Powered by Deep Web Technologies
Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A measurement of $alpha_s(Q^2)$ from the Gross-Llewellyn Smith Sum Rule  

E-Print Network (OSTI)

We extract a set of values for the Gross-Llewellyn Smith sum rule at different values of 4-momentum transfer squared ($Q^{2}$), by combining revised CCFR neutrino data with data from other neutrino deep-inelastic scattering experiments for $1 < Q^2 < 15 GeV^2/c^2$. A comparison with the order $\\alpha^{3}_{s}$ theoretical predictions yields a determination of $\\alpha_{s}$ at the scale of the Z-boson mass of $0.114 \\pm^{.009}_{.012}$. This measurement provides a new and useful test of perturbative QCD at low $Q^2$, because of the low uncertainties in the higher order calculations.

J. H. Kim; D. A. Harris



Evaluation of beta partical densitometry for determination of self-absorption factors in gross alpha and gross beta radioactivity measurements on air particulate filter samples  

E-Print Network (OSTI)

Alpha and beta particles emitted from radioactive material collected on an air filter may be significantly attenuated by the mass (thickness) of collected dust. In this study, we determined the mass or thickness of the simulated dust deposit...

Breida, Margaret A




NLE Websites -- All DOE Office Websites (Extended Search)

mechanics. D.H.E. Gross 1 Hahn-Meitner Institute Glienickerstr. 100 14109 Berlin, Germany gross@hmi.de; http:www.hmi.depeoplegross 2 Freie Universit at Berlin,...


Total Natural Gas Gross Withdrawals (Summary)  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Price Gross Withdrawals Gross Withdrawals From Gas Wells Gross Withdrawals From Oil Wells Gross Withdrawals From Shale Gas Wells Gross Withdrawals From Coalbed Wells...


What is Gross Up?  

NLE Websites -- All DOE Office Websites (Extended Search)

/19/12 Rev 0 /19/12 Rev 0 What is Gross Up? Gross up on relocation refers to money that is added to your pay to offset the federal and state tax deducted from the relocation reimbursement amount. You do not see the money in your pocket, but rather it offsets taxes that would have reduced the payment if we had not paid you the additional amount. For example: If the Relocation reimbursement request submitted = $5668. Without a gross up the net payment received would be $3539.66 because federal and state taxes reduce the pay out by $1694.73 ($1417 federal + $277.73 state). Paying only the additional amount of the taxes would create a larger tax burden because there would be taxes on that additional amount as well. Instead by paying an additional $2417.59 the federal and state taxes on the original $5668 and the additional federal and state taxes on


Countries Diesel Prices Excluding Taxes  

Gasoline and Diesel Fuel Update (EIA)

excluding taxes) excluding taxes) Date Belgium France Germany Italy Netherlands UK US 01/13/14 3.56 3.46 3.55 3.80 3.63 3.57 3.40 01/06/14 3.70 3.49 3.62 3.82 3.63 3.55 3.43 12/30/13 NA NA NA NA NA NA 3.42 12/23/13 NA NA NA NA NA NA 3.39 12/16/13 3.63 3.50 3.71 3.85 3.71 3.56 3.38 12/9/13 3.83 3.53 3.77 3.86 3.72 3.57 3.39 12/2/13 3.70 3.46 3.75 3.80 3.67 3.53 3.40 11/25/13 3.60 3.38 3.74 3.75 3.61 3.48 3.36 11/18/13 3.74 3.36 3.67 3.70 3.55 3.45 3.33 11/11/13 3.57 3.34 3.57 3.66 3.51 3.42 3.34 11/4/13 3.60 3.36 3.65 3.69 3.58 3.43 3.37 10/28/13 3.60 3.48 3.71 3.84 3.67 3.53 3.38 10/21/13 3.64 3.50 3.75 3.84 3.70 3.54 3.40 10/14/13 3.70 3.45 3.74 3.82 3.70 3.51 3.40 10/7/13 3.63 3.46 3.75 3.83 3.70 3.52 3.41


Gross decontamination experiment report  

SciTech Connect

A Gross Decontamination Experiment was conducted on various levels and surfaces of the TMI - Unit 2 reactor building in March 1982. The polar crane, D-rings, missile shields, refueling canals, refueling bridges, equipment, and elevations 305' and 347'-6'' were flushed with low pressure water. Additionally, floor surfaces on elevation 305' and floor surfaces and major pieces of equipment on elevation 347'-6'' were sprayed with high pressure water. Selective surfaces were decontaminated with a mechanical scrubber and chemicals. Strippable coating was tested and evaluated on equipment and floor surfaces. The effectiveness, efficiency, and safety of several decontamination techniques were established for the large, complex decontamination effort. Various decontamination equipment was evaluated and its effectiveness was documented. Decontamination training and procedures were documented and evaluated, as were the support system and organization for the experiment.

Mason, R.; Kinney, K.; Dettorre, J.; Gilbert, V.



Emotion Regulation JAMES J. GROSS  

E-Print Network (OSTI)

CHAPTER 31 ·Emotion Regulation JAMES J. GROSS Have you ever gotten so angry that you've done), and self-regulation (Mischel, Shoda, & Rodriguez, 1989). What is new are the theoretical and empiri cal

Gross, James J.


Clean Water Act (excluding Section 404)  

SciTech Connect

This Reference Book contains a current copy of the Clean Water Act (excluding Section 404) and those regulations that implement the statutes and appear to be most relevant to US Department of Energy (DOE) activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Updates that include important new requirements will be provided periodically. Questions concerning this Reference Book may be directed to Mark Petts, EH-231 (202/586-2609).

Not Available



Physics Nobel winner David Gross gives public lecture at Jefferson...  

NLE Websites -- All DOE Office Websites (Extended Search)

Physics Nobel winner David Gross gives public lecture at Jefferson Lab on June 12 (Monday) June 6, 2006 David Gross David Gross, Nobel Prize recipient and lecturer David Gross,...


,"Texas Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Texas Natural Gas Gross Withdrawals and Production",10,"Monthly","92014","1151989" ,"Release...


,"Wyoming Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Wyoming Natural Gas Gross Withdrawals and Production",10,"Monthly","92014","1151989" ,"Release...


,"Utah Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Utah Natural Gas Gross Withdrawals and Production",10,"Monthly","92014","1151989" ,"Release...


,"Oregon Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Oregon Natural Gas Gross Withdrawals and Production",10,"Monthly","92014","1151991" ,"Release...


,"California Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","California Natural Gas Gross Withdrawals and Production",10,"Annual",2013,"6301967" ,"Release...


David J. Gross and the Strong Force  

NLE Websites -- All DOE Office Websites (Extended Search)

David J. Gross and the Strong Force David J. Gross and the Strong Force Resources with Additional Information The 2004 Nobel Prize in Physics was awarded to David Gross for "the discovery of asymptotic freedom in the theory of the strong interaction". 'Gross, who obtained his PhD in physics in 1966, currently is a professor of physics and director of the Kavli Institute for Theoretical Physics at UC Santa Barbara. ... David Gross Courtesy of UC Santa Barbara [When on the faculty at Princeton University,] he and then-graduate student Frank Wilczek came up with a way to describe the "strong force" that governs interactions between protons and neutrons in the nucleus of the atom. He and Wilczek published their proposal simultaneously with H. David Politzer, a graduate student [at Harvard University] who independently came up with the same idea. ...


Macroeconomic Real Gross Domestic Product  

Gasoline and Diesel Fuel Update (EIA)

Macroeconomic Macroeconomic Real Gross Domestic Product (billion chained 2009 dollars - SAAR) ............. 15,584 15,680 15,819 15,886 15,970 16,068 16,173 16,295 16,422 16,557 16,701 16,832 15,742 16,127 16,628 Real Disposable Personal Income (billion chained 2009 dollars - SAAR) ............. 11,502 11,618 11,703 11,757 11,883 11,970 12,057 12,151 12,273 12,363 12,451 12,526 11,645 12,015 12,403 Real Personal Consumption Expend. (billion chained 2009 dollars - SAAR) ............. 10,644 10,692 10,729 10,813 10,884 10,959 11,036 11,114 11,191 11,264 11,343 11,416 10,719 10,998 11,304 Real Fixed Investment (billion chained 2009 dollars - SAAR) ............. 2,420 2,458 2,491 2,508 2,551 2,604 2,655 2,700 2,752 2,816 2,885 2,944 2,469 2,627 2,849 Business Inventory Change (billion chained 2009 dollars - SAAR) .............


Superfluid Mutual-friction Coefficients from Vortex Dynamics in the Two-dimensional Galerkin-truncated Gross-Pitaevskii Equation  

E-Print Network (OSTI)

We present algorithms for the ab-initio determination of the temperature ($T$) dependence of the mutual-friction coefficients $\\alpha$ and $\\alpha'$ and the normal-fluid density $\\rho_{\\rm n}$ in the two-dimensional (2D) Galerkin-truncated Gross-Pitaevskii system. Our algorithms enable us to determine $\\alpha(T)$, even though fluctuations in 2D are considerably larger than they are in 3D. We also examine the implications of our measurements of $\\alpha'(T)$ for the Iordanskii force, whose existence is often questioned.

Vishwanath Shukla; Marc Brachet; Rahul Pandit



Illinois Natural Gas Gross Withdrawals from Coalbed Wells (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

data. Release Date: 12312014 Next Release Date: 1302015 Referring Pages: Natural Gas Gross Withdrawals from Coalbed Wells Illinois Natural Gas Gross Withdrawals and...


South Dakota Natural Gas Gross Withdrawals from Coalbed Wells...  

U.S. Energy Information Administration (EIA) Indexed Site

data. Release Date: 12312014 Next Release Date: 1302015 Referring Pages: Natural Gas Gross Withdrawals from Coalbed Wells South Dakota Natural Gas Gross Withdrawals and...

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Monthly Natural Gas Gross Production Report  

U.S. Energy Information Administration (EIA) Indexed Site

Report Report Monthly Natural Gas Gross Production Report Data Files Methodology and Analysis Form and Instructions Monthly Natural Gas Gross Production Report with data for September 2013 Released: December 6, 2013 Next Release: January 7, 2014 The two graphs below show total U.S. and Lower 48 natural gas production on one and the individual State production on the other. U.S. and Lower 48 States Natural Gas Gross Withdrawals Figure Data State Natural Gas Gross Withdrawals Figure Data In September, Lower 48 States production decreased 0.8 percent or 0.58 billion cubic feet per day (Bcf/d). Louisiana had the largest volumetric decrease at 5.3 percent or 0.34 Bcf/d as many surveyed operators reported various maintenance issues and normal well decline. Wyoming also dropped


Definition: Gross generation | Open Energy Information  

Open Energy Info (EERE)

Definition Definition Edit with form History Facebook icon Twitter icon » Definition: Gross generation Jump to: navigation, search Dictionary.png Gross generation The total amount of electric energy produced by generating units (e.g. power plants) and measured at the generating terminal in kilowatt-hours (kWh) or megawatt-hours (MWh).[1] View on Wikipedia Wikipedia Definition Related Terms Electricity generation, Net generation, power References ↑ Retri Like Like You like this.Sign Up to see what your friends like. eved from "http://en.openei.org/w/index.php?title=Definition:Gross_generation&oldid=480543" Category: Definitions What links here Related changes Special pages Printable version Permanent link


,"Arkansas Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

,,"(202) 586-8800",,,"12292014 2:04:59 AM" "Back to Contents","Data 1: Arkansas Natural Gas Gross Withdrawals and Production" "Sourcekey","N9010AR2","N9011AR2","N9012AR2"...


,"Alabama Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

,,"(202) 586-8800",,,"12292014 2:04:59 AM" "Back to Contents","Data 1: Alabama Natural Gas Gross Withdrawals and Production" "Sourcekey","N9010AL2","N9011AL2","N9012AL2"...


,"Arkansas Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

,,"(202) 586-8800",,,"12292014 2:05:00 AM" "Back to Contents","Data 1: Arkansas Natural Gas Gross Withdrawals and Production" "Sourcekey","N9010AR2","N9011AR2","N9012AR2"...


,"Arizona Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

,,"(202) 586-8800",,,"12292014 2:05:00 AM" "Back to Contents","Data 1: Arizona Natural Gas Gross Withdrawals and Production" "Sourcekey","N9010AZ2","N9011AZ2","N9012AZ2"...


,"Alaska Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

,,"(202) 586-8800",,,"12292014 2:04:58 AM" "Back to Contents","Data 1: Alaska Natural Gas Gross Withdrawals and Production" "Sourcekey","N9010AK2","N9011AK2","N9012AK2"...


,"New York Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

,,"(202) 586-8800",,,"182015 12:49:56 PM" "Back to Contents","Data 1: New York Natural Gas Gross Withdrawals (MMcf)" "Sourcekey","N9010NY2" "Date","New York...


Generalization Of The Gross-Perry Metrics  

E-Print Network (OSTI)

A class of SO(n+1) symmetric solutions of the (N+n+1)-dimensional Einstein equations is found. It contains 5-dimensional metrics of Gross and Perry and Millward.

M. Jakimowicz; J. Tafel



Nucleosome positioning by genomic excluding-energy barriers  

Science Journals Connector (OSTI)

...genomic excluding-energy barriers 10.1073...Vaillant Benjamin Audit Zofia Haftek-Terreau...Sequence motifs and free energies of selected natural and non-natural...174 . 14 Vaillant C Audit B Arneodo A ( 2007...excluding genomic energy barriers Pascale Milani...Vaillant, Benjamin Audit, Zofia Haftek-Terreau...

Pascale Milani; Guillaume Chevereau; Cdric Vaillant; Benjamin Audit; Zofia Haftek-Terreau; Monique Marilley; Philippe Bouvet; Franoise Argoul; Alain Arneodo



Alpha Radiation  

NLE Websites -- All DOE Office Websites (Extended Search)

Basics of Radiation Basics of Radiation Gamma Radiation and X-Rays Beta Radiation Alpha Radiation Irradiation Radioactive Contamination Definitions Detection Measurement Safety Around Radiation Sources Types of Radiation Exposure Managing Radiation Emergencies Basics of Radiation Characteristics of Alpha Radiation 1. Alpha radiation is not able to penetrate skin. 2. Alpha-emitting materials can be harmful to humans if the materials are inhaled, swallowed, or absorbed through open wounds. 3. A variety of instruments have been designed to measure alpha radiation. Special training in use of these instruments is essential for making accurate measurements. 4. A civil defense instrument (CD V-700) cannot detect the presence of radioactive materials that produce alpha radiation unless the radioactive materials also produce beta and/or gamma radiation.


