Powered by Deep Web Technologies
Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

1 1 2 QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ ECTIO NS ENERGY INFORMA TION ADMINIST RATION May 1991 This publication may be purchased from the Superintendent of Documents, U.S. Government Printing Office. Purchasing in formation for this or other Energy Information Administration (EIA) publications may be obtained from the Government Printing Office or ElA's National Energy Information Center. Questions on energy statistics should be directed to the Center by mail, telephone, or telecommunications device for the hearing impaired. Addresses, telephone numbers, and hours are as follows: National Energy Information Center, El-231 Energy Information Administration Forrestal Building, Room 1F-048 Washington, DC 20585 (202) 586-8800 Telecommunications Device for the



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OU)JI OU)JI U.S. DEPARTIIIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DE TERlVlINATION RECIPIENT:City of St Petersburg PROJECT TITLE: EECBG Gir( of St. Petersburg· Commercial Energy Efficiency Audit Program Page 1 0[2 STATE: FL Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000013 DE-EE00007BO 0 Based on my review or the infonnation concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45t.IA), I have made th l~ (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited 10, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply


Thermoluminescence (TL) Analysis and Fading Studies of Naturally Occurring Salt Irradiated by 500 mGy Gamma Rays  

SciTech Connect

The aim of the present study was to investigate the potential of the naturally occurring salt for the dosimetry purposes, using TL. The fine powder samples (20 mg) were irradiated by {gamma}- rays from 500 mGy to 2500 mGy by using Theratron-780C Cobalt-60 source, however, this paper discusses about 500 mGy only. The TL glow curve peak parameters were studied by using Chen's peak shape equation. TL glow curves were compared with fitted curves using glow curve deconvolution (GCD) method by using Kitis expression. The kinetic parameter values (E, b and s) so calculated, are in good agreement with those available in literature. The calculated energy values were also verified by using various heating rate (VHR) method. {chi}{sup 2} test and figure of merit (FOM) calculation was done to accept the goodness of fit between the curves. Fading studies of the sample showed a good fitting between the curves. The analysis suggests that natural salt should be considered for dosimetry purposes.

Tiwari, Ramesh Chandra; Pau, Kham Suan [Department of Physics, Mizoram University: Tanhril Campus, Aizawl-796004, Mizoram (India)




Office of Legacy Management (LM)

GY GY DATE--- -- __-______-__ II II s7 /L SITE NAME: CITY:--~~~&L%J _________ ------STATE:-&!=- "";::;:'KA;~+ jqjuM..wti current: ~~~--_~---___-~~~----~~--- Owner contacted q yes if yes, date contacted-- TYPE OF OPERATION ----------------- fl&search & Development 0 Production scale testing 0 Pilot Scale q Bench Scale Process 0 Theoretical Studies 0 s ample & Analysis IX Cny t;-.e i)r&&.h 0 Production 0 Disposal/Storage 0 Prime 0 Subcantractbr Cl Purchase Order 0 Facility Type 0 Manufacturing 0 University 0 Research Organization a Government Sponsored Facility q Other ~~~~~~~~~---~~------~ 0 Other information (i.e., coat + fixed fee, unit price, time 88 material, gtc) ------_ Contract/Purchase Order # ---------------------------------


RenGyS | Open Energy Information  

Open Energy Info (EERE)

RenGyS RenGyS Jump to: navigation, search Name RenGyS Place Shanghai, China Sector Renewable Energy Product RenGyS is an independent renewable energy developer focused on the Chinese energy market. Coordinates 31.247709°, 121.472618° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.247709,"lon":121.472618,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


2008 Building Energy2008 Building Energyg gy Efficiency Standards  

E-Print Network (OSTI)

Buildings p , p g , Luminaire Power, etc. for Nonresidential Buildings 4 #12;What is New for 2008? R d l B ld What is New for 2008? R d l B ldResidential BuildingsResidential Buildings Mandatory Measures2008 Building Energy2008 Building Energyg gy Efficiency Standards g gy Efficiency Standardsfficie


2008 Residential2008 Residential Energy Plan ReviewEnergy Plan Reviewe gy la eviewe gy la eview  

E-Print Network (OSTI)

2008 Residential2008 Residential Energy Plan ReviewEnergy Plan Reviewe gy la eviewe gy la eview #12;2008 Residential Energy Plan2008 Residential Energy Plan Review ChecklistReview Checklist Simplification 2005 Residential Energy Plan Review2005 Residential Energy Plan Review 2005 and 2008 Nonresidential


OU Veterans Association (OU-VA) Student Handbook / Educational Benefits  

E-Print Network (OSTI)

OU Veterans Association (OU-VA) Student Handbook / Educational Benefits VA Educational Benefits://vabenefits.vba.va.gov/vonapp. Please note that OU-VA does require a copy of your application. In the event that you

Oklahoma, University of



Office of Legacy Management (LM)

of 500 feet and speed of 250 feet per second (170 miles per hour) along parallel fiight lines spaced 0.25 miles apart. The re- sults of that survey revealed 14 locations requiring...


Alternative Fuels Data Center: xTL Fuels  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

xTL Fuels to someone xTL Fuels to someone by E-mail Share Alternative Fuels Data Center: xTL Fuels on Facebook Tweet about Alternative Fuels Data Center: xTL Fuels on Twitter Bookmark Alternative Fuels Data Center: xTL Fuels on Google Bookmark Alternative Fuels Data Center: xTL Fuels on Delicious Rank Alternative Fuels Data Center: xTL Fuels on Digg Find More places to share Alternative Fuels Data Center: xTL Fuels on AddThis.com... More in this section... Biobutanol Drop-In Biofuels Methanol P-Series Renewable Natural Gas xTL Fuels xTL Fuels Synthetic liquid transportation fuels, collectively known as xTL fuels, are produced through specialized conversion processes. These production methods, including the Fischer-Tropsch process, produce fuels from carbon-based feedstocks, such as biomass, coal, or natural gas, and can



Office of Legacy Management (LM)

' ' $1 ;- / J. s. Cuidor, t?lrsckor, AbfnFstr&iqe L"~rz~fons 317ision t. .?, ' GwkwrJ, Chief, ?mp?rty "or??r.c.h 33-l i L!C3?~~~CH - !ST.dJ. r;c.pi, f:i!.!:&L: il<:-[,TC: Ij$ ';cto?w? X2, l?~- NY. 17 - *. . . -'p&. - _ _: Ou,I~ QMt w : -_ . .- . _I --_ . . - B ! /- 4 Id : ji&Y;~ .__ . I .m:;qy& * k Cctcber 1, and 5, 1-351, tha f~3ltirz~ xere jw33ent d&icg 32 . ~~3,?2~tifXt of Ytecl a.nd izm 3wn_p ~c~~3~lsti~3s et L4ka CCt.zJ."fQ XOr3,~9 Atua: ;-Ir. .i,llpb $. fiallett, ttatirx4', .~~zi~r?gs tervice, 29nenf hk~tltrial ?warfa Xris?on, ?ubl:c Xes33, E. %?stttrvelt .3erY? cu 4.33:nistr9tian, 'J.'lshln&oq; 3yinci:, ?!Yfr, t ?rc.pe.rty !2ecti5n, LXA; . Y, ?km, $;'339yty Ecp-a 3art7 ,w L the ~~ifft.81. sFurp3e CT tie


Prospects for laser cooling TlF  

Science Journals Connector (OSTI)

We measure the upper-state lifetime and two ratios of vibrational branching fractions fv?v on the B3?1(v?)-X1?+(v) transition of TlF. We find the B-state lifetime to be 99(9) ns. We also determine that the off-diagonal vibrational decays are highly suppressed: f01/f00<210?4 and f02/f00=1.10(6)%, in excellent agreement with their predicted values of f01/f00<810?4 and f02/f00=1.0(2)% based on Franck-Condon factors calculated using Morse and Rydberg-Klein-Rees (RKR) potentials. The implications of these results for the possible laser cooling of TlF and fundamental symmetries experiments are discussed.

L. R. Hunter; S. K. Peck; A. S. Greenspon; S. Saad Alam; D. DeMille



Superdeformed bands in sup 194 Tl  

SciTech Connect

Superdeformation was first observed in the mass-190 region in {sup 191}Hg. Since then, SD bands have been found in {sup 190-194}Hg nuclei. Here we report the discovery of two such bands in {sup 194}Tl which are the first SD bands fond in this mass region that are not in Hg nuclei. Subsequently, bands have been found in two Pb nuclei. 5 refs., 1 fig.

Azaiez, F.; Kelly, W.H.; Korten, W.; Deleplanque, M.A.; Stephens, F.S.; Diamond, R.M.; Beausang, C.W.; Draper, J.E.; Rubel, E. (Lawrence Berkeley Lab., CA (USA)); Becker, J.A.; Henry, E.A.; Brinkman, M.J.; Yates, S.W.; Kuhnert, A. (Lawrence Livermore National Lab., CA (USA))



Shanghai TL Chemical Company | Open Energy Information  

Open Energy Info (EERE)

TL Chemical Company TL Chemical Company Jump to: navigation, search Name Shanghai TL Chemical Company Place Shanghai, China Zip 200240 Product Focuses on novel chemical structure PEM and PE Resin, PEM FC materials and parts, Key chemical materials in Zn-Air fuel cell, Polymer additives, Fine chemicals,Chemical laboratory and Industry automation solutions. Coordinates 31.247709°, 121.472618° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.247709,"lon":121.472618,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ESPCI ParisTech 1/1 CABLOFIL ou quivalent  

E-Print Network (OSTI)

HAGER ou équivalent 15 000 ARNOULD ou équivalent 5 000 LUMINOX ou équivalent 3 000 SAFT ou équivalent 1

Paris 7 - Denis Diderot, Université


ber die Thalliumgermanate Tl2Ge4O9 und Tl2Ge6O13  

Science Journals Connector (OSTI)

Nach Dehydratation des Germanat-Zeoliths Tl3HGe7O16 4 H2O bildet sich bei 650C das zu Me2Ge4O9 (Me=Na, K, Rb) isotype Thalliumtetragermanat. Durch Entwsserung bei 700C entsteht aus dem Zeolith ein stabiles ...

Penelope Papamantellos; A. Wittmann



Hypofractionated Radiation Therapy (66 Gy in 22 Fractions at 3 Gy per Fraction) for Favorable-Risk Prostate Cancer: Long-term Outcomes  

SciTech Connect

Purpose: To report long-term outcomes of low- and intermediate-risk prostate cancer patients treated with high-dose hypofractionated radiation therapy (HypoRT). Methods and Materials: Patients with low- and intermediate-risk prostate cancer were treated using 3-dimensional conformal radiation therapy to a dose of 66 Gy in 22 daily fractions of 3 Gy without hormonal therapy. A uniform 7-mm margin was created around the prostate for the planning target volume, and treatment was prescribed to the isocenter. Treatment was delivered using daily ultrasound image-guided radiation therapy. Common Terminology Criteria for Adverse Events, version 3.0, was used to prospectively score toxicity. Biochemical failure was defined as the nadir prostate-specific antigen level plus 2 ng/mL. Results: A total of 129 patients were treated between November 2002 and December 2005. With a median follow-up of 90 months, the 5- and 8-year actuarial biochemical control rates were 97% and 92%, respectively. The 5- and 8-year actuarial overall survival rates were 92% and 88%, respectively. Only 1 patient died from prostate cancer at 92 months after treatment, giving an 8-year actuarial cancer-specific survival of 98%. Radiation therapy was well tolerated, with 57% of patients not experiencing any acute gastrointestinal (GI) or genitourinary (GU) toxicity. For late toxicity, the worst grade ?2 rate for GI and GU toxicity was 27% and 33%, respectively. There was no grade >3 toxicity. At last follow-up, the rate of grade ?2 for both GI and GU toxicity was only 1.5%. Conclusions: Hypofractionation with 66 Gy in 22 fractions prescribed to the isocenter using 3-dimensional conformal radiation therapy produces excellent biochemical control rates, with moderate toxicity. However, this regimen cannot be extrapolated to the intensity modulated radiation therapy technique.

Patel, Nita [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Faria, Sergio, E-mail: sergio.faria@muhc.mcgill.ca [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Cury, Fabio; David, Marc; Duclos, Marie; Shenouda, George; Ruo, Russell; Souhami, Luis [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)



Memria empresarial: interesse utilitarista ou responsabilidade histrica?.  

E-Print Network (OSTI)

??A pesquisa tem por objetivo refletir o papel desempenhado pela memria empresarial, analisando sua atuao estratgica no reforo da imagem institucional e na construo ou (more)

Sara Barbosa de Sousa




NLE Websites -- All DOE Office Websites (Extended Search)



X-ray diffraction study of (TlInSe{sub 2}){sub 1-x}(TlGaTe{sub 2}){sub x} crystal system  

SciTech Connect

The crystallographic and dynamic characteristics of TlInSe{sub 2} and TlGaTe{sub 2} crystals have been studied by X-ray diffraction in the temperature range of 85-320 K. The temperature dependences of the unit-cell parameters a of TlInSe{sub 2} and TlGaTe{sub 2} crystals, as well as their coefficients of thermal expansion along the [100] direction, are determined. The concentration dependences of the unit-cell parameters a and c for (TlInSe{sub 2}){sub 1-x}(TlGaTe{sub 2}){sub x} crystals are measured. Anomalies are found in the temperature dependences of the unit-cell parameters a and, correspondingly, the coefficient of thermal expansion, indicating the existence of phase transitions in TlInSe{sub 2} and TlGaTe{sub 2} crystals.

Sheleg, A. U., E-mail: sheleg@ifttp.bas-net.by; Zub, E. M.; Yachkovskii, A. Ya. [National Academy of Sciences of Belarus, State Scientific and Production Association, Scientific and Practical Materials Research Center (Belarus); Mustafaeva, S. N.; Kerimova, E. M. [Azerbaijan National Academy of Sciences, Institute of Physics (Azerbaijan)


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


205Tl NMR observation of vortex lattice formation in the high temperature superconductor Tl2Ba2CuO6  

Science Journals Connector (OSTI)

We report on the asymmetric field distribution of the triangular vortex lattice in the superconductor Tl2Ba2CuO6 as observed by205Tl NMR atB a =4.26 T. A penetra...

M. Mehring; F. Hentsch; Hj. Mattausch



Figure 1:Energy Consumption in USg gy p 1E Roberts, Energy in US  

E-Print Network (OSTI)

Fluctuations and Global Events 14E Roberts, Energy in US DOE: 2011 Vehicle Technology Market Report #12;Figure 15: Effect of Oil Prices on US Economy 15E Roberts, Energy in US DOE: 2011 Vehicle Technology MarketFigure 1:Energy Consumption in USg gy p 2008 1E Roberts, Energy in US Source: www.eia.gov #12

Sutton, Michael


Effect of the magnetic phase transition on the charge transport in layered semiconductor ferromagnets TlCrS{sub 2} and TlCrSe{sub 2}  

SciTech Connect

TlCrS{sub 2} and TlCrSe{sub 2} crystals were synthesized by solid-state reaction. X-ray diffraction analysis showed that TlCrS{sub 2} and TlCrSe{sub 2} compounds crystallize in the hexagonal crystal system with lattice parameters a = 3.538 A, c = 21.962 A, c/a {approx} 6.207, z = 3; a = 3.6999 A, c = 22.6901 A, c/a {approx} 6.133, z = 3; and X-ray densities {rho}{sub x} = 6.705 and 6.209 g/cm{sup 3}, respectively. Magnetic and electric studies in a temperature range of 77-400 K showed that TlCrS{sub 2} and TlCrSe{sub 2} are semiconductor ferromagnets. Rather large deviations of the experimental effective magnetic moment of TlCrS{sub 2} (3.26 {mu}{sub B}) and TlCrSe{sub 2} (3.05 {mu}{sub B}) from the theoretical one (3.85 {mu}{sub B}) are attributed to two-dimensional magnetic ordering in the paramagnetic region of strongly layered ferromagnets TlCrS{sub 2} and TlCrSe{sub 2}. The effect of the magnetic phase's transition on the charge transport in TlCrS{sub 2} and TlCrSe{sub 2} is detected.

Veliyev, R. G.; Sadikhov, R. Z.; Kerimova, E. M., E-mail: ekerimova@physics.ab.az; Asadov, Yu. G.; Jabbarov, A. I. [Azerbaijan National Academy of Sciences, Institute of Physics (Azerbaijan)




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY V.0. DEPARTMENT OF Albany, OR .Morgantown, WV s Plllsburgh, PA @ENERGY Januaty 27,201 1 MEMORANDUM FOR MAXI( J. MATARRESE DIRECTOR, OFFICE OF ENVIRONMENT, SECURITY, SAFETY AND HEALTH l c ? FROM: \ DIVISION SUBJECT: Amual Natioilal Enviro~l~neiltal Policy Act (NEPA) Planning Summary for 2011 The attached documents conlprise the 201 1 Allnual NEPA Planning Summary for the National Enexgy TechnologyLaboratory. The infoimation is presented according to the guidance and fonnats provided by DOE'SNEPA office. As required by the Order 451.1B, the Annual NEPA Pla~lning Siimmary will be made available to the public. Please contact nte for any additional info~.mation regarding r\lETL,'s NEPA plans. Distribution: A. Chlgini


ULTRACAM photometry of the eclipsing cataclysmic variables GY Cnc, IR Com and HT Cas  

E-Print Network (OSTI)

We present high-speed, three-colour photometry of the eclipsing cataclysmic variables GY Cnc, IR Com and HT Cas. We find that the sharp eclipses in GY Cnc and IR Com are due to eclipses of the white dwarf. There is some evidence for a bright spot on the edge of the accretion disc in GY Cnc, but not in IR Com. Eclipse mapping of HT Cas is presented which shows changes in the structure of the quiescent accretion disc. Observations in 2002 show the accretion disc to be invisible except for the presence of a bright spot at the disc edge. 2003 observations, however, clearly show a bright inner disc and the bright spot to be much fainter than in 2002. Although no outburst was associated with either set of quiescent observations, the system was ~0.6 mJy brighter in 2003, mainly due to the enhanced emission from the inner disc. We propose that these changes are due to variations in the mass transfer rate from the secondary star and through the disc. The disc colours indicate that it is optically thin in both its inner and outer regions. We estimate the white dwarf temperature of HT Cas to be 15 000 +/- 1000 K in 2002 and 14 000 +/- 1000 K in 2003.

W. J. Feline; V. S. Dhillon; T. R. Marsh; C. A. Watson; S. P. Littlefair



High spin band structures in doubly-odd $^{194}$Tl  

E-Print Network (OSTI)

The high-spin states in odd-odd $^{194}$Tl nucleus have been studied by populating them using the $^{185,187}$Re($^{13}$C, xn) reactions at 75 MeV of beam energy. $\\gamma-\\gamma$ coincidence measurement has been performed using the INGA array with a digital data acquisition system to record the time stamped data. Definite spin-parity assignment of the levels was made from the DCO ratio and the IPDCO ratio measurements. The level scheme of $^{194}$Tl has been extended up to 4.1 MeV in excitation energy including 19 new gamma ray transitions. The $\\pi h_{9/2} \\otimes \

H. Pai; G. Mukherjee; S. Bhattacharyya; M. R. Gohil; T. Bhattacharjee; C. Bhattacharya; R. Palit; S. Saha; J. Sethi; T. Trivedi; Shital Thakur; B. S. Naidu; S. K. Jadav; R. Donthi; A. Goswami; S. Chanda



Preparation and characterization of TL-based superconducting thin films  

E-Print Network (OSTI)

A simple method for growth of Tl-based superconducting thin films is described. In this method, the precursor was prepared in a vacuum chamber by deposition of Ba, Ca and Cu metals or a Ba-Ca alloy and Cu metal. The precursor was then oxidized...

Wang, Pingshu



Robotique de service: robots assistants ou quipiers  

E-Print Network (OSTI)

l'equipe hommes-robots #12;3 Robots Programmed and repetitive activity: welding, painting1 Robotique de service: robots assistants ou équipiers Rachid Alami LAAS-CNRS Toulouse - France La robotique de service en Midi-Pyrénées ­ 25 Novembre 2011 - LAAS! !! Les robots parmi nous #12;2 !! Robots

Ingrand, François


Montagne et plaines: adversaires ou partenaires?  

E-Print Network (OSTI)

Montagne et plaines: adversaires ou partenaires? Exemple du Haut Atlas, Maroc #12;Adresse de leurs bordures. Les hautes terres four- nissent aux plaines et à leurs centres urbains des ressources des montagnes et des plaines sont invités à développer un nouveau partenariat. La présentation du cas

Stoffel, Markus


OU Spirit Wind Farm | Open Energy Information  

Open Energy Info (EERE)

OU Spirit Wind Farm OU Spirit Wind Farm Jump to: navigation, search Name OU Spirit Wind Farm Facility OU Spirit Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner CPV Renewable Energy Developer CPV Renewable Energy Company Energy Purchaser Oklahoma Gas & Electric Location Woodward County OK Coordinates 36.245403°, -99.433011° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.245403,"lon":-99.433011,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



E-Print Network (OSTI)

The University of Oklahoma OU RETIREMENT PLANS MANAGEMENT COMMITTEE March 30, 2011 President Boren established the OU Retirement Plans Management Committee to identify ways for OU to help increase its,000 OU employees participating in the retirement savings plans. A transition period to the master

Oklahoma, University of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, , ... ~. u.s. DEPAR n-IENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:County of Escambia. FL PROJECT TITLE: Road Prison Geothermal Earth Coupled HVAC Upgrade Page 1 of2 STATE: FL Funding Opportunity Announcement Numbtr Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO764.oo1 0 Based on my review of the information concerning the proposed action. as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination; ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENER ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION Page 1 of2 RECIPI[NT:Oklahoma Municipal Powwer Authority STATE: OK PROJECT TITLE: OKLAHOMA SEP ARRA· OMPA Large Systems Request AI Funding Opportunity Announcement Number Proc:urtmtnt Instrument Number NEPA Control Number CIO Number DE-FOA-OOOOO52 DE·EE0133 GF0-000133-062 Based on my review orlbe information concerning the proposed action, as NEPA Compliance Officer (authoriHd UDder DOE Order 451.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: B5.19 Ground source heat pumps The installation, mocMcabon, operation and removal of commercially available smallscale ground source heat pumps to support operatloos In single facilities (suCh as a school Of community center) or contiguous facilities



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENER ENER GY EERE PROJECT M~~AGEMENT CE"lTER NEPA DETERMINATION RECIPIENT: Youngstown State University PROJECT TITLE: Center for Efficiency in Sustainable Energy Systems Page 1 of2 STATE : OH Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-EEOOOO366 GFQ-10-143 0 Based on my review arlhe information concerning tbe proposed action, as NEPA Compliance Offictr (authorized under DOE O rder 4SI.lA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Infonnation galhenng (including, but oot limited to, literature surveys, inventones, audits), data analYSIs (induding computer modeling), document preparation (such as cooceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

.0I0J. .0I0J. u .s . DEPARnvIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION RECIPIENT:Town of Irmo PROJECT TITLE: Irma Charing Cross Sidewalk Project ARRA·EECBG Page I of2 STATE: SC Funding Opportunity Announcement Number Procur ement Instrument Number NEPA Control Number CID Number EEOOOO950/000 DE-EEOO00950 0 Based OD my review ortbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENER ENER GY EE RE PROJECT MANAG EMENT CENT ER NEPA DETERl\lINATION RECIPIENT:AA Solar Products PROJECT TITLE: AA Solar Tracking System Factory Page 1 of2 STATE: IL Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOOS2 EEOOOO119 GFO-1O-331 EE119 Based on my review of the information concerning the proposed action, as NEPA Compliance Omen (authorized under DOE Order 451.1A), I ban made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : 81 .31 Relocation of machinery and equipment, such as analytical laboratory apparatus, electronic hardware, maintenance equipment, and health and safety equipment, including minor construction necessary for removal and installation, where uses of the relocated items will be similar to their former uses and consistent with the general missions of the



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTUENT OF ENER DEPARTUENT OF ENER GY EERE PROJECT M ANAGEMENT CENT ER NEPA DETERl\IINATION PROJECT TITLE: NREL Bus Service to Off-Site Parking lot; NREL Tracking No. 10-016 Page 1 of2 STATE: CO FUnding Opportunity Announcement Number Procurcmtntlnstrumtnt Number NEPA Control Number CIO Number NREl-10-016 G01 0337 Based on my review orlhe information concerning the proposed action, as N[PA Compliance Offi<:er (authoriud under DOE Order 4Sl.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: DOE/EA· 1440-5·1 .7 Final Supplement to Final Site-Wide Environmental Assessment of the National Renewable Energy Laboratory's (NREL) South Table Mountain Complex (May 2008) Transfer, lease, disposition , or acquisition of interests in personal property (e.g., equipment and materials) or



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

IEN IEN T OF ENER GY EERE PROJECT MAN Au EMENT CENTER NEPA DE TERl\IINATION RECIPIENT:$acramenio Municipal Utility District PROJECT TITLE : CRED - SMUD: Van Warmerdam Dairy Page 1 of2 STATE: CA Funding Opportunity Announcement Number DE-FOA-OOOO122 Procurement Instrument Number DE-EE0003070 NEPA Control Number CID Number o Based on my review of the info r mation concerning the proposed action, as NEPA Compliance Officer (authorized undu DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including , but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Louisvilie Metro Louisvilie Metro u.s. DEPARTMENT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER NEPA DETERl\lINATION PROJECT TITLE: Green Jobs Revolving Loan Fund Page 1 01'2 STATE: KY Funding Opportunity Announcement Number 09EE003966 Procurement Instrument Number DE-EEOOOO729.001 NEPA Control Number em Number o Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase tI1e indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTI'vIENT OF ENER DEPARTI'vIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DEIER1\IINATION RECIPIENT:City of Fort Wayne Page 1 of2 STATE: IN PROJECf TITLE: EECBG Fort Wayne , Indiana ARRA-EECBG (S) (SOW for Revised Activity #1 and Activity #3) Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOO00825 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARUvlllNT OF ENER DEPARUvlllNT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER NEPA DETERl\IlNATION RECIPIENT:MI Department of Energy, Labor & Economic Growth PROJECT TITL E : SEP - Green Chemistry - CEAM Phase 3 - KTM Industries Page 1 oI2 STATE: Ml Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number DE-EEOOOO166 NEPA Control Number em Num ber GFO-OOOO166-032 GOO Based on my review of the information concerning the proposed ac tion, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination : ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

n-IENT OF ENER n-IENT OF ENER GY EE RE PROJECT MANAG EMENT CENTER NEPA DETERlvIINATION Page 1 01'2 RECIPIENT:COUNTY OF MONTEREY, DEPARTMENT OF PUBLIC WORKS STATE: CO PROJECf TITLE: RECOVERY ACT: COUNTY OF MONTEREY, CA ENERGY EFFICI ENCY AND CONSERVATION BLOCK GRANT Funding Opportunity Announcement Numi>t'r Procurement Instrumcnt Number NEPA Control Number em Number DE-FOA-OOOOO 13 OE-EEOOOO897.001 0 Based on my review of the inronnation concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financia



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MRC Polymers MRC Polymers U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMDIT CENTER NEPA DETERMrNATION PROJECf TITLE: MRC PET Recycling Facility Page 1 of2 STATE: IL Funding Opportunity Announcement Numbu Procurement Instrument Number NEPA Control Number elD Number DE-FOA-OCX)()()52 EEOOOO119 EE119 Based on my review of the inronnation conenning the proposed action, as NEPA Compliance Offker (authorized undu DOE Order 45I.1A), I have made the rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTU DEPARTU E NT OF ENER GY EERE PROJECT MANAGEM ENT CENTER NEPA DETERl\lINATION RECIPIENT:lllinois Department of Commerce & Economic Opportunity PROJECT TITLE: Joliet Junior College; Joliet Junior College Facilities Building Page 1 of2 STATE: IL Funding Opportunity Announcement Numbtr Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOOS2 EE119 Based on my review orlbe information concerning tbe proposed action, 8S NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following detennination: ex, EA, [IS APPENDIX AND NUMBER: Description : 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Peoria Peoria u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION PROJECT TITLE: Storage Tanks and Dispensers for E85 and Biodiesel (IL) Page 1 of2 STATE: Il Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE·EE



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U)~) U)~) u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Arizona Governor's Office of Energy Policy PROJECT TITLE : Arizona Rooftop Challenge (ARC) Page 1 of2 STATE: AZ Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA-Q000549 DE-EEOOO5693 GFO-OOOO5693-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 1.1A),1 have made the following determination: CX, EA, EIS APPENDIX AND NUMBE R: Description: A 11 Technical advice and assistance to organizations Technica! advice and planning assistance to international , national, state, and local organizations. A9 Information gathering, analysis, and dissemination



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0I.0 ~ \ 0I.0 ~ \ U.S. DEPARTlVIENT OF ENER GY EERE PROJECT M ANAGEM ENT CENTER NEPA DETERMINATION RECIPIENT:ldaho Office of Energy Resources - City of Nampa PROJECT TITLE: SEP ARRA REEZ Nampa Wastewater Treatment Plant Biogas Boiler Project Page 1 of2 STATE: 10 Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOA-OOOOOS2 DE-EEOO0141 GFO-09-156-007 0 Based on my review orlhe information concerning tbe proposed action, as NEPA Compliance Officer (author ized under DOE Order 4SI. IA), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do nol increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENER ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT: Hi-Q Geophysical Inc Page I of2 STATE: NV PROJECT TITLE: Phase 3 - Seismic Fracture Characterization Methodologies for Enhanced Geothermal Systems .' unding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-08G09800B DE-FG36-08G018191 GFO-G018191-003 G018191 Based on my review of the information concerning the proposed action, as NEP A Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex. EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply


eGY-Africa: Addressing the Digital Divide for Science in Africa  

SciTech Connect

Adoption of information and communication technologies and access to the Internet is expanding in Africa, but because of the rapid growth elsewhere, a Digital Divide between Africa and the rest of the world exists, and the gap is growing. In many sub-Saharan African countries, education and research sector suffers some of the worst deficiencies in access to the Internet, despite progress in development of NRENs - National Research and Education (cyber) Networks. By contrast, it is widely acknowledged in policy statements from the African Union, the UN, and others that strength in this very sector provides the key to meeting and sustaining Millennium Development Goals. Developed countries with effective cyber-capabilities proclaim the benefits to rich and poor alike arising from the Information Revolution. This is but a dream for many scientists in African institutions. As the world of science becomes increasingly Internet-dependent, so they become increasingly isolated. eGY-Africa is a bottom-up initiative by African scientists and their collaborators to try to reduce this Digital Divide by a campaign of advocacy for better institutional facilities. Four approaches are being taken. The present status of Internet services, problems, and plans are being mapped via a combination of direct measurement of Internet performance (the PingER Project) and a questionnaire-based survey. Information is being gathered on policy statements and initiatives aimed at reducing the Digital Divide, which can be used for arguing the case for better Internet facilities. Groups of concerned scientists are being formed at the national, regional levels in Africa, building on existing networks as much as possible. Opinion in the international science community is being mobilized. Finally, and perhaps most important of all, eGY-Africa is seeking to engage with the many other programs, initiatives, and bodies that share the goal of reducing the Digital Divide - either as a direct policy objective, or indirectly as a means to an end, such as the development of an indigenous capability in science and technology for national development. The expectation is that informed opinion from the scientific community at the institutional, national, and international levels can be used to influence the decision makers and donors who are in a position to deliver better Internet capabilities.

Barton, C.E.; /Australian Natl. U., Canberra; Amory-Mazaudier, C.; /Lab.Phys.Plasmas, Saint Maur des Fosses; Barry, B.; /Assoc.African Univ., Accra; Chukwuma; /Olabisi Onabanjo U.; Cottrell, R.L.; /SLAC; Kalim, U.; /Pakistan Natl. U.; Mebrahtu, A.; /Mekelle U.; Petitdidier, M.; /Lab. d'Atmos., Velizy; Rabiu, B.; /Federal Tech. U., Akure; Reeves, C.; /Earthworks bv, Delft; ,



Inference of Causal Networks from Time-course Transcription Data in Response to a2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose  

NLE Websites -- All DOE Office Websites (Extended Search)

Causal Networks from Time-course Transcription Data in Response to a Causal Networks from Time-course Transcription Data in Response to a 2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose Kai Zhang, Ju Han, Torsten Groesser, Priscilla Cooper, and Bahram Parvin Lawrence Berkeley National Laboratory Goal: To elucidate temporal-dependent gene templates, causal networks, and underlying biological processes that can be inferred in response to a 10 cGy priming dose with or without a later higher challenged dose. Background and significance: Mechanistic inference of regulatory network can provide new insights into radiation systems biology. The main challenge continues to be high dimensionality of data, complex network architecture and limited knowledge of biological processes.


Assessment of Ge-doped optical fibre as a TL-mode detector M. Benabdesselam a, *  

E-Print Network (OSTI)

-vivo radiation dosimetry as well in the field of nuclear facilities. PACS Keywords: dosimetry, radiation, silica is found. Both features are particularly suitable for dosimetry. Thus, an investigation by the TL technique properties and should be excellent TL-mode detectors in instances of radiotherapy (clinical dosimetry) and in

Paris-Sud XI, Université de


Magnetic and electrical properties of layered magnets Tl(Cr,Mn,Co)Se{sub 2}  

SciTech Connect

Tl(Cr,Mn,Co)Se{sub 2} crystals were synthesized at T {approx} 1050 K. X-ray diffraction analysis showed that TlCrSe{sub 2}, TlMnSe{sub 2}, and TlCoSe{sub 2} compounds crystallize in the hexagonal crystal system with the lattice parameters: a = 3.6999 A, c = 22.6901 A, c/a {approx} 6.133, z = 3, {rho}{sub x} = 6.209 g/cm{sup 3}; a = 6.53 A, c = 23.96 A, c/a {approx} 3.669, z = 8, {rho}{sub x} = 6.71 g/cm{sup 3}; and a = 3.747 A, c = 22.772 A, c/a {approx} 6.077, z = 3, {rho}{sub x} = 7.577 g/cm{sup 3}, respectively. Magnetic and electrical studies in the temperature range from 80-400 K showed that TlCrSe{sub 2} is a semiconductor ferromagnet, TlMnSe{sub 2} is a semiconductor antiferromagnet, and TlCoSe{sub 2} is a ferrimagnet with a conductivity characteristic of metals. A rather large deviation in the experimental effective magnetic moment for TlCrSe{sub 2} (3.05 {mu}B) from the theoretical value (3.85 {mu}B) is attributed to two-dimensional magnetic ordering in the paramagnetic region of the noticeably layered ferromagnet TlCrSe{sub 2}. In TlCrSe{sub 2}, a correlation between magnetic and electrical properties was detected.

Veliyev, R. G.; Sadikhov, R. Z.; Kerimova, E. M., E-mail: ekerimova@physics.ab.az; Asadov, Yu. G.; Jabbarov, A. I. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

l"MC·Ff2a l"MC·Ff2a U.S. DEPAR.Tl\IENT OF ENERGY EERE PROJECT \.1A1 \J AG EMENT CENTER NEPA DETER.l\IINATION Page 1 of2 RECIPIENT:Oregon State University STATE: OR PROJECT TITLE: High Flux Microchannel Solar Receiver Development with Adaptive Flow Control Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000595 DE-EE0005801 GF0-0005801-001 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4Sl.JA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 83.6 Small*scale research and development, laboratory operations, and pilot projects 85.17 Solar thermal systems Rational for determination:


Optimization of Photodiode Readout of CsI(Tl) Crystals  

E-Print Network (OSTI)

An experimental setup for CsI crystal readout studies and a standard electronic readout chain are introduced and used in order to measure differences in light yield and equivalent noise for different readout schemes (direct and wavelength shifter). The linearity of the system and two possibilities for determination of the equivalent noise energy are discussed. The setup is used to compare temperature and bias voltage dependence of different photodiode types. Thorough studies of different couplings of photodiodes and crystals result in similar values of equivalent noise energy well below the specifications of the TDR for wavelength shifter readout and direct readout with photodiodes glued on a carrier plate made of plexiglass that is in optical contact with the crystal. contact: brose@pktw03.phy.tu-dresden.de The aims of the studies described in this note are a comparison of different readout schemes (wavelength shifter, direct) for large CsI(Tl) crystals with regard to li...

