National Library of Energy BETA

Sample records for grove padua arrow

  1. The arrow calculus 

    E-Print Network [OSTI]

    Lindley, Sam; Wadler, P.; Yallop, J.

    We introduce the arrow calculus, a metalanguage for manipulating Hughes's arrows with close relations both to Moggi's metalanguage for monads and to Paterson's arrow notation. Arrows arc classically defined by extending ...

  2. CONVERSIONE DEL PROPRIO CATALOGO IN PADUA@THESIS Padua@thesis (http://tesi.cab.unipd.it/) oltre ad essere un archivio che rende disponibili a testo

    E-Print Network [OSTI]

    Pettenella, Davide

    1 CONVERSIONE DEL PROPRIO CATALOGO IN PADUA@THESIS Padua@thesis (http://tesi.cab.unipd.it/) oltre ad essere un archivio che rende disponibili a testo pieno le tesi depositate ha anche funzione di catalogo delle tesi a stampa, consultabili presso le biblioteche, di cui fornisce i dati catalografici. Se

  3. Engine Driven Combined Heat and Power: Arrow Linen Supply, December...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Engine Driven Combined Heat and Power: Arrow Linen Supply, December 2008 Engine Driven Combined Heat and Power: Arrow Linen Supply, December 2008 This paper describes the Arrow...

  4. Pioneer Grove | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII JumpQuarterly SmartDB-2, Blue Mountain GeothermalPilgerPimaWind FarmI JumpGrove

  5. Fant's Grove Water System Clemson, SC

    E-Print Network [OSTI]

    Stuart, Steven J.

    requirements during 2002. Since we are only a distribution system, we do not actually filter or treat our water's Grove Water System is supplied by ARJWS, Hartwell Lake Filter Plant which draws its water from the U1 Fant's Grove Water System Clemson, SC 2002 Annual Water-Quality Report Clemson University

  6. Fant's Grove Water System Clemson, SC

    E-Print Network [OSTI]

    Stuart, Steven J.

    requirements during 2001. Since we are only a distribution system, we do not actually filter or treat our water is supplied by Duke Water Systems, Hartwell Lake Filter Plant which draws its water from the U.S. Army Corps1 Fant's Grove Water System Clemson, SC 2001 Annual Water-Quality Report Clemson University

  7. (Fuel Cells)(Fuel Cells) William Grove

    E-Print Network [OSTI]

    Chen, Yang-Yuan

    Fuel Cell #12; H2 O2 Power CH4 H2 Toyota H2 H2 #12; H2 ~253 #12; 2. 3. : 1. #12; #12;Fuel Cell #12; (Fuel Cells)(Fuel Cells) 1839 William Grove A H2O2 H2O2 2H; Fuel Cell #12;!! PEMFC DMFC SOFC (60~200) (60~100) (600~1000) #12; Proton

  8. There and Back Again Arrows for Invertible Programming

    E-Print Network [OSTI]

    van Eekelen, Marko

    There and Back Again Arrows for Invertible Programming Artem Alimarine Sjaak Smetsers Arjen van roll-backs may have to be performed. The goal of our work is to set up an arrow-based framework, because more code can be reused from the arrow library. Basically, one specifies the conversion in one

  9. Camp Grove Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia: Energy Resources Jump to: navigation, searchGrove

  10. John T. Groves Hugh Stott Taylor Chair of Chemistry

    E-Print Network [OSTI]

    Groves, John T.

    John T. Groves Hugh Stott Taylor Chair of Chemistry 231 New Frick Laboratory Department of Chemistry Princeton University Princeton, New Jersey 08544 Tel (609) 258-3593 E-mail: jtgroves@princeton.edu Web page: http://chemistry.princeton.edu/groves/ Professional Experience: 1988-1993 Chair, Department

  11. The Arrow Calculus as a Quantum Programming Language

    E-Print Network [OSTI]

    Juliana Kaizer Vizzotto; Andre Rauber Du Bois; Amr Sabry

    2009-04-10

    We express quantum computations (with measurements) using the arrow calculus extended with monadic constructions. This framework expresses quantum programming using well-understood and familiar classical patterns for programming in the presence of computational effects. In addition, the five laws of the arrow calculus provide a convenient framework for equational reasoning about quantum computations that include measurements.

  12. ARROW (Version 2) Commercial Software Validation and Configuration Control

    SciTech Connect (OSTI)

    HEARD, F.J.

    2000-02-10

    ARROW (Version 2), a compressible flow piping network modeling and analysis computer program from Applied Flow Technology, was installed for use at the U.S. Department of Energy Hanford Site near Richland, Washington.

  13. Fant's Grove Water System System No, SC390112

    E-Print Network [OSTI]

    Stuart, Steven J.

    a distribution system, we do not actually filter or treat our water and therefore depend on our water supplier University Water System is supplied by ARJWS, Hartwell Lake Filter Plant which draws its water from the U1 Fant's Grove Water System System No, SC390112 Clemson, SC 2004 Annual Water-Quality Report

  14. Fant's Grove Water System System No, SC390112

    E-Print Network [OSTI]

    Stuart, Steven J.

    a distribution system, we do not actually filter or treat our water and therefore depend on our water supplier University Water System is supplied by ARJWS, Hartwell Lake Filter Plant which draws its water from the U1 Fant's Grove Water System System No, SC390112 Clemson, SC 2003 Annual Water-Quality Report

  15. Final work plan : environmental site investigation at Sylvan Grove, Kansas.

    SciTech Connect (OSTI)

    LaFreniere, L. M.

    2012-07-15

    In 1998, carbon tetrachloride was found above the maximum contaminant level (MCL) of 5 {micro}g/L in groundwater from one private livestock well at Sylvan Grove, Kansas, by the Kansas Department of Health and Environment (KDHE). The 1998 KDHE sampling was conducted under the U.S. Department of Agriculture (USDA) private well sampling program. The Commodity Credit Corporation (CCC), a USDA agency, operated a grain storage facility in Sylvan Grove from 1954 to1966. Carbon tetrachloride is the contaminant of primary concern at sites associated with former CCC/USDA grain storage operations. Sylvan Grove is located in western Lincoln County, approximately 60 mi west of Salina (Figure 1.1). To determine whether the former CCC/USDA facility at Sylvan Grove is a potential contaminant source and its possible relationship to the contamination in groundwater, the CCC/USDA has agreed to conduct an investigation, in accordance with the Intergovernmental Agreement between the KDHE and the Farm Service Agency (FSA) of the USDA. This Work Plan presents historical data related to previous investigations, grain storage operations, local private wells and public water supply (PWS) wells, and local geologic and hydrogeologic conditions at Sylvan Grove. The findings from a review of all available documents are discussed in Section 2. On the basis of the analyses of historical data, the following specific technical objectives are proposed for the site investigation at Sylvan Grove: (1) Evaluate the potential source of carbon tetrachloride at the former CCC/USDA facility; (2) Determine the relationship of potential contamination (if present) at the former CCC/USDA facility to contamination identified in 1998 in groundwater samples from one private well to the west; and (3) Delineate the extent of potential contamination associated with the former CCC/USDA facility. The detailed scope of work is outlined in Section 3. The results of the proposed work will provide the basis for determining what future CCC/USDA actions may be necessary, with the ultimate goal of achieving classification of the Sylvan Grove site at no further action status. The proposed activities are to be performed on behalf of the CCC/USDA by the Environmental Science Division of Argonne National Laboratory, a nonprofit, multidisciplinary research center operated by the UChicago Argonne, LLC, for the U.S. Department of Energy. Argonne provides technical assistance to the CCC/USDA concerning environmental site characterization and remediation at former grain storage facilities. Argonne issued a Master Work Plan (Argonne 2002) that has been approved by the KDHE. The Master Work Plan describes the general scope of all investigations at former CCC/USDA facilities in Kansas and provides guidance for these investigations. That document should be consulted for the complete details of plans for work associated with the former CCC/USDA facility at Sylvan Grove.

  16. Franklin Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove, Illinois: Energy

  17. River Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, New York:Virginia:Riva, Maryland: Energy Resources JumpGrove,

  18. Pine Grove Mills, Pennsylvania: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open EnergyPhoenicia,Creek,PilgrimGrove Mills, Pennsylvania:

  19. Cottage Grove, Wisconsin: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans,Oregon:Volcano,CorsonCostaCottage Grove,

  20. Engine Driven Combined Heat and Power: Arrow Linen Supply, December 2008

    Broader source: Energy.gov [DOE]

    Presentation overview the arrow linen supply combined heat and power, its cost savings, success factors, and impacts

  1. Arrow Lakes Reservoir Fertilization Experiment, Technical Report 1999-2004.

    SciTech Connect (OSTI)

    Schindler, E.

    2007-02-01

    The Arrow Lakes food web has been influenced by several anthropogenic stressors during the past 45 years. These include the introduction of mysid shrimp (Mysis relicta) in 1968 and 1974 and the construction of large hydroelectric impoundments in 1969, 1973 and 1983. The construction of the impoundments affected the fish stocks in Upper and Lower Arrow lakes in several ways. The construction of Hugh Keenleyside Dam (1969) resulted in flooding that eliminated an estimated 30% of the available kokanee spawning habitat in Lower Arrow tributaries and at least 20% of spawning habitat in Upper Arrow tributaries. The Mica Dam (1973) contributed to water level fluctuations and blocked upstream migration of all fish species including kokanee. The Revelstoke Dam (1983) flooded 150 km of the mainstem Columbia River and 80 km of tributary streams which were used by kokanee, bull trout, rainbow trout and other species. The construction of upstream dams also resulted in nutrient retention which ultimately reduced reservoir productivity. In Arrow Lakes Reservoir (ALR), nutrients settled out in the Revelstoke and Mica reservoirs, resulting in decreased productivity, a process known as oligotrophication. Kokanee are typically the first species to respond to oligotrophication resulting from aging impoundments. To address the ultra-oligotrophic status of ALR, a bottom-up approach was taken with the addition of nutrients (nitrogen and phosphorus in the form of liquid fertilizer from 1999 to 2004). Two of the main objectives of the experiment were to replace lost nutrients as a result of upstream impoundments and restore productivity in Upper Arrow and to restore kokanee and other sport fish abundance in the reservoir. The bottom-up approach to restoring kokanee in ALR has been successful by replacing nutrients lost as a result of upstream impoundments and has successfully restored the productivity of Upper Arrow. Primary production rates increased, the phytoplankton community responded with a shift in species and zooplankton biomass was more favorable for kokanee. With more productive lower trophic levels, the kokanee population increased in abundance and biomass, resulting in improved conditions for bull trout, one of ALR's piscivorous species.

  2. Forest Grove, Oregon: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban Transport JumpFlowood,Pevafersa JV JumpWisconsin: EnergyGrove,

  3. Garden Grove, California: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky: Energy Resources Jump to:Garden Acres,Grove, California:

  4. Golden Grove, South Carolina: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County, Georgia: Energy Resources JumpGoldbeck SolarGrove, South

  5. Downers Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOEDixmont,Missouri:Dow ChemicalDowners Grove,

  6. Elk Grove Village, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH Jump to:Providence,NewInformationLabsKansas: Energy ResourcesGrove

  7. Maple Grove, Minnesota: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5TransportManitouChange | OpenMap ofGrove, Minnesota:

  8. Lake Grove, New York: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: EnergyKulpsville,LEDSGP/activitiesPlataLahendongSouthFlorida: Energy ResourcesGrove,

  9. Linn Grove, Iowa: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa: Energy Resources Jump to:

  10. Walnut Grove, California: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin FilmUnitedVairexVertVillageVitexWaco,Wales WindWalmartGrove,

  11. Beech Grove, Indiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental JumpInformation Beaufort County, SouthBeckerPark, Illinois:Cool Inc JumpGrove,

  12. Blooming Grove, Wisconsin: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental JumpInformationBio-Gas Technologies,BlackhawkBlauvelt,BloomBlooming Grove,

  13. The Arrow of Time Forbids a Positive Cosmological Constant $?$

    E-Print Network [OSTI]

    Laura Mersini-Houghton

    2007-04-20

    Motivated by the mounting evidence for dark energy, here we explore the consequences of a fundamental cosmological constant $\\Lambda$ for our universe. We show that when the gravitational entropy of a pure DeSitter state ultimately wins over matter, then the thermodynamic arrow of time in our universe must reverse in scales of order a Hubble time. We find that due to the dynamics of gravity and nonlocal entanglement, a finite size system such as a DeSitter patch with horizon size $H_0^{-1}$ has a finite lifetime $\\Delta t$. This phenomenon arises from the dynamic gravitational instabilities that develop during a DeSitter epoch and turn catastrophic. A reversed arrow of time is clearly in disagreement with observations. Thus we are led to conclude: Nature forbids a fundamental $\\Lambda$. Or else general relativity must be modified in the IR regime when $\\Lambda$ dominates the expansion of the Universe.

  14. Cabibbo-angle-favored, -suppressed, and -doubly-suppressed D r arrow PP and D r arrow VP decays in SU(3) symmetry with final-state interactions

    SciTech Connect (OSTI)

    Verma, R.C.; Kamal, A.N. (University of Alberta, Edmonton, (Canada). Theoretical Physics Institute University of Alberta, Edmonton, Alberta (Canada). Department of Physics)

    1991-02-01

    We have studied Cabibbo-angle-favored, -suppressed, and -doubly-suppressed {ital D}{r arrow}{ital PP} and {ital D}{r arrow}{ital VP} decays in a nonet-symmetry and a broken-nonet-symmetry scheme, with the inclusion of final-state-interaction phases. For {ital D}{r arrow}{ital VP} decays, the implications of sextet dominance are also investigated. In the discussion we have argued that the symmetry approach, as also the diagrammatic approach used by other authors, does not fare as well in describing {ital D}{r arrow}{ital VP} decays as the factorization approach, particularly in describing {ital B}({ital D}{sub {ital s}}{sup +}{r arrow}{omega}{pi}{sup +}), {ital B}({ital D}{sub {ital s}}{sup +}{r arrow}{phi}{pi}{sup +}), and {ital B}({ital D}{sub {ital s}}{sup +}{r arrow}{rho}{sup 0}{pi}{sup +}).

  15. Fan System Optimization Improves Production and Saves Energy at Ash Grove Cement Plant

    SciTech Connect (OSTI)

    2002-05-01

    This case study describes an optimization project implemented on a fan system at Ash Grove Cement Company, which led to annual energy and maintenance savings of $16,000 and 175,000 kilowatt-hours (kWh).

  16. Distributed Generation Study/Arrow Linen | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP)Displacement Transfer ZoneOpen EnergyArrow

  17. Quantum gravity, the origin of time and time's arrow

    SciTech Connect (OSTI)

    Moffat, J.W. (Univ. of Toronto, Ontario (Canada))

    1993-03-01

    The local Lorentz and diffeomorphism symmetries of Einstein's gravitational theory are spontaneously broken by a Higgs mechanism by invoking a phase transition in the early universe, at a critical temperature [Tc] below which the symmetry is restored. The spontaneous breakdown of the vacuum state generates an external time, and the wave function of the universe satisfies a time-dependent Schroedinger equation, which reduces to the Wheeler-deWitt equation in the classical regime for T<[Tc], allowing a semiclassical WKB approximation to the wave function. The conservation of energy is spontaneously violated for T>[Tc], and matter is created fractions of seconds after the big bang, generating the matter in the Universe. The time direction of the vacuum expectation value of the scalar Higgs field generates a time asymmetry, which defines the cosmological arrow of time and the direction of increasing entropy as the Lorentz symmetry is restored at low temperatures. 52 refs.

  18. The Universal Arrow of Time II: Quantum mechanics case

    E-Print Network [OSTI]

    Oleg Kupervasser

    2013-05-23

    This paper is a natural continuation of our previous paper arXiv:1011.4173 . We illustrated earlier that in classical Hamilton mechanics, for overwhelming majority of real chaotic macroscopic systems, alignment of their thermodynamic time arrows occurs because of their low interaction. This fact and impossibility to observe entropy decrease at introspection explain the second law of thermodynamics. The situation in quantum mechanics is even a little bit easier: all closed systems of finite volume are periodic or nearly periodic. The proof in quantum mechanics is in many respects similar to the proof in classical Hamilton mechanics - it also uses small interaction between subsystems and impossibility to observe entropy decrease at introspection. However, there are special cases which were not found in the classical mechanics. In these cases one microstate corresponds to a set of possible macrostates (more precisely, their quantum superposition). Consideration of this property with use of decoherence theory and taking into account thermodynamic time arrows will introduce new outcomes in quantum mechanics. It allows to resolve basic paradoxes of quantum mechanics: (a) to explain the paradox of wave packet reduction at measurements when an observer is included in the system (introspection) (paradox of the Schrodinger cat); (b) to explain unobservability of superposition of macroscopic states by an external observer in real experiments (paradox of Wigner's friend); (c) to prove full equivalence of multi-world and Copenhagen interpretations of quantum mechanics; (d) to explain deviations from the exponential law at decay of particles and pass from one energy level to another (paradox of a kettle which will never begin to boil).

  19. Arrow Lakes Reservoir Fertilization Experiment; Years 4 and 5, Technical Report 2002-2003.

    SciTech Connect (OSTI)

    Schindler, E.

    2007-02-01

    This report presents the fourth and fifth year (2002 and 2003, respectively) of a five-year fertilization experiment on the Arrow Lakes Reservoir. The goal of the experiment was to increase kokanee populations impacted from hydroelectric development on the Arrow Lakes Reservoir. The impacts resulted in declining stocks of kokanee, a native land-locked sockeye salmon (Oncorhynchus nerka), a key species of the ecosystem. Arrow Lakes Reservoir, located in southeastern British Columbia, has undergone experimental fertilization since 1999. It is modeled after the successful Kootenay Lake fertilization experiment. The amount of fertilizer added in 2002 and 2003 was similar to the previous three years. Phosphorus loading from fertilizer was 52.8 metric tons and nitrogen loading from fertilizer was 268 metric tons. As in previous years, fertilizer additions occurred between the end of April and the beginning of September. Surface temperatures were generally warmer in 2003 than in 2002 in the Arrow Lakes Reservoir from May to September. Local tributary flows to Arrow Lakes Reservoir in 2002 and 2003 were generally less than average, however not as low as had occurred in 2001. Water chemistry parameters in select rivers and streams were similar to previous years results, except for dissolved inorganic nitrogen (DIN) concentrations which were significantly less in 2001, 2002 and 2003. The reduced snow pack in 2001 and 2003 would explain the lower concentrations of DIN. The natural load of DIN to the Arrow system ranged from 7200 tonnes in 1997 to 4500 tonnes in 2003; these results coincide with the decrease in DIN measurements from water samples taken in the reservoir during this period. Water chemistry parameters in the reservoir were similar to previous years of study except for a few exceptions. Seasonal averages of total phosphorus ranged from 2.11 to 7.42 {micro}g/L from 1997 through 2003 in the entire reservoir which were indicative of oligo-mesotrophic conditions. Dissolved inorganic nitrogen concentrations have decreased in 2002 and 2003 compared to previous years. These results indicate that the surface waters in Arrow Lakes Reservoir were approaching nitrogen limitation. Results from the 2003 discrete profile series indicate nitrate concentrations decreased significantly below 25 {micro}g/L (which is the concentration where nitrate is considered limiting to phytoplankton) between June and July at stations in Upper Arrow and Lower Arrow. Nitrogen to phosphorus ratios (weight:weight) were also low during these months indicating that the surface waters were nitrogen deficient. These results indicated that the nitrogen to phosphorus blends of fertilizer added to the reservoir need to be fine tuned and closely monitored on a weekly basis in future years of nutrient addition. Phytoplankton results shifted during 2002 and 2003 compared to previous years. During 2002, there was a co-dominance of potentially 'inedible' diatoms (Fragilaria spp. and Diatoma) and 'greens' (Ulothrix). Large diatom populations occurred in 2003 and these results indicate it may be necessary to alter the frequency and amounts of weekly loads of nitrogen and phosphorus in future years to prevent the growth of inedible diatoms. Zooplankton density in 2002 and 2003, as in previous years, indicated higher densities in Lower Arrow than in Upper Arrow. Copepods and other Cladocera (mainly tiny specimens such as Bosmina sp.) had distinct peaks, higher than in previous years, while Daphnia was not present in higher numbers particularly in Upper Arrow. This density shift in favor to smaller cladocerans was mirrored in a weak biomass increase. In Upper Arrow, total zooplankton biomass decreased from 1999 to 2002, and in 2003 increased slightly, while in Lower Arrow the biomass decreased from 2000-2002. In Lower Arrow the majority of biomass was comprised of Daphnia throughout the study period except in 2002, while in Upper Arrow the total biomass was comprised of copepods from 2000-2003.

  20. B [right arrow] ([rho]/[omega]) [gamma] at BaBar

    E-Print Network [OSTI]

    Köneke, Karsten, 1978-

    2007-01-01

    This document describes the measurements of the branching fractions and isospin violations of the radiative electroweak penguin decays B [right arrow] ([rho]/[omega]) [gamma] at the asymmetric energy e+e- PEP-II collider ...

  1. Stimuli-Responsive Smart Gels Realized via Modular Protein Design Tijana Z. Grove,

    E-Print Network [OSTI]

    Regan, Lynne

    Stimuli-Responsive Smart Gels Realized via Modular Protein Design Tijana Z. Grove, Chinedum O 26, 2010; E-mail: lynne.regan@yale.edu Abstract: Smart gels have a variety of applications, including that permits the creation of protein-based smart gels with encoded morphology, functionality

  2. OAK GROVE C OAL D EGAS CEDAR COVE COAL D EGAS BLU E CREEK COAL DEGAS

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20, 20082008707 1OAK GROVE C OAL D

  3. 2008 ACEEE Summer Study on Energy Efficiency in Buildings August 1722, 2008 Asilomar Conference Center Pacific Grove, California

    E-Print Network [OSTI]

    Kissock, Kelly

    2008 ACEEE Summer Study on Energy Efficiency in Buildings August 17­22, 2008 · Asilomar Conference Center · Pacific Grove, California 1 Targeting Energy Efficiency in Commercial Buildings Using Advanced energy use, prioritizes buildings for specific energy-efficiency retrofits, and tracks weather

  4. The art of cross-writing in Grove Hall : two centuries of form and place-making in a Boston neighborhood

    E-Print Network [OSTI]

    Rosenzweig, Gilad J

    2013-01-01

    The Boston neighborhood of Grove Hall is presently engaged in a period of urban revival. New civic, commercial and residential projects are starting to fill in empty lots and rejuvenate historic yet dilapidated structures. ...

  5. PROCEEDINGS OF THE 1ST CONFERENCE ON NUCLEAR STRUCTURE DATA EVALUATION HELD IN CONJUNCTION WITH THE APS/DIVISION OF NUCLEAR PHYSICS FALL MEETING ASILOMAR CONFERENCE GROUNDS, PACIFIC GROVE, CA., OCT. 27-30, 1981.

    E-Print Network [OSTI]

    Firestone, R.B.

    2008-01-01

    forward to a second conference in the near future. RichardFall Meeting, Asilomar Conference Grounds, Pacific Grove,PROCEEDINGS OF THE FIRST CONFERENCE ON NUCLEAR STRUCTURE

  6. Symmetry and the arrow of time in theoretical black hole astrophysics

    E-Print Network [OSTI]

    David Garofalo

    2015-07-27

    While the basic laws of physics seem time-reversal invariant, our understanding of the apparent irreversibility of the macroscopic world is well grounded in the notion of entropy. Because astrophysics deals with the largest structures in the Universe, one expects evidence there for the most pronounced entropic arrow of time. However, in recent theoretical astrophysics work it appears possible to identify constructs with time-reversal symmetry, which is puzzling in the large-scale realm especially because it involves the engines of powerful outflows in active galactic nuclei which deal with macroscopic constituents such as accretion disks, magnetic fields, and black holes. Nonetheless, the underlying theoretical structure from which this accreting black hole framework emerges displays a time-symmetric harmonic behavior, a feature reminiscent of basic and simple laws of physics. While we may expect such behavior for classical black holes due to their simplicity, manifestations of such symmetry on the scale of galaxies, instead, surprise. In fact, we identify a parallel between the astrophysical tug-of-war between accretion disks and jets in this model and the time symmetry-breaking of a simple overdamped harmonic oscillator. The validity of these theoretical ideas in combination with this unexpected parallel suggests that black holes are more influential in astrophysics than currently recognized and that black hole astrophysics is a more fundamental discipline.

  7. ARGX-87: Accident Response Group Exercise, 1987: A Broken Arrow mini exercise. [Training

    SciTech Connect (OSTI)

    Schuld, E.P.; Cruff, D.F.

    1987-07-01

    A Broken Arrow mini exercise dubbed ''Accident Response Group Exercise - 1987'' (ARGX-87) was conducted on June 1, 1987 at the Lawrence Livermore National Laboratory (LLNL) and Sandia National Laboratories, Livermore (SNLL). The exercise started at 0445 PDT with a call from the Department of Energy (DOE) - EOC in Washington, DC, to the Albuquerque Operations (AL - ) - EOC. AL, in turn, called the Laboratory off-hour emergency number (Fire Dispatcher), who called the Laboratory Emergency Duty Officer (LEDO). The LEDO then contacted the Accident Response Group (ARG) Senior Scientific Advisor. Calls were placed to assemble appropriate members of the ARG in the ALERT Center. No phone number for SNLL was available at the Albuquerque Operations EOC, so a controller injected a message to SNLL to get them involved in the exercise. The messages received at the Laboratory identified the Air Force line item weapon system involved in the accident and the accident location. As people arrived at the ALERT Center they began discussing the details of the accident. They also started working the deployment logistics and other issues. Travel arrangements for the HOT SPOT equipment and ARG personnel were made for immediate deployment to the accident site in North Dakota. The exercise was terminated at 0840 as planned. While certain procedural deficiencies were noted, the exercise was considered a valuable learning experience. The results and observations from this experience will be used to refine the operating procedures and the training program.

  8. ACEEE 2000 Summer Study on Energy Efficiency in Buildings, Efficiency and Sustainability, August 20-25, 2000, Asilomar Conference Center, Pacific Grove, CA.

    E-Print Network [OSTI]

    LBNL-46376 CD-423 ACEEE 2000 Summer Study on Energy Efficiency in Buildings, Efficiency and Sustainability, August 20-25, 2000, Asilomar Conference Center, Pacific Grove, CA. The research reported here, California 94720 July 2000 #12;- 1 - Innovation Adoption Processes for Third Party Property Management

  9. To be presented at the 2000 ACEEE Summer Study on Energy Efficiency in Buildings, August 20-25, 2000, Pacific Grove, CA

    E-Print Network [OSTI]

    in commercial buildings, typically consuming nearly 40% of electric energy. By renovating older fluorescentLBNL-46009 L-220 To be presented at the 2000 ACEEE Summer Study on Energy Efficiency in Buildings, August 20-25, 2000, Pacific Grove, CA This work was supported by the Assistant Secretary for Energy

  10. Performance and evaluation of gas-engine-driven split-system cooling equipment at the Willow Grove Naval Air Station

    SciTech Connect (OSTI)

    Armstrong, P.R.; Schmelzer, J.R.

    1997-01-01

    DOE`s Federal Energy Management Program supports efforts to reduce energy use and associated expenditures within the federal sector; one such effort, the New Technology Demonstration Program (NTDP)(formerly the Test Bed Demonstration program), seeks to evaluate new energy saving US technologies and secure their more timely adoption by the federal government. This report describes the field evaluation conducted to examine the performance of a 15-ton natural-gas-engine- driven, split-system, air-conditioning unit. The unit was installed at a multiple-use building at Willow Grove Naval Air Station, a regular and reserve training facility north of Philadelphia, and its performance was monitored under the NTDP.

  11. Evaluation of water production in tight gas sands in the Cotton Valley formation in the Caspiana, Elm Grove and Frierson fields 

    E-Print Network [OSTI]

    Ozobeme, Charles Chinedu

    2007-04-25

    in the Elm Grove and Caspiana fields. 3 Fig. 1.2: Distribution of Cotton Valley Reservoirs across East Texas and North Louisiana. (Source - Collins 2 ) CV Lime Producing Trend. CV Blanket Sands . Good porosity and permeability..., no fracturing required. CV Massive Sands . Low permeability and porosity, require fracturing. CV Sand Fields. CV Lime Fields. 4 1.2 The Cotton Valley Formation in Northwest Louisiana The Cotton Valley formation is a tight gas sand play...