Missouri Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...


Arizona Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1996-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...


Arkansas Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...


Oregon Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1996-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1996-2014 From Shale...


Utah Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...


California Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...


Alaska Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

History Gross Withdrawals 299,035 277,208 262,287 252,184 194,411 189,411 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From...


Alabama Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...


Kansas Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Jun-14 Jul-14 Aug-14 View History Gross Withdrawals NA NA NA NA NA NA 1991-2014 From Gas Wells NA NA NA NA NA NA 1991-2014 From Oil Wells NA NA NA NA NA NA 1991-2014 From Shale...

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gross Theory of ?-Decay and Shell Effects  

Science Journals Connector (OSTI)

......nuclear final state measured fr:orn the parent. Although actual decays pro- Gross Theory of f3-Decay and Shell Effects 137 ceed only to the region of negative values of E, we extend our consideration to the positive region. Now, we can regard the whole......

Takayoshi Kondoh; Masami Yamada



Louisiana Natural Gas Gross Withdrawals Total Offshore (Million...  

Annual Energy Outlook 2012 (EIA)

Gross Withdrawals Total Offshore (Million Cubic Feet) Louisiana Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...


US--State Offshore Natural Gas Gross Withdrawals (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals (Million Cubic Feet) US--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8...


Alabama--State Offshore Natural Gas Gross Withdrawals (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (Million Cubic Feet) Alabama--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...


Federal Offshore--Alabama Natural Gas Gross Withdrawals (Million...  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals (Million Cubic Feet) Federal Offshore--Alabama Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...


California--onshore Natural Gas Gross Withdrawals from Shale...  

U.S. Energy Information Administration (EIA) Indexed Site

onshore Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet) California--onshore Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet) Decade Year-0 Year-1...


Thermodynamical Consistency of Excluded Volume Hadron Gas Models  

E-Print Network (OSTI)

The new excluded volume hadron gas model by Singh et al. [1-7] is critically discussed. We demonstrate that in this model the results obtained from relations between thermodynamical quantities disagree with the corresponding results obtained by statistical ensemble averaging. Thus, the model does not satisfy the requirements of thermodynamical consistency.

M. I. Gorenstein



National Environmental Policy Act (NEPA) Categorically Excluded Actions |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NEPA » National NEPA » National Environmental Policy Act (NEPA) Categorically Excluded Actions National Environmental Policy Act (NEPA) Categorically Excluded Actions Categorical Exclusions (CX) - Categorical exclusions are categories of actions that DOE has determined, by regulation, do not individually or cumulatively have a significant effect on the human environment and for which neither an environmental assessment nor an environmental impact statement is typically required. Title 10 Code of Federal Regulations Part 1021, National Environmental Policy Act Implementing Procedures, Appendices A and B to Subpart D, list DOE's categorical exclusions. Appendix A classes of actions are those actions considered to be general agency actions, such as awarding a contract or hiring personnel. Appendix B classes of actions


Solar Energy Gross Receipts Tax Deduction | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Gross Receipts Tax Deduction Energy Gross Receipts Tax Deduction Solar Energy Gross Receipts Tax Deduction < Back Eligibility Commercial Construction Installer/Contractor Residential Retail Supplier Savings Category Heating & Cooling Commercial Heating & Cooling Solar Heating Buying & Making Electricity Water Heating Program Info Start Date 7/1/2007 State New Mexico Program Type Sales Tax Incentive Rebate Amount 100% of gross receipts from sale and installation of solar energy systems Provider New Mexico Energy, Minerals and Natural Resources Department New Mexico has a gross receipts tax structure for businesses instead of a sales tax. Businesses are taxed on the gross amount of their business receipts each year before expenses are deducted. Revenue generated by the sale and installation of solar systems used to provide space heat, hot


Property:AvgAnnlGrossOpCpcty | Open Energy Information  

Open Energy Info (EERE)

AvgAnnlGrossOpCpcty AvgAnnlGrossOpCpcty Jump to: navigation, search Property Name AvgAnnlGrossOpCpcty Property Type Number Description Avg. Annual Gross Operating Capacity(MW). Pages using the property "AvgAnnlGrossOpCpcty" Showing 6 pages using this property. F Faulkner I Energy Generation Facility + 49.5 + N Navy I Geothermal Facility + 81.7 + Navy II Geothermal Facility + 86 + Neal Hot Springs Geothermal Power Plant + 22 + North Brawley Geothermal Power Plant + 50 + R Raft River Geothermal Facility + 11.5 + Retrieved from "http://en.openei.org/w/index.php?title=Property:AvgAnnlGrossOpCpcty&oldid=400186#SMWResults" Categories: Properties Geothermal Energy Generation Facilities properties What links here Related changes Special pages Printable version


,"Federal Offshore--Alabama Natural Gas Gross Withdrawals (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Federal Offshore--Alabama Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2013 ,"Release Date:","1...


,"Texas--State Offshore Natural Gas Gross Withdrawals (MMcf)...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Texas--State Offshore Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2013 ,"Release Date:","1302015"...


,"US--State Offshore Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

State Offshore Natural Gas Gross Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Alabama--State Offshore Natural Gas Gross Withdrawals (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Alabama--State Offshore Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2013 ,"Release Date:","1302015"...


,"Alaska--State Offshore Natural Gas Gross Withdrawals (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Alaska--State Offshore Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2013 ,"Release Date:","1302015"...


,"Louisiana--State Offshore Natural Gas Gross Withdrawals (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Louisiana--State Offshore Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2013 ,"Release Date:","1302015"...


,"California--State Offshore Natural Gas Gross Withdrawals (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","California--State Offshore Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2013 ,"Release Date:","1302015"...


,"California State Offshore Natural Gas Gross Withdrawals and...  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","California State Offshore Natural Gas Gross Withdrawals and Production",8,"Annual",2013,"630...


,"California Offshore Natural Gas Gross Withdrawals and Production...  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","California Offshore Natural Gas Gross Withdrawals and Production",1,"Annual",2013,"6301977"...


,"Federal Offshore California Natural Gas Gross Withdrawals and...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Federal Offshore California Natural Gas Gross Withdrawals and Production",7,"Annual",2013,"6301977" ,"Release...

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"Table 2. Real Gross Domestic Product Growth Trends, Projected...  

U.S. Energy Information Administration (EIA) Indexed Site

Real Gross Domestic Product Growth Trends, Projected vs. Actual" "Projected Real GDP Growth Trend" " cumulative average percent growth in projected real GDP from first year shown...


,"New York Natural Gas Gross Withdrawals and Production"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","New York Natural Gas Gross Withdrawals and Production",10,"Annual",2013,"6301967" ,"Release...


Oregon Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals NA NA NA NA NA NA 1996-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Oklahoma Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals 174,470 181,468 176,236 184,625 184,458 179,696 1991-2013 From Gas Wells


Kansas Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Utah Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Maryland Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Nevada Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Indiana Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Illinois Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Ohio Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Kentucky Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Pennsylvania Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Nebraska Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Tennessee Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Missouri Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Arizona Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals NA NA NA NA NA NA 1996-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Alaska Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals 282,018 261,026 234,298 241,910 231,276 247,528 1991-2013 From Gas Wells


Michigan Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Virginia Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Florida Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1996-2013


Colorado Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Montana Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Louisiana Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals 203,544 207,497 197,842 207,415 197,786 181,231 1991-2013 From Gas Wells


Texas Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals 668,363 704,080 673,815 708,526 704,973 680,075 1991-2013 From Gas Wells


Mississippi Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


California Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Alabama Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Mason Gross School of the Arts Extension Division  

E-Print Network (OSTI)

Mason Gross School of the Arts Extension Division Practice Your Passion! 2012-2013 Now Satellite School See page 7 within! #12;Main Office Mason Gross Extension Division Marryott Music Building 81 George Street New Brunswick, NJ 08901 Phone: 732-932-8618 Fax: 732-932-3140 Email: extension

Goodman, Robert M.



U.S. Energy Information Administration (EIA) Indexed Site

ENDING STOCKS OF CRUDE OIL (excluding SPR)" ENDING STOCKS OF CRUDE OIL (excluding SPR)" "Sourcekey","WCESTP11","WCESTP11","WCESTP21","WCESTP21","WCESTP31","WCESTP31","WCESTP41","WCESTP41","WCESTP51","WCESTP51","WCESTUS1","WCESTUS1" "Date","Weekly East Coast (PADD 1) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly East Coast (PADD 1) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Midwest (PADD 2) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Midwest (PADD 2) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Gulf Coast (PADD 3) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Gulf Coast (PADD 3) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Rocky Mountain (PADD 4) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Rocky Mountain (PADD 4) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly West Coast (PADD 5) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly West Coast (PADD 5) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly U.S. Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly U.S. Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)"


Alaska Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly Annual Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History Gross Withdrawals 3,479,290 3,415,884 3,312,386 3,197,100 3,162,922 3,164,791 1967-2012 From Gas Wells 165,624 150,483 137,639 127,417 112,268 107,873 1967-2012 From Oil Wells 3,313,666 3,265,401 3,174,747 3,069,683 3,050,654 3,056,918 1967-2012 From Coalbed Wells 0 0 0 0 0 0 2002-2012 Repressuring 3,039,347 3,007,418 2,908,828 2,812,701 2,795,732 2,801,763 1967-2012 Vented and Flared 6,458 10,023 6,481 10,173 10,966 11,769 1967-2012 Nonhydrocarbon Gases Removed 0 0 0 0 0 0 1996-2012 Marketed Production 433,485 398,442 397,077 374,226 356,225 351,259 1967-2012


Property:GrossProdCapacity | Open Energy Information  

Open Energy Info (EERE)

GrossProdCapacity GrossProdCapacity Jump to: navigation, search Property Name GrossProdCapacity Property Type Quantity Description Sum of the property AvgAnnlGrossOpCpcty for all Energy Generation Facilities with properties: Sector: Geothermal Energy InGeothermalResourceArea: set to the the variable vName of the Geothermal Resource Area Use this property to express potential electric energy generation, such as Nameplate Capacity. The default unit is megawatts (MW). For spatial capacity, use property Volume. Acceptable units (and their conversions) are: 1 MW,MWe,megawatt,Megawatt,MegaWatt,MEGAWATT,megawatts,Megawatt,MegaWatts,MEGAWATT,MEGAWATTS 1000 kW,kWe,KW,kilowatt,KiloWatt,KILOWATT,kilowatts,KiloWatts,KILOWATT,KILOWATTS 1000000 W,We,watt,watts,Watt,Watts,WATT,WATTS 1000000000 mW,milliwatt,milliwatts,MILLIWATT,MILLIWATTS


Fact #564: March 30, 2009 Transportation and the Gross Domestic...  

Energy Savers (EERE)

of the U.S. Gross Domestic Product (GDP) in 2007 is related to transportation. Housing, health care, and food are the only categories with greater shares of the GDP. GDP by...


Alabama Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals Total Offshore (Million Cubic Feet) Gross Withdrawals Total Offshore (Million Cubic Feet) Alabama Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1980's 0 9 13 1990's 19,861 32,603 191,605 218,023 349,380 356,598 361,068 409,091 392,320 376,435 2000's 361,289 200,862 202,002 194,339 165,630 152,902 145,762 134,451 125,502 109,214 2010's 101,487 84,270 87,398 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas Natural Gas Gross Withdrawals Alabama Offshore Natural Gas Gross Withdrawals and Production


California--State Offshore Natural Gas Gross Withdrawals (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) California--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 14,763 14,963 1980's 14,080 13,929 14,153 13,916 13,844 19,504 18,277 13,030 11,141 9,098 1990's 8,083 7,610 7,242 6,484 7,204 5,904 6,309 7,171 6,883 6,738 2000's 7,808 7,262 7,068 6,866 6,966 6,685 6,809 7,289 7,029 6,052 2010's 5,554 5,163 5,051 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas Natural Gas Gross Withdrawals


E-Print Network 3.0 - advanced cancer excluding Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Powered by Explorit Topic List Advanced Search Sample search results for: advanced cancer excluding Page: << < 1 2 3 4 5 > >> 1 Eur J Cancer. Author manuscript Social...


California Natural Gas Gross Withdrawals Total Offshore (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals Total Offshore (Million Cubic Feet) Gross Withdrawals Total Offshore (Million Cubic Feet) California Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 5,417 19,929 20,394 1980's 19,980 26,692 31,904 38,084 60,207 84,062 77,355 67,835 60,308 59,889 1990's 58,055 59,465 62,473 58,635 60,765 60,694 73,092 80,516 81,868 84,547 2000's 83,882 78,209 74,884 64,961 61,622 60,773 47,217 52,805 51,931 47,281 2010's 46,755 41,742 32,313 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Alaska Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals Total Offshore (Million Cubic Feet) Gross Withdrawals Total Offshore (Million Cubic Feet) Alaska Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 72,813 71,946 1980's 63,355 71,477 66,852 68,776 68,315 62,454 63,007 69,656 101,440 122,595 1990's 144,064 171,665 216,377 233,198 224,301 113,552 126,051 123,854 133,111 125,841 2000's 263,958 262,937 293,580 322,010 334,125 380,568 354,816 374,204 388,188 357,490 2010's 370,148 364,702 307,306 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Federal Offshore California Natural Gas Gross Withdrawals (Million Cubic  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) Federal Offshore California Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 5,417 5,166 5,431 1980's 5,900 12,763 17,751 24,168 46,363 64,558 59,078 54,805 49,167 50,791 1990's 49,972 51,855 55,231 52,150 53,561 54,790 66,784 73,345 74,985 77,809 2000's 76,075 70,947 67,816 58,095 54,655 54,088 40,407 45,516 44,902 41,229 2010's 41,200 36,579 27,262 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 12/12/2013 Next Release Date: 1/7/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Federal Offshore--Louisiana Natural Gas Gross Withdrawals (Million Cubic  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) Federal Offshore--Louisiana Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 3,838,521 4,101,321 4,262,607 1980's 4,200,273 4,202,553 3,879,918 3,313,354 3,750,641 3,286,091 3,071,900 3,384,442 3,418,949 3,373,680 1990's 3,549,524 3,401,801 3,304,336 3,351,101 3,513,981 3,460,103 3,689,170 3,760,953 3,759,040 3,732,046 2000's 3,671,424 NA NA NA NA NA NA NA NA NA 2010's NA NA 0 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 12/12/2013 Next Release Date: 1/7/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Louisiana--State Offshore Natural Gas Gross Withdrawals (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) Louisiana--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 498,876 487,512 1980's 417,312 381,938 366,546 322,588 319,638 256,736 207,265 225,599 214,645 204,005 1990's 182,240 148,429 138,101 157,011 159,513 94,044 192,527 180,848 192,956 164,523 2000's 141,567 153,871 137,192 133,456 129,245 107,584 97,479 72,868 86,198 76,386 2010's 69,836 71,226 73,244 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Gross Energy Cost of Horizontal Treadmill and Track Running  

Science Journals Connector (OSTI)

The gross energy cost of treadmill and track running is re-...2...(ml/kg/min) = 2.209 + 3.163 speed (km/h) for 130 subjects (trained and untrained males and females) and 10 treadmill studies. On the track, wind r...