Brose Dahlinger Eckstein; J. Brose; G. Dahlinger; P. Eckstein; K. R. Schubert



Cosmogenic radionuclide production in NaI(Tl) crystals  

E-Print Network (OSTI)

The production of long-lived radioactive isotopes in materials due to the exposure to cosmic rays on Earth surface can be an hazard for experiments demanding ultra-low background conditions, typically performed deep underground. Production rates of cosmogenic isotopes in all the materials present in the experimental set-up, as well as the corresponding cosmic rays exposure history, must be both well known in order to assess the relevance of this effect in the achievable sensitivity of a given experiment. Although NaI(Tl) scintillators are being used in experiments aiming at the direct detection of dark matter since the first nineties of the last century, very few data about cosmogenic isotopes production rates have been published up to date. In this work we present data from two 12.5 kg NaI(Tl) detectors, developed in the frame of the ANAIS project, which were installed inside a convenient shielding at the Canfranc Underground Laboratory just after finishing surface exposure to cosmic rays. The very fast start of data taking allowed to identify and quantify isotopes with half-lives of the order of tens of days. Initial activities underground have been measured and then production rates at sea level have been estimated following the history of detectors; values of about a few tens of nuclei per kg and day for Te isotopes and 22Na and of a few hundreds for I isotopes have been found. These are the first direct estimates of production rates of cosmogenic nuclides in NaI crystals. A comparison of the so deduced rates with calculations using typical cosmic neutron flux at sea level and a carefully selected description of excitation functions will be also presented together with an estimate of the corresponding contribution to the background at low and high energies, which can be relevant for experiments aiming at rare events searches.

J. Amar; S. Cebrin; C. Cuesta; E. Garca; C. Ginestra; M. Martnez; M. A. Olivn; Y. Ortigoza; A. Ortiz de Solrzano; C. Pobes; J. Puimedn; M. L. Sarsa; J. A. Villar; P. Villar



Set To Save *and* AB 811Set To Save and AB 811 Energy Independence Program (EIP)gy p g ( )  

E-Print Network (OSTI)

Set To Save *and* AB 811Set To Save and AB 811 Energy Independence Program (EIP)gy p g ( ) Lessons Learned (IOW How to avoid scar tissue) April 24, 2009 #12;Program StatusProgram Status · Set to Save goal: Save 30% citywide in 5 years. · 30% savings = 214 7 M kWh; 48 748 kW peak demand30% savings 214.7 M k

Kammen, Daniel M.


Polymorphic transformation in TlSe and the electrical properties of phases  

SciTech Connect

Alloys in the TlSe-Se system on the side of the TlSe compound in the phase diagram have been investigated using differential thermal, X-ray powder diffraction, and microstructural analyses. The phase diagram of the system has been constructed, and the temperature dependences of the electrical conductivity of the phases obtained have been examined. An analysis of the thermograms of alloys in the (TlSe){sub 0.96}-Se{sub 0.04} system has revealed a structural phase transition at a temperature of 470 {+-} 1 K. Investigations into the temperature dependences of the electrical conductivity in the range 120-450 K have demonstrated that the temperature dependence of the electrical conductivity for the (TlSe){sub 0.96}-Se{sub 0.04} alloy exhibits metallic behavior.

Najafov, A. I. [Azerbaijan National Academy of Sciences, Institute of Radiation Problems (Azerbaijan); Guseinov, G. G.; Alekperov, O. Z. [Azerbaijan National Academy of Sciences, Institute of Physics (Azerbaijan); Sardarly, R. M., E-mail: sardarli@yahoo.com; Abdullaev, A. P.; Eyubova, N. A. [Azerbaijan National Academy of Sciences, Institute of Radiation Problems (Azerbaijan)



Electrocatalytic Dioxygen Reduction on Underpotentially Deposited Tl on Au(111) Studied by an Active Site Blocking  

E-Print Network (OSTI)

to those related to corrosion and metal-air batteries. Consequently, dioxygen reduction has been well (upd) process.4,8 There are several upd metals including Bi, Pb, and Tl on Au(111), which are known

Kwak, Juhyoun


Evidence for charge Kondo effect in superconducting Tl-doped PbTe  

SciTech Connect

We report results of low-temperature thermodynamic and transport measurements of Pb{sub 1-x}Tl{sub x}Te single crystals for Tl concentrations up to the solubility limit of approximately x = 1.5%. For all doped samples, we observe a low-temperature resistivity upturn that scales in magnitude with the Tl concentration. The temperature and field dependence of this upturn are consistent with a charge Kondo effect involving degenerate Tl valence states differing by two electrons, with a characteristic Kondo temperature T{sub K} {approx} 6 K. The observation of such an effect supports an electronic pairing mechanism for superconductivity in this material and may account for the anomalously high T{sub c} values.

Fisher, I



Design Guidelines for Test Level 3 (TL-3) Through Test Level 5 (TL-5) Roadside Barrier Systems Placed on Mechanically Stabilized Earth (MSE) Retaining Wall  

E-Print Network (OSTI)

Campus. The author also wishes to sincerely thank the Reinforced Earth Company, Mr. Pete Anderson, Mr. Carl Sanders, and Mr. David Hutchinson, for their help on answering many questions and for providing the material for the construction of the full... for MASH TL-4 impact......... 77 Figure 3.10 Enhanced FE tractor-trailer model developed by NTRC (39) ..................... 83 Figure 3.11 MASH TL-5 FE model for the 42 in. (1.07 m) tall barrier and the tall vertical wall...

Saez Barrios, Deeyvid 1980-


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fermionic construction of partition function for multi-matrix models and multi-component TL hierarchy  

E-Print Network (OSTI)

We use $p$-component fermions $(p=2,3,...)$ to present $(2p-2)N$-fold integrals as a fermionic expectation value. This yields fermionic representation for various $(2p-2)$-matrix models. Links with the $p$-component KP hierarchy and also with the $p$-component TL hierarchy are discussed. We show that the set of all (but two) flows of $p$-component TL changes standard matrix models to new ones.

John Harnad; Alexander Yu. Orlov



Brookhaven National Laboratory - OU V VOC | Department of Energy  

Office of Environmental Management (EM)

monitored natural attenuation program. Remedy contained in ROD for OU V Area of concern (AOC) 4, 21, and 23. Cleanup goals have been achieved by MNA. Post cleanup monitoring has...


Jane Austen ou la caricature littraire domestique Marianne Camus  

E-Print Network (OSTI)

Jane Austen ou la caricature littéraire domestique Marianne Camus Professeur, Centre interlangues 21000 Dijon, marianne.camus [at] u-bourgogne.fr Loin de la caricature politique courante dans l

Paris-Sud XI, Université de



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENT;Kitsap County ENT;Kitsap County u.s. DEPARTlvIENT OF ENER GY EERE PROJECT MANAGEMENT CENT ER NEPA DETERlVITNATION PROJECT TITLE: EECBG * Energy Service Corps (SOW) Page 1 01'2 STATE: WA Funding Opportunity Announcem ent Number DE-FOA..QOOOO13 Procurement Instrument Number NEPA Control Number CID Number DE-EEOOOO853 '1t;..o -6ObC>g5~- 0(.::)\ EE81128 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Aclions 10 conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase Ihe indoor concentrations of potentially harmful substances, These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

O'··~ O'··~ I U.S. DEPARTh1FNT OF ENERGY EERE PROJECT ).tlA~AGE\tlENT CE~TER NEP.-\ DETER1UN.-\TION RECIPIENT:General Motors LLC Page 1 of2 STATE: Ml PROJECT TITLE: Development of Integrated Die Casting Process For Large Thin-Wall Magnesium Applications Funding Opportunity Announcement Number DE-FOA-0000560 Procurement Instrument Number NEPA Control Number CID Number EE0005753 GF0-000573-001 G05753 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visits, and


Ionic conductivity and dielectric relaxation in {gamma}-irradiated TlGaTe{sub 2} crystals  

SciTech Connect

The switching effect, field and temperature dependences of the permittivity and conductivity of TlGaTe{sub 2} crystals subjected to various {gamma}-irradiation doses are studied. Under rather low electric fields, the phenomenon of threshold switching with an S-shaped current-voltage characteristic containing a portion with negative differential resistance is observed in the crystals. In the region of critical voltages, current and voltage oscillations and imposed modulation are observed. Possible mechanisms of switching, ionic conductivity, disorder, and electrical instability in TlGaTe{sub 2} crystals are discussed.

Sardarli, R. M., E-mail: sardarli@yahoo.com; Samedov, O. A.; Abdullayev, A. P. [National Academy of Sciences of Azerbaijan, Institute of Radiation Problems (Azerbaijan); Huseynov, E. K. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan); Salmanov, F. T.; Alieva, N. A.; Agaeva, R. Sh. [National Academy of Sciences of Azerbaijan, Institute of Radiation Problems (Azerbaijan)



Off-center Tl and Na dopant centers in CsI  

SciTech Connect

We use density functional theory calculations to characterize the electronic and structural properties of the Tl and Na dopant centers in CsI. We nd that the Tl and Na centers can accept one or two electrons and couple to long-range relaxations in the surrounding crystal lattice to distort strongly off-center to multiple distinct minima, even without a triplet excitation. The long-range distortions are a mechanism to couple to phonon modes in the crystal, and are expected to play an important role in the phonon-assisted transport of polarons in activated CsI and subsequent light emission in this scintillator.

Van Ginhoven, Renee M.; Schultz, P. A.



Effect of Hf substitutions on the formation and superconductivity of Tl-1212 type phase TlSr{sub 2}(Ca{sub 1?x}Hf{sub x})Cu{sub 2}O{sub 7??}  

SciTech Connect

The TlSr{sub 2}(Ca{sub 1?x}Hf{sub x})Cu{sub 2}O{sub 7??} (Tl-1212) superconductor for x = 0.0 to 0.4 has been prepared by the solid state reaction method and studied by powder X-ray diffraction method, electrical resistance and scanning electron microscope (SEM). Most of the samples showed the Tl-1212 as the major phase and Tl-1201 as the minor phases. Small amounts of Hf-substitution (x ? 0.15 or x ? 0.25) maintained the formation of the Tl-1212 phase but larger amounts led to the formation of 1201 and an unknown impurity phase. The resistance versus temperature curve showed metallic behavior for all samples. The resistance versus temperature curves showed onset transition temperature (T{sub c} {sub onset}) between 38 and 47 K for Hf substitution.

Al-Sharabi, Annas; Abd-Shukor, R. [School of Applied Physics, Universiti Kebangsaan Malaysia 43600 Bangi, Selangor (Malaysia)



Physician Practice of the OU School of Community Medicine  

E-Print Network (OSTI)

.ou.edu/scom #12;COMPREHENSIVE SERVICES: Emergency Medicine Pediatric EM Shock/Trauma OTHER CLINIC SITES Based health clinics. Sand Springs Early Childhood CenterLaboratory, ultrasound and radiology services ­ School and FridayComprehensive physical exams Well baby and pediatric care Tulsa City County Health Department

Oklahoma, University of


Research Port 2013 -2014 University Libraries www.lib.umd.edu/tl/guides/research-port  

E-Print Network (OSTI)

Research Port 2013 - 2014 University Libraries www.lib.umd.edu/tl/guides/research-port What is Research Port? Research Port is an electronic portal that allows you to: Access subscription resources Research Port and also e-mail or save article citations. Log in to Research Port Start at the UM Libraries

Gruner, Daniel S.


rstb.royalsocietypublishing.org Cite this article: Macalady JL, Hamilton TL,  

E-Print Network (OSTI)

rstb.royalsocietypublishing.org Review Cite this article: Macalady JL, Hamilton TL, Grettenberger,2,3, Trinity L. Hamilton1,2, Christen L. Grettenberger1,3, Daniel S. Jones1,2,, Leah E. Tsao1,2 and William D

Burgos, William



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TlVIENT OF ENERGY TlVIENT OF ENERGY EERE PROJECT M_t\NAGEMENT CENTER NEPA DETEIUJ.IINATION Page 1 of3 REClPIENT:Hull Municipal Light Plant STATE: MA PROJECT TITLE: Hull Municipal Light Plant Offshore Wind Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number COP DE-EE0000326 GF0-0000326-002 G0326 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination 83.1 Site characterization and environmental monitoring Information gathering (including, but not limited to, literature surveys, inventories, site visits, and audits),



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RIGHISFOR·Tl~CHNOLOGY RIGHISFOR·Tl~CHNOLOGY DEVELOPEIl UNDERTHE· SC)LAR.ENERGY· TECHNQtOGIES PROGRAM (SE"fP) FUNDlNG Ol)P~)RTUNITY . ANNOUNCEMENT, "PHOlOVOLTAIC SUPPLY CHAIN ANDCROSS-CUTTJNG TECHNOLOGIES 7 " D,E-PSJ6-09G09'1003; W(C}-200'l-05 The Department of Energy (DOE) is providingfederalassistance under its Solar Energy Techn<'llngies Progr..am (SEIP) to cOlldtlCt research. deveiopment,demons{ration and d(;,,-pLoyment activitie.s to accelerate \\idespread commercialization of clean solar energy teclUlologies acrossAmcrica, dive.rsitYingtheNation's electricity supply options. while increasing national security and iI)lproving thecllvironment. In 2006, the Solar America Initiative (SAl:> was created for specific goals,including achieving grid parity



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEP.llliTlVlENT OF ENERGY DEP.llliTlVlENT OF ENERGY EERE PROJECt' lv'1ANAGEMENTCENTER NEPA DETE:RlVllNAtION RECIPIENT:Nevada Institute for Renewable Energy Commercialization STATE: NV PROJECT Sub-award: Investigating the performance of Residential Thermal Storage Refrigeration (TSR) TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FG36-08G088161 GFO-G088161-013 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply


Shape coexistence in {sup 180}Hg studied through the {beta} decay of {sup 180}Tl  

SciTech Connect

The {beta}{sup +}/EC decay of {sup 180}Tl and excited states in the daughter nucleus {sup 180}Hg have been investigated at the CERN On-Line Isotope Mass Separator (ISOLDE) facility. Many new low-lying energy levels were observed in {sup 180}Hg, of which the most significant are the 0{sub 2}{sup +} at 419.6 keV and the 2{sub 2}{sup +} at 601.3 keV. The former is the bandhead of an excited band in {sup 180}Hg assumed originally to be of prolate nature. From the {beta} feeding to the different states in {sup 180}Hg, the ground-state spin of {sup 180}Tl was deduced to be (4{sup -},5{sup -}).

Elseviers, J.; Bree, N.; Diriken, J.; Huyse, M.; Ivanov, O.; Van den Bergh, P.; Van Duppen, P. [Instituut voor Kern- en Stralingsfysica, K.U. Leuven, University of Leuven, BE-3001 Leuven (Belgium); Andreyev, A. N. [Instituut voor Kern- en Stralingsfysica, K.U. Leuven, University of Leuven, BE-3001 Leuven (Belgium); School of Engineering and Science, University of the West of Scotland, Paisley, PA1 2BE, UK and the Scottish Universities Physics Alliance (SUPA) (United Kingdom); Antalic, S. [Department of Nuclear Physics and Biophysics, Comenius University, SK-84248 Bratislava (Slovakia); Barzakh, A.; Fedorov, D. [Petersburg Nuclear Physics Institute, RU-188350 Gatchina (Russian Federation); Cocolios, T. E.; Seliverstov, M. [Instituut voor Kern- en Stralingsfysica, K.U. Leuven, University of Leuven, BE-3001 Leuven (Belgium); ISOLDE,CERN, CH-1211 Geneve 23 (Switzerland); Comas, V. F.; Heredia, J. A. [Gesellschaft fuer Schwerionenforschung, Planckstrasse 1, DE-64291 Darmstadt (Germany); Fedosseyev, V. N.; Marsh, B. A. [EN Department, CERN, CH-1211 Geneve 23 (Switzerland); Franchoo, S. [Institut de Physique Nucleaire, IN2P3-CNRS/Universite Paris-Sud, FR-91406 Orsay Cedex (France); Koester, U. [Institut Laue Langevin, 6 rue Jules Horowitz, FR-38042 Grenoble Cedex 9 (France); Page, R. D. [Department of Physics, Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 7ZE (United Kingdom)



DALI2: A NaI(Tl) detector array for measurements of $?$ rays from fast nuclei  

E-Print Network (OSTI)

A NaI(Tl) detector array called DALI2 (Detector Array for Low Intensity radiation 2) has been constructed for in-beam $\\gamma$-ray spectroscopy experiments with fast radioactive isotope (RI) beams. It consists typically of 186 NaI(Tl) scintillators covering polar angles from $\\sim$15$^{\\circ}$ to $\\sim$160$^{\\circ}$ with an average angular resolution of 6$^{\\circ}$ in full width at half maximum. Its high granularity (good angular resolution) enables Doppler-shift corrections that result in, for example, 10% energy resolution and 20% full-energy photopeak efficiency for 1-MeV $\\gamma$ rays emitted from fast-moving nuclei (velocities of $v/c \\simeq 0.6$). DALI2 has been employed successfully in numerous experiments using fast RI beams with velocities of $v/c = 0.3 - 0.6$ provided by the RIKEN RI Beam Factory.

S. Takeuchi; T. Motobayashi; Y. Togano; M. Matsushita; N. Aoi; K. Demichi; H. Hasegawa; H. Murakami



Angular dependence of the TL reading of thin -Al2O3:C dosemeters exposed to different beta spectra  

Science Journals Connector (OSTI)

......situation of medical personnel handling beta-emitting materials. MATERIALS AND METHODS TL detectors...exposure of medical personnel handling beta sources and to investigate...source. Figure 1. Schematic diagram of the irradiator. Side......

Pietro Mancosu; Dario Ripamonti; Ivan Veronese; Marie Claire Cantone; Augusto Giussani; Giampiero Tosi



La Thorie Hugodcimale; ou, La Base scientifique et dfinitive de l'Arithmologistique universelle  

Science Journals Connector (OSTI)

... .1038/016359a0 La Thorie Hugodcimale; ou, La Base scientifique et dfinitive de l'Arithmologistique universelle



Gene expression analysis of human primary prostate epithelial and fibroblast cell cultures to an acute dose of 10cGy  

NLE Websites -- All DOE Office Websites (Extended Search)

26, 2011 26, 2011 Gene expression analysis of human primary prostate epithelial and fibroblast cell cultures to an acute dose of 10cGy J. Tyson McDonald, Julia Fox, Heather Szelag, Annie Kang, Heiko Enderling, Peter Nowd, Douglas Scheinder, Giannoula Lakka Klement, Ingolf Tuerk, and Lynn Hlatky Center of Cancer Systems Biology, Steward St. Elizabeth's Medical Center, 736 Cambridge Street, Boston, Massachusetts 02135. Primary tissue represents a better model for studies than immortalized cell lines that are adapted


Microsoft Word - AR OU III April 09 subject.doc  

Office of Legacy Management (LM)

Administrative Record, Monticello Mill Tailings Site Operable Unit III, Subject Index April 2009 Administrative Record, Monticello Mill Tailings Site Operable Unit III, Subject Index April 2009 File Index: MRAP 1.11 page 1 of 10 Administrative Record for the U.S. Department of Energy Monticello Mill Tailings Site (MMTS), Operable Unit III (OU III), Monticello Ground Water Remedial Action Project (MSGRAP) Monticello, Utah Subject Index Note: This Administrative Record contains documents specifically relevant to Operable Unit III leading up to the Record of Decision in October 2004. Later Operable Unit III documents and Operable Units I and II post-Record of Decision documents are located in the Information Repository. Complete copies of the records are located at the U.S. Department of Energy Office of Legacy Management, 2597 B 3/4 Road, Grand Junction, CO 81503, and at the Monticello Field Office, 1665 S. Main Street,

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Alanine-EPR dosimetry for measurements of ionizing radiation absorbed doses in the range 0.5-10 kGy  

E-Print Network (OSTI)

The usefulness of two, easy accessible alanine dosimeters (ALANPOL from IChTJ and foil dosimeter from Gamma Service, Radeberg, Germany) to radiation dose measurement in the range of 0.5-10 kGy, were investigated. In both cases, the result of the test was positive. The foil dosemeter from Gamma Service is recommended for dose distribution measurements in fantoms or products, ALANPOL - for routine measurements. The EPR-alanine method based on the described dosimeters can be successfully used, among others, in the technology of radiation protection of food.

Peimel-Stuglik, Z



Optical investigation of defects in semi-insulating Tl6I4S single crystals  

Science Journals Connector (OSTI)

Native defect levels in ternary compound Tl6I4S single crystals were studied by low-temperature photoluminescence (PL) and photoconductivity (PC) measurements. From the PL measurements, a broad emission band centered at 1.64 eV was observed at low temperatures. The peak can be decomposed using two standard Gaussian functions to reveal two emission bands at 1.55 and 1.66 eV. The PL peak at 1.55 eV is attributed to donor-acceptor pair recombination between a sulphur vacancy (VS) deep donor (Ed=0.57eV) and an antisite defect (SI) shallow acceptor (Ea=20meV). The 1.66-eV emission band is attributed to self-activated luminescence involving a defect complex and is described using a configuration coordinate model. Within this framework, the 1.66-eV emission band is associated with a S vacancy donor bound to a Tl vacancy acceptor that forms a VS?VTl Schottky pair. The photoconductivity spectra show the presence of a deep donor level located at 0.46 eV below the conduction-band edge, in good agreement with that measured by PL spectroscopy.

J. A. Peters; M. Sebastian; S. Nguyen; Zhifu Liu; Jino Im; A. J. Freeman; M. G. Kanatzidis; B. W. Wessels



rat ~.t;:l~~i4.~''K' e$d'~i'~q"*at"'~~c~' `ti4P~" ,6~5~1' :~"  

E-Print Network (OSTI)

·rat ~.t;:l~~i4.~''K' e$d°'~i'~q"*at"'~~c~' `ti4P~" ,6~5~1' :~" m4e...;tl . rtr~r~r.FiY1 ~ .^4 More escape patrons of Victo r Tarello who boasts that he serves the finest food in the world. JIMMY, the Zoo

Sharp, Kim


E-Print Network 3.0 - acesso superior ou Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

do Banco Mundial para a educao: sentido oculto ou ... Source: Lucero, Jorge Carlos - Departamento de Matemtica, Universidade de Braslia Collection: Mathematics 40...


Transport and magnetization critical current densities in TlBa sub 2 Ca sub 2 Cu sub 3 O sub x tapes  

SciTech Connect

The powder in tube process was used to produce silver-sheathed tapes of TlBa{sub 2}Ca{sub 2}Cu{sub 3}O{sub 8+x} (Tl-1223). The powder was produced by thalliating a precursor powder mixture to produce the Tl-2223 phase and then beating to drive off excess Tl and reach the Tl-1223 stoichiometry. The tapes were rolled and pressed, each step followed with a 3 h sintering. The 200 {mu}m thick tapes show little sign of texturing; however, the critical current shows a small ({approximately}50%) dependence on the direction of the applied magnetic field. Both transport and magnetization measurents indicate relatively strong pinning at high temperatures. The 75 K self field critical current density is 62 MA/m{sup 2}. Transport measurements reveal the presence of weak links at all temperatures, but with a relatively weak field dependence above {approx}0.1T.

Willis, J.O.; Maley, M.P.; Kung, P.J.; Coulter, J.Y.; Peterson, D.E.; Wahlbeck, P.G.; Bingert, J.F.; Phillips, D.S.



Synthesis, Growth, and Properties of TlGa{sub 1-x}Yb{sub x}S{sub 2} Crystals  

SciTech Connect

The synthesis of TlGa{sub 1-x}Yb{sub x}S{sub 2} single crystals with the partial substitution of ytterbium for gallium is described. Variations in the electric conductivity of grown crystals irradiated with X-rays of various intensities are measured.

Kerimova, E.M.; Mustafaeva, S.N.; Asadov, Yu.G.; Kerimov, R.N. [Institute of Physics, National Academy of Sciences, pr. Dzhavida 33, Baku, 370143 (Azerbaijan)



Hall-Coefficient for Oriented Tl2ba2cacu2o8+delta Thin-Films  

E-Print Network (OSTI)

Measurements of the Hall coefficient and resistivity for highly oriented Tl2Ba2CaCu2O8+delta thin films are reported. The temperature dependence of cotTHETA(H), where THETA(H) is the normal-state Hall angle, for a single-phase (2:2:1:2) film sample...




Video Reserves in Canvas 2013 -2014 University Libraries www.lib.umd.edu/tl/guides/video-reserves  

E-Print Network (OSTI)

Video Reserves in Canvas 2013 - 2014 University Libraries www.lib.umd.edu/tl/guides/video-reserves What are Video Reserves? Video reserves are videos selected by a professor for a particular university to the professor or to the Libraries' collection. Videos from a professor's personal collection are placed

Gruner, Daniel S.


Pinning lattice: Effect of rhenium doping on the microstructural evolution from Tl-2212 to Hg-1212 films during cation exchange  

E-Print Network (OSTI)

In a cation exchange process developed recently by some of us, epitaxial HgBa2CaCu2O6 films can be obtained by diffusing volatile Tl cations out of, and simultaneously diffusing Hg cations into, the crystalline lattice of ...

Wu, Judy; Zhao, H.



Microstructural evolutions in converting epitaxial Tl2Ba2CaCu2Ox thin films to epitaxial HgBa2CaCu2O6+delta thin films  

E-Print Network (OSTI)

Superconducting HgBa2CaCu2O6+delta (Hg-1212) thin films were obtained from Tl2Ba2CaCu2Ox (Tl-2212) precursor films using a cation-exchange process. In this process, Tl cations on the precursor lattice were thermally excited ...

Wu, Judy; Siegal, M. P.; Xie, Y. Y.; Aytug, T.; Fang, L.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARTIlIENT OFI!NERGY DFPARTIlIENT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!Tl!Rl\.lINAIION RECIPIENT:NH Office of Energy and Planning PROJECf TITLE : Fonnula Grant for State Energy Program· NH Page 1 of2 STATE: NH Funding Opportunity Announ~ement Number Procurement Instrument Number NEPA Control Number CID Number DE FDA 0000643 DE-FG26-06R130472 GF()'()130472-OO1 Based on my review orlbe information concerning the proposed action, as NEPA Compliance OffICer (authorized under DOE Order 4sl.tA), I have made the foUowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for detennination: Technical advice and planning assistance to international, national, state, and local organizatioos



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARTlIIENT OFI!NERGY DFPARTlIIENT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!Tl!RMINATION Page 1 of2 RECIPIENT: Energent Corporation STATE: CA PROJECT TITLE: Scale Resistant Heat Exchangers for Low Temperature Geothermal Binary Cycle Power Plant Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOA-0000318 DE-EE0004423 GFO-OOO4423-OO2 G04423 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order4S1.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Inf ormation Information gathering (including, but not limited to, literature surveys, inventories, site visits, and gathering, analYSiS, and audits), data analysis (including, but not limited to, computer modeling), document preparation


Anisotropy of the fundamental absorption edge of TlSbS2  

Science Journals Connector (OSTI)

We have investigated, at pumped-liquid-helium temperature, the near-band-edge optical properties of the ternary layer compound TlSbS2. We resolve first a direct-band-gap exciton. A quantitative analysis of the data allows an accurate determination of the direct-band-gap energy E0=1.907 eV at 2 K. An anisotropic behavior is found, which depends on the direction of polarization of the incident light with respect to the triclinic axes which lie in the plane of the layer. Depending on the polarization, both E0 and the next threshold E1 have strongly different oscillator strengths. These results are discussed in the light of previous results for the monochalcogenide SnS.

P. Rouquette; J. Allegre; B. Gil; J. Camassel; H. Mathieu; A. Ibanez; J. C. Jumas



An abstract class loader for the SSP and its implementation in TL.  

SciTech Connect

The SSP is a hardware implementation of a subset of the JVM for use in high consequence embedded applications. In this context, a majority of the activities belonging to class loading, as it is defined in the specification of the JVM, can be performed statically. Static class loading has the net result of dramatically simplifying the design of the SSP as well as increasing its performance. Due to the high consequence nature of its applications, strong evidence must be provided that all aspects of the SSP have been implemented correctly. This includes the class loader. This article explores the possibility of formally verifying a class loader for the SSP implemented in the strategic programming language TL. Specifically, an implementation of the core activities of an abstract class loader is presented and its verification in ACL2 is considered.

Wickstrom, Gregory Lloyd; Winter, Victor Lono (University of Nebraska at Omaha, Omaha, NE); Fraij, Fares (University of Texas at El Paso, El Paso, TX); Roach, Steve (University of Texas at El Paso, El Paso, TX); Beranek, Jason (University of Nebraska at Omaha, Omaha, NE)




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

... ... ~ . u.s DEPAR lENT OFl!NERG' EERE PROJECT MANAGEMENT CDITER Nl!PA Dl!Tl!Rl\llNATION Page 1 of2 RECIPIENT:Stanford University STATE: CA PROJECf TITLE: In·Situ X·Ray Analysis of Rapid Thermal Processing for Thin·FiI Solar Cells: Closing the Gap between Production and Laboratory Efficiency Funding Opportunity Announcement Number DE·FOA-0000654 Procurement Instrument Number DE·EE0005951 NEPA Control Number em Number GFQ-0005951·001 G05951 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the following determination: CX, EA, EIS APP~:NDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination 81.31 Installation or


On the consistent definition of spinorbit effects calculated by relativistic effective core potentials with one-electron spinorbit operators: Comparison of spinorbit effects for Tl, TlH, TlH 3 , PbH 2 , and PbH 4  

Science Journals Connector (OSTI)

The spinorbit effects for Tl TlH TlH 3 PbH 2 and PbH 4 are evaluated by two-component calculations using several relativistic effective core potentials (RECP) with one-electron spinorbit operators. The used RECPs are shape-consistent RECPs derived by Wildman et al. [J. Chem. Phys. 107 9975 (1997)] and three sets of energy-consistent (or adjusted) RECPs published by Schwerdtfeger et al. [Phys. Scr. 36 453 (1987); J. Chem. Phys. 90 762 (1989)] Kchle et al. [Mol. Phys. 74 1245 (1991)] and Leininger et al. [Chem. Phys. 217 19 (1997)]. The shape-consistent RECP results are in very good agreement with the Kchle et al. energy-consistent RECP results for all the molecules studied here and all-electron results for TlH. The RECPs of Schwerdtfeger et al. and Leininger et al. seem to provide qualitatively different spinorbit effects. If one defines spin-free RECP as the potential average of the corresponding two-component RECP all RECPs give very similar spinorbit effects for all the cases. Most of the discrepancies of molecular spinorbit effects among various RECPs reported in the literature may originate from different definitions of RECPs with or without a spinorbit term and not from the inherent difference in spinorbit operators.

Young-Kyu Han; Cheolbeom Bae; Yoon Sup Lee




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tl\IFNT OF ENERGY Tl\IFNT OF ENERGY EERE PROJECT MA:'\1AGE\1ENTCEN rER NEPA DETFRl\.ITNATION Page 1 of2 RECIPIENT:Southwest Research Institute STATE: TX PROJECT TITLE : Optimizing the CSP Tower Air Brayton Cycle System to meet the SunShot Objectives Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000595 DE-EE0005805 GF0-0005805-001 Based on my review oftbe information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made tbe foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visits, and


Detection of Irradiated Ingredients Included in Low Quantity in Non-irradiated Food Matrix. 2. ESR Analysis of Mechanically Recovered Poultry Meat and TL Analysis of Spices  

Science Journals Connector (OSTI)

Protocols EN 1786 and EN 1788 for the detection of irradiated food by electron spin resonance spectroscopy (ESR) and thermoluminescence (TL) were not conceived for the detection of irradiated ingredients included in low concentration in nonirradiated ...

Eric Marchioni; Pter Horvatovich; Helne Charon; Florent Kuntz




E-Print Network (OSTI)

efficiency. Figure 15. Muon energy loss spectrum in the Nai:MUON ENERGY(GeV) MUONS IN Nal ( 112"LOGIC XBL 8011-12807 MUON ENERGY LOSS SPECTRUM IN Nai:Tl

Salamon, M.H.



Investigation of the high-temperature superconductor Tl?Ca?Ba?Cu?Fe?O in a wide range of temperature and iron concentration  

Science Journals Connector (OSTI)

A series of the composition Tl2Ca2Ba2Cu3?x Fe x O? with 0?x?0.1 were prepared by the usual ceramic method. The superconducting behaviour was investigated by elect...

A. A. El-Hamalaway; A. A. Bahgat


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - aigue ou semi-chronique Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

for: aigue ou semi-chronique Page: << < 1 2 3 4 5 > >> 1 Quelques exemples de lettrines Usage standard (2 lignes) Summary: marais de la Souteyranne, quelques kilomtres au nord...


Nonlinear dose dependence of TL and LM-OSL within the one trap-one center model  

E-Print Network (OSTI)

Nonlinear dose dependence of TL and LM-OSL within the one trap-one center model R. Chen a,*, V: Thermoluminescence LM-OSL Nonlinear dependence OTOR a b s t r a c t In a recent paper, it has been shown that strong. With the same sets of parameters, curves of LM-OSL have also been simulated; superlinear as well as sublinear

Chen, Reuven


Enhancement of thermoelectric properties of CoSb3-based skutterudites by double filling of Tl and In  

Science Journals Connector (OSTI)

Thermoelectric (TE) generators can directly generate electrical power from waste heat and thus could be an important part of the solution to future power supply and sustainable energy management. The main obstacle to the widespread use of TE materials in diverse industries e.g. for exhaust heat recovery in automobiles is their low efficiency in converting heat to electricity. The conversion efficiency of TE materials is quantified by the dimensionless figure of merit ZT and the way to enhance ZT is to decrease the lattice thermal conductivity (?lat ) of the material while maintaining a high electrical conductivity i.e. to create a situation in which phonons are scattered but electrons are unaffected. Here we report skutterudites filled by Tl and In Tl0.1In x Co4Sb12 which allow a dramatic reduction of ?lat yielding a ZT of 1.2 at 700?K. We demonstrate that the reduction of ?lat is due to the effective phonon scattering induced both by the rattling of Tl and In and by the naturally formed In2O3nanoparticles (<50?nm). The combined approach of double filling and self-formed nanostructures might be applicable to various clathrate compounds. Thus our results point to a new strategy in the improvement of bulk TE materials.

