally damaging to operate, and their use would substantially increase carbon dioxide emissions (compared to emissions from products made from conventional crude oil). This paper examines ways of heading of the impending oil crisis. 8 refs., 3 figs.

  9. Rhode Island: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, New York: EnergyOpenReykjanes Geothermal PowerRezacRhode Island:

  10. Island Energy Conference | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014 | International Nuclear Energyat Larger Scale|Is aIsland

  11. Resuspension studies in the Marshall Islands

    SciTech Connect (OSTI)

    Shinn, J.H.; Homan, D.N.; Robison, W.L. [Lawrence Livermore National Lab., CA (United States)

    1997-07-01

    The contribution of inhalation exposure to the total dose for residents of the Marshall Islands was monitored at occasions of opportunity on several islands in the Bikini and Enewetak Atolls. To determine the long-term potential for inhalation exposure, and to understand the mechanisms of redistribution and personal exposure, additional investigations were undertaken on Bikini Island under modified and controlled conditions. Experiments were conducted to provide key parameters for the assessment of inhalation exposure from plutonium-contaminated dust aerosols: characterization of the contribution of plutonium in soil-borne aerosols as compared to sea spray and organic aerosols, determination of plutonium resuspension rates as measured by the meteorological flux-gradient method during extreme conditions of a bare-soil vs. a stabilized surface, determination of the approximate individual exposures to resuspended plutonium by traffic, and studies of exposures to individuals in different occupational environments simulated by personal air sampling of workers assigned to a variety of tasks. Enhancement factors (defined as ratios of the plutonium-activity), of suspended aerosols relative to the plutonium-activity of the soil were determined to be less than 1 (typically 0.4 to 0.7) in the undisturbed, vegetated areas, but greater than 1 (as high as 3) for the case studies of disturbed bare soil, roadside travel, and for occupational duties in fields and in and around houses. 12 refs., 5 figs., 8 tabs.

  12. Suggested guidelines for anti-islanding screening.

    SciTech Connect (OSTI)

    Ellis, Abraham; Ropp, Michael

    2012-02-01

    As increasing numbers of photovoltaic (PV) systems are connected to utility systems, distribution engineers are becoming increasingly concerned about the risk of formation of unintentional islands. Utilities desire to keep their systems secure, while not imposing unreasonable burdens on users wishing to connect PV. However, utility experience with these systems is still relatively sparse, so distribution engineers often are uncertain as to when additional protective measures, such as direct transfer trip, are needed to avoid unintentional island formation. In the absence of such certainty, utilities must err on the side of caution, which in some cases may lead to the unnecessary requirement of additional protection. The purpose of this document is to provide distribution engineers and decision makers with guidance on when additional measures or additional study may be prudent, and also on certain cases in which utilities may allow PV installations to proceed without additional study because the risk of an unintentional island is extremely low. The goal is to reduce the number of cases of unnecessary application of additional protection, while giving utilities a basis on which to request additional study in cases where it is warranted.

  13. A Guidebook on Grid Interconnection and Islanded Operation of Mini-Grid Power Systems Up to 200 kW

    E-Print Network [OSTI]

    Greacen, Chris

    2014-01-01

    of Distributed Resource Island Systems with Electric Powerguidance on operating island systems in these variousof Distributed Resource Island Systems with Electric Power

  14. A Guidebook on Grid Interconnection and Islanded Operation of Mini-Grid Power Systems Up to 200 kW

    E-Print Network [OSTI]

    Greacen, Chris

    2014-01-01

    guidance on operating island systems in these variousof Distributed Resource Island Systems with Electric Powerof Distributed Resource Island Systems with Electric Power

  15. Islander: A database of precisely mapped genomic islands in tRNA and tmRNA genes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

    2014-11-05

    Genomic islands are mobile DNAs that are major agents of bacterial and archaeal evolution. Integration into prokaryotic chromosomes usually occurs site-specifically at tRNA or tmRNA gene (together, tDNA) targets, catalyzed by tyrosine integrases. This splits the target gene, yet sequences within the island restore the disrupted gene; the regenerated target and its displaced fragment precisely mark the endpoints of the island. We applied this principle to search for islands in genomic DNA sequences. Our algorithm identifies tDNAs, finds fragments of those tDNAs in the same replicon and removes unlikely candidate islands through a series of filters. A search for islandsmore »in 2168 whole prokaryotic genomes produced 3919 candidates. The website Islander (recently moved to http://bioinformatics.sandia.gov/islander/) presents these precisely mapped candidate islands, the gene content and the island sequence. The algorithm further insists that each island encode an integrase, and attachment site sequence identity is carefully noted; therefore, the database also serves in the study of integrase site-specificity and its evolution.« less

  16. Raft River monitor well potentiometric head responses and water...

    Open Energy Info (EERE)

    head responses and water quality as related to the conceptual ground-water flow system Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Raft...

  17. Type B Accident Investigation Board Report on the Head Injury...

    Office of Environmental Management (EM)

    2004 October 15, 2004 On August 25, 2004, an employee of Washington TRU Solution, LLC (WTS) sustained a head injury when he was struck by a C-clamp and rope attachment that broke...

  18. Energy Savings from Floating Head Pressure in Ammonia Refrigeration Systems 

    E-Print Network [OSTI]

    Barrer, P. J.; Jones, S. M.

    1998-01-01

    This paper presents case studies of two moderately sized ammonia refrigeration systems retrofitted for floating head pressure control. It also presents a parametric analysis to assist in selecting appropriate pressures in an ammonia refrigeration...

  19. Tony Reilly appointed to be SRF Operations Department Head |...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to be SRF Operations Department Head Following the appointment of Joe Preble to be the LCLS II Project Lead for Jefferson Lab, we initiated a search to replace Joe as SRF...

  20. Zeroth-order inversion of transient head observations

    SciTech Connect (OSTI)

    Vasco, D.W.

    2007-08-15

    A high-frequency, asymptotic solution for transient head,appropriate for a medium containing smoothly varying heterogeneity,provides a basis for efficient inverse modeling. The semi analyticsolution is trajectory based, akin to ray methods used in modeling wavepropagation, and may be constructed by post processing the output of anumerical simulator. For high frequencies, the amplitude sensitivities,the relationship between changes in flow properties and changes in headampliude, are dominated by the phase term which may be computed directlyfrom the output of the simulator. Thus, transient head waveforms may beinverted with little more computation than is required to invert arrivaltimes. An applicatino to synthetic head values indicates that thetechnique can be used to improve the fit to waveforms. An application totransient head data from the Migration experiment in Switzerland revealsa narrow, high conductivity pathway within a 0.5 m thick zone offracturing.

  1. Steam Generator Group Project. Task 6. Channel head decontamination

    SciTech Connect (OSTI)

    Allen, R.P.; Clark, R.L.; Reece, W.D.

    1984-08-01

    The Steam Generator Group Project utilizes a retired-from-service pressurized-water-reactor steam generator as a test bed and source of specimens for research. An important preparatory step to primary side research activities was reduction of the radiation field in the steam generator channel head. This task report describes the channel head decontamination activities. Though not a programmatic research objective it was judged beneficial to explore the use of dilute reagent chemical decontamination techniques. These techniques presented potential for reduced personnel exposure and reduced secondary radwaste generation, over currently used abrasive blasting techniques. Two techniques with extensive laboratory research and vendors prepared to offer commercial application were tested, one on either side of the channel head. As indicated in the report, both techniques accomplished similar decontamination objectives. Neither technique damaged the generator channel head or tubing materials, as applied. This report provides details of the decontamination operations. Application system and operating conditions are described.

  2. PPE-HEAD PROTECTION GUIDE Source Assessment of Hazard Protection

    E-Print Network [OSTI]

    Johnson, Eric E.

    . Specify type. (See ANSI performance requirements) Collision with fixed object Hard Hat. (See ANSI Hat, depending upon exposure. (See ANSI performance requirements) AMERICAN NATIONAL STANDARDS INSTITUTE (ANSI) PERFORMANCE REQUIREMENTS FOR OCCUPATIONAL HEAD PROTECTION Class A Class B Class C

  3. Zeroth-order inversion of transient head observations

    E-Print Network [OSTI]

    Vasco, D.W.

    2008-01-01

    The hydraulic head was observed in seven surrounding wellsHydraulic conductivity variation used for numerical trajectory computations. The wellhydraulic conductivity, given the significant variations in travel time to the observation wells.

  4. Running Head: EMOTION AND AGING Emotion and Aging

    E-Print Network [OSTI]

    Mather, Mara

    Running Head: EMOTION AND AGING Emotion and Aging Mara Mather, M., & Ponzio, A. (in press). Emotion and aging. In L. Feldman Barrett, M. All of these basic mechanisms and contextual factors change in normal aging

  5. SURFACE REMEDIATION IN THE ALEUTIAN ISLANDS: A CASE STUDY OF AMCHITKA ISLAND, ALASKA

    SciTech Connect (OSTI)

    Giblin, M. O.; Stahl, D. C.; Bechtel, J. A.

    2002-02-25

    Amchitka Island, Alaska, was at one time an integral player in the nation's defense program. Located in the North Pacific Ocean in the Aleutian Island archipelago, the island was intermittently inhabited by several key government agencies, including the U.S. Army, the U.S. Atomic Energy Commission (predecessor agency to the U.S. Department of Energy), and the U.S. Navy. Since 1993, the U.S. Department of Energy (DOE) has conducted extensive investigations on Amchitka to determine the nature and extent of contamination resulting from historic nuclear testing. The uninhabited island was the site of three high-yield nuclear tests from 1965 to 1971. These test locations are now part of the DOE's National Nuclear Security Administration Nevada Operations Office's Environmental Management Program. In the summer of 2001, the DOE launched a large-scale remediation effort on Amchitka to perform agreed-upon corrective actions to the surface of the island. Due to the lack of resources available on Amchitka and logistical difficulties with conducting work at such a remote location, the DOE partnered with the Navy and U.S. Army Corps of Engineers (USACE) to share certain specified costs and resources. Attempting to negotiate the partnerships while organizing and implementing the surface remediation on Amchitka proved to be a challenging endeavor. The DOE was faced with unexpected changes in Navy and USACE scope of work, accelerations in schedules, and risks associated with construction costs at such a remote location. Unfavorable weather conditions also proved to be a constant factor, often slowing the progress of work. The Amchitka Island remediation project experience has allowed the DOE to gain valuable insights into how to anticipate and mitigate potential problems associated with future remediation projects. These lessons learned will help the DOE in conducting future work more efficiently, and can also serve as a guide for other agencies performing similar work.

  6. The Hilton Boca Raton Suites offers preferred rates for

    E-Print Network [OSTI]

    Fernandez, Eduardo

    Open Oct 19, Close Nov 2 o Information Session Date: Nov 3, 2015 from 6:00pm-7:00pm Location: BA 105

  7. ,"Rhode Island Natural Gas Pipeline and Distribution Use Price...

    U.S. Energy Information Administration (EIA) Indexed Site

    ies","Frequency","Latest Data for" ,"Data 1","Rhode Island Natural Gas Pipeline and Distribution Use Price (Dollars per Thousand Cubic Feet)",1,"Annual",2005 ,"Release Date:","9...

  8. Celebrating Asian American Pacific Islander Heritage Month at...

    Broader source: Energy.gov (indexed) [DOE]

    Pacific Islanders at the Energy Department, in the energy workforce, and throughout history. Headquarter employees and members of the general public are invited to celebrate on...

  9. ,"Rhode Island Natural Gas LNG Storage Additions (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Of Series","Frequency","Latest Data for" ,"Data 1","Rhode Island Natural Gas LNG Storage Additions (MMcf)",1,"Annual",2014 ,"Release Date:","9302015" ,"Next Release...

  10. ,"Rhode Island Natural Gas LNG Storage Withdrawals (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Of Series","Frequency","Latest Data for" ,"Data 1","Rhode Island Natural Gas LNG Storage Withdrawals (MMcf)",1,"Annual",2014 ,"Release Date:","9302015" ,"Next Release...

  11. Rhode Island High Resolution Wind Resource - Datasets - OpenEI...

    Open Energy Info (EERE)

    Detailed license and usage information for this dataset Preview Download 50m GIS NREL Rhode Island energy high resoltuion renewable shapefile wind wind data wind...

  12. Energy Transition Initiative: Island Energy Snapshot - Dominican Republic

    SciTech Connect (OSTI)

    2015-09-01

    This profile provides a snapshot of the energy landscape of the Dominican Republic, a Caribbean nation that shares the island of Hispaniola with Haiti to the west.

  13. Energy Office Grant Helps the Virgin Islands Environmental Resource...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Resource Station Install Solar Panels, Improve Efficiency, and Cut Monthly Energy Use Nearly 30% Organization Virgin Islands Energy Office www.vienergy.org Industry...

  14. Validation in Genomics: CpG Island Methylation Revisited

    E-Print Network [OSTI]

    Segal, Mark R

    2006-01-01

    analysis. In: Functional Genomics: Methods and Protocols, M.Segal: Validation in Genomics: CpG Island Methylationpackage and applications to genomics. Bioinformatics and

  15. Commonwealth of Northern Mariana Islands Initial Technical Assessment

    SciTech Connect (OSTI)

    Baring-Gould, I.; Hunsberger, R.; Visser, C.; Voss, P.

    2011-07-01

    This document is an initial energy assessment for the Commonwealth of the Northern Mariana Islands (CNMI), the first of many steps in developing a comprehensive energy strategy.

  16. Harnessing Sun, Wind and Lava for Islands' Energy Needs | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Nations (EDIN) project - this international collaboration between the United States, Iceland and New Zealand is aimed at helping islands adopt clean energy policies, technology...

  17. U.S. Virgin Islands Leadership Embraces Inclusiveness to Ensure...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Leadership Embraces Inclusiveness to Ensure Community Ownership of Clean Energy Vision U.S. Virgin Islands Leadership Embraces Inclusiveness to Ensure Community Ownership of Clean...

  18. Bear Head LNG Corporation and Bear Head LNG (USA), LLC- FE Dkt. No.- 15-33-LNG

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Fossil Energy gives notice of receipt of an application filed on February 25, 2015, by Bear Head LNG, requesting long-term multi-contract authority as further described in their...

  19. Bunker View: Limited-range head-motion-parallax visualization for complex data sets

    E-Print Network [OSTI]

    Pollefeys, Marc

    of head-motion-parallax. In particular, the frame rates are often too low for convincing headBunker View: Limited-range head-motion-parallax visualization for complex data sets Andrei State Chapel Hill, North Carolina, 27514 ABSTRACT This work presents a head-motion-parallax visualization

  20. Is precise discrimination of low level motion needed for heading discrimination?

    E-Print Network [OSTI]

    Vaina, Lucia M.

    Is precise discrimination of low level motion needed for heading discrimination? Constance S be that this aspect of heading perception is more reliant on low level motion perception. Another aspect of heading judgments on low level motion perception and the relationship between heading and scene reconstruction, we

  1. Priming of Head Premotor Circuits During Oculomotor Preparation Brian D. Corneil,1,2

    E-Print Network [OSTI]

    Corneil, Brian D.

    of the eyes and head. However, it remains unclear whether low-frequency activity emitted by oculomotor neurons that such low- frequency activity contributes to eye-head coordination by selectively priming head premotor that low-frequency oculomotor activity primes head premotor circuits well in advance of gaze shift

  2. Driving With Hemianopia: IV. Head Scanning and Detection at Intersections in a Simulator

    E-Print Network [OSTI]

    Peli, Eli

    Low Vision Driving With Hemianopia: IV. Head Scanning and Detection at Intersections in a Simulator AR, Ananyev E, Mandel AJ, Goldstein RB, Peli E. Driving with hemianopia: IV. Head scanning) on head scanning behaviors at intersections and evaluated the role of inadequate head scanning

  3. A Real-Time Head Nod and Shake Detector Ashish Kapoor

    E-Print Network [OSTI]

    A Real-Time Head Nod and Shake Detector Ashish Kapoor Affective Computing, MIT Media Lab 20 Ames Media Lab 20 Ames Street, Cambridge, MA 02139 +1-617-253-0369 picard@media.mit.edu ABSTRACT Head nods conversational functions. We describe a vision-based system that detects head nods and head shakes in real time

  4. Using Self-Context for Multimodal Detection of Head Nods in Face-to-Face Interactions

    E-Print Network [OSTI]

    Gatica-Perez, Daniel

    Using Self-Context for Multimodal Detection of Head Nods in Face-to-Face Interactions Laurent gatica@idiap.ch ABSTRACT Head nods occur in virtually every face-to-face discussion. As part communicative attention. Detecting head nods in natural interactions is a challenging task as head nods can

  5. Energy impacts of heat island reduction strategies in the Greater Toronto Area, Canada

    E-Print Network [OSTI]

    Konopacki, Steven; Akbari, Hashem

    2001-01-01

    Energy Effects of Urban Heat Islands and Their Mitigation: aH. Taha. 1990. “Summer Heat Islands, Urban Trees, and WhiteNational Laboratory—Heat Island Group Technical Note. Ber-

  6. Energy Savings Calculations for Heat Island Reduction Strategies in Baton Rouge, Sacramento and Salt Lake City

    E-Print Network [OSTI]

    Konopacki, S.; Akbari, H.