Dr L. Lger; D. Mercier



An alpha scintillation spectrometer  

E-Print Network (OSTI)

investi- gation of the properties of alpha radiation. In his work, the scin- tillations produced by alpha particles impinging on a zinc-sulphide screen were observed and counted visually with the aid of a low power microscope. The scintillations..., the source changing in the proportional counter is inconvenient, requiring a fairly elaborate gas handling and purifying system. Alpha particl s, when passing through a photographic emulsion, ionize the silver halide crystals with which they come...

Yates, Ralph Aaron



Gross Receipts Tax Exemption for Sales of Wind and Solar Systems to Government Entities  

Energy.gov (U.S. Department of Energy (DOE))

New Mexico has a gross receipts tax structure for businesses instead of a sales tax. Businesses are taxed on the gross amount of their business receipts each year before expenses are deducted. ...


U.S. Natural Gas Gross Withdrawals Offshore (Million Cubic Feet...  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals Offshore (Million Cubic Feet) U.S. Natural Gas Gross Withdrawals Offshore (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...



NLE Websites -- All DOE Office Websites (Extended Search)

FUMIGATION, GROSS NITROGEN TRANSFORMATIONS, N-15, FUMIGATION, GROSS NITROGEN TRANSFORMATIONS, N-15, NITRATE, RATES, SOIL 1909 Pushnik, J.C., R.S. Demaree, J.L.J. Houpis, W.B. Flory, S.M. Bauer, and P.D. Anderson. 1995. The effect of elevated carbon dioxide on a Sierra-Nevadan dominant species: Pinus ponderosa. Journal of Biogeography 22(2-3):249-254. The impact of increasing atmospheric CO2 has not been fully evaluated on western coniferous forest species. Two year old seedlings of Pinus ponderosa were grown in environmentally controlled chambers under increased CO2 conditions (525 mu L L(-1) and 700 mu L L(-1)) for 6 months. These trees exhibited morphological, physiological and biochemical alterations when compared to our controls (350 mu L L(- 1)). Analysis of whole plant biomass distribution has shown no


Local well-posedness for Gross-Pitaevskii hierarchies  

E-Print Network (OSTI)

We consider the Cauchy problem for the Gross-Pitaevskii infinite linear hierarchy of equations on $\\mathbb{R}^n.$ By introducing a (F)-norm in certain Sobolev type spaces of sequences of marginal density matrices, we establish local existence, uniqueness and stability of solutions. Explicit space-time type estimates for the solutions are obtained as well. In particular, this (F)-norm is compatible with the usual Sobolev space norm whenever the initial data is factorized.

Zeqian Chen



Texas Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals Total Offshore (Million Cubic Feet) Gross Withdrawals Total Offshore (Million Cubic Feet) Texas Natural Gas Gross Withdrawals Total Offshore (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 88,258 418,474 760,566 1980's 949,177 1,010,772 1,120,830 992,041 1,021,260 942,413 1,169,038 1,330,604 1,376,093 1,457,841 1990's 1,555,568 1,494,494 1,411,147 1,355,333 1,392,727 1,346,674 1,401,753 1,351,067 1,241,264 1,206,045 2000's 1,177,257 53,649 57,063 53,569 44,946 36,932 24,785 29,229 46,786 37,811 2010's 28,574 23,791 16,506 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014


Imaging alpha particle detector  

DOE Patents (OSTI)

A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, D.F.



Imaging alpha particle detector  

DOE Patents (OSTI)

A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, David F. (Los Alamos, NM)



Event counting alpha detector  

DOE Patents (OSTI)

An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

Bolton, R.D.; MacArthur, D.W.



Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight  

NLE Websites -- All DOE Office Websites (Extended Search)

1: May 3, 2010 1: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight to someone by E-mail Share Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight on Facebook Tweet about Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight on Twitter Bookmark Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight on Google Bookmark Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight on Delicious Rank Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight on Digg Find More places to share Vehicle Technologies Office: Fact #621: May 3, 2010 Gross Vehicle Weight vs. Empty Vehicle Weight on AddThis.com...


Particle number fluctuations in nuclear collisions within excluded volume hadron gas model  

E-Print Network (OSTI)

The multiplicity fluctuations are studied in the van der Waals excluded volume hadron-resonance gas model. The calculations are done in the grand canonical ensemble within the Boltzmann statistics approximation. The scaled variances for positive, negative and all charged hadrons are calculated along the chemical freeze-out line of nucleus-nucleus collisions at different collision energies. The multiplicity fluctuations are found to be suppressed in the van der Waals gas. The numerical calculations are presented for two values of hard-core hadron radius, $r=0.3$ fm and 0.5 fm, as well as for the upper limit of the excluded volume suppression effects.

M. I. Gorenstein; M. Hauer; D. O. Nikolajenko



Spatial confinement and thermal deconfinement in the Gross-Neveu model  

SciTech Connect

We discuss the occurrence of spatial confinement and thermal deconfinement in the massive, D-dimensional, Gross-Neveu model with compactified spatial dimensions.

Malbouisson, J. M. C. [Instituto de Fisica, Universidade Federal da Bahia, 40210-340, Salvador, BA (Brazil); Khanna, F. C. [Theoretical Physics Institute, University of Alberta, Edmonton, Alberta T6G 2J1 (Canada); Malbouisson, A. P. C. [Centro Brasileiro de Pesquisas Fisicas/MCT, 22290-180, Rio de Janeiro, RJ (Brazil); Santana, A. E. [Instituto de Fisica, Universidade de Brasilia, 70910-900, Brasilia, DF (Brazil)




E-Print Network (OSTI)

APPLICATION OF MICROECONOMIC METRICS IN COMPETITIVE ELECTRICITY MARKETS Pedro Correia and George Gross Department of Electrical and Computer Engineering University of Illinois at Urbana

Gross, George



E-Print Network (OSTI)


Gray, William


South Dakota Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


New Mexico Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals 114,592 111,779 113,921 114,129 109,438 114,219 1991-2013 From Gas Wells


West Virginia Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


Gulf of Mexico Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals 114,382 103,384 110,472 103,769 106,596 102,840 1997-2013 From Gas Wells

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


New York Natural Gas Gross Withdrawals and Production  

Gasoline and Diesel Fuel Update (EIA)

Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Alaska Federal Offshore Gulf of Mexico Louisiana New Mexico Oklahoma Texas Wyoming Other States Total Alabama Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Maryland Michigan Mississippi Missouri Montana Nebraska Nevada New York North Dakota Ohio Oregon Pennsylvania South Dakota Tennessee Utah Virginia West Virginia Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Gross Withdrawals NA NA NA NA NA NA 1991-2013 From Gas Wells NA NA NA NA NA NA 1991-2013


6 Multicomponent Density-Functional Theory R. van Leeuwen and E.K.U. Gross  

E-Print Network (OSTI)

6 Multicomponent Density-Functional Theory R. van Leeuwen and E.K.U. Gross 6.1 Introduction fields. Our goal is to set up a time-dependent multicomponent density-functional theory (TDMCDFT.K.U. Gross: Multicomponent Density-Functional Theory, Lect. Notes Phys. 706, 93­106 (2006) DOI 10

Gross, E.K.U.


Other incarnations of the Gross-Pitaevskii dark soliton Indubala I Satija 1,2  

E-Print Network (OSTI)

Other incarnations of the Gross-Pitaevskii dark soliton Indubala I Satija 1,2 and Radha Balakrishnan3 1 Department of Physics, George Mason University, Fairfax, VA 22030 2 National Institute 600113, India (Dated: May 31, 2010) We show that the dark soliton of the Gross-Pitaevskii equation (GPE

Satija, Indu


The Gross-Pitaevskii Soliton: Relating Weakly and Strongly Repulsive Bosonic condensates and the magnetic soliton  

E-Print Network (OSTI)

The Gross-Pitaevskii Soliton: Relating Weakly and Strongly Repulsive Bosonic condensates and the magnetic soliton Indubala I Satija 1,2 and Radha Balakrishnan3 1 Department of Physics, George Mason soliton of the Gross-Pitaevskii equation (GPE) that describes the Bose-Einstein con- densate (BEC) density

Satija, Indu


Alpha-decay half-lives, alpha-capture and alpha-nucleus potential  

E-Print Network (OSTI)

The alpha-decay half-lives and the alpha-capture cross-sections are evaluated in the framework of unified model for alpha-decay and alpha-capture. In the framework of this model the alpha-decay and alpha-capture are considered as penetration of the alpha-particle through the potential barrier formed by nuclear, Coulomb and centrifugal interactions between alpha-particle and nucleus. The spins and the parities of parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of daughter nuclei are taken into account for evaluation of the alpha-decay half-lives. The alpha-decay half-lives for 344 nuclei and the alpha-capture cross-sections of 40Ca, 44Ca, 59Co, 208Pb and 209Bi agree well with the experimental data. The evaluated alpha-decay half-lives within the range 10^{-9} alpha-emitters are tabulated.

V. Yu. Denisov; A. A. Khudenko



Ionic Asymmetry and Solvent Excluded Volume Effects on Spherical Electric Double Layers: A Density Functional Approach  

SciTech Connect

In this article we present a classical density functional theory for electrical double layers of spherical macroions that extends the capabilities of conventional approaches by accounting for electrostatic ion correlations, size asymmetry and excluded volume effects. The approach is based on a recent approximation introduced by Hansen-Goos and Roth for the hard sphere excess free energy of inhomogeneous fluids (J. Chem. Phys. 124, 154506). It accounts for the proper and efficient description of the effects of ionic asymmetry and solvent excluded volume, especially at high ion concentrations and size asymmetry ratios including those observed in experimental studies. Additionally, we utilize a leading functional Taylor expansion approximation of the ion density profiles. In addition, we use the Mean Spherical Approximation for multi-component charged hard sphere fluids to account for the electrostatic ion correlation effects. These approximations are implemented in our theoretical formulation into a suitable decomposition of the excess free energy which plays a key role in capturing the complex interplay between charge correlations and excluded volume effects. We perform Monte Carlo simulations in various scenarios to validate the proposed approach, obtaining a good compromise between accuracy and computational cost. We use the proposed computational approach to study the effects of ion size, ion size asymmetry and solvent excluded volume on the ion profiles, integrated charge, mean electrostatic potential, and ionic coordination number around spherical macroions in various electrolyte mixtures. Our results show that both solvent hard sphere diameter and density play a dominant role in the distribution of ions around spherical macroions, mainly for experimental water molarity and size values where the counterion distribution is characterized by a tight binding to the macroion, similar to that predicted by the Stern model.

Medasani, Bharat; Ovanesyan, Zaven; Thomas, Dennis G.; Sushko, Maria L.; Marucho, Marcelo



Clean Water Act (excluding Section 404). Environmental guidance program reference book: Revision 6  

SciTech Connect

This Reference Book contains a current copy of the Clean Water Act (excluding Section 404) and those regulations that implement the statutes and appear to be most relevant to US Department of Energy (DOE) activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Updates that include important new requirements will be provided periodically. Questions concerning this Reference Book may be directed to Mark Petts, EH-231 (202/586-2609).

Not Available



Table 3. Gross Domestic Product, Projected vs. Actual  

Gasoline and Diesel Fuel Update (EIA)

Gross Domestic Product, Projected vs. Actual Gross Domestic Product, Projected vs. Actual (cumulative average percent growth in projected real GDP from first year shown for each AEO) 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 AEO 1982 4.3% 3.8% 3.6% 3.3% 3.2% 3.2% AEO 1983 3.3% 3.3% 3.4% 3.3% 3.2% 3.1% 2.7% AEO 1984 2.7% 2.4% 2.9% 3.1% 3.1% 3.1% 2.7% AEO 1985 2.3% 2.2% 2.7% 2.8% 2.9% 3.0% 3.0% 3.0% 2.9% 2.8% 2.8% AEO 1986 2.6% 2.5% 2.7% 2.5% 2.5% 2.6% 2.6% 2.6% 2.5% 2.5% 2.5% 2.5% 2.5% 2.5% 2.5% AEO 1987 2.7% 2.3% 2.4% 2.5% 2.5% 2.6% 2.6% 2.5% 2.4% 2.3% AEO 1989* 4.0% 3.4% 3.1% 3.0% 2.9% 2.8% 2.7% 2.7% 2.7% 2.6% 2.6% 2.6% 2.6% AEO 1990 2.9% 2.3% 2.5% 2.5% 2.4% AEO 1991 0.8% 1.0% 1.7% 1.8% 1.8% 1.9% 2.0% 2.1% 2.1% 2.1% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% AEO 1992 -0.1% 1.6% 2.0% 2.2% 2.3% 2.2% 2.2% 2.2% 2.2% 2.3% 2.3% 2.3% 2.3% 2.2%


Table 2. Real Gross Domestic Product, Projected vs. Actual  

U.S. Energy Information Administration (EIA) Indexed Site

Real Gross Domestic Product, Projected vs. Actual Real Gross Domestic Product, Projected vs. Actual Projected Real GDP Growth Trend (cumulative average percent growth in projected real GDP from first year shown for each AEO) 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 AEO 1994 3.1% 3.2% 2.9% 2.8% 2.7% 2.7% 2.6% 2.6% 2.6% 2.5% 2.5% 2.5% 2.4% 2.4% 2.4% 2.4% 2.3% 2.3% AEO 1995 3.7% 2.8% 2.5% 2.7% 2.7% 2.6% 2.6% 2.5% 2.5% 2.5% 2.5% 2.4% 2.4% 2.4% 2.3% 2.3% 2.2% AEO 1996 2.6% 2.2% 2.5% 2.5% 2.5% 2.5% 2.4% 2.4% 2.4% 2.4% 2.4% 2.3% 2.3% 2.2% 2.2% 2.2% 1.6% AEO 1997 2.1% 1.9% 2.0% 2.2% 2.3% 2.3% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% 2.2% 2.1% 2.1% 1.5% AEO 1998 3.4% 2.9% 2.6% 2.5% 2.4% 2.4% 2.3% 2.3% 2.3% 2.3% 2.3% 2.3% 2.3% 2.2% 1.8% AEO 1999 3.4% 2.5% 2.5% 2.4% 2.4% 2.4% 2.3% 2.4% 2.4% 2.4% 2.4% 2.4% 2.4% 1.8% AEO 2000 3.8% 2.9% 2.7% 2.6% 2.6% 2.6% 2.6% 2.6% 2.5% 2.5%


Gross Input to Atmospheric Crude Oil Distillation Units  

U.S. Energy Information Administration (EIA) Indexed Site

Day) Day) Process: Gross Input to Atmospheric Crude Oil Dist. Units Operable Capacity (Calendar Day) Operating Capacity Idle Operable Capacity Operable Utilization Rate Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Process Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History U.S. 15,283 15,709 16,327 16,490 16,306 16,162 1985-2013 PADD 1 1,134 1,188 1,178 1,142 1,122 1,130 1985-2013 East Coast 1,077 1,103 1,080 1,058 1,031 1,032 1985-2013 Appalachian No. 1 57 85 98 84 90 97 1985-2013 PADD 2 3,151 3,087 3,336 3,572 3,538 3,420 1985-2013 Ind., Ill. and Ky. 2,044 1,947 2,069 2,299 2,330 2,266 1985-2013


Note on gross capital formation and R&D expenditure  

Science Journals Connector (OSTI)

Companies often consider the cost of R&D projects (especially salaries paid to R&D personnel) as part of their current expenses. Companies continue to do this practice even without exactly specifying what they mean by R&D project costs. This practice is misleading because spending on research is undeniably a form of fixed capital investment, even more so than the item that economists consider as the epitome of fixed capital investment ?? purchase of machinery. The dynamics of the possible relationship between investment in research and investment in machinery is that during times of economic expansion, firms tend to increase their investment in research to come up with product innovations capable of exploiting increasing effectual demand. Over time, this investment results in the emergence of the direct relationship between expense on industrial R&D and the business cycle. We tested this hypothesis both in Italy and in the USA. Our experiments are based on OECD statistics, referring to R&D spending from 1987 to 1999, and on the magnitude 'Gross Capital Formation' in the manufacturing industry. We chose to represent our conjecture about a causal relationship between investment cycle and R&D expenditure econometrically.