Adul Harnwunggmoung; Ken Kurosaki; Atsuko Kosuga; Manabu Ishimaru; Theerayuth Plirdpring; Rattikorn Yimnirun; Jaru Jutimoosik; Saroj Rujirawat; Yuji Ohishi; Hiroaki Muta; Shinsuke Yamanaka



External Beam Accelerated Partial-Breast Irradiation Using 32 Gy in 8 Twice-Daily Fractions: 5-Year Results of a Prospective Study  

SciTech Connect

Purpose: External beam accelerated partial breast irradiation (APBI) is an increasingly popular technique for treatment of patients with early stage breast cancer following breast-conserving surgery. Here we present 5-year results of a prospective trial. Methods and Materials: From October 2003 through November 2005, 98 evaluable patients with stage I breast cancer were enrolled in the first dose step (32 Gy delivered in 8 twice-daily fractions) of a prospective, multi-institutional, dose escalation clinical trial of 3-dimensional conformal external beam APBI (3D-APBI). Median age was 61 years; median tumor size was 0.8 cm; 89% of tumors were estrogen receptor positive; 10% had a triple-negative phenotype; and 1% had a HER-2-positive subtype. Median follow-up was 71 months (range, 2-88 months; interquartile range, 64-75 months). Results: Five patients developed ipsilateral breast tumor recurrence (IBTR), for a 5-year actuarial IBTR rate of 5% (95% confidence interval [CI], 1%-10%). Three of these cases occurred in patients with triple-negative disease and 2 in non-triple-negative patients, for 5-year actuarial IBTR rates of 33% (95% CI, 0%-57%) and 2% (95% CI, 0%-6%; P<.0001), respectively. On multivariable analysis, triple-negative phenotype was the only predictor of IBTR, with borderline statistical significance after adjusting for tumor grade (P=.0537). Conclusions: Overall outcomes were excellent, particularly for patients with estrogen receptor-positive disease. Patients in this study with triple-negative breast cancer had a significantly higher IBTR rate than patients with other receptor phenotypes when treated with 3D-APBI. Larger, prospective 3D-APBI clinical trials should continue to evaluate the effect of hormone receptor phenotype on IBTR rates.

Pashtan, Itai M. [Harvard Radiation Oncology Program, Boston, Massachusetts (United States)] [Harvard Radiation Oncology Program, Boston, Massachusetts (United States); Recht, Abram [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States); Ancukiewicz, Marek [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Brachtel, Elena [Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts (United States); Abi-Raad, Rita F. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); D'Alessandro, Helen A. [Department of Radiology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiology, Massachusetts General Hospital, Boston, Massachusetts (United States); Levy, Antonin; Wo, Jennifer Y. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Hirsch, Ariel E. [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts (United States); Kachnic, Lisa A. [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Goldberg, Saveli [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Specht, Michelle; Gadd, Michelle; Smith, Barbara L. [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Powell, Simon N. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Taghian, Alphonse G., E-mail: ataghian@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)



Nuclear structure ''southeast'' of {sup 208}Pb: Isomeric states in {sup 208}Hg and {sup 209}Tl  

SciTech Connect

The nuclear structure of neutron-rich N>126 nuclei has been investigated following their production via relativistic projectile fragmentation of a E/A=1 GeV {sup 238}U beam. Metastable states in the N=128 isotones {sup 208}Hg and {sup 209}Tl have been identified. Delayed {gamma}-ray transitions are interpreted as arising from the decay of I{sup {pi}}=(8{sup +}) and (17/2{sup +}) isomers, respectively. The data allow for the so far most comprehensive verification of the shell-model approach in the region determined by magic numbers Z<82 and N>126.

Al-Dahan, N. [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Department of Physics, University of Kerbala, Kerbala (Iraq); Podolyak, Zs.; Regan, P. H.; Alkhomashi, N.; Deo, A. Y.; Farrelly, G.; Steer, S. J.; Cullen, I. J.; Gelletly, W.; Swan, T.; Thomas, J. S.; Walker, P. M. [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Gorska, M.; Grawe, H.; Gerl, J.; Pietri, S. B.; Wollersheim, H. J.; Boutachkov, P.; Domingo-Pardo, C.; Farinon, F. [GSI, D-64291 Darmstadt (Germany)] (and others)



Byron Price, Director of the Charles Russell Center and the OU Press to Receive Prestigious  

E-Print Network (OSTI)

Byron Price, Director of the Charles Russell Center and the OU Press to Receive Prestigious Chester -- Byron Price, director of the Charles M. Russell Center for the Study of Art of the National Cowboy & Western Heritage Museum. Price will be formally honored during

Oklahoma, University of


Subject: OU Employees & Health Insurance Exchanges To: Faculty, Staff, Graduate Assistants, and Student Employees  

E-Print Network (OSTI)

plans meet the standard for affordability provided by the ACA and exceed the federal minimum value on the cost of Employee Only coverage provided by OU. A health plan meets the minimum value standard if it evaluation and review by the university and Human Resources has determined that most employees

Oklahoma, University of



E-Print Network (OSTI)

COMPUTER SCIENCE @ UCI >>> WhaT dId yOU lEaRN? My COURSES havE INClUdEd: Computer Graphics I these environments with avatars. Embedded Computing Systems I designed an intelligent hexapod robot that used optical Languages I built a personnel-scheduling application that integrated components written in multiple computer

Barrett, Jeffrey A.


INVERTIBLE FILTER BANKS ON THE 2-SPHERE B.T. Thomas Yeo Wanmei Ou Polina Golland  

E-Print Network (OSTI)

INVERTIBLE FILTER BANKS ON THE 2-SPHERE B.T. Thomas Yeo Wanmei Ou Polina Golland Computer Science to the sphere, many key challenges remain. In this paper, we develop conditions for the invertibility be incorpo- rated into the design of self-invertible axis-symmetric wavelets. Self- invertibility

Golland, Polina


Candidature une admission en 2nde Elves-ingnieurs IFMA, ISIMA ou  

E-Print Network (OSTI)

Candidature à une admission en 2nde année Elèves-ingénieurs IFMA, ISIMA ou Polytech principe pour l'admission en 2nde année du Master recherche. La liste définitive des admis sera arrêtée en

Sart, Remi


Band gap engineering of In{sub 2}O{sub 3} by alloying with Tl{sub 2}O{sub 3}  

SciTech Connect

Efficient modulation of the bandgap of In{sub 2}O{sub 3} will open up a route to improved electronic properties. We demonstrate using ab initio calculations that Tl incorporation into In{sub 2}O{sub 3} reduces the band gap and confirm that narrowing of the gap is observed by X-ray photoemission spectroscopy on ceramic surfaces. Incorporation of Tl does not break the symmetry of the allowed optical transitions, meaning that the doped thin films should retain optical transparency in the visible region, in combination with a lowering of the conduction band effective mass. We propose that Tl-doping may be an efficient way to increase the dopability and carrier mobility of In{sub 2}O{sub 3}.

Scanlon, David O., E-mail: d.scanlon@ucl.ac.uk [Kathleen Lonsdale Materials Chemistry, Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom); Diamond Light Source Ltd., Diamond House, Harwell Science and Innovation Campus, Didcot, Oxfordshire OX11 0DE (United Kingdom); Regoutz, Anna; Egdell, Russell G. [Department of Chemistry, Inorganic Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QR (United Kingdom)] [Department of Chemistry, Inorganic Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QR (United Kingdom); Morgan, David J. [Cardiff Catalysis Institute (CCI), School of Chemistry, Cardiff University, Park Place, Cardiff CF10 3AT (United Kingdom)] [Cardiff Catalysis Institute (CCI), School of Chemistry, Cardiff University, Park Place, Cardiff CF10 3AT (United Kingdom); Watson, Graeme W. [School of Chemistry and CRANN, Trinity College Dublin, Dublin 2 (Ireland)] [School of Chemistry and CRANN, Trinity College Dublin, Dublin 2 (Ireland)



On peut donc conclure avec certitude que le polo-nium, le thorium, l'actinium ou leurs drivs, mettent  

E-Print Network (OSTI)

783 On peut donc conclure avec certitude que le polo- nium, le thorium, l'actinium ou leurs dérivés

Boyer, Edmond


Analysis of the 40K contamination in NaI(Tl) crystals from different providers in the frame of the ANAIS project  

E-Print Network (OSTI)

NaI(Tl) large crystals are applied in the search for galactic dark matter particles through their elastic scattering off the target nuclei in the detector by measuring the scintillation signal produced. However, energies deposited in the form of nuclear recoils are small, which added to the low efficiency to convert that energy into scintillation, makes that events at or very near the energy threshold, attributed either to radioactive backgrounds or to spurious noise (non-bulk NaI(Tl) scintillation events), can compromise the sensitivity goals of such an experiment. DAMA/LIBRA experiment, using 250 kg NaI(Tl) target, reported first evidence of the presence of an annual modulation in the detection rate compatible with that expected for a dark matter signal just in the region below 6 keVee (electron equivalent energy). In the frame of the ANAIS (Annual modulation with NaI Scintillators) dark matter search project a large and long effort has been carried out in order to understand the origin of events at very low energy in large sodium iodide detectors and develop convenient filters to reject those non attributable to scintillation in the bulk NaI(Tl) crystal. 40K is probably the most relevant radioactive contaminant in the bulk for NaI(Tl) detectors because of its important contribution to the background at very low energy. ANAIS goal is to achieve levels at or below 20 ppb natural potassium. In this paper we will report on our effort to determine the 40K contamination in several NaI(Tl) crystals, by measuring in coincidence between two (or more) of them. Results obtained for the 40K content of crystals from different providers will be compared and prospects of the ANAIS dark matter search experiment will be briefly reviewed.

Clara Cuesta; Julio Amar; Susana Cebrin; Eduardo Garca; Carlos Ginestra; Mara Martnez; Miguel A. Olivn; Ysrael Ortigoza; Alfonso Ortz de Solrzano; Carlos Pobes; Jorge Puimedn; Mara Luisa Sarsa; Jos ngel Villar; Patricia Villar




E-Print Network (OSTI)

. If this system is not installed properly, it not only wastes energy, but money as well. To prevent this, do two of the conditioned air into the attic or crawl space. Leaky ducts waste energy and make energy bills higher thanBLUEPRI NT E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY


Introduction L'Encyclopdie des Carabes ou Encyclopdie des Kali'na du Suriname  

E-Print Network (OSTI)

Introduction « L'Encyclopédie des Caraïbes » ou Encyclopédie des Kali'na du Suriname Odile Renault Suriname, jusqu'à la deuxième moitié du 20ème siècle5, pour désigner les peuples et langues de famille étude comparée des langues de la famille caribe du Suriname, ainsi que des descriptions grammaticales et

Boyer, Edmond


ENSIMAG 3`eme annee : Visualisation Scientifique Projet personnel sujet au choix (A ou B)  

E-Print Network (OSTI)

: Visualisation d'Iso-surfaces avec Marching Cubes Travail demand´e: I Partie visualisation · Procurez-vous sur Internet un logiciel (libre) ou un code source qui impl´emente l'algorithme de calcul d'iso- surface `a´equente). L'article de r´ef´erence peut ^etre t´el´echarg´e `a l'adresse suivante: http://ljk.imag.fr/membres/Stefanie.Hahmann/ENSIMAG/TP

Hahmann, Stefanie


Le mythe Al-Zarqawi ou la lgitimation de la guerre en Iraq  

E-Print Network (OSTI)

1 Le mythe Al-Zarqawi ou la légitimation de la guerre en Iraq __________________ Le 20 mars 2003 au-Unis et leurs alliés contre l'Iraq. Tous les éléments concordent pour diaboliser le pouvoir de Saddam Hussein et pour légitimer, aux yeux du monde, une intervention armée en Iraq. Face à cet « ?tat

Paris-Sud XI, Université de


Measurement of the Low Energy Nuclear Response in NaI(Tl) Crystals for Use in Dark Matter Direct Detection Experiments  

E-Print Network (OSTI)

The response of low energy nuclear recoil in NaI(Tl) is investigated in the following experiment. Such detectors have been used recently to search for evidence of dark matter in the form of weakly interacting massive particles (WIMPs). Na...

Stiegler, Tyana Michele




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

,",C:'Fn. ,",C:'Fn. : ..... ! . u.s. DEPARTMI!NI OFI!Nl!RGY EERE PROJECT MANAGEMENT CENTER NEPA DI!Tl!RlInNATION RECIPIENT:Ohio Department of Development PROJECT TITLE: SEP ARRA - French Creek Bioenergy Page I of3 ~'" @ STATE: OH Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number EEOOOO165 GF0-0000165-022 GOO Based on my review of the Information concerning tbe proposed .cliontlls NEPA Compliance Officer (authoru.ed under DOE Order 4St.IA).1 bave made the following dete ... minatton: ex. EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SD Energy Office SD Energy Office u.s. DEP.-illTlVlENT OF ENERGY EERE PROJECT MANAG EMENT CENTER NEPA DETERMINATION PROJECf TITLE : Technical analysis for geothermal system Page I of2 STATE: SO Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOQOQS2 DE-EEOOOO145 GFO-09-152-007 0 Based on my review of abe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.tA), I have made tbe following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including. but not limited to. literature surveys, inventories, audits), data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I.OJ) I.OJ) RECIPIENT:3M Company U.S. DEPAR.TlV.IENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlVIINATION Page 1 of2 STATE: MN PROJECT TITLE: H1gh Performance. Durable, Low Cost Membrane Electrode Assemblies for Transportation Applications Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE FOA-0000360 DE-EE0005667 GF0-0005667-001 G05667 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45l.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 83.6 Small-scale S1t1ng, constructron, modification , operation, and decommrssronrng of facrlitres for smallscale research researc



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OI.O!l OI.O!l U.S. DEP.-illTl'vIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION RECIPIENT:County of San Luis Obispo PROJECT TITLE: EECBG : Bike Lane Activity Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procurement instrument Number NEPA Control Number CID Number DE-FOA-0000013 DE-EE0000903 a Based on my review of the information com::erning the proposed actioo, as NEPA Compliance Officer (authorized under DOE Order 451.1A),1 have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThffNT OFI!NERGY DEPARThffNT OFI!NERGY EERE PROJECT MANAGEMENT CENTER NEPA DI!Tl!lUllNATION RECIPIENT:ldaho Office of Energy Resources PROJE(.T TITLE: SEP ARRA - REEZ Feasibility Studies Page 1 of2 STATE: 10 Funding Opportunity Announcement Number Procurement I.nstrument Number NEPA Control Number elD Number DE-FOA-OOOOO52 EEOOOO141 GFO-OOOO141-010 EE141 BaS('d OD my review oCtile information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 4Sl.IA), I bave made the (ollowlng determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply


Specific features of conductivity of {gamma}-irradiated TlGaTe{sub 2} crystals with nanochain structure  

SciTech Connect

Temperature dependences of electrical conductivity {sigma}(T) and current-voltage characteristics of one-dimensional TlGaTe{sub 2} single crystals subjected to various doses of {gamma}-ray radiation in both geometries of the experiment-along nanochains parallel to the tetragonal axis of the crystal ({sigma}{sub |} ) and perpendicular to these nanochains ({sigma}{sub perpendicular} )-are studied. It is shown that the dependence {sigma}(T) measured in the ohmic region of the current-voltage characteristic is the shape typical of the hopping mechanism and can be described in terms of the Mott approximation. The values of the densities of localized states N{sub F}, the activation energy E{sub a}, the hop lengths R, the difference between the energies of states {Delta}E in the vicinity of the Fermi level, and the concentrations of deep traps N{sub t} are determined. The current-voltage characteristics in the region of a more abrupt increase in the current are also studied. It is shown that this region of current-voltage characteristics is described in the context of the Pool-Frenkel thermal-field effect. Concentrations of ionized centers N{sub f}, the free-path lengths {lambda}, the Frenkel coefficients {beta}, and the shape of the potential well in initial and irradiated (with 250 Mrad) TlGaTe{sub 2} crystals are determined. It is shown that anisotropy of electrical conductivity changes under the effect of irradiation, which brings about translational ordering of nanochains.

Sardarli, R. M., E-mail: sardarli@yahoo.com; Samedov, O. A.; Abdullayev, A. P. [National Academy of Sciences of Azerbaijan, Institute of Radiation Problems (Azerbaijan); Huseynov, E. K. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan); Salmanov, F. T.; Safarova, G. R. [National Academy of Sciences of Azerbaijan, Institute of Radiation Problems (Azerbaijan)




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'..",. U.S. DEP.~TlIIEN'I OF ENERGY '..",. U.S. DEP.~TlIIEN'I OF ENERGY I"'''. ' EERE PROJECT MANAGEMENT CENTER NEPA Dl1TEIU.llNATION RECIPIENT:General Atomics STATE: CA PROJECT T ITLE : Novel Heterotrophic Algae Reactor Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE·FOAOOOO337 DE· EEOOO5004 GFO-OOO5004-001 0 Based on my nview of the informalion tORCrrRing the proposed action, as N£PA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 83.6 Siting, construction (or modification), operation, and decommissioning of facilities for indoor bench-scale research projects and conventional laboratory operations (for example, preparation of chemical standards and sample analysis);


piston r. tl. en vertu de la loi de 3Iariottc, les masses d'air sur lesquelles asissent ces deux pistons tant comprimes proportion-  

E-Print Network (OSTI)

84 piston r. tl. en vertu de la loi de 3Iariottc, les masses d'air sur lesquelles asissent ces deux pistons étant comprimées proportion- nellement à leurs volumes, leurs pressions respectives s réservoir R'. Si le piston ne cède pas sous l'action de la compres- sion exercée en b', on voit que la

Boyer, Edmond


Hyperfine structure and isotopic shift of the n PJ2 levels (n=710) of 203,205Tl measured by Doppler-free two-photon spectroscopy  

Science Journals Connector (OSTI)

Using Doppler-free two-photon absorption spectroscopy, we have measured hyperfine splitting constants as well as isotopic level shifts of the 6s2np P1/22,3/2 states (n=710) in Tl203 and Tl205. Calculations for hyperfine constants and electron density at the nucleus have been performed by the Dirac-Fock method. The experimental results are compared with these calculations as well as with the predictions of the semiempirical theory.

M. Grexa; G. Hermann; G. Lasnitschka; B. Fricke



Near-infrared Hong-Ou-Mandel interference on a silicon quantum photonic circuit  

E-Print Network (OSTI)

Near-infrared Hong-Ou-Mandel quantum interference is observed in silicon nanophotonic directional couplers with raw visibilities on-chip at 90.5%. Spectrally-bright 1557-nm two-photon states are generated in a periodically-poled KTiOPO4 waveguide chip, serving as the entangled photon source and pumped with a self-injection locked laser, for the photon statistical measurements. Efficient four-port coupling in the communications C-band and in the high-index-contrast silicon photonics platform is demonstrated, with matching theoretical predictions of the quantum interference visibility. Constituents for the residual quantum visibility imperfection are examined, supported with theoretical analysis of the sequentially-triggered multipair biphoton contribution and techniques for visibility compensation, towards scalable high-bitrate quantum information processing and communications.

Xinan Xu; Zhenda Xie; Jiangjun Zheng; Junlin Liang; Tian Zhong; Mingbin Yu; Serdar Kocaman; Guo-Qiang Lo; Dim-Lee Kwong; Dirk R. Englund; Franco N. C. Wong; Chee Wei Wong



Laser transmission through thin cirrus clouds K. N. Liou, Y. Takano, S. C. Ou, and M. W. Johnson  

E-Print Network (OSTI)

Laser transmission through thin cirrus clouds K. N. Liou, Y. Takano, S. C. Ou, and M. W. Johnson A near-infrared airborne-laser transmission model for thin cirrus clouds has been developed on the basis optical depth, and ice crystal size on laser transmission for tactical applications. We show

Takano, Yoshihide


A Unified Multiple-Level Cache for High Performance Storage Systems Li Ou, Xubin (Ben) He, Martha J. Kosa  

E-Print Network (OSTI)

A Unified Multiple-Level Cache for High Performance Storage Systems Li Ou, Xubin (Ben) He, Martha in high- performance storage systems to improve I/O performance. However, traditional cache management a unified cache (uCache) which uses both ex- clusive caching in L2 storage caches and cooperative client

He, Xubin "Ben"


Exemplar para a empresa ou entidade pagadora Imposto sobre a renda das persoas fsicas Retencins sobre rendementos do traballo  

E-Print Network (OSTI)

). NIF ...................... 1 2 l Solteiro/a, viúvo/a, divorciado/a ou separado/a legalmente con fillos deste recadro: NIF, primeiro apelido, segundo apelido e nome. Importante: os perceptores que accedan ao ................................................................ NIF do cónxuxe (se marcou a casa 2, deberá consignar nesta casa o NIF do seu cónxuxe

Fraguela, Basilio B.


The crystallization kinetics of nanothin amorphous TlGa{sub 1-x}Ge{sub x}Se{sub 2} films  

SciTech Connect

The kinetics of phase transformations of amorphous Ge-doped TlGaSe{sub 2} films has been investigated by kinematic electron diffraction. It is shown that the crystallization of 30-nm-thick amorphous films obtained both in the absence of external effects and in an external electric field occurs according to the regularities established by Avrami and Kolmogorov and described by the analytical expression V{sub t} = V{sub 0}[1 - exp(-kt{sup m})]. The activation energies of nucleation and the further growth of nuclei have been determined from the kinetic curves of phase transformations.

Alekberov, E. Sh., E-mail: aeldar@hotbox.ru; Sharifova, A. K.; Ismayilov, D. I. [Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



{open_quotes}Local texture, current flow, and superconductive transport properties of Tl1223 deposits on practical substrates{close_quotes}  

SciTech Connect

Quantitative investigations of the crystal grain orientations and electrical transport properties of high temperature superconducting (HTS)TiBa{sub 2}Ca{sub 2}Cu{sub 3}O{sub 8+x} (Tl1223) deposits on polycrystalline substrates show that current flow comprises percolative networks of strongly-coupled material. Superconductive transport properties on different samples, on the same samples at different widths, and on samples with artificially-induced strong flux pinning defects confirm the nature of current flow, and suggest that these materials may be useful as a new class of HTS conductors.

Christen, D.K.; Specht, E.D.; Goyal, A. [and others



Directive 2600-037 Page 1 Directive relative l'usage du titre de professeure ou de professeur dans les communications orales et  

E-Print Network (OSTI)

Directive 2600-037 Page 1 Directive relative à l'usage du titre de professeure ou de professeur dans les communications orales et écrites DIRECTIVE 2600-037 TITRE : Directive relative à l'usage du.................................................................................................................................. 1 1. USAGE DU TITRE DE PROFESSEURE OU DE PROFESSEUR .................................... 2 2

Vellend, Mark


Mise en place du systme de TMA dans les croles du Surinam : dveloppement interne ou contact de langues1 ?  

E-Print Network (OSTI)

1 Mise en place du système de TMA dans les créoles du Surinam : développement interne ou contact de anglaise du Surinam, et du ndyuka en particulier, montre une régularité à la fois dans les formes et dans différentes époques de contact. Les créoles de base lexicale anglaise du Surinam, résultat du contact entre

Paris-Sud XI, Université de


JOURNAL DE PHYSIQUE Colloque C5, supplment au n 5, Tome 40, Mai 1979, page C5-134 Theory of the transition temperature and the magnetization in Pr3Tl under  

E-Print Network (OSTI)

with increasing pressure. The first neutron scattering study of the magnetic exciton dynamics in the singlet is clearly quite substantial. Because of the fluctuations a smaller J(0) can sustain ordering. Recent neutron scattering measurements [3] of the exciton dispersion of (Pr,-,La,),Tl with c = 0, 0.07 and 0.12 shows

Boyer, Edmond


Production cross section of At radionuclides from $^{7}$Li+$^{\\textrm{nat}}$Pb and $^{9}$Be+$^{\\textrm{nat}}$Tl reactions  

E-Print Network (OSTI)

Earlier we reported theoretical studies on the probable production of astatine radionuclides from $^{6,7}$Li and $^{9}$Be-induced reactions on natural lead and thalliun targets, respectively. For the first time, in this report, production of astatine radionuclides has been investigated experimentally with two heavy ion induced reactions: $^{9}$Be+$^{\\textrm{nat}}$Tl and $^{7}$Li+$^{\\textrm{nat}}$Pb. Formation cross sections of the evaporation residues, $^{207,208,209,210}$At, produced in (HI, xn) channel, have been measured by the stacked-foil technique followed by the off-line $\\gamma$-spectrometry at the low incident energies ($<$50 MeV). Measured excitation functions have been explained in terms of compound nuclear reaction mechanism using Weisskopf-Ewing and Hauser-Feshbach model. Absolute cross section values are lower than the respective theoretical predictions.

Moumita Maiti; Susanta Lahiri



`Itinraire d'un enfant mou', `Le mal court' ou `L'chec sied au hros' : tude pour un sous-titre au  

E-Print Network (OSTI)

statut de héros étrangers au monde comme certains personnages de Steinbeck ou de l'étranger de Camus, par some of Steinbeck's characters or Camus' outsider, for example. B

Paris-Sud XI, Université de


Size Effect on Nuclear Gamma-Ray Energy Spectra Acquired by Different Sized CeBr3, LaBr3:Ce, and NaI:Tl Gamma-Ray Detectors  

SciTech Connect

Gamma-ray energy spectra were acquired for different sizes of cerium tribromide (CeBr3), cerium-doped lanthanum tribromide (LaBr3:Ce), and thallium-doped sodium iodide (NaI:Tl) detectors. A comparison was conducted of the energy resolution and detection efficiency of these scintillator detectors for different sizes of detectors. The results of this study are consistent with the observation that for each size detector, LaBr3:Ce offers better resolution than either a CeBr3 or NaI:Tl detector of the same size. In addition, CeBr3 and LaBr3:Ce detectors could resolve some closely spaced peaks in the spectra of several radioisotopes that NaI:Tl could not. As the detector size increased, all three detector materials exhibited higher efficiency, albeit with slightly reduced resolution. Significantly, the very low intrinsic activity of CeBr3 is also demonstrated in this study, which, when combined with energy resolution characteristics for a range of detector sizes, could lead to an improved ability to detect special nuclear materials compared to the other detectors.

Guss, Paul [NSTec; Reed, Michael [NSTec; Yuan, Ding [NSTec; Beller, Denis [UNLV; Cutler, Matthew [UNLV; Contreras, Chris [UNLV; Mukhopadhyay, Sanjoy [NSTec; Wilde, Scott UNLV



Processing of Mo-Si-B intermetallics by extrusion and oxidation properties of the extruded Tl-MoSi{sub 2}-MoB System  

SciTech Connect

An extrusion process was developed that is able to consistently produce large quantities of Mo-Si-B rods without the presence of defects. Binder removal from the extruded rods was studied in detail and it was determined that heating rates on the order of 0.02{degree}/minute (1.2{degree}/hour) are necessary to remove the binder without the formation of defects. This low heating rate resulted in debinding times in excess of 70 hours (approximately 3 days). Wicking was investigated as a means to decrease the time necessary for binder removal. Using 0.05{micro}m alumina powder as a wicking agent, binder removal times were reduced to 10 hours with heating rates up to 1{degree}/minute employed without defect formation. Once the extrusion process was complete the oxidation properties of the Tl-MoSi{sub 2}-MoB extruded phase assemblage was investigated. It was determined that this composition exhibits catastrophic oxidation or pesting in the temperature range of 660--760 C, resulting in the material turning to dust. Outside of this temperature range the composition is oxidatively stable. Continuous mass measurements were taken at 1,300, 1,450, and 1,600 C to determine the oxidation rate constants of this material. Parabolic rate constants of 6.9 x 10{sup {minus}3}, 1.3 x 10{sup {minus}3}, and 9.1 x 10{sup {minus}3} mg{sup 2}/cm{sup 4}/hr were determined for 1,300, 1,450, and 1,600 C respectively.

Summers, Eric


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


advancing ou r intellectual  

E-Print Network (OSTI)

Grand Challenge: Energy, Environment, and Infrastructure Grand Challenge: Health 2. Investing in Faculty ambition to transform Lehigh University by advanc- ing our intellectual footprint. The students and future' ability to compete in that world. · Globalization · Energy, environment, and infrastructure · Health Adv

Napier, Terrence


Licence de Sciences de la Terre Portail BGC (Biologie Gosciences chimie) Les Sciences de la Terre ou Gosciences sont accessibles via deux portails : BGC et PCGI  

E-Print Network (OSTI)

'autre. L'architecture de la Mention est bâtie autour de trois grands types d'UE : "quantitatives dans les autres disciplines Licence 3 Semestre 5 Géochimie ou (CNAM) (6ECTS) Géodyn. (3 ECTS) Envir

Arleo, Angelo


JOURNAL DE PHYSIQUE Colloque C7. supplkment ou no 12. Tome 38. dhcembre 1977. page C7-341 THE INFLUENCE OF SHORT RANGE INTERACTIONS  

E-Print Network (OSTI)

JOURNAL DE PHYSIQUE Colloque C7. supplkment ou no 12. Tome 38. dhcembre 1977. page C7 Netherlands Energy Research Foundation ECN, Petten, The Netherlands E. W. VAN ROYEN Materials Science Centre, Rijksuniversiteit Groningen, Groningen, The Netherlands and S. RADELAAR Physics Laboratory, Rijksuniversiteit

Paris-Sud XI, Université de


Ultrafast all-optical switching via coherent modulation of metamaterial absorption Xu Fang, Ming Lun Tseng, Jun-Yu Ou, Kevin F. MacDonald, Din Ping Tsai, and Nikolay I. Zheludev  

E-Print Network (OSTI)

Lun Tseng, Jun-Yu Ou, Kevin F. MacDonald, Din Ping Tsai, and Nikolay I. Zheludev Citation: Applied absorption Xu Fang,1,a) Ming Lun Tseng,2,3 Jun-Yu Ou,1 Kevin F. MacDonald,1 Din Ping Tsai,2,3,4 and Nikolay I

Zheludev, Nikolay


Le Camp Massawippi du Centre de radaptation MAB-Mackay est un camp de vacances bilingue qui reoit des campeurs gs entre 6 et 30 ans, qui vivent avec une dficience motrice, auditive ou visuelle. Le  

E-Print Network (OSTI)

des campeurs âgés entre 6 et 30 ans, qui vivent avec une déficience motrice, auditive ou visuelle. Le déficience motrice, auditive ou visuelle obligatoire; Aimer travailler avec les enfants et jeunes adultes et


Le Camp Massawippi du Centre de radaptation MAB-Mackay est un camp de vacances bilingue qui reoit des campeurs gs entre 6 et 30 ans, qui vivent avec une dficience motrice, auditive, ou visuelle. Le  

E-Print Network (OSTI)

des campeurs âgés entre 6 et 30 ans, qui vivent avec une déficience motrice, auditive, ou visuelle. Le; Connaissance de la clientèle vivant avec une déficience motrice, auditive ou visuelle un atout; Détenir une


Le Camp Massawippi du Centre de radaptation MAB-Mackay est un camp de vacances bilingue qui reoit des campeurs gs entre 6 et 30 ans, qui vivent avec une dficience motrice, auditive, ou visuelle. Le  

E-Print Network (OSTI)

des campeurs âgés entre 6 et 30 ans, qui vivent avec une déficience motrice, auditive, ou visuelle. Le développement personnel; Connaissance de la clientèle ayant une déficience motrice, auditive, visuelle ou du


Le Camp Massawippi du Centre de radaptation MAB-Mackay est un camp de vacances bilingue qui reoit des campeurs gs entre 6 et 30 ans, qui vivent avec une dficience motrice, auditive, ou visuelle. Le  

E-Print Network (OSTI)

des campeurs âgés entre 6 et 30 ans, qui vivent avec une déficience motrice, auditive, ou visuelle. Le-être; Connaître les besoins des personnes vivant avec une déficience motrice, auditive, visuelle ou du langage, un


Harry Potter, ange ou dmon ?, ds. I. Smadja et P. Bruno, P.U.F., octobre 2007, pp. 140-149 Nicole BIAGIOLI  

E-Print Network (OSTI)

les élèves lecteurs d'Harry Potter. Résumé La série de J. K. Rowling est un parfait exemple desHarry Potter, ange ou démon ?, éds. I. Smadja et P. Bruno, P.U.F., octobre 2007, pp. 140-149 1, Université de Nice-Sophia Antipolis, U.F.R. Lettres, Arts et Sciences humaines, 98 Bd. Edouard Herriot, B

Boyer, Edmond


Role of SRP RNA in the GTPase Cycles of Ffh and FtsY Paul Peluso, Shu-ou Shan, Silke Nock, Daniel Herschlag, and Peter Walter*,  

E-Print Network (OSTI)

Role of SRP RNA in the GTPase Cycles of Ffh and FtsY Paul Peluso, Shu-ou Shan, Silke Nock, Daniel recognition particle (SRP) and its receptor, the Ffh·4.5S RNA ribonucleoprotein complex and the FtsY protein the conformation of the Ffh·FtsY complex and may, in turn, regulate its GTPase activity during the SRP functional

Herschlag, Dan


Zhai, H., H.C. Frey, N.M. Rouphail, G.A. Gonalves, and T.L. Farias, "Fuel Consumption and Emissions Comparisons between Ethanol 85 and Gasoline Fuels for Flexible Fuel Vehicles," Paper No. 2007-AWMA-444, Proceedings, 100th  

E-Print Network (OSTI)

the Alternative Fuel Data Center (AFDC) of the U.S. Department of Energy.4 Carbon dioxide (CO2), CO, and nitricZhai, H., H.C. Frey, N.M. Rouphail, G.A. Gonçalves, and T.L. Farias, "Fuel Consumption and Emissions Comparisons between Ethanol 85 and Gasoline Fuels for Flexible Fuel Vehicles," Paper No. 2007-AWMA

Frey, H. Christopher


Le marchand tranger face la crise : dpart ou intgration ? Le cas de la colonie franaise de Cadix aux priodes rvolutionnaire et  

E-Print Network (OSTI)

1 Le marchand étranger face à la crise : départ ou intégration ? Le cas de la colonie française de fiables sur les marchés lointains était une nécessité pour tous les marchands participant aux échanges reconversion des négociants, mais également le problème plus spécifique du niveau d'intégration des marchands

Paris-Sud XI, Université de


Excitation functions of $^{nat}$Pb(d,x)$^{206,205,204,203,202}$Bi, $^{203cum,202m,201cum}$Pb and $^{202cum,201cum}$Tl reactions up to 50 MeV  

E-Print Network (OSTI)

Cross-sections of deuteron induced nuclear reactions on lead were measured up to 50 MeV using the standard stacked foil irradiation technique and high resolution $\\gamma$-ray spectrometry. Experimental cross-sections and derived integral yields are presented for the $^{nat}$Pb(d,x)$^{206,205,204,203,202}$Bi, $^{203cum,202m,201cum}$Pb and $^{202cum,201cum}$Tl reactions. The experimental data were compared with the results from literature and with the data in the TENDL-2013 library (obtained with TALYS code). The cross-section data were analyzed also with the theoretical results calculated by using the ALICE-IPPPE-D and EMPIRE-D codes.

F. Ditri; F. Trknyi; S. Takcs; A. Hermanne; A. V. Ignatyuk



Xinming (Simon) Ou Curriculum Vitae  

E-Print Network (OSTI)

2012. · Idaho National Laboratory, Research Associate, May 2006 ­ Aug 2006. · Purdue University, Post Research Instrumentation Program (DURIP), Air Force Office of Scientific Research (AFOSR). $605,650, 9 Office of Scientific Research. $1,000,311, 4/1/2012-3/31/2017. 6. An Innovative Cybersecurity Curriculum

Ou, Xinming "Simon"


Courses: Political Science (POLS) Page 361Sonoma State University 2010-2011 Catalog pOlS 312 AMeriCAn pOlitiCAl thOuGht (4)  

E-Print Network (OSTI)

Courses: Political Science (POLS) Page 361Sonoma State University 2010-2011 Catalog pOlS 312 AMeriCAn pOlitiCAl thOuGht (4) An examination of the development of American political ideas as reflected in the works and careers of representative writers and political leaders. pOlS 313 CritiCAl theOry: r

Ravikumar, B.


Le Camp Massawippi du Centre de radaptation MAB-Mackay est un camp de vacances bilingue qui reoit des campeurs gs entre 6 et 30 ans, qui vivent avec une dficience motrice, auditive, ou visuelle. Le  

E-Print Network (OSTI)

des campeurs âgés entre 6 et 30 ans, qui vivent avec une déficience motrice, auditive, ou visuelle. Le bien-être et leur développement personnel; Connaissance de la clientèle ayant une déficience motrice


Detection of ?-Irradiated Sesame Seeds before and after Roasting by Analyzing Photostimulated Luminescence, Thermoluminescence, and Electron Spin Resonance  

Science Journals Connector (OSTI)

Sesame seeds were irradiated using a 60Co irradiator (0?4 kGy) and then roasted (220 C for 10 min). To identify the irradiation treatment, physical detection methods like photostimulated luminescence (PSL), thermoluminescence (TL), and electron spin ...