    2000-01-01

    Energy Effects of Urban Heat Islands and Their Mitigation: aNational Laboratory - Heat Island Group Technical Note.of the US EPA’s Urban Heat Island Pilot Project (UHIPP) in

  7. Opportunities for Saving Energy and Improving Air Quality in Urban Heat Islands

    E-Print Network [OSTI]

    Akbari, Hashem

    2008-01-01

    Special Issue on Urban Heat Islands and Cool Communities,Special Issue on Urban Heat Islands and Cool Communities,Energy Effects of Urban Heat Islands and their Mitigation: A

  8. Energy Savings Calculations for Heat Island Reduction Strategies in Baton Rouge, Sacramento and Salt Lake City

    E-Print Network [OSTI]

    Konopacki, S.; Akbari, H.

    2000-01-01

    National Laboratory - Heat Island Group Technical Note.of the US EPA’s Urban Heat Island Pilot Project (UHIPP) in11. Conclusions Impact of Heat Island Reduction Strategies

  9. Energy impacts of heat island reduction strategies in the Greater Toronto Area, Canada

    E-Print Network [OSTI]

    Konopacki, Steven; Akbari, Hashem

    2001-01-01

    H. Taha. 1990. “Summer Heat Islands, Urban Trees, and WhiteNational Laboratory—Heat Island Group Technical Note. Ber-Savings Calculations for Heat Island Reduction Strategies in

  10. opinion: Political erosion dismantles the conservation network existing in the Canary Islands

    E-Print Network [OSTI]

    Fernández?Palacios, José María; de Nascimento, Lea

    2011-01-01

    seagrass meadows in the Canary Islands: a mul? tiscaled genetic diversity in the  Canary  Islands:  A  conservation synthesis for the Canary Islands.   Trends in Ecology and 

  11. U.S. Virgin Islands- Renewable Energy Feed-in-Tariff

    Broader source: Energy.gov [DOE]

    There is a 10 MW limit for aggregate production via feed-in-tariff contracts on the islands of St. Thomas, St. John, Water Island, and other offshore keys and islands and a similar 5 MW limit for...

  12. About Island Press Since 1984, the nonprofit Island Press has been stimulating, shap

    E-Print Network [OSTI]

    Barnosky, Anthony D.

    Change BARRY W. BROOK AND ANTHONY D. BARNOSKY Millennia before the modern biodiversity crisis-a worldwide, and comm unicating the ideas that are essential for solving envi ronmental problems worldwide. With more, the ecosystems we need to survive, the water we drink, and the air we breathe. Island Press gratefully

  13. Grey Island Energy Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar Jump to:Resources JumpStrategy | OpenGreshamGrey Island

  14. Hainan Green Islands Power | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,SolarFERCInformation 3.1 -HachijojimaHaddam,Green Islands

  15. Faroe Islands: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbHFarinello Geothermal Power Station JumpFaroe Islands: Energy Resources

  16. Marshall Islands: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation, searchScotland Jump to:Marshall Islands: Energy Resources

  17. University of Rhode Island | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company) JumpGTZ ClimateFeed JumpAlbertaUniversity ofRhode Island

  18. Block Island Power Co | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin:Pontiac Biomass Facility JumpII JumpBlackfeetBlock Island Power

  19. Block Island Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin:Pontiac Biomass Facility JumpII JumpBlackfeetBlock Island

  20. The island rule and the evolution of body size in the deep sea

    E-Print Network [OSTI]

    Boyer, Alison G.

    & Handley, 2002). Here we test the island rule of body-size evolution in a non- island system, the deep sea

  1. Assessing Pathways in the U.S. Virgin Islands and Hawai'i | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    by Adam Warren, NREL 18953 U.S. Virgin Islands Establishes Interconnection Standards to Clear the Way for Grid Interconnection Energy Transition Initiative: Islands Playbook...

  2. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    water is a concern, so too is proper disposal of wastewater. The Virgin Islands Water Resources Research with cistern water quality, treatment of wastewater from aquaponic systems and sediment export from watersheds Program Introduction 1 #12;Water Quality in Virgin Islands Rain Water Collection Cisterns. Basic

  3. Pacific Islands Fisheries Science Center Ecosystems and Oceanography Division

    E-Print Network [OSTI]

    Hawai'i at Manoa, University of

    Pacific Islands Fisheries Science Center Ecosystems and Oceanography Division Characterization Research Program Réka Domokos #12;Pacific Islands Fisheries Science Center Ecosystems and Oceanography Science Center Ecosystems and Oceanography Division -80 -77 -74 -71 -68 -65 -62 -59 -56 -53 -50 -47 -44 Sv

  4. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    of natural potable water for residents in these islands where cisterns are required by law. Seawater desalination plants supply the water distribution networks that are restricted to certain areas in the islands due to the hilly terrain. Dependence on rainfall and the expensive desalinated water makes Virgin

  5. Aboriginal Education Centre-Turtle Island House Aboriginal Education

    E-Print Network [OSTI]

    ;Aboriginal Education www.uwindsor.ca/aec We look forward to meeting you! Available Services UniversityAboriginal Education Centre-Turtle Island House Aboriginal Education The Aboriginal Education Centre (AEC) - Turtle Island was created in 1992 with the mandate of ensuring that services and programs

  6. Reduction of Islands in Full-pressure Stellarator Equilibria

    SciTech Connect (OSTI)

    S.R. Hudson; D.A. Monticello; A.H. Reiman

    2001-04-30

    The control of magnetic islands is a crucial issue in designing Stellarators. Islands are associated with resonant radial magnetic fields at rational rotational-transform surfaces and can lead to chaos and poor plasma confinement. In this article, we show that variations in the resonant fields of a full-pressure stellarator equilibrium can be related to variations in the boundary via a coupling matrix, and inversion of this matrix determines a boundary modification for which the island content is significantly reduced. The numerical procedure is described and the results of island optimization are presented. Equilibria with islands are computed using the Princeton Iterative Equilibrium Solver, and resonant radial fields are calculated via construction of quadratic-flux-minimizing surfaces. A design candidate for the National Compact Stellarator Experiment [Phys. Plasmas 8, 2001], which has a large island, is used to illustrate the technique. Small variations in the boundary shape are used to reduce island size and to reverse the phase of a major island chain.

  7. ORIGINAL PAPER Vulnerable island carnivores: the endangered endemic

    E-Print Network [OSTI]

    Gompper, Matthew E.

    ) and dwarf coati (Nasua nelsoni) on Cozumel Island, Mexico, we worked island-wide to identify the presence´a-Vasco Instituto de Ecologi´a, A. C., 91070 Xalapa, Veracruz, Mexico e-mail: denise.vasco@posgrado.inecol.edu.mx D´n, 77660 Cozumel, Quintana Roo, Mexico A. D. Cuaro´n Multicriteria SC, Unidad Independencia IMSS, Torre

  8. The Tuna Industry in the Pacific Islands Region

    E-Print Network [OSTI]

    to be at a crossroads. This paper reviews the tuna industry in the Pacific islands region, beginning with the regionThe Tuna Industry in the Pacific Islands Region: Opportunities for Foreign Investment DAVID J. DOULMAN Introduction The international tuna industry is in a state of flux. Since the early 1980's (and

  9. University of Rhode Island Dept. of Electrical and Computer Engineering

    E-Print Network [OSTI]

    Uht, Augustus K.

    University of Rhode Island Dept. of Electrical and Computer Engineering Kelley Hall 4 East Alumni in Synchronous Systems via Timing Error Toleration Augustus K. Uht Department of Electrical and Computer Engineering University of Rhode Island Email: uht@ele.uri.edu Web: www.ele.uri.edu/¸uht March 10, 2000

  10. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    . Historically, rain water harvesting has been a principal source of potable water for the residents of the USVI such as rain water harvesting, alternative on-site sewage disposal systems and investigation of applicableVirgin Islands Water Resources Research Institute Annual Technical Report FY 2011 Virgin Islands

  11. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    are principally of volcanic origin and are consequently relatively mountainous. Historically, rain water such as rain water harvesting, development of alternative on-site sewage disposal systems and investigationVirgin Islands Water Resources Research Institute Annual Technical Report FY 2012 Virgin Islands

  12. Jrgen Richter Hasty Foragers: The Crimea Island and Europe During

    E-Print Network [OSTI]

    Hartmann, Robert

    Jürgen Richter Hasty Foragers: The Crimea Island and Europe During the Last Interglacial Victor conditions in Europe similar to those of the present time, or even a lile more favourable (overview: Van, comparable environments as they prevail today. Hasty Foragers: The Crimea Island and Europe During the Last

  13. Integrated head package cable carrier for a nuclear power plant

    DOE Patents [OSTI]

    Meuschke, Robert E. (Monroeville, PA); Trombola, Daniel M. (Murrysville, PA)

    1995-01-01

    A cabling arrangement is provided for a nuclear reactor located within a containment. Structure inside the containment is characterized by a wall having a near side surrounding the reactor vessel defining a cavity, an operating deck outside the cavity, a sub-space below the deck and on a far side of the wall spaced from the near side, and an operating area above the deck. The arrangement includes a movable frame supporting a plurality of cables extending through the frame, each connectable at a first end to a head package on the reactor vessel and each having a second end located in the sub-space. The frame is movable, with the cables, between a first position during normal operation of the reactor when the cables are connected to the head package, located outside the sub-space proximate the head package, and a second position during refueling when the cables are disconnected from the head package, located in the sub-space. In a preferred embodiment, the frame straddles the top of the wall in a substantially horizontal orientation in the first position, pivots about an end distal from the head package to a substantially vertically oriented intermediate position, and is guided, while remaining about vertically oriented, along a track in the sub-space to the second position.

  14. Wind resource assessment: San Nicolas Island, California

    SciTech Connect (OSTI)

    McKenna, E. [National Renewable Energy Lab., Golden, CO (United States); Olsen, T.L. [Timothy L. Olsen Consulting, (United States)

    1996-01-01

    San Nicolas Island (SNI) is the site of the Navy Range Instrumentation Test Site which relies on an isolated diesel-powered grid for its energy needs. The island is located in the Pacific Ocean 85 miles southwest of Los Angeles, California and 65 miles south of the Naval Air Weapons Station (NAWS), Point Mugu, California. SNI is situated on the continental shelf at latitude N33{degree}14` and longitude W119{degree}27`. It is approximately 9 miles long and 3.6 miles wide and encompasses an area of 13,370 acres of land owned by the Navy in fee title. Winds on San Nicolas are prevailingly northwest and are strong most of the year. The average wind speed is 7.2 m/s (14 knots) and seasonal variation is small. The windiest months, March through July, have wind speeds averaging 8.2 m/s (16 knots). The least windy months, August through February, have wind speeds averaging 6.2 m/s (12 knots).

  15. Miocene structure of Mustang Island, Mustang Island East Addition and part of Matagorda Island, Outer Continental Shelf areas, Gulf of Mexico 

    E-Print Network [OSTI]

    Kasande, Robert

    1995-01-01

    Understanding the Miocene structure of Mustang Island and the neighboring areas in the northwestern Gulf of Mexico helps to increase knowledge of the geology and hence contribute to petroleum exploration and production in the area. Interpretation...

  16. Wave Power Resources off the Hawaiian Islands luisvega@hawaii.edu Wave Resources for Representative Sites Around the Hawaiian Islands

    E-Print Network [OSTI]

    Wave Power Resources off the Hawaiian Islands luisvega@hawaii.edu 1 Wave Resources for Representative Sites Around the Hawaiian Islands Table of Contents Summary p2 Background: Wave Power Conversion p3 Licensing and Permitting p3 Challenges and Barriers p4 Wave Power Resources: Previous Work p5 Wave

  17. Energy Development in Island Nations (EDIN), Partnering to Increase Island Energy Security Around the World (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2010-06-01

    This fact sheet provides an overview of the international partnership for Energy Development in Island nations, including mission, goals, and organization. It also includes background on EDIN's three pilot projects: U.S. Virgin Islands, Iceland-Dominica Collaboration, and New Zealand-Geothermal Potential in the Pacific.

  18. The coolability limits of a reactor pressure vessel lower head

    SciTech Connect (OSTI)

    Theofanous, T.G.; Syri, S. [Univ. of California, Santa Barbara, CA (United States)

    1995-09-01

    Configuration II of the ULPU experimental facility is described, and from a comprehensive set of experiments are provided. The facility affords full-scale simulations of the boiling crisis phenomenon on the hemispherical lower head of a reactor pressure vessel submerged in water, and heated internally. Whereas Configuration I experiments (published previously) established the lower limits of coolability under low submergence, pool-boiling conditions, with Configuration II we investigate coolability under conditions more appropriate to practical interest in severe accident management; that is, heat flux shapes (as functions of angular position) representative of a core melt contained by the lower head, full submergence of the reactor pressure vessel, and natural circulation. Critical heat fluxes as a function of the angular position on the lower head are reported and related the observed two-phase flow regimes.

  19. Distributed Wind Case Study: Cross Island Farms, Wellesley Island, New York (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-04-01

    Installing a small wind turbine can sometimes be difficult due to economics, zoning issues, public perception, and other barriers. Persistence and innovation, however, can result in a successful installation. Dani Baker and David Belding own Cross Island Farms, a 102-acre certified organic farm on Wellesley Island in northern New York. In 2009, they took their interest in renewable energy to the next level by researching the logistics of a small wind installation on their land to make their farm even more sustainable. Their renewable energy system consists of one 10-kilowatt Bergey Excel wind turbine, a solar array, and a propane-powered generator. This case study describes funding for the project and the installation process.

  20. Distributed Wind Case Study: Cross Island Farms, Wellesley Island, New York

    SciTech Connect (OSTI)

    2012-04-30

    Installing a small wind turbine can sometimes be challenging due to economics, zoning issues, public perception, and other barriers. Persistence and innovation, however, can result in a successful installation. Dani Baker and David Belding own Cross Island Farms, a 102-acre certified organic farm on Wellesley Island in northern New York. In 2009, they took their interest in renewable energy to the next level by researching the logistics of a small wind installation on their land to make their farm even more sustainable. Their renewable energy system consists of one 10-kilowatt Bergey Excel wind turbine, a solar array, and a propane-powered generator. This case study describes funding for the project and the installation process.

  1. Kinematic studies of transport across an island wake, with application to the Canary islands

    E-Print Network [OSTI]

    Mathias Sandulescu; Emilio Hernandez-Garcia; Cristobal Lopez; Ulrike Feudel

    2006-05-29

    Transport from nutrient-rich coastal upwellings is a key factor influencing biological activity in surrounding waters and even in the open ocean. The rich upwelling in the North-Western African coast is known to interact strongly with the wake of the Canary islands, giving rise to filaments and other mesoscale structures of increased productivity. Motivated by this scenario, we introduce a simplified two-dimensional kinematic flow describing the wake of an island in a stream, and study the conditions under which there is a net transport of substances across the wake. For small vorticity values in the wake, it acts as a barrier, but there is a transition when increasing vorticity so that for values appropriate to the Canary area, it entrains fluid and enhances cross-wake transport.

  2. Individual Radiation Protection Monitoring in the Marshall Islands: Enewetak Island Resettlement Support (May-December 2001)

    SciTech Connect (OSTI)

    Hamilton, T; Hickman, D; Conrado, C; Brown, T; Brunk, J; Marchetti, A; Cox, C; Martinelli, R; Kehl, S; Johannes, K; Henry, D; Bell, R T; Petersen, G

    2002-06-01

    The US Department of Energy (DOE) has recently implemented a series of strategic initiatives to address long-term radiological surveillance needs at former US test sites in the Marshall Islands. The plan is to engage local atoll communities in developing shared responsibilities for implementing radiation protection programs for resettled and resettling populations. Using pooled resources of the US Department of Energy and local atoll governments, individual radiation protection programs have been developed in whole-body counting and plutonium urinalysis to assess potential intakes of radionuclides from residual fallout contamination. The whole-body counting systems are operated and maintained by Marshallese technicians. Samples of urine are collected from resettlement workers and island residents under controlled conditions and analyzed for plutonium isotopes at the Lawrence Livermore National Laboratory using advanced accelerator based measurement technologies. This web site provides an overview of the methodologies, a full disclosure of the measurement data, and a yearly assessment of estimated radiation doses to resettlement workers and island residents.