Mario De Marchi; Maurizio Rocchi



Other States Total Natural Gas Gross Withdrawals and Production  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly Annual Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History Gross Withdrawals 4,430,466 4,839,942 5,225,005 5,864,402 6,958,125 8,225,321 1991-2012 From Gas Wells 2,480,211 2,613,139 2,535,642 2,523,173 1991-2010 From Oil Wells 525,280 534,253 648,906 691,643 1991-2010 From Shale Gas Wells 569,502 796,138 1,146,821 1,787,965 2007-2010 From Coalbed Wells 855,473 896,412 893,636 861,620 2002-2010 Repressuring 48,011 51,781 43,376 45,994 1991-2010 Vented and Flared 32,600 52,667 55,544 53,950 1991-2010 Nonhydrocarbon Gases Removed 223,711 282,651 291,611 352,304 1994-2010


Grade Assignments for Models Used for Calibration of Gross-Count Gamma-Ray Logging Systems (December 1983)  

Energy.gov (U.S. Department of Energy (DOE))

Grade Assignments for Models Used for Calibration of Gross-Count Gamma-Ray Logging Systems (December 1983)


Other States Natural Gas Gross Withdrawals from Coalbed Wells (Million  

Gasoline and Diesel Fuel Update (EIA)

Coalbed Wells (Million Cubic Feet) Coalbed Wells (Million Cubic Feet) Other States Natural Gas Gross Withdrawals from Coalbed Wells (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2002 0 0 0 0 0 0 0 0 0 0 0 0 2003 5,335 4,954 5,465 5,228 5,405 5,163 4,817 5,652 5,165 5,347 4,814 5,420 2004 5,684 5,278 5,822 5,570 5,758 5,500 5,132 6,022 5,502 5,697 5,129 5,774 2005 5,889 5,469 6,033 5,771 5,967 5,699 5,318 6,240 5,702 5,903 5,315 5,983 2006 65,302 59,484 66,007 63,071 65,663 63,437 65,249 65,951 62,242 65,271 63,215 64,841 2007 72,657 65,625 72,657 70,313 72,657 70,313 72,657 72,657 70,313 72,657 70,313 72,657 2008 75,926 71,027 75,926 73,476 75,926 73,476 75,926 75,926 73,476 75,926 73,476 75,926


Description of Hot and Dense Hadron Gas Properties in a New Excluded-Volume model  

E-Print Network (OSTI)

A new equation of state for a hot and dense hadron gas (HG) is obtained where the finite hard-core size of baryons has been incorporated in a thermodynamically consistent formulation of excluded volume correction. Our model differs from other existing approaches on the following points. We assign a hard-core volume only to each baryon and mesons though possess a small volume but they can fuse and interpenetrate into one another. Use of the full quantum statistics is made in obtaining the grand canonical partition function where excluded-volume correction has been incorporated by explicitly integrating over volume. We thus find that the new model works even for the cases of extreme temperatures and/or densities where most of other approaches fail. The model does not violate causality even at extreme densities. The temperature and density dependence of various thermodynamical quantities, e.g. pressure, baryon density, entropy and energy density compare well with the results of other microscopic HG models. After suitable parametrization of the centre-of-mass energy in terms of temperature and baryon chemical potential, we explore some new freeze-out criteria which exhibit full independence of the collision energy and of the structures of the colliding nuclei. We further demonstrate the suitability of our model in explaining various experimental results of the multiplicity-ratios of various particles and their antiparticles. Finally, we use our excluded-volume model to obtain the transport behaviour of the hot and/or dense HG such as shear viscosity to entropy ratio, speed of sound etc. and compare the results with earlier calculations.

S. K. Tiwari; P. K. Srivastava; C. P. Singh



,"US--Federal Offshore Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (MMcf)" Gross Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","US--Federal Offshore Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1060_rusf_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1060_rusf_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:57:21 AM"


,"Federal Offshore California Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (MMcf)" Gross Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Federal Offshore California Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1060_r5f_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1060_r5f_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:57:18 AM"


Bifurcated Endograft (Excluder) in the Treatment of Isolated Iliac Artery Aneurysm: Preliminary Report  

SciTech Connect

The aim of this study was to evaluate the effectiveness of endovascular repair in the treatment of isolated iliac artery aneurysm (IAA) using Excluder bifurcated endograft. Eight consecutive patients with IAA were treated during a period of 45 months using Excluder bifurcated endograft. Two patients presented with isolated IAA rupture and were treated emergently, whereas the other six patients underwent elective treatment. All aneurysms lacked sufficient proximal necks and therefore were not suitable for tubular-shaped endograft. Follow-up imaging was performed at 1 week, at every 3 months during the first year, semiannually until 2 years, and annually afterward using angio-computed axial tomography and plain films. Technical success was achieved in all patients. No mortality was seen despite two patients having IAA rupture. Follow-up (12 to 60 months) was done in all but one patient. During this period, complications were observed in three patients. One patient developed sexual impotence at 3-month follow up; one patient presented unilateral gluteal claudication after the procedure, which resolved at 3 months; and one patient developed a graft porosity-related endoleak, which was successfully managed with placement of an additional ipsilateral iliac extension. Endovascular treatment of isolated IAA using bifurcated endograft is safe and can be an alternative to surgical treatment. The benefits from decreased morbidity and mortality of endoluminal treatment of isolated IAA using bifurcated endograft outweigh the minor complications associated with this technique, which are mostly related to occlusion of hypogastric arteries.

Zander, Tobias, E-mail: tobiaszander@gmx.de; Baldi, Sebastian; Rabellino, Martin [Las Palmas de Gran Canaria University, Endoluminal Vascular Department, Rambla Hospiten Clinic Group (Spain); Kirsch, David [Louisiana State University Health Sciences Center (United States); Llorens, Rafael; Zerolo, Ignacio [Las Palmas de Gran Canaria University, Department of Cardiosurgery, Rambla Hospiten Clinic Group (Spain); Qian, Zhong [Louisiana State University Health Sciences Center (United States); Maynar, Manuel [Las Palmas de Gran Canaria University, Endoluminal Vascular Department, Rambla Hospiten Clinic Group (Spain)



E-Print Network 3.0 - alpha-alpha interaction contribution Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Alberta Collection: Computer Technologies and Information Sciences 55 Join The Gator Nation GENERAL INFORMATION 2011-12 Summary: Pi Alpha Gamma Rho Alpha Kappa Alpha...


Oil and Gas Gross Production Tax (North Dakota) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oil and Gas Gross Production Tax (North Dakota) Oil and Gas Gross Production Tax (North Dakota) Oil and Gas Gross Production Tax (North Dakota) < Back Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Construction Municipal/Public Utility Local Government Residential Installer/Contractor Rural Electric Cooperative Tribal Government Low-Income Residential Schools Retail Supplier Institutional Multi-Family Residential Systems Integrator Fuel Distributor Nonprofit General Public/Consumer Transportation Program Info State North Dakota Program Type Fees A gross production tax applies to most gas produced in North Dakota. Gas burned at the well site to power an electrical generator that consumes at least 75 percent of the gas is exempt from taxation under this chapter.

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Natural Gas Gross Withdrawals from Oil Wells (Million Cubic...  

NLE Websites -- All DOE Office Websites (Extended Search)

Oil Wells (Million Cubic Feet) U.S. Natural Gas Gross Withdrawals from Oil Wells (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 475,614 500,196 1993...


Fact #564: March 30, 2009 Transportation and the Gross Domestic Product, 2007  

Energy.gov (U.S. Department of Energy (DOE))

Transportation plays a major role in the U.S. economy. About 10% of the U.S. Gross Domestic Product (GDP) in 2007 is related to transportation. Housing, health care, and food are the only...


Fact #768: February 25, 2013 New Light Vehicle Sales and Gross...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

downs. Those ups and downs are also reflected in the change in Gross Domestic Product (GDP) over time which shows a trend similar to the vehicle sales trend. Vehicle sales have...


Affecting the Gross Cooling Power of a Pulse Tube Cryocooler with Mass Flow Control  

Science Journals Connector (OSTI)

To increase the cooling capacity of a pulse tube cryocooler the ... For a given pulse tube volume the gross cooling power is limited. Since the cooling effect originates from the phase shift angle ... we present ...

A. Waldauf; T. Schmauder; M. Thrk; P. Seidel



Analysis of historical gross gamma logging data from BY tank farm  

SciTech Connect

Gross gamma ray logs, recorded from January 1975 through mid-year 1994 as part of the Single-Shell Tank Farm Dry Well Surveillance Program, have been reanalyzed for the BY tank farm to locate the presence of mobile radionuclides in the subsurface. This report presents the BY tank farm gross gamma ray data in such a way as to assist others in their study of vadose zone mechanisms.




Analysis of historical gross gamma logging data from BX tank farm  

SciTech Connect

Gross gamma ray logs, recorded from January 1975 through mid-year 1994 as part of the Single-Shell Tank Farm Dry Well Surveillance Program, have been reanalyzed for the BX tank farm to locate the presence of mobile radionuclides in the subsurface. This report presents the BX tank farm gross gamma ray data in such a way as to assist others in their study of vadose zone mechanism.




I. Excluded Volume Effects in Ising Cluster Distributions and Nuclear Multifragmentation II. Multiple-Chance Effects in Alpha-Particle Evaporation  

E-Print Network (OSTI)

New York, [Isin 25] E . Ising, Z. Phys. 31, 253 (1925). [d e d V o l u m e Effects in Ising Cluster Distributions andl u d e d Volume Effects i n Ising Cluster Distributions and

Breus, Dimitry E.



Uncertainties on alpha_S in global PDF analyses  

E-Print Network (OSTI)

We determine the uncertainty on the strong coupling alpha_S due to the experimental errors on the data fitted in global analysis of hard-scattering data, within the standard framework of leading-twist fixed-order collinear factorisation in the MSbar scheme, finding that alpha_S(M_Z^2) = 0.1202^{+0.0012}_{-0.0015} at next-to-leading order and alpha_S(M_Z^2) = 0.1171^{+0.0014}_{-0.0014} at next-to-next-to-leading order. We investigate the interplay between uncertainties on alpha_S and uncertainties on parton distribution functions (PDFs). We show, for the first time, how both these sources of uncertainty can be accounted for simultaneously in calculations of cross sections, and we provide eigenvector PDF sets with different fixed alpha_S values to allow further studies by the general user. We illustrate the application of these PDF sets by calculating cross sections for W, Z, Higgs boson and inclusive jet production at the Tevatron and LHC.

Martin, A D; Thorne, R S; Watt, G



Infection with Strains of Citrus Tristeza Virus Does Not Exclude Superinfection by Other Strains of the Virus  

Science Journals Connector (OSTI)

...distinct strains. However, this model does not explain how hybrid viruses containing...Graft-transmissible diseases of detritus: handbook for detection and diagnosis. FAO, Rome...Infection with strains of Citrus tristeza virus does not exclude superinfection by other strains...

Svetlana Y. Folimonova; Cecile J. Robertson; Turksen Shilts; Alexey S. Folimonov; Mark E. Hilf; Stephen M. Garnsey; William O. Dawson



Derr Track Storage Bldg Sigma Alpha  

E-Print Network (OSTI)

!( Derr Track Storage Bldg Solar House Entomology Lab Bldg Sigma Alpha Epsilon 11 MEAS Ocean Lab & Storage Avent Ferry Complex Building Sigma Phi Epsilon 7 Pi Kappa Alpha 10 Sigma Alpha Mu 4 Tau Kappa

Reeves, Douglas S.


EIA-Revisions to Gross Domestic product and Implications for the  

Gasoline and Diesel Fuel Update (EIA)

Revisions to Gross Domestic Product and Implications for the Comparisons Revisions to Gross Domestic Product and Implications for the Comparisons Annual Energy Outlook Retrospective Review: Evaluation of Projections in Past Editions (1982-2008) Revisions to Gross Domestic Product and Implications for the Comparisons The concept of GDP is a commonly used measure of economic activity. It can be expressed in nominal dollars or, with the use of a matched price index to remove inflation, in "real" terms. Movements in nominal GDP show how the value of goods and services produced by the United States changes over time, while real GDP is a measure of how the physical production of the economy has grown. While simple in concept, the projecting of nominal and real GDP and the interpretation of these projected measures relative to "history" is not simple or straightforward. The Bureau of Economic Analysis (BEA) within the U.S. Department of Commerce continually adjusts the National Income and Product Accounts data, with comprehensive revisions completed every 4 or 5 years. The last four major revisions (1985, 1991, 1995, and 1999) incorporated definitional and statistical changes, as well as emphasizing new ways of presenting the data. Also, prior to AEO1993 aggregate economic activity was measured and projected on the basis of Gross National Product (GNP) as opposed to Gross Domestic Product (GDP). For the period from 1984 through 2004, nominal GNP is on average approximately 0.45 percent above nominal GDP.