  12. RESEARCH www.rsc.org/cerp | Chemistry Education Research and Practice Making sense of the arrow-pushing formalism among chemistry majors

    E-Print Network [OSTI]

    Bodner, George M.

    RESEARCH www.rsc.org/cerp | Chemistry Education Research and Practice Making sense of the arrow-pushing formalism among chemistry majors enrolled in organic chemistry Robert Fergusona, * and George M. Bodnerb of a qualitative study of sixteen students enrolled in a second year organic chemistry course for chemistry

  13. Measurement of the dipion mass spectrum in the decay X(3872) [right arrow] J/ [psi] [pi]? [pi]? at the CDFII experiment

    E-Print Network [OSTI]

    Rakitin, Alexander (Alexander Yurevich)

    2005-01-01

    We present a measurement of the dipion mass spectrum in the decay X(3872) [right arrow] J/ [psi] [pi]? [pi]? using a 360 pb-1 sample of pp collisions at av [square root]s = 1.96 TeV collected with the CDF II detector at ...

  14. Test Plan for Lockheed Idaho Technologies Company (LITCO), ARROW-PAK Packaging, Docket 95-40-7A, Type A Container

    SciTech Connect (OSTI)

    Kelly, D.L.

    1995-10-23

    This report documents the U.S. Department of Transportation Specification 7A Type A (DOT-7A) compliance testing to be followed for qualification of the Lockheed Idaho Technologies Company, ARROW-PAK, for use as a Type A Packaging. The packaging configuration being tested is intended for transportation of radioactive solids, Form No. 1, Form No. 2, and Form No. 3.

  15. David Padua (Ed.) Encyclopedia of Parallel

    E-Print Network [OSTI]

    Scott, Michael L.

    threads load the same value before either stores it back, updates may be lost: c == 0 Thread 1: Thread 2. As a trivial example, con- sider a global counter incremented by multiple threads. Each thread loads the counter into a register, increments the register, and writes the updated value back to mem- ory. If two

  16. university of padua Faculty of Engineering

    E-Print Network [OSTI]

    Schenato, Luca

    Introduction 1 1.1 Purpose . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 1.2 Micro Electro-Mechanical System Devices . . . . . . . . . . . . . 2 1.3 Estimation velocity

  17. Performance and evaluation of gas engine driven rooftop air conditioning equipment at the Willow Grove (PA) Naval Air Station

    SciTech Connect (OSTI)

    Armstrong, P.R.; Conover, D.R.

    1993-05-01

    In a field evaluation conducted for the US Department of Energy (DOE) Office of Federal Energy Management Program (FEMP), the Pacific Northwest Laboratory (PNL) examined the performance of a new US energy-related technology under the FEMP Test Bed Demonstration Program. The technology was a 15-ton natural gas engine driven roof top air conditioning unit. Two such units were installed on a naval retail building to provide space conditioning to the building. Under the Test Bed Demonstration Program, private and public sector interests are focused to support the installation and evaluation of new US technologies in the federal sector. Participating in this effort under a Cooperative Research and Development Agreement (CRADA) with DOE were the American Gas Cooling Center, Philadelphia Electric Company, Thermo King Corporation, and the US Naval Air Station at Willow Grove, Pennsylvania. Equipment operating and service data as well as building interior and exterior conditions were secured for the 1992 cooling season. Based on a computer assessment of the building using standard weather data, a comparison was made with the energy and operating costs associated with the previous space conditioning system. Based on performance during the 1992 cooling season and adjusted to a normal weather year, the technology will save the site $6,000/yr in purchased energy costs. An additional $9,000 in savings due to electricity demand ratchet charge reductions will also be realized. Detailed information on the technology, the installation, and the results of the technology test are provided to illustrate the advantages to the federal sector of using this technology. A history of the CRADA development process is also reported.

  18. Final evaluation report for Lockheed Idaho Technologies Company, ARROW-PAK packaging, Docket 95-40-7A, Type A container

    SciTech Connect (OSTI)

    Kelly, D.L.

    1995-11-01

    The report documents the U.S. Department of Transportation Specification 7A Type A (DOT-7A) compliance test results of the ARROW-PAK packaging. The ARROW-PAK packaging system consists of Marlex M-8000 Driscopipe (Series 8000 [gas] or Series 8600 [industrial]) resin pipe, manufactured by Phillips-Driscopipe, Inc., and is sealed with two dome-shaped end caps manufactured from the same materials. The patented sealing process involves the use of electrical energy to heat opposing faces of the pipe and end caps, and hydraulic rams to press the heated surfaces together. This fusion process produces a homogeneous bonding of the end cap to the pipe. The packaging may be used with or without the two internal plywood spacers. This packaging was evaluated and tested in October 1995. The packaging configuration described in this report is designed to ship Type A quantities of solid radioactive materials, Form No. 1, Form No. 2, and Form No. 3.

  19. Test and evaluation report for Lockheed Idaho Technologies Company, arrow-pak packaging, docket 95-40-7A, type A container

    SciTech Connect (OSTI)

    Kelly, D.L.

    1996-03-14

    This report incorporates the U.S. Department of Energy, Office of Facility Safety Analysis (DOE/EH-32) approval letter for packaging use. This report documents the U.S. Department of Transportation Specification 7A Type A (DOT-7A) compliance test results of the Arrow-Pak packaging. The Arrow-Pak packaging system consists of Marlex M-8000 Driscopipe, manufactured by Phillips-Driscopipe, Inc., and is sealed with two dome-shaped end caps manufactured from the same materials. The patented sealing process involves the use of electrical energy to heat opposing faces of the pipe and end caps, and hydraulic rams to press the heated surfaces together. This fusion process produces a homogeneous bonding of the end cap to the pipe. The packaging may be used with or without the two internal plywood spacers. This packaging configuration described in this report is designed to ship Type A quantities of solid radioactive materials.

  20. pi. sup minus p r arrow. pi. sup 0. pi. sup 0 n near threshold and chiral symmetry breaking

    SciTech Connect (OSTI)

    Lowe, J.; Bassalleck, B.; Burkhardt, H.; Fickinger, W.J.; Hall, J.R.; Hasinoff, M.D.; Horvath, D.; Koch, G.; Larson, K.D.; Miller, J.P.; Noble, A.; Roberts, B.L.; Robinson, D.K.; Sakitt, M.; Sevior, M.E.; Tanner, N.W.; Waltham, C.E.; Warner, T.M.; Wolfe, D.M. (University of Birmingham, Birmingham, B152TT, United Kingdom Boston University, Boston, Massachusetts (USA) University of British Columbia, Vancouver, British Columbia (Canada) Brookhaven National Laboratory, Upton, New York (USA) Case Western Reserve University, Cleveland, Ohio (USA) Central Research Institute for Physics, Budapest (Hungary) University of New Mexico, Albuquerque, New Mexico (USA) University of Nottingham, Nottingham, NG72RD, United Kingdom Oxford University, Oxford, OX13RH, United Kingdom TRIUMF, Vancouver, British Columbia, Canada)

    1991-09-01

    Total cross sections, angular, and mass distributions for the reaction {pi}{sup {minus}}{ital p}{r arrow}{pi}{sup 0}{pi}{sup 0}{ital n} have been measured for {ital p}{sub {pi}}{sup {minus}}(lab)=7--140 MeV/{ital c} above threshold. The threshold amplitude was used to determine a value for the chiral-symmetry-breaking parameter, {xi}, of {minus}0.98{plus minus}0.52. The {pi}{pi} scattering lengths {ital a}{sub {ital I}} for isospin {ital I}=0 and 2 are derived from this result, together with a current-algebra sum rule. The results are {ital a}{sub 0}=(0.207{plus minus}0.028){ital m}{sub {pi}}{sup {minus}1} and {ital a}{sub 2}=({minus}0.022{plus minus}0.011){ital m}{sub {pi}}{sup {minus}1}. These values are consistent with chiral symmetry broken by the Weinberg {pi}{pi} interaction and the effects of the {ital f}{sub 0}(975) scalar meson.

  1. Lawrence Grove Oral History

    E-Print Network [OSTI]

    Grove, Lawrence; Miller, Timothy

    2009-09-23

    circuits. We had circuit riders. The genius of John Wesley, the founder of Methodism, always a member of the Church of England, never a member of the Methodist church, was one who had the practical skills of getting people organized so that they could do... might call “canned sermons”. Usually there was one sermon on salvation. There was one sermon on assurance, which was one of John Wesley?s very important concepts. There was another sermon on Christian living, living responsibly in most cases not using...

  2. Leslie Groves - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse Bergkamp GraduateResidentialLensless Imaging of WholeX-Ray

  3. General Groves takes charge

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article)ForthcomingGENERALProblems

  4. flow beneath the East Pacific Rise. Nature 402, 282285 (1999). 14. Grove, T. L., Kinzler, R. J. & Bryan, W. B. in Mantle Flow and Melt Generation at Mid-Ocean Ridges (eds

    E-Print Network [OSTI]

    1999-01-01

    flow beneath the East Pacific Rise. Nature 402, 282­285 (1999). 14. Grove, T. L., Kinzler, R. J. & Bryan, W. B. in Mantle Flow and Melt Generation at Mid-Ocean Ridges (eds Morgan, J. P., Blackman, D. K. Dick, H. J. B. in Magmatism in the Ocean Basins (eds Sounders, A. D. & Norry, M. J.) 71­105 (Geol. Soc

  5. ARROW-PAK Report

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (BillionProvedTravel Travel ThePresidentialofSubsurfacetoDepartmentEnergyExternal Technical

  6. Performance and evaluation of gas engine driven rooftop air conditioning equipment at the Willow Grove (PA) Naval Air Station. Interim report, 1992 cooling season

    SciTech Connect (OSTI)

    Armstrong, P.R.; Conover, D.R.

    1993-05-01

    In a field evaluation conducted for the US Department of Energy (DOE) Office of Federal Energy Management Program (FEMP), the Pacific Northwest Laboratory (PNL) examined the performance of a new US energy-related technology under the FEMP Test Bed Demonstration Program. The technology was a 15-ton natural gas engine driven roof top air conditioning unit. Two such units were installed on a naval retail building to provide space conditioning to the building. Under the Test Bed Demonstration Program, private and public sector interests are focused to support the installation and evaluation of new US technologies in the federal sector. Participating in this effort under a Cooperative Research and Development Agreement (CRADA) with DOE were the American Gas Cooling Center, Philadelphia Electric Company, Thermo King Corporation, and the US Naval Air Station at Willow Grove, Pennsylvania. Equipment operating and service data as well as building interior and exterior conditions were secured for the 1992 cooling season. Based on a computer assessment of the building using standard weather data, a comparison was made with the energy and operating costs associated with the previous space conditioning system. Based on performance during the 1992 cooling season and adjusted to a normal weather year, the technology will save the site $6,000/yr in purchased energy costs. An additional $9,000 in savings due to electricity demand ratchet charge reductions will also be realized. Detailed information on the technology, the installation, and the results of the technology test are provided to illustrate the advantages to the federal sector of using this technology. A history of the CRADA development process is also reported.

  7. Meaurement of the target single-spin asymmetry in quasi-elastic region from the reaction {sup 3}He{up_arrow}(e,e')

    SciTech Connect (OSTI)

    Zhang, Yawei

    2013-10-01

    A measurement of the inclusive target single-spin asymmetry has been performed using the quasi-elastic {sup 3}He{up_arrow}(e,e') reaction with a vertically polarized {sup 3}He target at Q{sup 2} values of 0.13, 0.46 and 0.97 GeV{sup 2}. This asymmetry vanishes under the one photon exchange assumption. But the interference between two-photon exchange and one-photon exchange gives rise to an imaginary amplitude, so that a non-zero A{sub y} is allowed. The experiment, conducted in Hall A of Jefferson Laboratory in 2009, used two independent spectrometers to simultaneously measure the target single-spin asymmetry. Using the effective polarization approximation, the neutron single-spin asymmetries were extracted from the measured {sup 3}He asymmetries. The measurement is to #12;establish a non-vanishing A{sub y}. Non-zero asymmetries were observed at all Q{sup 2} points, and the overall precision is an order of magnitude improved over the existing proton data. The data provide new constraints on Generalized Parton Distribution (GPD) models and new information on the dynamics of the two-photon exchange process.

  8. Measurement of single-target spin asymmetries in the electroproduction of negative pions in the semi-inclusive deep inelastic reaction n{up_arrow}(e,e'{pi}{sup -})X on a transversely polarized {sup 3}He target

    SciTech Connect (OSTI)

    Chiranjib Dutta

    2010-06-01

    The experiment E06010 measured the target single spin asymmetry (SSA) in the semiinclusive deep inelastic (SIDIS) n{up_arrow}(e, e'{pi}{sup -})X reaction with a transversely polarized {sup 3}He target as an e#11;ective neutron target. This is the very #12;rst independent measurement of the neutron SSA, following the measurements at HERMES and COMPASS on the proton and the deuteron. The experiment acquired data in Hall A at Je#11;erson Laboratory with a continuous electron beam of energy 5.9 GeV, probing the valence quark region, with x = 0.13 {rt_arrow} 0.41, at Q{sup 2} = 1.31 {rt_arrow} 3.1 GeV{sup 2}. The two contributing mechanisms to the measured asymmetry, viz, the Collins effect and the Sivers effect can be realized through the variation of the asymmetry as a function of the Collins and Sivers angles. The neutron Collins and Sivers moments, associated with the azimuthal angular modulations, are extracted from the measured asymmetry for the very #12;first time and are presented in this thesis. The kinematics of this experiment is comparable to the HERMES proton measurement. However, the COMPASS measurements on deuteron and proton are in the low-x region. The results of this experiment are crucial as the first step toward the extraction of quark transversity and Sivers distribution functions in SIDIS. With the existing results on proton and deuteron, these new results on neutron will provide powerful constraints on the transversity and Sivers distributions of both the u and d-quarks in the valence region.

  9. Summary - ARROW-PAK Container

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About Us Shirley Ann Jackson,Delivery and14 StrengtheningSuccess Stories|Sue

  10. The {ital T}{sub 1}({ital n}{pi}{asterisk}){l_arrow}{ital S}{sub 0} laser induced phosphorescence excitation spectrum of acetaldehyde in a supersonic free jet: Torsion and wagging potentials in the lowest triplet state

    SciTech Connect (OSTI)

    Liu, H.; Lim, E.C.; Munoz-Caro, C.; Nino, A.; Judge, R.H.; Moule, D.C.

    1996-08-01

    The laser induced {ital T}{sub 1}({ital n}{pi}{asterisk}){l_arrow}{ital S}{sub 0} phosphorescence excitation spectrum of jet-cooled acetaldehyde has been observed for the first time with a rotating slit nozzle excitation system. The vibronic origins were fitted to a set of levels that were obtained from a Hamiltonian that employed flexible torsion-wagging large amplitude coordinates. The potential surface extracted from the fitting procedure yielded barriers to torsion and inversion of 609.68 and 869.02 cm{sup {minus}1}, respectively. Minima in the potential hypersurface at {theta}=61.7{degree} and {alpha}=42.2{degree} defined the equilibrium positions for the torsion and wagging coordinates. A comparison to the corresponding {ital S}{sub 1}-state parameters showed that the torsion barrier (in cm{sup {minus}1}) does not greatly change, {ital S}{sub 1}/{ital T}{sub 1}=710.8/609.7, whereas the barrier height for the wagging-inversion barrier increases dramatically, 574.4/869.0. {copyright} {ital 1996 American Institute of Physics.}

  11. Wilders Grove Solid Waste Services Center

    Broader source: Energy.gov [DOE]

    Project objective: Provide demonstration of Geothermal Heat Pumps viability on energy usage for future Service Centers planned by the City of Raleigh and other similar facilities in the southeast.

  12. Allen W. Groves Associate Vice President

    E-Print Network [OSTI]

    Reidenbach, Matthew A.

    Isbell Program Coordinator Vacant Directorof Student Activities Kendra Paisley Assistant Director Alyssa

  13. Manhattan Project: Groves and the MED, 1942

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy ofArticle)SciTechNorris Bradbury, RobertTheEntranceExcerpt from

  14. Grove Theatre | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Lowï‚— WeUpdate Jon Peschong Richland5 EOCGrove Theatre

  15. ARROW-PAK | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s sconveyance of fourProjectGrantee

  16. Willow Grove, Pennsylvania: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEtGeorgia:Illinois: Energy Resources Jump to:Willoughby, Ohio:Montana:

  17. Vine Grove, Kentucky: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin,Village of Wellington, Ohio (Utility Company)

  18. Washington Grove, Maryland: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin,VillageWarren Park,| Open Energy InformationWGES) Jump

  19. Twin Groves Wind Energy Facility Cut-in Speeds

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Karin Sinclair (National Renewable Energy Laboratory), Christy Johnson-Hughes (U.S. Fish and Wildlife Service), and Laurie K. Allen (U.S. Geological Survey) for providing...

  20. Grove School of Engineering Office of Student Development

    E-Print Network [OSTI]

    Sun, Yi

    to recruit a highly- qualified and diverse entering freshman class through pipeline relationships with New are at-risk (close to being placed on academic probation) and those who are not in good academic standing

  1. OxfordMusicOnline (GroveMusicOnline)

    E-Print Network [OSTI]

    and links on the left-hand side: Search terms are highlighted in yellow. A "Search within this article under the call number ML102.J3 N48 2001. Enter keyword(s) in either open field and click the box or choose Advanced Search links for more options, such as combining keywords. From the opening screen

  2. Sugar Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for the Entire Country |Illinois: Energy Resources

  3. Sugar Grove, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for the Entire Country |Illinois: Energy

  4. Grove City, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformation Crump's

  5. Green Grove, Wisconsin: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County, Georgia:Oregon:Corp Jump to: navigation,World GmbH Jump

  6. Elk Grove, California: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH Jump to:Providence,NewInformationLabsKansas: Energy

  7. Elm Grove, Wisconsin: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH JumpEllenville, New York: Energy Resources JumpNew Hampshire:

  8. Morton Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation MontanaOhio:Hill,Morrisville, New York:Morse,Morton

  9. Loxahatchee Groves, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon:Lowell Point, Alaska: EnergyLowville, New York:

  10. Leland Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona: EnergyLebanon County,LefloreInformation East, NewVillage,

  11. Lemon Grove, California: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona: EnergyLebanon County,LefloreInformation East,Lemhi

  12. Pingree Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | OpenBethlehem Biomass Facility JumpPineview,Piney

  13. Pleasant Grove, Utah: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | OpenBethlehemPlainsboroPlastic

  14. Oak Grove, Oregon: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPI VenturesNewSt. Louis, Minnesota:Nulato,Nyack, - MiningBrook,Oregon: Energy

  15. Pecan Grove, Texas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio Program |ViewIllinois: Energy ResourcesPebble Creek,

  16. City of Grove City, Minnesota (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLCLtdEllsworth, IowaGraettinger, IowaIowa (UtilityGroton,

  17. Twin Groves Wind Energy Facility Cut-in Speeds

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing ToolInternational Affairs,Department ofARPA-E TopDepartmentTribalSYNTHESIS OF OPERATIONAL

  18. Twin Groves I Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin Film SolarTown(LECBP) | OpenTrackI Wind Farm Jump to:

  19. Twin Groves II (07) Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin Film SolarTown(LECBP) | OpenTrackI Wind Farm Jump to:7) Wind

  20. Twin Groves II (08) Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin Film SolarTown(LECBP) | OpenTrackI Wind Farm Jump to:7) Wind8)

  1. Buffalo Grove, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank, Maine: EnergyEnergyOhio: Energy ResourcesSiliconBiomassWisconsin:

  2. Manhattan Project: Leslie Groves and J. Robert Oppenheimer

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report:Speeding accessby aLED Street LightingFrom theHighI _s - "U N C- . .

  3. Cedar Grove, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank,CammackFLIR Jump to:RAPIDCavallo Energy Jump to:Iowa: EnergyCrest,West,

  4. Cedar Grove, New Mexico: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank,CammackFLIR Jump to:RAPIDCavallo Energy Jump to:Iowa:

  5. Cedar Grove, West Virginia: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank,CammackFLIR Jump to:RAPIDCavallo Energy Jump to:Iowa:West Virginia: Energy

  6. City of Spring Grove, Minnesota (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company) Jump to: navigation, searchSeymour City

  7. Forest Grove Light & Power - Energy Efficiency Rebate Programs | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nA Guide to Tapping into Funding forFY'17and AccountabilityCostForeignSaultof

  8. Maple Grove Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios TowardsInformation Reducing theMassachusetts:PageMap ofMaple

  9. Borough of Grove City, Pennsylvania (Utility Company) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin:Pontiac BiomassInformation Catawissa,

  10. EcoGrove Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower VenturesInformation9)askDoubleEERESoda LakeEcho 1-7EcoComposite

  11. City of Forest Grove, Oregon (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla,ThermalCuba City, Wisconsin (Utility Company)CityCityCity of

  12. City of Long Grove, Iowa (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla,ThermalCuba City,(Redirected from CityLivermore, Iowa

  13. Oak Grove, Texas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to:Information 3rd|Northfork ElectricName0 Jump to:Oahu,Wind

  14. General Groves and Ernest O. Lawrence visit 9731

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article)ForthcomingGENERALProblems ISecurityGeneAccountingNuclearand

  15. Lilienthal and Groves comments on CEW transfer to AEC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and-E C H2015Tray and EnclosureLilienthal and

  16. A measurement of the neutron magnetic form factor Gn?M? form quasi-elastic ²[right arrow]H ([right arrow]e, e') at low Q²

    E-Print Network [OSTI]

    Meitanis, Nikolas (Nikolas C.)

    2006-01-01

    The neutron magnetic form factor GnM has been measured using the inclusive electro-disintegration 2H(e, e') of the deuteron for the first time. The longitudinally polarized electron beam of the MIT-Bates Linear Accelerator ...

  17. Performance Portability with the Chapel Language Albert Sidelnik, Saeed Maleki, Bradford L. Chamberlain, Maria J. Garzaran, David Padua

    E-Print Network [OSTI]

    Garzarán, María Jesús

    GPU accelerator architectures, have become increasingly popular. This popularity has been driven- geneous systems containing GPU accelerator components, while retaining performance and portability across and multicore platforms. I. INTRODUCTION In the last few years, systems of heterogeneous compo- nents, including

  18. Classical Lie Algebra Weight Systems of Arrow Diagrams Louis Leung

    E-Print Network [OSTI]

    Bar-Natan, Dror

    . Especially I would like to thank Professor George Elliott for his donation to the OGSST, through which I parents Thomas and Kit Ching, my brother Sammy), for their care and support which I can always count on

  19. The Origin of the Universe and the Arrow of Time

    ScienceCinema (OSTI)

    Carroll, Sean

    2010-01-08

    Over a century ago, Boltzmann and others provided a microscopic understanding for the tendency of entropy to increase. But this understanding relies ultimately on an empirical fact about cosmology: the early universe had very low entropy. Why was it like that? Cosmologist aspire to provide a dynamical explanation for the observed state of the universe, but have had very little to say about the dramatic asymmetry between early times and late times. I will argue that the search for a natural explanation for the observed breakdown of time-reversal symmetry in cosmology leads us directly to interesting conclusions about inflation, quantum gravity, and the multiverse.

  20. The arrow of time, complexity and the scale free analysis

    E-Print Network [OSTI]

    Dhurjati Prasad Datta; Santanu Raut

    2010-01-10

    The origin of complex structures, randomness, and irreversibility are analyzed in the scale free SL(2,R) analysis, which is an extension of the ordinary analysis based on the recently uncovered scale free $C^{2^n-1}$ solutions to linear ordinary differential equations. The role of an intelligent decision making is discussed. We offer an explanation of the recently observed universal renormalization group dynamics at the edge of chaos in logistic maps. The present formalism is also applied to give a first principle explanation of 1/$f$ noise in electrical circuits and solid state devices. Its relevance to heavy tailed (hyperbolic) distributions is pointed out.

  1. Emergence of randomness and arrow of time in quantum walks

    E-Print Network [OSTI]

    Shikano, Yutaka

    Quantum walks are powerful tools not only for constructing the quantum speedup algorithms but also for describing specific models in physical processes. Furthermore, the discrete time quantum walk has been experimentally ...

  2. White Arrow Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw,What Is a Small Community WindWhere is DBWind FarmWhite

  3. Broken Arrow, Oklahoma: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank, Maine: Energy ResourcesCounty,Wisconsin:RiverBroadwindEnterprises

  4. Energy dependence of spin effects in p/sub up-arrow/+p/sub up-arrow/->p+p

    SciTech Connect (OSTI)

    Court, G.R.; Crabb, D.G.; Gialas, I.; Khiari, F.Z.; Krisch, A.D.; Lin, A.M.T.; Raymond, R.S.; Raylman, R.R.; Roser, T.; Terwilliger, K.M.

    1986-08-04

    We measured the analyzing power A and the spin-spin correlation parameter A/sub n//sub n/, in large-P/sub perpendicular//sup 2/ proton-proton elastic scattering, using a polarized-proton target and the polarized-proton beam at the Brookhaven Alternating-Gradient Synchrotron. We also used our polarimeter to measure A at small P/sub perpendicular//sup 2/ at 13 GeV with good precision and found some deviation from the expected 1/P/sub lab/ behavior. At 18.5 GeV/c we found A/sub n//sub n/ = (-2 +- 16)% at P/sub perpendicular//sup 2/ = 4.7 (GeV/c)/sup 2/. Comparison with lower-energy data from the Argonne Zero-Gradient Synchrotron shows a sharp and surprising energy dependence for A/sub n//sub n/ at large P/sub perpendicular//sup 2/.

  5. QTYUIOPNATIONAL FUSION FACILITY DIII-D National Fusion Program

    E-Print Network [OSTI]

    . (Goteberg, Sweden) CFN-IST (Lisbon, Portugal) CIEMAT (Madrid, Spain) Consorzia RFX (Padua, Italy) Culham

  6. Automatic Generation and Management of Program Analyses Kwangkeun Yi

    E-Print Network [OSTI]

    Yi, Kwangkeun "Kwang"

    , David Kuck, Dennis Mickunas, and David Padua. I thank Samuel Kamin for several suggestions about my

  7. Polaris: Improving the E ectiveness of Parallelizing William Blume, Rudolf Eigenmann, Keith Faigin, John Grout, Jay Hoe inger, David Padua, Paul

    E-Print Network [OSTI]

    Padua, David

    machine-speci c features and language elements. These issues make the discipline of supporting standard Rauchwerger, Peng Tu and Stephen Weatherford Center for Supercomputing Research and Development Coordinated Introduction Supporting standard programming languages on any kind of computer system is and has been an im

  8. Measurement of spin effects in p/sub up-arrow/+p/sub up-arrow/. -->. p+p at 18. 5 GeVc

    SciTech Connect (OSTI)

    Crabb, D.G.; Gialas, I.; Krisch, A.D.; Lin, A.M.T.; Peaslee, D.C.; Phelps, R.A.; Raymond, R.S.; Roser, T.; Stewart, J.A.; Terwilliger, K.M.; and others

    1988-06-06

    We measured the analyzing power A and the spin-spin correlation parameter A/sub n//sub n/ in medium-P/sub perpendicular//sup 2/ proton-proton elastic scattering, using a polarized-proton target and the 18.5-GeVc Brookhaven Alternating-Gradient Synchrotron polarized-proton beam. We found sharp dips in both A and A/sub n//sub n/, which occur at different P/sub perpendicular//sup 2/ values. The unexpected sharp structure in the spin-spin force occurs near P/sub perpendicular//sup 2/ = 2.3 (GeVc)/sup 2/ where the elastic cross section has no apparent structure.

  9. Measurement of p/sub arrow-up/+p/sub arrow-up/. -->. p+p with a 16. 5-GeV/c polarized proton beam

    SciTech Connect (OSTI)

    Brown, K.A.; Bruni, R.J.; Cameron, P.R.; Crabb, D.G.; Cummings, R.L.; Khiari, F.Z.; Krisch, A.D.; Lin, A.M.T.; Raymond, R.S.; Roser, T.; Terwilliger, K.M.; Danby, G.T.; Ratner, L.G.; Peaslee, D.C.; O'Fallon, J.R.; Roberts, J.B.; Bhatia, T.S.; Northcliffe, L.C.; Simonius, M.