  3. Re-evaluating the general dynamic theory of oceanic island biogeography

    E-Print Network [OSTI]

    Steinbauer, Manuel Jonas; Dolos, Klara; Field, Richard; Reineking, Björn; Beierkuhnlein, Carl

    2013-01-01

    oceanic island biogeography integrates temporal changes in ecological circumstances with diversification processes, and has stimulated current

  4. Demographic and genetic structure of fossorial water voles (Arvicola terrestris) on Scottish islands

    E-Print Network [OSTI]

    Lambin, Xavier

    - lations occupying both mainland and island systems are needed. A suitable system in which to compare

  5. Influence of air conditioning management on heat island in Paris air street temperatures

    E-Print Network [OSTI]

    Influence of air conditioning management on heat island in Paris air street temperatures Brice 2012 Available online 13 March 2012 Keywords: Air conditioning Heat island mitigation Urban heat island killer'', is exacerbated in urban areas owing to the heat island effect. Air conditioning (A/C) is a key

  6. Can Microsatellites Be Used to Infer Phylogenies? Evidence from Population Affinities of the Western Canary Island

    E-Print Network [OSTI]

    Thorpe, Roger Stephen

    of the Western Canary Island Lizard (Gallotia galloti) Murielle Richard1 and Roger S. Thorpe2 School of the West- ern Canary Island lacertid (Gallotia galloti) as a model. The geological times of island in 12 populations from four islands (representing five haplotype lineages) was investigated in five

  7. Inferring dispersal: a Bayesian approach to phylogeny-based island biogeography,

    E-Print Network [OSTI]

    García-Barros, Enrique

    , with special reference to the Canary Islands Isabel Sanmarti´n1 *, Paul van der Mark2 and Fredrik Ronquist2,3 1 set of published phylogenies of Canary Island organisms to examine overall dispersal rates archipelagos with special reference to the Atlantic Canary Islands. Methods The Canary Islands were divided

  8. ORIGINAL PAPER The diet of feral cats on islands: a review and a call for more

    E-Print Network [OSTI]

    Zavaleta, Erika

    Santa Cruz de La Palma, Canary Islands, Spain M. Nogales Island Ecology and Evolution Research Group (IPNA-CSIC), Astrofi´sico Francisco Sa´nchez 3, 38206 La Laguna Tenerife, Canary Islands, Spain BORIGINAL PAPER The diet of feral cats on islands: a review and a call for more studies E. Bonnaud

  9. Differences in flower visitation networks between an oceanic and a continental island

    E-Print Network [OSTI]

    Traveset, Anna

    communities of each of two different island systems: the Canary Islands (oceanic origin) and the BalearicDifferences in flower visitation networks between an oceanic and a continental island ROCÍO CASTRO, Mallorca, Balearic Islands, Spain Received 27 May 2013; revised 28 October 2013; accepted for publication

  10. Cats, rabbits, Myxoma virus, and vegetation on Macquarie Island: a comment on Bergstrom et al. (2009)

    E-Print Network [OSTI]

    Krebs, Charles J.

    2009-01-01

    ). Four mammalian pest species occurred on subantarctic Macquarie Island: cats Felis catus L., rabbits

  11. Challenges Ahead Head movements and other social acts in conversations

    E-Print Network [OSTI]

    Theune, Mariët

    Challenges Ahead Head movements and other social acts in conversations Dirk Heylen University of face-to-face interactions. The fact that conversations are a type of joint activity involving social in functions that are served by the multitude of movements that people display during conversations. 1

  12. Running head: Biopsychological Aspects of Motivation Biopsychological Aspects of Motivation

    E-Print Network [OSTI]

    Schultheiss, Oliver C.

    Running head: Biopsychological Aspects of Motivation Biopsychological Aspects of Motivation Oliver, O. C., & Wirth, M. M. (2008). Biopsychological aspects of motivation. In J. Heckhausen & H. Heckhausen (Eds.), Motivation and action (2 ed., pp. 247-271). New York: Cambridge University Press. #12

  13. Running Head: TESTOSTERONE AND POWER Testosterone and power

    E-Print Network [OSTI]

    Schultheiss, Oliver C.

    Running Head: TESTOSTERONE AND POWER Testosterone and power Steven J. Stanton and Oliver C. Schultheiss University of Michigan, Ann Arbor, MI, USA To appear in: K. Dowding (Ed.), Encyclopedia of power-647-9440, email: stantons@umich.edu #12;Testosterone and power 2 Across many studies in humans, two functional

  14. F A C U L T Y DIVISION HEAD

    E-Print Network [OSTI]

    Gering, Jon C.

    F A C U L T Y DIVISION HEAD Lanny C. Morley PROFESSORS Wayne P. Bailey, Robert Cacioppo, Ruthie. Miller, Anthony M. Vazzana, Dana R. Vazzana ASSISTANT PROFESSORS K. Scott Alberts, Don Bindner, Dean De Thatcher INSTRUCTORS Donna J. Bailey, Karen Croarkin, Joe Moyer D E G R E E S O F F E R E D Bachelor

  15. F A C U L T Y DIVISION HEAD

    E-Print Network [OSTI]

    Gering, Jon C.

    F A C U L T Y DIVISION HEAD Lanny C. Morley PROFESSORS Wayne P. Bailey, Robert Cacioppo, Kevin. Scott Alberts, Don Bindner, Dean DeCock, David Garth, Alan Garvey, Carol Hoferkamp, Hyun-Joo Kim FACULTY Yuichi Iwashita, Thomas Tegtmeyer D E G R E E S O F F E R E D Bachelor of Science, BS Bachelor

  16. Recto Running Head 1 Available Potential Energy and Exergy in

    E-Print Network [OSTI]

    Tailleux, Remi

    Recto Running Head 1 Available Potential Energy and Exergy in Stratified Fluids R´emi Tailleux in classi- cal thermodynamics, however, usually relies on the concept of exergy, and is usually measured/eddy decompositions, APE in incompressible fluids, APE and irreversible turbulent mixing, and the role of mechanical

  17. AUTOMATIC AND ROBUST SEMANTIC REGISTRATION OF 3D HEAD SCANS

    E-Print Network [OSTI]

    Eisert, Peter

    useful for error- prone vision techniques like stereo analysis but also for model based repairing for applications such as 3D graphics production and also for computer vision research. Laser scanners are the primeAUTOMATIC AND ROBUST SEMANTIC REGISTRATION OF 3D HEAD SCANS David C. Schneider, Peter Eisert

  18. Data Mining: Where is it Heading? Database Systems Research Laboratory

    E-Print Network [OSTI]

    Han, Jiawei

    Data Mining: Where is it Heading? (Panel) Jiawei Han Database Systems Research Laboratory School of Computing Science Simon Fraser University, B.C., Canada V5A 1S6 E-mail: han@cs.sfu.ca Abstract Data mining on the issues in the field. Data mining has attracted popular interest recently, due to the high demand

  19. Molecular architecture of the prolate head of bacteriophage T4

    E-Print Network [OSTI]

    Rossmann, Michael G.

    -Maklaya Street, Moscow 117997, Russia; and §Department of Biology, Center for Advanced Training in Cell) The head of bacteriophage T4 is a prolate icosahedron with one unique portal vertex to which the phage tail by the portal protein gp20. The prohead contains an internal core made up of the major core protein, gp22

  20. Diffuse optical imaging of the whole head Maria Angela Franceschini

    E-Print Network [OSTI]

    Diffuse optical imaging of the whole head Maria Angela Franceschini Danny K. Joseph Theodore J@nmr.mgh.harvard.edu Abstract. Near-Infrared Spectroscopy NIRS and diffuse optical im- aging DOI are increasingly used to detect of optodes in NIRS instruments has hampered measurement of optical signals from diverse brain regions. Our

  1. Future Choices 1 Running head: EFFECT OF FUTURE CHOICES

    E-Print Network [OSTI]

    Future Choices 1 Running head: EFFECT OF FUTURE CHOICES The Effect of Highlighting Future Choices on Current Preferences Uzma Khan Carnegie Mellon University Ravi Dhar Yale School of Management #12;Future future choices rather than as an isolated choice. Our finding contrasts with the general wisdom

  2. Evaluation of a New Method of Heading Estimation for Pedestrian

    E-Print Network [OSTI]

    Calgary, University of

    Evaluation of a New Method of Heading Estimation for Pedestrian Dead Reckoning Using Shoe Mounted) (Email: Lachapelle@geomatics.ucalgary.ca) In this paper, a novel method of sensor based pedestrian dead with respect to a high accuracy reference trajectory. KEY WORDS 1. Pedestrian Navigation. 2. Dead Reckoning. 1

  3. Head-Tail Modes for Strong Space Charge

    SciTech Connect (OSTI)

    Burov, Alexey

    2008-12-01

    Head-tail modes are described here for the space charge tune shift significantly exceeding the synchrotron tune. General equation for the modes is derived. Spatial shapes of the modes, their frequencies, and coherent growth rates are explored. The Landau damping rates are also found. Suppression of the transverse mode coupling instability by the space charge is explained.

  4. Heading Off Correlated Failures through Independence-as-a-Service

    E-Print Network [OSTI]

    Haller, Gary L.

    Heading Off Correlated Failures through Independence-as-a-Service Ennan Zhai1 Ruichuan Chen2, David Losses Data Center Outages Generate Big Losses Downtime in a data center can cost an average of $505 Operational Trends Report #12;Service Outage Losses Data Center Outages Generate Big Losses Downtime in a data

  5. RENEWABLE RESOURCES Selected SUBJECT HEADINGS for ILink catalog

    E-Print Network [OSTI]

    Kearfott, R. Baker

    renewable energy sources biosphere renewable natural resources environmental policy sustainable agriculture Architecture Stks SB 469 .L3 V.93 Renewable Energy Stks TJ 807 .R46 and online SELECTED PRINT INDEXES (valuableRENEWABLE RESOURCES Selected SUBJECT HEADINGS for ILink catalog agricultural industries landscape

  6. Learning expressive human-like head motion sequences from speech

    E-Print Network [OSTI]

    Busso, Carlos

    With the development of new trends in human-machine interfaces, animated feature films and video games, better avatars and virtual agents are required that more accurately mimic how humans communicate and interact. Gestures the emotional perception of facial animations [6]. Given the importance of head motion in human-human

  7. Non Stationary Operator Selection with Island Models Caner Candan

    E-Print Network [OSTI]

    Goëffon, Adrien

    Non Stationary Operator Selection with Island Models Caner Candan LERIA - Université d'Angers Angers, France caner.candan@univ-angers.fr Adrien Goëffon LERIA - Université d'Angers Angers, France

  8. A Dynamic Island Model for Adaptive Operator Selection Caner Candan

    E-Print Network [OSTI]

    Goëffon, Adrien

    A Dynamic Island Model for Adaptive Operator Selection Caner Candan LERIA - University of Angers Angers, France caner.candan@univ-angers.fr Adrien Goëffon LERIA - University of Angers Angers, France

  9. AN INVESTIGATION OF REMOTELY SENSED URBAN HEAT ISLAND CLIMATOLOGY

    E-Print Network [OSTI]

    Hu, Leiqiu

    2014-08-31

    Satellite remotely sensed temperatures are widely used for urban heat island (UHI) studies. However, the abilities of satellite surface and atmospheric data to assess the climatology of UHI face many unknowns and challenges. ...

  10. Energy Transition Initiative: Island Energy Snapshot - Dominica (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-03-01

    This profile provides a snapshot of the energy landscape of the Commonwealth of Dominica, an island nation located southeast of Guadeloupe and northwest of Martinique in the Lesser Antilles.

  11. Measuring Edinburgh’s Surface Urban Heat Island 

    E-Print Network [OSTI]

    Mackinnon, Kerr A H

    2013-10-27

    This project investigated Edinburgh’s surface urban heat island (SUHI) in relation to land cover and land use. Thermal channels of Landsat TM, Landsat ETM+ and ASTER imagery captured between 1999 and 2011 provide land surface temperatures (LST...

  12. American Samoa's Rebate Program Brings ENERGY STAR to Island

    Broader source: Energy.gov [DOE]

    Thanks to a grant through the American Recovery and Reinvestment Act, residents of American Samoa are able for the first time to purchase ENERGY STAR air conditioners – and for 30 percent off - through the Island's first appliance rebate program.

  13. Rhode Island Natural Gas Underground Storage Injections All Operators...

    U.S. Energy Information Administration (EIA) Indexed Site

    Rhode Island Natural Gas Underground Storage Injections All Operators (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1994 0 0 0 0 0 0 0 0 0 0 0 0 1995 0...

  14. Visual Modeling for Aqua Ventus I off Monhegan Island, ME

    SciTech Connect (OSTI)

    Hanna, Luke A.; Whiting, Jonathan M.; Copping, Andrea E.

    2013-11-27

    To assist the University of Maine in demonstrating a clear pathway to project completion, PNNL has developed visualization models of the Aqua Ventus I project that accurately depict the Aqua Ventus I turbines from various points on Monhegain Island, ME and the surrounding area. With a hub height of 100 meters, the Aqua Ventus I turbines are large and may be seen from many areas on Monhegan Island, potentially disrupting important viewsheds. By developing these visualization models, which consist of actual photographs taken from Monhegan Island and the surrounding area with the Aqua Ventus I turbines superimposed within each photograph, PNNL intends to support the project’s siting and permitting process by providing the Monhegan Island community and various other stakeholders with a probable glimpse of how the Aqua Ventus I project will appear.

  15. DWEA Webinar: Wind-Diesel and Islanded Grids

    Broader source: Energy.gov [DOE]

    DWEA is launching a monthly webinar program to discuss new developments in the industry. During the first webinar, experts will provide information on wind systems in the emerging market of island...

  16. A Simple Technique for Islanding Detection with Negligible Nondetection Zone

    E-Print Network [OSTI]

    Kirtley Jr, James L.

    Although active islanding detection techniques have smaller nondetection zones than passive techniques, active methods could degrade the system power quality and are not as simple and easy to implement as passive methods. ...

  17. A numerical model simulation of longshore transport for Galveston Island 

    E-Print Network [OSTI]

    Gilbreath, Stephen Alexander

    1995-01-01

    The shoreline changes, deposition patterns, and longshore transport rates were calculated for the coast of Galveston Island using a numerical model simulation. The model only simulated changes due to waves creating longshore currents. East Beach...

  18. Fish assemblages on coral reefs in Guanaja, Bay Islands, Honduras 

    E-Print Network [OSTI]

    Mahendran, Christopher Kandiah

    1999-01-01

    Species composition and relative abundance of ichthyofaunal assemblages on reefs surrounding Guanaja, Bay Islands, Honduras were censused from June through December 1996. Transect and random swim surveys were used to characterize community structure...

  19. Renewable Energy and Inter-Island Power Transmission (Presentation)

    SciTech Connect (OSTI)

    Gevorgian, V.

    2011-05-01

    This presentation summarizes recent findings pertaining to inter-island connection of renewable and other energy sources, in particular, as these findings relate cable options, routing, specifications, and pros and cons.

  20. Power Plant Options Report for Thompson Island prepared by the

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    .................................................................... 11 4.1. Hybrid2 ­ A Renewable Power System Model................................................ 11 4.......................................................................... 4 2.3. Thompson Island heating load....................................................................... 7 3. Grid-connected and Autonomous Renewable Power Systems ................................ 9 3

  1. Town of Babylon- Long Island Green Homes Program

    Broader source: Energy.gov [DOE]

    The Long Island Green Homes Program is a self-financing residential retrofit program designed to support a goal of upgrading the energy efficiency of existing homes in the Town of Babylon. The...

  2. PSEG Long Island- Solar Initiative Feed-in Tariff

    Broader source: Energy.gov [DOE]

    The PSEG Long Island Feed-in Tariff II (FIT II) program provides fixed payments for electricity produced by approved photovoltaic systems over a fixed period of time. The program operates under a...

  3. A Presidential Proclamation - Asian American and Pacific Islander...

    Broader source: Energy.gov (indexed) [DOE]

    Islanders have prevailed over adversity and risen to the top of their fields -- from medicine to business to the bench. But even now, too many hardworking AAPI families face...

  4. Quantitative analysis of forest island pattern in selected Ohio landscapes

    SciTech Connect (OSTI)

    Bowen, G.W.; Burgess, R.L.