Risk assessment of loss of structural integrity of a floating production platform due to gross errors  

Science Journals Connector (OSTI)

During the last years The Norwegian Petroleum Directorate, as well as Statoil, has put increased focus on how gross errors related to structural integrity are influencing the safety of offshore installations. Also, the loss of the P36, a floating platform outside Brazil in 2001, emphasised the importance to control gross errors in large projects. On this basis, a work to assess the risk of loss of the structural integrity of the Kristin platform, during operation, due to failure from gross errors was initiated. The Kristin platform is a permanently moored ring-pontoon semi-submersible production unit planned to be placed in the south-west part of Haltenbanken area in the North Sea in 2005. The water depth at the site is approximately 315m. The objective of this work was to quantify the risk contribution from gross errors related to structural integrity and to pinpoint the most critical items that may govern the probability of gross error for the Kristin platform. Some of the main findings from this work are presented in this paper.

Inge Lotsberg; Odd Olufsen; Gunnar Solland; Jan Inge Dalane; Sverre Haver



,"Federal Offshore--Texas Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Texas Natural Gas Gross Withdrawals (MMcf)" Texas Natural Gas Gross Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Federal Offshore--Texas Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1060_r44f_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1060_r44f_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:57:18 AM"


,"Federal Offshore--Louisiana Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (MMcf)" Gross Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Federal Offshore--Louisiana Natural Gas Gross Withdrawals (MMcf)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1060_r19f_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1060_r19f_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:57:18 AM"


Workshop on Precision Measurements of $\\alpha_s$  

SciTech Connect

These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

Bethke, Siegfried; /Munich, Max Planck Inst.; Hoang, Andre H.; /Vienna U.; Kluth, Stefan; /Munich, Max Planck Inst.; Schieck, Jochen; /Munich U.; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS



Texas--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) Texas--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 169,219 206,490 1980's 252,996 235,421 245,626 147,330 111,482 107,543 114,501 98,050 97,545 110,901 1990's 108,404 98,493 78,263 79,234 84,573 63,181 63,340 64,528 60,298 48,918 2000's 41,195 53,649 57,063 53,569 44,946 36,932 24,785 29,229 46,786 37,811 2010's 28,574 23,791 16,506 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Alaska--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) Alaska--State Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 72,813 71,946 1980's 63,355 71,477 66,852 68,776 68,315 62,454 63,007 69,656 101,440 122,595 1990's 144,064 171,665 216,377 233,198 224,301 113,552 126,051 123,854 133,111 125,841 2000's 263,958 262,937 293,580 322,010 334,125 380,568 354,816 374,204 388,188 357,490 2010's 370,148 364,702 307,306 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Federal Offshore--Texas Natural Gas Gross Withdrawals (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) Federal Offshore--Texas Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 88,258 249,255 554,076 1980's 696,181 775,351 875,204 844,711 909,778 834,870 1,054,537 1,232,554 1,278,548 1,346,940 1990's 1,447,164 1,396,001 1,332,883 1,276,099 1,308,154 1,283,493 1,338,413 1,286,539 1,180,967 1,157,128 2000's 1,136,062 NA NA NA NA NA NA NA NA NA 2010's NA NA 0 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 12/12/2013 Next Release Date: 1/7/2014 Referring Pages: Offshore Gross Withdrawals of Natural Gas


Density-Functional Theory for Triplet Superconductors K. Capelle E.K.U. Gross  

E-Print Network (OSTI)

Density-Functional Theory for Triplet Superconductors K. Capelle E.K.U. Gross Institut f Introduction The purpose of this work is to generalize the density-functional theory (DFT) for superur Theoretische Physik Universitat Wurzburg Am Hubland D-97074 Wurzburg Germany Abstract The density-functional

Gross, E.K.U.


Electronic Structure: Density Functional Theory S. Kurth, M. A. L. Marques, and E. K. U. Gross  

E-Print Network (OSTI)

Electronic Structure: Density Functional Theory S. Kurth, M. A. L. Marques, and E. K. U. Gross: July 5, 2003) PACS numbers: 71.15.Mb, 31.15.Ew 1 #12;I. INTRODUCTION Density functional theory (DFT systems becomes prohibitive. A different approach is taken in density functional theory where, instead

Gross, E.K.U.

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Time-dependent Density Functional Theory Miguel A. L. Marques and E. K. U. Gross  

E-Print Network (OSTI)

Time-dependent Density Functional Theory Miguel A. L. Marques and E. K. U. Gross 1 Introduction Time-dependent density-functional theory (TDDFT) extends the basic ideas of ground-state density-functional is the one-body electron density, n(r, t). The advantages are clear: The many-body wave-function, a function

Wu, Zhigang


Copyright George Gross, 2004 1 Evolving Nature of Electricity Market Design in the U.S.  

E-Print Network (OSTI)

of the wholesale electricity industry including · the structure of wholesale energy markets; · transmissionCopyright George Gross, 2004 1 Evolving Nature of Electricity Market Design in the U.S. G a robust wholesale market via the so-called standard design (SMD) proposed rule making. The SMD was a bold


Math 151-2 INTRODUCTION TO MATLAB L. J. Gross -August 1995  

E-Print Network (OSTI)

Math 151-2 INTRODUCTION TO MATLAB L. J. Gross - August 1995 This is a very basic introduction to the elements of MATLAB that will be used in the early part of this course. A much more complete description is available for purchase (The Student Edition of MATLAB for MS-DOS or the version for Windows), however

Gross, Louis J.


PECO-ELIGIBLE PROJECT REQUESTS Academic or Net Gross Project Cost Educational Approved by  

E-Print Network (OSTI)

PECO-ELIGIBLE PROJECT REQUESTS Academic or Net Gross Project Cost Educational Approved by 2013 Priority to Benefit Square Feet Feet Project (Proj. Cost/ Recommended reference No Project Title Year 1 Year 2 Year 3 Year 4 Year 5 from Projects (NASF) (GSF) Cost GSF) Date/Rec No. 1 UTILITIES

Slatton, Clint


PECO-ELIGIBLE PROJECT REQUESTS Academic or Net Gross Project Cost Educational Approved by  

E-Print Network (OSTI)

PECO-ELIGIBLE PROJECT REQUESTS Academic or Net Gross Project Cost Educational Approved by 2014 Priority to Benefit Square Feet Feet Project (Proj. Cost/ Recommended reference No Project Title Year 1 Year 2 Year 3 Year 4 Year 5 from Projects (NASF) (GSF) Cost GSF) Date/Rec No. 1 UTILITIES

Slatton, Clint


PECO-ELIGIBLE PROJECT REQUESTS Academic or Net Gross Project Cost Educational Approved by  

E-Print Network (OSTI)

PECO-ELIGIBLE PROJECT REQUESTS Academic or Net Gross Project Cost Educational Approved by 2015 Priority to Benefit Square Feet Feet Project (Proj. Cost/ Recommended reference No Project Title Year 1 Year 2 Year 3 Year 4 Year 5 from Projects (NASF) (GSF) Cost GSF) Date/Rec No. 1 UTILITIES

Slatton, Clint


Species independence of mutual information in coding and noncoding DNA Ivo Grosse,1  

E-Print Network (OSTI)

- isms, and the goal of genome projects is to uncover that genetic information. Hence, genomes of many. Mutual information function, I(k), of human coding thin line and noncoding thick line DNA, from GenSpecies independence of mutual information in coding and noncoding DNA Ivo Grosse,1 Hanspeter

Stanley, H. Eugene


Flow pattern and hydraulic performance of the REDAC Gross Pollutant Trap  

Science Journals Connector (OSTI)

This paper discusses the flow pattern and hydraulic performance of a Gross Pollutant Trap (GPT), designed and patented by River Engineering and Drainage Research Centre (REDAC) at Universiti Sains Malaysia. Stormwater problems have become more severe due to the increase in urbanization. The increase in the amount of impervious surface in urban areas produces more stormwater runoff, that is carried to the receiving bodies of water. The higher runoff volume also carries more pollutants (gross pollutants, sediments, and nutrients) from the contributing catchment area. Coarse sediments transported by stormwater runoff have negative effects on the receiving body of water and the aquatic environment by covering up aquatic habitats and clogging waterways. One of the challenges in designing a GPT for urban stormwater drainage is providing effective trapping without hindering the hydraulic function of the channel, thus, avoiding overspill or flooding. The current study presents a GPT design to meet these specific requirements of trapping efficiency and hydraulic function. The current GPT overcame the common problem of overspilling of gross pollutants in GPT by the introduction of additional overspill compartments that can handle excessive runoff and improve pollutant trapping in higher flow conditions. In laboratory testing, the prototype GPT was capable of achieving good trapping efficiency (over 80% for gross pollutants and over 60% for coarse sediments) without causing any overspill.

Aminuddin Ab Ghani; H.Md. Azamathulla; Tze Liang Lau; C.H. Ravikanth; Nor Azazi Zakaria; Cheng Siang Leow; Mohd Azlan Mohd Yusof



Water treatment facilities (excluding wastewater facilities). (Latest citations from the Selected Water Resources Abstracts database). Published Search  

SciTech Connect

The bibliography contains citations concerning the design, construction, costs, and operation of water treatment facilities. Facilities covered include those that provide drinking water, domestic water, and water for industrial use. Types of water treatment covered include reverse osmosis, chlorination, filtration, and ozonization. Waste water treatment facilities are excluded from this bibliography. (Contains 250 citations and includes a subject term index and title list.)

Not Available



Dipole oscillations in Bose-Fermi mixtures in the time-dependent Gross-Pitaevskii and Vlasov equations  

E-Print Network (OSTI)

Dipole oscillations in Bose-Fermi mixtures in the time-dependent Gross-Pitaevskii and Vlasov equations Tomoyuki Maruyama1,2,3 and George F. Bertsch1 1 Institute for Nuclear Theory, University with the time-dependent Gross-Pitaevskii equation and the Vlasov equation. While the Bose gas oscillates

Bertsch George F.


Solitons in a hard-core bosonic system: Gross-Pitaevskii type and beyond Radha Balakrishnan1  

E-Print Network (OSTI)

Solitons in a hard-core bosonic system: Gross-Pitaevskii type and beyond Radha Balakrishnan1, Astronomy and Computational Sciences, George Mason University, Fairfax, VA 22030, USA A unified formulation of the hallmarks of quantum coherence inherent in ultracold atomic systems As predicted theoretically in the Gross

Satija, Indu


Supporting Systolic and Memory Communication in iWarp Shekhar Borkar, Robert Cohn, George Cox, Thomas Gross,  

E-Print Network (OSTI)

Supporting Systolic and Memory Communication in iWarp Shekhar Borkar, Robert Cohn, George Cox, Thomas Gross, H. T. Kung, Monica Lam, Margie Levine, Brian Moore, Wire Moore, Craig Peterson, Jim Susman/CMO under Contract MDA972­90­C­0035. Authors' affiliations: R. Cohn, T. Gross, H. T. Kung, and J. Webb

Shewchuk, Jonathan


The {alpha}-induced thick-target {gamma}-ray yield from light elements  

SciTech Connect

The {alpha}-induced thick-target {gamma}-ray yield from light elements has been measured in the energy range 5.6 MeV {le} E{sub {alpha}} {le} 10 MeV. The {gamma}-ray yield for > 2.1 MeV from thick targets of beryllium, boron nitride, sodium fluoride, magnesium, aluminum and silicon were measured using the {alpha}-particle beam from the Lawrence Berkeley Laboratories 88 in. cyclotron. The elemental yields from this experiment were used to construct the {alpha}-induced direct production {gamma}-ray spectrum from materials in the SNO detector, a large volume ultra-low background neutrino detector located in the Creighton mine near Sudbury, Canada. This background source was an order of magnitude lower than predicted by previous calculations. These measurements are in good agreement with theoretical calculations of this spectrum based on a statistical nuclear model of the reaction, with the gross high energy spectrum structure being reproduced to within a factor of two. Detailed comparison of experimental and theoretical excitation population distribution of several residual nuclei indicate the same level of agreement within experimental uncertainties.

Heaton, R.K. [Queen`s Univ., Kingston, ON (Canada). Dept. of Physics; [Lawrence Berkeley Lab., CA (United States)



Surface Radiography with Alpha Rays  

Science Journals Connector (OSTI)

... , and C are deposited on the surfaces of objects which come in contact with radon. Three of them, namely, radium A, C and C, emit alpha rays ... two hours in a vessel (volume 70 c.c.) containing 1 me. of radon. Afterwards the wing was put for 8 min. on the emulsion of a photographic ...




,"Kentucky Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly","9/2013" Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ngm_epg0_fgs_sky_mmcfm.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/ngm_epg0_fgs_sky_mmcfm.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:59:25 AM" "Back to Contents","Data 1: Kentucky Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)" "Sourcekey","NGM_EPG0_FGS_SKY_MMCF" "Date","Kentucky Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"


,"South Dakota Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly","9/2013" Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ngm_epg0_fgs_ssd_mmcfm.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/ngm_epg0_fgs_ssd_mmcfm.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:59:32 AM" "Back to Contents","Data 1: South Dakota Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)" "Sourcekey","NGM_EPG0_FGS_SSD_MMCF" "Date","South Dakota Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"


,"South Dakota Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly","9/2013" Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n9010sd2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n9010sd2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:55:15 AM" "Back to Contents","Data 1: South Dakota Natural Gas Gross Withdrawals (MMcf)" "Sourcekey","N9010SD2" "Date","South Dakota Natural Gas Gross Withdrawals (MMcf)" 33253,525 33284,421 33312,458 33343,445 33373,421 33404,427 33434,474


,"South Dakota Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Annual",2012 Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ngm_epg0_fgs_ssd_mmcfa.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/ngm_epg0_fgs_ssd_mmcfa.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:59:32 AM" "Back to Contents","Data 1: South Dakota Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)" "Sourcekey","NGM_EPG0_FGS_SSD_MMCF" "Date","South Dakota Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"


,"South Dakota Natural Gas Gross Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Annual",2012 Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n9010sd2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n9010sd2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:55:15 AM" "Back to Contents","Data 1: South Dakota Natural Gas Gross Withdrawals (MMcf)" "Sourcekey","N9010SD2" "Date","South Dakota Natural Gas Gross Withdrawals (MMcf)" 24653,0 25019,0 25384,0 25749,0 26114,9 26480,8 26845,10 27210,48 27575,39 27941,52


Anomalous discrete chiral symmetry in the Gross-Neveu model and loop gas simulations  

E-Print Network (OSTI)

We investigate the discrete chiral transformation of a Majorana fermion on a torus. Depending on the boundary conditions the integration measure can change sign. Taking this anomalous behavior into account we define a chiral order parameter as a ratio of partition functions with differing boundary conditions. Then the lattice realization of the Gross-Neveu model with Wilson fermions is simulated using the recent `worm' technique on the loop gas or all-order hopping representation of the fermions. An algorithm is formulated that includes the Gross-Neveu interaction for N fermion species. The critical line m_c(g) is constructed for a range of couplings at N = 6 and for N = 2, the Thirring model, as examples.