Jeongeun Lee; Tusneem Kausar; Byeong-Keun Kim; Joong-Ho Kwon


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Action des enzymes pancratiques ou de leurs inhibiteurs sur les niveaux enzymatiques du pancras et de l'intestin chez le rat, par Agns ESTIVAL, P. FAGOT, F. CLMENTE,Agns ESTIVAL P. FAGOT F. CLMENTE,  

E-Print Network (OSTI)

Action des enzymes pancréatiques ou de leurs inhibiteurs sur les niveaux enzymatiques du pancréas intrapancréatique des enzymes sécrétoires. Ces résul- tats laissent supposer une action régulatrice de la trypsine sur la synthèse et la sécrétion des enzymes pancréatiques ; les facteurs impliqués dans la

Paris-Sud XI, Université de


Segmented crystalline scintillators: An initial investigation of high quantum efficiency detectors for megavoltage x-ray imaging  

E-Print Network (OSTI)

and dose delivery in external beam radiotherapy. However, current AMFPI EPIDs, which are based on powdered by infusing crystalline CsI Tl in a 2 mm thick tungsten matrix, and the signal response was measured under exhibited less than 15% reduction in light output after 2500 cGy equivalent dose. The prototype CsI Tl

Cunningham, Ian


Slug Test Characterization Results for Multi-Test/Depth Intervals Conducted During the Drilling of CERCLA Operable Unit OU ZP-1 Wells 299-W10-33 and 299-W11-48  

SciTech Connect

Slug-test results obtained from single and multiple, stress-level slug tests conducted during drilling and borehole advancement provide detailed hydraulic conductivity information at two Hanford Site Operable Unit (OU) ZP-1 test well locations. The individual test/depth intervals were generally sited to provide hydraulic-property information within the upper ~10 m of the unconfined aquifer (i.e., Ringold Formation, Unit 5). These characterization results complement previous and ongoing drill-and-test characterization programs at surrounding 200-West and -East Area locations (see Figure S.1).

Newcomer, Darrell R.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RECIPIENT: RECIPIENT: Govemor's Office of Energy Independence and Security PROJECT TITL.E: State Energy Program Year 2012 Fonnula Grant Page 1 of2 STATE: ME Funding Opportunity Announcement Number Procurement Instrument Number N[PA Control Number CID Number DE-FOA-0000643 R130272 GF0-0130272-OO1 Based on my ~view oftht information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, tiS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for determination: Technical adVice and planning assistance to International. nabonal state and local organtzatlons InfOOTlaboo gathenng (indudlng. but not limited to, literature surveys InventOrieS. Site visits and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Page 1 of2 Page 1 of2 RECIPIENT:Hudson Valley Community College sub: Mohaw k Valley Community College STATE: NY PROJECT TITLE: Northeast Photovaltaic Regional Training Provider Funding Opportunity Announc~mtnl Number Procu~mtnt Instrument Number NEPA Control Number CID Number DE-EE-O:Xl2087 OE-EEOOO2087 GF().{)()()2087-OO7 Based on my review orthe inform ation concerning the proPOSH action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the (oUowinli': determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A91nfonnation Information gathering (indudlng, but not limited to, literature surveys, Inventones, site Visits, and audits), gathering, analysis, data analysis (including, but not limited to, computer modeling), document preparation (induding, but



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REClPIENT:Optony Inc. REClPIENT:Optony Inc. PROJECf Southwest Solar Transformation Initiative TITLE: Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procuremrnt Instrument Number NEPA Control Number CID Number DOE·FQA.Q()()()549 DE-EEOOO5682 GF0-0005682-OO1 0 Based on my review of the information concerning the proposw action, as NEPA Compliance Offic:er (authorized under DOE Order 451.IA),1 have made the follOwing determination : ex, EA, [IS APPENDIX AND NUMBER: Ocscription : A11 Technical advice a nd as s istance to organizations Technical advice and planning assistance to international, national, state, and local organizabons A91nf ormation gathering. analysis, and dissemination Informabon gathenng (indudlng, but not limited 10, literature surveys, inventories, site VISits, and audits), data analysis


Autumn 2014 YoRK'S neW ReSeARCH StRAteGY  

E-Print Network (OSTI)

; Environmental Sustainability and Resilience; Health and Wellbeing; Justice and Equality; Risk, Evidence College ­ 4 a new student community Transforming the treatment 5 of cancer patients Pigs' unhappy balloon


ENE-.R:GY ORNL/Sub/80-61601/2 Research and Development of  

E-Print Network (OSTI)

~Supermarket Refrigeration Systems .~~~~E ~Volume 2 -- &i Supplementary Laboratory Testing William M. Toscano ENERGY-EFFICIENT SUPERMARKET REFRIGERATION SYSTEMS VOLUME 2 SUPPLEMENTAL LABORATORY TESTING JUNE, 1983 and development of a new, highly energy-efficient, supermarket refrigeration system: a. Investigate

Oak Ridge National Laboratory



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

individuals (such as builders, owners, consultan ts, designers), organizations (such as utilities), and state and local governments. Covered actions include, but are not limited...


Analysis of AGS E880 polarimeter data at Gy = 12.5.  

SciTech Connect

Data were collected with the AGS internal (E880) polarimeter at G{gamma} = 12.5 during the FY04 polarized proton run. Measurements were made with forward scintillation counters in coincidence with recoil counter telescopes, permitting an absolute calibration of the polarimeter for both nylon and carbon targets. The results are summarized and they will also be useful for an absolute calibration of the AGS CNI polarimeter at G{gamma} = 12.5.

Cadman, R.; Huang, H.; Krueger, K.; Spinka, H.; Underwood, D. (High Energy Physics); (Brookhaven National Laboratory)



Inn vati ns at EECS: Techn l gy f r a gl bal future  

E-Print Network (OSTI)

of Society Invention Lab 141/143 Sutardja Dai Hall Center for Research in Energy Systems Transformation 406 - Peter Bailis, AMPLab (Algorithms, Machines, and People Laboratory) · Raven: An Energy Wireless Research Center) & E3S (Center for Energy Efficient Electronics Science) · Occupant Detection

California at Irvine, University of


Tennessee Business and economic ouTlook  

E-Print Network (OSTI)

Director and Project Director Center for Business and Economic Research Prepared by the Center for Business. Murray, Associate Director and Project Director Donald J. Bruce, Associate Professor LeAnn Luna the worst may be over for the banking sector, global stock markets remain a mess. And the real economy

Tennessee, University of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Meteorological Tower Installation Mille Lacs Band of Ojibwa Indian Reservation ; NREL Tracking No. 10- 012 Funding Opportunity Announcement Number Proturement Instrument Number...



E-Print Network (OSTI)

diffèrent des halogé- nures alcalins notamment par leur grande constante diélectrique optique et par un

Paris-Sud XI, Université de


Nanocrystalline BaSO{sub 4}:Eu For Dosimetry of Proton Beams  

SciTech Connect

Nanocrystalline BaSO{sub 4} doped with Eu, was prepared by the Chemical Co-precipitation method. The particle size was calculated by the broadening of the XRD peaks using Scherrer's formula with particle size around 45 nm. Samples in the form of pellets were irradiated by 150 MeV proton beam with dose range of 0.1 Gy to 325 Gy. Thermoluminescence (TL) glow curves of the irradiated samples were recorded and studied. It has been found that there are two prominent TL glow peaks at 460 K and 495 K. The TL response is sublinear below 1 Gy, linear in the range 1 Gy to 200 Gy and then becomes supralinear for higher doses. The wider linear TL response of nanocrystalline BaSO{sub 4}:Eu and low fading makes it a superior candidate as a dosimeter to be used for detecting the doses of protons for its various applications in the field of space, therapy and research.

Bahl, Shaila; Kumar, Pratik [Medical Physics Unit, IRCH, AIIMS, New Delhi-110029 (India); Lochab, S. P. [Inter-University Accelerator Center, Aruna Asaf Ali Marg, New Delhi - 110067 (India); Pandey, Anant [Department of Physics, Sri Venkateswara College, New Delhi-110021 (India); Aleynikov, V. E.; Molokanov, A. [Joint Institute for Nuclear Research, Dubna - 141980 (Russian Federation)




E-Print Network (OSTI)

, Département Acoustique et Eclairage 11 rue Henri Picherit, 44300 Nantes, France. Problématique : Dans le cadre. Tiberio et S. Maci [TIB 1, TIB 2]. Il présente l'avantage, par rapport aux autres publications traitant de

Paris-Sud XI, Université de


Gt'o(,MimrClI t'l CO,\  

E-Print Network (OSTI)

) anthropogenic inputs of various elements as compared to natural sources, (2) mid-ocean ridges (through seawater calcula- tions, R-mode factor analysis and mass balance calcu- lations .. The selection of geochemical in a standard material. In this section, average shale (TUREKtAN and WEDEPOHL, 1961) is adopted as the standard

Luther, Douglas S.


TL detectors for gamma ray dose measurements in criticality accidents  

Science Journals Connector (OSTI)

......Aires, Republica Argentina Determination of...depend on neutron energy i.e., on neutron...into account the energy dependence of dosemeter...Nuclear (ARN), Argentina. All dosemeters...into account the energy dependence of dosemeter...Nuclear (ARN), Argentina. All dosemeters......

Saveta Miljanic; Benjamin Zorko; Beatriz Gregori; Zeljka Knezevic



TL detectors for gamma ray dose measurements in criticality accidents  

Science Journals Connector (OSTI)

......both the neutron and the gamma...radiation field induced by criticality...with both neutron and photon...the neutron spectrum can improve...on neutron energy i.e...251017 fissions, t=35s...data about energy spectrum, the choice...shielding from thermal neutrons (containing......

Saveta Miljanic; Benjamin Zorko; Beatriz Gregori; Zeljka Knezevic



L-Shell Fluorescence Yields of Pt, Tl, and Pb  

Science Journals Connector (OSTI)

Partial L-shell fluorescence yields for three heavy elements have been measured using an x-ray coincidence counting method. Vacancies in the K shell of the atom are produced either by K-electron capture or internal conversion of a nuclear gamma ray in the K shell. The coincidence rate between the K and L x rays observed after the creation of the K vacancy determines the partial fluorescence yield, ?KL. This quantity is defined as the fluorescence yield of those vacancies in the L shell created by K?1 and K?2 x-ray emission. In some cases, it was also possible to determine the partial fluorescence yield, ?LL of the L shell following L-electron capture. The results obtained are in reasonable agreement with previous measurements. The relationship between ?KL, ?LL, and the fluorescence yields of individual L subshells is discussed.

R. C. Jopson; Hans Mark; C. D. Swift


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


School of Civil and Environmental Engineering GE O RGIA IN S TITU TE O F TE CHN O LO GY  

E-Print Network (OSTI)

ENVIRONMENTAL ENGINEERING · Environmental biotechnology · Water quality and treatment · Wastewater reclamation in chemostat vessels. EnvE #12;CEE @ GT EFM&WR ENVIRONMENTAL FLUID MECHANICS & WATER RESOURCES . Science & engineering applications of environmental transport processes . Sustainable resource management . Innovative

Jacobs, Laurence J.


Study of Photostimulated- and Thermo-luminescence Characteristics for Detecting Irradiated Kiwifruit  

Science Journals Connector (OSTI)

Photostimulated luminescence (PSL) and thermo-luminescence (TL) analyses were conducted to detect irradiated kiwifruits. Samples were irradiated with Co-60 ?-rays at 02 kGy. The freeze-dried kiwifruit peel showed 309 photon counts (PCs) for nonirradiated ...

Deokjo Jo; Byeong-Keun Kim; Tusneem Kausar; Joong-Ho Kwon



Radiation Protection Dosimetry Vol. 100, Nos 14, pp. 207209 (2002)  

E-Print Network (OSTI)

207 Radiation Protection Dosimetry Vol. 100, Nos 1­4, pp. 207­209 (2002) Nuclear Technology, Ship Research Institute, Tokyo, Japan §Institute of General and Inorganic Chemistry, Moscow, Russia. The dependence of the TL efficiency on the radiation dose was found to be linear up to 6 kGy for the 3 at.% Pr3

Chen, Reuven



Gasoline and Diesel Fuel Update (EIA)

DOE DOE /E/A- 0202( 83//Q J Sh or t-T er m En er gy O ut lo ok a to m Quar terly Proje ction s Febru ary 1983 Ene rgy Info rma tion Adm inist ratio n Was hing ton, D.C. t rt jrt .or t lor t lor t .lor t- ior t- ior t <.o rt ort . m .er m -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -T erm -T erm -T erm Nrm ue rgy En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y ^n erg y Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Sh ort -T erm 1 Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm


Microsoft Word - mOu_NERSC_ITWN.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

between NERSC Lawrence between NERSC Lawrence Berkeley National Laboratory and ITWM Fraunhofer Gesellschaft Document Version: 0.3 9/26/2000 The National Energy Research Scientific Computing Division (NERSC) at the Lawrence Berkeley National Laboratory is a leading-edge scientific computing center, providing high-end computing services and performing leading-edge computational science research, operated under the auspices of the Office of Science in the U.S. Department of Energy. The Institut für Techno- und Wirtschaftsmathematik (ITWM) in Kaiserslautern, Germany provides a critical link between the academic fields of applied mathematics and computational science on one hand, and the world of practical industrial engineering on the other. In recent discussions, these institutions have identified several areas of mutual


L'Amrique latine ou les Amriques latines Georges Couffignal  

E-Print Network (OSTI)

, le Suriname, la Guyane, la Jamaïque, la Guadeloupe, la Martinique et les mini ?tats de la Caraïbe. Au

Paris-Sud XI, Université de


ClRe GiOuPr Journal of DISCOVERY  

E-Print Network (OSTI)

Center researcher Sherry Chow, PhD, and colleagues have discovered antioxidants in green tea that can of the huge variety of work under way here. Read about green tea as a cancer preventive agent, exciting of Regents. The University of Arizona is an EEO/AA ­ M/W/D/V Employer. 2 | Going Green | Arizona Cancer

Arizona, University of


Brookhaven National Laboratory - OU III VOC | Department of Energy  

Office of Environmental Management (EM)

Driver Cleanup Requirement CCI4 64 Yes 5 Chloroform 19 Yes 5 DCA 12 Yes 5 DCE 77 Yes 5 PCE 1000 Yes 5 TCS 87 Yes 5 freon 450 (ppm) 5 Fuel Present? No Metals Present? Yes Isotopes...


Pereg Kineret ID_066592809 -DN: c=IL, title= , ou= ,  

E-Print Network (OSTI)

.2. , . . , 6.: 6.1.. 6.2." , ­1603. 6.2. , , 05,555() ,12.6.2512 . ' 6.2.255. 6.0.(PARTNER.6.05% " " " ' 11. 6.: , 6.1... , 6.2." , -1603 , ) ( . 6.2.. ' 6.2.( HP

Maoz, Shahar


Brookhaven National Laboratory - OU I/IV VOC | Department of...  

Office of Environmental Management (EM)

and only post closure monitoring of several wells continues in this area. The Strontium 90 plume is several acres and concentrations still remain above cleanup goals. Basis...


Brookhaven National Laboratory - OU VI VOC | Department of Energy  

Office of Environmental Management (EM)

Present? No Contaminant Concentration (ppb) Regulatory Driver Cleanup Requirement ethylene dibromide 2.3 Yes 0.05 Hydrogeology Conduit Flow? No Depth (feet): 100 Mulitple Units...


Savannah River Site - Central Shops GW OU | Department of Energy  

Office of Environmental Management (EM)

Migration Under Control? No Current Human Exposure Acceptable? Yes Confirmed by Lead Regulator? Yes Confirmed by Lead Regulator? Yes Regulatory Decision Document Status?...


Brookhaven National Laboratory - OU I VOC | Department of Energy  

Office of Environmental Management (EM)

Migration Under Control? Yes Current Human Exposure Acceptable? Yes Confirmed by Lead Regulator? Yes Confirmed by Lead Regulator? Yes Regulatory Decision Document Status? Decision...


A Cultura na Rua: Estratgia ou Entretenimento Cultural.  

E-Print Network (OSTI)

??Trabalho de Projecto apresentado para cumprimento dos requisitos necessrios obteno do grau de Mestre em Prticas Culturais para Municpios Em Portugal, so muitos os (more)

Fonseca, Tiago Miguel Pereira Martins da



Numerical calculation of Green's functions  

E-Print Network (OSTI)

have: lim $ (x) represents E~O E (7+6 p dG lim) ( ? ( ) d. qG )dx = ? 1 E Then r '+' a ( ? (~) ? qG)d? = ? 1 and by direct integration ix= ad+6 6~0 x= g ? 6 The condition expressed by equation (1. 2. 6) is known as the jump condition.... Let 1 + x = y; then g(y) = e 1 I ( y I ) 2 = e y ( 2 - y ) 0 & y & 2 g(y) = o y & 0; then 23 ~d( ) ( ~d( ) ( &, ~tl ? (0) x=-1 y=0 y~ If y& 0 then g(y) = 0 and lim g-Z ? = 0, =1 I f y & 0 use z = ? in the expression then 1 lim ? g(y) = lim...

Urrea-Beltran, Julian



On LiF:Mg,Cu,P and LiF:Mg,Ti phosphors high & ultra-high dose features  

E-Print Network (OSTI)

LiF:Mg,Ti and LiF:Mg,Cu,P are well known thermoluminescence (TL) dosimetry materials since many years. A few years ago their properties seemed well known and it was widely believed that they are not suitable for the measurement of doses above the saturation level of the TL signal, which for both materials occur at about 1 kGy. The high-dose high-temperature TL emission of LiF:Mg,Cu,P observed at the IFJ in 2006, which above 30 kGy takes the form of the so-called TL peak B, opened the way to use this material for measuring the dose in the high and ultra-high range, in particular for the monitoring of ionizing radiation around the essential electronic elements of high-energy accelerators, also fission and fusion facilities, as well as for emergency dosimetry. This discovery initiated studies of high and ultra-high dose characteristics of both of these phosphors, which turned out to be significantly different in many aspects. These studies not only strive to refine the method for measuring high doses based on th...

Obryk, Barbara; de Barros, Vinicius S; Guzzo, Pedro L; Bilski, Pawe?




SciTech Connect

Intrinsic dosimetry is the method of measuring total absorbed dose received by the walls of a container holding radioactive material. By considering the total absorbed dose received by a container in tandem with the physical characteristics of the radioactive material housed within that container, this method has the potential to provide enhanced pathway information regarding the history of the container and its radioactive contents. The latest in a series of experiments designed to validate and demonstrate this newly developed tool are reported. Thermoluminescence (TL) dosimetry was used to measure dose effects on raw stock borosilicate container glass up to 70 days after gamma ray, x-ray, beta particle or ultraviolet irradiations at doses from 0.15 to 20 Gy. The TL glow curve when irradiated with 60Co was separated into five peaks: two relatively unstable peaks centered near 120 and 165C, and three relatively stable peaks centered near 225, 285, and 360C. Depending on the borosilicate glass source, the minimum measurable dose using this technique is 0.15-0.5 Gy, which is roughly equivalent to a 24 hr irradiation at 1 cm from a 50-165 ng source of 60Co. Differences in TL glow curve shape and intensity were observed for the glasses from different geographical origins. These differences can be explained by changes in the intensities of the five peaks. Electron paramagnetic resonance (EPR) and multivariate statistical methods were used to relate the TL intensity and peaks to electron/hole traps and compositional variations.

Clark, Richard A.



Nanocrystalline K{sub 2}Ca{sub 2}(SO{sub 4}){sub 3}: Eu for proton beam dosimetry  

SciTech Connect

This paper investigates the Thermoluminescent response of nanocrystalline K{sub 2}Ca{sub 2}(SO{sub 4}){sub 3}: Eu, prepared by Co-precipitation technique to 150 MeV proton beam. The particle size was calculated to be 45 nm by the broadening of the XRD peaks using Scherrer's formula. Samples in the form of pellets were irradiated by 150 MeV proton beam with dose range of 0.1 Gy to 325 Gy. Thermoluminescence (TL) glow curves of the irradiated samples were recorded and studied. It has been found that the phosphor shows a characteristic single peak at around 420 K. The TL response is linear in the range upto 200 Gy and then saturates for higher doses. The wider linear TL response of nanocrystalline K{sub 2}Ca{sub 2}(SO{sub 4}){sub 3}: Eu and low fading makes it a superior candidate as a dosimeter to be used for detecting the doses of protons beams for its various applications in the field of space, therapy and research.

Bahl, Shaila; Lochab, S. P.; Pandey, A.; Aleynikov, V. E.; Molokanov, A.; Kumar, Pratik [Medical Physics Unit, IRCH, AIIMS, New Delhi-110029 (India); Inter-University Accelerator Center, Aruna Asaf Ali Marg, New Delhi - 110067 (India); Department of Physics, Sri Venkateswara College, New Delhi-110021 (India); Joint Institute for Nuclear Research, Dubna - 141980 (Russian Federation); Medical Physics Unit, IRCH, AIIMS, New Delhi-110029 (India)



E3NE3R'GY ORNL/Sub/80-13817/1&20 RD&D Opportunities for Large Air  

E-Print Network (OSTI)

by TRW Energy Engineering Division 800 Oak Ridge Turnpike Oak Ridge, Tennessee 37830 under Subcontract 62X-13817C, Letter Release 62X-20 JN -sf2;~~~~~~~~~for Oak Ridge National Laboratory Oak Ridge by TRW Energy Engineering Division 800 Oak Ridge Turnpike Oak Ridge, Tennessee 37830 Under Subcontract 62

Oak Ridge National Laboratory


Cell Cycle Disturbances and Mitotic Catastrophes in HeLa Hep2 Cells following 2.5 to 10 Gy of Ionizing Radiation  

Science Journals Connector (OSTI)

...death (2-5). Radiation is known to exert...molecules involved in this radiation-induced cellular safety machinery is p53...different doses of radiation at the molecular and...using the CellQuest software program, setting...

David Eriksson; Per-Olov Lfroth; Lennart Johansson; Katrine hlstrm Riklund; and Torgny Stigbrand


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Combined TL and 10B-alanine ESR dosimetry for BNCT  

Science Journals Connector (OSTI)

......Mijnheer, B. J. Determination of dose components...neutron beam for boron neutron capture...Validation Studies | 0 Isotopes 7440-42-8 Boron | Body Burden...radiation effects Boron Neutron Capture...therapeutic use Humans Isotopes radiation effects......

A. Bartolotta; M. C. D'Oca; B. Lo Giudice; M. Brai; R. Borio; N. Forini; P. Salvadori; S. Manera



Application of different TL detectors for the photon dosimetry in mixed radiation fields used for BNCT  

Science Journals Connector (OSTI)

......neutrons as used for Boron Neutron Capture...The experimental determination of the thermal neutron...INTRODUCTION In BNCT a boron compound enriched...and 7LiF of such isotope compositions are...neutrons as used for Boron Neutron Capture...The experimental determination of the thermal neutron......

B. Burgkhardt; P. Bilski; M. Budzanowski; R. Bttger; K. Eberhardt; G. Hampel; P. Olko; A. Straubing



Radiation damage in undoped CsI and CsI(Tl)  

SciTech Connect

Radiation damage has been studied in undoped CsI and CsI(TI) crystals using [sup 60]Co gamma radiation for doses up to [approximately] 4.2 [times] 10[sup 6]. Samples from various manufacturers were measured ranging in size from 2.54 cm long cylinders to a 30 cm long block. Measurements were made on the change in optical transmission and scintillation light output as a function of dose. Although some samples showed a small change in transmission, a significant change in light output was observed for all samples. Recovery from damage was also studied as a function of time and exposure to UV light. A short lived phosphorescence was observed in undoped CsI, similar to the phosphorescence seen in CsI(TI).

Woody, C.L.; Kierstead, J.A.; Levy, P.W.; Stoll, S.



Radiation damage in undoped CsI and CsI(Tl)  

SciTech Connect

Radiation damage has been studied in undoped CsI and CsI(TI) crystals using {sup 60}Co gamma radiation for doses up to {approximately} 4.2 {times} 10{sup 6}. Samples from various manufacturers were measured ranging in size from 2.54 cm long cylinders to a 30 cm long block. Measurements were made on the change in optical transmission and scintillation light output as a function of dose. Although some samples showed a small change in transmission, a significant change in light output was observed for all samples. Recovery from damage was also studied as a function of time and exposure to UV light. A short lived phosphorescence was observed in undoped CsI, similar to the phosphorescence seen in CsI(TI).

Woody, C.L.; Kierstead, J.A.; Levy, P.W.; Stoll, S.



E-Print Network 3.0 - adenosine stress tl-201 Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

proteins Summary: protein; T84 cells; ADENOSINE IS A PURINE NUCLEOSIDE generated by ATP catabolism at sites of tissue stress... Agonist-induced polarized trafficking and...


Vision Statement for Research and Educationall Outreach for tl1e...  

NLE Websites -- All DOE Office Websites (Extended Search)

P. J. lamb Cooperative Institute for Mesoscale Meteorological Studies K. C. Crawford Oklahoma Climatological Survey F. V. Brock School of Meteorology R. M. Rabin National Severe...


Formation of thin film Tl-based high-Tc? superconducting oxides from amorphous alloy precursors  

E-Print Network (OSTI)

-jar vacuum chamber. The bell-jar vacuum chamber was evacuated by use of the standard set-up of a roughing pump and difFusion pump connected to the chamber (see Fig. 2. 1) via a cold trap. Feed through lines for air, electrical current, quartz crystal... and thallium dif- fusion as opposed to a system where thallium was a part of the deposition. The process also was simpler than attempting to get the correct ratio of thallium with respect to the other elements during deposition of the precursor...

Williams, John Charles



DO WEM-0307 Advanced Worker Protection System TlVE TECHNOLOGY...  

Office of Scientific and Technical Information (OSTI)

of Energy DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. Y DESCRI TION...



E-Print Network (OSTI)

of field windings (phases) that can be switched on to produce pole pairs (N and S). Variable reluctance (VR and Control of Stepper Motors c. de Silva, Industrial Automation Laboratory, UBC Department of Mechanical Engineering CICSR-TR91-017 #12;-' i MODELING AND CONTROL OF STEPPER MOTORS Clarence W. de Silva NSERC

Wilton, Steve


Method of fabricating a (1223) Tl-Ba-Ca-Cu-O superconductor  

DOE Patents (OSTI)

A method is disclosed for fabricating a polycrystalline <223> thallium-containing superconductor having high critical current at elevated temperatures and in the presence of a magnetic field. A powder precursor containing compounds other than thallium is compressed on a substrate. Thallium is incorporated in the densified powder precursor at a high temperature in the presence of a partial pressure of a thallium-containing vapor. 2 figs.

Tkaczyk, J.E.; Lay, K.W.; He, Q.



Contact presse : Cedric Ulmer Tl. : +33 4 92 91 14 27  

E-Print Network (OSTI)

projet se termine avec la mise en place de la solution de recherche Constellio dans l'intranet de la suite à une volonté politique forte de se tourner vers les technologies d'avenir, la ville d

Gesbert, David


Application of different TL detectors for the photon dosimetry in mixed radiation fields used for BNCT  

Science Journals Connector (OSTI)

......response ratio of such a pair at the Geesthacht Neutron Facility (GeNF) operated by...reference field, operated by PTB at the Geesthacht Neutron Facility (GeNF)(4) and...response ratio of such a pair at the Geesthacht Neutron Facility (GeNF) operated by......

B. Burgkhardt; P. Bilski; M. Budzanowski; R. Bttger; K. Eberhardt; G. Hampel; P. Olko; A. Straubing



E-Print Network 3.0 - au tl-201 permettent-elles Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Source: Ecole Polytechnique, Centre de mathmatiques Collection: Mathematics 14 RSTI -RIA 192005. ARCo'04, pages 45 55 Formes symboliques et mergence Summary: formes...


Current Activities at the ACRELab Renewable Energy Systems Test T.L. Pryor1  

E-Print Network (OSTI)

of New South Wales2 Australian CRC for Renewable Energy3 E-mail: pryor@central.murdoch.edu.au Abstract includes the following components: · A programmable 10 kW Dc power supply · 1000W HP PV array simulator · A 27.5 kVA diesel genset · A 20 kW Westwind/ACRE wind turbine · A 20 kW AES three phase inverter


Measurements of NaI(Tl) electron response: comparison of different samples  

E-Print Network (OSTI)

and by the National Nuclear Security Administration, Officepart by the National Nuclear Security Administration, OfficeNuclear Detection Office of the Department of Homeland Security.

Hull, Giulia



Dosimetric property of mineral extracted from calamari and exposed to gamma rays  

SciTech Connect

Dosimetric property of polymineral fraction, quartz mainly, obtained from calamari was investigated. The commercial calamari samples from China and Sud Africa were collected in the markets of Italy. All polymineral debris were extracted and isolated from the whole body of calamari. The surface of the polymineral samples was analyzed by using the Scanning Electron Microscopy (SEM) and their chemical composition was determined using Energy Dispersive Spectroscopy (EDS). The polymineral was exposed to gamma rays ({sup 60}Co) at different doses (0.5-80 Gy) to determine dosimetric property. Thermoluminescent (TL) glow curves showed two peaks centered at around 98-100 Degree-Sign C and 128-138 Degree-Sign C temperature range. The glow curves have been analyzed by using a deconvolution program. A linear dose response between 0.5 to 20 Gy was observed. The TL response of the samples as a function of the time storage, fading, presented a reduction of about 36-40 % at the end of 24 h. The reproducibility of the TL response after ten cycles of irradiation-readout showed an acceptable standard deviation in dosimetry. The polimineral fraction obtained from calamari shows an interesting dosimetric property and it may be useful for dosimetry in gamma radiation field.

Cruz-Zaragoza, E.; Roman-Lopez, J.; Cruz, L. Perez; Furetta, C. [Unidad de Irradiacion y Seguridad Radiologica, Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, A.P. 70-543, 04510 Mexico D.F (Mexico); Chiaravalle, E.; Mangiacotti, M.; Marchesani, G. [Centro di Referenza Nazionale per la Ricerca della Radioattivita nel Settore Zootecnico-Veterinario, Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata, Via Manfredonia 20, I-71121 Foggia (Italy)



Lack of Effect of Human Growth Hormone and Ovine Prolactin on Cancer in Man  

Science Journals Connector (OSTI)

...x} _ 4% [Ad"n J 6AQ 07 % aC8nT L #T 0qL MJdCa l&J / ^"gy d? P 8 Lb" _Z / y s3 / M 5 P2c " ) p Bp0 % 0}r ) >B aA D` o (3:A > F / 9) l r L4 p C (9 (a"0J L B ! p 2 C : ' 2 e E #tL* k E ] l 9 ] r$ H r z...

Mortimer B. Lipsett and Delbert M. Bergenstal



E-Print Network 3.0 - aglomerados ou sistemas Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Information Sciences 78 ISR-Lisboa | Instituto de Sistemas e Robtica Lisboa | Lisboa e Horta Av. Rovisco Pais 1049-001 Lisboa, Portugal Tel: (+351) 218 418 289 Fax: (+351) 218...


Google, ou comment s'imposer comme un point de passage oblig 1. Introduction  

E-Print Network (OSTI)

, sur le livre de John Battelle « The Search » pour les aspects économiques et stratégiques de la of a large-scale hypertextual web search engine » qui traite du fonctionnement de Google sur le plan d'un projet de recherche pour travailler sur un moteur d'analyse des liens hypertextes qu

Paris-Sud XI, Université de


Aide la vie quotidienne ou la robotique vue par un mdecin  

E-Print Network (OSTI)

Vella, Guillaume Lepicard Pour en savoir plus et liens vers démos : www.aal-domeo.org #12;Salle des Patient search Patient location Video call Telealarm Call to robot Video call Case assessment Patient search Video request Video call In black : sequence in case a telealarm trigger is the primum movens

Ingrand, François

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

-based control of big marine engines and naval propulsion and then moved to cars and trucks. Beyond automotive

Eustice, Ryan


0191-!00~,R!1030:OU-10103 oo!(l Perpamon Press Ltd  

E-Print Network (OSTI)

loading profile) are also outside the scope of this paper. nuclear power plants,5 but the approach Studies, Massachusetts Institute of Technology, Cambridge. MA 02139. U.S.A. (Receioed 8 July 1980 it will be lower than the time required to load the network (which is capacity constrained). Note also

Powell, Warren B.


Introduc~ao ao LATEX 2 Ou LATEX2 em 105 minutos  

E-Print Network (OSTI)

Chapman, Christopher Chin, Carl Cerecke, Chris McCormack, Wim van Dam, Jan Dittberner, Michael John Downes, David Dureisseix, Elliot, David Frey, Robin Fairbairns, J¨org-- Fischer, Erik Frisk, Frank, Kasper B, Claus Malten, Kevin Van Maren, Lenimar Nunes de Andrade, Hubert Partl, John Refling, Mike Ressler, Brian

Reverbel, Francisco


High explosive spot test analyses of samples from Operable Unit (OU) 1111  

SciTech Connect

A preliminary evaluation has been completed of environmental contaminants at selected sites within the Group DX-10 (formally Group M-7) area. Soil samples taken from specific locations at this detonator facility were analyzed for harmful metals and screened for explosives. A sanitary outflow, a burn pit, a pentaerythritol tetranitrate (PETN) production outflow field, an active firing chamber, an inactive firing chamber, and a leach field were sampled. Energy dispersive x-ray fluorescence (EDXRF) was used to obtain semi-quantitative concentrations of metals in the soil. Two field spot-test kits for explosives were used to assess the presence of energetic materials in the soil and in items found at the areas tested. PETN is the major explosive in detonators manufactured and destroyed at Los Alamos. No measurable amounts of PETN or other explosives were detected in the soil, but items taken from the burn area and a high-energy explosive (HE)/chemical sump were contaminated. The concentrations of lead, mercury, and uranium are given.

McRae, D.; Haywood, W.; Powell, J.; Harris, B.



E-Print Network 3.0 - anos ou mais Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

vrias Aces de Divulgao do Programa de Source: Instituto de Sistemas e Robotica - Polo de Lisboa (Institute for Systems and Robotics, Lisbon pole) Portugal...


E-Print Network 3.0 - alongar relaxar ou Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

tempo para ti: tempo para sonhar, tempo para ... Source: Instituto de Sistemas e Robotica - Polo de Lisboa (Institute for Systems and Robotics, Lisbon pole) Portugal...


E-Print Network 3.0 - ao trabalho ou Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

realizados pelos alunos da disciplina de Oficinas Source: Instituto de Sistemas e Robotica - Polo de Lisboa (Institute for Systems and Robotics, Lisbon pole) Portugal...


Crible quadratique, fractions continu'ees et o`u l'on verra '  

E-Print Network (OSTI)

divisions par nanoseconde sur un super­ordinateur hyperparall`ele, quantique et extra­terrestre, il faudrait

Banderier, Cyril


Using The Self-Service Feature of OU HRMS Learning module date: 10//07  

E-Print Network (OSTI)

section. This review will take ten 10 minutes or less to complete. If you do not know your User ID or your Earnings Statements can be viewed under the "Payroll and Compensation" section (see illustration above

Oklahoma, University of


Le Numerus clausus, ou la planification de la pnurie mdicale, 19712009  

Science Journals Connector (OSTI)

Nous sommes en 1971. Trois ans aprs 1968, aprs cette priode de rvolte o les jeunes ont fait si peur la France. Mais cela sest calm, les ouvriers travaillent, les tudiants tudient. Ces tudiants, ils...