    1981-07-01

    The purpose of this study was to quantitatively describe the various aspects of regional distribution patterns of forest islands and relate those patterns to other landscape features. Several maps showing the forest cover of various counties in Ohio were selected as representative examples of forest patterns to be quantified. Ten thousand hectare study areas (landscapes) were delineated on each map. A total of 15 landscapes representing a wide variety of forest island patterns was chosen. Data were converted into a series of continuous variables which contained information pertinent to the sizes, shape, numbers, and spacing of woodlots within a landscape. The continuous variables were used in a factor analysis to describe the variation among landscapes in terms of forest island pattern. The results showed that forest island patterns are related to topography and other environmental features correlated with topography.

  5. Energy Design Guidelines for High Performance Schools: Tropical Island Climates

    SciTech Connect (OSTI)

    2004-11-01

    Design guidelines outline high performance principles for the new or retrofit design of K-12 schools in tropical island climates. By incorporating energy improvements into construction or renovation plans, schools can reduce energy consumption and costs.

  6. Rules and Regulations for Sewage Sludge Management (Rhode Island)

    Broader source: Energy.gov [DOE]

    The purpose of these rules and regulations is to ensure that sewage sludge that is treated, land applied, disposed, distributed, stockpiled or transported in the State of Rhode Island is done so in...

  7. Distribution, Growth, and Disturbance of Catalina Island Rhodoliths

    E-Print Network [OSTI]

    Tompkins, Paul Anthony

    2011-01-01

    seasonality. Sedimentology 41: 963-984 Friewald A (1998)Godinez-Orta L (2006) Sedimentology and acoustic mapping ofIsland, New Zealand. Sedimentology 55: 249-274 Orth RJ (

  8. Quaternary morphology and paleoenvironmental records of carbonate islands

    E-Print Network [OSTI]

    Toomey, Michael (Michael Ryan)

    2014-01-01

    Here I use a simple numerical model of reef profile evolution to show that the present-day morphology of carbonate islands has developed largely in response to late Pleistocene sea level oscillations in addition to variable ...

  9. Stereo-Based Head Pose Tracking Using Iterative Closest Point and Normal Flow Constraint

    E-Print Network [OSTI]

    Morency, Louis-Philippe

    2003-05-01

    In this text, we present two stereo-based head tracking techniques along with a fast 3D model acquisition system. The first tracking technique is a robust implementation of stereo-based head tracking designed for ...

  10. Neural compass or epiphenomenon? Experimental and theoretical investigations into the rodent head direction cell system 

    E-Print Network [OSTI]

    van der Meer, Matthijs

    2007-11-28

    How does the brain convert sensory information into abstract representations that can support complex behaviours? The rodent head-direction (HD) system, whose cell ensembles represent head direction in the horizontal plane, ...

  11. Obtaining parsimonious hydraulic conductivity fields using head and transport observations: A Bayesian

    E-Print Network [OSTI]

    Barrash, Warren

    Obtaining parsimonious hydraulic conductivity fields using head and transport observations parameter values (hydraulic conductivity in this case) which, in turn, determine flow paths. This work (2009), Obtaining parsimonious hydraulic conductivity fields using head and transport observations

  12. Geostatistical inference of hydraulic conductivity and dispersivities from hydraulic heads and tracer data

    E-Print Network [OSTI]

    Cirpka, Olaf Arie

    Geostatistical inference of hydraulic conductivity and dispersivities from hydraulic heads; accepted 25 April 2006; published 10 August 2006. [1] In groundwater, hydraulic heads and solute arrival times depend primarily on the hydraulic conductivity field and hydraulic boundary conditions. The spread

  13. Numerical Simulation of the Head/Disk Interface for Patterned Media

    E-Print Network [OSTI]

    Murthy, Aravind N.; Duwensee, Maik; Talke, Frank E.

    2010-01-01

    ying head slider bearings in magnetic hard disk drives. ASMEfor ?ying head slider bearings in magnetic storage. ASME J.slider Á Magnetic data storage Á Slider air bearing Á Finite

  14. Leakage Rate and Hydraulic Head Change Evaluation through Conduits in Deep Storage Aquifers 

    E-Print Network [OSTI]

    Islam, Jinia

    2015-04-13

    mathematical model for estimating leakage rate by hydraulic head change evaluation through different conduits or leakage pathways coupled with an injection well. The leakage rate is estimated using Darcy’s law by evaluating hydraulic head change between...

  15. Amchitka Island, Alaska, Biological Monitoring Report 2011 Sampling Results

    SciTech Connect (OSTI)

    2013-09-01

    The Long-Term Surveillance and Maintenance (LTS&M) Plan for the U.S. Department of Energy (DOE) Office of Legacy Management (LM) Amchitka Island sites describes how LM plans to conduct its mission to protect human health and the environment at the three nuclear test sites located on Amchitka Island, Alaska. Amchitka Island, near the western end of the Aleutian Islands, is approximately 1,340 miles west-southwest of Anchorage, Alaska. Amchitka is part of the Aleutian Island Unit of the Alaska Maritime National Wildlife Refuge, which is administered by the U.S. Fish and Wildlife Service (USFWS). Since World War II, Amchitka has been used by multiple U.S. government agencies for various military and research activities. From 1943 to 1950, it was used as a forward air base for the U.S. Armed Forces. During the middle 1960s and early 1970s, the U.S. Department of Defense (DOD) and the U.S. Atomic Energy Commission (AEC) used a portion of the island as a site for underground nuclear tests. During the late 1980s and early 1990s, the U.S. Navy constructed and operated a radar station on the island. Three underground nuclear tests were conducted on Amchitka Island. DOD, in conjunction with AEC, conducted the first nuclear test (named Long Shot) in 1965 to provide data that would improve the United States' capability of detecting underground nuclear explosions. The second nuclear test (Milrow) was a weapons-related test conducted by AEC in 1969 as a means to study the feasibility of detonating a much larger device. Cannikin, the third nuclear test on Amchitka, was a weapons-related test detonated on November 6, 1971. With the exception of small concentrations of tritium detected in surface water shortly after the Long Shot test, radioactive fission products from the tests remain in the subsurface at each test location As a continuation of the environmental monitoring that has taken place on Amchitka Island since before 1965, LM in the summer of 2011 collected biological and seawater samples from the marine and terrestrial environment of Amchitka Island adjacent to the three detonation sites and at a background or reference site, Adak Island, 180 miles to the east. Consistent with the goals of the Amchitka LTS&M Plan, four data quality objectives (DQOs) were developed for the 2011 sampling event.

  16. Timing of the Three Mile Island Unit 2 core degradation as determined by forensic engineering

    SciTech Connect (OSTI)

    Henrie, J.O. (Hydrogen Control, Inc., Panguitch, UT (USA))

    1988-01-01

    Unlike computer simulation of an event, forensic engineering is the evaluation of recorded data and damaged as well as surviving components after an event to determine progressive causes of the event. Such an evaluation of the 1979 Three Mile Island Unit 2 accident indicates that gas began accumulating in steam, generator A at 6:10, or 130 min into the accident and, therefore, fuel cladding ruptures and/or zirconium-water reactions began at that time. Zirconium oxidation/hydrogen generation rates were highest ({approximately}70 kg of hydrogen per minute) during the core quench and collapse at 175 min. By 180 min, over 85% of the hydrogen generated by the zirconium-water reaction had been produced, and {approximately}400 kg of hydrogen had accumulated in the reactor coolant system. At that time, hydrogen concentrations at the steam/water interfaces in both steam generators approached 90%. By 203 min, the damaged reactor core had been reflooded and has not been uncovered since that time. Therefore, the core was completely under water at 225 min, when molten core material flowed into the lower head of the reactor vessel. 10 refs., 7 figs., 1 tab.

  17. Diversification processes in an island radiation of shrews

    E-Print Network [OSTI]

    Esselstyn, Jacob Aaron

    2010-04-22

    , and thus are subjt to phylogenetic study. Whatever the cause, most 16 studis investigang the tempo of diversifcation examine continental raditions and 17 many have inferred t putative density-dependent patern (McPek 2008; Philimore and 18 Price 2008...; Pric 2008). Although island funas have ben the focus of intensive study 19 by evolutionary biologist, i remins an open question wtr declining rats of 20 diversifcation is the norm in island archipelagos, where tre a enormous opportunities 21...

  18. Investigation of the effect of shock, vibration, surface texture and surface pattern on the dynamics of the head disk interface

    E-Print Network [OSTI]

    Murthy, Aravind N.

    2007-01-01

    Corrections for Very Low Spacing at the Head Disk InterfaceS, "Low Stiction/Low Glide Height Head Disk Interface forCorrections for Very Low Spacing at the Head Disk Interface

  19. Aleutian Pribilof Islands Wind Energy Feasibility Study

    SciTech Connect (OSTI)

    Bruce A. Wright

    2012-03-27

    Under this project, the Aleutian Pribilof Islands Association (APIA) conducted wind feasibility studies for Adak, False Pass, Nikolski, Sand Point and St. George. The DOE funds were also be used to continue APIA's role as project coordinator, to expand the communication network quality between all participants and with other wind interest groups in the state and to provide continued education and training opportunities for regional participants. This DOE project began 09/01/2005. We completed the economic and technical feasibility studies for Adak. These were funded by the Alaska Energy Authority. Both wind and hydro appear to be viable renewable energy options for Adak. In False Pass the wind resource is generally good but the site has high turbulence. This would require special care with turbine selection and operations. False Pass may be more suitable for a tidal project. APIA is funded to complete a False Pass tidal feasibility study in 2012. Nikolski has superb potential for wind power development with Class 7 wind power density, moderate wind shear, bi-directional winds and low turbulence. APIA secured nearly $1M from the United States Department of Agriculture Rural Utilities Service Assistance to Rural Communities with Extremely High Energy Costs to install a 65kW wind turbine. The measured average power density and wind speed at Sand Point measured at 20m (66ft), are 424 W/m2 and 6.7 m/s (14.9 mph) respectively. Two 500kW Vestas turbines were installed and when fully integrated in 2012 are expected to provide a cost effective and clean source of electricity, reduce overall diesel fuel consumption estimated at 130,000 gallons/year and decrease air emissions associated with the consumption of diesel fuel. St. George Island has a Class 7 wind resource, which is superior for wind power development. The current strategy, led by Alaska Energy Authority, is to upgrade the St. George electrical distribution system and power plant. Avian studies in Nikolski and Sand Point have allowed for proper wind turbine siting without killing birds, especially endangered species and bald eagles. APIA continues coordinating and looking for funding opportunities for regional renewable energy projects. An important goal for APIA has been, and will continue to be, to involve community members with renewable energy projects and energy conservation efforts.

  20. Head-mounted mobility aid for low vision using scene classification techniques M R Everingham1

    E-Print Network [OSTI]

    Everingham, Mark

    Head-mounted mobility aid for low vision using scene classification techniques M R Everingham1 , B by over 100% using the system. Keywords: Low Vision, Mobility Aids, Head Mounted Display, Object-network classifier is used to identify objects in images from a head mounted camera so that scene content

  1. Tracking Head Yaw by Interpolation of Template Responses Mario Romero and Aaron Bobick

    E-Print Network [OSTI]

    Haro, Antonio

    time large range head yaw given a single non-calibrated monocular grayscale low resolution imageTracking Head Yaw by Interpolation of Template Responses Mario Romero and Aaron Bobick College sequence of the head. The architecture is composed of five parallel template detectors, a Radial Basis

  2. Differences in Head Orientation Behavior for Speakers and Listeners: An Experiment in a Virtual Environment

    E-Print Network [OSTI]

    Theune, Mariët

    the speaker from the listeners. However, the human speaker identification results were rather low. Head2 Differences in Head Orientation Behavior for Speakers and Listeners: An Experiment in a Virtual good stimulus control. Head orientations were displayed as the only cue for focus attention

  3. Mime: Compact, Low-Power 3D Gesture Sensing for Interaction with Head-Mounted Displays

    E-Print Network [OSTI]

    Goyal, Vivek K

    Mime: Compact, Low-Power 3D Gesture Sensing for Interaction with Head-Mounted Displays Andrea Colac of Technology Figure 1: Mime is a compact, low power sensor for 3D gestural control of head mounted displays, a compact, low-power 3D sensor for unen- cumbered free-form, single-handed gestural interaction with head

  4. Simple, Robust and Accurate Head-Pose Tracking Using a Single Camera

    E-Print Network [OSTI]

    Ward, Koren

    low-cost head-pose tracking system developed. Furthermore, our system is robust and re- quiresSimple, Robust and Accurate Head-Pose Tracking Using a Single Camera Simon Meers, Koren Ward of the head in real time is finding increasing application in avionics, virtual reality, augmented reality

  5. Facial Expression Invariant Head Pose Normalization using Gaussian Process Ognjen Rudovic

    E-Print Network [OSTI]

    Theune, Mariët

    into a head-pose space defined by a low dimensional manifold attained by means of multi-class LDA. ThenFacial Expression Invariant Head Pose Normalization using Gaussian Process Regression Ognjen for facial- expression-invariant head pose normalization. We address the problem by mapping the locations

  6. Converting Commodity Head-Mounted Displays for Optical See-Through Augmented Reality

    E-Print Network [OSTI]

    Pollefeys, Marc

    head-mounted display. Project achieves wide field of view and low latency augmented reality displayConverting Commodity Head-Mounted Displays for Optical See-Through Augmented Reality The Challenge The current market for fully immersive virtual reality head- mounted displays is rapidly expanding, however

  7. Design of a polarized head-mounted projection display using ferroelectric liquid-crystal-on-silicon

    E-Print Network [OSTI]

    Hua, Hong

    - gravated in head-mounted projection displays in which multiple beam splitting and low retroreflectanceDesign of a polarized head-mounted projection display using ferroelectric liquid 2008 It has been a common problem in optical see-through head-mounted displays that the displayed image

  8. Articulatory features for speech-driven head motion synthesis Atef Ben-Youssef 1

    E-Print Network [OSTI]

    Edinburgh, University of

    the very low frame-wise correlations they found between the speech and head motion features, it was shownArticulatory features for speech-driven head motion synthesis Atef Ben-Youssef 1 , Hiroshi investigates the use of articulatory features for speech-driven head motion synthesis as opposed to prosody fea

  9. IEEE TRANSACTIONS ON AUDIO, SPEECH AND LANGUAGE PROCESSING 1 Rigid Head Motion in Expressive Speech

    E-Print Network [OSTI]

    Deng, Zhigang

    animations to effectively mimic human behaviors. In this paper, head motion sequences in expressive facial, IEEE Abstract Rigid head motion is a gesture that conveys important non-verbal information in human head motion and hand movements are combined in a non-trivial manner, as they unfold in natural human

  10. Classifying Facial Gestures in Presence of Head Motion Wei-Kai Liao and Isaac Cohen

    E-Print Network [OSTI]

    Southern California, University of

    expressions of a moving head. We present a systematic framework to analyze and classify the facial gestures. After estimating the head pose, the human face is modeled by a collection of face's regionsClassifying Facial Gestures in Presence of Head Motion Wei-Kai Liao and Isaac Cohen Institute

  11. In-Your-Face, Yet Unseen? Improving Head-Stabilized Warnings to Reduce Reaction Time

    E-Print Network [OSTI]

    studies in a driving simulator, comparing different warning visualizations in a head-up display (HUD compared to the HUD. Our insights can help others design better head- stabilized notifications. Author, we conducted two studies, comparing equally large HMD (head- stabilized) and HUD (cockpit

  12. Single-channel Head Orientation Estimation Based on Discrimination of Acoustic Transfer Function

    E-Print Network [OSTI]

    Takiguchi, Tetsuya

    of this method has been confirmed by talker localiza- tion and head orientation estimation experiments performed transfer function 1. Introduction For human-human or human-computer interaction, the talker's head on the talker's head orientation. Other approaches focus on the radiation pat- tern of the magnitude for each

  13. USE OF GCLS TO CONTROL LEAKAGE THROUGH GEOMEMBRANE DEFECTS UNDER HIGH HYDRAULIC HEADS

    E-Print Network [OSTI]

    Zornberg, Jorge G.

    USE OF GCLS TO CONTROL LEAKAGE THROUGH GEOMEMBRANE DEFECTS UNDER HIGH HYDRAULIC HEADS Christine T liners under conditions representative of dams (i.e., high hydraulic heads). Specifically, the objective of interface contact, hydraulic head, and GCL hydration procedures on the leakage rate were considered

  14. A Demonstrated Optical Tracker With Scalable Work Area for Head-Mounted Display Systems

    E-Print Network [OSTI]

    Pollefeys, Marc

    A Demonstrated Optical Tracker With Scalable Work Area for Head- Mounted Display Systems Mark Ward Hall University of North Carolina Chapel Hill, NC 27599-3175 Abstract An optoelectronic head of an optoelectronic head-tracking concept developed at the University of North Carolina at Chapel Hill. In the concept

  15. Two dedicated software, voxel-based, anthropomorphic (torso and head) phantoms.

    E-Print Network [OSTI]

    Duncan, James S.