Oliver Br; Willi Rath; Ulli Wolff


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Kentucky Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Annual",2012 Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ngm_epg0_fgs_sky_mmcfa.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/ngm_epg0_fgs_sky_mmcfa.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:59:25 AM" "Back to Contents","Data 1: Kentucky Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)" "Sourcekey","NGM_EPG0_FGS_SKY_MMCF" "Date","Kentucky Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)"


EIA-Annual Energy Outlook Retrospective Review-Revisions to Gross Domestic  

Gasoline and Diesel Fuel Update (EIA)

Revisions to Gross Domestic Product and Implications for the Comparisons The concept of GDP is a commonly used measure of economic activity. It can be expressed in nominal dollars or, with the use of a matched price index to remove inflation, in "real" terms. Movements in nominal GDP show how the value of goods and services produced by the United States changes over time, while real GDP is a measure of how the physical production of the economy has grown. While simple in concept, the projecting of nominal and real GDP and the interpretation of these projected measures relative to "history" is not simple or straightforward. The Bureau of Economic Analysis (BEA) within the U.S. Department of Commerce continually adjusts the National Income and Product Accounts data, with comprehensive revisions completed every 4 or 5 years. The last four major revisions (1985, 1991, 1995, and 1999) incorporated definitional and statistical changes, as well as emphasizing new ways of presenting the data. Also, prior to AEO1993 aggregate economic activity was measured and projected on the basis of Gross National Product (GNP) as opposed to Gross Domestic Product (GDP). For the period from 1984 through 2004, nominal GNP is on average approximately 0.45 percent above nominal GDP.


US--Federal Offshore Natural Gas Gross Withdrawals (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

Gross Withdrawals (Million Cubic Feet) Gross Withdrawals (Million Cubic Feet) US--Federal Offshore Natural Gas Gross Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1970's 3,932,196 4,355,742 4,822,114 1980's 4,902,354 4,990,667 4,772,873 4,182,233 4,706,782 4,185,519 4,185,515 4,671,801 4,746,664 4,771,411 1990's 5,046,660 4,849,657 4,771,744 4,765,865 4,996,197 4,942,089 5,246,422 5,315,514 5,185,312 5,130,746 2000's 5,043,769 5,136,962 4,615,443 4,505,443 4,055,340 3,204,906 2,954,538 2,858,713 2,374,857 2,485,331 2010's 2,300,344 1,867,492 1,555,138 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data.



NLE Websites -- All DOE Office Websites (Extended Search)

is on the order of the torus major radius. Let us now consider, following Similon and Sudan, 17 an Alfve n wave packet, with a characteristic perpendicular wave number k 0...


Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-Print Network (OSTI)

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Dllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schdel; A. Yakushev; S. berg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thrle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Trler; A. Ward; D. E. Ward; N. Wiehl



Targeted alpha therapy for cancer  

Science Journals Connector (OSTI)

Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 11.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 Ci in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

Barry J Allen; Chand Raja; Syed Rizvi; Yong Li; Wendy Tsui; David Zhang; Emma Song; Chang Fa Qu; John Kearsley; Peter Graham; John Thompson



Modulational instability of a modified Gross-Pitaevskii equation with higher-order nonlinearity  

Science Journals Connector (OSTI)

We consider the modulational instability (MI) of Bose-Einstein condensate (BEC) described by a modified Gross-Pitaevskii (GP) equation with higher-order nonlinearity both analytically and numerically. A new explicit time-dependent criterion for exciting the MI is obtained. It is shown that the higher-order term can either suppress or enhance the MI, which is interesting for control of the system, instability. Importantly, we predict that with the help of the higher-order nonlinearity, the MI can also take place in a BEC with repulsively contact interactions. The analytical results are confirmed by direct numerical simulations.

Xiu-Ying Qi and Ju-Kui Xue



Properties of the massive Gross-Neveu model with nonzero baryon and isospin chemical potentials  

Science Journals Connector (OSTI)

The properties of the two-flavored Gross-Neveu model with nonzero current quark mass are investigated in the (1+1)-dimensional space-time at finite isospin ?I as well as quark number ? chemical potentials and zero temperature. The consideration is performed in the limit Nc??, i.e., in the case with an infinite number of colored quarks. In the plane of parameters ?I, ? a rather rich phase structure is found, which contains phases with and without pion condensation. We have found a great variety of one-quark excitations of these phases, including gapless and gapped quasiparticles. Moreover, the mesonic mass spectrum in each phase is also investigated.

D. Ebert and K. G. Klimenko



Local Varying-Alpha Theories  

E-Print Network (OSTI)

In a recent paper we demonstrated how the simplest model for varying alpha may be interpreted as the effect of a dielectric material, generalized to be consistent with Lorentz invariance. Unlike normal dielectrics, such a medium cannot change the speed of light, and its dynamics obey a Klein-Gordon equation. This work immediately suggests an extension of the standard theory, even if we require compliance with Lorentz invariance. Instead of a wave equation, the dynamics may satisfy a local algebraic relation involving the permittivity and the properties of the electromagnetic field, in analogy with more conventional dielectric (but still preserving Lorentz invariance). We develop the formalism for such theories and investigate some phenomenological implications. The problem of the divergence of the classical self-energy can be solved, or at least softened, in this framework. Some interesting new cosmological solutions for the very early universe are found, including the possibility of a bounce, inflation and expansion with a loitering phase, all of which are induced by early variations in alpha.

John D. Barrow; Joao Magueijo



Beta/alpha continuous air monitor  

DOE Patents (OSTI)

A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

Becker, G.K.; Martz, D.E.




Energy Science and Technology Software Center (OSTI)

002913MLTPL00 Sandia Higher Order Elements (SHOE) v 0.5 alpha http://midas3.kitware.com/midas/folder/10328



SciTech Connect

Due to its proximity, the mass of the supermassive black hole in the nucleus of the Andromeda galaxy (M31), the most massive black hole in the Local Group of galaxies, has been measured by several methods involving the kinematics of a stellar disk which surrounds it. We report here the discovery of an eccentric H{alpha} emitting disk around the black hole at the center of M31 and show how modeling this disk can provide an independent determination of the mass of the black hole. Our model implies a mass of 5.0{sup +0.8}{sub -1.0} Multiplication-Sign 10{sup 7} M{sub Sun} for the central black hole, consistent with the average of determinations by methods involving stellar dynamics, and compatible (at 1{sigma} level) with measurements obtained from the most detailed models of the stellar disk around the central black hole. This value is also consistent with the M-{sigma} relation. In order to make a comparison, we applied our simulation on the stellar kinematics in the nucleus of M31 and concluded that the parameters obtained for the stellar disk are not formally compatible with the parameters obtained for the H{alpha} emitting disk. This result suggests that the stellar and the H{alpha} emitting disks are intrinsically different from each other. A plausible explanation is that the H{alpha} emission is associated with a gaseous disk. This hypothesis is supported by the detection of traces of weaker nebular lines in the nuclear region of M31. However, we cannot exclude the possibility that the H{alpha} emission is, at least partially, generated by stars.

Menezes, R. B.; Steiner, J. E.; Ricci, T. V., E-mail: robertobm@astro.iag.usp.br [Instituto de Astronomia Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, Rua do Matao 1226, Cidade Universitaria, Sao Paulo, SP CEP 05508-090 (Brazil)



Alpha Technologies | Open Energy Information  

Open Energy Info (EERE)

Technologies Technologies Jump to: navigation, search Name Alpha Technologies Place Bellingham, Washington State Zip 98226 Sector Services, Solar Product Bellingham (WA)-based firm offering, among other products, power conversion products designed specifically for the PV market, plus installation services for solar systems. Coordinates 48.75235°, -122.471219° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.75235,"lon":-122.471219,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Derr Track Storage Bldg Sigma Alpha  

E-Print Network (OSTI)

!( Derr Track Storage Bldg Japan Center Memorial Bell Tower Solar House Primrose Chancellor & Storage Bio. Sci Avent Ferry Complex Building Sigma Phi Epsilon 7 Welch Pi Kappa Alpha 10 Sigma Alpha Mu 4 and Visitor's Center Thompson Admin II Bostian Library Storage Facility Winston Clark Ricks Robertson Harris

Reeves, Douglas S.


Elementary Processes Underlying Alpha Channeling in Tokamaks  

SciTech Connect

Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

NM.J. Fisch



Alpha Renewable Energy | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy Renewable Energy Jump to: navigation, search Name Alpha Renewable Energy Place Atlanta, Georgia Sector Biomass Product Manufacturer of biomass wood gas stoves and standalone power generators for rural areas. References Alpha Renewable Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Alpha Renewable Energy is a company located in Atlanta, Georgia . References ↑ "Alpha Renewable Energy" Retrieved from "http://en.openei.org/w/index.php?title=Alpha_Renewable_Energy&oldid=342033" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


A Brief Review of the Basis for, and the Procedures Currently Utilized in, Gross Gamma-Ray Log Calibration (October 1976)  

Energy.gov (U.S. Department of Energy (DOE))

A Brief Review of the Basis for, and the Procedures Currently Utilized in, Gross Gamma-Ray Log Calibration (October 1976)


EIA Energy Efficiency-Table 3e. Gross Output by Selected Industries, 1998,  

Gasoline and Diesel Fuel Update (EIA)

e e Page Last Modified: May 2010 Table 3e. Gross Output1 by Selected Industries, 1998, 2002, and 2006 (Current Billion Dollars) MECS Survey Years NAICS Subsector and Industry 1998 2002 2006 311 Food Manufacturing 417 444 526 312 Beverage and Tobacco Product Manufacturing 114 128 144 313 Textile Mills 57 45 38 314 Textile Product Mills 31 30 32 315 Apparel Manufacturing 63 40 26 316 Leather and Allied Product Manufacturing 10 6 6 321 Wood Product Manufacturing 91 88 111 322 Paper Manufacturing 153 151 167 323 Printing and Related Support Activities 99 95 99 324 Petroleum and Coal Products Manufacturing 135 212 530 325 Chemical Manufacturing 407 444 639 326 Plastics and Rubber Products Manufacturing 162 169 208 327 Nonmetallic Mineral Product Manufacturing 91 94 126 331 Primary Metal Manufacturing 166 139 230 332 Fabricated Metal Product Manufacturing


Bacterial Alpha Amylase Paper Disc Tests on Starch Agar  

Science Journals Connector (OSTI)

...Articles Bacterial Alpha Amylase Paper Disc Tests on Starch Agar Egon Stark Ralph...Mass. Bacterial Alpha Amylase Paper Disc Tests on Starch Agar EGON STARK...hydrolysis of soluble starch by a bacterial alpha-amylase preparation, so...

Egon Stark; Ralph Wellerson Jr.; Philip A. Tetrault; Carl F. Kossack




E-Print Network (OSTI)

231, Curium-242, and Americium-241 (Thesis), AECU-2757 (rimental Results A. Alpha Decay of Americium-243 L Alpha-Particle Energy of Americium-243 New Alpha Groups of

Hummel, John Philip


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C...


CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of...


CRAD, Management - Oak Ridge National Laboratory TRU ALPHA LLWT...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Management - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to...


Direct constraints on diffusion models from cosmic-ray positron data: Excluding the minimal model for dark matter searches  

Science Journals Connector (OSTI)

Galactic cosmic-ray (CR) transport parameters are usually constrained by the boron-to-carbon ratio. This procedure is generically plagued with degeneracies between the diffusion coefficient and the vertical extent of the Galactic magnetic halo. The latter is of paramount importance for indirect dark matter (DM) searches because it fixes the amount of DM annihilation or decay that contributes to the local antimatter CR flux. These degeneracies could be broken by using secondary radioactive species, but the current data still have large error bars, and this method is extremely sensitive to the very local interstellar medium properties. Here, we propose to use the low-energy CR positrons in the GeV range as another direct constraint on diffusion models. We show that the PAMELA data disfavor small diffusion halo (L?3??kpc) and large diffusion slope models and exclude the minimal configuration [Maurin etal. Astrophys. J. 555, 585 (2001); Donato etal. Phys. Rev. D 69, 063501 (2004)] widely used in the literature to bracket the uncertainties in the DM signal predictions. This is complementary to indirect constraints (diffuse radio and gamma-ray emissions) and has a strong impact on DM searches. Indeed, this makes the antiproton constraints more robust while enhancing the discovery/exclusion potential of current and future experiments, like AMS-02 and GAPS, especially in the antiproton and antideuteron channels.

Julien Lavalle; David Maurin; Antje Putze



Dynamics of pulled desorption with effects of excluded volume interaction: The p-Laplacian diffusion equation and its exact solution  

E-Print Network (OSTI)

We analyze the dynamics of desorption of a polymer molecule which is pulled at one of its ends with force $f$, trying to desorb it. We assume a monomer to desorb when the pulling force on it exceeds a critical value $f_{c}$. We formulate an equation for the average position of the $n^{th}$ monomer, which takes into account excluded volume interaction through the blob-picture of a polymer under external constraints. The approach leads to a diffusion equation with a $p$-Laplacian for the propagation of the stretching along the chain. This has to be solved subject to a moving boundary condition. Interestingly, within this approach, the problem can be solved exactly in the trumpet, stem-flower and stem regimes. In the trumpet regime, we get $\\tau=\\tau_{0}n_d^{2}$ where $n_d$ is the number of monomers that have desorbed at the time $\\tau$. $\\tau_{0}$ is known only numerically, but for $f$ close to $f_{c}$, it is found to be $\\tau_{0}\\sim f_c/(f^{2/3}-f_{c}^{2/3})$. If one used simple Rouse dynamics, this result changes to {\

K. L. Sebastian; V. G. Rostiashvili; T. A. Vilgis



Direct constraints on diffusion models from cosmic-ray positron data: Excluding the Minimal model for dark matter searches  

E-Print Network (OSTI)

Galactic Cosmic-ray (CR) transport parameters are usually constrained by the boron-to-carbon ratio. This procedure is generically plagued with degeneracies between the diffusion coefficient and the vertical extent of the Galactic magnetic halo. The latter is of paramount importance for indirect dark matter (DM) searches, because it fixes the amount of DM annihilation or decay that contributes to the local antimatter CR flux. These degeneracies could be broken by using secondary radioactive species, but the current data still have large error bars, and this method is extremely sensitive to the very local interstellar medium (ISM) properties. Here, we propose to use the low-energy CR positrons in the GeV range as another direct constraint on diffusion models. We show that the PAMELA data disfavor small diffusion halo ($L\\lesssim 3$ kpc) and large diffusion slope models, and exclude the minimal ({\\em min}) configuration (Maurin et al. 2001, Donato et al. 2004) widely used in the literature to bracket the uncertainties in the DM signal predictions. This is complementary to indirect constraints (diffuse radio and gamma-ray emissions) and has strong impact on DM searches. Indeed this makes the antiproton constraints more robust while enhancing the discovery/exclusion potential of current and future experiments, like AMS-02 and GAPS, especially in the antiproton and antideuteron channels.