    1985-06-01

    Using the new Brookhaven Alternating Gradient Synchrotron polarized proton beam and our polarized proton target, we measured the spin-spin correlation parameter A/sub n/n in 16.5-GeV/c proton-proton elastic scattering. We found an A/sub n/n of (6.1 +- 3.0)% at P/sub perpendicular/ /sup 2/ = 2.2 (GeV/c)/sup 2/. We also measured the analyzing power A in two independent ways, providing a good test of possible experimental errors. Comparing our new data with 12-GeV Argonne Zero Gradient Synchrotron data shows no evidence for strong energy dependence in A/sub n/n in this medium-P/sub perpendicular/ /sup 2/ region.

  10. Forward Angle Analyzing Power in (P)over-Right-Arrow-N and (P)over-Right-Arrow-P Quasi-Free Scattering at 643 and 797 Mev 

    E-Print Network [OSTI]

    Glass, G.; Bhatia, T. S.; Hiebert, John C.; Kenefick, R. A.; Nath, S.; Northcliffe, L. C.; Tippens, W. B.; Simmons, J. E.

    1993-01-01

    . Scintillators S1 and S2 (of thickness 1.6 and 6.4 mm, respectively) gave time-of-flight information over a 3.8-m path, which was used to distinguish protons from other particles (deute- rons and pions) in the spectrometer. When multiple- scattering effects...'s, W5 and W6, two large scintillator planes R and V, of thick- ness 6.4 mm, and a scintillator hodoscope neutron bar counter (NBC). The planes R and V are made from adja- cent scintillator paddies (three for R and four for V), each of height 100 cm...

  11. 11/12 ANNUAL REPORT . THE GROVE SCHOOL OF ENGINEERING THE FUTURE IS ENGINEERED HERE

    E-Print Network [OSTI]

    Sun, Yi

    's rigorous STEM programs. A good deal of energy this year was focused on expanding international educational consortium, to provide research and study From the Dean #12;abroad opportunities for our students. Our faculty is developing contacts around the world, leading to research projects and articulation agreements

  12. Marty Grove B.S., Department of Geology, California State University, Long Beach, 1983

    E-Print Network [OSTI]

    California at Los Angeles, University of

    histories of a sandstone petroleum reservoir, Elk Hills, California. Part 1: 40 Ar/39 Ar thermal history

  13. DOE Zero Energy Ready Home Case Study: Weiss Building & Development, Downers Grove, Illinois

    SciTech Connect (OSTI)

    none,

    2013-09-01

    This single-family home built in a peat bog has underground storage tanks and drainage tanks, blown fiberglass insulation, coated rigid polyisocyanurate, and flashing. The 3,600-square-foot custom home built by Weiss Building & Development LLC is the first home in Illinois certified to the DOE Challenge Home criteria, which requires that homes meet the EPA Indoor airPlus guidelines.The builder won a 2013 Housing Innovation Award in the custom builder category.

  14. Radiological Survey Data for 38 Grove Avenue, Rochelle Park, l'lew Jersey

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the t-) S/,,5 'a C O M1 the RFSOGorPLEASE5 R A DY-t7sEP

  15. The Round Robin Program: Ground Motion in the Vicinity of the Grove Event

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference)FeedbackProperties ofThe Maximum ValueSciTech(Technical Report) |

  16. Joseph M. Groves | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATIONIntroducingJobs HumanImaging NSRCJordiJoseph Cerny,

  17. Pontotoc Co. Greene Co. Hale Co. OAK GROVE C OAL D EGAS CEDAR COVE

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets160 October 2015 Table 44. PAD075 October

  18. Pontotoc Co. Greene Co. Hale Co. OAK GROVE C OAL D EGAS CEDAR COVE COAL DEGAS

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets160 October 2015 Table 44. PAD075

  19. Real wavepacket code for ABC + D {r_arrow} AB + CD reactive scattering.

    SciTech Connect (OSTI)

    Mayneris, J.; Gonzalez, M.; Gray, S. K.; Chemical Sciences and Engineering Division; Univ. de Barcelona

    2008-09-01

    We discuss a six-dimensional, time-dependent real wavepacket (RWP) code designed to obtain reaction probabilities for ABC(v{sub I}) + D {yields} AB + CD four-atom reactions, where v{sub I} is a collective index for the initial quantum state of the triatomic molecule. The code provides exact results for total angular momentum J = 0, and invokes the helicity decoupling (or centrifugal sudden) approximation for J > 0. Our new RWP code has been extensively checked by considering the benchmark H + H{sub 2}O {yields} H{sub 2} + OH abstraction reaction.

  20. Broken Arrows: Radiological hazards from nuclear warhead accidents (the Minot USAF base nuclear weapons incident)

    E-Print Network [OSTI]

    Liolios, Theodore

    2009-01-01

    According to numerous press reports, in 2007 at Minot US Air Force Base six AGM-129 Advanced Cruise Missiles mistakenly armed with W80-1 thermonuclear warheads were loaded on a B-52H heavy bomber in place of six unarmed AGM-129 missiles that were awaiting transport to Barksdale US Air Force Base for disposal. The live nuclear missiles were not reported missing, and stood unsecured and unguarded while mounted to the aircraft for a period of 36 hours. The present work investigates the radiological hazards associated with a worst-case postulated accident that would disperse the nuclear material of the six warheads in large metropolitan cities. Using computer simulations approximate estimates are derived for the ensuing cancer mortality and land contamination after the accident. Health, decontamination and evacuation costs are also estimated in the framework of the linear risk model.

  1. Beyond blue and red arrows : optimizing natural ventilation in large buildings

    E-Print Network [OSTI]

    Meguro, Wendy (Wendy Kei)

    2005-01-01

    Our growing understanding of technology and environment has expanded the complexities of producing large naturally ventilated buildings. While it may be argued that designing for natural ventilation is a straightforward, ...

  2. Famine as a Function of Empire in Arrow of God and Star of the Sea

    E-Print Network [OSTI]

    Conley, Erin B.

    2010-05-22

    colonies (Vernon 6-7), and while its colonies experienced numerous devastating famines throughout the nineteenth century, people in Britain itself enjoyed increased calorific intake from the introduction of cheap foods like sugar from outlying colonies... in mass starvation. 3 Given the role that colonial powers played in the creation and exacerbation of numerous famines across the globe during the nineteenth and twentieth centuries, it is surprising that famine has not been as extensively...

  3. Radiative corrections to [Gamma]([ital Z][r arrow][ital b[bar b

    SciTech Connect (OSTI)

    Kundu, A.; Raychaudhuri, S.; De, T.; Dutta-Roy, B. (Theory Group, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Calcutta-700064 (India))

    1994-12-01

    Isodoublet color-octet scalar bosons appear in the low-energy limit of a natural extension of the standard model in which the electroweak symmetry is broken by a [ital t[bar t

  4. Contemporizing Performance: Mexican California and the Pádua Hills Theatre

    E-Print Network [OSTI]

    Arrizón, Alicia

    1993-01-01

    The Padua Hills Theatre ÁGUILA-NOPAL EAGLE AND CACTUS THE FEnotes of "Águila y Nopal. "Padua Hills Theatre Collection atAmador directed Águila y nopal (Eagle and Cactus, Figure

  5. The good lake, the possible sea : ethics and environment in Northern Vanuatu

    E-Print Network [OSTI]

    Wescott, Jeffrey

    2012-01-01

    resurgence of murder by poison arrow (Armstrong 1900:218;connection. They Codrington (2005) describes both poison andnon-poison arrows used in the Banks Islands. Poison arrows

  6. Root health of HLB-affected groves: What are the issues and how can we manage them?

    E-Print Network [OSTI]

    Ma, Lena

    before harvest sugars move from the leaves into the fruit such that the Brix and the sugar:acid ratio measured a 45% reduction in fibrous roots for HLB+ trees compared to HLB- #12;Soil pH and well water in the wetted zone · Soil pH >6.5 and/or well water with bicarbonate (>100 ppm) are associated with >HLB

  7. Oil transport inside the oil control ring grove and its interaction with surrounding areas in internal combustion engines

    E-Print Network [OSTI]

    Senzer, Eric B

    2012-01-01

    In piston ring pack design, there is a tradeoff between reducing friction and increasing oil consumption. While friction reduces engine efficiency, oil consumption can poison exhaust aftertreatment systems. The primary ...

  8. City of Raleigh, Wilders Grove Service Center Solid Waste Services Facility Final Report, Department of Energy, DOE Grant EE0002808

    SciTech Connect (OSTI)

    Cox, P.E., Robert; Black, P.E., Bill; Battle, Fred

    2015-07-22

    Final Report for DOE Grant EE0002808. Grant award was for technology demonstration of geothermal energy systems.

  9. DOE Zero Energy Ready Home Case Study 2013: Weiss Building & Development, LLC., Custom Home, Downer Grove, IL

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 2015 GATEWAY Takes 9.New Town Builders Denver,TCLLC Custom

  10. Measurement of longitudinal double spin asymmetries of [pi]+/- production in p[over-arrow] + p[over-arrow] collisions at [sqrt]s = 200 GeV at RHIC

    E-Print Network [OSTI]

    Kocoloski, Adam (Adam Philip)

    2010-01-01

    Spin dependent measurements provide incisive tests for modern theories of particle physics. The discovery that the integral of the quark helicity distribution is much too small to account for the spin of the proton is an ...

  11. HOPKINS MARINE STATION 2014 Safety, Security, and Fire Report

    E-Print Network [OSTI]

    Kay, Mark A.

    : 120 Ocean View Boulevard Pacific Grove Police Department Pacific Grove, CA 93950-3094 580 Pine Avenue Telephone: (831) 655-6200 Pacific Grove, CA 93950 E-mail: information@marine.stanford.edu Telephone: (831 the jurisdiction of the Pacific Grove Police Department. They are located at 580 Pine Avenue, Pacific Grove, CA

  12. Fermi Large Area Telescope Constraints on the Gamma-ray Opacity...

    Office of Scientific and Technical Information (OSTI)

    Dept. IASF, Milan Padua U. AIM, Saclay ASDC, Frascati INFN, Perugia Perugia U. NASA, Goddard NASA, Goddard CRESST, Greenbelt CSST, Baltimore SLAC KIPAC, Menlo Park...

  13. Gamma-Ray Emission Concurrent with the Nova in the Symbiotic...

    Office of Scientific and Technical Information (OSTI)

    Menlo Park SLAC IASF, Milan Padua U. DAPNIA, Saclay INFN, Perugia Perugia U. NASA, Goddard NASA, Goddard Maryland U., Baltimore County KIPAC, Menlo Park SLAC...

  14. Fermi Observations of GRB 090510: a Short Hard Gamma-Ray Burst...

    Office of Scientific and Technical Information (OSTI)

    Dept. IASF, Milan IASF, Milan Padua U. DAPNIA, Saclay INFN, Perugia Perugia U. NASA, Goddard NASA, Goddard Maryland U., Baltimore County Stanford U., HEPL KIPAC, Menlo...

  15. DEPOSITION OF NIOBIUM AND OTHER SUPERCONDUCTING MATERIALS WITH HIGH POWER IMPULSE MAGNETRON SPUTTERING: CONCEPT AND FIRST RESULTS

    E-Print Network [OSTI]

    Anders, Andre

    2013-01-01

    Workshop on RF Superconductivity, DESY, Hamburg, Germany,Gennaro, Physica C: Superconductivity 441 (2006) 130. [10]the Limits of RF Superconductivity, Padua, Italy, 2010. [12

  16. Universe Abdo, A.A.; /Naval Research Lab, Wash., D.C. /Natl....

    Office of Scientific and Technical Information (OSTI)

    Dept. IASF, Milan Padua U. AIM, Saclay ASDC, Frascati INFN, Perugia Perugia U. NASA, Goddard NASA, Goddard CRESST, Greenbelt CSST, Baltimore SLAC KIPAC, Menlo Park...

  17. Supporting Photovoltaics in Market-Rate Residential New Construction: A Summary of Programmatic Experience to Date and Lessons Learned

    E-Print Network [OSTI]

    Barbose, Galen; Wiser, Ryan; Bolinger, Mark

    2006-01-01

    Study on Energy Efficiency in Buildings. Pacific Grove, CA:Study on Energy Efficiency in Buildings. Pacific Grove, CA:Study on Energy Efficiency in Buildings. Pacific Grove, CA:

  18. Summary and early findings from a second generation information monitoring and diagnostic system

    E-Print Network [OSTI]

    Piette, Mary Ann; Kinney, Satkartar; Bourassa, Norman; Kinney, Kristopher L.; Shockman, Christine

    2003-01-01

    Study on Energy Efficiency in Buildings, Pacific Grove, CA,Study on Energy Efficiency in Buildings, Pacific Grove, CA,Study on Energy Efficiency in Buildings, Pacific Grove, CA,

  19. Early evaluation of a second generation information monitoring and diagnostic system

    E-Print Network [OSTI]

    2002-01-01

    Study on Energy Efficiency in Buildings, Pacific Grove, CA,Study on Energy Efficiency in Buildings, Pacific Grove, CA,Study on Energy Efficiency in Buildings, Pacific Grove, CA,

  20. Dynamic Controls for Energy Efficiency and Demand Response: Framework Concepts and a New Construction Study Case in New York

    E-Print Network [OSTI]

    Kiliccote, Sila; Piette, Mary Ann; Watson, David S.; Hughes, Glenn

    2006-01-01

    Study on Energy Efficiency in Buildings. Pacific Grove, CA.Study on Energy Efficiency in Buildings. Pacific Grove, CA.Study on Energy Efficiency in Buildings, Pacific Grove, CA,

  1. Standby power use: How big is the problem? What policies and technical solutions can address it?

    E-Print Network [OSTI]

    2002-01-01

    Study on Energy Efficiency in Buildings, Pacific Grove CA.Study on Energy Efficiency in Buildings. Pacific Grove CA.Study on Energy Efficiency in Buildings, Pacific Grove CA.

  2. Participation through Automation: Fully Automated Critical Peak Pricing in Commercial Buildings

    E-Print Network [OSTI]

    Piette, Mary Ann; Watson, David S.; Motegi, Naoya; Kiliccote, Sila; Linkugel, Eric

    2006-01-01

    Study on Energy Efficiency in Buildings. Pacific Grove, CA.Study on Energy Efficiency in Buildings. Pacific Grove, CA.Study on Energy Efficiency in Buildings, Pacific Grove, CA,

  3. Comparison of Demand Response Performance with an EnergyPlus Model in a Low Energy Campus Building

    E-Print Network [OSTI]

    Dudley, Junqiao Han

    2010-01-01

    Study of Energy Efficiency in Buildings, Pacific Grove, CA,Study of Energy Efficiency in Buildings, Pacific Grove, CA,Study of Energy Efficiency in Buildings, Pacific Grove, CA,

  4. Evaluating a Social Media Application for Conserving Energy and Improving Operations in Commercial Buildings

    E-Print Network [OSTI]

    Lehrer, David R.; Vasudev, Janani; Kaam, Soazig

    2012-01-01

    Study on Energy Efficiency in Buildings, Pacific Grove, CA,Study on Energy Efficiency in Buildings, Pacific Grove, CA,Study on Energy Efficiency in Buildings, Pacific Grove, CA,

  5. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Tankless Water Heater, Commercial Refrigeration Equipment Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  6. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    MeasuresWhole Building, Other EE, Reflective Roofs Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  7. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Heat Pumps, Air conditioners, Motors, Other EE, LED Lighting Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  8. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Controls, LED Lighting, Commercial Refrigeration Equipment Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  9. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Windows, Other EE, Food Service Equipment, LED Lighting Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  10. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Equipment, LED Lighting, Commercial Refrigeration Equipment Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  11. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    DuctAir sealing, Building Insulation, Other EE, LED Lighting Forest Grove Light & Power- Energy Efficiency Rebate Programs Forest Grove Light & Power offers a variety of rebates...

  12. Economic and environmental benefits of reducing standby power loss in DVD/VCD players and copiers in China

    E-Print Network [OSTI]

    Lin, Jiang; Li, Tienan; Li, Aizhen; Zhang, Guoqing

    2004-01-01

    Studies on Energy Efficiency in Buildings, Washington, DC,Study on Energy Efficiency in Buildings, Pacific Grove CA,Study on Energy Efficiency in Buildings, Pacific Grove CA,

  13. Regional Analysis of Building Distributed Energy Costs and CO2 Abatement: A U.S. - China Comparison

    E-Print Network [OSTI]

    Mendes, Goncalo

    2014-01-01

    Study on Energy Efficiency in Buildings, Pacific Grove,Study on Energy Efficiency in Buildings, Pacific Grove,DOE), Energy Efficiency & Renewable Energy, Buildings Energy

  14. Birth of the Female Student-Writer in Meiji Japan (1868-1912): Miyake Kaho’s The Warbler in the Grove

    E-Print Network [OSTI]

    Alvarez, Miho T

    2010-01-01

    shoten, 1990. “The Concept of Education in the Educationshobo, 1999), 14. “The Concept of Education in the Educationthrough modern education. This new concept was clearly

  15. Presented at the 2000 ACEEE Summer Study on Energy Efficiency in Buildings, August 20-25, 2000 in Pacific Grove, CA, and published in the Proceedings.

    E-Print Network [OSTI]

    LBNL-46303 Presented at the 2000 ACEEE Summer Study on Energy Efficiency in Buildings, August 20 of Energy`s (DOE) Office of Building Equipment combined DOE-2 results for a large set of prototypical commercial and residential buildings with data from the Energy Information Administration (EIA) residential

  16. Remarks for the Giant Sequoia Symposium1 Douglas R. Leisz2

    E-Print Network [OSTI]

    the American River and southern Tulare County. The large groves are concentrated between the Kings River

  17. CALIFORNIA ENERGY COMMISSION ESCHINGER-BRUCEVILLE

    E-Print Network [OSTI]

    -GRANTLINE ELK GROVE-COLTON BOND-ELK GROVE FLORIN SEASONS- BRUCEVILLE APPLE INC STOCKTON- SHELDON MORGAN HILLS- SONOMA HILLS ELK GROVE FLORIN BIG HORN- MEADOWSPRING CARSON ICE SACRAMENTO REGIONAL WWTP CARSON ICE COGEN COSUMNES RANCHO SECO COLONY-WOODS DILLARD-WILTON GRANTLINE-SIEFKER DILLARD-ORANGE ELK GROVE WATERMAN

  18. REVIEWS OF GEOPHYSICS AND SPACE PHYSICS, VOL. 19, NO. 4, PAGES 687-688, NOVEMBER 1981 Comment on 'Geomagnetic Depth Sounding by Induction Arrow Representation

    E-Print Network [OSTI]

    Jones, Alan G.

    transfer functions given by Ziw) = z~w) . Hn(w) + zo(w) . Dn(w) + g' (2) where Za(W) is the anomalous, as given by Z(w) = A(w) . H(w) + B(w) . D(w) + g'1 (3) where H(w), D(w), and Z(w) are the total fields MAN G. JONES Institutfiir Geophysik tier Westfiilischen Wilhelms-Universitiit, D-4400 Munster, Federal

  19. . . . they took twenty-seven eight-by-ten color glossy photographs with circles and arrows and a paragraph on the back of each one explaining what each

    E-Print Network [OSTI]

    Palmeri, Thomas

    and a paragraph on the back of each one explaining what each one was to be used as evidence against us. --from systems. A basic modus operandi of cognitive science is to "carve things up at the joints" (c.f., Fodor

  20. The Universal Arrow of Time V-VI: (Part V) Unpredictable dynamics (Part VI) Future of artificial intelligence - Art, not Science: Practical Application of Unpredictable Systems

    E-Print Network [OSTI]

    Oleg Kupervasser

    2013-05-23

    The paper consists of the two independent papers:(Part V) We see that exact equations of quantum and classical mechanics describe ideal dynamics which is reversible and leads to Poincare's returns. Real equations of physics describing observable dynamics, for example, hydrodynamic equations of viscous fluid, are irreversible and exclude Poincare's returns to the initial state. Besides, these equations describe systems in terms of macroparameters or phase distribution functions of microparameters. For many systems introduction of macroparameters that allow exhaustive describing of dynamics of the system is impossible. Their dynamics becomes unpredictable in principle, sometimes even unpredictable by the probabilistic way. We will refer to dynamics describing such system as unpredictable dynamics. Dynamics of unpredictable systems is not described and not predicted by scientific methods. Thus, the science itself puts boundaries for its applicability. But such systems can intuitively "understand itself" and "predict" the behavior "of its own" or even "communicate with each other" at intuitive level. (Part VI) Perspective of the future of artificial intellect (AI) is considered. It is shown that AI development in the future will be closer rather to art than to science. Complex dissipative systems whose behavior cannot be understood completely in principle will be the basis of AI. Nevertheless, it will not be a barrier for their practical use.

  1. Modeling Motion Electromagnetism In Class Test 1. Which of the arrows indicates the direction of the electric field at point P due the stationary

    E-Print Network [OSTI]

    battery with Emf E. A B C R (a) Rank the bulbs in order of their brightness explaining your reasoning 2.0 Tesla and the particle follow tracks in the plane of the page in the directions indicated

  2. IEEEJOURNAL OF QUANTUM ELECTRONICS, VOL. QE-16, NO. 3, MARCH 1980 373 Internal Photoemission Mechanisms at Interfaces

    E-Print Network [OSTI]

    Teich, Malvin C.

    electron transition mechanisms. tum efficiencyassociatedwith the mechanismsindicatedby arrows 3 and 4

  3. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Stanford U Phys Dept IASF Milan Padua U AIM Saclay ASDC Frascati INFN Perugia Perugia U NASA Goddard NASA Goddard CRESST Greenbelt CSST Baltimore SLAC KIPAC Menlo Park Stanford U...

  4. Perspectives of the Forest Products Industry on Management Strategies1

    E-Print Network [OSTI]

    : Past history indicates a wide range of management strategies in the giant sequoia groves of Tulare groves for the past 25 years in Tulare and Fresno counties. We can learn much about the giant sequoia

  5. Recording the Nation: Folk Music and the Government in Roosevelt’s New Deal, 1936–1941

    E-Print Network [OSTI]

    Davidson, Mark A.

    2015-01-01

    vol. XXV. American Folk Music. Southern Folklore Quarterly,2 Vols. ) Grove’s Dictionary of Music and Musicians—Americanand Compilers of Sacred Music. The Abingdon Press, N.Y. 1935

  6. The UCSC Arboretum: A Grand Experiment

    E-Print Network [OSTI]

    Reti, Irene; Regional History Project, UC Santa Cruz Library; Hall, Brett; Harder, Daniel; Norris, Phyllis

    2007-01-01

    we were, Randall. The Eucalyptus Grove Jarrell: Okay, I wanta hay wagon in from the Eucalyptus grove. It’s very nicelyof approximately eighty Eucalyptus tree seedlings from Max

  7. CX-004519: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Cottage Grove Wastewater Treatment PlantCX(s) Applied: B5.1Date: 11/19/2010Location(s): Cottage Grove, OregonOffice(s): Energy Efficiency and Renewable Energy, Golden Field Office

  8. This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research

    E-Print Network [OSTI]

    Grau, James

    et al., 1966; Groves and Thompson, 1970; Durkovic, 1975; e.g. Beggs et al., 1985; Wolpaw et al., 1991

  9. Office Hours Office Ext. T 11 A -12 P & 2 P -3 P

    E-Print Network [OSTI]

    Grove, Karen kgrove@sfsu.edu TH516 x8-2617 Sedimentology, Quatemary Geology, Marine Sci Engineering Geol

  10. PROCEEDINGS OF THE 1ST CONFERENCE ON NUCLEAR STRUCTURE DATA EVALUATION HELD IN CONJUNCTION WITH THE APS/DIVISION OF NUCLEAR PHYSICS FALL MEETING ASILOMAR CONFERENCE GROUNDS, PACIFIC GROVE, CA., OCT. 27-30, 1981.

    E-Print Network [OSTI]

    Firestone, R.B.

    2008-01-01

    with the APS/Division of Nuclear Physics Fall Meetingical Soc iety (APS): Division of Nuclear Physics Arrer ican

  11. A DISTENSIBLETUBE WAVE ENERGY CONVERTER WITH A DISTRIBUTED POWERTAKEOFF R.C.T.Rainey, Atkins Ltd., Woodcote Grove, Epsom KT18 5BW, U.K. rod.rainey@atkinsglobal.com

    E-Print Network [OSTI]

    1 A DISTENSIBLETUBE WAVE ENERGY CONVERTER WITH A DISTRIBUTED POWERTAKEOFF R.C.T.Rainey, Atkins A distensibletube Wave Energy Converter (WEC) operates by converting the wave energy into "bulge waves interaction then occurs, and large bulge waves are generated, concentrating the wave energy

  12. PROCEEDINGS OF THE 1ST CONFERENCE ON NUCLEAR STRUCTURE DATA EVALUATION HELD IN CONJUNCTION WITH THE APS/DIVISION OF NUCLEAR PHYSICS FALL MEETING ASILOMAR CONFERENCE GROUNDS, PACIFIC GROVE, CA., OCT. 27-30, 1981.

    E-Print Network [OSTI]

    Firestone, R.B.

    2008-01-01

    1. J 29fl2.2 N 82 Nuclides _ _ _ _ _ _ =-~264~S_ c) ~5Q ~45,S z nS2.2 64 (Gd) Nuclides (B-) n02.5 . S9! l . _. _.parity of odd-odd actinide nuclides, L. K. Peker and J. K.

  13. Using XY-pic in LYX H. Peter Gumm

    E-Print Network [OSTI]

    Jagannatham, Aditya K.

    and with the preview-style installed in the LATEX-System, the graph drawing package XY-pic can be conveniently used.2 Arrows . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 3.3 Labels and labels . . . . . . . . . . . . . . 10 4.4 Modifying arrows

  14. TMC Template

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    20000 30000 40000 50000 60000 70000 80000 Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun cfs Arrow+Duncan - 1937 Outflow AOP12 AOP15 AOP16 AOP18 Arrow+Duncan - Outflow (cfs) August...

  15. GETTING UP AND RUNNING WITH AM S-LATEX

    E-Print Network [OSTI]

    Hirschhorn, Philip S.

    of an arrow44 8.13. Nodes off of the grid 45 8.14. Text objects 48 8.15. Arrows off of the grid 49 8.16. Dropping objects

  16. Ecological transitions in a coastal upwelling ecosystem

    E-Print Network [OSTI]

    Ohman, MD; Barbeau, K; Franks, PJS; Goericke, R; Landry, MR; Miller, AJ

    2013-01-01

    arrows represent weaker offshore wind stress curl upwelling.the onshore-to-offshore gradient in equatorward wind stress.

  17. Marine microbes rapidly adapt to consume ethane, propane, and butane within the dissolved hydrocarbon plume of a natural seep

    E-Print Network [OSTI]

    2015-01-01

    the Coal Oil Point seeps, offshore California. Spatial andthe red star) is located offshore Goleta, California. Arrows

  18. A Cure for the Valentine's Blues? Livermore Supercomputer Seeks to Mend Broken Hearts

    Broader source: Energy.gov [DOE]

    Cupid's arrows may help you find love, but an Energy Department supercomputer is working to help cure broken hearts.

  19. Measurement of the analyzing power for p+p/sub arrow-up/. -->. p+p at P/sub perpendicular/ /sup 2/ = 6. 5 (GeV/c)/sup 2/

    SciTech Connect (OSTI)

    Cameron, P.R.; Crabb, D.G.; DeMuth, G.E.; Khiari, F.Z.; Krisch, A.D.; Lin, A.M.T.; Raymond, R.S.; Roser, T.; Terwilliger, K.M.; Brown, K.A.

    1985-12-01

    The spin analyzing power A in 28-GeV/c proton-proton elastic scattering was measured at P/sub perpendicular/ /sup 2/ = 6.5 (GeV/c)/sup 2/ using a polarized proton target and a high-intensity unpolarized proton beam at the Brookhaven National Laboratory Alternating Gradient Synchrotron. The result of (24 +- 8)% confirms that the analyzing power is large and rising in the large-P/sub perpendicular/ /sup 2/ region.

  20. 1 Put me not to rebuke O | Lord in thine | anger : neither | chasten me in thy | heavy dis | 2 For thine | arrows stick | fast in me : and | thy hand | presseth me | sore.