    1 Two dedicated software, voxel-based, anthropomorphic (torso and head) phantoms. I. George Zubal with isotropic voxel dimensions of 2.5 mms. Secondly, a dedicated head phantom was created by similar processing isotropic voxel dimensions of 1.5mm. This dedicated head phantom contains 62 index numbers designating

  16. Amphibians and Reptiles, Luzon Island, Aurora Province and Aurora Memorial National Park, Northern Philippines: New island distribution records

    E-Print Network [OSTI]

    Brown, Rafe M.

    2011-01-01

    We report 35 new amphibian and reptile distribution records for two regions within the southern Sierra Madre Mountain Range, Aurora Province, central Luzon Island, Philippines. Together with results of our previous survey work in Aurora, our new...

  17. Approaching the Island of Inversion: 34P

    SciTech Connect (OSTI)

    Bender, P.C.; Hoffman, C.R.; Wiedeking, M.; Allmond, J.M.; Bernstein, L.A.; Burke, J.T.; Bleuel, D.L.; Clark, R.M.; Fallon, P.; Goldblum, B.L.; Hinners, T.A.; Jeppesen, H.B.; Lee, Sangjin; Lee, I.Y.; Lesher, S.R.; Machiavelli, A.O.; McMahan, M.A.; Morris, D.; Perry, M.; Phair, L.; Scielzo, N.D.; Tabor, S.L.; Tripathi, Vandana; Volya, A.

    2011-06-14

    Yrast states in 34P were investigated using the 18O(18O,pn) reaction at energies of 20, 24, 25, 30, and 44 MeV at Florida State University and at Lawrence Berkeley National Laboratory. The level scheme was expanded, ray angular distributions were measured, and lifetimes were inferred with the Doppler-shift attenuation method by detecting decay protons in coincidence with one or more rays. The results provide a clearer picture of the evolution of structure approaching the 'Island of Inversion', particularly how the 1 and 2 particle-hole (ph) states fall in energy with increasing neutro number approaching inversion. However, the agreement of the lowest few states with pure sd shell model predictions shows that the level scheme of 34P is not itself inverted. Rather, the accumulated evidence indicates that the 1-ph states start at 2.3 MeV. A good candidate for the lowest 2-ph state lies at 6236 keV, just below the neutron separation energy of 6291 keV. Shell model calculations made using a small modification of the WBP interaction reproduce the negative-parity, 1-ph states rather well.

  18. An updated dose assessment for Rongelap Island

    SciTech Connect (OSTI)

    Robison, W.L.; Conrado, C.L.; Bogen, K.T.

    1994-07-01

    We have updated the radiological dose assessment for Rongelap Island at Rongelap Atoll using data generated from field trips to the atoll during 1986 through 1993. The data base used for this dose assessment is ten fold greater than that available for the 1982 assessment. Details of each data base are presented along with details about the methods used to calculate the dose from each exposure pathway. The doses are calculated for a resettlement date of January 1, 1995. The maximum annual effective dose is 0.26 mSv y{sup {minus}1} (26 mrem y{sup {minus}1}). The estimated 30-, 50-, and 70-y integral effective doses are 0.0059 Sv (0.59 rem), 0.0082 Sv (0.82 rem), and 0.0097 Sv (0.97 rem), respectively. More than 95% of these estimated doses are due to 137-Cesium ({sup 137}Cs). About 1.5% of the estimated dose is contributed by 90-Strontium ({sup 90}Sr), and about the same amount each by 239+240-Plutonium ({sup 239+240}PU), and 241-Americium ({sup 241}Am).

  19. Using Cool Roofs to Reduce Energy Use, Greenhouse Gas Emissions, and Urban Heat-island Effects: Findings from an India Experiment

    E-Print Network [OSTI]

    Akbari, Hashem

    2011-01-01

    below: ?Urban Heat Islands and Mitigation Technologies?India ?Urban Heat Islands and Mitigation Technologies?India ?Urban Heat Islands and Mitigation Technologies? India

  20. STRAWBERRY ISLAND PHASE III EROSION CONTROL AND WETLAND HABITAT RESTORATION: A CASE STUDY IN THE SUCCESSFUL APPLICATION OF IN-LIEU FEE MITIGATION

    E-Print Network [OSTI]

    Spierto, Timothy J.; Lazazzero, Sarah A.; Nelson, Patricia L.

    2003-01-01

    Corporation. 1988. Strawberry Island Draft Report. Barrow,1996. Bossert, H. D. 1973. Strawberry Island, Theories as to1998. Geologic Study or Strawberry Island, Niagara River,

  1. Using Cool Roofs to Reduce Energy Use, Greenhouse Gas Emissions, and Urban Heat-island Effects: Findings from an India Experiment

    E-Print Network [OSTI]

    Akbari, Hashem

    2011-01-01

    from heat island control ..Taha, H. 1990. "Summer Heat Islands, Urban Trees, and WhiteGas Emissions, and Urban Heat- island Effects: Findings from

  2. Augmented saliency model using automatic 3D head pose detection and learned gaze following in natural scenes

    E-Print Network [OSTI]

    Itti, Laurent

    a combination of gaze fol- lowing, head region, and bottom-up saliency maps with a Markov chain composed of head

  3. Analysis of head pose, faces, and eye dynamics in images and videos : a multilevel framework and algorithms

    E-Print Network [OSTI]

    Wu, Junwen

    2007-01-01

    II.C. Head Pose Estimation . . . . . . . . . . . . II.D.V.D.1. Stage 1: “Coarse” Pose Estimation . . . . . . . . . .Chapter V Two Stage Head Pose Estimation: Framework and

  4. Investigation of the effect of shock, vibration, surface texture and surface pattern on the dynamics of the head disk interface

    E-Print Network [OSTI]

    Murthy, Aravind N.

    2007-01-01

    Flying Head Slider Bearings in Magnetic Hard Disk Drives”,Flying Head Slider Bearings in Magnetic Storage”, ASME J.of textured air bearing sliders for magnetic recording

  5. Integrated hydraulic cooler and return rail in camless cylinder head

    DOE Patents [OSTI]

    Marriott, Craig D. (Clawson, MI); Neal, Timothy L. (Ortonville, MI); Swain, Jeff L. (Flushing, MI); Raimao, Miguel A. (Colorado Springs, CO)

    2011-12-13

    An engine assembly may include a cylinder head defining an engine coolant reservoir, a pressurized fluid supply, a valve actuation assembly, and a hydraulic fluid reservoir. The valve actuation assembly may be in fluid communication with the pressurized fluid supply and may include a valve member displaceable by a force applied by the pressurized fluid supply. The hydraulic fluid reservoir may be in fluid communication with the valve actuation assembly and in a heat exchange relation to the engine coolant reservoir.

  6. In-plane electric fields in magnetic islands during collisionless magnetic reconnection

    SciTech Connect (OSTI)

    Chen Lijen; Bhattacharjee, Amitava; Torbert, Roy B.; Bessho, Naoki; Daughton, William; Roytershteyn, Vadim

    2012-11-15

    Magnetic islands are a common feature in both the onset and nonlinear evolution of magnetic reconnection. In collisionless regimes, the onset typically occurs within ion-scale current layers leading to the formation of magnetic islands when multiple X lines are involved. The nonlinear evolution of reconnection often gives rise to extended electron current layers (ECL) which are also unstable to formation of magnetic islands. Here, we show that the excess negative charge and strong out-of-plane electron velocity in the ECL are passed on to the islands generated therein, and that the corresponding observable distinguishing the islands generated in the ECL is the strongly enhanced in-plane electric fields near the island core. The islands formed in ion-scale current layers do not have these properties of the ECL-generated islands. The above result provides a way to assess the occurrence and importance of extended ECLs that are unstable to island formation in space and laboratory plasmas.

  7. Reactor pressure vessel head vents and methods of using the same

    DOE Patents [OSTI]

    Gels, John L; Keck, David J; Deaver, Gerald A

    2014-10-28

    Internal head vents are usable in nuclear reactors and include piping inside of the reactor pressure vessel with a vent in the reactor upper head. Piping extends downward from the upper head and passes outside of the reactor to permit the gas to escape or be forcibly vented outside of the reactor without external piping on the upper head. The piping may include upper and lowers section that removably mate where the upper head joins to the reactor pressure vessel. The removable mating may include a compressible bellows and corresponding funnel. The piping is fabricated of nuclear-reactor-safe materials, including carbon steel, stainless steel, and/or a Ni--Cr--Fe alloy. Methods install an internal head vent in a nuclear reactor by securing piping to an internal surface of an upper head of the nuclear reactor and/or securing piping to an internal surface of a reactor pressure vessel.

  8. Examples of cooler reflective streets for urban heat-island mitigation : Portland cement concrete and chip seals

    E-Print Network [OSTI]

    Pomerantz, M.; Akbari, H.; Chang, S.-C.; Levinson, R.; Pon, B.

    2003-01-01

    1995). “Mitigation of Urban Heat Islands: Materials, UtilityStreets for Urban Heat-Island Mitigation: Portland CementR. Levinson and B. Pon Heat Island Group Energy Analysis

  9. Evolution in the Canary Islands. I. Phylogenetic Relations in the Genus Echium (Boraginaceae) as Shown by Trichome Development

    E-Print Network [OSTI]

    Bradshaw, William E.

    Evolution in the Canary Islands. I. Phylogenetic Relations in the Genus Echium (Boraginaceae-threespeciesofEchiumfromthe Canary Islands and Madeira werestudiedin orderto relate growthformtoevolutionarystatusand ecology hypothesisoftheevolutionofannualplants,and ofitsopposite,thetheoryofinsularwoodiness. Introduction The Canary Islands have long been

  10. COMPARISON OF THE FATE OF DISSOLVED ORGANIC MATTER IN TWO COASTAL SYSTEMS: HOG ISLAND BAY, VA (USA)

    E-Print Network [OSTI]

    Lawrence, Deborah

    COMPARISON OF THE FATE OF DISSOLVED ORGANIC MATTER IN TWO COASTAL SYSTEMS: HOG ISLAND BAY, VA (USA) AND PLUM ISLAND SOUND, MA (USA) A Thesis Presented to The Faculty of the School of Marine Science............................... 55 DISCUSSION ................................................................... 57 Plum Island

  11. Statistics of the Island-Around-Island Hierarchy in Hamiltonian Phase Space

    E-Print Network [OSTI]

    Or Alus; Shmuel Fishman; James D. Meiss

    2014-12-10

    The phase space of a typical Hamiltonian system contains both chaotic and regular orbits, mixed in a complex, fractal pattern. One oft-studied phenomenon is the algebraic decay of correlations and recurrence time distributions. For area-preserving maps, this has been attributed to the stickiness of boundary circles, which separate chaotic and regular components. Though such dynamics has been extensively studied, a full understanding depends on many fine details that typically are beyond experimental and numerical resolution. This calls for a statistical approach, the subject of the present work. We calculate the statistics of the boundary circle winding numbers, contrasting the distribution of the elements of their continued fractions to that for uniformly selected irrationals. Since phase space transport is of great interest for dynamics, we compute the distributions of fluxes through island chains. Analytical fits show that the "level" and "class" distributions are distinct, and evidence for their universality is given.

  12. Undersea line planned to transmit to an island

    SciTech Connect (OSTI)

    Not Available

    1993-08-09

    The electric utility serving Nantucket Island in Massachusetts, which until now has generated its own power, plans to lay 25 miles of transmission cable to connect with New England's mainland grid. The line will allow the utility to purchase less costly power and retire several old generators, improving both reliability and air quality on the island. Nantucket Electric Co. says the 33-Mw submarine link, costing at least $23 million, probably will connect with a line near the elbow on Cape Cod. The undersea cable will be as deep as 60 ft. Nantucket Electric plans to form a partnership within a few months with a mainland utility or private producer that would help finance the project and sell the power. The island utility has preliminary approval by the state Industrial Finance Agency for a tax-exempt bond issue to finance the cable, contingent on its finding a partner.

  13. A PRELIMINARY SURVEY OF APOIDEA (ANTHOPHILA) AND THEIR USE OF FLORAL RESOURCES ON THE ISLAND OF MO'OREA, FRENCH POLYNESIA

    E-Print Network [OSTI]

    Rejas, Daniel

    2008-01-01

    disharmonic nature of island systems of the Pacific, whereas is the case in many island systems (Barrett et al. 1996,

  14. Remedial Action Work Plan Amchitka Island Mud Pit Closures

    SciTech Connect (OSTI)

    DOE/NV

    2001-04-05

    This remedial action work plan presents the project organization and construction procedures developed for the performance of the remedial actions at U.S. Department of Energy (DOE's) sites on Amchitka Island, Alaska. During the late1960s and early 1970s, the U.S. Department of Defense and the U.S. Atomic Energy Commission (the predecessor agency to DOE) used Amchitka Island as a site for underground nuclear tests. A total of nine sites on the Island were considered for nuclear testing; however, tests were only conducted at three sites (i.e., Long Shot in 1965, Milrow in 1969, and Cannikin in 1971). In addition to these three sites, large diameter emplacement holes were drilled in two other locations (Sites D and F) and an exploratory hole was in a third location (Site E). It was estimated that approximately 195 acres were disturbed by drilling or preparation for drilling in conjunction with these activities. The disturbed areas include access roads, spoil-disposal areas, mud pits which have impacted the environment, and an underground storage tank at the hot mix plant which was used to support asphalt-paving operations on the island. The remedial action objective for Amchitka Island is to eliminate human and ecological exposure to contaminants by capping drilling mud pits, removing the tank contents, and closing the tank in place. The remedial actions will meet State of Alaska regulations, U.S. Fish and Wildlife Service refuge management goals, address stakeholder concerns, and address the cultural beliefs and practices of the native people. The U.S. Department of Energy, Nevada Operations Office will conduct work on Amchitka Island under the authority of the Comprehensive Emergency Response, Compensation, and Liability Act. Field activities are scheduled to take place May through September 2001. The results of these activities will be presented in a subsequent Closure Report.

  15. Hotspots within hotspots? Hammerhead shark movements around Wolf Island, Galapagos Marine Reserve

    E-Print Network [OSTI]

    Hearn, Alex; Ketchum, James; Klimley, A. Peter; Espinoza, Eduardo; Peñaherrera, Cesar

    2010-01-01

    showing major islands and oceanic currents affecting itsOceanic islands, like seamounts, provide structure to both ocean bathymetry and currentcurrent (Barton 2001). Enhanced primary production downstream of oceanic

  16. A multi-proxy approach to assessing isolation basin stratigraphy from the Lofoten Islands, Norway

    E-Print Network [OSTI]

    Bradley, Raymond S.

    A multi-proxy approach to assessing isolation basin stratigraphy from the Lofoten Islands, Norway Lofoten Islands Norway This study takes a comprehensive approach to characterizing the isolation sequence source. Methods of characterizing isolation basin stratigraphy traditionally rely on microfossil

  17. Energy Transition Initiative: Island Energy Snapshot - Saint Martin/Sint Maarten

    SciTech Connect (OSTI)

    2015-09-01

    This profile provides a snapshot of the energy landscape of the northeast Caribbean island Saint Martin. The island is divided between two nations, France in the north (Saint-Martin) and the Netherlands in the south (Sint Maarten).

  18. Energy Transition Initiative: Island Energy Snapshot - St. Kitts & Nevis; NREL (National Renewable Energy Laboratory)

    SciTech Connect (OSTI)

    2015-03-01

    This profile provides a snapshot of the energy landscape of the Federation of St. Christopher (St. Kitts) and Nevis - two islands located in the Leeward Islands in the West Indies.

  19. U.S. Virgin Islands Ramping Up Clean Energy Efforts with an Eye...

    Energy Savers [EERE]

    U.S. Virgin Islands Ramping Up Clean Energy Efforts with an Eye Toward a Sustainable Future U.S. Virgin Islands Ramping Up Clean Energy Efforts with an Eye Toward a Sustainable...

  20. Modeling Microgrid Islanding Problems as DCOPs Saurabh Gupta, William Yeoh, Enrico Pontelli

    E-Print Network [OSTI]

    Yeoh, William

    Modeling Microgrid Islanding Problems as DCOPs Saurabh Gupta, William Yeoh, Enrico Pontelli, we formulate the microgrid islanding problem as distributed constraint optimization problem (DCOP the potential of distributed constraint reasoning paradigm as a candidate for solving common microgrids problems

  1. U.S. Coast Guard, Kodiak Island, Alaska | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    U.S. Coast Guard, Kodiak Island, Alaska October 7, 2013 - 2:01pm Addthis Photo of new boiler at Kodiak Island facility The first delivery order included upgrades to the steam...