Julien Lavalle; David Maurin; Antje Putze



Electronic Structure: Density Functional Theory S. Kurth, M.A.L. Marques, and E. K. U. Gross  

E-Print Network (OSTI)

Electronic Structure: Density Functional Theory S. Kurth, M.A.L. Marques, and E. K. U. Gross: July 5, 2003) PACS numbers: 71.15.Mb, 31.15.Ew 1 #12; I. INTRODUCTION Density functional theory (DFT systems becomes prohibitive. A di#erent approach is taken in density functional theory where, instead

Gross, E.K.U.


A Multiscale Approach to Mesh-based Surface Tension Flows Nils Thurey Chris Wojtan Markus Gross Greg Turk  

E-Print Network (OSTI)

A Multiscale Approach to Mesh-based Surface Tension Flows Nils Th¨urey Chris Wojtan Markus Gross 1: Our method allows us to efficiently simulate complex surface tension phenomena such as this crown surface tension forces that is free from typical strict time step constraints. The second simulation layer

Frey, Pascal


GROSS, W L., E. W ROELOFS, AND P. O. FROMM. 1965. Influence of photoperiod on growth ofgreen sunfish,  

E-Print Network (OSTI)

GROSS, W L., E. W ROELOFS, AND P. O. FROMM. 1965. Influence of photoperiod on growth ofgreen. (VNIRO), Tr. Vses. Nauchno-Issled. 50:109-141. (Fish. Res. Board Can., Trans\\. Ser. 549,39 p.l GEORGE W


Net pay evaluation: a comparison of methods to estimate net pay and net-to-gross ratio using surrogate variables  

E-Print Network (OSTI)

Net pay (NP) and net-to-gross ratio (NGR) are often crucial quantities to characterize a reservoir and assess the amount of hydrocarbons in place. Numerous methods in the industry have been developed to evaluate NP and NGR, depending on the intended...

Bouffin, Nicolas



Summary Gross canopy photosynthesis (Pg) can be simu-lated with canopy models or retrieved from turbulent carbon  

E-Print Network (OSTI)

Summary Gross canopy photosynthesis (Pg) can be simu- lated with canopy models or retrieved from applications and model development. Keywords: canopy photosynthesis model, carbon dioxide flux- es, eddy in de- termining the balance between photosynthesis and respiration can lead to unexpected behavior


Nuclear diagnostic for fast alpha particles  

DOE Patents (OSTI)

This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.



Gross crack initiation and propagation in brittle thin solid and annular disks subjected to impact loading  

SciTech Connect

This paper derives from a study of grinding wheel break-up behavior due to impact. The impact fracture characteristics of circular disks of plaster of Paris with a concentric central hole were studied experimentally for three types of loading: (a) when the disks were suspended freely and loaded intensely at one point on their circumference by an explosive detonator; (b) when the disks were allowed to fall under gravity from a certain height on to a rigid base; and (c) when a disk, resting on a rigid base, was struck by a flat ended rigid body which was dropped on to it from a certain height. Quasi-static flattening tests on the disks were also carried out. The paper describes a theoretical investigation into the stress analysis of disks under impact, classifies the relevant damage sustained by them and attempts to unify the ''gross'' impact fracture patterns which arise in different modes of dynamic loading. The extent of local flattening of the quasi-statically loaded disks before fracture, is also reported. Good correlation between the theory and experimental results is obtained, especially for rings of diameter ratio (D /SUB i/ /D/sub 0/) of around 0.5.

Johnson, W.; Bai, Y.L.; Ghosh, S.K.



Correlation of gross tumor volume excursion with potential benefits of respiratory gating  

SciTech Connect

Purpose: To test the hypothesis that the magnitude of thoracic tumor motion can be used to determine the desirability of respiratory gating. Methods and materials: Twenty patients to be treated for lung tumors had computed tomography image data sets acquired under assisted breath hold at normal inspiration (100% tidal volume), at full expiration (0% tidal volume), and under free breathing. A radiation oncologist outlined gross tumor volumes (GTVs) on the breath-hold computed tomographic images. These data sets were registered to the free-breathing image data set. Two sets of treatment plans were generated: one based on an internal target volume explicitly formed from assessment of the excursion of the clinical target volume (CTV) through the respiratory cycle, representing an ungated treatment, and the other based on the 0% tidal volume CTV, representing a gated treatment with little margin for residual motion. Dose-volume statistics were correlated to the magnitude of the motion of the center of the GTV during respiration. Results: Patients whose GTVs were >100 cm{sup 3} showed little decrease in lung dose under gating. The other patients showed a correlation between the excursion of the center of the GTV and a reduction in potential lung toxicity. As residual motion increased, the benefits of respiratory gating increased. Conclusion: Gating seems to be advantageous for patients whose GTVs are <100 cm{sup 3} and for whom the center of the GTV exhibits significant motion, provided residual motion under gating is kept small.

Starkschall, George [Department of Radiation Physics, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States)]. E-mail: gstarksc@mdanderson.org; Forster, Kenneth M. [Department of Radiation Physics, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States); Kitamura, Kei [Department of Radiation Physics, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States); Department of Radiology, Hokkaido University, Graduate School of Medicine, Sapporo (Japan); Cardenas, Alex [Department of Radiation Physics, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States); Tucker, Susan L. [Department of Biomathematics, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States); Stevens, Craig W. [Department of Radiation Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States)



Alpha Channeling in Rotating Plasma with Stationary Waves  

SciTech Connect

An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high n? can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

A. Fetterman and N.J. Fisch



(Data in thousand metric tons of silicon content unless otherwise noted) Domestic Production and Use: Estimated value of silicon alloys and metal (excluding semiconductor-and solar-  

E-Print Network (OSTI)

Production and Use: Estimated value of silicon alloys and metal (excluding semiconductor- and solar- grade and aluminum alloys and the chemical industry. The semiconductor and solar industries, which manufacture chips%; Venezuela, 15%; Canada, 8%; and other, 8%. Silicon metal: Brazil, 38%; South Africa, 24%; Canada, 16


AlphaWatt Ltd | Open Energy Information  

Open Energy Info (EERE)

AlphaWatt Ltd AlphaWatt Ltd Jump to: navigation, search Name AlphaWatt Ltd Place London, United Kingdom Zip EC1V 4PY Sector Solar Product Solar project developer, plans to become an independent power provider. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Exotic decay model and alpha decay studies  

SciTech Connect

In exotic decay studies, the lifetime of alpha emission occurs crucially in the branching ratio calculation. In this work, we extend our previous exotic decay model to calculate the same. But, in this case unlike in the exotic decay, the redistribution of charge for given masses of the fragments has to be taken into account since the charge-to-mass ratio of the alpha fragment differs from that of the parent nucleus. We have therefore modified the Yukawa-plus-exponential potential in the post-scission region in our model suitably so as to allow the required charge redistribution among the fragments in the region between sharp contact and the point up to which the finite-range effects persist. The success of this model for alpha decay is as good as for the exotic decay studies.

Shanmugam, G.; Kamalaharan, B. (Department of Physics, Presidency College, Madras 600005, India (IN))



Energy production in varying {\\alpha} theories  

E-Print Network (OSTI)

Aims. On the basis the theoretical model proposed by Bekenstein for {\\alpha}'s variation, we analyze the equations that describe the energy exchange between matter and both the electromagnetic and the scalar fields. Methods. We determine how the energy flow of the material is modified by the presence of a scalar field. We estimate the total magnetic energy of matter from the "sum rules techniques". We compare the results with data obtained from the thermal evolution of the Earth and other planets. Results. We obtain stringent upper limits to the variations in {\\alpha} that are comparable with those obtained from atomic clock frequency variations. Conclusions. Our constraints imply that the fundamental length scale of Bekenstein's theory "lB" cannot be larger than Planck's length "lP".

Kraiselburd, Lucila; Sisterna, Pablo; Vucetich, Hctor; 10.1051/0004-6361/201015970



On the well-posedness and scattering for the Gross-Pitaevskii hierarchy via quantum de Finetti  

E-Print Network (OSTI)

We prove the existence of scattering states for the defocusing cubic Gross-Pitaevskii (GP) hierarchy in ${\\mathbb R}^3$. Moreover, we show that an energy growth condition commonly used in the well-posedness theory of the GP hierarchy is, in a specific sense, necessary. In fact, we prove that without the latter, there exist initial data for the focusing cubic GP hierarchy for which instantaneous blowup occurs.

Thomas Chen; Christian Hainzl; Natasa Pavlovic; Robert Seiringer


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Other States Natural Gas Gross Withdrawals from Shale Gas (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Shale Gas (Million Cubic Feet) Shale Gas (Million Cubic Feet) Other States Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 48,369 43,688 48,369 46,808 48,369 46,808 48,369 48,369 46,808 48,369 46,808 48,369 2008 67,432 63,082 67,432 65,257 67,432 65,257 67,432 67,432 65,257 67,432 65,257 67,432 2009 97,401 87,975 97,401 94,259 97,401 94,259 97,401 97,401 94,259 97,401 94,259 97,401 2010 120,583 110,275 123,021 136,059 141,911 138,726 158,338 161,005 157,181 182,320 175,525 183,023 2011 199,632 182,762 204,041 213,258 221,592 221,224 238,708 246,625 241,304 278,250 269,872 281,981 2012 294,346 270,695 293,738 302,393 313,343 303,156 332,473 336,825 327,725 366,985 354,759 366,520


Other States Natural Gas Gross Withdrawals from Oil Wells (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Oil Wells (Million Cubic Feet) Oil Wells (Million Cubic Feet) Other States Natural Gas Gross Withdrawals from Oil Wells (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 3,459 3,117 3,336 1,781 1,806 1,881 1,841 1,820 1,781 1,699 1,247 1,228 1992 4,284 3,872 4,141 4,027 4,047 3,883 3,964 3,957 3,892 4,169 4,146 4,334 1993 4,123 3,693 4,049 3,865 3,942 3,786 3,915 3,924 3,861 4,146 4,114 4,200 1994 3,639 3,242 3,557 3,409 3,488 3,384 3,552 3,643 3,597 3,796 3,818 3,991 1995 3,937 3,524 3,842 3,679 3,731 3,591 3,683 3,710 3,597 3,747 3,778 3,937 1996 3,960 4,174 4,704 4,202 3,860 4,239 4,285 4,447 4,978 4,585 4,564 4,512 1997 4,656 4,105 4,501 4,102 4,135 4,047 4,273 4,190 3,962 4,213 3,959 3,830


Other States Natural Gas Gross Withdrawals from Gas Wells (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Gas Wells (Million Cubic Feet) Gas Wells (Million Cubic Feet) Other States Natural Gas Gross Withdrawals from Gas Wells (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 72,328 63,451 67,732 63,118 62,276 59,557 61,217 60,722 59,142 65,119 67,627 70,643 1992 66,374 62,007 65,284 63,487 63,488 60,701 62,949 63,036 61,442 66,259 65,974 68,514 1993 66,943 61,161 64,007 60,709 61,964 63,278 60,746 62,204 59,969 64,103 63,410 70,929 1994 65,551 60,458 63,396 60,438 60,965 61,963 60,675 62,160 59,730 63,444 62,373 68,990 1995 64,205 59,095 62,006 58,918 60,063 60,885 58,713 59,803 57,421 61,243 60,372 67,498 1996 64,824 61,742 66,951 60,806 62,653 59,952 61,102 62,970 61,239 65,475 67,324 68,206


Radiological hazards of alpha-contaminated waste  

SciTech Connect

The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

Rodgers, J.C.



Production of alpha-amylase by yeast  

SciTech Connect

The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

Thomse, K.K.



The SimCore/Alpha Functional Simulator  

Science Journals Connector (OSTI)

We have developed a function-level processor simulator, SimCore/Alpha Functional Simulator Version 2.0 (SimCore Version 2.0), for processor architecture research and processor education. This paper describes the design and implementation of SimCore Version ...

Kenji Kise; Takahiro Katagiri; Hiroki Honda; Toshitsugu Yuba



H-alpha observations of zeta Tauri  

E-Print Network (OSTI)

We report H-alpha observations of zeta Tauri, taken between late 2000 and early 2006. Next to extending existing long-term montioring of the disk state of this star we report an intermediate timescale of about 69 days to be present in the V/R variations of the Halpha line. The observational data will be published together with this manuscript.

E. Pollmann; Th. Rivinius



E-Print Network 3.0 - alpha hnf-3alpha negatively Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Manchester Collection: Biology and Medicine 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Delta Pi III 2 Ankurage I II 3 Don't Haze Me Bro 2 II I 4 Gram...


E-Print Network 3.0 - alpha cap alpha Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Pi Greek Woman of the Year Ann... Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... of the Year Carl Braunlich Philanthropy...


E-Print Network 3.0 - alpha-1-antitrypsin augmentation therapy...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha-1-Antitrypsin Alpha-Hydroxybutyrate Dehydrogenase (aHBDH) ALTSGPT Amylase Amylase (Alpha) Amylase Source: Rodriguez, Carlos - Department of Mathematics and Statistics, State...


E-Print Network 3.0 - alpha-1 antitrypsin deficiency Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha-1-Antitrypsin Alpha-Hydroxybutyrate Dehydrogenase (aHBDH) ALTSGPT Amylase Amylase (Alpha) Amylase Source: Rodriguez, Carlos - Department of Mathematics and Statistics, State...