Daniel Wallach



> L'tudiant(e) peut se prsenter 1, 2, 3 ou 4  

E-Print Network (OSTI)

« Numerus clausus » ­ est fixé chaque année par arrêté du ministre de l'Enseignement supérieur et de la, dépôt des voeux en juin, à l'issue de cette procédure, inscription définitive via Internet. > Numerus clausus pour l'année 2012-2013 : Médecine 200 Pharmacie 85 Odontologie 45 Maïeutique 27 Organisation

Rennes, Université de


E-Print Network 3.0 - animal irradie ou Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Dunlop E.D., Albuisson M., Wald L, 2006. Online data and tools for estimation of solar electricity in Africa: the PVGIS approach. Proceedings from 21st Summary: Basin, Africa...


et discipline ou spcialit Institut National Polytechnique de Toulouse (INP Toulouse)  

E-Print Network (OSTI)

2014 Modular Multilevel Converters for HVDC power stations ED GEET : Génie Electrique LABORATOIRE2014 #12;tel-00945375,version1-12Feb2014 #12;MODULAR MULTILEVEL CONVERTERS FOR HVDC POWER STATIONS i of the work. Mr. Philippe EGROT, engineer at EDF in the HVDC frame for having accepted to review my thesis

Paris-Sud XI, Université de


Operational experience of electronic active personal dosemeter and comparison with CaSo4:Dy TL dosemeter in Indian PHWR  

Science Journals Connector (OSTI)

......radiation level and personnel monitoring by Health...Physics Group. The personnel monitoring in operation...In India, the personnel monitoring for...modifications, material selection, components improvement...ALARA measures, RP training, good practices...economical, multiple operating cycles, less fading......

Vishwanath P. Singh; S. S. Managanvi; R. R. Bihari; H. R. Bhat



Evaluation of NaI(TL) and plastic scintillators for use in remote, unattended, and portal monitoring  

SciTech Connect

The authors have evaluated and compared some of the relevant operating characteristics of NaI and plastic scintillators for use in various safeguards monitoring applications. These include a sensitivity analysis of the two scintillators to various radiation fields and scintillator response as affected by environmental temperature. A comparison of experiment and modeling via the Monte Carlo N-Particle (MCNP) code has been performed to validate the calculational techniques. This then enables complex detector situations to be simulated with increased confidence.

Staples, P.; Audia, J.; Bai, Y.; Briggs, M.; Halbig, J.K.; Ianakiev, K.D.



Operational experience of electronic active personal dosemeter and comparison with CaSo4:Dy TL dosemeter in Indian PHWR  

Science Journals Connector (OSTI)

......gamma-ray for the energy range 50 keV...The angular response of Saphydose...and 60Co gamma energies. The equivalent...It shows quick response for dose and dose rate, storage of dose/dose...monthly processing frequency. The dose measurement......

Vishwanath P. Singh; S. S. Managanvi; R. R. Bihari; H. R. Bhat



A comparative study of the responses of lithium borate and calcium sulphate phosphors in a TL personal dosemeter  

Science Journals Connector (OSTI)

......preparation and loading of Caorso reactor spent fuel elements in the...dosemeters' account for the reliability of the method. A study...Oxygen | Algorithms Borates analysis Boron analysis Calcium Sulfate analysis Humans Lithium analysis......

M. Ceretti; G. Costa; S. Romani; F. Bobba



Operational experience of electronic active personal dosemeter and comparison with CaSo4:Dy TL dosemeter in Indian PHWR  

Science Journals Connector (OSTI)

......comparative analysis of dose, energy...3, 13) and reliability. The angular...nuclear power reactors, research reactors...dosemeters. RELIABILITY APD is a user-friendly...transactions during reactor outage. The...be read for analysis. However...reduction for more reliability of the dosemeters......

Vishwanath P. Singh; S. S. Managanvi; R. R. Bihari; H. R. Bhat



Operational experience of electronic active personal dosemeter and comparison with CaSo4:Dy TL dosemeter in Indian PHWR  

Science Journals Connector (OSTI)

......completion of job within planned dose. Battery Batteries of the APD are capable of operating...operation with a provision that the batteries can only be removed with a special...such as nuclear power plants, fuel reprocessing plants, research......

Vishwanath P. Singh; S. S. Managanvi; R. R. Bihari; H. R. Bhat



Figure 1. Time-of-Flight (TOF) versus light output (L) of CsI:Tl to He+  

E-Print Network (OSTI)

as the difference in curvature and dispersive of the data. EMSL Research and Capability Development Proposals applications in the field of astronomy, medical physics, high-energy nuclear physics, non-destructive evaluation, non-proliferation, and national security. Stringent requirements involving nuclear proliferation

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Quantum electrodynamics corrections to energies, transition amplitudes, and parity nonconservation in Rb, Cs, Ba+, Tl, Fr, and Ra+  

Science Journals Connector (OSTI)

We use the previously developed radiative potential method to calculate quantum electrodynamic (QED) corrections to energy levels and electric dipole transition amplitudes for atoms which are used for the study of the parity nonconservation (PNC) in atoms. The QED shift in energies and dipole amplitudes leads to noticeable change in the PNC amplitudes. This study compliments the previously considered QED corrections to the weak matrix elements. We demonstrate that the QED corrections due to the change in energies and dipole matrix elements are comparable in value to those due to the change in weak matrix elements and therefore must be included.

B. M. Roberts; V. A. Dzuba; V. V. Flambaum




E-Print Network (OSTI)

to helping contractors and others comply with the Building Energy Efficiency Standards. The website received and timely technical information on how to comply with the Building Energy Efficiency Standards Schwarzenegger Governor California Energy Commission June 2010 CEC-400-2010-006 Minimum Best Practices Guide



E-Print Network (OSTI)

COMMISSION Residential Indoor Air Quality under the 2008 Building Energy Efficiency Standards ASHRAE 62. Requirements The ASHRAE Standard requires a minimum level of ventilation in two areas: (1) whole-building for Residential Low- Rise Buildings (ASHRAE Standard) and various ways to meet this standard are described


Analysis of Aquifer Response, Groundwater Flow, and Plume Evolution at Site OU 1, Former Fort Ord, California  

E-Print Network (OSTI)

earlier than in wells midway between these two locations.after the initial recharge. Midway between the center andearlier than in the areas midway between them. This can be

Jordan, Preston D.; Oldenburg, Curtis M.; Su, Grace W.



Analysis of Aquifer Response, Groundwater Flow, and Plume Evolution at Site OU 1, Former Fort Ord, California  

E-Print Network (OSTI)

solvents were placed in the burn pit and combusted for fireareas as well as the burn pit. The depiction shown is based

Jordan, Preston D.; Oldenburg, Curtis M.; Su, Grace W.



L'ajustement dans le geste du pointage par l'index De l'incertitude rflchie ou instinctive ?  

E-Print Network (OSTI)

(rétroactif ) : Dans ce premier mode, une trace motrice stockée en mémoire à long terme, détermine le début du commandes motrices centrales nécessaires et suffisantes pour la tracer correctement et rapidement début d'une séquence motrice, et qui permet à la séquence tout entière de se dérouler sans être

Paris-Sud XI, Université de


Optimization of Mineral Activation for CO2 sequestration Hui X. Ou, McNair Scholar, Pennsylvania State University  

E-Print Network (OSTI)

. Introduction Fossil fuels are formed in the earth from the plant or animal remains; include natural gas of expanding use of fossil fuels for energy, has risen from pre-industrial levels of 280 parts per million (ppm the efficiency of primary energy conversion; (2) to substitute lower-carbon or carbon-free energy sources; and (3

Omiecinski, Curtis


The cross-coupled amplifier  

E-Print Network (OSTI)

~t R~t(p, ti)(RitR&))Lp~ ? p, R, Lpy -6, R, vpq 0 = ? p&R, cp, -p&ii, && +IYpxtR&+(i&tiYii~+R, jjvp&+(p tl)R lpga p~ E~ = (pi+ I) Ri Lp& + I Ypt t (pqt i) R i] "pl Output E R, L~a Lps Gi Gy K. X cps p, e? Gt r Qgq Gg, K+ R, R Yp f E, E...ARi))+ R 4~ I I'&+ I i " ') $1 I00 ( 3 I&i i I t h p&)[1p + (p &t)R )[ypb lilac+(IIi + i) Ry) If z pb is much smaller than pb R, &; + )VAN ~+(4+') R~1Lyi &+k, I-(Ii~~i) R I (Iiii. i)(&yFi: ~ ~A Ri) IOO (& 0&+~)ffqv+Rq+(IIi, +i)R, ) Since the first...

Robinson, George Clyde



Comparison of neutron capture spectra taken by a constellation Xe-110 detector and a 1?1? NaI(Tl) crystal  

Science Journals Connector (OSTI)

Constellation Technology Corporation has developed a spectroscopic nuclear ... Xe-110, which suggests that the superior energy resolution and low background level of this...

R. A. Austin; D. Hooten



Characterization of polycrystalline materials by X-ray diffraction contrast tomography W. Ludwig, M. Herbig, J.Y. Buffire Laboratoire MATEIS, UMR5510, 69621 Villeurbanne Tl-  

E-Print Network (OSTI)

Adresse électronique : reischig@esrf.fr A. King GKSS, DESY, 22607 Hamburg Adresse électronique : Andrew.King@gkss

Paris-Sud XI, Université de


Persisting impact of historical mining activity to metal (Pb, Zn, Cd, Tl, Hg) and metalloid (As, Sb) enrichment in sediments of the Gardon River,  

E-Print Network (OSTI)

) enrichment in sediments of the Gardon River, Southern France Eléonore Resongles a, , Corinne Casiot a , Rémi in sediments was investigated in multi-source context. · Metal(loid) enrichment during the 19th century in sediment. · Cd, Zn and Pb may be mobilized under changing environmental conditions. a b s t r a c ta r t i

Demouchy, Sylvie


p o~sihlc trclll)., of IIl1Pl ll\\ ,' Ill ,'T1I 111 Ih,' ..:olle..: tl\\) 11 and dllah ~ " ll\\ ,'atcil .l ilt!  

E-Print Network (OSTI)

, alternator; S, control panel; SA, start relay; S6, stop relay; SC, cranking intermiller; SO, safety lockout


FlashInformatique.epfl.ch p/a EPFL -Domaine IT -Station 8 -CH 1015 Lausanne -tl. +41 21 69 322 11  

E-Print Network (OSTI)

Fawal 22 Logiciel libre Arduino, l'autre circuit! R. Timsit 1 Analyse d'image scientifique, le monde.05.12 5 10.05.12 12.06.12 SP 21.06.12 24.07.12 page 22 RAK Arduino, l'autre circuit! Richard.Timsit@epfl.ch, EPFL - Domaine IT, responsable des services réseau Logiciel libre Arduino, an open-source elec- tronic


copyrighto resobythee-"ri"fftT"'ffrljiffi.t.tl-,"#:J*rll33'fitolr*,r.ion orthecopl.rightowner. Wet ChemicalApproachesto the Charaeterizationof  

E-Print Network (OSTI)

, Applicotions;Cooper,S. L., Peppas,N. A.. Eds.;Adr.ancesin Chemis- tr1' 199;AmericanChemicalSocietl':\\\\:ashing1

Prentiss, Mara


Estimation of bremsstrahlung photon energy in the environment of high-energy electron accelerator using CaSO4:Dy based TL dosemeter  

Science Journals Connector (OSTI)

......Estimation of bremsstrahlung photon energy in the environment of high-energy electron accelerator using CaSO4...Mishra S. C. Quality control audit using TLDs for linear accelerators...Estimation of bremsstrahlung photon energy in the environment of high-energy......

A. K. Bakshi; M. K. Nayak; G. Haridas; S. Chatterjee; R. K. Kher



Structural characterization, thermoluminescence and EPR studies of Nd{sub 2}O{sub 3}:Co{sup 2+} nanophosphors  

SciTech Connect

Graphical abstract: Display Omitted Highlights: ? Nd{sub 2}O{sub 3}:Co{sup 2+} (14 mol%) nanophosphors have been prepared at much lower temperatures. ? Phosphors are well characterized by PXRD, SEM, TEM, FTIR, Raman, UVvis spectroscopy. ? EPR and thermoluminescence properties were also reported. ? TL intensity increases linearly with ? dose suggesting usage in radiation dosimetry. -- Abstract: Nd{sub 2}O{sub 3}:Co{sup 2+} (14 mol%) nanophosphors (1525 nm) have been prepared via low temperature solution combustion method. Scanning electron micrograph (SEM) shows that the product is highly porous in nature. The stokes line in the Raman spectrum at ?2000 cm{sup ?1} is assigned to F{sub g} mode and the anti-stokes lines are assigned to a combination of A{sub g} + E{sub g} modes. With increase of Co{sup 2+} concentration, the intensity of F{sub g} mode decreases, whereas the combination of A{sub g} + F{sub g} modes completely disappears. Electron paramagnetic resonance (EPR) spectrum exhibits two resonance signals with effective g values at g = 2.25 and g = 2.03. Thermoluminescence (TL) response of Nd{sub 2}O{sub 3}:Co{sup 2+} nanopowders with ? dose 0.232.05 kGy was studied. The activation energy (E) and frequency factor (s) are estimated using Chen's glow peak shape method and obtained to be in the range 0.451.67 eV and 1.8 10{sup 4} to 4.0 10{sup 12} s{sup ?1}, respectively. It is observed that the TL glow peak intensity at 430 K increases linearly with ? dose which is suitable for radiation dosimetry.

Umesh, B. [Department of Humanities, PVP Polytechnic, Dr. AIT Campus, Bangalore 560 056 (India) [Department of Humanities, PVP Polytechnic, Dr. AIT Campus, Bangalore 560 056 (India); Department of Physics, Bangalore University, Bangalore 560 056 (India); Eraiah, B., E-mail: eraiah@rediffmail.com [Department of Physics, Bangalore University, Bangalore 560 056 (India); Nagabhushana, H., E-mail: bhushanvlc@gmail.com [Prof. C.N.R. Rao Centre for Advanced Materials, Tumkur University, Tumkur 572 103 (India); Sharma, S.C.; Sunitha, D.V. [Prof. C.N.R. Rao Centre for Advanced Materials, Tumkur University, Tumkur 572 103 (India)] [Prof. C.N.R. Rao Centre for Advanced Materials, Tumkur University, Tumkur 572 103 (India); Nagabhushana, B.M. [Department of Chemistry, M.S. Ramaiah Institute of Technology, Bangalore 560 054 (India)] [Department of Chemistry, M.S. Ramaiah Institute of Technology, Bangalore 560 054 (India); Rao, J.L. [Department of Physics, Sri Venkateswara University, Tirupati 517 502 (India)] [Department of Physics, Sri Venkateswara University, Tirupati 517 502 (India); Shivakumara, C. [Solid State and Structural Chemistry Unit, Indian Institute of Science, Bangalore 560 012 (India)] [Solid State and Structural Chemistry Unit, Indian Institute of Science, Bangalore 560 012 (India); Chakradhar, R.P.S., E-mail: sreechakra72@yahoo.com [CSIR National Aerospace Laboratories, Bangalore 560 017 (India)] [CSIR National Aerospace Laboratories, Bangalore 560 017 (India)



ESPCI ParisTech 1/2 Bordereau de Prix  

E-Print Network (OSTI)

équivalent LUMINOX ou équivalent SAFT ou équivalent PLANET ou équivalent TEHALIT ou équivalent CABLOFIL ou

Paris 7 - Denis Diderot, Université


The life cycles of Damalinia limbata (Gervais), order Mallophaga and Linognathus stenopsis (Burmeister), order Anoplura  

E-Print Network (OSTI)

BSEflVC'I) C. AC I OAY F" R A Pf. . 100 . )F * IX Uf. i, ' 0 . M C ~ IIAtiAL I HI A L IMOATA UA') A1, 60 RE'Ri:i 0FF T C HOST IN A C0!ISTANT TC-, PEt, ATU E OVEN ~ 'I IIUM 't\\ OF L I CC lr tL REARCO I ", 'THI !I ll ti Atf 1 T ttE Ou AT t UN uf T'iff L I FE... I E. A&1C Ki& il&1 ~ 0&'C L IFE &it )TOW I . W. ' VC ' ' ?I ' TUDJ "O I "1 T'lE E&??J. ', toPLJ?AT!, a ~ I 1 t;EDRDC&&Ac? ~ w'ir&? ~ T ir t AJ HIT'UFTwc L I f. Uf' 1 !, &JL'T I c 1'*Mi?AI. . A ~ . . Fou &i& I 4 1 JE U&1DC ?ANDPLUR* ~ &AMSD 1 1...

White, Howard Wayne



What's happening? Find out what the CURA Streams have been doing and  

E-Print Network (OSTI)

Ecotourism Stream The Ecotourism stream of the CURA project led by Amelia Stark (Tl'azt'en Nation) and Pam of potential sites, features, locations for ecotourism in Tl'azt'en territory; · Tl'azt'en Perspectives or Potential Locations for Ecotourism in Tl'azt'en Traditional Territory? What are the special places ­ like

Northern British Columbia, University of



E-Print Network (OSTI)

.H. Wills Physics Laboratory, University of Bristol, BS8 1TL, United Kingdom. ABSTRACT Galliumnitride (Ga

Boyer, Edmond

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mechanism of Cation Exchange Process for Epitaxy of Superconducting HgBa2CaCu2O6 Films and Passive Microwave Devices  

E-Print Network (OSTI)

cations into, the lattice of epitaxial Tl2Ba2CaCu2O8 (Tl-2212) or TlBa2CaCu2O7 (Tl-1212) precursor films. Aiming at the remained issues in understanding the mechanism of the cation exchange (CE) process, this thesis work has studied the reversibility of CE...

Zhao, Hua




E-Print Network (OSTI)

DE LA REGION CAPITALE DE BRUXELLES ET DE QUEBEC THOU?MENT, Hervé Maître de Conférences, Faculté de methodology and examples from the Capital Region of Brussels and Quebec City The concept of territorial of Brussels, where identity hinders development, and Quebec City, where it leverages development. halshs

Paris-Sud XI, Université de


Analytical Data Report for Sediment Samples Collected From 200 BP 5 OU, C7514 (299-E28-30) L-Well  

SciTech Connect

This an analytical data report for samples received from BP-5 L Well. This report is being prepared for CHPRC.

Lindberg, Michael J.



on a des cristau~baignant dans une partie liquide. Par centrifugation ou tout autre procd, si on limine la partie liquide, on a des .  

E-Print Network (OSTI)

- _ mulateurs. t , DANIEL BERTHELOT et HEXRY GAUDECHON (i). - Sur le rôle de la longueur d'onde dans les la lumière ultra-violette de longueur d'onde 2536 émise par une lampe à mercure; 2° que, quand la

Paris-Sud XI, Université de


de la pression de l'air (entre zero et 75 millimtres), et restent les mmes quc les surfaces dl'S ballons soient noircies ou non, ce qui  

E-Print Network (OSTI)

galvamscher Combinationen durch die Wärme (Changements qu'eprouve la force électromotrice des combinaisons

Boyer, Edmond


Analytical Data Report for Sediment Samples Collected From 200 BP 5 OU, C5860 (299-E29-545) K-Well  

SciTech Connect

This is an analytical data report for sediments received fro BP 5 K Well. This report is prepared for CHPRC

Lindberg, Michael J.



O corpo na transversal do tempo: da sociedade disciplinar sociedade de controle ou da analtica de "um corpo que cai.  

E-Print Network (OSTI)

??No fluxo de acontecimentos que revolveram as certezas e regimes de verdade nas ltimas dcadas, a tese O Corpo na Transversal do Tempo: da sociedade (more)

Edivaldo Vieira da Silva



LISTE DES MEMBRES DU CONSEIL DES ETUDES ET DE LA VIE UNIVERSITAIRE Collge ou catgorie Secteur Statut Nom Prnom Fonction Affectation  

E-Print Network (OSTI)

langues, sciences humaines et sociales Titulaire FRANCALANZA Eric Professeurs des Universités UFR Lettres et Sciences Humaines Art, littérature et langues, sciences humaines et sociales Titulaire AGOSTO Marie-Christine Professeurs des Universités UFR Lettres et Sciences Humaines Droit, économie, gestion

Brest, Université de


Cet article a t publi en 2009 sous le titre : Vanessa Van Renterghem, Invisibles ou absents ? Questions sur la prsence kurde Bagdad  

E-Print Network (OSTI)

;constant de lettrés, de mystiques, de gestionnaires et de militaires persans et turcs, provenant des

Boyer, Edmond


Working paper, ne pas diffuser sans l'autorisation de l'auteur. Quand l'entrepreneur est un destructeur ou comment dtruire pour crer ?  

E-Print Network (OSTI)

& Phillips, 2004; Prahalad & Bettis, 1986, p. 498). Concomitant de l'apprentissage, le désapprentissage s permettre l'arrivée de nouvelles connaissances (Nicolini & Meznar, 1995; Prahalad & Bettis, 1986, p. 498

Paris-Sud XI, Université de


Housing and Food Services is a department in OU's Division of Student Affairs. The University of Oklahoma is an equal opportunity institution. For accommodations on the basis of  

E-Print Network (OSTI)

with a house dressing. Spicy Wing Tray Served with ranch, blue cheese and bbq dips, carrots and celery. Tex

Oklahoma, University of


tivcment a perdu la proprit de dissiper la charge positive ou ngative d'un second conducteur; mais il peut dcharger un con-  

E-Print Network (OSTI)

photo- graphique, comme dans les expériences de M. H. Becquerel sur l'uranium, le nitrate d'urane, le sulfate double d'uranyle et de potassium, etc. Mais il n'a pas réussi à observer l'action électrique de l

Paris-Sud XI, Université de


Physique des racteurs eau lourde ou lgre en cycle thorium : tude par simulation des performances de conversion et de sret.  

E-Print Network (OSTI)

??Le niveau de conversion des racteurs CANDU et REP en cycle thorium a t tudi dans l'optique d'une utilisation en troisime et dernire strate de (more)

Nuttin, Alexis



A Detailed Study of the Vapochromic Behavior of {Tl[Au(C6Cl5)2]}n Eduardo J. Fernandez, Jose M. Lopez-de-Luzuriaga, Miguel Monge, Manuel Montiel,  

E-Print Network (OSTI)

, tetrahydrothiophene, 2-fluoropyridine, acetonitrile, acetylacetone, and pyridine. Solid-state exposure of 1 to vapors

Abdou, Hanan E.


Site Battelle, Bt. A -7 route de Drize -CH-1227 Carouge Tl. 022 379 07 70 -Fax 022 379 07 71 -http://www.unige.ch/environnement/index.html  

E-Print Network (OSTI)

la nature, �thique environnementale Ganguli, Pratima. � Different perspective of environmental ethics.79 INN Ressources renouvelables d'�nergie Renergy FNP : renewable energy handbook = anu�rio de energias "WATARID" (Water, ecosystems and sustainable development in arid and semi-arid areas), tenue � l

Laemmli, Ulrich


MFR PAPER 1056 J . ~. Lt';] tlH.'n~"od i, ,,, ilh rhe "i;J\\a l l lIC1\\:r,e;] (e nler Hi n-  

E-Print Network (OSTI)

"I JI'I . dll Ihe, ('ncJ .1 l'll.ltl, n hd\\\\C~n ~ra) \\\\hdk anJ l'thl'r etaL.:an Inl h.:J Jull 'Ih


Site Battelle, Bt. A -7 route de Drize -CH-1227 Carouge Tl. 022 379 07 70 -Fax 022 379 07 71 -http://www.unige.ch/environnement/index.html  

E-Print Network (OSTI)

University Press, 2012. � 193 p. : ill. � Bibliogr.: p. 154-180. Index. � ISBN 978�01�9975�4489 (hardcover

Laemmli, Ulrich



E-Print Network (OSTI)

effects in electronic structure calculations of moleculessymmetry. Electronic structure calculations for Au 2 +, TH,

Lee, Yoon S.



Microsoft PowerPoint - DOE NEAC 13June2013 draft B  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Research Project FHR Overview Research Project FHR Overview for DOE Nuclear Energy Advisory Committee gy y Per Peterson (UCB), Charles Forsberg (MIT), Lin Win Hu (MIT) and Kumar Sridharan (UW) Lin-Win Hu (MIT), and Kumar Sridharan (UW) 13 June 2013 http://canes.mit.edu/sites/default/files/reports/ANP-147_1-2013_FHR-rpt.pdf Fl id S l C l d 2 Fluoride Salt-Cooled High-Temperature Reactor (FHR) Reactor (FHR) General Electric S-PRISM The image cannot be display ed. Your computer may not hav e enough memory to open the image, or the image may hav e been corrupted. Restart y our computer, and then open the file again. If the red x still appears, y ou may hav e to delete the image and then insert it again. The image cannot be display ed. Your computer may not hav e enough memory to open the image, or the image may hav


A shipping plan for bulk petroleum products by sea-going tankers  

E-Print Network (OSTI)

(. 01; 1 ?I 0 st '. ii i 0 '. 0 i. gbt 01 uolltc e 0 1!i 1(!i Ly has 1&ci il (' !( !tlst ccl SL sotto po inL in i t s cr&!it 0) I&1 0 I, . P. 'I&(obl &i& iS ii(I jt!' Lcd . . ' 'g t(1011 'Oiuc, thc' pcoilp, 1 ti( Lh so(le 1&(& 1 ! (Pl!it c&i, 'll.... (gy us inc t&&o d I?! ts, ny nc &bcr up Lo &nd 1?eluding 1295 ccn be rcprcuc?Lcd in L&sc 36. ) The. ro&& n; &&c XJPj jpn spccii I&. s I h&t all Lh &uutri &. - in i his ro&& coL'respond co Lhe n r& quir -mont for: product p ?t dc; I inai &ou jj (base...

Boyd, David George


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

CONTRACT!D CODE IPAU!£ 0, PAGeS 1 10 Z, AMENOMENT/MOO[PICATIQN NO, 3, EFI'tECT!Va DATE 4. REQU!SmoNtPuRCHASE'REQ. NO. 15, PROJECT NO. ("appllen!)I,,) 178. See BIQC¥ 16C 1080008480 6: I$SueD- BY COOE 00518 7. ADMINJSTERED ay lffothOrffum Item 6) CODE 100518 Oak Rl.gy t!. S. D-Opartmen t of Energy P.O. Box 2001 J? .0. Box 2001 .oak Ridge l'N 37831 Oak R'idge TN 37831 tl-. NAMEAND ADDRESS- OF CONrRACTOR (/'to" srrfMJj. <:.euflfy, Sialf! 11M! ZIP Ctm} ~ 9A, AI\1ENDMENT OF SOLiCITAT10N NO. OllK RIDGE ASSOCIATED UNIVERSITIES, INC. P.O. BOX 11'7 BB.DATEO (SEE ITEM 11) OA.I< RIDGE TN 37830-6218 x 10A;MQOJFICATION oro CONTRACTfORDER NO. DE-Ac05-060R23100 10B. DATEO (SEE I173M 1.3) COOE


Identification of Irradiated Prawn (Penaeus monodon) Using Thermoluminescence and 2-Alkylcyclobutanone Analyses  

Science Journals Connector (OSTI)

Thermoluminescence (TL) and 2-alkylcyclobutanone (2-ACB) analyses were performed to identify irradiated prawns (Penaeus monodon). With the TL method, minerals were extracted from prawns using acid hydrolysis. The experimental results satisfied the ...

Susu Chen; Yuka Morita; Kimie Saito; Hiromi Kameya; Mitsutoshi Nakajima; Setsuko Todoriki



Analysis of truckload prices and rejection rates  

E-Print Network (OSTI)

Truckload (TL) is the principle mode of freight transportation in the United Sates. Buyers of TL services are shippers with significant amount of shipments throughout a year. Due to the complexity of their network and the ...

Kim, Yoo Joon



Die Elemente der 13. Gruppe: die Borgruppe  

Science Journals Connector (OSTI)

Die 13. Gruppe enthlt die Elemente: Bor (B), Aluminium (Al), Gallium (Ga), Indium (In) und Thallium (Tl).

Prof. Dr. Waldemar Ternes



An integrated life cycle quality model for general public market software products  

E-Print Network (OSTI)

. The requirements are built upon existing industry standards, including ISO 9001. The TL 9000 Quality System quality view of TL9000 Handbook and detailed view from ISO/IEC 1926 in the process of defining, measuring by TL9000-ISO complement model as well as by application process walk-through. #12;1. Complement model

Laporte, Claude Y.


An integrated life cycle quality model for general public market software products  

E-Print Network (OSTI)

. The requirements are built upon existing industry standards, including ISO 9001. The TL 9000 Quality System quality view of TL9000 Handbook and detailed view from ISO/IEC 1926 in the process of defining, measuring by TL9000-ISO complement model as well as by application process walk-through. Proceedings of Software

Suryn, Witold


Le franais, langue d'accueil Marie Treps, Laboratoire d'anthropologie urbaine (CNRS UPR34)  

E-Print Network (OSTI)

, hébreux, persans, turcs ou grecs, des mots néerlandais ou scandinaves, des mots allemands, slaves ou

Paris-Sud XI, Université de


E-Print Network 3.0 - absorption-biological reduction integrated...  

NLE Websites -- All DOE Office Websites (Extended Search)

UOW Environment ManagementUOW Environment Management Summary: responses)gy g ( p ) Energy consumption reduction (205) RenewableAlternative energy Carbon (135)gy... ( ) -...


TREKisM Issue 56  

E-Print Network (OSTI)

'?~-~ / \\ ADMIRAL 1{JE'lR ALN10ST OUT Of HOT tJll{ 1tVD (9tl~- 'PRo8J..E:M5/VO-rHINq Bur FkOB~ /"'cfY/5. jP6CI(/HflT HftT )sN), ~J"/ GOINq 10 LJOR.I< 61HeR" \\, 13 Crossword BY Lynn Mostafa ACROSS CLUES 2. Kruge 27. Pon Farr 3. Chekov's "Wessel" 29. Beauty IIke...OuR 6Cl Ii5) Bur 1iMr Hfff 15r/r qOltVq 10 (JOf



Reaction with Propane of I(52P1/2), produced by Photolysis of Iodine in the Continuum of the B3?ou+X1?g+ System, and by Collisional Release inside the Banded Region  

Science Journals Connector (OSTI)

... and the ^-propyl iodide was determined by gas chromatography, after separation of the unreacted propane on a low-temperature still. The quantum yield is independent of the area of ... 60 C in a mixture of 0-20 mm of iodine with 100 mm of propane, the quantum yield for the formation of ^-propyl iodide is 1-5 x ...




Improved potentials and Born-Oppenheimer corrections by new measurements of transitions of 129I2and 127I 129I in the B3 $\\Pi_{\\rm O^+_u}$ - X1 $\\Sigma^+_{\\rm g}$ band system  

Science Journals Connector (OSTI)

The light from one single frequency cw laser was employed in a double saturation spectroscopy experiment to record high resolution spectra of 129I2and 127I129Itogether with spectra of 127I2which is used as a...

E. J. Salumbides; K. S.E. Eikema; W. Ubachs



Etude biochimique et morphologique des particules lipoprotiques de la lymphe intestinale de rat au cours de l'absorption d'acide olique ou de son isomre trans, l'acide tadique,  

E-Print Network (OSTI)

, iso- mère trans de l'acide oléique. On infuse dans une anse intestinale de rat, 90 Ilmoles d'absorption se situe au cours de la seconde demi-heure qui suit l'infusion du régime « acide olëique» (37 + 3

Boyer, Edmond


Black phosphorus field-effect transistors Likai Li1, Yijun Yu1, Guo Jun Ye2, Qingqin Ge1, Xuedong Ou1, Hua Wu1, Donglai Feng1, Xian Hui Chen2  

E-Print Network (OSTI)

nanometres. Reliable transistor performance is achieved at room temperature in samples thinner than 7.5 nm in the infrared regime. In addition, observations of a phase transition from semiconduc- tor to metal14-layer phosphorene FETs with a backgate electrode (Fig. 2a). A scotch tape-based mechanical exfoliation method

Cai, Long


Service Scolarit Centrale Anne 2012-2013 Vous pouvez retrouver ces conventions sur l'Intranet de l'Universit (rubrique Conseils de l'universit puis CEVU) ou les obtenir sur simple demande auprs du  

E-Print Network (OSTI)

clausus Odontologie attribué à l'UFR Médecine Dijon : 6 étudiants accueillis pour un numerus clausus fixé'issue de la PACES, filière « Odontologie Clermont-Ferrand » (chiffre fixé en fonction du numerus clausus Odontologie attribué à l'UFR Médecine Dijon : 10 étudiants accueillis pour un numerus clausus fixé à 30) AVIS

Herrmann, Samuel


Service Scolarit Centrale Anne 2012-2013 Vous pouvez retrouver ces conventions sur l'Intranet de l'Universit (rubrique Conseils de l'universit puis CEVU) ou les obtenir sur simple demande auprs du  

E-Print Network (OSTI)

, filière « Odontologie Nancy » (chiffre fixé en fonction du numerus clausus Odontologie attribué à l'UFR Médecine Dijon : 8 étudiants accueillis pour un numerus clausus fixé à 30) FAVORABLE FAVORABLE #12;Service

Herrmann, Samuel


MARCH Results 10--Myers University Newark, OH 1:00 DH CCD  

E-Print Network (OSTI)

21-0 MAY 4/5 ORC State Tournament @ Lancaster, OH OU Zanesville - 11 / OU Lancaster - 4 Newark - 17 / Miami Middletown - 2 11/12 ORC State Finals @ Newark, OH Newark - 6 / OU Zanesville - 3 Newark - 10 / OU



E-Print Network (OSTI)

, le Japon ou l'Inde, ou encore des groupements de pays asiatiques, par exemple l'ASEAN (Association

Genève, Université de


Akram Kachee et Jrme Maucourant1 Sur la notion de "rvolution" en Syrie (2011-2013)2  

E-Print Network (OSTI)

différentes appartenances religieuses ou communautaires, sur l'essence religieuse des Arabes (ou des Persans

Paris-Sud XI, Université de



Science Journals Connector (OSTI)

......led to very high dose levels, to several organs in particular. The doses ranged from 4 to 60 Gy to the skin, 15 Gy to the brain (a few cubic centimetres), from 1 to 8 Gy to the lung and 2 Gy to the heart. Among events concerning medical staff, seven......

Carole Rousse; Paul Cillard; Aurelie Isambert; Marc Valero



B-splines as a basis for the Rayleigh-Ritz-Galerkin procedure  

E-Print Network (OSTI)

- Tl WTI ) R2=2 ~ 4 {FU14 (T3-T2)+FU24( T I-T3) +FU34( T2- Tl ) ) TESTT=RI/R2 IF (TESTT ~ LE ~ Tl ~ OR ~ TESTT AGE ~ T3) GO TO 95 T { I ) =TESTT CALL COMPFU(T ~ CINE K ~ ADIF ~ NG ~ I ~ FUsSV) If (FU sLTe FU2) GO TQ 10 T(I )=T2 GO TO 10 T(I )=T1...- Tl WTI ) R2=2 ~ 4 {FU14 (T3-T2)+FU24( T I-T3) +FU34( T2- Tl ) ) TESTT=RI/R2 IF (TESTT ~ LE ~ Tl ~ OR ~ TESTT AGE ~ T3) GO TO 95 T { I ) =TESTT CALL COMPFU(T ~ CINE K ~ ADIF ~ NG ~ I ~ FUsSV) If (FU sLTe FU2) GO TQ 10 T(I )=T2 GO TO 10 T(I )=T1...