  2. U.S. Virgin Islands Wind Resources Update 2014 (Technical Report...

    Office of Scientific and Technical Information (OSTI)

    U.S. Virgin Islands Wind Resources Update 2014 Citation Details In-Document Search Title: U.S. Virgin Islands Wind Resources Update 2014 This report summarizes the data collected...

  3. Distribution and abundance of endangered Florida Key deer on outer islands 

    E-Print Network [OSTI]

    Watts, Dominque Elijah

    2007-04-25

    -based survey data. All outer islands exhibited estimated abundances considerably below carrying capacities, with larger populations occurring closer to Big Pine Key. Results indicated that other islands and complexes such as Ramrod Key, Water Key...

  4. Review Article Seismic sequence near Zakynthos Island, Greece, April 2006: Identification of the

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    Review Article Seismic sequence near Zakynthos Island, Greece, April 2006: Identification of Patras, Seismological Laboratory, Patras, Greece b Charles University, Faculty of Mathematics and Physics Zakynthos Island The April 2006 earthquake sequence near Zakynthos (Western Greece) is analysed to identify

  5. Management of the coastal zone in Small Island Developing States; coastal defences and sustainable tourism 

    E-Print Network [OSTI]

    Chambers, Jennifer

    2014-11-27

    Barbados, as with many Small Island Developing States has a tourism-dependent economy. Climate change and its effects pose a great threat to the coastal tourism facilities the island has to offer, particularly vulnerable are beaches. The government...

  6. Working Groups Collaborate on U.S. Virgin Islands Clean Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Working Groups Collaborate on U.S. Virgin Islands Clean Energy Vision and Road Map Working Groups Collaborate on U.S. Virgin Islands Clean Energy Vision and Road Map A diverse set...

  7. Tropical Island Invaders: Swamp Harrier (Circus approximans) Behavior and Seabird Predatioin on Moorea, French Polynesia

    E-Print Network [OSTI]

    Wilcox, Rebecca C

    2009-01-01

    because it is a model island system (Vitousek 2002) and thePeter. 2002. Oceanic islands as model systems for ecologicalislands where endemism is high and diversity is low. Introduced predatory invasive organisms can damage fragile systems

  8. Small Changes Help Long Island Homeowner Save Big on Energy Costs...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Small Changes Help Long Island Homeowner Save Big on Energy Costs Small Changes Help Long Island Homeowner Save Big on Energy Costs April 16, 2013 - 12:20pm Addthis Located near...

  9. Virus-vectored immunocontraception to control feral cats on islands: a mathematical model

    E-Print Network [OSTI]

    Courchamp, Franck

    CB2 3EJ, UK Summary 1. Feral cats Felis catus introduced onto oceanic islands pose a major ecological-words: baits, biological control, Felis catus, introduced predator, island conser- vation, mammal pest, VVIC

  10. Island precipitation enhancement and the diurnal cycle in radiative-convective equilibrium

    E-Print Network [OSTI]

    Cronin, Timothy W.

    To understand why tropical islands are rainier than nearby ocean areas, we explore how a highly idealized island, which differs from the surrounding ocean only in heat capacity, might respond to the diurnal cycle and ...

  11. Effects of Hurricane Katrina on the Mammalian and Vegetative Communities of the Barrier Islands of Mississippi 

    E-Print Network [OSTI]

    Scoggin, Annaliese K.

    2010-01-14

    The barrier islands of the gulf coast of the U.S. have been shaped and changed by hurricanes for centuries. These storms can alter the vegetation of the barrier islands by redistributing sediments, scouring off vegetation, physical damage...

  12. The 'Sphinx' Head from the Cult Center at Mycenae

    E-Print Network [OSTI]

    Rehak, Paul

    2005-01-01

    University) passed away on the 5 th of June 2004. This paper has been edited by John Younger, based on a draft that Paul prepared in the early Spring of 2004. 1 Inventory number: NMA 4575. The head is nearly complete (the preserved height is 16... at Mycenae (Immerwahr 1990: 191, MY No. 6, pl. 61). 3 Later examples include the caps of mourning women on some of the painted larnakes from Tanagra (e.g., Demakopoulou 1988: 74–5, no. 5 and colour fig. 10). Thus, the cap is worn almost exclusively...

  13. Extreme high-head portables provide more pumping options

    SciTech Connect (OSTI)

    Fiscor, S.

    2006-10-15

    Three years ago, Godwin Pumps, one of the largest manufacturers of portable pumps, introduced its Extreme Duty High Lift (HL) series of pumps and more mines are finding unique applications for these pumps. The Extreme HL series is a range single-stage Dri-Prime pumps with heads up to 600 feet and flows up to 5,000 gallons per minute. The American Coal Co.'s Galatia mine, an underground longwall mine in southern Illinois, used an HL 160 to replace a multiple-staged centrifugal pump. It provided Galatia with 1,500 gpm at 465 ft. 3 photos.

  14. Indian Head Park, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. Water Res.:01 -India: Energy ResourcesHead Park,

  15. Bear Head Lake, Minnesota: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminexInformationArkansas:InformationHead Lake, Minnesota:

  16. Los Alamos names new head of stockpile manufacturing and support

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and-EearnstakesLos AlamosPortableNew head of

  17. Energy Department Helps Advance Island Clean Energy Goals (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-10-01

    This U.S. Department of Energy (DOE) Office of Energy Efficiency and Renewable Energy (EERE) fact sheet highlights a June 2012 solar power purchase agreement between the Virgin Islands Water and Power Authority and three corporations. The fact sheet describes how financial support from DOE and technical assistance from DOE's National Renewable Energy Laboratory enabled the U.S. Virgin Islands to realistically assess its clean energy resources and identify the most viable and cost-effective solutions to its energy challenges--resulting in a $65 million investment in solar energy in the territory.

  18. MHK Projects/Willow Island | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050 JumpCoosSlough BendVidal IslandWestWaveWillapaIsland

  19. Independent Verification Survey Report for the Long Island Solar Farm, Brookhaven National Laboratory, Upton, New York

    SciTech Connect (OSTI)

    E.M. Harpenau

    2010-11-15

    5119-SR-01-0 INDEPENDENT VERIFICATION SURVEY REPORT FOR THE LONG ISLAND SOLAR FARM, BROOKHAVEN NATIONAL LABORATORY

  20. Energy Transition Initiative, Island Energy Snapshot - Jamaica; NREL (National Renewable Energy Laboratory)

    SciTech Connect (OSTI)

    2015-04-06

    This profile provides a snapshot of the energy landscape of Jamaica, an island nation located in the north Caribbean Sea.

  1. Management implications of the Macquarie Island trophic cascade revisited: a reply to Dowding et al.

    E-Print Network [OSTI]

    Krebs, Charles J.

    cats Felis catus on sub-Antarctic Macquarie Island were exerting top-down control on the feral rabbit

  2. Hypersonic drift-tearing magnetic islands in tokamak plasmas R. Fitzpatrick and F. L. Waelbroeck

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    heat and particles are able to travel radially from one side of an island to another by flowing alongHypersonic drift-tearing magnetic islands in tokamak plasmas R. Fitzpatrick and F. L. Waelbroeck of helical magnetic island equilibria in the pedestals of H-mode tokamak plasmas Phys. Plasmas 17, 062503

  3. Exploring the LandOcean Contrast in Convective Vigor Using Islands F. J. ROBINSON

    E-Print Network [OSTI]

    Sherwood, Steven

    was idealized, with islands represented by regions of uniform surface heat flux without orography, using a rangeExploring the Land­Ocean Contrast in Convective Vigor Using Islands F. J. ROBINSON Department) observations over islands of increasing size to those simulated by a cloud- resolving model. The observed

  4. Nonlinear dynamics of feedback modulated magnetic islands in toroidal plasmas Richard Fitzpatrick and Franois L. Waelbroeck

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    because both heat and particles are able to travel radially from one side of an island chain to the otherNonlinear dynamics of feedback modulated magnetic islands in toroidal plasmas Richard Fitzpatrick-induced magnetic responses during nonlinear dynamics of magnetic islands due to resonant magnetic perturbations

  5. Impacts of landscape structure on surface urban heat islands: A case study of Shanghai, China

    E-Print Network [OSTI]

    Wu, Jianguo "Jingle"

    Impacts of landscape structure on surface urban heat islands: A case study of Shanghai, China in revised form 6 June 2011 Accepted 9 July 2011 Available online 5 August 2011 Keywords: Urban heat island of the ecological consequences of urbanization is the urban heat island (UHI) effect, which leads to higher

  6. 2 Urban heat island in the subsurface 3 Grant Ferguson1

    E-Print Network [OSTI]

    Woodbury, Allan D.

    2 Urban heat island in the subsurface 3 Grant Ferguson1 and Allan D. Woodbury2 4 Received 11 heat island effect has received significant 7 attention in recent years due to the possible effect that the urban heat island 19 effect has significant and complex spatial variability. In 20 most situations

  7. HEAT ISLAND OF SAN ANTONIO, TEXAS DETECTED BY MODIS/AQUA TEMPERATURE PRODUCT

    E-Print Network [OSTI]

    Texas at San Antonio, University of

    HEAT ISLAND OF SAN ANTONIO, TEXAS DETECTED BY MODIS/AQUA TEMPERATURE PRODUCT Hongjie Xie, Huade resolution) of time period June 1 to September 30 from year 2002 to 2005 to study the heat island (HI:30 am, CST) data have been used. The existence of a heat island (HI) of the San Antonio downtown area

  8. Strain relief and Pd island shape evolution on the palladium and palladium hydride (100) surface

    SciTech Connect (OSTI)

    Kolesnikov, S. V.; Klavsyuk, A. L.; Saletsky, A. M. [Moscow State University (Russian Federation)

    2012-06-15

    The mesoscopic relaxation of small Pd islands on Pd(100) and PdH(100) surfaces is investigated on the atomic scale by performing molecular statics calculations. A strong strain and stress inhomogeneity in islands and topmost layers of the substrate is revealed. An unusual size dependence of the shape of islands is discovered.

  9. Windgenerated eddy characteristics in the lee of the island of Hawaii

    E-Print Network [OSTI]

    Qiu, Bo

    Click Here for Full Article Windgenerated eddy characteristics in the lee of the island of Hawaii to clarify the mesoscale eddy characteristics in the lee of the island of Hawaii, the largest island. In the immediate lee southwest of Hawaii (Region E), eddy signals have a predominant 60 day period and a short

  10. Gravity anomalies of the Northern Hawaiian Islands: Implications on the shield evolutions of Kauai and Niihau

    E-Print Network [OSTI]

    Ito, Garrett

    Gravity anomalies of the Northern Hawaiian Islands: Implications on the shield evolutions of Kauai reveal two positive residual gravity anomalies in the Northern Hawaiian Islands: one over Kaua'i, the other between the islands of Kaua'i and Ni'ihau. These gravitational highs are similar in size

  11. Hybridization in the Catalina Island Mountain Mahogany (Cercocarpus traskiae):RAPD Evidence

    E-Print Network [OSTI]

    Rieseberg, Loren

    Hybridization in the Catalina Island Mountain Mahogany (Cercocarpus traskiae):RAPD Evidence LOREN H.S.A. Introduction The Catalina Island mountain mahogany is one of 10 species of shrubs and small trees (Lis 1992 1992). The Catalina Island mountain mahogany (C. traskiae East- wood) is one of the most distinctive

  12. Aalborg Universitet Distributed Secondary Control for Islanded MicroGrids A Networked Control Systems

    E-Print Network [OSTI]

    Vasquez, Juan Carlos

    Aalborg Universitet Distributed Secondary Control for Islanded MicroGrids ­ A Networked Control, Q., Vasquez, J. C., & Guerrero, J. M. (2012). Distributed Secondary Control for Islanded MicroGrids M.; , "Distributed secondary control for islanded MicroGrids - A networked control systems approach

  13. Voltage and frequency control of islanded microgrids: a plug-and-play approach

    E-Print Network [OSTI]

    Ferrari-Trecate, Giancarlo

    Voltage and frequency control of islanded microgrids: a plug-and-play approach Stefano Riverso propose a new decentralized control scheme for Islanded microGrids (ImGs) composed by the interconnection. INTRODUCTION In recent years, research on Islanded microGrids (ImG) has received major attention. ImGs are self

  14. Aalborg Universitet Model Order Reductions for Stability Analysis of Islanded Microgrids with Droop

    E-Print Network [OSTI]

    Vasquez, Juan Carlos

    Aalborg Universitet Model Order Reductions for Stability Analysis of Islanded Microgrids with Droop. C., & Guerrero, J. M. (2015). Model Order Reductions for Stability Analysis of Islanded Microgrids.aau.dk on: juli 07, 2015 #12;1 Model Order Reductions for Stability Analysis of Islanded Microgrids

  15. Plug-and-play voltage and frequency control of islanded microgrids with meshed topology

    E-Print Network [OSTI]

    Ferrari-Trecate, Giancarlo

    1 Plug-and-play voltage and frequency control of islanded microgrids with meshed topology Stefano--In this paper we propose a new decentralized control scheme for Islanded microGrids (ImGs) composed proposed in IEEE standards. I. INTRODUCTION In recent years, research on Islanded microGrids (ImG) has

  16. Aalborg Universitet Power Flow Analysis Algorithm for Islanded LV Microgrids Including Distributed

    E-Print Network [OSTI]

    Vasquez, Juan Carlos

    Aalborg Universitet Power Flow Analysis Algorithm for Islanded LV Microgrids Including Distributed., & Guerrero, J. M. (2014). Power Flow Analysis Algorithm for Islanded LV Microgrids Including Distributed.aau.dk on: juli 04, 2015 #12;Power Flow Analysis Algorithm for Islanded LV Microgrids Including Distributed

  17. Momentum flux estimates for South Georgia Island mountain waves in the stratosphere observed via satellite

    E-Print Network [OSTI]

    Alexander, M. Joan

    Momentum flux estimates for South Georgia Island mountain waves in the stratosphere observed via observations of mountain wave events in the stratosphere above South Georgia Island in the remote southern important drag forces on the circulation. Small island orography is generally neglected in mountain wave

  18. PLANT ASSEMBLAGE STRUCTURE ON BARRIER ISLAND `PIMPLE' DUNES AT THE VIRGINIA COAST RESERVE

    E-Print Network [OSTI]

    Lawrence, Deborah

    PLANT ASSEMBLAGE STRUCTURE ON BARRIER ISLAND `PIMPLE' DUNES AT THE VIRGINIA COAST RESERVE LONG ASSEMBLAGE STRUCTURE ON BARRIER ISLAND `PIMPLE' DUNES AT THE VIRGINIA COAST RESERVE LONG-TERM ECOLOGICAL', small, rounded dunes forming along main dune ridges of the barrier islands. There are distinct plant

  19. Inorganic islands on a highly stretchable polyimide substrate Jeong-Yun Sun

    E-Print Network [OSTI]

    Suo, Zhigang

    Inorganic islands on a highly stretchable polyimide substrate Jeong-Yun Sun Department of Material. A polyimide substrate is first coated with a thin layer of an elastomer, on top of which SiNx islands, but SiNx islands on much stiffer polyimide (PI) sub- strates crack and debond when the substrates

  20. Origin and Age of the Marine Stygofauna of Lanzarote, Canary Islands

    E-Print Network [OSTI]

    Iliffe, Thomas M.

    Origin and Age of the Marine Stygofauna of Lanzarote, Canary Islands HORSTWILKENS crustaceans, previously known only from the Jameos del Agua marine lava tube in Lanzarote, Canary Islands, November 1986 ISSN 0072-9612 Lanzarote, at the eastern end of the Canary Islands, possesses one

  1. Contradiction in conservation of island ecosystems: plants, introduced herbivores and avian scavengers

    E-Print Network [OSTI]

    Donázar, José A.

    scavengers in the Canary Islands LAURA GANGOSO1, *, JOSE´ A. DONA´ ZAR1 , STEPHAN SCHOLZ2 , CE´ SAR J rabbits Oryctolagus cuniculus were introduced in the Canary Islands around 500 B.C. Barbary ground. It is urgently necessary to harmonize farming and conservation objectives in the Canary Islands. The impact

  2. Monsoon surges trigger oceanic eddy formation and propagation in the lee of the Philippine Islands

    E-Print Network [OSTI]

    with eddies that form in the lee of the Cabo Verde and Canary Islands [Chavanne et al., 2002; Sangra et al., 2007]. The Hawaii, Cabo Verde and Canary Islands are located in the trades where winds have typicalMonsoon surges trigger oceanic eddy formation and propagation in the lee of the Philippine Islands

  3. Wide-angle seismic constraints on the internal structure of Tenerife, Canary Islands

    E-Print Network [OSTI]

    Watts, A. B. "Tony"

    Wide-angle seismic constraints on the internal structure of Tenerife, Canary Islands J.P. Canalesa of Tenerife, Canary Islands. The experiment was designed as a seismic fan pro®le to detect azimuthal rights reserved. Keywords: seismic structure; P-wave velocity anomaly; Tenerife; Canary Islands 1

  4. Journal of Biogeography (1992)I9,383-390 Habitat distribution of canary chaffinchesamong islands

    E-Print Network [OSTI]

    Carrascal, Luis M.