    E-Print Network [OSTI]

    Flynn, E. Victor

    Psalm 38 1 Put me not to rebuke O | Lord · in thine | anger : neither | chasten me · in thy | heavy There is no health in my flesh be | cause of · thy dis | pleasure : neither is there any rest in my | bones

  1. Measurement of the Target-Normal Single-Spin Asymmetry A{sub y}{sup n} in the Deep Inelastic Region from the Reaction {sup 3}He{up_arrow}(e,e')

    SciTech Connect (OSTI)

    Katich, Joseph [William and Mary College

    2011-01-01

    A first measurement of the inclusive target single-spin asymmetry, A{sup n}{sub y}, has been performed in deep-inelastic scattering of electrons from a {sup 3}He target polarized normal to the electron scattering plane. This asymmetry is void of contributions at the Born level, and thus is a direct observable for two-photon physics. The experiment was performed in Hall A at Thomas Jefferson National Accelerator Facility from October 2008 through early February 2009. The measurement is the first from a polarized neutron target. The final overall precision is several times better than previously existing SLAC proton data, and significantly extends the kinematic range over which the asymmetry has been measured. The asymmetry was measured at five kinematic points in the deep inelastic scattering region covering Q{sup 2} = 1 - 3 GeV{sup 2} and x{sub B} = 0.16 to 0.41. The asymmetry varied from 0.006 to 0.071 with astatistical precision at the 10{sup -2} level.

  2. A review of "Galileo Interviewed" by William R. Shea 

    E-Print Network [OSTI]

    Giostra, Alessandro

    2015-01-01

    matters. William Shea, Galileo professor of History of Science at the University of Padua, is author or editor of many books concerning Galileo and the Scientific Revolution. The outcome of his work is a very pleasant read- ing, which finds the way... decided to abandon the University of Padua and go back to Florence. The treatment of the Evils of Censorship (21–24) represents the beginning of this interview, in which Galileo shows his situation dur- ing the years he was spending in Arcetri...

  3. INSTITUTE OF PHYSICS PUBLISHING REPORTS ON PROGRESS IN PHYSICS Rep. Prog. Phys. 68 (2005) 19351996 doi:10.1088/0034-4885/68/8/R06

    E-Print Network [OSTI]

    2005-01-01

    , 4800 Oak Grove Drive, Pasadena, CA 91109, USA 2 Department of Planetary Sciences and Lunar hydrogen and helium with some volatiles and refractory materials, largely mirroring the bulk

  4. "Put One More 'S' in the USA": Communist Pamphlet Literature and the Productive Fiction of the Black Nation Thesis

    E-Print Network [OSTI]

    Sangrey, Trevor Joy

    2012-01-01

    definition of social movements and social movement rhetoric.Tarrow, Sidney G. Power in movement: Social movements andE. Denton. Persuasion and social movements. Long Grove:

  5. Olive fruit fly populations measured in Central and Southern California

    E-Print Network [OSTI]

    Rice, Richard E.; Phillips, Phil A.; Stewart-Leslie, Judy; Sibbett, G. Steven

    2003-01-01

    olive grove in southern Tulare County in the San Joaquinflies were trapped in Tulare County, and in adjacent Kernand noncommercial sites in Tulare and Fresno counties to

  6. Beeran ki kai jaat ...? : the figure of the woman in Partition discourse

    E-Print Network [OSTI]

    Limki, Rashné Marzban

    2009-01-01

    Khushwant. Train to Pakistan. New York: Grove Weidenfeld,of partitioning India (and Pakistan) was assigned by theof Ibid. , 65-66. While Pakistan and India achieved ‘

  7. CX-009442: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Cutters Grove, Anoka CX(s) Applied: A9, B5.19 Date: 07/31/2012 Location(s): Minnesota Offices(s): Golden Field Office

  8. Do Photovoltaic Energy Systems Effect Residential Selling Prices? Results from a California Statewide Investigation.

    E-Print Network [OSTI]

    Hoen, Ben

    2012-01-01

    Study on Energy Efficiency in Buildings, Pacific Grove,Summer Study on Energy Efficiency in Buildings, August 22-Summer Study on Energy Efficiency in Buildings, August 22-

  9. Global implications of standby power use

    E-Print Network [OSTI]

    Lebot, Benoit; Meier, Alan; Anglade, Alain

    2000-01-01

    Study on Energy Efficiency in Buildings. Pacific Grove, CA:Summer Study on Energy Efficiency in Buildings. Asilomar,Summer Study on Energy Efficiency in Buildings. Asilomar (

  10. Residential Photovoltaic Energy Systems in California: The Effect on Home Sales Prices

    E-Print Network [OSTI]

    Hoen, Ben

    2013-01-01

    Summer Study on Energy Efficiency in Buildings, August 22-Summer Study on Energy Efficiency in Buildings, August 22-Study on Energy Efficiency in Buildings, Pacific Grove,

  11. Small Business Demand Response with Communicating Thermostats: SMUD's Summer Solutions Research Pilot

    E-Print Network [OSTI]

    Herter, Karen

    2010-01-01

    Study on Energy Efficiency in Buildings. Pacific Grove, CA.Study on Energy Efficiency in Buildings. American CouncilStudy on Energy Efficiency in Buildings. American Council

  12. Expansion of Domestic Production of Lithium Carbonate and Lithium...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    0 DOE Vehicle Technologies and Hydrogen Programs Annual Merit Review and Peer Evaluation Meeting, June 7-11, 2010 -- Washington D.C. esarravt010groves2010...

  13. Miscellaneous and Electronic Loads Energy Efficiency Opportunities for Commercial Buildings: A Collaborative Study by the United States and India

    E-Print Network [OSTI]

    Ghatikar, Girish

    2014-01-01

    and provide energy efficiency and building technologies toStudy on Energy Efficiency in Buildings. Pacific Grove,in improving energy efficiency in commercial buildings would

  14. A Usability Study of a Social Media Prototype for Building Energy Feedback and Operations

    E-Print Network [OSTI]

    Lehrer, David R.; Vasudev, Janani; Kaam, Soazig

    2014-01-01

    © 2014 ACEEE Summer Study on Energy Efficiency in BuildingsSummer Study on Energy Efficiency in Buildings Froehlich,Study on Energy Efficiency in Buildings. Pacific Grove, CA.

  15. Climate and Transportation Solutions: Findings from the 2009 Asilomar Conference on Transportation and Energy Policy

    E-Print Network [OSTI]

    Sperling, Daniel; Cannon, James S.

    2010-01-01

    California Department of Transportation, the California EnergyCalifornia Energy Commission Climate and TransportationTransportation and Energy Policy, at Paci?c Grove, California.

  16. Exploitation in Human Trafficking and Smuggling

    E-Print Network [OSTI]

    Campana, Paolo; Varese, Federico

    2015-08-11

    is an example of this scenario. Anna was smuggled from Chisinau (Moldova) to Padua (Italy) in November 2007. The journey started on a Friday and lasted until Sunday. Anna was first driven to Odessa where she boarded a train to Chop (Ukraine). The smuggling...

  17. Cost effective electronics for LAr and photo-detectors readout Sandro Centro

    E-Print Network [OSTI]

    Esole, Jonathan Mboyo

    Cost effective electronics for LAr and photo-detectors readout Sandro Centro University of Padua Critical issues It is important to remember that the DAQ architecture for T600 was conceived in 1997 components are now discontinued. In this scenario it is very important then to make a critical analysis

  18. Gomez Villegas, M. A. (2014). 2013, A~no internacional de la estadistica: una panoramica. Historia de la Probabilidad y la Estadistica [VII] (J. Santos y S. de Paz, eds.), Madrid: Delta, 1129.

    E-Print Network [OSTI]

    Gómez Villegas, Miguel Ángel

    2014-01-01

    ´amica. Historia de la Probabilidad y la Estad´istica [VII] (J. Santos y S. de Paz, eds.), Madrid: Delta, 11) Universidad Complutense de Madrid 1. Introducci´on En este trabajo se recoge una panor´amica de la historia de dos ciudades, Padua, dependiente del Senado de Florencia, m´as abierta, y Pisa dependiente de la

  19. Characterizing Shared Memory Multiprocessor Benchmarks for Future Chip Multiprocessor Architectures Using Instruction Flow Analysis 

    E-Print Network [OSTI]

    Jagielski, Philip

    2011-08-08

    ., 1990. [6] D. D. Gajski, D. A. Padua, D. J. Kuck, and R. H. Kuhn, ?A second opinion on data flow machines and languages,? in Computer, 1982. [7] Charles L. Seitz, ?The cosmic cube,? in Communications of the ACM, 1985. [8] Mark S. Papamarcos and Janak...

  20. Generalized Multitext Grammars A revised and extended version of the ACL'04 paper

    E-Print Network [OSTI]

    is possible with other synchronous formalisms. This paper investigates the generative capacity of GMTG, proves University 2 University of Padua Abstract Generalized Multitext Grammar (GMTG) is a synchronous grammar of the notational and intuitive simplicity of Context-Free Grammar (CFG). GMTG allows both synchronous

  1. ccsd00002004, Di usivity induced by vortex-like coherent

    E-Print Network [OSTI]

    in Reversed Field Pinch plasmas M. Spolaore x, V. Antoni, E. Spada, R. Cavazzana, E. Martines, G. Regnoli z, G Laboratory, Royal Institute of Technology, SE10044, Stockholm, Sweden Abstract. Coherent structures emerging of two Reversed Field Pinch experiments, RFX (Padua) and Extrap-T2R (Stockholm). Measurements have been

  2. Proceedings of the 3rd International Conference on Information Systems, Logistics and Supply Chain

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Proceedings of the 3rd International Conference on Information Systems, Logistics and Supply-16 Sustainable supply chain management in city logistics solutions: an experience's comeback from Cityporto Padua.gonzales-feliu}@let.ish-lyon.cnrs.fr Abstract : The sustainable logistics and transportation studies constitute a primordial research axis

  3. 2015 Plant Sale Friends & Founders Preview Sale and Reception

    E-Print Network [OSTI]

    , May 9, 2015 - 9:00 a.m. to 3:00 p.m. ·Location: Centre Furnace Mansion, 1001 East College Avenue; open house and tours of the Centre Furnace Mansion ·Sale information: 814-234-4779, www Site, 2710 West Pine Grove Road, Pennsylvania Furnace, PA 16865 (5 miles west of Pine Grove Mills

  4. PROPER SAFETY EQUIPMENT Safety Glasses -Proper eye

    E-Print Network [OSTI]

    Jia, Songtao

    be managed as Hazardous Waste. Paint Material Storage location: Right side of Grove tunnel heading towards. Universal Waste not placed in proper storage locations is a violation of environmental regulations and is punishable by a fine, it also poses a hazard to the many people and vehicles that use the Grove everyday

  5. NMR, MRI, and spectroscopic MRI in inhomogeneous fields

    DOE Patents [OSTI]

    Demas, Vasiliki; Pines, Alexander; Martin, Rachel W; Franck, John; Reimer, Jeffrey A

    2013-12-24

    A method for locally creating effectively homogeneous or "clean" magnetic field gradients (of high uniformity) for imaging (with NMR, MRI, or spectroscopic MRI) both in in-situ and ex-situ systems with high degrees of inhomogeneous field strength. THe method of imaging comprises: a) providing a functional approximation of an inhomogeneous static magnetic field strength B.sub.0({right arrow over (r)}) at a spatial position {right arrow over (r)}; b) providing a temporal functional approximation of {right arrow over (G)}.sub.shim(t) with i basis functions and j variables for each basis function, resulting in v.sub.ij variables; c) providing a measured value .OMEGA., which is an temporally accumulated dephasing due to the inhomogeneities of B.sub.0({right arrow over(r)}); and d) minimizing a difference in the local dephasing angle .phi.({right arrow over (r)},t)=.gamma..intg..sub.0.sup.t{square root over (|{right arrow over (B)}.sub.1({right arrow over (r)},t')|.sup.2+({right arrow over (r)}{right arrow over (G)}.sub.shimG.sub.shim(t')+.parallel.{right arrow over (B)}.sub.0({right arrow over (r)}).parallel..DELTA..omega.({right arrow over (r)},t'/.gamma/).sup.2)}dt'-.OMEGA. by varying the v.sub.ij variables to form a set of minimized v.sub.ij variables. The method requires calibration of the static fields prior to minimization, but may thereafter be implemented without such calibration, may be used in open or closed systems, and potentially portable systems.

  6. Microsoft Word - 7B8E8D37.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    COLUMBIA HYDRO AND POWER AUTHORITY Relating to: (1) Use of Columbia River Non-Treaty Storage; (2) Mica and Arrow Reservoir Refill Enhancement; and (3) Initial Filling of...

  7. 2011_12NTSA_signed.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    concurrent Arrow provisional draft rights under the Libby Coordination Agreement (LCA), LCA provisional draft rights will take precedence and energy deliveries under this...

  8. Electrochemical arsenic remediation for rural Bangladesh

    E-Print Network [OSTI]

    Addy, Susan Amrose

    2009-01-01

    2-line ferrihydrite (2L FH), goethite, and scorodite. Arrows6-line ferrihydrite, goethite, lepidocrocite, and akaganeiteof arsenate on/from goethite. Soil Science, 166 (3), 197–

  9. Commercial Buildings Energy Consumption and Expenditures 1995...

    U.S. Energy Information Administration (EIA) Indexed Site

    fuel oil, and district heat consumption and expenditures for commercial buildings by building characteristics. Previous Page Arrow Separater Bar File Last Modified: January 29,...

  10. Muonium-antimuonium oscillations and exotic muon decay in broken [ital R]-parity SUSY models

    SciTech Connect (OSTI)

    Halprin, A. (Department of Physics and Astronomy, University of Delaware, Newark, Delaware 19716 (United States)); Masiero, A. (Instituto Nazionale di Fisica Nucleare, Sezione di Padova, 35100 Padova (Italy))

    1993-10-01

    We analyze the process of muonium-antimuonium conversion and the rare decay [mu][sup +][r arrow][ital e][sup +][bar [nu

  11. Placing Refuge: Shell Mounds and the Archaeology of Colonial Encounters in the San Francisco Bay Area, California

    E-Print Network [OSTI]

    Schneider, Tsim Duncan

    2010-01-01

    Figure 5.10. Select bullet cartridge casings. Calibers fromCaliber Maker Federal Cartridge Corp. Imperial Chemicalin arrow) Omark/Cascade Cartridges Inc. Remington Arms Co. ,

  12. FY 2012 Annual Progress Report for Energy Storage R&D

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    TGA analysis (a) and Raman spectra (b) of pyrolized polyimide sample with and without heat treatments. (Arrows in the TGA curve mark with corresponding colors the points where...

  13. Unconventional Switching Behavior in La0.7Sr0.3MnO3/La0.7Sr0...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    resonant XRR spectra show clear Kiessig fringes from finite thickness effects as well as energy dependent features indicated by arrows. Careful fitting of the resonant XRR curves...

  14. Remote Control Inserting the batteries

    E-Print Network [OSTI]

    Kostic, Milivoje M.

    Top View Rear View Inserting the batteries 1 3Press in on the arrow mark and slide in the direction of the arrow to remove the battery cover. 2 Insert two AA size batteries, making sure their polarities match the and marks inside the battery compartment. Insert the side tabs of the battery cover into their slots

  15. XY-pic User's Guide Kristoffer H. Rose krisrose@ens-lyon.fr

    E-Print Network [OSTI]

    Spivak, David

    Abstract XY-pic is a package for typesetting graphs and diagrams using Knuth's TEX typesetting system. XY. · Arrows may be decorated with labels that are tied to a specified point along the arrow and extend 1.4 Labels . . . . . . . . . . . . . . . . . . 3 1.5 Breaks . . . . . . . . . . . . . . . . . . 3 1

  16. TUTORIAL FOR UW NETWORK CODING USING OPNET AND CHRIS LYDICK

    E-Print Network [OSTI]

    Roy, Sumit

    have downloaded the .zip or .tar.gz file from the UWEE FUNLAB web- site (http, the packets we are processing for network coding) follow the dark blue arrow to either a sink processor to all of its output streams (again, the dark blue arrows going from the nc-proc processor to other

  17. Computers for Physicists 2nd Semester 2004

    E-Print Network [OSTI]

    Barkana, Rennan

    in the correct color, with its velocity and label) Controller · main() program entry point, responsible(e.g., set the screen size, boundaries, etc.) · draw sphere() draws a sphere at a given point, with given parameters · draw arrow() draws an arrow at a given point, with a given direction (for the velocity plots

  18. Run Run Shaw Library City University of Hong Kong

    E-Print Network [OSTI]

    Po, Lai-Man

    or ISBN fields 1. Enter search term(s). Select to go to Advanced Search #12;- 2 - Steps: 1. Enter search term(s) in relevant boxes. Optional: 2. Click on down arrow(s) to specify a search option Optional: 3), if known. Optional: 5. Filter by specific Journal Title. Refine search by entering additional volume, issue

  19. Performance and gas cleanup criterion for a cotton gin waste fluidized-bed gasifier 

    E-Print Network [OSTI]

    Craig, Joe David

    1980-01-01

    to gasify cottin gin waste. General objectives are: 1) Design and construct a fluidized-bed gasification reactor based on results of a study by Groves (1979). 2) Evaluate performance of the scaled up reactor based on Groves' empirical prediction equation... of Groves (1979). A gasifier of this type would supply about 238 megajoules of heat per hour based on converting 90 percent of the produced gas to heat. If the produced gas were used in an internal combustion engine with 20 per- e nt conversion effic...

  20. A review of "1604-2004: Supernovae as Cosmological Lighthouses." by Massimo Turatto, Stefano Benetti, Luca Zampieri, William Shea, eds. 

    E-Print Network [OSTI]

    Giostra, Alessandro

    2006-01-01

    . Massimo Turatto, Stefano Benetti, Luca Zampieri, William Shea, eds. 1604- 2004: Supernovae as Cosmological Lighthouses. Astronomical Society of the Pacific Conference Series, Vol. 342. San Francisco: ASP, 2005. 512 pp. $77.00. Review by ALESSANDRO... GIOSTRA, ACCADEMIA GEORGICA, TREIA. REVIEWS 223 The proceedings of the international conference, which took place in Padua on 16-19 June 2004 to commemorate the 400 th anniversary of the appearance of Kepler?s Supernova, are collected in this publication...

  1. Increasing Energy Efficiency and Reducing Emissions from China's Cement Kilns: Audit Report of Two Cement Plants in Shandong Province, China

    E-Print Network [OSTI]

    Price, Lynn

    2013-01-01

    http://www.wbcsd.ch/web/projects/cement/pop-report.pdfShui Ni 1 and Shui Ni 2 cement plants in Shangdong ProvinceReferences Ash Grove Cement, n.d. , “Cement Manufacturing

  2. Virgil: Objects on the Head of a Pin

    E-Print Network [OSTI]

    Titzer, B L

    2006-01-01

    Spain, June 2002. [7] D. Bacon and P. Sweeney. Fast StaticSpoonhower, J. Auerbach, D. Bacon, P. Cheng, and D. Grove.CA. June 2003. [5] D. Bacon. Kava: a Java Dialect with a

  3. The ExoVM System for Automatic VM and Application Reduction

    E-Print Network [OSTI]

    Titzer, B L; Joshua Auerbach; David F. Bacon; Palsberg, J

    2007-01-01

    Spoonhower, J. Auerbach, D. Bacon, P. Cheng, and D. Grove.CA. June 2003. [2] D. Bacon and P. Sweeney. Fast Staticjosh@us.ibm.com David F. Bacon IBM T.J. Watson Research

  4. DOE Zero Energy Ready Home Case Study: Weiss Building & Development...

    Broader source: Energy.gov (indexed) [DOE]

    Downers Grove, IL, that scored HERS 35 without PV. This 3,600-square-foot custom home has advanced framed walls with R-23 dense-packed fiberglass plus R-13 rigid polyiso, a sealed...

  5. DOE Zero Energy Ready Home Case Study: Weiss Building & Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Ready Home in Downers Grove, IL, that scored HERS 35 without PV. This 3,600-square-foot custom home has advanced framed walls with R-23 dense-packed fiberglass plus R-13...

  6. MULTISCALE SIMULATIONS OF THE RF DIODE SPUTTERING OF COPPER

    E-Print Network [OSTI]

    Wadley, Haydn

    . F.GROVES Intelligent Processing of Materials Laboratory Department of Materials science sensors [4-6], read heads for disk drives, and magnetic random access memories (MRAM) [5,6]. GMR

  7. CX-011246: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Timber Tap to Forest Grove-Keeler #1 Access Roads CX(s) Applied: B1.3 Date: 09/20/2013 Location(s): Oregon Offices(s): Bonneville Power Administration

  8. LincolnStreet WhitneyAvenue

    E-Print Network [OSTI]

    Post, David M.

    CAMPUS CROSS CAMPUS GROVE STREET CEMETERY Jonathan Edwards Trumbull Berkeley Silliman Davenport Saybrook 341-47 Off Broadway Theater 35 Broadway Music Library Rosenfeld Hall 202 St. Thomas More Chapel Golden

  9. A limpet shell shape that reduces drag: laboratory demonstration of a hydrodynamic mechanism and an exploration of its effectiveness in nature

    E-Print Network [OSTI]

    Denny, Mark

    , Hopkins Marine Station, Pacific Grove, CA 93950, U.S.A. Received October 3, 1988 DENNY,M. 1989. A limpet is lift, so any reduction in drag is unlikely to enhance survivorship. The likelihood that drag reduction

  10. Ocean waves, nearshore ecology, and natural selection Mark W. Denny*

    E-Print Network [OSTI]

    Denny, Mark

    , Hopkins Marine Station, Pacific Grove, CA 93950, USA; *Author for correspondence (e-mail: mwdenny, Intertidal communities, Lift, Wave theory Abstract Although they are subjected to one of the most stressful

  11. Saving Water Saves Energy

    E-Print Network [OSTI]

    McMahon, James E.; Whitehead, Camilla Dunham; Biermayer, Peter

    2006-01-01

    H. , Groves D. California Water 2030: An Efficient Future,Preemption of California’s Water Conservation Standards for2Epdf Biermayer P. Potential Water and Energy Savings from

  12. OpenMaTrEx: A Free/Open-Source Marker-Driven Example-Based Machine

    E-Print Network [OSTI]

    Way, Andy

    : Departament de Llenguatges i Sistemes Inform`atics, Universitat d'Alacant, E-03071 Alacant, Spain Also: Trasl-18 Aug. 2010) #12;2 Dandapat, Forcada, Groves, Penkale, Tinsley and Way decoder, using a hybrid

  13. CX-008211: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Cedar Grove Composting High Solids Anaerobic Digestion Permitting CX(s) Applied: A9, B3.1 Date: 03/23/2012 Location(s): Washington Offices(s): Golden Field Office

  14. HFIR Plant Maintenance - August

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    IV International Forum working group that is developing design criteria for sodium fast reactors. The meeting was held July 17-18 in Paris, France. * Bob Grove was an invited...

  15. Gypsum (CaSO4 .2H2O) and anhydrite (CaSO4) are two related minerals that formed

    E-Print Network [OSTI]

    Polly, David

    called satin spar. Although associated with gypsum, anhydrite lacks H2O molecules. Anhydrite closely Indiana's Evaporite Minerals satin spar gypsum #12;611 North Walnut Grove Ave. Bloomington, Indiana 47405

  16. Bayesian Algorithmic Mechanism Design [Extended Abstract

    E-Print Network [OSTI]

    Hartline, Jason D.

    Bayesian Algorithmic Mechanism Design [Extended Abstract] Jason D. Hartline Northwestern, Canada blucier@cs.toronto.edu ABSTRACT The principal problem in algorithmic mechanism design approach for designing incen- tive compatible mechanisms, namely that of Vickrey, Clarke, and Groves

  17. Russel and Karen Wolter: Down to Earth Farm

    E-Print Network [OSTI]

    Farmer, Ellen

    2010-01-01

    saw in there, Down to Earth, he actually had his daughter,our organic brand, Down to Earth. It doesn’t mean we weren’tand Karen Wolter Down to Earth Farm Born in Pacific Grove,

  18. Table of Contents Introducing the Historic Netsch Campus at UIC 4

    E-Print Network [OSTI]

    Illinois at Chicago, University of

    Circle Memorial Grove 16 Addenda 17 #12;UIC/HALSTED CTA STATION TAYLOR STREET ROOSEVELT ROAD POLK STREET/94 POLK STREET MORGANSTREET HALSTEDSTREET HARRISON STREET MORGANSTREET TAYLOR STREET LC Jane Addams Hull

  19. MARRIAGE AT A CROSSROADS | TAKINGS ON TRIAL | A NEW DEAN FOR UF LAW U N I V E R S I T Y O F F L O R I D A F R E D R I C G . L E V I N C O L L E G E O F L A W S P R I N G 2 0 1 5

    E-Print Network [OSTI]

    Roy, Subrata

    Smith Online Communications Manager JC Kirwan Contributing Writers Tim Groves (1L) Laura Hogan Andrew and public purpose in Florida 22 Personal cause of action For some students, faculty and alumni, same

  20. Fish, fishing, diving and the management of coral reefs

    E-Print Network [OSTI]

    Johnson, Ayana Elizabeth

    2011-01-01

    to fishers. An island-wide buyout of gill nets to compensatebe the ideal situation for a buyout of the fishery. For aGroves and Squires, 2007). Such a buyout would have to be

  1. DRAFT VERSION NOVEMBER 29, 2006 Preprint typeset using LATEX style emulateapj v. 10/10/03

    E-Print Network [OSTI]

    Leka, K. D .

    , ASANTHA COORAY 2 , RANGA-RAM CHARY 1 , JAMES J. BOCK 1,3 , MARK BRODWIN 3 , MICHAEL J. I. BROWN 4 , ARJUN Jet Propulsion Laboratory, 4800 Oak Grove Drive, Pasadena, CA 91109 4 Princeton University Observatory

  2. Appears in the Proceedings of the International Symposium on Artificial Intelligence, Robotics, and Automation for Space, Turin, Italy, September, 2012.

    E-Print Network [OSTI]

    Schaffer, Steven

    Flatley(3) (1) Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drivecm. To support it's primary flight software, IPEX carries a 200MHz Atmel ARM9 CPU with 128MB RAM, 512

  3. Thermochronology, geochronology, and upper crustal structure of the Cordillera Real: Implications for Cenozoic exhumation

    E-Print Network [OSTI]

    Horton, Brian K.

    Thermochronology, geochronology, and upper crustal structure of the Cordillera Real: Implications] Structural mapping, 40 Ar/39 Ar and fission track thermochronology, U-Pb geochronology, and basin analysis. Grove (2006), Thermochronology, geochronology, and upper crustal structure of the Cordillera Real

  4. Macroencapsulation of mixed waste debris at the Hanford Nuclear Reservation -- Final project report by AST Environmental Services, LLC

    SciTech Connect (OSTI)

    Baker, T.L.

    1998-02-25

    This report summarizes the results of a full-scale demonstration of a high density polyethylene (HDPE) package, manufactured by Arrow Construction, Inc. of Montgomery, Alabama. The HDPE package, called ARROW-PAK, was designed and patented by Arrow as both a method to macroencapsulation of radioactively contaminated lead and as an improved form of waste package for treatment and interim and final storage and/or disposal of drums of mixed waste. Mixed waste is waste that is radioactive, and meets the criteria established by the United States Environmental Protection Agency (US EPA) for a hazardous material. Results from previous testing conducted for the Department of Energy (DOE) at the Idaho National Engineering Laboratory in 1994 found that the ARROW-PAK fabrication process produces an HDPE package that passes all helium leak tests and drop tests, and is fabricated with materials impervious to the types of environmental factors encountered during the lifetime of the ARROW-PAK, estimated to be from 100 to 300 years. Arrow Construction, Inc. has successfully completed full-scale demonstration of its ARROW-PAK mixed waste macroencapsulation treatment unit at the DOE Hanford Site. This testing was conducted in accordance with Radiological Work Permit No. T-860, applicable project plans and procedures, and in close consultation with Waste Management Federal Services of Hanford, Inc.`s project management, health and safety, and quality assurance representatives. The ARROW-PAK field demonstration successfully treated 880 drums of mixed waste debris feedstock which were compacted and placed in 149 70-gallon overpack drums prior to macroencapsulation in accordance with the US EPA Alternate Debris Treatment Standards, 40 CFR 268.45. Based on all of the results, the ARROW-PAK process provides an effective treatment, storage and/or disposal option that compares favorably with current mixed waste management practices.