Snodgrass, Jerry Grant


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analysis of the ITER LFS Reflectometer Transmission Line System  

SciTech Connect

A critical issue in the design of the ITER Low Field Side (LFS) reflectometer is the transmission line (TL) system. A TL connects each launcher to a diagnostic instrument. Each TL will typically consist of ~42 m of corrugated waveguide and up to 10 miter bends. Important issues for the performance of the TL system are mode conversion and reflections. Minimizing mode conversion and reflections in the waveguide are critical to minimizing standing waves and phase errors in the reflectometer-measured phase. The performance of the corrugated waveguide and miter bends is analyzed and recommendations given.

Hanson, Gregory R [ORNL; Wilgen, John B [ORNL; Bigelow, Tim S [ORNL; Diem, Stephanie J [ORNL; Biewer, Theodore M [ORNL



Powder synthesis and consolidation of thallium based high temperature superconductors  

SciTech Connect

Objective is to provide research samples of the Tl-based powders prepared by Rockwell's spray calciner. Target compositions were set at 1.1 Tl, 1 Ba, 1 Ca, 1.5 Cu and 1.1 Tl, 1.12 Ba, 1 Ca, 1.88 Cu. Three calciner runs were made. The Nomex bags were replaced with Gore-Tex bags. The system was operated continuously for 24 h, producing 1.7 kg HTSC powder. Problems with CO[sub 2], Tl volatility during sintering, etc., are discussed.

Gay, R.L. (Rockwell International Corp., Canoga Park, CA (United States). Rocketdyne Div.)



Powder synthesis and consolidation of thallium based high temperature superconductors. Final technical report  

SciTech Connect

Objective is to provide research samples of the Tl-based powders prepared by Rockwell`s spray calciner. Target compositions were set at 1.1 Tl, 1 Ba, 1 Ca, 1.5 Cu and 1.1 Tl, 1.12 Ba, 1 Ca, 1.88 Cu. Three calciner runs were made. The Nomex bags were replaced with Gore-Tex bags. The system was operated continuously for 24 h, producing 1.7 kg HTSC powder. Problems with CO{sub 2}, Tl volatility during sintering, etc., are discussed.

Gay, R.L. [Rockwell International Corp., Canoga Park, CA (United States). Rocketdyne Div.



Analyzing and simulating the variability of solar irradiance and solar PV powerplants  

E-Print Network (OSTI)

T.L. Gibson, Improved photovoltaic energy output for cloudyphotovoltaic panels in Sanliurfa, Turkey, Renewable Energy,to substantial energy production. Solar photovoltaic (PV)

Lave, Matthew S.



Selective Capture of Cesium and Thallium from Natural Waters...  

NLE Websites -- All DOE Office Websites (Extended Search)

evaluated against iron(III) hexacyanoferrate(II) (insoluble Prussian blue) for the sorption of cesium (Cs+) and thallium (Tl+) from natural waters and simulated wastes. The...


E-Print Network 3.0 - arbuscular mycorrhizal fungi1w Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sciences and Ecology 19 Aug, RM. 2004 Arbuscular mycorrhizae and soilplant water relations. Canadian Journal of Soil Science 84(4): 373-381. Dhillon SS, Gardsjord TL....


E-Print Network 3.0 - arbuscular mycorrhiza cultures1 Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sciences and Ecology 15 Aug, RM. 2004 Arbuscular mycorrhizae and soilplant water relations. Canadian Journal of Soil Science 84(4): 373-381. Dhillon SS, Gardsjord TL....


E-Print Network 3.0 - arbuscular mycorrhizal symbiosis1woa Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sciences and Ecology 19 Aug, RM. 2004 Arbuscular mycorrhizae and soilplant water relations. Canadian Journal of Soil Science 84(4): 373-381. Dhillon SS, Gardsjord TL....


High-Resolution Soft X-Ray Photoionization Studies of Selected Molecules  

E-Print Network (OSTI)

energies than tl'e fundamental electronic transition, withsidebands from fundamental electronic transitions in athe ground electronic state. From a fundamental viewpoint,

Hudson, E.A.



Characterization of wound monitoring systems used to quantify and locate plutonium contamination  

E-Print Network (OSTI)

When an accident involving the possibility of a plutonium contaminated wound occurs, the contamination is often quantified using sodium iodide (NaI(Tl)) and high purity germanium (HPGe) detection systems. The NaI(Tl) system is used to quantify...

Dimmerling, Paul James



Software Technology and Engineering Practice (STEP) 2002 Montreal, Canada, October 6-8 2003  

E-Print Network (OSTI)

, including ISO 9001. The TL 9000 Quality System Measures Handbook [2] defines a minimum set of performance Software Product Quality Practices Quality Measurement and Evaluation using TL9000 and ISO/IEC 9126 Witold is the editor and co-editor of ISO/IEC 9126 and ISO/IEC SQuaRE series of standards Alain Abran Department

Suryn, Witold


Software Technology and Engineering Practice (STEP) 2002 Montreal, Canada, October 6-8 2003  

E-Print Network (OSTI)

, including ISO 9001. The TL 9000 Quality System Measures Handbook [2] defines a minimum set of performance Software Product Quality Practices Quality Measurement and Evaluation using TL9000 and ISO/IEC 9126 Witold-editor and co-editor of ISO/IEC 9126, ISO/IEC 14598 and ISO/IEC SQuaRE series of standards 2 Alain Abran

Laporte, Claude Y.


Measurements of environmental terrestrial gamma radiation average dose rate in three mountainous locations in the western region of Saudi Arabia  

Science Journals Connector (OSTI)

......produced an almost energy-independent response of the detectors within the energy range of terrestrial...TL signal vs. storage time. As can be...Figure 1. TL response of CaSO4:Dy as...3 -5 show the frequency distributions of......

Fayez H. H. A1-Ghorabie



Synthesis and characterisation of BaSo4:Eu thermoluminescence phosphor  

Science Journals Connector (OSTI)

......The TL dose response of the phosphor...E) or the energy required to...the trap, frequency factor (s...post-irradiation storage at ambient...2SO4. Dose response The linearity...The TL dose response of the phosphor...E) or the energy required to...the trap, frequency factor (s......

O. Annalakshmi; M. T. Jose; U. Madhusoodanan



Les rseaux ont la fibre de l'information Laurent Viennot  

E-Print Network (OSTI)

demandez donc « Montmartre 22 12 » ou « tic, tic-tic-tic-tic-tic-tic... » ou « do si do si mi mi ré mi » ou

Boyer, Edmond


Summary - Remedial System Performance Improvement for the 200...  

Office of Environmental Management (EM)

The 200-ZP-1 OU and PW-1 OU are pump and treat operating units (OU) designed to remove carbon tetrachloride (CT) from the groundwater and vadose zone, respectively. The units...


E-Print Network 3.0 - avec les telescopes Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

2010 Summary: arcsec ou plus. Possible avec optique adaptative, ou telescopes hors atmosphere. 3- v V + 5 log10... etecter a cause de la turbulence atmospherique,...


Investigao est em risco  

E-Print Network (OSTI)

laborais. Ou seja, temos questões sé- rias de sustentabilidade". Portanto, "ou há de facto uma revisão das

Instituto de Sistemas e Robotica


Investigation of Radiation-Induced Free Radicals and Luminescence Properties in Fresh Pomegranate Fruits  

Science Journals Connector (OSTI)

Radiation-induced free radicals and luminescence properties were investigated in ?-irradiated (03 kGy) pomegranate (Punica granatum L.) fruits. Photostimulated luminescence (PSL) analysis showed limited applicability, and only 3 kGy-irradiated ...

Hafiz M. Shahbaz; Kashif Akram; Jae-Jun Ahn; Joong-Ho Kwon



Improved Technique of Hydrogen Content Analysis by Slow Neutron Scattering  

DOE R&D Accomplishments (OSTI)

A slow-neutron-transmission method fro determining the H content of fluorcarbons is described (G.Y.)

Rainwater, L. J.; Havens, W. W. Jr.


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Banach-Semikategorien III SitzUngsbcrichtco dct Ostcm:i<:hlsehen Akaderoie dcr Wiasensc:haften  

E-Print Network (OSTI)

ist leicht einzusehen, daB der Teilraum aller spalten- und zeilenendliehen Matrizen [gyX] (d. h. flir in 8.1, dann be trachten wir den NormabsehluB des Teilraumes aller Matrizen [gyX], flir die gyX "" 0 nur flir endlich viele (X, Y) gilt (spater gemeinhin endliche Matrizen genannt), in [[G

Michor, Peter W.


Investigative Response Modeling and Predictive Data Collection  

E-Print Network (OSTI)

Rajagopalan Honeywell ACS siva.rajagopalan@honeywell.com Sathya Chandran Sundaramurthy, Xinming Ou Kansas

Ou, Xinming "Simon"


Dosimetric Comparison of High-Dose-Rate Brachytherapy and Intensity-Modulated Radiation Therapy as a Boost to the Prostate  

SciTech Connect

Purpose: We compared the dose conformity of two radiation modalities: high-dose-rate brachytherapy (HDR BT) and intensity-modulated radiation therapy (IMRT) to deliver a boost to the prostate after external beam radiotherapy (EBRT). Methods and Materials: Ten successive patients with prostate adenocarcinoma treated with a single 10-Gy HDR BT boost after EBRT were investigated. Four theoretical IMRT plans were computed: (a) 32.85 Gy IMRT and (b) 26 Gy IMRT with CTV-PTV expansions, doses corresponding to the equivalent dose in 2-Gy fractions (EQD2) of one 10-Gy fraction calculated with a prostate alpha/beta ratio of respectively 1.5 and 3 Gy; and (c) 32.85 Gy IMRT and (d) 26 Gy IMRT without CTV-PTV expansions. The dose-volume histogram values converted in EQD2 with an alpha/beta ratio of 3 Gy for the organs at risk were compared. Results: The HDR BT plan delivered higher mean doses to the PTV compared with IMRT plans. In all, 33% of the rectal volume received a mean dose of 5.32 +- 0.65 Gy and 20% of bladder volume received 4.61 +- 1.24 Gy with HDR BT. In comparison, doses delivered with IMRT were respectively 13.4 +- 1.49 Gy and 10.81 +- 4 Gy, even if only 26 Gy was prescribed to the PTV with no CTV-PTV expansion (p < 0.0001). The hot spots inside the urethra were greater with HDR BT but acceptable. Conclusions: Use of HDR BT produced a more conformal plan for the boost to the prostate than IMRT even without CTV-PTV expansions.

Hermesse, Johanne, E-mail: jhermesse@chu.ulg.ac.b [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Biver, Sylvie; Jansen, Nicolas [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Lenaerts, Eric [Department of Medical Physics, Liege University Hospital, Liege (Belgium); Nickers, Philippe [Department of Radiation Oncology, Oscar Lambret Center, Lille (France)



Control of Glyphosate-Resistant Palmer Amaranth in DHT Cotton, and Peanut Response to 2,4-D  

E-Print Network (OSTI)

. References Culpepper A.S., York A.C., Brown S.M., Hanna W.W., Davis J.W., Vencill W.K., Grey T.L., Webster T.M

Arnold, Jonathan


Thermoluminescence and Electron Spin Resonance Investigations of Minerals for the Detection of Irradiated Foods  

Science Journals Connector (OSTI)

Thermoluminescence (TL) measurements are used to detect irradiated foods. They are performed by investigating the minerals that contaminate certain products. Pure quartz, feldspars, and mineral mixtures, which are to be expected in foods, were examined ...

Birgit Ziegelmann; Klaus W. Bgl; Georg. A. Schreiber



2010 Wind Technologies Market Report  

E-Print Network (OSTI)

ET2/TL-08-1474. May 19, 2010 Wind Technologies Market ReportIndustry Annual Market Report: Year Ending 2010. Washington,Quarter 2011 Market Report. Washington, D.C. : American Wind

Wiser, Ryan



Photochemical synthesis of a water oxidation catalyst based on...  

NLE Websites -- All DOE Office Websites (Extended Search)

Photochemical synthesis of a water oxidation catalyst based on cobalt nanostructures Authors: Wee, T-L., Sherman, B.D., Gust, D., Moore, A.L., Moore, T.A., Liu, Y., and Scaiano,...


g ert de M" B. BREUIL Le Campinien et l'Age du Mammouth en Flandre,  

E-Print Network (OSTI)

!lt, et met souvent à de rude;; épt·en,·es notre esprit d'im·es- tigation. J 'ni eul'ocea'iion tl

Paris-Sud XI, Université de



E-Print Network (OSTI)

The weight function 1/ can be assumed to be given on the whole surface S by setting 1/(x) = l .... we can now formulate the main result of Thurston's theory. Tl-


The effect of high-level waste glass composition on spinel liquidus temperature  

SciTech Connect

Spinel crystals precipitate in high-level waste glasses containing Fe, Cr, Ni , Mn, Zn, and Ru. The liquidus temperature (TL) of spinel as the primary crystallization phase is a function of glass composition and the spinel solubility (c0) is a function of both glass composition and temperature (T). Previously reported models of TL as a function of composition are based on TL measured directly, which requires laborious experimental procedures. Viewing the curve of c0 versus T as the liquidus line allows a significant broadening of the composition region for model fitting. This paper estimates TL as a function of composition based on c0 data obtained with the X-ray diffraction technique.

Hrma, Pavel R.; Riley, Brian J.; Crum, Jarrod V.; Matyas, Josef



Pacific Northwest Laboratory  

Office of Scientific and Technical Information (OSTI)

Subcritical Neutron Multiplier Facility - H. G. Rieck A Low-Background, Ge(Li) Gamma-Ray Spectrometer Shielded with a Multidimensional NaI(Tl) Crystal System - N. A. Wogman . A...



E-Print Network (OSTI)


Robinson, J.



Stable Isotope Discrimination by Consumers in a Tropical Mangrove Food Web: How Important Are Variations in C/N Ratio?  

Science Journals Connector (OSTI)

Stable isotopes are widely used as tracers in food webs and as indicators of the trophic levels (TL) of consumers. The objectives of this study were to verify a possible ecosystem-wide increase in the relative...

Ralf Schwamborn; Tommaso Giarrizzo



Environmental Sciences Division Publications Calendar Year 2004  

E-Print Network (OSTI)

. Kercher, and T.L. Ashwood, Toward a Framework for assessing risk to vertebrate populations from brine- contaminated sites; Business Briefing, in Exploration and Production: The Oil and Gas Review 2004. 2004, World


Studies of the Al2O3:C thermoluminescent dosimeter  

E-Print Network (OSTI)

. Analysis, under a variety of conditions, shows this dosimeter to be insensitive to neutron irradiation. Additionally, the TL response was studied for variation in output due to changing the heating rate of the crystal. The measured output was constant from...

Naquin, Tyrone Daniel



Impact of risk sharing on competitive bidding in truckload transportation  

E-Print Network (OSTI)

The purpose of this research was to evaluate whether a shipper's fuel surcharge (FSC) program affected its per-load transportation costs in the United States full-truckload (TL) transportation industry. In this study, we ...

Abramson, Molly (Molly Elizabeth)



The cloned gene, Xa21, confers resistance to multiple Xanthomonas oryzae pv. oryzae isolates in transgenic plants.  

E-Print Network (OSTI)

Tl progeny plants were inoculated with X.oryzae pv. oryzae.oryzae pv. oryzae in transgenic plants. The resistanceoryzae pv. oryzae Isolates in Transgenic Plants Guo-Liang

Wang, G L; Song, W Y; Ruan, D L; Sideris, S; Ronald, P C



CURA presentations in Tache on Aboriginal Day All four CURA research streams will be presenting posters on their re-  

E-Print Network (OSTI)

Leon, Amelia Stark and Sophia Raby. We are also Education Research Stream ECOTOURISM STREAM GETS will be the Ecotourism Stream Leader from UNBC. She has been getting to know Tl'az- t'en community perspectives through

Northern British Columbia, University of


Energy-based analysis of biochemical cycles using bond graphs  

Science Journals Connector (OSTI)

...encouragement to embark on a new research direction...Hill, TL . 1989 Free energy transduction and biochemical cycle kinetics. New York, NY: Springer...cellular systems. New York, NY: Chapman Hall...D . 1977 Power and energy in linearized physical...



International Conference  

NLE Websites -- All DOE Office Websites (Extended Search)

A GENERAL TRANSFORM FOR VARIANCE REDUCTION IN MONTE CARLO SIMULATIONS T.L. Becker Knolls Atomic Power Laboratory Schenectady, New York 12301 troy.becker@unnpp.gov E.W. Larsen...

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Factors limiting microbial growth and activity at a proposed high-level nuclear repository, yucca mountain, nevada.  

Science Journals Connector (OSTI)

...High-Level Nuclear Repository, Yucca Mountain, Nevada TL Kieft WP Kovacik Jr...part of the characterization of Yucca Mountain, Nev., as a potential repository...from nine sites along a tunnel in Yucca Mountain. Microbial abundance was generally...

T L Kieft; W P Kovacik; D B Ringelberg; D C White; D L Haldeman; P S Amy; L E Hersman



The value of RFID in transportation : from greater operational efficiency to collaborative transportation management  

E-Print Network (OSTI)

This paper assesses the value of Radio Frequency Identification (RFID) in the transportation forecasting, planning, and execution processes for truckload (TL) and less than truckload (LTL) services. The results show that ...

Guitton, Antoine, 1963-



Quasiparticle self-consistent GW calculations for PbS, PbSe, and PbTe: Band structure and pressure coefficients  

E-Print Network (OSTI)

and in solar-energy panels.8 With Tl doping PbTe may even exhibit superconductivity.9,10 The lead chalcogenides Laboratory, Los Alamos, New Mexico 87545, USA 4School of Materials, Arizona State University, Tempe, Arizona

Svane, Axel Torstein


Neutron Activation Analysis of Milligram Quantifies of Lunar Rocks and Soils  

Science Journals Connector (OSTI)

...Tl) detector, depending on efficiency and purity requirements. Approximately...performed at the Union Car-bide "swimming pool" reactor at Ster-ling Forest...RNAA; radiochemical, high-energy gamma, activation analysis, RGAA...

Karl K. Turekian; D. P. Kharkar



Masculine Ideology and College Men's Reactions to a Sexual Assault Prevention Program  

E-Print Network (OSTI)

-test/post- test Elaboration Likelihood Model Rape Myth Acceptance Scale (RMAS); Adversarial Sexual Beliefs Scale (ASB); Speaker Rating Form (SRF) - a slightly modified version of the Counselor Rating Form (CRF); Thought Listing (TL); Assessment...

Caver, Kelly



This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network (OSTI)

-Aviv 69978, Israel c Nuclear Physics Laboratory, Aristotle University of Thessaloniki, 54124 Thessaloniki (OSL) Luminescence dating Equivalent dose estimation Quartz Retrospective dosimetry Authenticity testing Accident dosimetry Kinetic rate equations Additive dose TL technique SAR technique SAR

Chen, Reuven


Strategic Freight Transportation Contract Procurement  

E-Print Network (OSTI)

lane. Economy of density (EOD) is de?ned as the decrease inand density. Economy of density (EOD) is defined 182 as theAccording to Plummer, EOD is relatively significant in TL

Nandiraju, Srinivas



Phenotypic Instability and Rapid Gene Silencing in Newly Formed Arabidopsis Allotetraploids  

Science Journals Connector (OSTI)

...C. arenosa, or A. suecica led to better seed set than did selfing...artificial daylight provided with fluorescent bulbs (model TL80 Philips, Sunnyvale...shown in (H). A related alteration led to formation of basipetal flower...

Luca Comai; Anand P. Tyagi; Ken Winter; Rachel Holmes-Davis; Steven H. Reynolds; Yvonne Stevens; Breck Byers


Full Fermi Surface of a High Temperature Superconductor Revealed by Angular Magnetoresistance Oscillations  

Science Journals Connector (OSTI)

We report the first observation of polar angular magnetoresistance oscillations in the high-T c cuprate Tl2Ba2CuO6. These measurements establish the existence of a coherent three-dimensional Fermi s...

N. E. Hussey; M. Abdel-Jawad; A. Carrington



Local diagnostic reference levels for some common diagnostic X-ray examinations in Tehran county of Iran  

Science Journals Connector (OSTI)

......thus, if these low temperature peaks are present, significant thermal fading can occur and affect the TL readout. The low temperature...patients undergoing selected diagnostic X-ray examinations in Sudan. Radiat. Protect. Dosim (2006) 14 Sept. online print......

Mohammad Taghi Bahreyni Toosi; Mohsen Asadinezhad



Thinking through Teacher Talk: Increasing Target Language Use in the Beginning Russian Classroom  

E-Print Network (OSTI)

In July 2012 the American Council on the Teaching of Foreign Languages (ACTFL) adopted a position statement calling for instructors and learners to use the target language (TL) for 90% plus of instructional time. Implementing ...

Comer, William J.



Equity Mispricing and Leverage Adjustment Costs  

E-Print Network (OSTI)

We find that equity mispricing impacts the speed at which firms adjust to their target leverage (TL) and does so in predictable ways depending on whether the firm is over- or underlevered. For example, firms that are above ...

Warr, Richard S.; Elliott, William B.; Koeter-Kant, Johanna; Ö ztekin, Ö zde



Subtask 2: Water oxidation complex | Center for Bio-Inspired...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Yan, H.(2013)Unidirectional Scaffold-Strand Arrangement in DNA Origami,Angewandte Chemie International Edition,52,9031-9034(Read online) Ben-Daat, H., Hall, G.B., Groy, T.L.,...


Photon beam audits for radiation therapy clinics: a pilot mailed dosemeter study in Turkey  

Science Journals Connector (OSTI)

......International Atomic Energy Agency/World Health...Organization) TLD postal dose audit service operates for...consistency in clinical high energy photon beams by external audits using mailed TL dosimetry...shown that the high energy photon dosimetry in......

Z. Yegingil; L. A. DeWerd; S. D. Davis; C. Hammer; K. Kunugi




Office of Scientific and Technical Information (OSTI)



A Transaction Choice Model for Forecasting Demand for Alternative-Fuel Vehicles  

E-Print Network (OSTI)

Forecasting Demand Alternative-Fuel Vehicles for DavldNG DEMANDFOR ALTERNATIVE-FUEL VEHICLES DavidBrownstone,interested in promoting alternative-fuel vehicles. Tlus is

Brownstone, David; Bunch, David S.; Golob, Thomas F.; Ren, Weiping



A Transactions Choice Model for Forecasting Demand for Alternative-Fuel Vehicles  

E-Print Network (OSTI)

Forecasting Demand Alternative-Fuel Vehicles for DavldNG DEMANDFOR ALTERNATIVE-FUEL VEHICLES DavidBrownstone,interested in promoting alternative-fuel vehicles. Tlus is

Brownstone, David; Bunch, David S; Golob, Thomas F; Ren, Weiping



Retrospective dosimetry with alumina substrate from electronic components  

Science Journals Connector (OSTI)

......reach the light detection system. The power of light intensity is...period. The heating system of the reader is able...Rahola T., Smith K. TMT Handbook. Triage, Monitoring...using the TL from dental restoration porcelains. Radiat......

Daniela Ekendahl; Libor Judas



Borehole geophysics evaluation of the Raft River geothermal reservoir...  

Open Energy Info (EERE)



LM567LM567CToneDecoder February 1995  

E-Print Network (OSTI)

TL H 6975 LM567LM567CToneDecoder February 1995 LM567 LM567C Tone Decoder General Description The LM567 and LM567C are general purpose tone decod- ers designed to provide a saturated transistor switch Connection Diagrams Metal Can Package TL H 6975­1 Top View Order Number LM567H or LM567CH See NS Package

Wedeward, Kevin

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Study of Compact Tunable Filters Using Negative Refractive Index Transmission Lines  

E-Print Network (OSTI)

NOMENCLATURE CTL Composite (right/left-hand) Transmission Line LH Left-Handed LHTL Left-Handed Transmission Line NRI Negative Refractive Index PRI Positive Refractive Index RHTL Right-Handed Transmission Line SRF Self-Resonant Frequency TL... NOMENCLATURE CTL Composite (right/left-hand) Transmission Line LH Left-Handed LHTL Left-Handed Transmission Line NRI Negative Refractive Index PRI Positive Refractive Index RHTL Right-Handed Transmission Line SRF Self-Resonant Frequency TL...

Lewis, Brian Patrick



The 4000-3400A S02 vibration spectrum with long absorbing paths  

E-Print Network (OSTI)

~ Of the eyeetrngreyh ~rating n oae a+noted te refloat light fxoo tho loxp ~ tbe?ido open slit 8 onto plane sdxror tL?~ N~ nas xn11ostsd to oonter the r?floated bono ca R x and pries Rapzssaed te ebs nearest eea4iaeteri LL ~ prh pg 4 p1~tL Q1wcLnste ths socaen...

Russell, Ralph Keith



The liquidus temperature of nuclear waste glasses: an international Round-Robin Study  

SciTech Connect

Ten institutions from five countries participated in a Round Robin study to contribute to the Precision and Bias section of an American Society for Testing and Materials standard procedure that Pacific Northwest National Laboratory (PNNL) is developing for measuring the liquidus temperature (TL) of radioactive and simulated waste glasses. In this study, three separate TL measurement methods were a gradient temperature (GT) method, a uniform temperature (UT) method, and a crystal fraction extrapolation (CF) method. Three different glasses were measured with a combination of these three methods. The TL values reported by different institutions are generally consistent and vary within a narrow range. The precision of a TL measurement was evaluated as 10C regardless of the method used for making the measurement. The Round Robin glasses were all previously studied at PNNL and included ARG-1 (Glass A), Zr-9 (Glass B), and AmCm2-19 (Glass C), with measured TL values spanning the temperature range ~960-1240C. The three methods discussed here in more detail are the GT, UT, and CF methods. A best-case precision for TL has been obtained from the data, even though the data were not acquired for all three glasses using all three methods from each participating organization.

Riley, Brian J.; Hrma, Pavel R.; Vienna, John D.; Schweiger, Michael J.; Rodriguez, Carmen P.; Crum, Jarrod V.; Lang, Jesse B.; Marra, James C.; Johnson, Fabienne; Peeler, David K.; Leonelli, Cristina; Ferrari, Anna M.; Lancellotti, Isabella; Dussossoy, Jean-Lue A.; Hand, Russell J.; Schofield, James M.; Connelly, Andrew J.; Short, Rick; Harrison, Mike T.



Ann bay lodyans 5 / se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network (OSTI)

genyen. Tijo we yon tig ki te tonbe nan yon gwo twou. Li pa t kapab soti paske twou a fon. Kounye a tig la prizonye. Li di Tijo: "Ou se yon bon ti gason, ede m soti, souple." Tijo reponn: "Si mwen retire ou nan twou a, ou ap manje m." Tig la di: "O... non, bon ti pitit mwen, mwen p ap manje ou. Pa panse sa, non." Tijo mande li: "Eske ou ap pwomet mwen ou p ap manje m?" "Wi, pwomes fet," tig la di I avek gwo vwa li. Tijo ede tig la soti nan twou a. Le tig la fin soti, li vole sou T i j...

Freeman, Bryant C.



Validation and Routine monitoring of Electron Beam sterilization  

E-Print Network (OSTI)

;2 Absorbed dose: Energy absorbed per unit mass 1 Gray (Gy) = 1 J/kg dose range for sterilization: 10-50 k after irradiation #12;5 Dosimeter examples #12;6 Calorimeter for dose measurement at high energy (Me Measures change in temperature Dose range: 1.5 kGy ­50 kGy Range based on : Tmax = 500C Tmin = 20C Stable


A Novel Unified Approach to Invariance in Control  

E-Print Network (OSTI)

May 20, 2014 ... Category 3: Applications -- Science and Engineering (Control Applications ) ... Gy?r, Hungary Department of Industrial and Systems Engineering,...

Zoltn Horvth



E-Print Network 3.0 - applied high energy Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

with high ener- gy efficiency. This is highly relevant to buildings... ), and gross energy consumption in buildings ... Source: Ris National Laboratory Collection:...


arXiv:nucl-th/0412037v110Dec2004 Transport Theories for Heavy Ion Collisions in the 1 AGeV  

E-Print Network (OSTI)

. Danielewicz8 , C. Fuchs9 , T. Gaitanos10 , C.M. Ko6 , A. Larionov5 , M. Reiter4 , Gy. Wolf11 , J. Aichelin2 1

Heger, Alexander


E-Print Network 3.0 - adams view system Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

ou Recherche avec licence Site INSA ou serveur de jetons ORACLE LabView... ABAQUS MATLAB MAPLE SOLID EDGE FEMAP NX-CAM ... Source: Stouls, Nicolas - Centre of Innovation in...



E-Print Network (OSTI)

of the 1999 Operable Unit (OU) III Remedial Investigation/Feasibility Study(RI/FS) and was designated as AreaOU III BUILDING 96 RECOMMENDATION FOR SOURCE AREA REMEDIATION FINAL Prepared by: Brookhaven REMEDIATION Executive Summary


II Congresso de e justia da UFPR Novas Tecnologias para o Direito e o Poder Judicirio  

E-Print Network (OSTI)

INTERNET PROFUNDA OU "DEEP WEB". Manuel Martin Pino Estrada O presente trabalho visa mostrar à comunidade mais fácil desviar dinheiro pela chamada "internet profunda" ou "deep web" e o melhor, sem ser

Paraná, Universidade Federal do



E-Print Network (OSTI)


Jeanjean, Louis


Le point de vue critique de l'anthropologie musicale. 1 Franois Picard, Le point de vue critique de l'anthropologie musicale , Jean During (ed.), La musique  

E-Print Network (OSTI)

la musique persane ou chinoise devra, lui, répondre à ce type de questions. Musicologue, il devra se

Paris-Sud XI, Université de


Prsente par Fabien AYRINHAC  

E-Print Network (OSTI)

ou en mélange avec du ciment, son anhydrite conduit à la formation d'ettringite, hydrate responsable

Paris-Sud XI, Université de


Revue de presse hebdomadaire 04 10 mars 2013  

E-Print Network (OSTI)

, c'est possible (por Fernando Barciela) : Des multinationales comme Coca-Cola, HSBC ou Crédit Suisse

Rennes, Université de


Revisiting Low-Dose Total Skin Electron Beam Therapy in Mycosis Fungoides  

SciTech Connect

Purpose: Total skin electron beam therapy (TSEBT) is a highly effective treatment for mycosis fungoides (MF). The standard course consists of 30 to 36 Gy delivered over an 8- to 10-week period. This regimen is time intensive and associated with significant treatment-related toxicities including erythema, desquamation, anhydrosis, alopecia, and xerosis. The aim of this study was to identify a lower dose alternative while retaining a favorable efficacy profile. Methods and Materials: One hundred two MF patients were identified who had been treated with an initial course of low-dose TSEBT (5-<30 Gy) between 1958 and 1995. Patients had a T stage classification of T2 (generalized patch/plaque, n = 51), T3 (tumor, n = 29), and T4 (erythrodermic, n = 22). Those with extracutaneous disease were excluded. Results: Overall response (OR) rates (>50% improvement) were 90% among patients with T2 to T4 disease receiving 5 to <10 Gy (n = 19). In comparison, OR rates between the 10 to <20 Gy and 20 to <30 Gy subgroups were 98% and 97%, respectively. There was no significant difference in median progression free survival (PFS) in T2 and T3 patients when stratified by dose group, and PFS in each was comparable to that of the standard dose. Conclusions: OR rates associated with low-dose TSEBT in the ranges of 10 to <20 Gy and 20 to <30 Gy are comparable to that of the standard dose ({>=} 30 Gy). Efficacy measures including OS, PFS, and RFS are also favorable. Given that the efficacy profile is similar between 10 and <20 Gy and 20 and <30 Gy, the utility of TSEBT within the lower dose range of 10 to <20 Gy merits further investigation, especially in the context of combined modality treatment.

Harrison, Cameron, E-mail: cameronh@stanford.edu [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Young, James; Navi, Daniel [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Riaz, Nadeem [Department of Radiation Oncology, Stanford Cancer Center, Stanford, California (United States); Lingala, Bharathi; Kim, Youn [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Hoppe, Richard [Department of Radiation Oncology, Stanford Cancer Center, Stanford, California (United States)



L'intgration des mots venus d'ailleurs Henriette WALTER  

E-Print Network (OSTI)

voyageurs 9. La phonologie au secours du lexique 10. Des mots venus de l'arabe, du persan, du turc 11 portugais, l'italien ou le roumain, mais aussi au néerlandais ou au danois, ou encore à l'arabe et au persan

Paris-Sud XI, Université de



E-Print Network (OSTI)

rateur externe ou celui qui existe a la surface des cristaux d'halog6nures alcalins ou d'autres mat6riaux (halog6nures alcalins, teflon) ou n'en pr6sentant pas (polyethylene, polyisobutylene), il se produit des

Paris-Sud XI, Université de


Instituto Superior T ecnico Departamento de Matem atica  

E-Print Network (OSTI)

Exames A nota dos testes ou exames 1 #19;e, consoante a op#24;c~ao de cada aluno: { ou a m#19;edia das;#16;nua #19;e a m#19;edia da nota dos testes ou exames com peso 70

Cannas da Silva, Ana


Instituto Superior Tecnico Departamento de Matematica  

E-Print Network (OSTI)

Exames A nota dos testes ou exames1 ´e, consoante a op¸c~ao de cada aluno: ­ ou a m´edia das notas dos notas nas fichas de exerc´icios. A nota com avalia¸c~ao cont´inua ´e a m´edia da nota dos testes ou

Cannas da Silva, Ana

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LA-13194-MS Fracture Characterization of the  

E-Print Network (OSTI)

LA-13194-MS Fracture Characterization of the Bandelier Tuff in OU-1098 (TA-2 and TA-41) LosN A T I technical correctness. #12;Fracture Characterization of the Bandelier Tuff in OU-1098 (TA-2 and TA-41 Los Alamos, New Mexico 87545 #12;1 Fracture Characterization of the Bandelier Tuff in OU-1098 (TA-2


Experimental investigation of the 100 keV X-ray dose response of the high-temperature thermoluminescence in LiF:Mg,Ti (TLD-100): theoretical interpretation using the unified interaction model  

Science Journals Connector (OSTI)

......measured from 1 to 50 000 Gy using 100 keV X rays at the European Synchroton Radiation Facility. Glow curves were deconvoluted into component...from 1 to 50,000 Gy using 100 keV X rays at the European Synchroton Radiation Facility. Glow curves were deconvoluted into component......

J. Livingstone; Y. S. Horowitz; L. Oster; H. Datz; M. Lerch; A. Rosenfeld; A. Horowitz



Dose-Response Effect of Charged Carbon Beam on Normal Rat Retina Assessed by Electroretinography  

SciTech Connect

Purpose: To compare the effects of carbon beam irradiation with those of proton beam irradiation on the physiology of the retina of rats. Methods and Materials: Eight-week-old Wister rats were used. The right eyes were irradiated with carbon beam (1, 2, 4, 8, and 16 Gy) or proton beam (4, 8, 16, and 24 Gy) with the rats under general anesthesia. Electroretinograms were recorded 1, 3, 6, and 12 months after the irradiation, and the amplitudes of the a and b waves were compared with those of control rats. Results: The amplitude of b waves was reduced more than that of a waves at lower irradiation doses with both types of irradiation. With carbon ion irradiation, the amplitudes of the b wave were significantly reduced after radiation doses of 8 and 16 Gy at 6 months and by radiation doses of 4, 8, and 16 Gy at 12 months. With proton beam irradiation, the b-wave amplitudes were significantly reduced after 16 and 24 Gy at 6 months and with doses of 8 Gy or greater at 12 months. For the maximum b-wave amplitude, a significant difference was observed in rats irradiated with carbon beams of 4 Gy or more and with proton beams of 8 Gy or more at 12 months after irradiation. Conclusions: These results indicate that carbon beam irradiation is about two times more damaging than proton beam irradiation on the rat retina at the same dose.