    1992-01-01

    Journal of Biogeography (1992)I9,383-390 Habitat distribution of canary chaffinchesamong islands studied for the Canary Islands (Tenerife and El Hierro). The Common Chaffinch was significantly denser time. Key words. Canary Islands, Chaffinches (Fringilla spp.), habitat preferences, competitive

  5. Following more than 30 years of seismic and volcanic quiescence, the Canary Islands

    E-Print Network [OSTI]

    Sleeman, Reinoud

    Following more than 30 years of seismic and volcanic quiescence, the Canary Islands region located History Several eruptions have taken place in the Canary Islands in the last 500 years, all of them, TRANSACTIONS, AMERICAN GEOPHYSICAL UNION PAGES 61,65 Monitoring the Reawakening of Canary Islands'Teide Volcano

  6. SHORT COMMUNICATION The possible origin of Zostera noltii in the Canary Islands

    E-Print Network [OSTI]

    Borges, Rita

    SHORT COMMUNICATION The possible origin of Zostera noltii in the Canary Islands and guidelines are declining worldwide. Zostera noltii in the Canary Islands has been drastically reduced, mainly of the Canary Islands (Pavo´n-Salas et al. 2000). Cymodocea nodosa (Ucria) Ascherson is the most abundant

  7. A seismic reflection profile study of lithospheric flexure in the vicinity of the Cape Verde Islands

    E-Print Network [OSTI]

    Watts, A. B. "Tony"

    ., 1994], Tuamotu [Ito et al., 1995], Canary Islands [Watts et al., 1997], La Re´union [Charvis et al Islands M. Y. Ali and A. B. Watts Department of Earth Sciences, University of Oxford, Oxford, UK I. Hill the stratigraphic ``architecture'' of the flexural moat that flanks the Cape Verde Islands. The moat region

  8. The recycling of marine carbonates and sources of HIMU and FOZO ocean island basalts

    E-Print Network [OSTI]

    Castillo, PR

    2015-01-01

    of OIB from Mangaia and Canary islands. The intersections ofoccur in Canary and Cape Verde Islands (Hoernle et al. ,island group, the slope of Pb/ 207 Pb line represents roughly the interval of time (Mangaia, about 3.2 Ga; Canary,

  9. Scatterometer observations of wind variations induced by oceanic islands: Implications for

    E-Print Network [OSTI]

    Scatterometer observations of wind variations induced by oceanic islands: Implications for wind-driven of the Hawaiian and Cabo Verde islands on the mean atmospheric flow. A wake of weak winds, flanked by accelerated winds, appears for each major island of both archipelagos. The resulting wind stress curl displays

  10. Subsidized Island Biogeography Hypothesis: another new twist on an old theory

    E-Print Network [OSTI]

    Wait, D. Alexander

    the standard species±area curve that explains many larger island systems so well. Our conceptual model (Polis & Hurd 1996). In effect, if islands receive material from the surrounding system, these subsidiesSubsidized Island Biogeography Hypothesis: another new twist on an old theory Abstract We present

  11. Immersive Second Language Acquisition in Narrow Domains: A Prototype ISLAND Dialogue System

    E-Print Network [OSTI]

    Immersive Second Language Acquisition in Narrow Domains: A Prototype ISLAND Dialogue System Ian Mc and imple- mented an ISLAND dialogue system in Mandarin Chinese. Our ISLAND is immersive, in that no content technology in general and spoken di- alogue systems in particular have the potential to bridge this gap

  12. Fluctuations in systemsFluctuations in systems with superconducting islandswith superconducting islands

    E-Print Network [OSTI]

    Fominov, Yakov

    Fluctuations in systemsFluctuations in systems with superconducting islandswith superconducting islands Mikhail A. Skvortsov Mikhail V. Feigel'man Anatoly I. Larkin Landau Institute, Moscow #12;OutlineOutline #12;Uniform materials, grains, islandsUniform materials, grains, islands #12;Two mechanism of

  13. IEEE TRANSACTIONS ON POWER SYSTEMS 1 MILP Formulation for Islanding of Power Networks

    E-Print Network [OSTI]

    Grothey, Andreas

    IEEE TRANSACTIONS ON POWER SYSTEMS 1 MILP Formulation for Islanding of Power Networks P. A. Trodden prevented by intentionally splitting the system into islands [10]. By isolating the faulty part formulation for the islanding of power networks is presented. Given an area of uncertainty in the network

  14. Island biogeography from regional to local scales: evidence for a spatially

    E-Print Network [OSTI]

    Kreft, Holger

    - cies pool. INTRODUCTION Island systems have long played a crucial role in biogeo- graphicalORIGINAL ARTICLE Island biogeography from regional to local scales: evidence for a spatially scaled of this study was to investigate whether the equilibrium theory of island biogeography (ETIB) is equally

  15. Sculpting Semiconductor Heteroepitaxial Islands: From Dots to Rods J. T. Robinson,1,2

    E-Print Network [OSTI]

    Evans, Paul G.

    that may be exploited to tailor the functionality of island arrays in heteroepitaxial systems. DOI: 10 been shown to mediate the growth of high-quality, single-crystalline films in systems in which island island growth. In general, investigations of this system have focused on the characterization of fundamen

  16. size; island size promoted abundances of some organisms and reduced others (Fig. 1). Second,

    E-Print Network [OSTI]

    Springer, Timothy A.

    - systems. Although a growing number of studies have used the concepts developed in island geographysize; island size promoted abundances of some organisms and reduced others (Fig. 1). Second, our study found diversity, community compo- sition, and ecosystem functioning all responded to island

  17. The Evolution of Ocean Island Systems: A New Community Perspective from the

    E-Print Network [OSTI]

    Geist, Dennis

    The Evolution of Ocean Island Systems: A New Community Perspective from the Galápagos Report of Oregon #12;2 The Evolution of Ocean Island Systems: A New Community Perspective from the Galápagos and other ocean island systems, such a complete picture of physiographic and ecological evolution has

  18. ''A ground water resources study of a Pacific Ocean atoll - Tarawa, Gilbert Islands,'' by J. W. Lloyd, J. C. Miles, G. R. Chessmand, and S. F. Bugg

    SciTech Connect (OSTI)

    Wheatcraft, S.W.; Buddemeier, R.W.

    1981-10-01

    Several inherent problems in the methodology employed in the ground water resource study of Tarawa Atoll (Lloyd, et al., 1981) are described. Studies of Enewetak Atoll have provided data that require a significantly different conceptual model of the atoll hydrogeology system. Comparison of well, lagoon, and ocean tidal observations with a mathematical model that assumes horizontal tidal propagation indicates that the observed results are more consistent with a system that is controlled by vertical coupling between the unconsolidated surface aquifer and an underlying aquifer of more permeable limestone. This indicates that most fresh water recharged to the aquifer migrates downward and mixes with the sea water in a deeper aquifer providing easy exchange with the ocean. Lloyd, et al., do not take tidal mixing or vertical transport into account and it therefore seems likely that fresh water inventories are significantly overestimated. Failure to include these significant loss terms in the island water budget may also account for calculated heads above ground level. (JMT)

  19. Low hydrostatic head electrolyte addition to fuel cell stacks

    DOE Patents [OSTI]

    Kothmann, Richard E. (Churchill Boro, PA)

    1983-01-01

    A fuel cell and system for supply electrolyte, as well as fuel and an oxidant to a fuel cell stack having at least two fuel cells, each of the cells having a pair of spaced electrodes and a matrix sandwiched therebetween, fuel and oxidant paths associated with a bipolar plate separating each pair of adjacent fuel cells and an electrolyte fill path for adding electrolyte to the cells and wetting said matrices. Electrolyte is flowed through the fuel cell stack in a back and forth fashion in a path in each cell substantially parallel to one face of opposite faces of the bipolar plate exposed to one of the electrodes and the matrices to produce an overall head uniformly between cells due to frictional pressure drop in the path for each cell free of a large hydrostatic head to thereby avoid flooding of the electrodes. The bipolar plate is provided with channels forming paths for the flow of the fuel and oxidant on opposite faces thereof, and the fuel and the oxidant are flowed along a first side of the bipolar plate and a second side of the bipolar plate through channels formed into the opposite faces of the bipolar plate, the fuel flowing through channels formed into one of the opposite faces and the oxidant flowing through channels formed into the other of the opposite faces.

  20. Post-Cretaceous faulting at head of Mississippi embayment

    SciTech Connect (OSTI)

    Nelson, W.J. (Illinois State Geological Survey, Champaign, IL (United States)); Harrison, R.W. (Geological Survey, Reston, VA (United States))

    1993-03-01

    Recent mapping in southernmost Illinois and southeastern Missouri has revealed numerous faults that displace Cretaceous and Tertiary strata. Units as young as the Pliocene-Pleistocene( ) Mounds Gravel are deformed; some faults possibly displace Quaternary sediments. The faults strike northeast, dip nearly vertically, and exhibit characteristics of dextral strike-slip. Pull-apart grabens occur along right-stepping fault strands, they contain chaotically jumbled blocks of Paleozoic, Cretaceous and Tertiary rocks downdropped as much as 800 m relative to wall rocks. Faults at the head of the Mississippi embayment probably originated during Cambrian rifting (Reelfoot rift) and have a long, complex history of reactivation under different stress fields. Some faults are on strike with faults in the New Madrid seismic zone. Kinematics of post-Cretaceous displacements fit the contemporary stress regime of ENE-WSW compression. Similar fault orientations and kinematics, as well as close proximity, suggest a close link between faulting at the head of the embayment and ongoing tectonism in the New Madrid seismic zone.

  1. Head-on collisions of black holes: the particle limit

    E-Print Network [OSTI]

    Carlos O. Lousto; Richard H. Price

    1996-09-05

    We compute gravitational radiation waveforms, spectra and energies for a point particle of mass $m_0$ falling from rest at radius $r_0$ into a Schwarzschild hole of mass $M$. This radiation is found to lowest order in $(m_0/M)$ with the use of a Laplace transform. In contrast with numerical relativity results for head-on collisions of equal-mass holes, the radiated energy is found not to be a monotonically increasing function of initial separation; there is a local radiated-energy maximum at $r_0\\approx4.5M$. The present results, along with results for infall from infinity, provide a complete catalog of waveforms and spectra for particle infall. We give a representative sample from that catalog and an interesting observation: Unlike the simple spectra for other head-on collisions (either of particle and hole, or of equal mass holes) the spectra for $\\infty>r_0>\\sim5M$ show a series of evenly spaced bumps. A simple explanation is given for this. Lastly, our energy vs. $r_0$ results are compared with approximation methods used elsewhere, for small and for large initial separation.

  2. Kauai Island Utility Cooperative energy storage study.

    SciTech Connect (OSTI)

    Akhil, Abbas Ali; Yamane, Mike; Murray, Aaron T.

    2009-06-01

    Sandia National Laboratories performed an assessment of the benefits of energy storage for the Kauai Island Utility Cooperative. This report documents the methodology and results of this study from a generation and production-side benefits perspective only. The KIUC energy storage study focused on the economic impact of using energy storage to shave the system peak, which reduces generator run time and consequently reduces fuel and operation and maintenance (O&M) costs. It was determined that a 16-MWh energy storage system would suit KIUC's needs, taking into account the size of the 13 individual generation units in the KIUC system and a system peak of 78 MW. The analysis shows that an energy storage system substantially reduces the run time of Units D1, D2, D3, and D5 - the four smallest and oldest diesel generators at the Port Allen generating plant. The availability of stored energy also evens the diurnal variability of the remaining generation units during the off- and on-peak periods. However, the net economic benefit is insufficient to justify a load-leveling type of energy storage system at this time. While the presence of storage helps reduce the run time of the smaller and older units, the economic dispatch changes and the largest most efficient unit in the KIUC system, the 27.5-MW steam-injected combustion turbine at Kapaia, is run for extra hours to provide the recharge energy for the storage system. The economic benefits of the storage is significantly reduced because the charging energy for the storage is derived from the same fuel source as the peak generation source it displaces. This situation would be substantially different if there were a renewable energy source available to charge the storage. Especially, if there is a wind generation resource introduced in the KIUC system, there may be a potential of capturing the load-leveling benefits as well as using the storage to dampen the dynamic instability that the wind generation could introduce into the KIUC grid. General Electric is presently conducting such a study and results of this study will be available in the near future. Another study conducted by Electric Power Systems, Inc. (EPS) in May 2006 took a broader approach to determine the causes of KIUC system outages. This study concluded that energy storage with batteries will provide stability benefits and possibly eliminate the load shedding while also providing positive voltage control. Due to the lack of fuel diversity in the KIUC generation mix, SNL recommends that KIUC continue its efforts to quantify the dynamic benefits of storage. The value of the dynamic benefits, especially as an enabler of renewable generation such as wind energy, may be far greater than the production cost benefits alone. A combination of these benefits may provide KIUC sufficient positive economic and operational benefits to implement an energy storage project that will contribute to the overall enhancement of the KIUC system.

  3. A MESSAGE TO VETERANS The University of Rhode Island

    E-Print Network [OSTI]

    Rhode Island, University of

    , be entitled to classification as a Rhode Island resident for the purposes of determining tuition and fees. #12 needs. The office will also assist with post-deployment transition issues and transfer credits. The FAFSA is available on-line at www.fafsa.ed.gov or at post offices and libraries. Students may apply (or

  4. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    of water for the islands' limited public water distribution systems. Wastewater disposal continues such as rain water harvesting, alternative on-site sewage disposal systems and investigation of applicable water quality, sediment generation and control, water use in rice production and climate variability

  5. Virgin Islands Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    and quality issues of water harvesting, development of alternative on-site sewage disposal systems and non to the public water distribution systems. The islands experience challenges in collecting and disposing in water quality degradation, plant nutrient management in aquaponic systems, anthropogenic impacts

  6. BIRDS OF LAYSAN AND THE LEEWARD' ISLANDS, HAWAIIAN GROUP.

    E-Print Network [OSTI]

    large members from Hawaii to Niihau and Kauai, and the Leeward Islands or "'chain," comprising. Wilson and Evans's "Aves 769 #12;770 .'BULI..ETTN OF TH E UN fTED STATES FIsH OlfMI 'BION . Hawaii nses

  7. Community-Scale Environmental Measures and Urban Heat Island

    E-Print Network [OSTI]

    interactions vary with climate. For example, while generating power, a photovoltaic system can also increaseCommunity-Scale Environmental Measures and Urban Heat Island Impacts Buildings End-Use Energy, are not well quantified. Community-scale environmental measures include solar collection technologies

  8. Energy Transition Initiative, Island Energy Snapshot - Turks & Caicos (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-02-01

    This profile presents a snapshot of the electricity generation and reduction technologies, including solar hot water heating, available to Turks and Caicos - a British overseas territory consisting of two groups of islands located southeast of the Bahamas. Heating and transportation fuels are not addressed.

  9. Energy Transition Initiative: Island Energy Snapshot - St. Lucia (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-02-01

    This profile provides a snapshot of the electricity generation or reduction technologies, including solar hot water heating, available to Saint Lucia, one of six Caribbean countries that make up the Windward Islands - the southern arc of the Lesser Antilles chain - at the eastern end of the Caribbean Sea. Heating and transportation fuels are not addressed.

  10. Energy Transition Initiative, Island Energy Snapshot - Bahamas (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-02-01

    This profile provides a snapshot of the electricity generation or reduction technologies, including solar hot water heating, available to the Commonwealth of the Bahamas - a country consisting of more than 700 islands, cays, and islets - of which only 30 are actually inhabited. Heating and transportation fuels are not addressed.

  11. Converting Maturing Nuclear Sites to Integrated Power Production Islands

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Solbrig, Charles W.