  5. Origin of anomalous atomic vibrations in efficient thermoelectrics...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of S(Q,E) measured with INS (left) and calculated (right) with density functional theory (DFT). SnTe results are the top and PbTe results at the bottom. White arrows point...

  6. ONE- AND TWO-PROTON INCLUSIVE SPECTRA IN 800 MeV PROTON-NUCLEUS COLLISIONS AND THE MEAN FREE PATH OF PROTONS IN NUCLEI

    E-Print Network [OSTI]

    Tanihata, I.

    2013-01-01

    path of 2. 5 fm si.ngle~proton data, absolute com~ parisonCAPT IONS Fig. 1. Single-proton inclusive spectra (a) andin (a) Arrows indicate the proton momenta Curves in (b) show

  7. The Effects of Consumer Bliss on Welfare Economics

    E-Print Network [OSTI]

    Barnett, William A.

    1973-03-01

    This article explores the impact of consumer satiation on the functioning of a private ownership economy free from market imperfections. Kenneth Arrow has proved that consumer satiability has no effect on the Pareto optimality of competitive...

  8. Evolution and development in Spiralia: Early progeny of the mesodermal lineage in the leech Helobdella sp. (Austin)

    E-Print Network [OSTI]

    Gline, Stephanie Eve

    2010-01-01

    the mouth as well as an array of thin muscle fibers thatmuscle fibers in the head and RDA containing cells within the mouth (mouth (opening indicated by arrow). At this stage, a thin fan of muscle

  9. Ecological transitions in a coastal upwelling ecosystem

    E-Print Network [OSTI]

    Ohman, MD; Barbeau, K; Franks, PJS; Goericke, R; Landry, MR; Miller, AJ

    2013-01-01

    velocities associated with offshore wind-stress curl upwell-arrows represent weaker offshore wind stress curl upwelling.the onshore-to-offshore gradient in equatorward wind stress.

  10. TRUMAN STATE International Student Pre-

    E-Print Network [OSTI]

    Gering, Jon C.

    : POLICIES & RULES No weapons on campus! · No Guns · No Bow & Arrows · No BB Guns and/or BBs · No Sling shots · No Airsoft guns · No paintball guns · No C02 Canisters for Paintball guns · No ammunition of any kind

  11. Preliminary Thoughts on the Application of Thermodynamics to the Development of Sustainability Criteria

    E-Print Network [OSTI]

    Gutowski, Timothy G.

    In this paper we address the problem of taking the general notion of sustainability as reported in the Brundtland Report and later in Arrow et al approach and interpreting it from a thermodynamics point of view, with a ...

  12. Silicon microrefrigerator

    E-Print Network [OSTI]

    Zhang, Y; Zeng, G H; Shakouri, A

    2006-01-01

    resistance of the device, K/W. Peltier coef?cient, V. I. Ijunction heats up. The Peltier effect occurs because 1521-by the red arrows. The Peltier cooling and heating are

  13. SSAP Annual_13may2013.indb

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1.7 MA Zebra at UNR. a) Photograph of Triple Wire Array load. b) Wire Ablation Dynamic Model predictions at 60 nsec (view from the top). Dotted arrowed lines show the direction of...

  14. On the articulation and the synthesis of space in architectural and urban design

    E-Print Network [OSTI]

    Arioka, Takashi

    1986-01-01

    The problem of observer in contemporary physics, or Heisenberg's principle of uncertainty and Einstein's theory of relativity had considerable strong impact on our notion of time and space. We are in the irreversible arrow ...

  15. Local and synoptic mechanisms causing Southern California’s Santa Ana winds

    E-Print Network [OSTI]

    Hughes, Mimi; Hall, Alex

    2010-01-01

    California’s Santa Ana winds Oceans (Fig. 2). The timem s -1 ) Fig. 4 a Average winds for the Santa Ana cluster,2006). Arrows show total wind, color contours show wind

  16. Motorist interpretation of potential transition symbols in a freeway lane control signal array 

    E-Print Network [OSTI]

    Wohlschlaeger, Steven D

    1994-01-01

    This thesis documents licensed driver response to, interpretation of, and perceived urgency of response to freeway lane control signals (more s . pacifically to the yellow X and yellow diagonal arrow) when displayed in a scene depicting a three...

  17. Competition and Innovation

    E-Print Network [OSTI]

    Gilbert, Richard J

    2007-01-01

    innovation allows a firm to differentiate its products or achieve significantly lower production costs.innovation competition and lower profits from innovation. Arrow (1962) showed that for process innovations that reduce marginal production costs,

  18. An Extended Evaluation of the Readability of Tapered, Animated, and Textured Directed-Edge Representations in Node-Link Graphs

    E-Print Network [OSTI]

    Isenberg, Petra

    arrow ­ S, (b) tapered ­ T, (c) dark-to-light ­ DL (a.k.a intensity ­ I), (d) light-to-dark ­ LD, (e- net. Graphs represent a collection of elements ­ called vertices or nodes ­ as well as the connections

  19. Electrochemical Synthesis and Structural Characterization of Titania Nanotubes

    E-Print Network [OSTI]

    Nguyen, Que Anh

    2010-01-01

    indication of the barrier oxide layer(identified by arrow),on top of the compact oxide layer. These fibers were formedclusters on the compact oxide layer. (b, c) Side view and

  20. Using Self-Assembly to Control Nanoscale Morphology in Semiconducting Polymers for Application in Organic Photovoltaics

    E-Print Network [OSTI]

    Ferreira, Amy Susan

    2015-01-01

    Dr. Miyata prepared the polyimide substrates. ChristopherBefore the addition of polyimide (by Cannon), 200 nm of SiOwill provide those. Once the polyimide is coated, the arrow

  1. Revealing a Novel Mode of Action for an Osteoporosis Drug

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bone beams were subjected to 4-point bending, and after each displacement of 20 mm (black arrow), 20 x-ray scattering measurements were taken (red dashed line). Diffraction...

  2. Sexual Conditioning in the Dyeing Poison Dart Frog (Dendrobates tinctorius)

    E-Print Network [OSTI]

    Gaalema, Diann E.

    2013-01-01

    F. W. , & Schmidt, W. (2007). Poison frogs. Biology, speciesJ. S. (2003). Notes on poison dart frog breeding at thebehavior in a Panamanian poison-arrow frog (Dendrobates

  3. The neural correlates of social attention: automatic orienting to social and nonsocial cues

    E-Print Network [OSTI]

    Greene, Deanna J.; Mooshagian, Eric; Kaplan, Jonas T.; Zaidel, Eran; Iacoboni, Marco

    2009-01-01

    and Arrow cues Table 2 Coordinates (MNI) and peak activationSMG, supramarginal gyrus Table 3 Coordinates (MNI) and peak2009) 73:499–511 Table 4 Coordinates (MNI) and peak

  4. Is Ring breaking feasible in relative binding free energy calculations?

    E-Print Network [OSTI]

    Liu, S; Wang, L; Mobley, DL

    2015-01-01

    the free energy to move each molecule from water to the “energy change by transforming molecule 1 to molecule 2 both in water andenergy for each molecule, green arrows shown in (a), from water

  5. Microsoft Word - CRT 50 yr News Release with logos

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ecological uses of the Columbia River. As a direct result of the Treaty, four storage dams were built: Mica, Arrow and Duncan dams in British Columbia, Canada; and Libby Dam in...

  6. AMSTEX Reference Card Footnotes and Insertions Dimensions (See the TEX Reference Card for\\furtherfcommands)ootnote#1footnote\\footnote"**

    E-Print Network [OSTI]

    Silverman, Joseph H.

    \\fracwithdelims()#1#2fraction\\withnparen.edelime* *tersgmedspacenegative medium space \\rm roman\\smallpageb* *reaksmall space between paragraphs \\Bbb#1 blackboard bold @>#1>#2> right arrow with labels\\medpagebreak* *medium space between paragraphs \\rom#1 Roman @

  7. Accessing Your Account for the ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4. Once you have reviewed the changes made to the RFQ, click the back arrow on your internet browser in order to return to the previous screen titled Amendment History. 12 5....

  8. Atomic structure of postgrowth annealed epitaxial Fe/(001)GaAs interfaces

    E-Print Network [OSTI]

    LeBeau, James; Hu, Qi O.; Palmstrom, Christopher; Stemmer, Susanne

    2008-01-01

    line pro?le across the interface along the line indicated inHAADF images of the GaAs/Fe interface along ?a? ?11 0? GaAsindicates the location of an interface step. Arrows in ?b?

  9. LINEAR MODELS Preliminaries

    E-Print Network [OSTI]

    Spang, Rainer

    ]; arrows(mu[1],mu[2],mu[1]+15,mu[2]+15*PC1[2]/PC1[1],col="red",lty= 1,lwd=2); PC2 = eigen_vectors[,2]; arrows(mu[1],mu[2],mu[1]+15,mu[2]+15*PC2[2]/PC2[1],col="orange",lt y=1,lwd=2); legend

  10. Search for the B{sub c} meson in hadronic Z{sup 0} decays using the OPAL detector at LEP

    SciTech Connect (OSTI)

    Herndon, M.F.

    1999-01-01

    A search for decays of the B{sub c} meson was performed using data collected from 1990--1995 with the OPAL detector on or near the Z{sup 0} peak at LEP. The decay channels B{sub c}{sup +} {r_arrow} J/{psi}{pi}{sup +}, B{sub c}{sup +} {r_arrow} J/{psi}a{sub 1}{sup +} and B{sub c}{sup +} {r_arrow} J/{psi}{ell}{sup +}{nu} were investigated, where {ell} denotes an electron or a muon. Two candidates are observed in the mode B{sub c}{sup +} {r_arrow} J/{psi}{pi}{sup +}, with an estimated background of (0.63 {+-} 0.20) events. The weighted mean of the masses of the two candidates is (6.32 {+-} 0.06) GeV/c{sup 2}, which is consistent with the predicted mass of the B{sub c} meson. One candidate event is observed in the mode B{sub c}{sup +} {r_arrow} J/{psi}{ell}{sup +}{nu}, with an estimated background of (0.82 {+-} 0.19) events. No candidate events are observed in the B{sub c}{sup +} {r_arrow} J/{psi}a{sub 1}{sup +} decay mode, with an estimated background of (1.10 {+-} 0.22) events. Upper bounds at the 90% confidence level are set on the production rates for these processes.

  11. Stop City IntersectionStop # Van Name Arrive Depart Van Stops, Times, & Fees

    E-Print Network [OSTI]

    Mullins, Dyche

    .88Active 7.6DENTAL6:40 CONCORD 59Near Pleasant Hill Bart Station2120.01 CONCORD 12120 7:55 5:05 $195:30 CONCORD 59Near Pleasant Hill Bart Station2120.01 CONCORD 12120 7:55 5:05 $195.12Active 8.05P, LH6:50 DALY, MTZ6:50 ELK GROVE 203LAGUNA & FRANKLIN BLVD.2225.01 ELK GROVE2225 6:15 3:20 $356.40Active 6.4MB

  12. Some properties of amplitudes at multiboson thresholds in spontaneously broken scalar theory

    SciTech Connect (OSTI)

    Voloshin, M.B. (Theoretical Physics Institute, University of Minnesota, Minneapolis, Minnesota 55455 (United States) Institute of Theoretical and Experimental Physics, Moscow 117259 (Russian Federation))

    1993-04-15

    It is shown that in a [lambda][phi][sup 4] theory of one real scalar field with spontaneous breaking of symmetry a calculation of the amplitudes of production by a virtual field [phi] of [ital n] on-mass-shell bosons all being exactly at rest is equivalent in any order of the loop expansion to a Euclidean-space calculation of the mean field of a kink-type configuration. Using this equivalence it is found that all the 1[r arrow][ital n] amplitudes have no absorptive part at the thresholds to any order of perturbation theory. This implies nontrivial relations between multiboson threshold production amplitudes. In particular, the on-mass-shell amplitude of the process 2[r arrow]3 should vanish at the threshold in all loops. It is also shown that the factor [ital n] in the 1[r arrow][ital n] amplitudes at the threshold is not eliminated by loop effects.

  13. Quantum Monte Carlo simulation of spin-polarized H

    SciTech Connect (OSTI)

    Markic, L. Vranjes; Boronat, J.; Casulleras, J.

    2007-02-01

    The ground-state properties of spin polarized hydrogen H{down_arrow} are obtained by means of diffusion Monte Carlo calculations. Using the most accurate to date ab initio H{down_arrow}-H{down_arrow} interatomic potential we have studied its gas phase, from the very dilute regime until densities above its freezing point. At very small densities, the equation of state of the gas is very well described in terms of the gas parameter {rho}a{sup 3}, with a the s-wave scattering length. The solid phase has also been studied up to high pressures. The gas-solid phase transition occurs at a pressure of 173 bar, a much higher value than suggested by previous approximate descriptions.

  14. Red Algae Respond to Waves: Morphological and Mechanical Variation in Mastocarpus papillatus Along

    E-Print Network [OSTI]

    Denny, Mark

    Red Algae Respond to Waves: Morphological and Mechanical Variation in Mastocarpus papillatus Along Grove, California, 93950 Abstract. Intertidal algae are exposed to the potentially severe drag forces generated by crashing waves, and several species of brown algae respond, in part, by varying the strength

  15. intramural fields bissonnet street

    E-Print Network [OSTI]

    Aazhang, Behnaam

    founder's court "John and Anne" Grove campanile road West Lot 2 (faculty, staff, student) Visitor Parking Greenbriar Lot North Lot N bus stop A Bike Track visitor parking visitor parking (faculty, staff, student Student Parking Commuter Parking Visitor Parking Accessible Parking Parking Lots: apB Alice Pratt Brown

  16. visitor parking rice village

    E-Print Network [OSTI]

    Aazhang, Behnaam

    H West Lot 5 Founder's Court Visitor Lot visitor parking faculty, staff, student, contract parking's court John and Anne Grove visitor parking North Lot N Bike Track MEMORIAL HERMANN AT 6400 FANNIN ST Accessible Parking Parking Lots: APB Alice Pratt Brown Hall Lot B Baker College­Housing & Dining Lot BG

  17. Using the Air Void Analyzer for Real-Time Quality Control Adjustments

    E-Print Network [OSTI]

    May 2006 Using the Air Void Analyzer for Real-Time Quality Control Adjustments in the Field Tech Brief by Jim Grove, P.E. Bob Steffes Mark Anderson-Wilk Overview of the Air Void Analyzer The air void analyzer (AVA) with its independent isolation base can be used to accurately evaluate the air void system

  18. College of Science & Engineering Dr. Sheldon Axler, Dean

    E-Print Network [OSTI]

    College of Science & Engineering Dr. Sheldon Axler, Dean Dr. Robert M. Ramirez, Associate Dean Dr & Biochemistry Dr. Dragutin Petkovic, Chair, Department of Computer Science Dr. Wenshen Pong, Director, School of Engineering Dr. Jerry Davis, Chair, Department of Geography & Environment Dr. Karen Grove, Chair, Department

  19. he 1900-foot rule and eradication of citrus canker-affected trees

    E-Print Network [OSTI]

    Burns, Jacqueline K.

    , but disease in infested groves increased rapidly in extent and severity. Locations directly affected by both early- and late-season rain events had increased canker incidence that dis- qualified fruit sales from on these varieties was often associated with exposure to wind- blown rain due to the absence of nat- ural or planted

  20. BSD Postdoctoral Association BulletinSeptember 4, 2007 Included in this bulletin

    E-Print Network [OSTI]

    10-24 In our continuing efforts to better serve the postdoc community, the PDA has prepared a survey on Mondays. Chicago State is located at 95th and King Dr/Cottage Grove on the South Side...it is accessible and plants and microbes, molecular, cell, organismal, ecological, etc. Sincerely, Andrew G. Maselli #12

  1. Equacions Diferencials --Bibliografia Alguns llibres de text

    E-Print Network [OSTI]

    Gràcia, Xavier

    Equacions Diferencials -- Bibliografia Alguns llibres de text 1. W. E. Boyce, R. C. Di/Cole, Pacific Grove, 2002). 11. C. Batlle, I. Massana, M. Zaragoz´a, `Algebra i equacions diferencials, Paris, 1967). 16. L. El'sgol'c, Ecuaciones diferenciales y c´alculo variacional, (Mir, Moscou, 1988). 17

  2. Testing the scaling of thermal transport models: predicted and measured temperatures in the Tokamak Fusion Test

    E-Print Network [OSTI]

    in the Tokamak Fusion Test Reactor dimensionless scaling experiments D. R. Mikkelsen, S. D. Scott Princeton the Tokamak Fusion Test Reactor [D. J. Grove and D. M. Meade, Nucl. Fusion 25, 1167 (1985)] nondimensional to International Tokamak Experimental Reactor [2] (ITER) class tokamaks. This paper compares the predictions

  3. Testing the ae \\Lambda scaling of thermal transport models: predicted and measured temperatures in the Tokamak Fusion Test

    E-Print Network [OSTI]

    in the Tokamak Fusion Test Reactor dimensionless scaling experiments D. R. Mikkelsen, S. D. Scott Princeton the Tokamak Fusion Test Reactor [D. J. Grove and D. M. Meade, Nucl. Fusion 25, 1167 (1985)] nondimensional to extrapo­ late [1] from current experiments to International Tokamak Experimental Reactor [2] (ITER) class

  4. PROGRAM REVIEW October 2 -3, 2014

    E-Print Network [OSTI]

    Virginia Tech

    Fuels and Treating William Maza & Waste Water Mohan Qin 2:15pm Manganese as an Emerging Human Amanda Entrepreneurship Forum Duckpond 1:15pm Thrust Overview Dennis Grove 1:25pm ICTAS II Facility Upgrade to Support Amy

  5. Management of Giant Sequoia on Mountain Home Demonstration

    E-Print Network [OSTI]

    : Established in 1946, the Mountain Home Demonstration State Forest, Tulare County, California, is managed campsites in Tulare County in central California. A unique characteristic of the For est is an extensive groves in the Sierra Nevada from Placer County south to Tulare County. Logging on what is now

  6. Growth Kinetics and Modeling of Direct Oxynitride Growth with NO-O2 Gas Mixtures

    SciTech Connect (OSTI)

    Everist, Sarah; Nelson, Jerry; Sharangpani, Rahul; Smith, Paul Martin; Tay, Sing-Pin; Thakur, Randhir

    1999-05-03

    We have modeled growth kinetics of oxynitrides grown in NO-O2 gas mixtures from first principles using modified Deal-Grove equations. Retardation of oxygen diffusion through the nitrided dielectric was assumed to be the dominant growth-limiting step. The model was validated against experimentally obtained curves with good agreement. Excellent uniformity, which exceeded expected walues, was observed.

  7. by Natasha Vizcarra On the tail of three scorching heat waves in the

    E-Print Network [OSTI]

    forest fires broke out across Greece and destroyed thousands of acres of forest, olive groves industrial and vehicular pollutants lingering in the atmosphere. Did the forest fires cause the city's air from a forest fire near Athens on July 25, 2007. More than 3,000 forest fires burned in Greece

  8. "Lost in the Pacific" Biography of TSgt. Paul Fredrick Adler MIA 1943 

    E-Print Network [OSTI]

    Adler, Paul Earl; Adler, Paul Earl

    2010-08-24

    PA'l'HY - Pres. Dot Owens, 30 OVElllden Way, Lee Mount, Halifax, West Yorks. Good general ST club, they soIl various ST fanzines. S'l'AT{ TItEK INFORMA'l'IOll GIWUP - Hoss Carter, 29 Castle Hoad, Southsea, Portsmouth. OEICOHll - Tracy Cooke, 67 Eden Grove...

  9. STAG UK Newsletter Issue 21 

    E-Print Network [OSTI]

    1977-01-01

    Journal . S'l'AHBASE 13; Brian Longstaff, 13 II oodfarln Dr., Sheffie 10.. S 6 SUi STIG, Eoss Carter, 29 Castle Road, Southsea, Portsmouth. OlHCOHN: Tracy Cooke, 67 Eden Grove, Horfield, Bristol, B57 OPQ A New Club for WILLIAM SHATNER, Pres. Dee Smith...

  10. Sensors and Actuators A 127 (2006) 270275 Plastic 95-GHz rectangular waveguides by micro molding technologies

    E-Print Network [OSTI]

    Lin, Liwei

    2006-01-01

    Sensors and Actuators A 127 (2006) 270­275 Plastic 95-GHz rectangular waveguides by micro molding technologies Firas Sammouraa,, Yu-Chuan Sua, Ying Caib, Chen-Yu Chic, Bala Elamaranc, Liwei Lina, Jung at Arlington, Arlington, TX 76019-0016, USA c Agilent Technologies, 1400 Fountain Grove Pky, San Rosa, CA 95403

  11. Reflectivity and topography of cells grown on glass-coverslips measured with

    E-Print Network [OSTI]

    Ovryn, Ben

    Reflectivity and topography of cells grown on glass-coverslips measured with phase-shifted laser the topography and reflection from calibration spheres and from stress fibers and adhesions in both fixed membrane topography," Cell. Biochem. Bio- phys. 1(3), 391­414 (2004). 11. J. T. Groves, R. Parthasarathy

  12. Superlattices and Microstructures 33 (2003) 95101 www.elsevier.com/locate/jnlabr/yspmi

    E-Print Network [OSTI]

    2003-01-01

    . Balandinb, aJet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Dr. (MS-169; Ge/Si 1. Introduction Raman spectroscopy has proven to be a powerful tool for investigation of arrays branches, e.g. standing waves inside or between quantum dots, etc. [10]. This presents a strong motivation

  13. Near-field scanning optical microscopy of photonic crystal nanocavities Koichi Okamoto,a)

    E-Print Network [OSTI]

    Okamoto, Koichi

    System Section, Jet Propulsion Laboratory, California Institute of Technology, MS 302-306, 4800 Oak Grove used as a powerful alternative method to analyze local electromagnetic field distributions of both illumination mode I- mode and the collection mode C-mode measurements. For the I mode, continuous-wave

  14. Estimated performance of a symmetric nulling coronagraph for exoplanet imaging

    E-Print Network [OSTI]

    Propulsion Laboratory, 4800 Oak Grove Drive, MS 171-113, Pasadena, CA 91101 ABSTRACT The direct detection. The coronagraph is based on interferometric amplitude division technique, in which amplitudes of waves are equally one has optical power in order to introduce a extra focus while the other doesn't has, the starlight

  15. Ultralow-threshold Raman lasing with CaF2 Ivan S. Grudinin and Lute Maleki

    E-Print Network [OSTI]

    Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA, 91109, USA-gallery-mode resonators. Continuous-wave emission threshold is shown to be possible below 1 W with a 5 mm cavity, which components of up to the fifth order were observed at a pump power of 160 W, and up to the eighth order at 1 m

  16. J Low Temp Phys (2008) 151: 684689 DOI 10.1007/s10909-008-9728-3

    E-Print Network [OSTI]

    Golwala, Sunil

    2008-01-01

    whose output power is coupled to MKIDs via in-line color-defining bandpass filters. A prototype software · Submillimeter and millimeter wave detectors PACS 95.55.Jz · 85.25.Pb J. Schlaerth ( ) · J. Glenn Center Jet Propulsion Laboratory, 4800 Oak Grove Drive, M/S: 169-506, Pasadena, CA 91109, USA #12;J Low Temp

  17. arXiv:astro-ph/0309610v229Sep2003 Mon. Not. R. Astron. Soc. 000, 000000 (0000) Printed 30 September 2003 (MN LATEX style file v1.4)

    E-Print Network [OSTI]

    Hu, Wayne

    Propulsion Labratory, 4800 Oak Grove Dr., Pasadena, CA 91109 6Division of Physics, Math and Astronomy in the B-mode spectrum. Such an experiment could also directly detect the gravitational wave component to be a powerful cosmological probe. Successive generations of experiments have provided a stringent test

  18. PROJECT TITLE: Developing a Recycling Plan in a New York City Elementary School TEAM MEMBERS: Miriam N. Ward & Blake Wells

    E-Print Network [OSTI]

    Wolberg, George

    PROJECT TITLE: Developing a Recycling Plan in a New York City Elementary School TEAM MEMBERS in Partial Fulfillment of the Master of Science in Sustainability Degree The City College of New York Grove School 3 I. Abstract New York City provides many of the educational tools to integrate responsible waste

  19. The City College of New York Of the City University of New York

    E-Print Network [OSTI]

    Sun, Yi

    The City College of New York Of the City University of New York Grove School of Engineering. # ______________________________________________________ City State/Country Zip Code 7. Mailing Address (if different from above, or local address. # ______________________________________________________ City State/Country Zip Code 8. Social Security Number: __________--_______--_____________ ( Check here

  20. Landscape and Urban Planning 87 (2008) 269278 Contents lists available at ScienceDirect

    E-Print Network [OSTI]

    Wang, Le

    2008-01-01

    States and Daqing, Heilongjiang province in China. Both cities expanded rapidly on the basis of the petroleum indus- tries during the last 50 years; however, under different socio-political contexts diversity (Grove and Burch, 1997), energy flows (Breuste et al., 1998), and climatic conditions (Orville et

  1. Learning-based versus model-based log-polar feature extraction operators: a comparative study

    E-Print Network [OSTI]

    Fisher, Bob

    Introduction Primal sketch features, like Edges, Bars, Blobs and Ends are part of Marr's [7] hypothesis for an attention mechanism. Marr's original idea was to use differ- ential operators, such as the Laplacian be used to form these features. Inspired by Marr's ideas, Grove and Fisher [4] conceived a vision system

  2. NC State Chemical Engineering Degrees -MS Graduation Name NicknameGrad Date Hometown StateUndergrad Chair Initial Employer Employer City State

    E-Print Network [OSTI]

    Velev, Orlin D.

    William Long Belvin Bill 6/11/1934 Raleigh NC NC State John Colwell McNair 6/11/1934 Wilmington NC NC State William Henry Ayscue Bill 6/10/1935 Henderson NC NC State DuPont Penns Grove NY Gerald Thomas Henry Richard Ireland Henry 6/7/1953 Greensboro NC NC State Beatty Paul Davis Miller Jr Paul 6

  3. Statute miles . 0 10. 20

    E-Print Network [OSTI]

    in the form of cooling water for coastal power stations. The CDFG, through a cooperative agreement with Se S GROVE Artificial Reefs as a Resource Management Option for Siting Coastal Power Stations in SouthernStatute miles . 0 10.·· 20 COUNTY ORANGE plicable to SO GS and potentially any future coastal power

  4. DOI: 10.1126/science.1215429 , 1636 (2012);335Science

    E-Print Network [OSTI]

    2012-01-01

    (2003). 5. K. M. Bishop, G. Goudreau, D. D. O'Leary, Science 288, 344 (2000). 6. T. Fukuchi-Shimogori, E. A. Grove, Science 294, 1071 (2001). 7. D. D. O'Leary, S. J. Chou, S. Sahara, Neuron 56, 252 (2007

  5. PRACTICAL TECHNIQUES FOR VALLEY ELDERBERRY LONGHORN BEETLE MITIGATION1

    E-Print Network [OSTI]

    -24, 1988, Davis, California 2 Resource Ecologist, Jones & Stokes Associates Inc., Sacramento, Calif.; Entomologist, U.S. Fish and Wildlife Service, Sacramento Endangered Species Office, Sacramento Calif of Flood Management, Sacramento Calif.; Owner and Manager, Cornflower Farms, Elk Grove, Calif. The valley

  6. A delta transformed in the sacramento-san joaquin delta

    E-Print Network [OSTI]

    A delta transformed in the sacramento-san joaquin delta ecological functions, spatial metrics Safran A delta transformed in the sacramento-san joaquin delta ecological functions, spatial metrics Grove Fairfield Clarksburg KnightsLanding Sacramento West Sacramento newhope tract mccormack williamson

  7. CX-002275: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Community Renewable Energy Deployment-Sacramento Municipal Utility District: Van Warmerdam DairyCX(s) Applied: A9, B5.1Date: 05/10/2010Location(s): Elk Grove, CaliforniaOffice(s): Energy Efficiency and Renewable Energy, Golden Field Office

  8. A delta transformed in the sacramento-san joaquin delta

    E-Print Network [OSTI]

    A delta transformed in the sacramento-san joaquin delta ecological functions, spatial metrics Safran A delta transformed in the sacramento-san joaquin delta ecological functions, spatial metrics Grove Faireld Clarksburg KnightsLanding Sacramento West Sacramento NEWHOPE TRACT MCCORMACK WILLIAMSON

  9. advertisement | your ad herePrint This Article Back to Robots measure flow of Sacramento

    E-Print Network [OSTI]

    advertisement | your ad herePrint This Article Back to Article Robots measure flow of Sacramento River David Perlman Wednesday, May 9, 2012 A fleet of 100 robots floated down the Sacramento River, demonstrating their ability to navigate the water route from their launch site at Walnut Grove (Sacramento

  10. Two-pulse solutions in the fifth-order KdV equation

    E-Print Network [OSTI]

    Pelinovsky, Dmitry

    Two-pulse solutions in the fifth-order KdV equation Marina Chugunova and Dmitry Pelinovsky (Mc. Existence of localized solutions: · c pulse solutions (Tovbis, 2000; Lombardi, 2000) · 0 - unique one-pulse solution (Amick­Toland, 1992; Groves, 1998) · c > 1 4 - unique one-pulse and infinite

  11. Virginia Tech Conductor AGUIDEFOROURJOURNEY TOWARDEXCELLENCE,EQUITYANDEFFECTIVENESS

    E-Print Network [OSTI]

    Beex, A. A. "Louis"

    transition New friend leads to new opinions The Virginia Tech on-campus transition program (VT/ OCTPVirginia Tech Conductor AGUIDEFOROURJOURNEY TOWARDEXCELLENCE,EQUITYANDEFFECTIVENESS by Austin Morton May 5, 2006 See New opinions on page 3 Poetry at the Grove honors victims At three o

  12. HPCBSHigh Performance Commercial Building Systems Mary Ann Piette and Satkartar Kinney,

    E-Print Network [OSTI]

    .S. General Services Administration Pacific Rim Region (Region 9), manages over 20 million gross square feet information technology activities within GSA's Pacific Rim Region (also known as Region 9). The Pacific Rim in Buildings, August 18-23, 2002, Asilomar Conference Center, Pacific Grove, California, and published

  13. Leisure Systems Design & Evaluation (3cr.) Wednesday 1:00-4:00

    E-Print Network [OSTI]

    Brown, Gregory G.