Mizota, Atsushi, E-mail: mizota-a@med.teikyo-u.ac.j [Department of Ophthalmology, Teikyo University School of Medicine, Tokyo (Japan); Department of Ophthalmology, Juntendo University Urayasu Hospital, Urayasu (Japan); Tanaka, Minoru [Department of Ophthalmology, Juntendo University Urayasu Hospital, Urayasu (Japan); Kubota, Mariko; Negishi, Hisanari [Department of Ophthalmology, National Hospital Organization Chiba Medical Center, Chiba (Japan); Watanabe, Emiko [Department of Ophthalmology, Teikyo University School of Medicine, Tokyo (Japan); Tsuji, Hiroshi; Miyahara, Nobuyuki; Furusawa, Yoshiya [National Institute of Radiological Sciences, Chiba (Japan)



Angiotensin Converting Enzyme Inhibitors Mitigate Collagen Synthesis Induced by a Single Dose of Radiation to the Whole Thorax  

Science Journals Connector (OSTI)

......pneumonitis after whole-thoracic irradiation (WTI) even when therapy is started up to one...compared to those of animals receiving 13 Gy WTI alone. Based upon directives from the IACUC...after 13 Gy whole- thoracic irradiation (WTI). Drugs were started 1 week after irradia......

Lakhan Kma; Feng Gao; Brian L. Fish; John E. Moulder; Elizabeth R. Jacobs; Meetha Medhora



Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone  

E-Print Network (OSTI)

. Male Sprague-Dawley rats (15-weeks old, n=32) were randomized to receive an adequate (45 mg Fe/kg diet) or high (650 mg Fe/kg diet) Fe diet for 4 weeks and either 3 Gy (8 fractions, 0.375 Gy each) of 137Cs radiation (?RAD) or sham exposure every other...

Yuen, Evelyn P



New Centers and Training Programs atNew Centers and Training Programs at the interface of nanotechnology and  

E-Print Network (OSTI)

on integration of nanotechnology and biology/medicine � World Fastest Transistor Transistor Laser 2 g p g gy gy of nanotechnology and biology Rashid Bashir Electrical and Computer Engineering & Bioengineeringp g g g g Director, Micro and Nanotechnology Laboratory University of Illinois at Urbana-Champaign, IL. USA 1 #12;Micro

Bashir, Rashid


Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto



Cell cycle responses to low-dose ionizing radiation.  

Science Journals Connector (OSTI)

...47, 2006] 5178 Low-dose hyper-radiosensitivity...radiosensitivity of cells to doses of ionizing radiation less than 0.5 Gy...connection between low-dose HRS survival, Ataxia...the low dose radiation range (0-1 Gy). MR4 cells...

Sarah A. Krueger; George D. Wilson; Michael C. Joiner; and Brian Marples



Ionizing Radiation-induced, Mitochondria-dependent Generation of Reactive Oxygen/Nitrogen  

Science Journals Connector (OSTI)

...exposing cells to ionizing radiation. In the 1-10 Gy dose range, the amount...demonstrated that ionizing radiation in the therapeutic dose range stimulates a...exposing cells to ionizing radiation. In the 1-10 Gy dose range, the amount...

J. Kevin Leach; Glenn Van Tuyle; Peck-Sun Lin; Rupert Schmidt-Ullrich; and Ross B. Mikkelsen



Activation of mitogen-activated protein kinase pathway by extremely low-dose ionizing radiation  

Science Journals Connector (OSTI)

X-ray irradiation at very low doses, between 2 and 5 cGy, stimulated activity of a member of the mitogen-activated protein (MAP) kinase, the extracellular signal-regulated kinase (ERK) 1/2 in normal human diploid cells. Higher doses of irradiation at more than 1 Gy induced phosphorylation of ERK1/2 and accumulated p53 protein. Phosphorylation of ERK1/2 decreased with doses down to 50 cGy, however, doses of between 2 and 5 cGy phosphorylated ERK1/2 as efficiently as higher doses of X-rays, while the p53 protein level was no longer changed by doses below 50 cGy. Ataxia telangiectasia-mutated (ATM)-dependent phosphorylation of p53 protein at Ser15 and histone H2AX at Ser139 was only observed at higher doses of more than 10 cGy of X-rays. We found that the MEK1 inhibitor, PD98059, and the specific epidermal growth factor receptor tyrosine kinase inhibitor, AG1478, decreased phosphorylation of the ERK1/2 proteins induced by 2 cGy or 6 Gy of X-rays. These results indicate that a limited range of low-dose ionizing radiation differentially activates ERK1/2 kinases via activation of the epidermal growth factor receptor and MAP kinaseERK kinase, which mediates various effects of cells receiving very low doses of ionizing radiation.

Keiji Suzuki; Seiji Kodama; Masami Watanabe



p53-Mediated Regulation of Proliferating Cell Nuclear Antigen Expression in Cells Exposed to Ionizing Radiation  

Science Journals Connector (OSTI)

...exposed to increasing doses of IR at 24 h posttransfection...cellular response to ionizing radiation in which p53-mediated...IR at 12 Gy, a dose that induced maximal...the 1- to 4-Gy range does not effectively...because a high radiation dose is used and the...

Jin Xu; Gilbert F. Morris



Inactivation of 14-3-3? Influences Telomere Behavior and Ionizing Radiation-Induced Chromosomal Instability  

Science Journals Connector (OSTI)

...per dish was chosen to ensure that about 50 colonies would survive a particular radiation dose treatment. Cells were exposed to ionizing radiation in the dose range of 0 to 8 Gy at room temperature using a 137Cs ray at a dose rate of 1.1 Gy...

Sonu Dhar; Jeremy A. Squire; M. Prakash Hande; Raymund J. Wellinger; Tej K. Pandita



Secondary neutron doses in proton therapy treatments of ocular melanoma and craniopharyngioma  

Science Journals Connector (OSTI)

......as the non-treated eye, the healthy brain tissue etc. and these should be taken...Non-treated eye 11.42 10.64 121.5 Brain 4.55 8.09 36.8 Thyroid 3.33 8...neutron absorbed doses received by the brain (1.5 microGy Gy1) and three times lower......

J. Farah; R. Sayah; F. Martinetti; L. Donadille; V. Lacoste; J. Hrault; S. Delacroix; C. Nauraye; I. Vabre; C. Lee; W. E. Bolch; I. Clairand



Dosimetric performance evaluation regarding proton beam incident angles of a lithium-based AB-BNCT design  

Science Journals Connector (OSTI)

......suitable for the treatments of deep-seated brain tumours, such as glioblastoma multiforme...large energy deposition in the skin and the brain surface. The use of beryllium target with...60.0 RBE-Gy, (e) maximum healthy brain dose 12.5 RBE-Gy and (f) maximum......

Pei-Yi Lee; Yuan-Hao Liu; Shiang-Huei Jiang



AFRRI Form 331 (12/2007) Page 1 of 6Patient's service number: Biodosimetry Worksheet  

E-Print Network (OSTI)

) Estimated time post-exposure (h) Dose (Gy) Reference radiation quality and dose rate (Gy/min) Time onset Record of Radiation Dose, Contamination, and Acute Radiation Sickness Response) Reporting Authority-mail: Country of origin: Date dose assessed (yymmdd): Time dose assessed: Place: Nature of exposure: radiation


The Estimation of Molecular and Cytogenetic Effects in Mice Exposed to Chronic Low Dose-Rate Gamma-Radiation  

Science Journals Connector (OSTI)

Molecular and cytogenetic parameters were estimated in male CBA/lac mice exposed to chronic low dose-rate ?-radiation (62 cGy/year) for 40, 80, 120, 210, and 365 days. After 40 days of exposure (6.7 cGy), sple...

A. N. Osipov; A. L. Elakov; P. V. Puchkov



Lack of Radiation Maculopathy After Palladium-103 Plaque Radiotherapy for Iris Melanoma  

SciTech Connect

Purpose: To report on the risk of radiation maculopathy for iris and iridociliary melanomas treated by {sup 103}Pd plaque radiotherapy. Methods and Materials: This is a retrospective clinical case series of 30 eyes in 30 patients with melanomas limited to the iris or invading the ciliary body. The main outcome measures included demographic information, laterality, tumor size, location, visual acuity, radiation dose, local control, retinal evaluation, and duration of follow-up. Results: Thirty patients were followed for a median 36 months (range, 12-90 months). Sixteen of 30 tumors (53%) were pure iris melanomas, and 14 (47%) were primary iris melanomas extending into the ciliary body. Radiation dosimetry showed that the median tumor apex dose was 85 Gy (range, 75-100 Gy), lens dose 43.5 Gy (range, 17.8-60 Gy), fovea dose 1.8 Gy (range, 1.3-5 Gy), and central optic disc dose 1.7 Gy (range, 1.3-4.7 Gy). Cataracts developed in 20 of the 28 phakic eyes (71.4%). No patient in this series developed radiation maculopathy or radiation optic neuropathy. Last best-corrected visual acuity was {>=}20/25 in 28 patients (93%) at a median 36 months' follow-up. Conclusion: Though visual acuities were transiently affected by radiation cataract, no radiation maculopathy or optic neuropathy has been noted after {sup 103}Pd treatment of iris and iridociliary melanomas.

Yousef, Yacoub A. [New York Eye Cancer Center, New York Eye and Ear Infirmary, and New York University School of Medicine, New York, NY (United States); Finger, Paul T., E-mail: pfinger@eyecancer.com [New York Eye Cancer Center, New York Eye and Ear Infirmary, and New York University School of Medicine, New York, NY (United States)



ESI_CS_Zirkle 1.6.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

Zirkle Fruit case study ZIRKLE FRUIT Utility Benton PUD ProJect Refrigeration, compressed air, door, and lighting upgrades eNerGy SAViNGS 3,441,532 kWhy eNerGy coSt SAViNGS...


Radiochromic film for medical radiation dosimetry Martin J. Butsona,b  

E-Print Network (OSTI)

Cheunga , Peter Metcalfeb a Department of Physics and Materials Science, City University of Hong Kong, Tat, which have accurate dose measurement ranges from less than 1 Gy up to many kGy. A relatively energy independent dose response combined with automatic development of radiochromic film products has made

Yu, K.N.


SCH66336 (Sarasar), an oral farnesyl transferase inhibitor, synergizes with temozolomide and radiation therapy for orthotopic malignant gliomas  

Science Journals Connector (OSTI)

...completed prior to and at RT completion, and skin toxicity was assessed at week 3 and RT completion. We recorded patient demographics, body mass index (BMI), disease and treatment...Gy + 10 Gy boost. At RT completion, all patients had ST...

Jessica W. Barnes; Claire Sauvageot; Naren Ramakrishna; Jamie L. Dellagatta; Deviney Chaponis; Patrick Wen; Charles Stiles; Andrew Kung; and Mark W. Kieran


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Prospective Studies of Body Mass Index with Head and Neck Cancer Incidence and Mortality  

Science Journals Connector (OSTI)

...completed prior to and at RT completion, and skin toxicity was assessed at week 3 and RT completion. We recorded patient demographics, body mass index (BMI), disease and treatment...50 Gy 10 Gy boost. At RT completion, all patients had ST...

Mia M. Gaudet; Alpa V. Patel; Juzhong Sun; Janet S. Hildebrand; Marjorie L. McCullough; Amy Y. Chen; and Susan M. Gapstur



Ann bay lodyans 3 / se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network (OSTI)

la di: "Sa fe 2 fwa." Bourik la fe yon twazyem fopa. Neg la desann bourik la ak madanm li, epi li touye bourik la. Madanm li di: "Poukisa ou fe sa?" Neg la d i : " S a fe yon fwa." Se konsa zarenyen te | r p rive touye ni ti sourit, ni YMk c n.... "Monkonpe Chen, m raze net. Ou pa ta gen yon ti pyas prete m? M a remet ou li denmen a midi." Konpe Chen di li: "Men, pran sa. Denmen a midi m a pase chache li." Zarenyen reponn li: 2 "Wi, pa gen pwoblem. Ou met vini, m ap pare pou ou." Apre sa...

Freeman, Bryant C., ed.



Gene Expression Analysis of Apoptosis and Oxidative Stress in Mouse Brain  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis of Apoptosis and Oxidative Stress in Mouse Brain Analysis of Apoptosis and Oxidative Stress in Mouse Brain After Low-dose and Acute Radiation Exposure Daila Gridley Loma Linda University & Medical Center Abstract Purpose: 1) To examine the induction of oxidative stress and apoptosis-associated gene expression profiles in brain after whole-body irradiation with low-dose/low-dose-rate (LDR) photons and acute exposure to photons 2) to compare these radiation-induced effects with those produced by LDR and acute exposure to protons. Material and Methods: C57BL/6 mice were exposed to 2 Gy of photons or protons at 0.8 Gy/min and 0.9 Gy/min, respectively, both with and without pre-exposure to 0.01 Gy LDR γ-rays (57Co) at 0.03 cGy/h. Brain tissues were harvested and quick-frozen for analyses by quantitative RTPCR at 56


Experimental efforts and results in finding new heavy scintillators  

SciTech Connect

New heavy scintillators are being discovered with increasing frequency. In recent years NaI(Tl) (with its high light output and energy resolution) has been joined by BGO (with its high stopping power), BaF{sub 2} (with its excellent timing resolution), and CeF{sub 3} (with its speed and short Moliere radius). More than 10 potentially useful scintillators have been under development in the past five years, such as PbSO{sub 4} and Lu{sub 2}SiO{sub 5}(Ce). We tabulate the characteristics of these and other scintillators, including wavelength, luminous efficiency, decay time, and initial intensity. We describe a search strategy and the prospects for finding the ``ideal`` heavy scintillator, which would combine the light output of NaI(Tl) and CsI(Tl), the stopping power of BGO, and the speed of BaF{sub 2} and ZnO(Ga).

Derenzo, S.E.; Moses, W.W.



Universal nature of collective plasmonic excitations in finite 1-D carbon-based nanostructures  

E-Print Network (OSTI)

Tomonaga-Luttinger (T-L) theory predicts collective plasmon resonances in 1-D nanostructure conductors of finite length, that vary roughly in inverse proportion to the length of the structure. Yet, such resonances have not been clearly identified in experiments so far. Here we provide evidence of the T-L plasmon resonances using first-principle computational real-time spectroscopy studies of representative finite 1-D carbon-based nanostructures ranging from atom and benzene-like chain structures to short carbon nanotubes. Our all-electron Time-Dependent Density-Functional Theory (TDDFT) real-time simulation framework is capable to accurately capture the relevant nanoscopic effects including correct frequencies for known optical transitions, and various collective plasmon excitations. The presence of 1-D T-L plasmons is universally predicted by the various numerical experiments, which also demonstrate a phenomenon of resonance splitting. Extending these simulations to longer structures will allow the accurate ...

Polizzi, Eric



Pin-end column tests on square structural steel tubes  

E-Print Network (OSTI)

11 ~, t. kt k'. f t I' , I I . t t t 1 I 'I 't I ' ll t 1. I li I 1 t I kl; li ;tj j, E il It ~ . I 't ll 1 ' t 1' I'. I I k- I- , tl T, t i. 'l '1 rf . i t t [" tt :11 I l;, Jt itff tl I I . I t 'j i'4 't...tl5455 MMN 785TS 05 SQUlhR gROGTGRAL flgRSp TCRS I ~ 40NNR ~ N SHWO KRQG5$AL %%+ - g+gg i 1 . 1 j , --. l OeaLi OeheiN%4 te No Oteyheta Sehw4 ef %ho 1e@tstal, as4 ~h~ College ef 5eee $a AACilkseat of the ~ahheesAe 5' the 4syyse of ( SN...

Smith, James Arnold



An intuitive approach to quantum circuit simulation  

E-Print Network (OSTI)

'(t)tf It, )Ill), &f)l;')'I' itttt') t)l&( i)t)tlt)fl ft), &:)ill() . )Lf) t)l I):)ttlttltfi)t) . ) Relllill I ltillilti I fluster hi 8'I l:t, IiV hl Xh t, RN . 'Iuhmtttett to the ()tliie iil I li?tot i I'rii i, imi (4 Ae;lttelHle ht llol;11+ht[ts I...'. tltet (' l), iu lii nti (I ellows . i tfetiot ) httu, tttf . ), I. unhtt&ntiet (I ietuttie l)tteitiii i Apt tl 2()()4 lt1, tjot I:leetiie;it Rii uteeon )&? IIII(?tr(e Appioric]1 Io ()(I i&it(if)i ( i&i?it Nifirrrl it&or) I . \\f)ill (I() ] I jtc...

Sensarn, Steven



Weekly Dose-Volume Parameters of Mucosa and Constrictor Muscles Predict the Use of Percutaneous Endoscopic Gastrostomy During Exclusive Intensity-Modulated Radiotherapy for Oropharyngeal Cancer  

SciTech Connect

Purpose: To define predictors of percutaneous endoscopic gastrostomy (PEG) use during intensity-modulated radiotherapy (IMRT) for oropharyngeal cancer. Methods and Materials: Data for 59 consecutive patients treated with exclusive IMRT at a single institution were recovered. Of 59 patients, 25 were treated with hyperfractionation (78 Gy, 1.3 Gy per fraction, twice daily; 'HYPER'); and 34 of 59 were treated with a once-daily fractionation schedule (66 Gy, 2.2 Gy per fraction, or 70 Gy, 2 Gy per fraction; 'no-HYPER'). On the basis of symptoms during treatment, a PEG tube could have been placed as appropriate. A number of clinical/dosimetric factors, including the weekly dose-volume histogram of oral mucosa (OM DVHw) and weekly mean dose to constrictors and larynx, were considered. The OM DVHw of patients with and without PEG were compared to assess the most predictive dose-volume combinations. Results: Of 59 patients, 22 needed a PEG tube during treatment (for 15 of 22, {>=}3 months). The best cutoff values for OM DVHw were V9.5 Gy/week <64 cm{sup 3} and V10 Gy/week <54 cm{sup 3}. At univariate analysis, fractionation, mean weekly dose to OM and superior and middle constrictors, and OM DVHw were strongly correlated with the risk of PEG use. In a stepwise multivariate logistic analysis, OM V9.5 Gy/week ({>=}64 vs. <64 cm{sup 3}) was the most predictive parameter (odds ratio 30.8, 95% confidence interval 3.7-254.2, p = 0.0015), confirmed even in the no-HYPER subgroup (odds ratio 21, 95% CI 2.1 confidence interval 210.1, p = 0.01). Conclusions: The risk of PEG use is drastically reduced when OM V9.5-V10 Gy/week is <50-60 cm{sup 3}. These data warrant prospective validation.

Sanguineti, Giuseppe, E-mail: gsangui1@jhmi.ed [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Gunn, G. Brandon; Parker, Brent C.; Endres, Eugene J. [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Zeng Jing [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Fiorino, Claudio [Department of Medical Physics, San Raffaele Scientific Institute, Milano (Italy)




Office of Legacy Management (LM)

tlEtlORANDUtl tlEtlORANDUtl TO: FILE 311% /1 DATE-----------~------- FROM: P. %a- w-----------_____ SUBJECT: F,/;-;d&;- /3ec+.e I SITE ALTERNATE NAME: --~~~-~-;,.--_~~~~-~-------------NAHE:----------------- _____ CITY: -!%!2~-&&-~- _______ STATE: s.-c&- OWNER(S) _--_--__ Past: ------------------------ Current: I Owner contacted 0 yes --_--~~~--~~~~--~_~--~~-~~ 0 no; if ye., date contacted 1 I TYPE OF OPERATION ---------------__ q Research & Development 0 Production scale testing a Pilot scale 0 Bench Scale Process 0" Theoretical Studies Sample b Analysis 0 Production 0 Disposal/Storage @- Facility Type 0 Government Sponsored Facility W Clther --_Lp2+k-4;- --------------- TYPE OF CONTRACT -_------------__ a Prime 0 Subcontract&


A structural investigation of the chemokine dimer interface  

E-Print Network (OSTI)

plasmid) were added. PCR products were purified by gel electrophorcsis followed by cleanup with a Qiagen Gel Extraction kit Purified PCR products were then digcstcd in a 31 Eco R I P lac Nsi I sol I on M13 Pst I Hind ill cl oodi 1-132 X los I... by a lac promoter (dark arrow at I:00) This figure is courtesy of Dr. Jim Hu of Texas A&M University. . 32 20pl mixture containing 141tl purified DNA, 21tI New England Biolabs BamH I Buffer, 21tl New England Biolabs 10X BSA buffer, I ltl New England...

Hayes, Garret Lance



Mark Twain's despair: a comparison of the deterministic ideas of the Old Man in What is man: And Satan in The mysterious stranger.  

E-Print Network (OSTI)

there is no longer to be' seen the Mark Twain who had a coherent development up to A Connecticut Yankee. 19 Th g yh ' t ITh I t dh d d~RM lt is gone. As DeVoto says, "There is. a new Mark Twain, ?ZO th tl IWh tl M . d Th ~Mt I ~gt 17 Clemens, Clemens, 19...'s disillusionment in A Connecticut Yankee in K~in Arthur's Court (1889) when the narrator Hank Morgan speaks out of character to voice a deterministic philosophy and to blame man's weaknesses on training. This developing pessimism, Smith contends, gradually...

Hord, Larry Dean



Energy $ Savings From Power Capacitors  

E-Print Network (OSTI)

penalty or a reduction in the kVA demand, or a similar reduction in the power bill for improved power factor. In addition, some users will add power capacitors to improve voltage regulation or reduce the loading of heavily loaded transformers... (TL) of a transformer can be divided into no load loss (NL) and load loss (LL) where: TL .. NL + LL The no load loss is affected very little by the addition of capacitors. The load loss varies as the square of the current or the square of the k...

Harder, J. E.



Free energy of thallium-based superconductors  

Science Journals Connector (OSTI)

Free-energy surfaces have been determined for both Tl2Ba2Ca1Cu2O8 and Tl2Ba2Ca2Cu3O10 in order to determine the thermodynamic aspects of vortex formation in the mixed state of these materials. For fields up to 5 T, the free-energy change, GH-G0, is found to be linear in temperature, over a wide temperature range, thus indicating that the specific heat is roughly independent of magnetic field. The slope of the upper critical field versus temperature plot is at least 20 T/K. These two materials obey a law of corresponding states.

M. M. Fang; J. E. Ostenson; D. K. Finnemore; D. E. Farrell; N. P. Bansal



Low-temperature vortex dynamics in a high-temperature superconductor  

Science Journals Connector (OSTI)

Magnetic-field gradients in the mixed state of a type-II superconductor are studied using Tl205 nuclear magnetic resonance (NMR) on Tl2Ba2Ca2Cu3O10+?. An anomalous peak was observed in the temperature dependence of the transverse relaxation rate at T/Tc?0.25. We attribute this behavior to magnetic-field flucutations from vortex dynamics. We interpret this behavior as a crossover of the principal time scale for vortex dynamics with that of the NMR experiment, approximately 100 ?s. The temperature dependence of this time scale is discussed.

Y.-Q. Song; S. Tripp; W. P. Halperin; L. Tonge; T. J. Marks



Industrial Energy Conservation Potentials in North Carolina  

E-Print Network (OSTI)

molecules are closer together than those in warmer air. Also cooler air has a lower moisture content. The energy savings E for this ECO are E = C x H x W x L x PLF x ?TI - TO)/ Tl + 460?/EFF where C = conversion constant, 2,545 BTU/HP hr H... molecules are closer together than those in warmer air. Also cooler air has a lower moisture content. The energy savings E for this ECO are E = C x H x W x L x PLF x ?TI - TO)/ Tl + 460?/EFF where C = conversion constant, 2,545 BTU/HP hr H...

Barakat, M. G.; Singh, H.; Mallik, A. K.


Geographic variation and distribution of the genus Tomodactylus in Mexico  

E-Print Network (OSTI)

of Volcan Paricutin~ the most recent active volcano in Mexico. Patscuaro, 101 31' ~18 $1'~ 8, 800 ft, ~ Lecation 28 Pine-oak Forest. A large town surrounded by low hills on the southern edge of Lago Patscuaro. Large areas of lava deposits lie... 800 t, ( fL tl 38. Pine-oak Forest, A large suburb of Mexico City. MORE LO8 ~AL . $015' ~18 44'; 3?$00 ft. ; L tl 50. A Tropical 8crub. A snail town surrounded by rell- ing hills and irrigated valleys. The eager crops are rice, oorn, and bananas...

Dixon, James Ray



Protecting entangled states of two ions by engineering reservoir  

E-Print Network (OSTI)

We present a proposal for realizing local decoherence-free evolution of given entangled states of two two-level (TL) ions. For two TL ions coupled to a single heavily damped cavity, we can use engineering reservoir scheme to obtain a decoherence-free subspace which can be nonadiabatically controlled by the system and reservoir parameters. Then the local decoherence-free evolution of the entangled states are achieved. And we also discuss the relation between the geometric phases and the entanglement of the two ions under the nonadiabatic coherent evolution.

Dong Xue; Jian Zou; Lin-Guang Yang; Jun-Gang Li; Bin Shao



Age and growth of black drum (Pogonias cromis Linneaus) from Galveston Bay  

E-Print Network (OSTI)

for black drum ranging from 140 to 400 mm standard length and 1 to 3 years old. Nean standard length for drum at age 1, 2 and 3 was 182, 283 and 369 ms, respectively. Tne theoretical growth equation developed for black drum through age was lt = 640(1 ? e... 0. 2783(t+0. 1562) ]. Standard and total length-weight relationships were log W = 2. 939 log SL - 4. 24 and log W = 3. 038 log TL ? 4. 958, respectively. The relatzonship of standard length to total length was TL = 13. 199 + 1. 209 SL. Results...

Massey, Julie Kay



The effect of the time of inoculation with Maize Dwarf Mosaic Virus on grain sorghum  

E-Print Network (OSTI)

the effect of the time of inoculation with Maize Dwarf Mosaic Virus on some agronomic charac- teristics of a tolerant and a susceptible grain sorghum hybrid. A completely randomized block design with three replications was util- ized, Mass inoculation.... The magn ?. 'tu. :e of the effects of tl e viru' was dependent tl. e particular hybz. id and the time of inoculation. As expected, the toLerant hybrid was affected to s. esser degree than the susceptible hybrid. Tn general, the earlier in the growth...

Batte, Robert Dan



Type of Space Bulb Type #/House Fixture Style Greenhouse #  

E-Print Network (OSTI)

841 360 8 F 32 T8/TL 841 360 9 F 32 T8/TL 841 360 MTPS 216 Ch. 1 F 72 T12 CW/VHO 72 1 Incandescent 60w 72 2 F 72 T12 CW/VHO 72 2 Incandescent 60w 72 5 F 72 T12 CW/VHO 72 5 Incandescent 60w 72 10 F 72 T12 CW/VHO 72 10 Incandescent 60w 72 #12;DR 1009 Ch. 27 F 032/431 4 Seed Chamber Ch. 28 F40T12/ADV 41 6

Pawlowski, Wojtek

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Experimental verification of broadband invisibility using a cloak based on inductor-capacitor networks  

Science Journals Connector (OSTI)

We demonstrate the experimental realization of an invisibility cloak based on inductor-capacitor (L-C) transmission line (TL) networks. The anisotropic medium parameters of a cloak in the cylindrical basis are controlled independently by three branches of the L-C unit cell which leads to a full-parameter realization of the cloak. A cylindrical cloak working in very-high-frequency band has been designed and fabricated with its performance measured. The nonresonant property of the TL structure results in a relatively broad bandwidth (from 24 to 40 MHz) of the realized cloak which is clearly observed in our experiment.

Xiu Liu; Chao Li; Kan Yao; Xiankun Meng; Wei Feng; Bingheng Wu; Fang Li



Low Dose Suppression of Neoplastic Transformation in Vitro  

SciTech Connect

This grant was to study the low dose suppression of neoplastic transformation in vitro and the shape of the dose-response curve at low doses and dose-rates of ionizing radiation. Previous findings had indicated a suppression of transformation at dose <10cGy of low-LET radiation when delivered at high dose-rate. The present study indicates that such suppression extends out to doses in excess of 100cGy when the dose (from I-125 photons) is delivered at dose-rates as low as 0.2 mGy/min and out to in excess of {approx}25cGy the highest dose studied at the very low dose-rate of 0.5 mGy/day. We also examined dose-rate effects for high energy protons (which are a low-LET radiation) and suppression was evident below {approx}10cGy for high dose-rate delivery and at least out to 50cGy for low dose-rate (20cGy/h) delivery. Finally, we also examined the effect of low doses of 1 GeV/n iron ions (a high-LET radiation) delivered at high dose-rate on transformation at low doses and found a suppression below {approx}10cGy that could be attributable to an adaptive response in bystander cells induced by the associated low-LET delta rays. These results have implications for cancer risk assessment at low doses.

John Leslie Redpath



Dose-Effect Relationships for the Submandibular Salivary Glands and Implications for Their Sparing by Intensity Modulated Radiotherapy  

SciTech Connect

Purpose: Submandibular salivary glands (SMGs) dysfunction contributes to xerostomia after radiotherapy (RT) of head-and-neck (HN) cancer. We assessed SMG dose-response relationships and their implications for sparing these glands by intensity-modulated radiotherapy (IMRT). Methods and Materials: A total of 148 HN cancer patients underwent unstimulated and stimulated SMG salivary flow rate measurements selectively from Wharton's duct orifices, before RT and periodically through 24 months after RT. Correlations of flow rates and mean SMG doses were modeled throughout all time points. IMRT replanning in 8 patients whose contralateral level I was not a target incorporated the results in a new cost function aiming to spare contralateral SMGs. Results: Stimulated SMG flow rates decreased exponentially by (1.2%){sup Gy} as mean doses increased up to 39 Gy threshold, and then plateaued near zero. At mean doses {<=}39 Gy, but not higher, flow rates recovered over time at 2.2%/month. Similarly, the unstimulated salivary flow rates decreased exponentially by (3%){sup Gy} as mean dose increased and recovered over time if mean dose was <39 Gy. IMRT replanning reduced mean contralateral SMG dose by average 12 Gy, achieving {<=}39 Gy in 5 of 8 patients, without target underdosing, increasing the mean doses to the parotid glands and swallowing structures by average 2-3 Gy. Conclusions: SMG salivary flow rates depended on mean dose with recovery over time up to a threshold of 39 Gy. Substantial SMG dose reduction to below this threshold and without target underdosing is feasible in some patients, at the expense of modestly higher doses to some other organs.

Murdoch-Kinch, Carol-Anne [Department of Oral Medicine/Hospital Dentistry, University of Michigan, Ann Arbor, MI (United States); Kim, Hyugnjin M. [Department of Biostatistics, University of Michigan, Ann Arbor, MI (United States); Vineberg, Karen A. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Ship, Jonathan [Department of Oral Medicine/Hospital Dentistry, University of Michigan, Ann Arbor, MI (United States); Eisbruch, Avraham [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)], E-mail: eisbruch@umich.edu



You are now leaving Energy.gov | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

generating-your-own-power/incentive-program/!ut/p/b1/rZRNc5swEIb_invwUcMiBEhHSF0MuKb-aBJz8QgQlEwsiE3str--suuZDE5j7HE5MOzMuw-rd1erxdqjFku-LQvelJXkz_s4tpY69ZyhPwM_cn0LfPfOuYuiAICAEiyUAD54HDjkMw8GwyAC35tPDPCNCYxnjmMAWNqDFmtxKpu6-aEtNqlYppVshGyWQvbh-N2H5HVTSrHZ9KEQUqxVdbLo_ape171qJ3t1tRPrPpQyVeJyK1C9roo1X-3RNS9EJjZlIQ9RWmbaAps5sznPUcZ4gogtMKJE50hPqMB2pgthsOPBzlTeMsab2hj84H4wilwdA8HH_DOCVj51GVXGhqOBPsKe58Fp_ntBR2MOxna0pqs5cdchx8NqJbSFKtX-UBbq2uzNe5pTwjKDImqSXHmf5YhRXaCEYSvnNDExSbqA5FZgZHqg3Bp44Vd3Dsy-Hhhc0P7y6eUldtR076f4Z6M9do73aZ0nTactJ3X1G5IaKbJymiGC1SuxbBPtq-SM6UJnVgfQs28Ftp30Q3w1MLjgIlzv5JlF8e4I7avTHteLVsV5ILFvBdLp5LMCGtbAcr_AN2peDQwuWOP_1eR_beN69X1Fn_IwHFnT4Q4Ms97-nuerB8QT-jca5ePxMXouPv0BOUBh4A!!/dl4/d5/L2dBISEvZ0FBIS9nQSEh generating-your-own-power/incentive-program/!ut/p/b1/rZRNc5swEIb_invwUcMiBEhHSF0MuKb-aBJz8QgQlEwsiE3str--suuZDE5j7HE5MOzMuw-rd1erxdqjFku-LQvelJXkz_s4tpY69ZyhPwM_cn0LfPfOuYuiAICAEiyUAD54HDjkMw8GwyAC35tPDPCNCYxnjmMAWNqDFmtxKpu6-aEtNqlYppVshGyWQvbh-N2H5HVTSrHZ9KEQUqxVdbLo_ape171qJ3t1tRPrPpQyVeJyK1C9roo1X-3RNS9EJjZlIQ9RWmbaAps5sznPUcZ4gogtMKJE50hPqMB2pgthsOPBzlTeMsab2hj84H4wilwdA8HH_DOCVj51GVXGhqOBPsKe58Fp_ntBR2MOxna0pqs5cdchx8NqJbSFKtX-UBbq2uzNe5pTwjKDImqSXHmf5YhRXaCEYSvnNDExSbqA5FZgZHqg3Bp44Vd3Dsy-Hhhc0P7y6eUldtR076f4Z6M9do73aZ0nTactJ3X1G5IaKbJymiGC1SuxbBPtq-SM6UJnVgfQs28Ftp30Q3w1MLjgIlzv5JlF8e4I7avTHteLVsV5ILFvBdLp5LMCGtbAcr_AN2peDQwuWOP_1eR_beN69X1Fn_IwHFnT4Q4Ms97-nuerB8QT-jca5ePxMXouPv0BOUBh4A!!/dl4/d5/L2dBISEvZ0FBIS9nQSEh


Design and development of a cooling device for solid polymer electrolyte fuel cells  

E-Print Network (OSTI)

, tic d. qas ilry gas elec; electrical eu . evaporation f . Faradic fg: phase change from liquid to vapor f ri c . friction g: gas 1: liquid m e c jt: mechanical s f: steady flow tl; v Lpol' tll: 'iva, tel' Superscripts c cell d: dry f...

Nandi, Asis



J. Phys. D:Appl. Phys. 27 (1994)522-528. Printed in the UK Investigation of a cathode regionof an  

E-Print Network (OSTI)

theoretical models have been proposed for industrial and spectroscopic application of arc plasmas [l, 21;F,filter;TL, tungsten ribbon lamp; MR, flatmirror; CM, concave mirror; A, arc; MT, step-motor-drivenmovable table; AL an electric arc S Pellerint, K Musiott, B Pokrzywkas and J Chapellet t GREMl Universitb $Orleans, BP 6759


MFR PAPER 1041 One of the nation's oldest fishing  

E-Print Network (OSTI)

'- , I"noln!! Icre \\.tlued .II \\er mIl- 1IIIn ano h\\ 11)-2 the \\illUe ,)1 lilnd lng had lO..:re.t cd tlOJu,llllent ha, heel) illaoe. u'lng Ihe \\ alue \\1( Ihe oollal in 19(,7 d' the ha,e \\ car. allo I, pre,entco III I


Study of the (e,e'p) quasi-elastic reaction in complex nuclei: theory and experiment  

SciTech Connect

Experimental coincidence cross section and transverse-longitudinal asymmetry A{sub TL} have been obtained for the quasielastic (e,e'p) reaction in {sup 16}O, {sup 12}C, and {sup 208}Pb in constant q-? kinematics in the missing momentum range -350 < p{sub miss} < 350 MeV/c. In these experiments, performed in experimental Hall A of the Thomas Jefferson National Accelerator Facility (JLAB), the beam energy and the momentum and angle of the scattered electrons were kept fixed, while the angle between the proton momentum and the momentum transfer q was varied in order to map out the missing momentum distribution. The experimental cross section and A{sub TL} asymmetry have been compared with Monte Carlo simulations based on Distorted Wave Impulse Approximation (DWIA) calculations with both relativistic and non-relativistic spinor structure. The spectroscopic factors obtained for both models are in agreement with previous experimental values, while A{sub TL} measurements favor the relativistic DWIA calculation. This thesis describes the details of the experimental setup, the calibration of the spectrometers, the techniques used in the data analysis to derive the final cross sections and the A{sub TL}, the ingredients of the theoretical calculations employed and the comparison of the results with the simulations based on these theoretical models.