    2011-01-01

    Nuclear islands, which are integrated power production sites, could effectively sequester and safeguard the US stockpile of plutonium. A nuclear island, an evolution of the integral fast reactor, utilizes all the Transuranics (Pu plus minor actinides) produced in power production, and it eliminates all spent fuel shipments to and from the site. This latter attribute requires that fuel reprocessing occur on each site and that fast reactors be built on-site to utilize the TRU. All commercial spent fuel shipments could be eliminated by converting all LWR nuclear power sites to nuclear islands. Existing LWR sites have the added advantage ofmore »already possessing a license to produce nuclear power. Each could contribute to an increase in the nuclear power production by adding one or more fast reactors. Both the TRU and the depleted uranium obtained in reprocessing would be used on-site for fast fuel manufacture. Only fission products would be shipped to a repository for storage. The nuclear island concept could be used to alleviate the strain of LWR plant sites currently approaching or exceeding their spent fuel pool storage capacity. Fast reactor breeding ratio could be designed to convert existing sites to all fast reactors, or keep the majority thermal.« less

  12. Lightweight Energy Management of Islanded Operated Microgrids for Prosumer Communities

    E-Print Network [OSTI]

    Rossi, Michele

    Lightweight Energy Management of Islanded Operated Microgrids for Prosumer Communities Riccardo storage devices with the distribution grid. The UI acts as the control master for the microgrid strategy is tested on a residential microgrid model, 100 kVA rated, which has been developed and utilized

  13. Small Island States Green Energy Initiative. Final report

    SciTech Connect (OSTI)

    Khattak, Nasir

    1999-10-15

    This report covers the activities carried out during a one year period from 7/15/99 to 7/15/00 as part of the Small Islands Green Energy Initiative. The three activities were: 1) Energy Ministerial conference in the Caribbean; 2) Training session on renewable energy for utility engineers; and 3) Case studies compilation on renewable energy in the Caribbean.

  14. Desert Island Contribution --ASE Journal Software Engineering --A Human Activity

    E-Print Network [OSTI]

    Fischer, Gerhard

    Desert Island Contribution -- ASE Journal Software Engineering -- A Human Activity Gerhard Fischer of software engineering? Without a doubt, different people will have very different answers to this question their ideas and visions. Software engineering (especially its upstream activities) is a human-oriented field

  15. New constraints on the Slate Islands impact structure, Ontario, Canada

    E-Print Network [OSTI]

    Herrick, Robert R.

    New constraints on the Slate Islands impact structure, Ontario, Canada Virgil L. Sharpton Lunar Bernie Schnieders Ontario Geological Survey, 435 South James Street, Thunder Bay, Ontario, P7E 6E3 km south of Terrace Bay, Ontario (Fig. 1). Numerous shatter cones (observed first by R. Sage during

  16. University of Rhode Island inAdvance March 30, 2006

    E-Print Network [OSTI]

    Rhode Island, University of

    . More... University Library wins national award for information forum series The University of Rhode with high-tech training The traditional Narragansett Indian culture plays a vital role in Wanda Hopkins Island Library has been selected to receive the 2006 Association of College and Research Libraries

  17. Air Quality and Emissions Impacts of Heat Island Mitigation Strategies

    E-Print Network [OSTI]

    by generating fewer emissions from electricity production. These benefits, however, are difficult quality planning process. If a model were available to accurately predict the decrease in temperature and detailed manner is important if heat island control strategies are to be viewed as "quantifiable

  18. Spherical deformation of compliant substrates with semiconductor device islands

    E-Print Network [OSTI]

    Suo, Zhigang

    is a function of the island structure, size, and substrate material properties. Although the substrate semiconductor device materials, such as amor- phous silicon and silicon nitride, are brittle and crack easily and thinning the substrate cannot be used to reduce the strain. Because inorganic semiconductor materials

  19. Marine Iguanas Older Than Their Islands Jeff Mitton

    E-Print Network [OSTI]

    Mitton, Jeffry B.

    Marine Iguanas Older Than Their Islands Jeff Mitton Natural Selections (Appeared in the Boulder endemic species remain, three land iguanas and the only marine iguana in the world. The marine iguana by a variety of green and red algae. Marine iguanas rely solely on marine algae but they are not restricted

  20. Northern Marshall Islands radiological survey: sampling and analysis summary

    SciTech Connect (OSTI)

    Robison, W.L.; Conrado, C.L.; Eagle, R.J.; Stuart, M.L.

    1981-07-23

    A radiological survey was conducted in the Northern Marshall Islands to document reamining external gamma exposures from nuclear tests conducted at Enewetak and Bikini Atolls. An additional program was later included to obtain terrestrial and marine samples for radiological dose assessment for current or potential atoll inhabitants. This report is the first of a series summarizing the results from the terrestrial and marine surveys. The sample collection and processing procedures and the general survey methodology are discussed; a summary of the collected samples and radionuclide analyses is presented. Over 5400 samples were collected from the 12 atolls and 2 islands and prepared for analysis including 3093 soil, 961 vegetation, 153 animal, 965 fish composite samples (average of 30 fish per sample), 101 clam, 50 lagoon water, 15 cistern water, 17 groundwater, and 85 lagoon sediment samples. A complete breakdown by sample type, atoll, and island is given here. The total number of analyses by radionuclide are 8840 for /sup 241/Am, 6569 for /sup 137/Cs, 4535 for /sup 239 +240/Pu, 4431 for /sup 90/Sr, 1146 for /sup 238/Pu, 269 for /sup 241/Pu, and 114 each for /sup 239/Pu and /sup 240/Pu. A complete breakdown by sample category, atoll or island, and radionuclide is also included.

  1. Wave Energy Resources Representative Sites Around the Hawaiian Islands

    E-Print Network [OSTI]

    Wave Energy Resources for Representative Sites Around the Hawaiian Islands Prepared by: Luis A Foreword This report provides wave energy resource information required to select coastal segments for specific wave-energy-conversion (WEC) technology and to initiate engineering design incorporating

  2. Rate of Post-Hurricane Barrier Island Recovery 

    E-Print Network [OSTI]

    Hammond, Brianna

    2015-06-03

    that is reinforced if there is a sufficient recovery period. This study examines the resiliency of Assateague Island National Seashore, MD through its ability to return to its pre-storm condition following a hurricane. The primary hypothesis of this study...

  3. Real World Demonstration of a New American Low-Head Hydropower...

    Broader source: Energy.gov (indexed) [DOE]

    World Demonstration of a New American Low-Head Hydropower Unit 69dhydrogreenhydrodemonstration12.ppt More Documents & Publications Laboratory Demonstration of a New American...

  4. SU-E-J-127: Real-Time Dosimetric Assessment for Adaptive Head...

    Office of Scientific and Technical Information (OSTI)

    METHODS; DEFORMATION; ERRORS; GLANDS; HEAD; IMAGES; NECK; PATIENTS; RADIATION DOSE DISTRIBUTIONS; RADIATION DOSES; RADIOTHERAPY Word Cloud More Like This Full Text...

  5. Imaging system for cardiac planar imaging using a dedicated dual-head gamma camera

    DOE Patents [OSTI]

    Majewski, Stanislaw (Morgantown, VA); Umeno, Marc M. (Woodinville, WA)

    2011-09-13

    A cardiac imaging system employing dual gamma imaging heads co-registered with one another to provide two dynamic simultaneous views of the heart sector of a patient torso. A first gamma imaging head is positioned in a first orientation with respect to the heart sector and a second gamma imaging head is positioned in a second orientation with respect to the heart sector. An adjustment arrangement is capable of adjusting the distance between the separate imaging heads and the angle between the heads. With the angle between the imaging heads set to 180 degrees and operating in a range of 140-159 keV and at a rate of up to 500kHz, the imaging heads are co-registered to produce simultaneous dynamic recording of two stereotactic views of the heart. The use of co-registered imaging heads maximizes the uniformity of detection sensitivity of blood flow in and around the heart over the whole heart volume and minimizes radiation absorption effects. A normalization/image fusion technique is implemented pixel-by-corresponding pixel to increase signal for any cardiac region viewed in two images obtained from the two opposed detector heads for the same time bin. The imaging system is capable of producing enhanced first pass studies, bloodpool studies including planar, gated and non-gated EKG studies, planar EKG perfusion studies, and planar hot spot imaging.

  6. NNSA Sites Host Head of Comprehensive Nuclear-Test-Ban Treaty...

    National Nuclear Security Administration (NNSA)

    Sites Host Head of Comprehensive Nuclear-Test-Ban Treaty Organization (CTBTO) | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing...

  7. Revisiting Insights from Three Mile Island Unit 2 Postaccident Examinations and Evaluations in View of the Fukushima Daiichi Accident

    SciTech Connect (OSTI)

    Joy Rempe; Mitchell Farmer; Michael Corradini; Larry Ott; Randall Gauntt; Dana Powers

    2012-11-01

    The Three Mile Island Unit 2 (TMI-2) accident, which occurred on March 28, 1979, led industry and regulators to enhance strategies to protect against severe accidents in commercial nuclear power plants. Investigations in the years after the accident concluded that at least 45% of the core had melted and that nearly 19 tonnes of the core material had relocated to the lower head. Postaccident examinations indicate that about half of that material formed a solid layer near the lower head and above it was a layer of fragmented rubble. As discussed in this paper, numerous insights related to pressurized water reactor accident progression were gained from postaccident evaluations of debris, reactor pressure vessel (RPV) specimens, and nozzles taken from the RPV. In addition, information gleaned from TMI-2 specimen evaluations and available data from plant instrumentation were used to improve severe accident simulation models that form the technical basis for reactor safety evaluations. Finally, the TMI-2 accident led the nuclear community to dedicate considerable effort toward understanding severe accident phenomenology as well as the potential for containment failure. Because available data suggest that significant amounts of fuel heated to temperatures near melting, the events at Fukushima Daiichi Units 1, 2, and 3 offer an unexpected opportunity to gain similar understanding about boiling water reactor accident progression. To increase the international benefit from such an endeavor, we recommend that an international effort be initiated to (a) prioritize data needs; (b) identify techniques, samples, and sample evaluations needed to address each information need; and (c) help finance acquisition of the required data and conduct of the analyses.

  8. Structural and optoelectronic properties of germanium-rich islands grown on silicon using molecular beam epitaxy

    SciTech Connect (OSTI)

    Nataraj, L.; Sustersic, N.; Coppinger, M.; Gerlein, L. F.; Kolodzey, J. [Department of Electrical and Computer Engineering, University of Delaware, Newark, Delaware 19716 (United States); Cloutier, S. G. [Department of Electrical and Computer Engineering, University of Delaware, Newark, Delaware 19716 (United States); Delaware Biotechnology Institute, University of Delaware, Newark, Delaware 19711 (United States)

    2010-03-22

    We report on the structural and optoelectronic properties of self-assembled germanium-rich islands grown on silicon using molecular beam epitaxy. Raman, photocurrent, photoluminescence, and transient optical spectroscopy measurements suggest significant built-in strains and a well-defined interface with little intermixing between the islands and the silicon. The shape of these islands depends on the growth conditions and includes pyramid, dome, barn-shaped, and superdome islands. Most importantly, we demonstrate that these germanium-rich islands provide efficient light emission at telecommunication wavelengths on a complementary metal-oxide semiconductor-compatible platform.

  9. Shape evolution of Ge/Si(001) islands induced by strain-driven alloying

    SciTech Connect (OSTI)

    Huang, C. J.; Zuo, Y. H.; Li, D. Z.; Cheng, B. W.; Luo, L. P.; Yu, J. Z.; Wang, Q. M.

    2001-06-11

    The shape evolution of Ge/Si(001) islands grown by ultrahigh vacuum chemical vapor deposition were investigated by atomic force microscopy at different deposition rates. We find that, at low deposition rates, the evolution of islands follows the conventional pathway by which the islands form the pyramid islands, evolve into dome islands, and dislocate at a superdome shape with increasing coverage. While at a high deposition rate of 3 monolayers per minute, the dome islands evolve towards the pyramids by a reduction of the contact angle. The presence of the atomic intermixing between the Ge islands and Si substrate at high deposition rate is responsible for the reverse evolution. {copyright} 2001 American Institute of Physics.

  10. Effects of the Hawaiian Islands on the Vertical1 Structure of Low-level Clouds from CALIPSO Lidar2

    E-Print Network [OSTI]

    Xie, Shang-Ping

    -top elevation over the windward slopes of the islands of Kauai and Oahu due32 to orographic lifting and daytime island heating. In the nighttime near-island wake of33 Kauai, CALIPSO captures a striking cloud eddy of the mechanical wake behind35 the island of Hawaii favors the formation of low-level clouds

  11. Ar/Ar ages from transitionally magnetized lavas on La Palma, Canary Islands, and the geomagnetic instability timescale

    E-Print Network [OSTI]

    Singer, Bradley S.

    Ar/Ar ages from transitionally magnetized lavas on La Palma, Canary Islands, and the geomagnetic the north and south walls of Barranco de los Tilos on the island of La Palma, Canary Islands, reveals from transitionally magnetized lavas on La Palma, Canary Islands, and the geomagnetic instability

  12. Internal structure of the western flank of the Cumbre Vieja volcano, La Palma, Canary Islands, from land

    E-Print Network [OSTI]

    Jones, Alan G.

    Palma, Canary Islands, from land magnetotelluric imaging X. Garcia1,2 and A. G. Jones1 Received 9 March on the island of La Palma (Canary Islands) provides an ideal setting to address fundamental questions about (2010), Internal structure of the western flank of the Cumbre Vieja volcano, La Palma, Canary Islands

  13. Inferring crustal structure in the Aleutian island arc from a sparse wide-angle seismic data set

    E-Print Network [OSTI]

    Shillington, Donna J.

    in the Aleutian islands shed a new light on island arc systems, and the role that magmatic arcs may play G 3 G 3Inferring crustal structure in the Aleutian island arc from a sparse wide-angle seismic data set inversion with static corrections for island stations reduces the data variance of a 1-D starting model

  14. The status of dwarf carnivores on Cozumel Island, 1, 1 *ALFREDO D. CUARON , MIGUEL ANGEL MARTINEZ-MORALES ,

    E-Print Network [OSTI]

    Gompper, Matthew E.

    . Introduction The isolation of island systems and the biogeographic factors that contribute to an island's biotaThe status of dwarf carnivores on Cozumel Island, Mexico 1, 1´ ´*ALFREDO D. CUARON , MIGUEL ANGEL in revised form 9 January 2003 Key words: Conservation, Cozumel, Island endemics, Nasua nelsoni, Potos flavus

  15. Characterization of tropical near-shore fish communities by coastal habitat status on spatially complex island systems

    E-Print Network [OSTI]

    Sealey, Kathleen Sullivan

    complex island systems Vanessa L. Nero & Kathleen Sullivan Sealey Coastal Ecology Project, Department communities for Andros Island, Bahamas, a complex coastal-reef island system. Benthic assessments and beach available to fishes on island bank systems. Since habitat mapping is often incorpo- rated into marine

  16. S, Afr, ,J, Alltarct, Res" Val, 8, 1978 The mammals of IVIarion Island: a revie,v

    E-Print Network [OSTI]

    Pretoria, University of

    schedules and intra and interspecific relationships had to be obtained, Marion and Prince Edward islands (4635 CVS S, Afr, ,J, Alltarct, Res" Val, 8, 1978 The mammals of IVIarion Island: a revie,v J is typical for sub-Antarctic islands. Marion Island, the larger of the two, is approximately 19 km by 14 km

  17. Registration of an on-axis see-through head-mounted display and camera system

    E-Print Network [OSTI]

    Peli, Eli

    Registration of an on-axis see-through head- mounted display and camera system Gang Luo Harvard Abstract. An optical see-through head-mounted display (HMD) system integrating a miniature camera and a low registration error across a wide range of depth. In reality, a small camera-eye misalignment may

  18. INVOLVEMENT OF THE FGFR4 Arg388 ALLELE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA

    E-Print Network [OSTI]

    Ullrich, Axel

    INVOLVEMENT OF THE FGFR4 Arg388 ALLELE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA Sylvia STREIT 1/Arg polymorphism (388) in head and neck squamous cell carcinomas (HNSCCs) of the oral cavity and the oropharynx and graded into a low, intermediate, or high degree of staining. FGFR4 expression was scored as high in 17

  19. NATURE|Vol 438|8 December 2005 BRIEF COMMUNICATIONS ARISING Head et al.1

    E-Print Network [OSTI]

    Montgomery, David R.

    NATURE|Vol 438|8 December 2005 BRIEF COMMUNICATIONS ARISING E9 Head et al.1 interpret spectacular of Hellas. They attribute growth of the low-latitude glaciers to snow- fall during periods of increased spin. Head et al.1 identify an accumulation area for the hourglass glacier in an `alcove' above its upper

  20. Head Pose Estimation of Partially Occluded Faces Markus T. Wenzel and Wolfram H. Schiffmann

    E-Print Network [OSTI]

    Schiffmann, Wolfram

    Head Pose Estimation of Partially Occluded Faces Markus T. Wenzel and Wolfram H. Schiffmann.Schiffmann@FernUni-Hagen.de Abstract This paper describes an algorithm which calculates the approximate head pose of partially occluded faces with- out training or manual initialization. The presented ap- proach works on low