    Field, A. (2005). Discovering Statistics Using SPSS. (2nd Edition). (and sex, drugs, and rock `n' roll). London: Sage Publications. Dahl, B. and D. Molnar. (2003). Anatomy of a Park (3rd Edition). Long Grove--or recreation program planning--or evaluation of recreation programs and facilities--or evaluation methods

  14. IBM Research June 8, 2004 PLDI'04 Tutorial 2004 IBM Corporation

    E-Print Network [OSTI]

    Grove, David

    1 IBM Research June 8, 2004 PLDI'04 Tutorial © 2004 IBM Corporation Dynamic Compilation and Adaptive Optimization in Virtual Machines Stephen Fink, David Grove, and Michael Hind IBM Research PLDI'04 Tutorial | June 8, 2004 | Dynamic Compilation and Adaptive Optimization in Virtual Machines © 2004 IBM

  15. Released on receipt but intended f o r use

    E-Print Network [OSTI]

    &-Hol*tein earth walls are thrown up and shrubbery is planted upon them, since forest trees cannot be made t o grow- protected portions of the groves AS i n those sheltered by the windbreak. p s e r i e s of anemometers

  16. Tree SelectionTree Selection Why is selection important?

    E-Print Network [OSTI]

    was planned ­ 200 years ago - to give owner and future generations a view of Mississippi River through grove;Tree Selection Style III Process Plan - for the future Purpose - planting goal Ponder - site There are lists from different locations. Utility company Local tree board Native trees #12;Utility Company

  17. The University of Miami's Rosenstiel School of Marine and

    E-Print Network [OSTI]

    Shyu, Mei-Ling

    Fluid Dynamics II Electives: · Advanced Weather Forecasting · Air-Sea Interaction · Applied Data Information #12;Student Life · Most students live in great neighborhoods nearby: Key Biscayne, Brickell, Coconut Grove, Coral Gables · RSMAS is home to a beach, restaurant, and bar called the Wetlab! · Miami

  18. Palomar Testbed Interferometer -Update B.F. Lane a , M.M. Colavita b , A.F. Boden b , P.R. Lawson b (for the PTI Collaboration)

    E-Print Network [OSTI]

    Palomar Testbed Interferometer - Update B.F. Lane a , M.M. Colavita b , A.F. Boden b , P.R. Lawson, 4800 Oak Grove Dr., Pasadena, CA., 91109, USA. ABSTRACT The Palomar Testbed Interferometer (PTI) is a long-baseline near-infrared interferometer operating at Palomar Observatory, CA. The interferometer has

  19. ENGR G6601 Environmental Modeling for Earth Systems Science and Engineering/Syllabus 01/29/2014 City College of New York

    E-Print Network [OSTI]

    Wolberg, George

    ENGR G6601 Environmental Modeling for Earth Systems Science and Engineering/Syllabus 01 Science and Technology ENGR G6601 Environmental Modeling for Earth Systems Science and Engineering/29/2014 City College of New York Grove School of Engineering MS Program in Earth Systems and Environmental

  20. Magnetic Field Structure around Low-Mass Class 0 Protostars: B335, L1527 and IC348-SMM2

    E-Print Network [OSTI]

    Novak, Giles

    Magnetic Field Structure around Low-Mass Class 0 Protostars: B335, L1527 and IC348-SMM2 J Propulsion Laboratory, California Institute of Technology N. H. Volgenau6 California Institute of Technology Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Dr., Ms 264

  1. MGS MAG/ER observations at the magnetic pileup boundary of Mars: draping enhancement and low frequency waves

    E-Print Network [OSTI]

    California at Berkeley, University of

    MGS MAG/ER observations at the magnetic pileup boundary of Mars: draping enhancement and low Propulsion Laboratory, 4800 Oak Grove Drive, Pasadena, CA 91109, USA Received 26 November 2002; received in revised form 19 March 2003; accepted 24 April 2003 Abstract The magnetic pileup boundary (MPB) is a sharp

  2. arXiv:astro-ph/0406184v17Jun2004 Magnetic Effects Change Our View of the

    E-Print Network [OSTI]

    De Zeeuw, Darren L.

    arXiv:astro-ph/0406184v17Jun2004 ` Magnetic Effects Change Our View of the Heliosheath M. Opher , P Propulsion Laboratory, MS 169-506, 4800 Oak Grove Drive, Pasadena, CA 91109 Dept. of Scienza del Spatizo, is one of the most unknown regions theoretically. In the Heliosheath magnetic effects are crucial

  3. Titan ATEP Alum List 2012-13 LAST FIRST YR AFFILIATION SITE E-MAIL

    E-Print Network [OSTI]

    de Lijser, Peter

    Nixa, MO ccbeets@aol.com Belandres Melissa 03 Elk Grove, CA mbelandres@hotmail.com Benitez Evelyn 05 Health Fullerton, CA hlightle@fullerton.edu Callahan-Hill Diane 86 Centinial High School Corona, CA.com Chisar Michael 84 Diablo Valley College Pleasant Hill, CA mchisar@dvc.edu Chu-Coury Cindi 92 Coury

  4. Tools for Easier Gardening By Margaret Hagen

    E-Print Network [OSTI]

    New Hampshire, University of

    Road Elk Grove Village IL 60007 1-800-334-3675 Access to Recreation, Inc. 8 Sandra Court Newbury Park Idea PO Box 955 Vail CO 81658 1-800-538-6690 Ames True Temper 465 Railroad Avenue Camp Hill PA 17001

  5. SANFRANCISCO MokelumneCamanche

    E-Print Network [OSTI]

    Petaluma Napa Novato San Francisco Oakland San Mateo OakdaleTracy Manteca Lodi Rio Vista Galt Elk Grove Hawthorne Mammoth Lakes Benton TonopahSan Jose Morgan Hill Santa Clara Klamath Cedarville Paynes Creek Scotia Leggett Rancho Cordova Lincoln Loomis Coloma Volcano Mokelumne Hill Chinese Camp June Lake

  6. Interaction of waves and currents with kelp forests (Macrocystis pyrifera): Insights from a dynamically scaled laboratory model

    E-Print Network [OSTI]

    Denny, Mark

    . Monismith,c and Jeffrey R. Koseff c a Institute of Marine Sciences, University of North Carolina at Chapel Hill, Morehead City, North Carolina bHopkins Marine Station, Stanford University, Pacific Grove increased the time-averaged drag by a factor of 2 and altered the shape of current profiles. Relative motion

  7. Campus Toolkit What goes around comes around

    E-Print Network [OSTI]

    compostable items such as paper plates and food ware that is approved by Cedar Grove Composting or Biode2 ZERO WASTE Campus Toolkit What goes around comes around #12;11 Zero Waste Campus Toolkit created Campus Zero Waste Program. Graphics and formatting by Charles Taylor-Love and Alex Fallenstedt

  8. THE DESIRE TO ACQUIRE: FORECASTING THE EVOLUTION OF HOUSEHOLD

    E-Print Network [OSTI]

    THE DESIRE TO ACQUIRE: FORECASTING THE EVOLUTION OF HOUSEHOLD ENERGY SERVICES by Steven Groves BASc of Research Project: The Desire to Acquire: Forecasting the Evolution of Household Energy Services Report No, and gasoline. A fixed effects panel model was used to examine the relationship of demand for energy

  9. Biol. Rev. (2014), pp. 000000. 1 doi: 10.1111/brv.12088

    E-Print Network [OSTI]

    Malhi, Yadvinder

    2014-01-01

    of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109, U.S.A. 8 School of Geography, University of Leeds, Leeds LS2 9JT, U.K. ABSTRACT Extreme climatic events and land-use change are known to influence strongly. This review intends to evaluate the effects of both climate and anthropogenic perturbations on the carbon

  10. The origin and implications of clay minerals from Yellowknife Bay, Gale crater, Marsk Thomas F. BrisTow1,

    E-Print Network [OSTI]

    Downs, Robert T.

    TzinGer5 , eLizaBeTh B. ramPe4 , Joy a. crisP6 , cherie n. achiLLes2 , DouG w. minG4 , BeThany L. ehLmann5 91125, U.S.A. 6 Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive

  11. STATE OF CALIFORNIA --THE NATURAL RESOURCES AGENCY ARNOLD SCHWARZENEGGER, Governor CALIFORNIA ENERGY COMMISSION

    E-Print Network [OSTI]

    available on May 18, 2010. This report is a review of the projects submitted under the Biomethane Production Scientific Enhanced Transportation Biomethane Production from Municipal Sludge Digesters ­ Elk Grove Natural Gas Vehicle Fuel ­ Oroville, California · Pixley Biogas ­ Pixley, California · High Mountain Fuels

  12. ECOLOGY OF MOUNTAIN LIONS (Puma concolor) IN THE NORTH DAKOTA BADLANDS: POPULATION DYNAMICS AND PREY USE

    E-Print Network [OSTI]

    in creating and maintaining the automated GPS location retrieval system and database of locations; I know. You always had words of wisdom and encouragement to help me through the many "character building. Grove) driving out in the middle of the night to help with captures. Brian Hosek was integral

  13. Marine Ecomechanics Mark W. Denny1

    E-Print Network [OSTI]

    Denny, Mark

    Marine Ecomechanics Mark W. Denny1 and Brian Gaylord2 1 Hopkins Marine Station, Stanford University, Pacific Grove, California 93950; email: mwdenny@stanford.edu 2 Bodega Marine Laboratory and Department The Annual Review of Marine Science is online at marine.annualreviews.org This article's doi: 10.1146/annurev-marine

  14. Double Higgs boson production via WW fusion in TeV e sup + e sup minus collisions

    SciTech Connect (OSTI)

    Barger, V.; Han, T. . Dept. of Physics)

    1990-04-10

    The production of two standard model Higgs bosons via the WW fusion process e{sup +}e{sup {minus}} {r arrow} {bar v}{sub e}v{sub e}HH would test the predicted HHH, HWW and HHWW couplings. At TeV energies this fusion cross section dominates over that from e{sup +}e{sup {minus}} {r arrow} ZHH and would give significant event rates for M{sub H}{approx lt} 1/2 M{sub z} at high luminosity e{sup +}e{sup {minus}} colliders. The authors evaluate the rates and present the dynamical distributions.

  15. Analytic equivalence of geometric transitions

    E-Print Network [OSTI]

    Michele Rossi

    2014-08-28

    In this paper \\emph{analytic equivalence} of geometric transition is defined in such a way that equivalence classes of geometric transitions turn out to be the \\emph{arrows} of the \\cy web. Then it seems natural and useful, both from the mathematical and physical point of view, look for privileged arrows' representatives, called \\emph{canonical models}, laying the foundations of an \\emph{analytic} classification of geometric transitions. At this purpose a numerical invariant, called \\emph{bi--degree}, summarizing the topological, geometric and physical changing properties of a geometric transition, is defined for a large class of geometric transitions.

  16. Microfluidic Acoustic System to Generate Aged Yeast for Cell Aging Studies 

    E-Print Network [OSTI]

    Krenek, Keith

    2015-05-07

    of each row show the inlet (far right) and the outlet with DEP OFF (middle) and ON (far left). Yeast entered the image fields-of-view from the right (red arrows) and flowed into the main microchannel from the right side (top of image). The bottom row... to the flow direction toward the opposite channel wall. The three images of each row show the inlet (far right) and the outlet with DEP OFF (middle) and ON (far left). Yeast entered the image fields-of-view from the right (red arrows) and flowed into the main...

  17. NATURE GEOSCIENCE | ADVANCE ONLINE PUBLICATION | www.nature.com/naturegeoscience 1 news & views

    E-Print Network [OSTI]

    Avouac, Jean-Philippe

    .1 Lorca earthquake. a, González et al.5 suggest that water extraction from an aquifer could have triggered to regional tectonics (red arrows). Water extraction caused a drop in the water table and unloaded an area by the impoundment of reservoir lakes, hydrocarbon extraction, quarrying and deep well injections have been

  18. Bioenergy 2015: Attendee Networking Tool

    Broader source: Energy.gov [DOE]

    For the Bioenergy 2015 Conference, this tool offers a concise listing of participants' background, areas of expertise, areas of need, and business contact information. Users can sort the information by clicking on the arrows in the header rows. Users can also filter by keywords by typing them into the search field in order to find individuals with skill sets complementary to their own.

  19. Dynamic Optimization for Functional Reactive Programming using Generalized Algebraic Data Types

    E-Print Network [OSTI]

    Nilsson, Henrik

    practical purposes. However, this may require quite sophisticated library implementa- tions in the form of a self-optimizing, arrow-based Haskell combinator library. The paper has two aims. Firstly of "pre-composed" primitives that were there mainly for per- formance reasons are no longer needed

  20. 17 April 2000 Z .Physics Letters A 268 2000 241246

    E-Print Network [OSTI]

    D'Ariano, Giacomo Mauro

    17 April 2000 Z .Physics Letters A 268 2000 241­246 www.elsevier.nlrlocaterphysleta Isotropic phase 23 December 1999; accepted 9 March 2000 Communicated by P.R. Holland Abstract We prove that isotropic squeezing of the phase is equivalent to reversing the arrow of time. q 2000 Published by Elsevier Science B

  1. Statistical mechanics of the vacuum

    E-Print Network [OSTI]

    Christian Beck

    2012-03-01

    The vacuum is full of virtual particles which exist for short moments of time. In this paper we construct a chaotic model of vacuum fluctuations associated with a fundamental entropic field that generates an arrow of time. The dynamics can be physically interpreted in terms of fluctuating virtual momenta. This model leads to a generalized statistical mechanics that distinguishes fundamental constants of nature.

  2. Determining the gluonic content of isoscalar mesons

    SciTech Connect (OSTI)

    Close, F.E. [Rutherford Appleton Laboratory, Chilton, Didcot, OX11 0QX (England)] [Rutherford Appleton Laboratory, Chilton, Didcot, OX11 0QX (England); Farrar, G.R. [Department of Physics and Astronomy, Rutgers University, Piscataway, New Jersey 08855 (United States)] [Department of Physics and Astronomy, Rutgers University, Piscataway, New Jersey 08855 (United States); Li, Z. [Physics Department, Peking University, Beijing, 100871, Peoples Republic of (China)] [Physics Department, Peking University, Beijing, 100871, Peoples Republic of (China)

    1997-05-01

    We develop tools to determine the gluonic content of a resonance of known mass, width, and J{sup PC} from its branching fraction in radiative quarkonium decays and production cross section in {gamma}{gamma} collisions. We test the procedures by applying them to known q{bar q} mesons, then analyze four leading glueball candidates. We identify inconsistencies in data for J/{psi}{r_arrow}{gamma}f{sub 0}(1500) and J/{psi}{r_arrow}{gamma}f{sub J}(1710) whose resolution can quantify their glueball status. When {Gamma}(f{sub 0}(1500){r_arrow}{gamma}{gamma}) and {Gamma}(f{sub J}(1710){r_arrow}{gamma}{gamma}) are known, the n{bar n},s{bar s},gg mixing angles can be determined. The enigmatic situation in the 1400-1500 MeV region of the isosinglet 0{sup {minus}+} sector is discussed. {copyright} {ital 1997} {ital The American Physical Society}

  3. IEEE ELECTRON DEVICE LETTERS, VOL. 22, NO. 5, MAY 2001 233 Interface Traps at High Doping Drain Extension

    E-Print Network [OSTI]

    Fu, Li Ming

    to induce the thermal-trap-tunneling process of electron transition from the conduction band to the valence the conduction band, and the arrow NT indicates the net process of electron tunneling from traps to the valenceIEEE ELECTRON DEVICE LETTERS, VOL. 22, NO. 5, MAY 2001 233 Interface Traps at High Doping Drain

  4. Banks, credit-card issuers warn of e-mail breach By LAURA GREEN

    E-Print Network [OSTI]

    Fernandez, Eduardo

    ' credit card numbers, for example, were hacked, said Roy Levow, Florida Atlantic University computer carefully read any messages that appear to come from your bank. The affected businesses include Capital One business. Hover your arrow over the link in the e-mail and the address will show up, Levow said. If the web

  5. Instructions for connecting to the Sun Workstations Using the EOD Client.

    E-Print Network [OSTI]

    Califf, Mary Elaine

    Instructions for connecting to the Sun Workstations Using the EOD Client. 1. The Exceed on Demand box will open: For host name enter 10.21.100.49. 4. Enter your Sun credentials (User ID and Password) in the spaces provided. In the Xconfig selection box, choose "All SUN Hosts" and then click on the green arrow

  6. You Can't Go Holmes Again

    E-Print Network [OSTI]

    Mulligan, Lumen N.

    2012-01-01

    Under the standard interpretation of 28 U.S.C. § 1331, the so called Holmes test, pleading a federal cause of action is sufficient for finding federal question jurisdiction. In January 2012, the Supreme Court, in Mims v. Arrow Financial Services...

  7. Pervasive informatics and persistent actimetric information in health smart homes

    E-Print Network [OSTI]

    Fouquet, Yannick

    Pervasive informatics and persistent actimetric information in health smart homes Yannick Fouquet (arrows) for localizing dependent people in a health smart home (left) & pressure sensors (right: FSA Seat integrated smart home (HsH). In general, the underlying principle of the HsH consists in continuously

  8. Time and Matter An International Colloquium on the Science of Time

    E-Print Network [OSTI]

    Time and Matter An International Colloquium on the Science of Time August 11 - 17, 2002 at Venice International University, Italy Topics: Precise measurements of time Arrow of time in classical and quantum physics Tunneling time and various paradoxa in quantum physics Matter, antimatter and microscopic time

  9. YES User Guide Adding a Class to Cart

    E-Print Network [OSTI]

    Palmeri, Thomas

    Registration". 2. Use the drop down arrow to select the term. 3. Enter the subject area, course number". · Enter the class information below as needed and click "Search". 4. Once you click "Search", the class, or title into the text box and click "Search". · To search using additional criteria click "Advanced

  10. Towards a biosensor based on Anti Resonant Reflecting Optical Waveguide fabricated from porous silicon.

    E-Print Network [OSTI]

    Boyer, Edmond

    (PS) material can be used as a transducer for the development of a new optical biosensor. Compared mode of an optical biosensor using the ARROW structure. We reported here an extensive study whereB/cm and 3 dB/cm for Transverse Electric (TE) and 1 Electronic mail : mohamed-lazhar.haji@univ-rennes1.fr hal

  11. PLASMAQUEST STANDARD OPERATING PROCEDURE CORAL Name: Plasmaquest

    E-Print Network [OSTI]

    Reif, Rafael

    you're finished with the BCL3, you notify the Specialist again. This time so the tank can be shut this button disables the power to the entire system (but not the vacuum pumps). Use this button in emergency, press the SET TEMPERATURE button. Then use the UP and DOWN Arrows to set the temperature. Press the SET

  12. Oceanography December 2008 53 THE WINDDRIVEN COASTAL OCEAN: NOW IN HIGHDEF

    E-Print Network [OSTI]

    Pierce, Stephen

    of wind-driven coastal ocean ecosystems. ese tools allowed us to probe the entire water column, the air (vertical sections), winds and ocean currents (arrows), and surface chlo- rophyll (green shades at seaOceanography December 2008 53 THE WINDDRIVEN COASTAL OCEAN: NOW IN HIGHDEF By John A. Barth, John M

  13. 6 Radar wind profiler and radiosonde wind vectors during MILAGRO This supplemental section shows vertical profiles of horizontal wind vectors from the radar wind profilers at T0, T1

    E-Print Network [OSTI]

    Meskhidze, Nicholas

    6 Radar wind profiler and radiosonde wind vectors during MILAGRO This supplemental section shows vertical profiles of horizontal wind vectors from the radar wind profilers at T0, T1 and T2 along with radiosonde wind vectors at MEX and T1 (labelled as T1R). An arrow pointing up shows winds blowing towards

  14. The following are considered prohibited articles and are prohibited at SRS and its facilities unless in the possession of a person who has obtained specific authorization for them

    E-Print Network [OSTI]

    Georgia, University of

    unless in the possession of a person who has obtained specific authorization for them: · weapons (cross-bows, bows and arrows, martial arts weapons such as butterfly knives, other fixed blade knives not intended, vials and pipes designed to smoke hashish or marijuana. · tear gas, chemical mace, and devices

  15. The METAflow package for METAPOST Kevin W. Hamlen

    E-Print Network [OSTI]

    Hamlen, Kevin W.

    The METAflow package for METAPOST Kevin W. Hamlen January 2, 2013 Abstract This package supplies.g., rectangles, ovals, drums, etc.), text labels, fill patterns, and arrow connectors. 1 Introduction METAPOST the resulting documents more convenient to serve over the web. The METAflow package creates convenient METAPOST

  16. Typesetting spectral sequences in LATEX with Tilman Bauer

    E-Print Network [OSTI]

    Bauer, Tilman

    The present package, sseq, facilitates the typesetting of mathematical objects called spectral sequence charts circles or boxes, digits etc.), possibly decorated with labels, and between any two such symbols may or may not be a connection--e. g., a line, an arrow, or some curved line. The sseq package is built

  17. Quick Notes on CO2 Diagram and Energy Diagram For the ESRP 285 Website (Spring 2008)

    E-Print Network [OSTI]

    Ford, Andrew

    (CO2) emissions are the largest source of greenhouse gas emissions, accounting for over 80% of the emissions in the USA (EIA 2003, p. 35). CO2 emissions arise from the combustion of carbon fuels arrows are sized to represent emissions in million metric tons of CO2 equivalent, hereafter abbreviated

  18. Publications Indian Ocean

    E-Print Network [OSTI]

    : "Kinematics and Dynamics" and "Thermodynamics." The first section portrays sea level pressure, resultant wind (arrows and isotachs), directional steadiness of wind, divergence, relative vorticity, and cui of wind St., Madison, WI 53715; the cost is $70.00. EDIS Prints Great Lakes Data Catalog EDIS' National

  19. Hydroxyl radical production via the photo-Fenton reaction in natural waters

    E-Print Network [OSTI]

    Southworth, Barbara A. (Barbara Anne), 1973-

    2002-01-01

    This dissertation investigates the importance of photo-Fenton chemistry in natural waters. The Fenton reaction, H202 + Fe(ll) [right arrow] Fe(ll) + OH- + OH', can occur in sunlit waters because both H202 and Fe(ll) are ...

  20. Getting To Know Matlab The following worksheets will introduce Matlab to the new user. Please, be

    E-Print Network [OSTI]

    Barkana, Rennan

    Getting To Know Matlab The following worksheets will introduce Matlab to the new user. Please is to be typed in Matlab. 2. Using the arrows you can scroll in the previous Matlab commands, so you do not have advisor at the end of the lesson. 1. What is Matlab? Matlab is a technical computing environment for high

  1. Animatronic Shader Lamps Avatars Peter Lincoln Greg Welch Andrew Nashel Andrei State Adrian Ilie Henry Fuchs

    E-Print Network [OSTI]

    State, Andrei

    (inset and red arrow). In (d) we show the avatar of the user, consisting of a Styrofoam head mounted view of the avatar site, acquired by two co-located cameras mounted above the Styrofoam head in (d-sized Styrofoam head mounted on a pan-tilt unit. The system captures imagery of a moving, talking user and maps

  2. CONVERSATION ON CONSENSUS THE NATIONAL HUMANITIES CENTER

    E-Print Network [OSTI]

    Wagner, Carl

    . · Any function F: A(n,m;s,V) A(m;s,V) is called an allocation aggregation method (AAM). Each AAM F, with universal domain conditions. 2. Impossibility (i.e., Arrow-type) theorems. Example: ALLOCATION AGGREGATION the value assigned by individual i to variable xj. Any such matrix is called an s-allocation matrix. If n

  3. Mixed normal-superconducting states in the presence of strong electric currents

    E-Print Network [OSTI]

    Mixed normal-superconducting states in the presence of strong electric currents Yaniv Almog stability. For steady-state solutions in the large limit, we prove that the superconductivity order A = A + , = - t , = ei . (1.8) 3 #12;c c i i Jin Jout Figure 1: Typical superconducting sample. The arrows denote

  4. A low-temperature source for the generation of uranium Henry U. Lee and Richard N. Zare

    E-Print Network [OSTI]

    -temperature uranium vapor source. The four boldface arrows point to where a mirror- like film is deposited whenA low-temperature source for the generation of uranium vapor Henry U. Lee and Richard N. Zare Department of Chemistry, Columbia University, New York, New York 10027 (Received 8 September 1975) Uranium

  5. Commercial Fertilizers in 1946-47. 

    E-Print Network [OSTI]

    Ogier, T. L. (Thomas Louis); Fudge, J. F. (Joseph Franklin)

    1947-01-01

    Milorganite Smith Money Maker All-Weather Four Leaf Mr. 0 Smith Nitro-F'hos Arcadian Fulton's Plantabbs N. J. Soiless-Hydroponics Armstrong's Prescription Goldenrod Nulife Soylaid Arrow Standard Green Acre Old Black Joe Star Best Bet Gro-Crop Owl Siauffer...

  6. 09/10/2009 17:48Why Chimpanzees Make Bad Suicide Bombers : The Primate Diaries Page 1 of 15http://scienceblogs.com/primatediaries/2009/08/why_chimpanzees_make_bad_suici.php

    E-Print Network [OSTI]

    Gardner, Andy

    Search Recent Posts Afghanistan's Arrow and the Cycle of Imperial Hubris Is Bisphenol-A Turning Our Kids that Religion Really Does Poison Everything Jim Lippard on Is Bisphenol-A Turning Our Kids Nasty? Bob O'H on Evidence that Religion Really Does Poison Everything EMJ on Is Bisphenol-A Turning Our Kids Nasty? Jim

  7. Measurement of the W and Z boson production cross sections in p{anti p} collisions at {radical}s = 1.8 TeV with the D0 detector

    SciTech Connect (OSTI)

    Grudberg, P.M.