Joaquin Lopez Herraiz



Western limits of the Seattle fault zone and its interaction with the Olympic Peninsula, Washington  

E-Print Network (OSTI)

deformation zone. Newly acquired high- resolution seismic reflection and marine magnetic data suggest A.P. Lamb1 , L.M. Liberty1 , R.J. Blakely2 , T.L. Pratt3 , B.L. Sherrod3 , and K. van Wijk1 1

Boise State University


E-Print Network 3.0 - ag dy ta Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Tc 44 Ru 45 Rh 46 Pd 47 Ag 48 Cd 49 In 50 Sn 51 Sb 52 Te 53 I 54 Xe 55 Cs 56 Ba 57 La 72 Hf 73... Ta 74 W 75 Re 76 Os 77 Ir 78 Pt 79 Au 80 Hg 81 Tl 82 Pb 83 Bi 84 Po 85 At 86 Rn 87...


Susan D. Hovorka Publications  

E-Print Network (OSTI)

\\press\\NETL%20- %20Carbon%20Sequestration_files\\tl_frio_injection [Hovorka prominently featured]. Hovorka, S. D., 2004, CEC environmental exchange: carbon sequestration may be answer to excess greenhouse gas: CEC., 2007, Biggest carbon-burial test will hunt for leaks: NewScientist Environment, February, New

Yang, Zong-Liang


Analysis of the Golgi Apparatus in Arabidopsis Seed Coat Cells during Polarized Secretion of Pectin-Rich Mucilage  

Science Journals Connector (OSTI)

...thank Andrew Staehelin (University of Colorado, Boulder, CO) for constructive criticism...manuscript and Zach Gergely (University of Colorado) and the staff of the Boulder Lab for...dispensable. Am. J. Bot. 81: 833-842. Western, T.L., Burn, J., Tan, W.L...

Robin E. Young; Heather E. McFarlane; Michael G. Hahn; Tamara L. Western; George W. Haughn; A. Lacey Samuels



A Characterisation of Relatively Bounded Perturbations  

Science Journals Connector (OSTI)

......an integral divisor of tx. Since z(t) is smaller than the period, T actually has period tx. Also inf {f 6 [0, t0 ]: WTi-iT-Wl ^ yt} ^ tx -x{t), so case (a) or (b) applies to the semigroups T~l and T (actually (b) is ruled out......

C. J. K. Batty



Annual effective dose due to natural radionuclides in building blocks in eight cities of Southwestern Nigeria  

Science Journals Connector (OSTI)

......sealed. The equipment was calibrated against reference sample with known activity concentrations of 226Ra, 232Th and 40K (Rocketdyne Laboratories, CA). The following gamma transitions were used: 226Ra, 1.760 MeV (214Bi); 232Th, 2.614 MeV (208Tl......

J. A. Ademola; I. P. Farai



Reservoir characterization of the upper Merecure and lower Oficina Formations sands in the Leona Este Field, Eastern Venezuela Basin  

E-Print Network (OSTI)

data. The hydrocarbon trapping mechanism of each studied stratigraphic interval, traditionally known as the "S5", "TU", "TL", "U1U", "U1L", "U2U", "U2MA", "U2MB" and "U2L" sands, includes two components: ? Stratigraphic component: each stratigraphic...

Flores Millan, Maria Carolina



NATO-Russia Security Council and NATO Summit 2009.  

E-Print Network (OSTI)

??Die M?ster ?rbeit unter den Titel N?T?-Russl?nd R?t und N?T?-Gipfel 2009 verf?lgt ein Ziel um ?merik?nische-Russische Beziehung in R?mmen der N?rd?tl?ntikp?kt-?rg?nis?ti?n ?n?lysieren. Der Mittelpunkt der (more)

Podobinska, Tetyana



Growth of chrysanthemums in sewage sludge amended media  

E-Print Network (OSTI)

of seedlings of Lironden- d ~tl' 'f, L. d C fl d, L. g t tt screened compost (224 metric tons/ha) made from degested sewage sludge and woodchips. However, Kirkham and Emino (50) found with increasing rates of liquid sewage sludge (50 ml...

Schlutt, Edward Frederick



LM741OperationalAmplifier November 1994  

E-Print Network (OSTI)

TL H 9341 LM741OperationalAmplifier November 1994 LM741 Operational Amplifier General Description The LM741 series are general purpose operational amplifi- ers which feature improved performance over industry stan- dards like the LM709 They are direct plug-in replacements for the 709C LM201 MC1439 and 748

Ida, Nathan


LM194LM394SupermatchPair December 1994  

E-Print Network (OSTI)

TL H 9241 LM194LM394SupermatchPair December 1994 LM194 LM394 Supermatch Pair General Description The LM194 and LM394 are junction isolated ultra well- matched monolithic NPN transistor pairs emitter to ensure com- plete isolation between devices The LM194 and LM394 will provide a considerable

Lanterman, Aaron


LM2907LM2917FrequencytoVoltageConverter February 1995  

E-Print Network (OSTI)

TL H 7942 LM2907LM2917FrequencytoVoltageConverter February 1995 LM2907 LM2917 Frequency to Voltage Converter General Description The LM2907 LM2917 series are monolithic frequency to voltage converters doubling for low ripple full input protection in two versions (LM2907-8 LM2917-8) and its output swings

Wedeward, Kevin

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LRRR Emplacement Range and Azimuth From. LM for Fra Mauro  

E-Print Network (OSTI)

LRRR Emplacement Range and Azimuth From. LM for Fra Mauro Landing Site NO. A Tl\\1- WIO PAGE I REV abovt by LM or other lunar equipment (ALSEP), Potential damage to the .i RRR l'Ould be caused . (}~/ #12;.. ~ospace LRRR Emplacement Range and Azimuth From LM for Fra Mauro Landing Site NO. ATM-890 PAGE

Rathbun, Julie A.


IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY, VOL. 62, NO. 3, MARCH 2013 1075 Virtual-Sensor-Based Maximum-Likelihood Voting  

E-Print Network (OSTI)

://ieeexplore.ieee.org. Digital Object Identifier 10.1109/TVT.2012.2230200 m Electric motor mechanical speed. TB Load torque accounting for friction and windage. TL Load torque. Tm Electric motor torque. i Transmission ratio( ) Estimated quantity. Reference quantity. V (I) Voltage (current). Flux. r Rotor electric speed. Tem Motor

Paris-Sud XI, Université de


Design optimization of a 2D prompt-gamma measurement system for proton dose verification  

Science Journals Connector (OSTI)

To verify in-vivo proton dose distribution, a 2-dimensional (2D) prompt-gamma measurement system, comprised of a multi-hole collimation system, a 2D array of CsI(Tl) scintillators, and a position-sensitive pho...

Han Rim Lee; Jong Hoon Park; Chan Hyeong Kim



The Use of Conditioned Air for Maintaining Quality of Stored Sorghum Grain.  

E-Print Network (OSTI)

.- ...... '. .................................... 21 .............................................. Design Method No: 3 21 Effects of Conditioned-air Storage on Grain Quality ........................................................... II! Insect Control...,~ of controlled storage environments for bulk yain are discussed. The initial vapor pressure of tile moisture in the grain and the partial pressure of !lie vapor in the conditioned air circulating through llle grain mass were found to be very important tl...

Person, Nat K. Jr.; Sorenson, J. W. Jr.; McCune, W. E.; Hobgood, Price



Screening Data from the Cancer Chemotherapy National Service Center Screening Laboratories. XXIII  

Science Journals Connector (OSTI)

...Division Agricultural Research Service U. S. Department of Agriculture Olustee, Florida 378A Prof. Mary H. Aldridge Department...1 a 00O " 1No c " X0)TJ OJOai oC -t-L. ai* o. e-o lca iTJl ^lco -imIH "tOVX VXCO tvtotv OCOtHtv OltvCM IO tv COCO...

Joseph Leiter; B. J. Abbott; and Saul A. Schepartz



MFR PAPER 1097 Plastic Turf Substitute for Gravel in Salmon Incubators  

E-Print Network (OSTI)

layer Dun ng the next 2 or 3 wee\\... . the alevins distnbuted them ehes until they were evenly dlsper ed they emerged a~ fry. The pea\\... of emergence occurred In April conc urren tl y with th e pea\\... of emergence of fry from gravel Incuba- tors. Survival from eyed eggs to fry In th e Incubator With the turf substrate


Analyses of Commercial Fertilizers Sold during 1955-56.  

E-Print Network (OSTI)

!,ear Grades of the 1-2-1 ratio accounted for 67 percent and the 1-1-1 ratio for 11 percent of the total lli' 281,797 tons of mixed goods sold. Nitrogenous materials accounted for 44 percent, superphosph;tl~ for 27 percent and ammoniated phosphates...

Fudge, J. F.



DOE/OR/20722-84 Formerly Utilized Sites Remedial Action Program  

Office of Legacy Management (LM)

ds* R"f""ence 33. eA rorking level (tL) is any cdination of short-lived radon decay products in I liter of air that rill result in the ultimate emission of 1.3 x lO5 tteV of...


Gordon Research Conferences  

Science Journals Connector (OSTI)

...alkali halides"; R. Condit, "017 dif-fusion along grain boundaries in BeO"; S. B...R. J. Friauf, "Dif-15 MARCH 1963 fusion and correlation effects in TlCl and AgCl...E. L. Mackor, "NMR relaxation in HF"; I. Solomon, "Spin temperatures in...

W. George Parks



March 1~3, 2000 Edited by: / '  

E-Print Network (OSTI)

(PW) from an offshore oil production facility were quantified for the early life stages of haddock 'classical' lab species tl1at may not be representative of communities near offshore oil and gas production-sponsored by Sable Offshore Energy EFFECTS OF OFFSHORE Environmental Effects Monitoring Advisory Group (SEEMAG

Taggart, Christopher


Term Life Insurance Change Form Life Insurance Company of North America (LINA)  

E-Print Network (OSTI)

(herein called the Insurance Company) Forinfoandcustomerservicecall1-800-732-1603 TO MEDICAL EVIDENCE Pleaseprint(preferablyinblackink). EMPLOYEE SECTION Mr. Mrs. Ms. (CheckOne) Name and Authorization section. Return to your employer. Be sure to make a copy for your own records TL-009320 (WA) #12

Nelson, Tim


0-600 kev Gamma-Ray Spectra from Thermal Neutron Capture in the Region A=104to198  

Science Journals Connector (OSTI)

The energies and absolute intensities of prominent peaks in the 0-600 kev region of the gamma-ray spectrum following thermal neutron capture have been measured with a single NaI(Tl) scintillation spectrometer. The elements investigated were rhodium, silver, cadmium, indium, antimony, tellurium, iodine, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, hafnium, tantalum, rhenium, iridium, platinum, and gold.

James E. Draper



Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830  

E-Print Network (OSTI)

PNNL-22900 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 Solar-22900 Solar Powered Radioactive Air Monitoring Stations JM Barnett TL Gervais LE Bisping October 2013 at identified preferred locations could not be initially accomplished because utilities were not readily


Separation of supercritical slab-fluids to form aqueous fluid and melt components in subduction zone magmatism  

Science Journals Connector (OSTI)

...Grove TL Parman SW Bowring SA Price RC Baker MB...calibration line as a function of oil pressure (in tons) at 900...Fig. 1C). Then, during heating, aqueous fluid is surrounded...ZZQQhy50% (wt) H2O. During heating, the dark portion moves downward...

Tatsuhiko Kawamoto; Masami Kanzaki; Kenji Mibe; Kyoko N. Matsukage; Shigeaki Ono



Welcome to SWAMP The Stream and Wetland Assessment Management Park  

E-Print Network (OSTI)

in Streams: Pools (deep and slow parts) and riffles (fast and shallow parts) provide more areas for water'S OS Improve Water Q lit Better Habitat for W tl d S i Outdoor Research F ilit Education Established 2007 Nicholas School of the Environment www.nicholas.duke.edu/wetland Sandy Creek Restoration Project


Alpha particle and proton relative thermoluminescence efficiencies in LiF:Mg,Cu,P:is track structure theory up to the task?  

Science Journals Connector (OSTI)

......approximations have been described in organic media, gas and water (19...biology, the DNA molecule or the cell nucleus) of variable size...understanding of the fundamental TL production mechanisms and can be used...of absorption of 0.1 for solar radiation incident on highly......

Y. S. Horowitz; D. Siboni; L. Oster; J. Livingstone; S. Guatelli; A. Rosenfeld; D. Emfietzoglou; P. Bilski; B. Obryk



High-pressure optical studies of doped alkali halides. IV. Mixed crystals  

Science Journals Connector (OSTI)

Optical excitation and emission studies have been made on various compositions of mixed crystals of KCl1-xBrx:In, KCl1-xBrx:Tl, and NaCl1-xBrx:Tl. For the potassium salts measurements were made in both the NaCl and CsCl phases. In general, excitation peak locations were measurably below the prediction from linear interpolation, while emission peak locations deviated so far as to provide a minimum in peak location and a maximum in the Stokes's shift at an intermediate composition. The half-widths were greater than a linear interpolation would predict. This last result can be explained in terms of the number of different isostructures with which the impurity ion interacts in a mixed crystal. Although the analytical relation between Stokes's shift and dielectric constant does not give a quantitative correlation, it is of interest that one can quantitatively relate the deviation from linearity of the Stokes's shift and the dielectric constant using a single scaling parameter for both the KCl1-xBrx:Tl and NaCl1-xBrx:Tl systems.

W. D. Drotning and H. G. Drickamer



Khesbn no. 61-62 - Autumn - Winter 1970-1971 - Journal  

E-Print Network (OSTI)

StJ't lyl! )t rrtvj s I'N lgh r'ltNT J.r," ltJt' srs N ,-t:l t? illt D ''ly rrs;t /l1"lgh,, rtfty'l .rJD]t: 1y,'1 IrR

Admin, LAYCC



Proceedings of the 27th Ris International Symposium on Materials Science  

E-Print Network (OSTI)

Materials for Wind Power Turbines Editors: H. Lilholt, B. Madsen, T.L. Andersen, L.P. Mikkelsen, A. Thygesen. In a wind turbine blade certain areas can, with advantage, be constructed incorporating a sandwich structure, the sandwich structures provides a good strength and stiffness when exposed to compressive loads. Wind turbine


Proceedings of the 27th Ris International Symposium on Materials Science  

E-Print Network (OSTI)

Materials for Wind Power Turbines Editors: H. Lilholt, B. Madsen, T.L. Andersen, L.P. Mikkelsen, A. Thygesen joints are found today in the electronic, automobile, aerospace, wind turbine and shipingbuilding performance and economic advantages. The use of adhesives leads to a more uniform stress distribution

Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Proceedings of the 27th Ris International Symposium on Materials Science  

E-Print Network (OSTI)

components like wind power turbines it is important to consider composite density. Plant fibre composites Materials for Wind Power Turbines Editors: H. Lilholt, B. Madsen, T.L. Andersen, L.P. Mikkelsen, A. Thygesen their potential as reinforcement agents in wind power turbines. The investigation was focussed on the effect


Drug repositioning by integrating target information through a heterogeneous network model  

Science Journals Connector (OSTI)

......receptors occur in central nervous system and play a role in many brain functions. TL_HGBI was able to identify Lorazepam as the...with advanced non-small cell lung cancer with and without brain metastases. a phase II study of the EORTC Lung Cancer Group......

Wenhui Wang; Sen Yang; Xiang Zhang; Jing Li



Second-Order DOA Estimation from Digitally Modulated Signals  

E-Print Network (OSTI)

the followingresearch projects of L e SpanisWCatalanScience and TechnologyCommissions(CICYTICIRIT): TlC2003-05482, TIC2002-04594, TIC2001-2356. TIC-2001-0633-CO3-01. TIC2000-1025 and 2001SGR-00268. spaced X/2 meters

Vázquez, Gregori


The TRANSPARENT TESTA12 Gene of Arabidopsis Encodes a Multidrug Secondary Transporter-like Protein Required for Flavonoid Sequestration in Vacuoles of the Seed Coat Endothelium  

Science Journals Connector (OSTI)

...Eindhoven, The Netherlands] TL 84 fluorescent tubes supplemented with four 60-W incandescent...105 plaque-forming units per fraction led to the recovery of only one positive clone...at the heart stage of ED. The chalazal bulb shows large endothelial cells filled with...

Isabelle Debeaujon; Anton J. M. Peeters; Karen M. Léon-Kloosterziel; Maarten Koornneef


Dataset Issues in Object Recognition J. Ponce1,2  

E-Print Network (OSTI)

Dataset Issues in Object Recognition J. Ponce1,2 , T.L. Berg3 , M. Everingham4 , D.A. Forsyth1 , M of Edinburgh, Edinburgh, UK Abstract. Appropriate datasets are required at all stages of object recognition datasets are lacking in several respects, and this paper discusses some of the lessons learned from

Everingham, Mark


Analytical Challenges and Recent Advances in the Determination of Estrogens in Water Environments  

Science Journals Connector (OSTI)

......MIPs for E2 were synthesized from 4-vinyl pyridine and ethylene dimethacrylate as a functional monomer and cross-linking...2007). 91. D.D. Fine, G.P. Breidenbach, T.L. Price, and S.R. Hutchins. Quantitation of estrogens in ground......

Rodica Domnica Briciu; Agata Kot-Wasik; Jacek Namiesnik



Towards making -------Matthew Green  

E-Print Network (OSTI)

Tromer, Eli Ben-Sasson (In submission) Wednesday, January 29, 14 #12;Bitcoin privacy · TL;DR: Bitcoin is not very anonymous · Bitcoin transactions are recorded in a public ledger · Parties `write checks' using problem is crucial to Bitcoin's long-term success · Existing countermeasures don't address the problem

Amir, Yair


c SPIE and IS&T. This paper was published by SPIE/IS&T and is made available as an electronic reprint with permission of SPIE and IS&T. One print or electronic copy may be made  

E-Print Network (OSTI)

³tBt¯IIti?tl§eVex¯IxF¶tC¢ ¸¤V§A¯I¤DI£rDl¿Bt¯AxU§x£f³tU¢UGI t¶tutD®qrqv8xUxµVVDG¢3V¤³wxU§x§3§tlw

Uhl, Andreas


Consumers of fresh and processed pork in the at-home and away-from-home markets  

E-Print Network (OSTI)

in the Middle Atlantic region (MA). The statistical model in conjunction with equation (I) is as follows: (5) Yi = Pi + (iiMARi + P2APRi + (JiMAYi + tl~i + (JSJUL] + PsA UGi + filzSEPi + 'tisOCT, + P9NOV, + P t ODEC, + P t i JAN; + P] zDIC, + P izDPD, + 1 Ji...

Briggeman, Brian C.



Rules and Regulations for Control of Parking on the Grounds of the University of Connecticut  

E-Print Network (OSTI)

1 Rules and Regulations for Control of Parking on the Grounds of the University of Connecticut 1. GENERAL INFORMATION The University of Connecticut ("University" or "UConn") is authorized by state law. The University of Connecticut's Office of Transportation, Logistics, and Parking Services (TL&P) has overall

Blei, Ron


Pathogenicity of the lesion nematodes on sorghum  

E-Print Network (OSTI)

Science 53:689-692. 21. Marks, C. F. , and J. L. Townshend. 1972. Multiplication of the tl ' td, ~gt the Mhd crops. Canadian Journal of Plant Science 52:187-188. 22. Martin, J. H. 1970. History and classification of sorghum. Pages 1-27. In: sorghum...

Motalaote, Baikabile



Brittle Fracture Ductile to Brittle transition  

E-Print Network (OSTI)

FRACTURE Brittle Fracture Ductile to Brittle transition Fracture Mechanics T.L. Anderson CRC sulphur in steel Residual stress Continuity of the structure Microcracks #12;Fracture Brittle Ductile Factors affecting fracture Strain rate State of stress Temperature #12;Behaviour described Terms Used

Subramaniam, Anandh



E-Print Network (OSTI)

of s-triazolo[4,3-bl-s-tetrazine is described. Dimitriades,s-triazo] o(4, 3-b )-s-tetrazine derivatives (II) from 4-s-tl'iazolo(4,3-b)-s- tetrazine sYstem were reco! mized as

Lepman, S.R.



Proceedings of the 27th Ris International Symposium on Materials Science  

E-Print Network (OSTI)

turbines under surveillance. Especially for offshore wind farms, where the accessibility is low and where Materials for Wind Power Turbines Editors: H. Lilholt, B. Madsen, T.L. Andersen, L.P. Mikkelsen, A. Thygesen Risø National Laboratory, Roskilde, Denmark, 2006 COMMON ACCESS TO WIND TURBINE DATA FOR CONDITION


Diabat L., Remund J., Wald L., 2003. Linke turbidity factors for several sites in Africa. Solar Energy, 75, 2, 111-119. Copyright UFAE Meteotest -Ecole des Mines de Paris Armines 1  

E-Print Network (OSTI)

in the fields of renewable energies, climatology, agro-meteorology, and atmospheric pollution. These issues Energy, 75, 2, 111-119. Copyright UFAE ­ Meteotest - Ecole des Mines de Paris ­ Armines 1 LINKE TURBIDITY turbidity factor (TL) has been estimated at sixteen locations in Africa (9 stations in Egypt, 2

Boyer, Edmond


Quality management system in the CIEMAT Radiation Dosimetry Service  

Science Journals Connector (OSTI)

......spectrometry (NaI (Tl), low energy germanium and Fastscan detection...management system, an external auditor made a revision of the initial...CSN. 4 International Atomic Energy Agency. The management system...GS-R-3. 5 Internatinal Atomic Energy Agency. Application of the......

R. Martn; T. Navarro; A. M. Romero; M. A. Lpez



The energy components of stacked chromatin layers explain the morphology, dimensions and mechanical properties of metaphase chromosomes  

Science Journals Connector (OSTI)

...to the amount of energy required to increase S T and S L by unit area. Considering...during friction measurements, the kinetic energy of the AFM tip produce...text, 1 arbitrary unit 1.2 1017 J. The total surface energy (E T+L = E T...



Larry DeWerd, PhD, FAAPM University ofWisconsin  

E-Print Network (OSTI)

. #12; MeasuredTL output per unit air kerma as a function of photon energy normalized at the average 60 be necessary #12; Each of the x-ray energy beams would have different characteristics A measurement of HVLCo energy. All measurements were made in the linear region of theTLD output (Nunn et al 2008). #12


Acoustic Analysis of R.E.E.L. Semi-Reveberant Sound Chamber  

E-Print Network (OSTI)

Institute ASHRAE The American Society of Heating, Refrigerating and Air-Conditioning Engineers ANSI American National Standards Institute dB Decibel Lp Sound Pressure Level (dB) Lw Sound Power Level (dB) BKG Background Noise TL Sound... PROCEDURE .......................................................................16 H.V.I. Standard ....................................................................................................................18 SONE Calculation...

Elliston, Sean David



Nestling telomere length does not predict longevity, but covaries with adult body size in wild barn swallows  

Science Journals Connector (OSTI)

...All rights reserved. October 23, 2013 research-article Evolutionary...70 60 Nestling telomere length does not predict longevity, but covaries...mean for males: 7.44 (0.23) kb; females: 7.90 (0...obscure. Hence, the present study does not support the idea that TL...


Note: This page contains sample records for the topic "gy ou tl" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Peer Review Summary Document (2/18/2014)  

E-Print Network (OSTI)

Peer Review Summary Document (2/18/2014) http://www.usgs.gov/peer_review and T.L. Nichols. Peer Reviewers Expertise and Credentials Peer Reviewer #1: USGS research Reviewer #2: Senior USGS research geologist with expertise in carbonate environments. Peer Reviewer #3

Torgersen, Christian


High power millimeter wave experiment of ITER relevant electron cyclotron heating and current drive system  

SciTech Connect

High power, long pulse millimeter (mm) wave experiments of the RF test stand (RFTS) of Japan Atomic Energy Agency (JAEA) were performed. The system consists of a 1 MW/170 GHz gyrotron, a long and short distance transmission line (TL), and an equatorial launcher (EL) mock-up. The RFTS has an ITER-relevant configuration, i.e., consisted by a 1 MW-170 GHz gyrotron, a mm wave TL, and an EL mock-up. The TL is composed of a matching optics unit, evacuated circular corrugated waveguides, 6-miter bends, an in-line waveguide switch, and an isolation valve. The EL-mock-up is fabricated according to the current design of the ITER launcher. The Gaussian-like beam radiation with the steering capability of 20 deg. - 40 deg. from the EL mock-up was also successfully proved. The high power, long pulse power transmission test was conducted with the metallic load replaced by the EL mock-up, and the transmission of 1 MW/800 s and 0.5 MW/1000 s was successfully demonstrated with no arcing and no damages. The transmission efficiency of the TL was 96%. The results prove the feasibility of the ITER electron cyclotron heating and current drive system.

Takahashi, K.; Kajiwara, K.; Oda, Y.; Kasugai, A.; Kobayashi, N.; Sakamoto, K. [Japan Atomic Energy Agency, 801-1 Mukoyama, Naka, Ibaraki 311-0193 (Japan); Doane, J.; Olstad, R. [General Atomics, P.O. Box 85608, San Diego, California 92186-5608 (United States); Henderson, M. [ITER Organization, CS90 046, 13067 St. Paul lez Durance Cedex (France)



Feeding value of ammoniated rice hulls, cottonseed hulls and Coastal Bermudagrass hay in high-concentrate rations for lactating dairy cows  

E-Print Network (OSTI)

'tl. nut au%arse effects on rate of growth. ! o" and and Ford (30) called attention to the importance of suppl sentatlon with protegn, m marais and Vitamin A wnen race hulls . ue used to replace 15 to 25 percent of the prairie hay in the diet...

Sekhara Rao, Basavarju Purna Chandra



Shorter Leukocyte Telomere Length Is Independently Associated with Poor Survival in Patients with Bladder Cancer  

Science Journals Connector (OSTI)

...decreased survival after diagnosis (log-rank test, P = 3.9 104). A Cox regression adjusted...and with up to 18-year follow-up to test whether shorter TL may be associated with...Statistical analysis The Kolmogorov-Smirnov test and quantile-quantile plot were performed...

Alessia Russo; Federica Modica; Simonetta Guarrera; Giovanni Fiorito; Barbara Pardini; Clara Viberti; Alessandra Allione; Rossana Critelli; Andrea Bosio; Giovanni Casetta; Giuseppina Cucchiarale; Paolo Destefanis; Paolo Gontero; Luigi Rolle; Andrea Zitella; Dario Fontana; Bruno Frea; Paolo Vineis; Carlotta Sacerdote; Giuseppe Matullo



Species specific blood typing in birds using hemagglutin and precipitin techniques  

E-Print Network (OSTI)

RRVURUMURS 66 VITA 70 LIST OP TABLES T. ABLE Page PIax&m?m agglutination and pre& IpiLin Liter's resulting from immunization of chickens wirh pigeon donor antigcns. . 20 Tl&e ef I ect of di f farci&t ia3 aI&; orIiL ion on hemi&ggh uLinat ion and pr...

Cragg, Peter Charles



The Metabolism of Americium in the Rat  

E-Print Network (OSTI)

t _ 'mE METABOLISM OF AMERICIUM IN THE RAT* By K. G. Scott,The distri :.1). tl.on of americium in the bone was studied,48A THE METABOLISM OF AMERICIUM IN THE RAT By K. G. Scott,

Scott, K.G.



Optimized Waveform Relaxation Solution of RLCG Transmission Line Type Circuits  

E-Print Network (OSTI)

Optimized Waveform Relaxation Solution of RLCG Transmission Line Type Circuits Mohammad D. Al to transmission line circuit problems based on the longitudinal partitioning into segments. This greatly improves the convergence for strongly coupled RLCG transmission line (TL) type circuits. The method can be applied to other

Gander, Martin J.


143 164 143 612Ma 653Ma  

E-Print Network (OSTI)

Cathelineau, M. and Nieva, D. (1985) A chlorite solid solution geothermometer, the Los Azufres (Mexico) geothermal system. Contrib. Mineral. Petrol., 91, 235-244. Charvet, J., Lapierre, H. and Yu, Y. (1994 of the Tungliang well TL-1 of the Penghu Island. Petrol. Geol. Taiwan, 5, 131-149. #12;158 Jahn, B.M., Chen, P

Chen, Wen-Shan


Is semantics computational?* MARK STEEDMAN and MATTHEW STONE  

E-Print Network (OSTI)

225mm) TimesM J-1551 TL, 32:1 PMU: H(C) 09/06/2006 pp. 73­90 1551_32-1_06 (p. 73) #12;merely by put o can account for the key data for the realist view: cases where we judge interlocutors to be ignorant

Steedman, Mark


Model Validation and Spatial Interpolation by Combining Observations with Outputs from Numerical  

E-Print Network (OSTI)

""r,c,rn The authors are for hel]JfuI #12;Abstract Constructing maps of pollution levels is vital for air quality concentrations. Key tlJords: air pollution, Ba~yesian inference, change of support, likelihood approaches, Matern Resolutions 2.5 Modeling a Nonstationary Covariance . 3 Estimation 3.1 Algorithm 4 Application: Air Pollution

Washington at Seattle, University of


AScienneserviaam -*--I-Released u2on receipt but intended f o r use  

E-Print Network (OSTI)

the thermometer falls below -80 and: remains below -70 f o r dWs. Iiowever much one may doubt the accuracy. In February 1932 a privately owned thermometer at Alatna, near AllalrdCet registered -82, but this tl deacon Stuck's mininnun thermometer, found at an altitude of 15,000 feet on Mount McKinley after lying


Comment on ``Return stroke transmission line model for stroke speed near and equal that of light'' by R. Thottappillil, J. Schoene,  

E-Print Network (OSTI)

Comment on ``Return stroke transmission line model for stroke speed near and equal that of light subsequent stroke current at the channel base and a return-stroke speed equal to the speed of light (v = c predicted by the TL model. Optical measurements of the return-stroke speed within the bottom 100 m

Florida, University of


Potential for quantification of regionally altered myocardial perfusion by analysis of rubidium and thallium mean transit times in the rabbit heart  

SciTech Connect

Quantitative estimation of regionally altered perfusion could result in improved clinical care for patients with coronary artery disease. We hypothesized that myocardial blood flow (F) and mean transit time (T{sub mtt}) should vary reciprocally for potassium analogs, such as rubidium and thallium, based on the relationship V{sub d}/F=T{sub mtt}. Twelve isolated blood-perfused rabbit hearts were studied at flows ranging from 0.7 to 2.92 ml/gm min{sup -1}. Bolus injections of Rb-83, Tl-201 and I-125 albumin were followed by subsequent venous ampling for 20 to 30 minutes. T{sub mtt} was estimated using two methods which compensate for the dispersion of the bolus in the blood vessels. In Method A, the I-125 albumin venous concentration curve was convolved with a Dirac delta function and one or more exponentials, and fit to the Rb-83 and Tl-201 venous concentration curves. Mean transit times of the Rb-83 and Tl-201 were computed as the weighted sums of the fitted components. In B, all three venous concentration curves were extrapolated by fitting a straight line to the tail of the semi-log plot of each curve. Extrapolated curves were then normalized to unit area, weighted by time, and numerically integrated to obtain gross mean transit times. Net mean transit times for Rb-83 and Tl-201 were then obtained by subtracting the gross mean transit time for I-125 albumin from those for Rb-83 and Tl-201. T{sub mtt} ranged from 4.0 to 15.5 min for Rb-83 and 6.0 to 29.7 min for Tl-=201. Correlations between 1/T{sub mtt} and F for Tl-201 were y = 0.064x - 0.005, r = 0.87 (Method A) and y = 0.049x + 0.011, r = 0.80 (Method B). The correlation for Rb-83 and Method B was y = 0.07x + 0.03, r = 0.89 which was significantly superior to Method A. Results are consistent with the hypothesis that F and T{sub mtt} vary inversely and suggest that T{sub mtt} could be used to quantitatively estimate regional perfusion in vivo after subtraction of the mean transit time of the input function.

Marshall, R.C.; Taylor, S.E.; Powers-Risius, P. [Lawrence Berkeley Laboratory, CA (United States)] [and others



NSTX Upgrade Vessel Rework for the Neutral Beam and Thomson  

E-Print Network (OSTI)

=Thomas Willard, o=Engineering, ou=PPPL, email=twillard@pppl.gov, c=US Date: 2011.02.02 13:45:19 -05'00' Ali Zolfaghari Digitally signed by Ali Zolfaghari DN: cn=Ali Zolfaghari, o=PPPL, ou=Engineering, email=azolfagh@pppl, o=PPPL, ou=FOM, email=msmith@pppl.gov, c=US Date: 2011.02.02 16:49:16 -05'00' George Labik Digitally

Princeton Plasma Physics Laboratory


Women's Basketball 2008-09 NOVEMBER Results  

E-Print Network (OSTI)

:30 W 77-49 14-- ORC State Tournament @ Lancaster Score Winner 1:00 OSU Mansfield vs. Miami Middletown 61-51 OU Zanesville 15-- ORC State Tournament @ Lancaster Winner 1:00 UC Clermont vs. OSU Mansfield Wayne 63-36 OU Lancaster 7:00 OU Zanesville vs. OSU-Newark/COTC 77-63 OSU Newark/COTC 21-- ORC State


Amde Querry : drogman en Perse au milieu du XIXe sicle Amde Querry est connu pour avoir pass au cours de la seconde moiti du XIX  

E-Print Network (OSTI)

Trébizonde. Ses traductions de larabe et du persan et ses travaux sur certains dialectes iraniens sont, dune plus grande exactitude possible, des oeuvres écrites en arabe ou en persan dans le monde chiite. De ce, destinés à devenir drogmans ou interprètes en arabe, en persan ou en turc et à servir les intérêts français

Paris-Sud XI, Université de


E-Print Network 3.0 - activity recall instrument Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

IN NEW DIGITAL MUSICAL DEVICES ? A CONTRIBUTION FROM COGNITIVE LINGUISTICS & PSYCHOLOGY Summary: on peut les dnommer outils ou instruments selon la prdominance de la...


E-Print Network 3.0 - ameliorer leur bilan Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Universit Paul Sabatier Collection: Mathematics 3 Maturation du genie logiciel au Quebec : ou en sommes-nous ? Summary: ameliorer la qualite et la productivite de leurs...


E-Print Network 3.0 - anseniformes ocorrido na Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

de maior intensidade e freqncia esto na periferia das placas tectnicas. O Brasil se situa numa... posio privilegiada, ou seja, na poro central da Placa...


E-Print Network 3.0 - algodoeiro cultivadas em Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

maio-ago. 2008 A cidade, um foco de diversidade agrcola no Rio Negro (Amazonas, Brasil)? Summary: vezes em baniwa ou lngua geral. Por plantas cultivadas, entendemos os...