    1997-01-01

    This thesis reports on the measurement of the W and Z boson inclusive production cross sections ({sigma}{sub W} and {sigma}{sub Z}) times electronic branching ratios (Br(W {r_arrow} e{nu}) and Br(Z {r_arrow} ee)) in p{anti p} collisions at {radical}s = 1.8 TeV. The analysis is based on 12.8 pb{sup {minus}1} of data taken in the 1992--1993 run by the D0 detector at the Fermilab Tevatron collider; the cross sections were measured to be: {sigma}{sub W} {center_dot} Br(W {r_arrow} e{nu}) = 2.36 {+-} 0.02 {+-} 0.07 {+-} 0.13 nb and {sigma}{sub Z} {center_dot} Br(Z {r_arrow} ee) = 0.218 {+-} 0.008 {+-} 0.008 {+-} 0.012 nb. The first error is statistical, the second error represents the non-luminosity systematic error, and the third error shows the uncertainty in the luminosity determination. Future prospects for similar measurements based on larger samples of data are discussed.

  8. Graphical Economics Sham M. Kakade, Michael Kearns, and Luis E. Ortiz

    E-Print Network [OSTI]

    Ives, Zachary G.

    Graphical Economics Sham M. Kakade, Michael Kearns, and Luis E. Ortiz Department of Computer-theoretic generalization of classical Arrow-Debreu economics, in which an undirected graph specifies which consumers and economics, graphical games, and graphical models for probabilistic inference. 1 Introduction Models

  9. Graphical Economics Sham M. Kakade, Michael Kearns, and Luis E. Ortiz

    E-Print Network [OSTI]

    Kakade, Sham M.

    Graphical Economics Sham M. Kakade, Michael Kearns, and Luis E. Ortiz Department of Computer­theoretic generalization of classical Arrow­Debreu economics, in which an undirected graph specifies which consumers and economics, graphical games, and graphical models for probabilistic inference. 1 Introduction Models

  10. Office of International Education International Student, Scholar, and Immigration Services

    E-Print Network [OSTI]

    Arnold, Jonathan

    1 Office of International Education International Student, Scholar, and Immigration Services 1324 ACCESS TO iSTART 1. Navigate your browser to https://istart.uga.edu 2. Click on "Administrative Services on "Departmental Services" in the left-hand menu (red arrow). 4. Click on "Departmental Access Request" in the sub

  11. Harvesting Energy from Wastewater Treatment

    E-Print Network [OSTI]

    Harvesting Energy from Wastewater Treatment Bruce Logan Penn State University #12;Energy Costs? 5 #12;Energy content of Wastewaters · Electricity "lost" to water and wastewater treatment= 0.6 quad wastewater (primary clarifier effluent) Arrows indicate wastewater addition P= 28 mW/m2 (PEM/Nafion) =146 m

  12. LANDFILL UNDERGROUND POLLUTION DETECTION AND CHARACTERIZATION USING INORGANIC TRACES

    E-Print Network [OSTI]

    Short, Daniel

    LANDFILL UNDERGROUND POLLUTION DETECTION AND CHARACTERIZATION USING INORGANIC TRACES M. O. LOOSER1 received 1 January 1998; accepted in revised form 1 January 1999) AbstractÐSince water is the main contamination arrow in the underground, it is necessary to get good indicators to be able to detect pollution

  13. Generalized Conceptual Models Wetlands Regional Monitoring Program

    E-Print Network [OSTI]

    to re-suspension of tidal flat sediments by wind-generated waves (Krone 1979, Schoellhamer and Burau Wetlands as Transitional Environments (larger arrows represent larger fluxes of materials or energy WETLAND ECOLOGY The evolution and natural maintenance of tidal wetlands depen

  14. A Case Study on the Automatic Composition of Network Application Mashups Maxim Shevertalov and Spiros Mancoridis

    E-Print Network [OSTI]

    Mancoridis, Spiros

    into the input of an- other. To support the development of mashups, Microsoft and Yahoo have released tools], and Yahoo calls their analogous tool Yahoo Pipes [3]. These tools provide adapters for sev- eral open APIs. They represent an API as a box in a diagram and allow developers to draw arrows to signify data flow be- tween

  15. 01-002(b)-00 P00206010013

    E-Print Network [OSTI]

    rock check dam ACID-SMA-2 52.651 Acres P00202040018 established vegetation, green hatch area Acid-001 45-002 ACID-SMA-2 52.651 Acres Ashley Pond Pueblo Canyon Acid C a nyon MAP: P002-13-0006-207-ACID2 SMA drainage area Structure LANL boundary ¬« Fire hydrant Security fence Flow arrow Unpaved road

  16. THE SUNSPOT All the news under the Sun

    E-Print Network [OSTI]

    Mojzsis, Stephen J.

    THE SUNSPOT All the news under the Sun September 1, 2008 Volume 1, Issue 1 The blue arrows in this picture show a Coronal Mass Ejection (CME) leaving the Sun. A CME is a violent eruption from the Sun. In this image, the center of the Sun is blocked out by the SOHO spacecraft so the outside of the Sun can be seen

  17. Exam Category Theory and Topos Theory May 26, 2014; 10:0013:00

    E-Print Network [OSTI]

    van Oosten, Jaap

    , and whether it preserves all colimits. Give a short argument in each case. a) The functor Pos Pos which sends, where A is a fixed nonempty set and + denotes disjoint sum. c) The inclusion functor from Pos to Pos; the objects of Pos are posets with a bottom element, and its arrows are order-preserving maps which preserve

  18. PS11900 Winter 2008 V1.1 The Hertzsprung-Russel Diagram

    E-Print Network [OSTI]

    Collar, Juan I.

    are logarithmic, so you are looking at stars over a huge range of temperature and brightness. Label the directions of redder color, and higher temperatures on the x-axis. Label higher luminosity on the Y-axis. Label the Main Sequence and draw an arrow in the direction stars would go as they evolve off the main sequence

  19. The development and operational testing of an experimental reactor for gas-liquid-solid reaction systems at high temperatures and pressures 

    E-Print Network [OSTI]

    Hess, Richard Kenneth

    1985-01-01

    , but REACTANTS IN P L'MP CATALYST BED PROD L'CT5 OUT Figure 2. A schematic drawing of an external recycle reactor. ARROWS SHOW FLUID FLOW PATTERN TC PORT CATALYST BED TC PORT INLET IMPELLER OUTLET IMPELLER SHAFT Figure 3. A ISerty reactor. 10...

  20. Event Photography Setting up the Camera

    E-Print Network [OSTI]

    Zhou, Chongwu

    the exposure. #12;Shooting Basics » Support the bottom of the camera with your left hand and rest your elbows button (marked with a lightning bolt arrow) on the front right side of the camera. Make sure you your left hand under the camera for support, use the same hand to adjust the focusing ring on the end

  1. Page 1 of 4 Creating and Submitting a Key Request

    E-Print Network [OSTI]

    Howitt, Ivan

    of employees. Enter search criteria in the search fields available and select the down red arrow to filter the terms. #12;Page 3 of 4 13. On the Key Request Form - Room List windowpane, select Add New. 14 use the Select Drawing button after entering the building and floor to display the floor plan

  2. Table 3-2. Activity and idea summary for unit 2, cycle 3: Combining Pushes and Pulls. Activity Activity Summary Benchmark Ideas

    E-Print Network [OSTI]

    Sandifer, Cody

    54 Table 3-2. Activity and idea summary for unit 2, cycle 3: Combining Pushes and Pulls. Activity, and then the teacher leads a class discussion as to which ideas best explain the cycle phenomena. All cycle ideas. A5, Power Drive: Going fishing Students use pull arrows and various motion representations to represent

  3. 2004 NaturePublishing Group covering approximately 150 years. It was shown that even under the

    E-Print Network [OSTI]

    Sereno, Martin

    % of the strong warming since then can be of solar origin. There are 31 periods during which the 10-year averaged. The current level of high solar activity has now already lasted close to 65 years and is marked by the arrow on the figure. This implies that not only is the current state of solar activity unusually high, but also

  4. ¹?C(n,?) ¹?C as a Test Case in the Evaluation of a New Method to Determine Spectroscopic Factors Using Asymptotic Normalization Coefficients 

    E-Print Network [OSTI]

    McCleskey, Matthew Edgar

    2012-02-14

    . The direct neutron capture rate on ¹?C is important for a variety of topics of interest in astrophysics, and the ANC for ¹?C[left right arrow]¹?C+n was also used to calculate this reaction rate. The objective of the first part of this work was to find the ANC...

  5. Exploring the Deep... Exploring the Ocean Environment Unit 4Marine Productivity

    E-Print Network [OSTI]

    Wright, Dawn Jeannine

    that consumes other organisms. Figure 2. Simple marine food chain. Arrows represent the transfer of energy fromGEO/OC 103 Exploring the Deep... Lab 7 #12;Exploring the Ocean Environment Unit 4­Marine Productivity 123 Unit 4 Marine Productivity Inthisunit,youwill · Discoverpatternsinglobalprimaryproductivity

  6. OIMB GK12 CURRICULUM 4th Grade 60 minutes

    E-Print Network [OSTI]

    on energy from the sun. ! A food web illustrates energy transfer through feeding interactions. ! Organisms the sun (the grass); a consumer cannot make its own energy from the sun, but gets it from #12;OIMB GK12 a consumer, consuming the rabbit. The arrow and energy go from the rabbit to the fox. 3. Bring in the Sun

  7. Spectroscopy at the high-energy electron beam ion trap (Super EBIT)

    SciTech Connect (OSTI)

    Widmann, K.; Beiersdorfer, P.; Crespo Lopez-Urrutia, J.R.

    1996-07-10

    The following progress report presents some of the x-ray measurements performed during the last year on the Livermore SuperEBIT facility. The measurements include: direct observation of the spontaneous emission of the hyperfine transition in ground state hydrogenlike holmium, {sup 165}Ho{sup 66{plus}}; measurements of the n {equals} 2 {r_arrow} 2 transition energies in neonlike thorium, Th{sup 80{plus}}, through lithiumlike thorium, Th{sup 87{plus}}, testing the predictions of quantum electrodynamical contributions in high-Z ions up to the 0.4{percent} level; measurements of the isotope shift of the n= 2 {r_arrow} 2 transition energies between lithiumlike through carbonize uranium, {sup 233}U{sup 89{plus}...86{plus}} and {sup 238}U{sup 89{plus}...86{plus}}, inferring the variation of the mean- square nuclear charge radius; and high-resolution measurements of the K{alpha} radiation of heliumlike xenon, Xe{sup 52 {plus}}, using a transmission-type crystal spectrometer, resolving for the first time the ls2p{sup 3}P{sub 1} {r_arrow} 1S{sup 2} {sup 1}S{sub 0} and ls2s{sup 3}S{sub 1} {r_arrow} 1S{sup 2} {sup 1}S{sub 0} transitions individually. 41 refs., 9 figs., 1 tab.

  8. Defining the Syntax and the Semantics of a Visual Programming Language in a Spatial Logic

    E-Print Network [OSTI]

    Leeds, University of

    , School of Computer Studies, University of Leeds, Leeds LS2 9JT, England. \\Lambda 1 Introduction. An agent may contain one or more rules which can be used to process incoming messages. \\Lambda Email: fagc,goodayg@scs.leeds additional elements. An agent is a closed contour containing rules, a call arrow or a label. It may have any

  9. Emerald Insight Emerald eJournals. Contains over 200 management journals featuring comprehensive coverage of

    E-Print Network [OSTI]

    Po, Lai-Man

    arrow to narrow search to Journals, Books, or Case Studies. 1. Enter search term(s) and click Search to Journals, Books or Case Studies (Emerald Emerging Markets Case Studies). 2. Enter search term(s) and select Search **This limit is only available when searching in Journals. Search tips Multiple words entered

  10. Learning in Network Contexts: Experimental Results from Simulations

    E-Print Network [OSTI]

    Greenwald, Amy

    roman numeral 4 #18; subset 2 member 1 in#12;nity ! right arrow [ left square bracket ] right square function I boldface roman numeral 1 II boldface roman numeral 2 III boldface roman numeral 3 IV boldface bracket ( left parenthesis ) right parenthesis f left set bracket g right set bracket 3 #12; List

  11. available to OSU students at any can be accessed from any computer

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    a citation. WHERE TO SAVE DOCUMENTS #12;1 4 2 · In Microsoft Office, i.e. Word, Excel, PowerPoint,: click File Save As... · In Adobe, i.e. PDF documents,: at the top left, click Find the "Save In" drop down arrow. Select the location where you want your document saved. · For floppy/diskette select "3 1/2 in

  12. UNIVERSITY OF SUSSEX Getting Started with IBM

    E-Print Network [OSTI]

    Sussex, University of

    REPORTS 6 B. ADD A PORTAL TAB 6 3. SAVING COPIES OF YOUR REPORTS 8 A. CHANGE format) or Save report to Excel by clicking on the down arrow next to the pdf icon then click on View you to open or save the report in the chosen format. #12;Type your search criteria (eg all or part

  13. YES User Guide 1 | P a g e updated 4/21/15

    E-Print Network [OSTI]

    Bordenstein, Seth

    landing page, click "Student Registration". 2. Use the drop down arrow to select the term. 3. Enter the subject area, course number, or title into the text box and click "Search". 4. To search using additional criteria click "Advanced". · Options for advanced search include: a. Course title--all or part (e

  14. A brief guide to access the Wound Healing and Management (WHAM) Node via JBI COnNECT+

    E-Print Network [OSTI]

    Mucina, Ladislav

    (WHAM) click on the Node title as indicated by the red arrow. #12; Enter your search term; in this example I have entered the term `wound' And/or use the drop-down menus to define the boundaries of your search. #12; The search term `wound' within the WHAM Node returned 35 Evidence Summaries; 7 Recommended

  15. Data Stream Query Optimization Across System Boundaries of Server and Sensor Network

    E-Print Network [OSTI]

    Lindner, Wolfgang

    (SNs). Such networks may consist of small battery-powered motes with possibly lossy wireless of the motes. This paper fo- cusses on such SNs of battery-powered motes. SNQPs act as a natural data source The Borealis system [11] uses the box-and-arrow paradigm to specify the data flow. A box represents a query

  16. Primary coal crushers grow to meet demand

    SciTech Connect (OSTI)

    Fiscor, S.

    2009-09-15

    Mine operators look for more throughput with less fines generation in primary crushers (defined here as single role crushers and two stage crushers). The article gives advice on crusher selection and application. Some factors dictating selection include the desired product size, capacity, Hard Grove grindability index, percentage of rock to be freed and hardness of that rock. The hardness of coal probably has greatest impact on product fineness. 2 refs., 1 fig., 1 tab.

  17. University Calendar, August 15, 2012

    E-Print Network [OSTI]

    2012-08-15

    Orientation. Call Heidie Grove-Tosaka. Departmental. School of Architecture Welcome Barbecue. 12 p.m. Behind Marvin Hall. Free. Sponsored by New Student Orientation. Departmental. School of Music New Student Welcome. 12 p.m., Swarthout Recital Hall... Utopias: An Example of Contemporary Practice from Switzerland. Prof. Isidor Wallimann. Noon. 706 Fraser Hall. Free. Sponsored by Department of Sociology. Call 785-864-4111. Public Event. Tea at Three. 3 p.m., Kansas Union. Free. Sponsored by New...

  18. Center for Successful Aging California State University, Fullerton

    E-Print Network [OSTI]

    de Lijser, Peter

    Year 21-35 Farmers Tustin El Camino & 3rd 9 a ­ 1 p, All Year Over 35 Farmers #12;There are general & Garden Grove Blvd 10 a ­ 3 p, All Year Unknown Great Park The Great Park in Irvine, Marine Way off Sand Canyon 10 a ­ 2 p, All Year 21-35 Farmers Tuesdays Brea Brea Blvd & Birch Street 4 p ­ 8 p, All Year

  19. Copyright 2014 by George Peter Bird. This edition may be freely distributed, duplicated, performed, and recorded. Sole (q. = 90)

    E-Print Network [OSTI]

    Bird, Peter

    groves trees hud dle,- green Si f ir- us.- mf mp Enduring2 #12;17 Ob. S. A. T. B. Pno. Trees mf hud dle,- lift ing- their Trees mf hud dle,- lift ing- their lift ing- their bran ches like beck on- ing- hands. tutti Trees mf hud dle,- lift ing- their Trees mf hud dle,- lift ing- their 21 Ob. S. A. T. B. Pno. mf

  20. An economic study of the Texsun Citrus Exchange 

    E-Print Network [OSTI]

    Liao, Shubert Shui-Chien

    1950-01-01

    3 VALLEY CITRUS AND ITS POTENTIAL 4 Comparison to Other Areas 4 General Description of Climate 6 SELECTING A SITE 6 Soil Factors 6 Water Quality 7 Water Availability 7 Topography Factors 8 IRRIGATION, SALINITY, AND DRAINAGE 8 lrrigation... Systems for Citrus Groves 10 Salinity Problems 10 Drainage Problems 12 KINDS OF CITRUS AND THEIR VALUE 12 Grapefruit Varieties 12 Orange Varieties 13 Tangerines and Tangelos 13 Limes, Lemons and Miscellaneous Citrus 14 Rootstocks-Their Tolerance...

  1. The impacts of mining on the habitat ecology of raccoons in east-central Texas 

    E-Print Network [OSTI]

    Beucler, Michele

    1995-01-01

    and Movements Results Home Ranges Habitat Use Diel Activity and Movements Discussion. Management Implications. 10 13 13 15 18 . . 19 . . 20 20 . . 26 . . 32 37 . . 42 III RESTING SITE USE BY RACCOONS IN UNMINED AND RECLAIMED AREAS . 45.... (aimed Shrubland Ulrims stare Populus defrordes Borrhoos frofunlfoflo Panicum vrrgorum Elaeagrtris umbelloro Ulmus ufare Paulrorn I'Inorunt Herbaceous plams Rubus spp 35 34 06 202 Grove Improved Pasture Developed'. Poult rocdo Plntoms...

  2. Industrial recreation in Texas: an exploratory study 

    E-Print Network [OSTI]

    Kershaw, Deborah Louise

    1982-01-01

    . The Texas inventory of facilities, programs and personnel was compared to the 1978 national study. Industrial Recreation: Outlook for the Future (Groves, Rath, McGinn, and Decarlo, 1979) is the report of this This thesis follows the style put forth... as a tool to retain presently employed workers. Finally, another benefit that a company seeks to obtain is the healthy psychological outlook of its employees near retirement. By providing a means in which an employee can develop new recreation...

  3. Tropical bases by regular projections

    E-Print Network [OSTI]

    Hept, Kerstin

    2007-01-01

    We consider the tropical variety $\\mathcal{T}(I)$ of a prime ideal $I$ generated by the polynomials $f_1, ..., f_r$ and revisit the regular projection technique introduced by Bieri and Groves from a computational point of view. In particular, we show that $I$ has a short tropical basis of cardinality at most $r + \\codim I + 1$ at the price of increased degrees, and we provide a computational description of these bases.

  4. The TAMU Outdoors Program: a case study 

    E-Print Network [OSTI]

    Kott, Patsy L

    1990-01-01

    the Memorial Student Center. The MSC agreed to allow the TAMU Outdoors program to retain the storage locations at the Grove for the rental operation. A student was hired as equipment manager and the inventory was sorted into different catagories ? -rentable..., \\ repairable, and discardable. Items in the rentable catagory were in quality condition and ready to be checked out, items. that were repairable were worked on until rentable, and those items in bad disrepair were discarded. Procedures for reservation...

  5. Franklin Lakes, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove, Illinois:

  6. Franklin Park, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove,

  7. Franklin Park, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove,Illinois: Energy

  8. Franklin Park, Pennsylvania: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove,Illinois:

  9. Franklin, Massachusetts: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove,Illinois:Franklin,

  10. Golden Lakes, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County, Georgia: Energy Resources JumpGoldbeck SolarGrove,

  11. River Inn Natural Hot Spring Pool & Spa Low Temperature Geothermal Facility

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, New York:Virginia:Riva, Maryland: Energy Resources JumpGrove,|

  12. Linndale, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa: Energy Resources Jump

  13. Linthicum, Maryland: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa: Energy Resources

  14. Linwood, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa: Energy

  15. Linwood, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa: Energy

  16. Lisbon, New Hampshire: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa: EnergyLipscomb

  17. Liskey Greenhouses Greenhouse Low Temperature Geothermal Facility | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa:

  18. List of Hydroelectric Incentives | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa:Lisle, Illinois:

  19. Litchfield, New Hampshire: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa:Lisle,

  20. Lithopolis, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove, Iowa:Lisle,Trough

  1. Little Ferry, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,

  2. Little Melozitna Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,Little Melozitna Geothermal Area

  3. Little River County, Arkansas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,Little Melozitna Geothermal

  4. Littlerock, California: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,Little Melozitna

  5. Littlestown, Pennsylvania: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,Little MelozitnaLittlestown,

  6. Littleton, Colorado: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,Little MelozitnaLittlestown,

  7. Littleton, Colorado: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,Little

  8. Littleton, New Hampshire: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,LittleNew Hampshire: Energy

  9. Littletown, Arizona: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,LittleNew Hampshire:

  10. Livermore, California: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,LittleNew

  11. Livingston County, Illinois: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,LittleNewNew Hampshire:

  12. Livingston County, Michigan: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,LittleNewNew

  13. Livingston, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: Energy ResourcesGrove,LittleNewNewMissouri:

  14. Pine Hill, New York: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open EnergyPhoenicia,Creek,PilgrimGrove Mills,

  15. Pine Hills, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open EnergyPhoenicia,Creek,PilgrimGrove

  16. Pine Island Ridge, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open EnergyPhoenicia,Creek,PilgrimGroveIsland Ridge,

  17. Pine Lake, Georgia: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open EnergyPhoenicia,Creek,PilgrimGroveIsland

  18. Pine Mountain, Georgia: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open EnergyPhoenicia,Creek,PilgrimGroveIslandMountain,

  19. Multiple production of supersymmetric Higgs bosons in Z sup 0 decays

    SciTech Connect (OSTI)

    Giudice, G.F. )

    1990-04-01

    Multi-Higgs-boson production in {ital Z}{sup 0} decays is discussed in the context of low-energy supergravity models. For Higgs-boson masses lighter than about 20 GeV, {ital Z}{sup 0}{r arrow}{ital H}{sub 2}{sup 0}{ital H}{sub 2}{sup 0}{ital H}{sub 3}{sup 0} naturally has a branching ratio in the range 10{sup {minus}4}--10{sup {minus}6}. {ital Z}{sup 0}{r arrow}{ital H}{sub 2}{sup 0}{ital H}{sub 2}{sup 0}{ital l{bar l}}, where {ital l} is a neutral or charged lepton, has a branching ratio in the same range if {ital m}{sub {ital H}2}{lt}10 GeV. Detection of these processes will give information about the structure of the Higgs sector and about the {ital HHZZ} and {ital HHH} couplings.

  20. On the world cognizability

    E-Print Network [OSTI]

    B. L. Ioffe

    2013-03-11

    The paper gives a few examples of the phenomena that will never be understood by the mankind. The first example is the physics at the scales of $\\sim 10^{-33}$ cm where the gravitation interaction becomes strong, sales at the very beginning of the Big Bang. It argues that the mankind will never establish the laws that controls the events at these scales. Further, it is supposed that the time dependence of the entropy, which determine the direction of the time arrow, originates at the same time scale and, thus, the nature of the time arrow will be never established either. Finally, I conjecture that the brain cells are controlled by quantum computer with the very large (or even infinite) number of degenerate states. An external observation destroys this degeneracy, leading to impossibility to understand the mechanism of the conscience.

  1. Observation of enhanced subthreshold [ital K][sup +] production in central collisions between heavy nuclei

    SciTech Connect (OSTI)

    Miskowiec, D.; Ahner, W.; Barth, R.; Cieslak, M.; Debowski, M.; Grosse, E.; Henning, W.; Koczon, P.; Schicker, R.; Schwab, E.; Senger, P. (Gesellschaft fuer Schwerionenforschung, D-64220 Darmstadt (Germany)); Baltes, P.; Muentz, C.; Oeschler, H.; Sartorius, S.; Sturm, C.; Wagner, A. (Technische Hochschule Darmstadt, D-64289 Darmstadt (Germany)); Beckerle, P.; Bormann, C.; Brill, D.; Shin, Y.; Stein, J.; Stock, R.; Stroebele, H. (Johann Wolfgang Goethe Universitaet, D-60486 Frankfurt (Germany)); Kohlmeyer, B.; Poeppl, H.; Puehlhofer, F.; Speer, J.; Voelkel, K. (Philipps Universitaet, D-35037 Marburg (Germany)); Walus, W. (Jagiellonian University, PL-30-059 Krakow (Poland))

    1994-06-06

    In the very heavy collision system [sup 197]Au+[sup 197]Au the [ital K][sup +] production process was studied as a function of impact parameter at 1 GeV/nucleon, a beam energy well below the free [ital N]-[ital N] threshold. The [ital K][sup +] multiplicity increases more than linearly with the number of participant nucleons and the [ital K][sup +]/[pi][sup +] ratio rises significantly when going from peripheral to central collisions. The measured [ital K][sup +] double differential cross section is enhanced by a factor of 6 compared to microscopic transport calculations if secondary processes ([Delta][ital N][r arrow][ital K][Lambda][ital N] and [Delta][Delta][r arrow][ital K][Lambda][ital N]) are ignored.

  2. Gross-Neveu and Thirring models. Covariant Gaussian analysis

    SciTech Connect (OSTI)

    Rosenstein, B.; Kovner, A.

    1989-07-15

    Two-dimensional fermionic theories, the SU(/ital N/) Gross-Neveu and themassive Thirring models, are analyzed in the covariant Gaussian approximation.In the Gross-Neveu model we find three phases (renormalizations). In one ofthem the results coincide with the leading order in 1//ital N/ expansion. Inthe other two phases the gap equation has no solution and there are nofermionic excitations in the spectrum of the theory. It is argued that thoserenormalizations are relevant for /ital N/=1,2. The massive Thirringmodel is found to possess a line of ultraviolet fixed points. In the limit/ital m//sub /ital b///r arrow/0 the axial symmetry is not broken. The 2/r arrow/2/ital S/-matrix element for the nonasymptotically free phase is calculated andit qualitatively agrees with the exact expression. We also find anasymptotically free phase with vanishing bare coupling.

  3. Transfer matrix for spanning trees, webs and colored forests

    E-Print Network [OSTI]

    J. G. Brankov; V. S. Poghosyan; V. B. Priezzhev; P. Ruelle

    2014-05-02

    We use the transfer matrix formalism for dimers proposed by Lieb, and generalize it to address the corresponding problem for arrow configurations (or trees) associated to dimer configurations through Temperley's correspondence. On a cylinder, the arrow configurations can be partitioned into sectors according to the number of non-contractible loops they contain. We show how Lieb's transfer matrix can be adapted in order to disentangle the various sectors and to compute the corresponding partition functions. In order to address the issue of Jordan cells, we introduce a new, extended transfer matrix, which not only keeps track of the positions of the dimers, but also propagates colors along the branches of the associated trees. We argue that this new matrix contains Jordan cells.

  4. Scissors modes: The first overtone

    SciTech Connect (OSTI)

    Hatada, Keisuke [Instituto de Ciencia de Materiales de Aragon, CSIC-Universidad de Zaragoza, E-50009 Zaragoza (Spain); INFN Laboratori Nazionali di Frascati, c.p. 13, I-00044 Frascati (Italy); Hayakawa, Kuniko [INFN Laboratori Nazionali di Frascati, c.p. 13, I-00044 Frascati (Italy); Centro Fermi, Compendio Viminale, Roma I-00184 (Italy); Palumbo, Fabrizio [INFN Laboratori Nazionali di Frascati, c.p. 13, I-00044 Frascati (Italy)

    2011-07-15

    Scissors modes were predicted in the framework of the two-rotor model. This model has an intrinsic harmonic spectrum, so that the level above the scissors mode, the first overtone, has excitation energy twice that of the scissors mode. Because the latter is of the order of 3 MeV in the rare-earth region, the energy of the overtone is below threshold for nucleon emission, and its width should remain small enough for the overtone to be observable. We find that B(E2){up_arrow}{sub overtone}=(1/64 {theta}{sub 0}{sup 2})B(E2){up_arrow}{sub scissors}, where {theta}{sub 0} is the zero-point oscillation amplitude, which in the rare-earth region is of order 10{sup -1}.

  5. {tau} decays and chiral perturbation theory

    SciTech Connect (OSTI)

    Colangelo, G.; Finkemeier, M.; Urech, R.

    1996-10-01

    In a small window of phase space, chiral perturbation theory can be used to make standard model predictions for {tau} decays into two and three pions. For {tau}{r_arrow}2{pi}{nu}{sub {tau}}, we give the analytical result for the relevant form factor {ital F}{sub {ital V}} up to two loops, then calculate the differential spectrum and compare with available data. For {tau}{r_arrow}3{pi}{nu}{sub {tau}}, we have calculated the hadronic matrix element to one loop. We discuss the decomposition of the three pion states into partition states and we give detailed predictions for the decay in terms of structure functions. We also compare with low energy predictions of meson dominance models. Overall, we find good agreement, but also some interesting discrepancies, which might have consequences beyond the limit of validity of chiral perturbation theory. {copyright} {ital 1996 The American Physical Society.}

  6. Scissors mode of Gd nuclei studied from resonance neutron capture

    SciTech Connect (OSTI)

    Kroll, J.; Baramsai, B.; Becker, J. A.; and others

    2012-10-20

    Spectra of {gamma} rays following the neutron capture at isolated resonances of stable Gd nuclei were measured. The objectives were to get new information on photon strength of {sup 153,155-159}Gd with emphasis on the role of the M1 scissors-mode vibration. An analysis of the data obtained clearly indicates that the scissors mode is coupled not only to the ground state, but also to all excited levels of the nuclei studied. The specificity of our approach ensures unbiasedness in estimating the sumed scissors-mode strength {Sigma}B(M1){up_arrow}, even for odd product nuclei, for which conventional nuclear resonance fluorescence measurements yield only limited information. Our analysis indicates that for these nuclei the sum {Sigma}B(M1){up_arrow} increases with A and for {sup 157,159}Gd it is significantly higher compared to {sup 156,158}Gd.

  7. On the Allocative Efficiency of Competitive Prices in Economies with Incomplete Markets

    E-Print Network [OSTI]

    Sabarwal, Tarun

    2003-09-01

    -Malinvaud Efficiency 1I thank Bob Anderson and Max Stinchcombe for helpful conversations. 1 Introduction The Pareto efficiency of competitive equilibria in Arrow-Debreu economies is one of the strongest welfare results in economics about the allocative efficiency of a... system can indicate scarcity of com- modities via relative value, it helps equate marginal rates of substitution across consumers, and it results in a Pareto efficient allocation of commodities. If the system of markets is incomplete, (in other words...

  8. Modeling of Time with Metamaterials

    E-Print Network [OSTI]

    Igor I. Smolyaninov; Yu-Ju Hung

    2011-05-12

    Metamaterials have been already used to model various exotic "optical spaces". Here we demonstrate that mapping of monochromatic extraordinary light distribution in a hyperbolic metamaterial along some spatial direction may model the "flow of time". This idea is illustrated in experiments performed with plasmonic hyperbolic metamaterials. Appearance of the "statistical arrow of time" is examined in an experimental scenario which emulates a Big Bang-like event.

  9. Commissioning Trial for Mechanical Ventilation System Installed in Houses 

    E-Print Network [OSTI]

    Ohta, I.; Fukushima, A.

    2004-01-01

    at the bottom of the main unit. Fig. 2 Floor plan and the ventilation system of the model house The ideal air flow pattern of the model house is shown in Figure 3. Each arrow shows the airflow direction...-8588 Summary Airflow rate of a mechanical ventilation system for houses may not exceed the designed or rated airflow rate because of construction problem and lack of maintenance. According to our survey, half of the houses were enjoying less than 50...

  10. Supplementary material for "Coherent Josephson qubit suitable for scalable quantum integrated circuits"

    E-Print Network [OSTI]

    Martinis, John M.

    J. Mutus,1 C. Neill,1 P. O'Malley,1 P. Roushan,1 J. Wenner,1 T. C. White,1 A. N. Cleland,1 and John. The right inset is a cross section at Z = 0 (squares) and Z = Zamp (circles), as indicated by the arrows population is plotted in Fig. S2 as a function of time and amplitude. A cross section of the main figure at Z

  11. Supplementary materials An asymmetric interface between the regulatory particle and core particle of

    E-Print Network [OSTI]

    Hill, Chris

    -terminal tails of Rpt1­6 (a) and the N-terminal regions of 1­7 (b) from various species. Black, grey and light. The conserved residue corres­ ponding to K66 in the T. acidophilum proteasome CP is highlighted by a blue arrow are visualized in this 20S proteasome model (PDB: 1RYP²); the C-terminal tails of the other subunits

  12. Blood and water; the archaeological excavation and historical analysis of the Wreck of the Industry, a North-American transport sloop chartered by the British army at the end of the Seven Years' War: British colonial navigation and trade to supply Spanish Florida in the eighteenth century 

    E-Print Network [OSTI]

    Franklin, Marianne

    2006-04-12

    .................................... 102 7-3 Iron Swivel Gun 8SJ3478-39............................................................... 104 7-4 Lead Container 8SJ3478-36................................................................ 108 7-5 Wooden Crate 8SJ3478... single cannon was recovered from the site during the 1998 field season. After cleaning, the gun was identified as a British six-pounder, incised with a broad arrow signifying its status as government property, bearing the crest of King George II (1727...

  13. Arm-Hand-Finger Video Game Interaction 

    E-Print Network [OSTI]

    Logsdon, Drew Anthony

    2012-02-14

    Page 20 Sequence of motions and gestures used to fire a bow and arrow .............. 61 21 A player grabs a pistol from its holster in the FPS game .......................... 62 22 Gesture used to fire a gun... be tedious for gamers, especially those playing fast-paced games such as first-person shooters, because exact grips are not necessary and could ruin the experience. For example, if the player is holding a gun but shifts or slightly relaxes the fingers...

  14. Edit your faculty directory listing: 1. Start at the homepage: http://bio.unc.edu. Scroll to the bottom and click the small grey text

    E-Print Network [OSTI]

    Crews, Stephen

    and password. The first time you log in, you may have to agree to some Terms of Use. 4. Now you should the Faculty tab marked with the red arrow. 5. You can either search for your name by eye in the directory list or use the search box at the top right to search for your name. (Note that there are TWO search boxes

  15. In-phase waves: Their behavior, internal stratification and fabric

    SciTech Connect (OSTI)

    Cheel, R.J. (Brock Univ., St. Catharines, Ontario (Canada). Dept. of Earth Sciences); Udri, A. (Freiburg Univ. (Germany). Dept. of Geologie)

    1993-03-01

    Experiments were conducted in 0.305m wide, 9m long recirculating sediment flume on a bed of quartz sand (mean diameter of 0.18mm). The experiments included eight runs over the following range of conditions: 0.0605m [<=] depth [<=] 0.068m, 0.51m/s [<=] mean flow velocity [<=] 0.90m/s and 0.63 [<=] Froze Number (F) [<=] 1.1. For F < 0.83 dunes were the dominant bedform and these became longer and lower as F increased. At F = 0.83 the bed was nominally plane but locally and temporarily developed low in-phase waves or dunes. Post-run bed profiles showed symmetrical bedwaves with average length (L) of 0.26m and average height (H) of 0.005m. A complete cycle was characterized by: increased height of bed and water surface waves [r arrow] upstream migration [r arrow] breaking or decay [r arrow] planing of bed surface [r arrow] growth of new in-phase waves (initially migrating downstream and then remaining stationary during continued vertical growth). Each in-phase wave normally behaved independently of other waves although less commonly a breaking wave would trigger breaking of the next downstream wave. For F > 1.0 in-phase waves behaved as described above but a breaking wave would more commonly cause breaking of other waves. With increasing F it became more common for waves to break and rebuild quickly without complete planing of the bed surface. However, complete cycles occurred frequently with the following significant differences: (1) the upstream-migrating antidune developed upstream slopes that approached 25[degree]; (2) planing was accomplished by the rapid migration of a low, asymmetrical bedform through the antidune trough.

  16. Recent Results from KTeV

    SciTech Connect (OSTI)

    Leo Bellantoni et al.

    2001-08-02

    Recent results are presented for (1) the charge asymmetry in semielectronic kaon decay; (2) the charge radius of the neutral kaon; (3) the decay K{sub L}{sup 0} {r_arrow} {pi}{sup 0}{pi}{sup 0}e{sup +}e{sup {minus}}; (4) constraints on {rho}{sub CKM} from kaon decays; (5) lepton flavor violation. A few words about future kaon physics work at Fermilab are included.

  17. PUBLISHED ONLINE: 8 AUGUST 2010 | DOI: 10.1038/NPHYS1742 Observation of second-harmonic generation

    E-Print Network [OSTI]

    Loss, Daniel

    with a central wavelength of 1,500 nm (red waves in Fig. 1) or one-photon absorption (green vertical arrow in Fig. 1b) of a ^y-polarized, 290 fs pulse with a central wavelength of 750 nm (green waves in Fig. 1-mail: huizhao@ku.edu. Ep EP EJ EJ 750nm 1,500nm 750 nm 1,500 nm GaAs Conduction band Valence band Energy

  18. Application of a ratiometric laser induced fluorescence (LIF) thermometry for micro-scale temperature measurement for natural convection flows 

    E-Print Network [OSTI]

    Lee, Heon Ju

    2004-11-15

    ????????????????????????. x CHAPTER I INTRODUCTION??????????????????? 1 1.1 Literature Review??????????..???????. 1 1.2 Summary of Present Study??????????.....??? 2 II BACKGROUND???????????????????? 4 2.1 Principle of Fluorescence & Ratiometric LIF... Process: The White Arrows Represent That Water Circulates the Thermo-baths to Maintain Isothermal Conditions.. 10 3.2 Temperature Dependence of Fluorescence Images of Rh-B (column (a)), Rh-110 (column (b)) and Their Ratiometric Images (column (c...

  19. Earnings differential between men and women: an empirical analysis 

    E-Print Network [OSTI]

    Pandey, Ruby

    1982-01-01

    be the net value of output to the economy as a whole which is forgone because of a mis- allocation of resources associated with discrimination. Gary Becker (1971) approaches the problem by restricting his dis- cussion to an analysis of the relations among... between male-female wage differentials and sex composition is ultimately an empirical proposition. 7 Utility maximizing theories of discrimination are discussed in Gary Backer (1971); Kenneth Arrow (1971); Orley Ashenfelter and Al- bert Rees (1973) . 8...

  20. Water Use in the Eagle Ford Shale: An Economic and Policy Analysis of Water Supply and Demand 

    E-Print Network [OSTI]

    Arnett, Benton; Healy, Kevin; Jiang, Zhongnan; LeClere, David; McLaughlin, Leslie; Roberts, Joey; Steadman, Maxwell

    2014-01-01

    . 7 Texas Water Development Board. 2012. Water for Texas 2012 State Water Plan. Austin, TX. 8 Ibid. 3. 9 Learning as a distinct source of technical change was presented in Wright (1936) and Arrow (1963) and is often termed, “learning... to sell his water to San Antonio. Water for San Antonio is more socially beneficial than irrigating corn production, but selling water outside the GCD is contingent; local control of the GCDs results in electing board members who will restrict water...

  1. Matrix Operations on the TI-83 For the examples, we will consider the matrix 2 7 6 -7

    E-Print Network [OSTI]

    McClendon, David M.

    Matrix Operations on the TI-83 For the examples, we will consider the matrix 2 7 6 -7 -3 -5 -7 -2 -2 3 8 5 A. How to type in a matrix into the TI-83 Hit [MATRX]. You will see Use the right arrow matrices. If you want to put the matrix into [A], highlight "[A]" and hit [ENTER]; if you want to put

  2. Motion of the planets: the calculation and visualization in Mathcad

    E-Print Network [OSTI]

    Ochkov, Valery

    2015-01-01

    This article describes use of Mathcad mathematical package to solve problem of the motion of two, three and four material points under the influence of gravitational forces on the planar motion and in three-dimensional space. The limits of accuracy of numerical methods for solving ordinary differential equations are discussed. Usual concept of Kepler hours with uneven movement arrows illustrates Kepler's second law. Mathcad animation tools are used to illustrate solutions and links with animations are provided.

  3. Plant Defense Signaling Mechanisms and Evolution 

    E-Print Network [OSTI]

    Jiang, Shan

    2015-08-13

    for two Salk lines. The positions of RT-PCR primers are labeled with arrows. (B) Genotyping and RT-PCR detection of ASR3 expression in Salk lines. PCR was carried out with genomic DNA or cDNA using either the full-length or RT-PCR primers as indicated... modifications and charge. 7 Supplemental Table 2. Primers used in this study. Cloning and mutation primers Gene Forward primer Reverse primer ASR3 CGGGATCCATGGCTCTGGAACAGTTAGG GAAGGCCTCATCTTATCCGCGATTT TTG ProASR3...

  4. Economic Modernization in a Chepang Village in Nepal

    E-Print Network [OSTI]

    Gurung, Ganesh M

    1990-01-01

    of Indigenous lools lo glean their subsislence. Including bows and arrows. snares. lraps. baskets. hooks and nels, and poisons. Previously. their staple food consisted of honey. wild grains. wild bananas. and forest roots and tubers. • 34 GANESH MAN CURUNG... once and washed- thrice to make It edible. And Bharlang which Is poisonous has to be boned thrice in ashes and washed seven tbnes to make It eatable M (Varya 19721. The Chepangs presently still collect insects to eat along with honey and wax...

  5. Sample Preparation and Characterisation

    E-Print Network [OSTI]

    Cambridge, University of

    supplied by Corus RD&T. These were from creep tests, and comprised a screw-thread, which was used to hold.49 0.011 0.009 11.15 Mo Ni Nb V W 0.85 0.34 0.01 0.28 0.02 Table 6.2: Composition of creep-tested steel Fracture surface Screw thread Gauge Figure 6.1: Failed creep test specimen. The arrows show the position

  6. VNI version 4.1. Simulation of high-energy particle collisions in QCD: Space-time evolution of e{sup +}e{sup {minus}}...A + B collisions with parton-cascades, cluster-hadronization, final-state hadron cascades

    SciTech Connect (OSTI)

    Geiger, K.; Longacre, R.; Srivastava, D.K.

    1999-02-01

    VNI is a general-purpose Monte-Carlo event-generator, which includes the simulation of lepton-lepton, lepton-hadron, lepton-nucleus, hadron-hadron, hadron-nucleus, and nucleus-nucleus collisions. It uses the real-time evolution of parton cascades in conjunction with a self-consistent hadronization scheme, as well as the development of hadron cascades after hadronization. The causal evolution from a specific initial state (determined by the colliding beam particles) is followed by the time-development of the phase-space densities of partons, pre-hadronic parton clusters, and final-state hadrons, in position-space, momentum-space and color-space. The parton-evolution is described in terms of a space-time generalization of the familiar momentum-space description of multiple (semi)hard interactions in QCD, involving 2 {r_arrow} 2 parton collisions, 2 {r_arrow} 1 parton fusion processes, and 1 {r_arrow} 2 radiation processes. The formation of color-singlet pre-hadronic clusters and their decays into hadrons, on the other hand, is treated by using a spatial criterion motivated by confinement and a non-perturbative model for hadronization. Finally, the cascading of produced prehadronic clusters and of hadrons includes a multitude of 2 {r_arrow} n processes, and is modeled in parallel to the parton cascade description. This paper gives a brief review of the physics underlying VNI, as well as a detailed description of the program itself. The latter program description emphasizes easy-to-use pragmatism and explains how to use the program (including simple examples), annotates input and control parameters, and discusses output data provided by it.

  7. Dynamical real numbers and living systems

    E-Print Network [OSTI]

    Dhurjati Prasad Datta

    2010-01-11

    Recently uncovered second derivative discontinuous solutions of the simplest linear ordinary differential equation define not only an nonstandard extension of the framework of the ordinary calculus, but also provide a dynamical representation of the ordinary real number system. Every real number can be visualized as a living cell -like structure, endowed with a definite evolutionary arrow. We discuss the relevance of this extended calculus in the study of living systems. We also present an intelligent version of the Newton's first law of motion.

  8. Heavy-quark symmetry and chiral dynamics

    SciTech Connect (OSTI)

    Yan, T. (Institute of Physics, Academia Sinica, Taipei, Taiwan 11529 (Taiwan, Province of China) Floyd R. Newman Laboratory of Nuclear Studies, Cornell University, Ithaca, New York 14853 (United States)); Cheng, H.; Cheung, C.; Lin, G. (Institute of Physics, Academia Sinica, Taipei, Taiwan 11529 (Taiwan, Province of China)); Lin, Y.C. (Physics Department, National Central University, Chung-li, Taiwan 32054 (Taiwan, Province of China)); Yu, H. (Institute of Physics, Academia Sinica, Taipei, Taiwan 11529 (Taiwan, Province of China))

    1992-08-01

    The flavor and spin symmetry of the heavy quarks and the spontaneously broken approximate SU(3){sub {ital L}}{times} SU(3){sub {ital R}} chiral symmetry of the light quarks are exploited to formulate a theory describing the low-energy interactions of the heavy mesons ({ital Q{bar q}} bound states) and heavy baryons ({ital Qq}{sub 1}{ital q2} bound states) with the Goldstone bosons {pi}, {ital K}, and {eta}. The theory contains only three parameters independent of the number of heavy-quark species involved. They can be determined by the decays {ital D}{sup *}{r arrow}{ital D}+{pi}, {Sigma}{sub {ital c}}{r arrow}{Lambda}{sub {ital c}}+{pi}, and {Sigma}{sub {ital c}}{sup *}{r arrow}{Sigma}{sub {ital c}}+{pi}. Theoretically, these coupling constants are related, through partial conservation of axial-vector current, to the axial charges of the heavy mesons and the heavy baryons. They are all calculable in the nonrelativistic quark model by using the spin wave functions of these particles alone. The theory is applied to strong decays and semileptonic weak decays of the heavy mesons and baryons. The implications are also discussed.

  9. High-temperature phase transformation in Cr added TiAl base alloy

    SciTech Connect (OSTI)

    Abe, E.; Niinobe, K.; Nobuki, M.; Nakamura, M.; Tsujimoto, T.

    1999-07-01

    The authors have investigated a microstructure evolution of a Ti-48Al-3.5Cr (in at.%) alloy at high-temperatures ({gt} 1,473K). In the alloy annealed at 1673K for 1.8ks, followed by air-cooling, a characteristic microstructure with a feathery fashion was uniformly formed. From a cooling-rate-controlling study, it was found that formation of the feathery structure is accomplished during continuous cooling from 1673K to 1573K, within the {alpha} + {gamma} two-phase region. Transmission electron microscopy revealed that the feathery structure is composed of lamellar colonies (5--10{micro}m) which are crystallographically tilted slightly (a few degree) with their neighbors. A surprising fact is that lamellae in each colony are mostly the {gamma} phase with few {alpha}{sub 2} phase less than 5% in volume. This suggests that the feathery structure is a metastable product and has not resulted from the {alpha} {r{underscore}arrow} {alpha} + {gamma} transformation above 1,573 K. Instead, the feathery structure formation should be attributed to the non-equilibrium {alpha} {r{underscore}arrow} {gamma} transformation which occurs at high-temperatures with a small degree of supercooling. The authors discuss this interesting phase transformation in terms of the {alpha} {r{underscore}arrow} {gamma} massive transformation, based on the continuous-cooling-transformation (CCT) diagram constructed for the present alloy.

  10. Transport processes in directional solidification and their effects on microstructure development

    SciTech Connect (OSTI)

    Mazumder, Prantik

    1999-11-08

    The processing of materials with unique electronic, mechanical, optical and thermal properties plays a crucial role in modern technology. The quality of these materials depend strongly on the microstructure and the solute/dopant fields in the solid product, that are strongly influenced by the intricate coupling of heat and mass transfer and melt flow in the growth systems. An integrated research program is developed that include precisely characterized experiments and detailed physical and numerical modeling of the complex transport and dynamical processes. Direct numerical simulation of the solidification process is carried out that takes into account the unsteady thermo-solutal convection in the vertical Bridgman crystal growth system, and accurately models the thermal interaction between the furnace and the ampoule by appropriately using experimentally measured thermal profiles. The flow instabilities and transitions and the nonlinear evolution following the transitions are investigated by time series and flow pattern analysis. A range of complex dynamical behavior is predicted with increasing thermal Rayleigh number. The route to chaos appears as: steady convection {r_arrow} transient mono-periodic {r_arrow} transient bi-periodic {r_arrow} transient quasi-periodic {r_arrow} transient intermittent oscillation-relaxation {r_arrow} stable intermittent oscillation-relaxation attractor. The spatio-temporal dynamics of the melt flow is found to be directly related to the spatial patterns observed experimentally in the solidified crystals. The application of the model to two phase Sn-Cd peritectic alloys showed that a new class of tree-like oscillating microstructure develops in the solid phase due to unsteady thermo-solutal convection in the liquid melt. These oscillating layered structures can give the illusion of band structures on a plane of polish. The model is applied to single phase solidification in the Al-Cu and Pb-Sn systems to characterize the effect of convection on the macroscopic shape and disorder in the primary arm spacing of the cellular/dendritic freezing front. The apparently puzzling experimental observation of higher disorder in the weakly convective Al-Cu system than that in the highly convective Pb-Sn system is explained by the numerical calculations.

  11. Fall Chinook Salmon Spawning Ground Surveys in the Snake River Basin Upriver of Lower Granite Dam, Annual Report 2002.

    SciTech Connect (OSTI)

    Garcia, Aaron P.; Bradbury, S.M.; Arnsberg, Billy D.

    2003-09-01

    Redd counts were used to document the spawning distribution of fall chinook salmon (Oncorhynchus tshawytscha) in the Snake River basin upriver of Lower Granite Dam. The first reported redd counts were from aerial searches conducted intermittently between 1959 and 1978 (Irving and Bjornn 1981, Witty 1988; Groves and Chandler 1996)(Appendix 1). In 1986, the Washington Department of Fish and Wildlife began an annual monitoring program that, in addition to the Snake River, included aerial searches of the Grande Ronde River the first year (Seidel and Bugert 1987), and the Imnaha River in subsequent years (Seidel et al. 1988; Bugert et al. 1989-1991; Mendel et al. 1992). The U. S. Fish and Wildlife Service and Idaho Power Company began contributing to this effort in 1991 by increasing the number of aerial searches conducted each year and adding underwater searches in areas of the Snake River that were too deep to be searched from the air (Connor et al. 1993; Garcia et al. 1994a, 1994b, 1996-2001; Groves 1993; Groves and Chandler 1996). The Nez Perce Tribe added aerial searches in the Clearwater River basin beginning in 1988 (Arnsberg et. al 1992) and the Salmon River beginning in 1992. Currently searches are conducted cooperatively by the Nez Perce Tribe, Idaho Power Company, and U. S. Fish and Wildlife Service. Our objective for this report was to consolidate the findings from annual redd searches into a single document containing detailed information about the searches from the most recent spawning season, and summary information from previous years. The work conducted in 2002 was funded by the Bonneville Power Administration (Projects 1998-01-003 and 1994-03-400) and the Idaho Power Company.

  12. Scuttlebutt Volume 1, No. 8 

    E-Print Network [OSTI]

    2007-01-01

    to bring together all elements of game design and succeed to the wildest degree." ?IGN (9.7/10) Southern Cross Gaming 6 Vol.1 Issue 8 ScuttleButt A welcome to our newest members: Burt Gabot Jason Groves Ashley Walker Jeff Neves The following...?) and a new Role Playing Group ? Starbase Pitcairn. Both of these activities are designed to assist members to extend the ?fiction-side? of the fan activities, by enabling members to participate in either the establishment of a group that will focus...

  13. Commercial Pecans: Controlling Rosette, Diseases and Zinc Deficiency 

    E-Print Network [OSTI]

    Lee, Thomas A.; Krausz, Joseph P.

    2006-04-13

    to be healthy and vigor- ous and for nut quality and yield to be satisfactory, producers must establish sound disease-management programs. Producers can pre- vent losses from diseases and insuff_i cient zinc by implementing ef_fective grove management... fall. Although the foliage is mature and no longer susceptible to the scab fun- gus, the shucks surrounding the nuts are immature and vulnerable to late-season infections. Factors inf_l uencing disease development As you develop a spray program...

  14. What is Pseudonovibos spiralis?

    E-Print Network [OSTI]

    Timm, Robert M.; Olson, Link E.; Brandt, John H.; Dioli, Maurizio

    2001-12-01

    ) pneumatization of the skull pronounced; (4) frontals flat and not enlarged, with posterior margin forming a ridge or crest between the horns. This combination of char- acters places the animal in the genus Bos following the definition provided by Groves (1981... molecularly inter- preted as being bogus, being derived from cow horns (Hassanin et al., 2001; Hassanin, submitted). (2) The five specimens identified as fakes (four de- scribed in the paper of Hassanin et al., 2001 and one in the paper of Kuznetsov et al...

  15. STAG UK Newsletter Issue 23 

    E-Print Network [OSTI]

    1977-01-01

    -on-Trent, Notts. zine, Murasaki Journal. serIG: hoss Carter, 29 Castle Hoad, Southsea, Portsmouth. STJ.RBASE 13: Jlrian Longstaff, 13 'doodfarm Drive, Sheffield, s6 51'11. OMICOBN: ~'raoy Cooke, 67 Eden Grove, Horfield, Bristol, B57 OPQ,. '.iSF: Club for Kirk... driving along a ~uiet road one evening all of a sudden a strange mist enveloped their car and on awakening they found they were in Portsmouth, England! On looking at their watches, only one hour had passed!!! Perhaps you might be asking "Many...

  16. Oxidation of step edges on vicinal 4H-SiC(0001) surfaces

    SciTech Connect (OSTI)

    Li, Wenbo; Zhu, Qiaozhi; Wang, Dejun, E-mail: dwang121@dlut.edu.cn [School of Electronic Science and Technology, Faculty of Electronic Information and Electrical Engineering, Dalian University of Technology, Dalian 116024 (China)] [School of Electronic Science and Technology, Faculty of Electronic Information and Electrical Engineering, Dalian University of Technology, Dalian 116024 (China); Zhao, Jijun [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Dalian University of Technology), College of Advanced Science and Technology, Ministry of Education, Dalian 116024 (China)] [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Dalian University of Technology), College of Advanced Science and Technology, Ministry of Education, Dalian 116024 (China)

    2013-11-18

    The oxidation processes of stepped SiC(0001) surfaces are studied within the ab initio atomistic thermodynamics approach. Our calculations show that a one-dimensional -Si-O- chain structure as a precursor for oxide growth on stepped SiC surfaces is formed along the step edge, promoting further oxidation of the step edges. Following the modified Deal-Grove oxidation model, we also find that the oxidation rate at steps is higher than that at terraces by three orders of magnitude. These findings give a reasonable explanation for the oxide thickness fluctuation between the step and the terrace observed in the previous experiments.

  17. Supercritical plants to come online in 2009

    SciTech Connect (OSTI)

    Spring, N.

    2009-07-15

    A trio of coal-fired power plants using supercritical technology set to enter service this year. These are: We Energies is Elm Road Generating Station in Wisconsin, a two-unit, 1,230 MW supercritical plant that will burn bituminous coal; a 750 MW supercritical coal-fired power plant at the Comanche Generating Station in Pueblo, Colo., the third unit at the site; and Luminant's Oak Grove plant in Texas which will consist of two supercritical, lignite-fueled power generation units. When complete, the plant will deliver about 1,6000 MW. Some details are given on each of these projects. 2 photos.

  18. Correspondence (Top Secret) of the Manhattan Engineer District, 1942--1946

    SciTech Connect (OSTI)

    NONE

    1982-12-31

    This pamphlet prepared by the National Archives Trust Fund Board, National Archives Records Service provides an overview to a collection of formerly security classified `Top Secret` correspondence maintained by Major General Leslie Groves when commanding general of the Manhattan District from September, 1942 to December, 1946. The pamphlet describes the administrative history of the record collection. The records are described as well as how they are arranged along with finding aids and content of records. For further details concerning the se records the user is referred to the US National Archives, Washington.

  19. Franklin Parish, Louisiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban TransportFortistar LLC Jumpwells,Maine:Grove, Illinois:Parish,

  20. Garden Home-Whitford, Oregon: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky: Energy Resources Jump to:Garden Acres,Grove,