E-Print Network 3.0 - alpha chi sigma Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha: 2515 Leon Street KS...Kappa Sigma: 1002 West 26th Street LCA...Lambda Chi Alpha... ACW...Alpha Chi Omega: 2420 Nueces Street ADP...


E-Print Network 3.0 - alpha-radiation construction calibration...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha Radiation - An alpha particle is identical... of only an inch or so. Naturally occurring radioactive elements such as radon emit alpha radiation... to Construct PE Plant...


CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G...


The effects of alpha particle irradiation on stainless steel  

E-Print Network (OSTI)

A Monte Carlo code was developed to calculate the alpha particle emission rate from WGPu. It yielded information pertaining to the alpha particle source strength at the WGPU and stainless steel interface as well as the damage production and He...

Shipp, John Douglas



The Use of a Multichannel Analyzer to Investigate Effects of Experimental Factors on Gross-Counting Gamma and Neutron Detectors  

SciTech Connect

Radiation detection technology is invaluable to many fields of study in identifying nuclear materials. However, many detectors use gross-counting methods that give only a relative count rate. Without a spectrum (information on counts over time vs energy), it can be more difficult to discern if an alarm is false, innocent, or real. In particular, we would like to understand better the effect of experimental factors (i.e., external conditions and equipment parameters) on detector data, with possible implications for false alarms. To more thoroughly characterize detector technology, a multichannel analyzer (MCA) was used to record spectra from neutron (helium-3 tubes) and gamma (photomultiplier tubes) gross-counting detectors. Several factors could affect the signal-to-noise ratio of sources. For example, we examined the effects of neutron detector high voltage setting on the appearance of a californium-252 spectrum, the effect of discriminator values on integrated counts in neutron detection, and the effect of gain changes on the gamma spectra from several sources. Possible implications of ambient temperature of the experiment on the data collected will be discussed. The input impedance of the MCA must be considered to ensure that data are not affected by the measurement itself. Moreover, a calibration on the MCA was performed to verify the conversion of a MCA channel number to a voltage. In summary, the series of source spectra collected on an MCA with a variety of experimental conditions allow us to understand factors that affect data better, and assure us that gross-counting neutron and gamma detectors will have minimal false alarms.

Volz, Heather M. [Los Alamos National Laboratory; Rennie, John A. [Los Alamos National Laboratory; Lovejoy, Christopher M. [Los Alamos National Laboratory; Martinez, Diana E. R [Los Alamos National Laboratory; Dempsey, Michael A. [Los Alamos National Laboratory; Livesay, Jake [ORNL; Lousteau, Angela [ORNL



Electrical Resistance of Alpha Hydrogen?Palladium  

Science Journals Connector (OSTI)

Electrical resistancemeasurements of gas?charged alpha hydrogen?palladium alloys have been made in the range 100 to 400C. The fractional increase of palladiumresistance caused by addition of hydrogen is proportional to hydrogen concentration. The constant of proportionality is independent of temperature indicating that Matthiessen's rule is inapplicable to this system. When the results of this work are combined with those of previous authors all of the data can be adequately represented in the range 75 to 400C by the equation (R/R 0) 1 = (2.410.04) m where R is the resistance of alpha hydrogen?palladium R 0 is the resistance of hydrogen?free palladium and m is the hydrogen?to?palladium atom ratio.

W. T. Lindsay Jr.; F. W. Pement



Alternate Alpha Induced Reactions for NIF Radiochemistry  

SciTech Connect

Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

Shaughnessy, D A; Moody, K J; Bernstein, L A



$\\alpha$ Centauri A in the far infrared  

E-Print Network (OSTI)

Chromospheres and coronae are common phenomena on solar-type stars. Understanding the energy transfer to these heated atmospheric layers requires direct access to the relevant empirical data. Study of these structures has, by and large, been limited to the Sun thus far. The region of the temperature reversal can be directly observed only in the far infrared and submm. We aim at the determination of the characteristics of the atmosphere in the region of the temperature minimum of the solar sister star alpha Cen A. For the nearby binary system alpha Centauri, stellar parameters are known with high accuracy from measurements. For the basic model parameters Teff, log g and [Fe/H], we interpolate in the grid of GAIA/PHOENIX stellar model atmospheres and compute the corresponding model for the G2 V star alpha Cen A. Comparison with photometric measurements shows excellent agreement between observed photospheric data in the optical and infrared. For longer wavelengths, the modelled spectral energy distribution is co...

Liseau, R; Olofsson, G; Bryden, G; Marshall, J P; Ardila, D; Aran, A Bayo; Danchi, W C; del Burgo, C; Eiroa, C; Ertel, S; Fridlund, M C W; Krivov, A V; Pilbratt, G L; Roberge, A; Thbault, P; Wiegert, J; White, G J



Alpha Particle Physics Experiments in the Tokamak Fusion Test Reactor  

SciTech Connect

Alpha particle physics experiments were done on the Tokamak Fusion Test Reactor (TFTR) during its deuterium-tritium (DT) run from 1993-1997. These experiments utilized several new alpha particle diagnostics and hundreds of DT discharges to characterize the alpha particle confinement and wave-particle interactions. In general, the results from the alpha particle diagnostics agreed with the classical single-particle confinement model in magnetohydrodynamic (MHD) quiescent discharges. Also, the observed alpha particle interactions with sawteeth, toroidal Alfvn eigenmodes (TAE), and ion cyclotron resonant frequency (ICRF) waves were roughly consistent with theoretical modeling. This paper reviews what was learned and identifies what remains to be understood.

Budny, R.V.; Darrow, D.S.; Medley, S.S.; Nazikian, R.; Zweben, S.J.; et al.


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Complex-Energy Shell-Model Description of Alpha Decay  

SciTech Connect

In his pioneering work of alpha decay, Gamow assumed that the alpha particle formed inside the nucleus tunnels through the barrier of the alpha-daughter potential. The corresponding metastable state can be viewed as a complex-energy solution of the time-independent Schroedinger equation with the outgoing boundary condition. The formation of the alpha cluster, missing in the original Gamow formulation, can be described within the R-matrix theory in terms of the formation amplitude. In this work, the alpha decay process is described by computing the formation amplitude and barrier penetrability in a large complex-energy configuration space spanned by the complex-energy eigenstates of the finite Woods-Saxon (WS) potential. The proper normalization of the decay channel is essential as it strongly modifies the alpha-decay spectroscopic factor. The test calculations are carried out for the ^{212}Po alpha decay.

Id Betan, R. [Rosario Physics Institute, Rosario, Argentina] [Rosario Physics Institute, Rosario, Argentina; Nazarewicz, Witold [ORNL] [ORNL



Extreme alpha-clustering in the 18O nucleus  

E-Print Network (OSTI)

The structure of the 18O nucleus at excitation energies above the alpha decay threshold was studied using 14C+alpha resonance elastic scattering. A number of states with large alpha reduced widths have been observed, indicating that the alpha-cluster degree of freedom plays an important role in this N not equal Z nucleus. However, the alpha-cluster structure of this nucleus is very different from the relatively simple pattern of strong alpha-cluster quasi-rotational bands in the neighboring 16O and 20Ne nuclei. A 0+ state with an alpha reduced width exceeding the single particle limit was identified at an excitation energy of 9.9+/-0.3 MeV. We discuss evidence that states of this kind are common in light nuclei and give possible explanations of this feature.

E. D. Johnson; G. V. Rogachev; V. Z. Goldberg; S. Brown; D. Robson; A. M. Crisp; P. D. Cottle; C. Fu; J. Giles; B. W. Green; K. W. Kemper; K. Lee; B. T. Roeder; R. E. Tribble



Generation of matter-wave solitons of the Gross-Pitaevskii equation with a time-dependent complicated potential  

Science Journals Connector (OSTI)

We examine the generation of bright matter-wave solitons in the Gross-Pitaevskii equation describing Bose-Einstein condensates with a time-dependent complex potential, which is composed of a repulsive parabolic background potential and a gravitational field. By performing a modified lens-type transformation, an explicit expression for the growth rate of a purely growing modulational instability is presented and analyzed. We point out the effects of the gravitational field, as well as of the parameter related to the feeding or loss of atoms in the condensate, on the instability growth rate. It is evident from numerical simulations that the feeding with atoms and the magnetic trap have opposite effects on the dynamics of the system. It is shown that the feeding or loss parameter can be well used to control the instability domain. Our study shows that the gravitational field changes the condensate trail of the soliton trains during the propagation. We also perform a numerical analysis to solve the Gross-Pitaevskii equation with a time-dependent complicated potential. The numerical results on the effect of both the gravitational field and the parameter of feeding or loss of atoms in the condensate agree well with predictions of the linear stability analysis. Another result of the present work is the modification of the background wave function in the Thomas-Fermi approximation during the numerical simulations.

Alidou Mohamadou; Etienne Wamba; Serge Y. Doka; Thierry B. Ekogo; Timoleon C. Kofane



Energy-dependent scattering and the Gross-Pitaevskii equation in two-dimensional Bose-Einstein condensates  

Science Journals Connector (OSTI)

We consider many-body effects on particle scattering in one-, two-, and three-dimensional (3D) Bose gases. We show that at T=0 these effects can be modeled by the simpler two-body T matrix evaluated off the energy shell. This is important in 1D and 2D because the two-body T matrix vanishes at zero energy and so mean-field effects on particle energies must be taken into account to obtain a self-consistent treatment of low-energy collisions. Using the off-shell two-body T matrix we obtain the energy and density dependence of the effective interaction in 1D and 2D and the appropriate Gross-Pitaevskii equations for these dimensions. Our results provide an alternative derivation of those of Kolomeisky and co-workers. We present numerical solutions of the Gross-Pitaevskii equation for a 2D condensate of hard-sphere bosons in a trap. We find that the interaction strength is much greater in 2D than for a 3D gas with the same hard-sphere radius. The Thomas-Fermi regime is, therefore, approached at lower condensate populations and the energy required to create vortices is lowered compared to the 3D case.

M. D. Lee; S. A. Morgan; M. J. Davis; K. Burnett



Alpha decay from fission isomeric states  

Science Journals Connector (OSTI)

Alpha-decay half-lives from shape isomeric states of some even-even isotopes of U, Pu and Cm nuclei are calculated by using fission theory in the parametrisation of a spheroid intersected with a sphere. The potential barrier was calculated in the framework of the liquid-drop model of Myers and Swiatecki (1967) extended for systems with different charge densities; a phenomenological shell correction was introduced. The WKB computed lifetimes are many orders of magnitude longer than that of the spontaneous fission process, in agreement with experimental results.

D N Poenaru; M Ivascu



A Precise Determination of $\\alpha_s$ from the C-parameter Distribution  

E-Print Network (OSTI)

We present a global fit for $\\alpha_s(m_Z)$, analyzing the available C-parameter data measured at center-of-mass energies between $Q=35$ and $207$ GeV. The experimental data is compared to a N$^3$LL$^\\prime$ + $\\mathcal{O}(\\alpha_s^3)$ + $\\Omega_1$ theoretical prediction (up to the missing 4-loop cusp anomalous dimension), which includes power corrections coming from a field theoretical nonperturbative soft function. The dominant hadronic parameter is its first moment $\\Omega_1$, which is defined in a scheme which eliminates the $\\mathcal{O}(\\Lambda_{\\rm QCD})$ renormalon ambiguity. The resummation region plays a dominant role in the C-parameter spectrum, and in this region a fit for $\\alpha_s(m_Z)$ and $\\Omega_1$ is sufficient. We find $\\alpha_s(m_Z)=0.1123\\pm 0.0015$ and $\\Omega_1=0.421\\pm 0.063\\,{\\rm GeV}$ with $\\chi^2/\\rm{dof}=0.988$ for $404$ bins of data. These results agree with the prediction of universality for $\\Omega_1$ between thrust and C-parameter within 1-$\\sigma$.

Hoang, Andr H; Mateu, Vicent; Stewart, Iain W



CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TRU ALPHA LLWT TRU ALPHA LLWT Project CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Training Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project


Universal formula for the energy--momentum tensor via a flow equation in the Gross--Neveu model  

E-Print Network (OSTI)

For the fermion field in the two-dimensional Gross--Neveu model, we introduce a flow equation that allows a simple $1/N$ expansion. By employing the $1/N$ expansion, we examine the validity of a universal formula for the energy--momentum tensor which is based on the small flow-time expansion. We confirm that the formula reproduces a correct normalization and the conservation law of the energy--momentum tensor by computing the translation Ward--Takahashi relation in the leading non-trivial order in the $1/N$ expansion. Also we confirm that the expectation value at finite temperature correctly reproduces thermodynamic quantities. These observations support the validity of a similar construction of the energy--momentum tensor via the gradient/Wilson flow in lattice gauge theory.

Suzuki, Hiroshi



Fit to the Bjorken, Ellis-Jaffe and Gross-Llewellyn-Smith sum rules in a renormalon based approach  

SciTech Connect

We study the large order behavior in perturbation theory of the Bjorken, Ellis-Jaffe and Gross-Llewellyn-Smith sum rules. In particular, we consider their first infrared renormalons, for which we obtain their analytic structure with logarithmic accuracy and also an approximate determination of their normalization constant. Estimates of higher order terms of the perturbative series are given. The renormalon subtracted scheme is worked out for these observables and compared with experimental data. Overall, good agreement with experiment is found. This allows us to obtain a-circumflex{sub 0} and some higher-twist nonperturbative constants from experiment: a-circumflex 0.141{+-}0.089; f{sub 3,RS}(1 GeV)=-0.124{sub -0.142}{sup +0.137} GeV{sup 2}.

Campanario, Francisco [Department of Physics, University of Toronto, St. George Street, Toronto, M5S 1A7 (Canada); Pineda, Antonio [Dept. d'Estructura i Constituents de la Materia, U. Barcelona, Diagonal 647, E-08028 Barcelona, Catalonia (Spain)



Catalyzing Alpha-Channeling by Minority Ion Injection in Mirror...  

NLE Websites -- All DOE Office Websites (Extended Search)

Maintaining fuel ions hotter than electrons would greatly facilitate controlled nuclear fusion. Alpha channeling is a technique that can potentially extract energy from fusion...


Alpha-particle optical potential proofs at astrophysically relevant energies  

E-Print Network (OSTI)

$(\\alpha,\\gamma)$ and $(\\alpha$,n) reaction cross sections recently measured close to the reaction thresholds are rather well described by a previously developed regional optical potential. Thus, particular features of the $\\alpha$-particle optical potential at energies below the Coulomb barrier, besides parameters describing $\\alpha$-particle elastic scattering at higher energies are confirmed. Additional limitations of similar statistical model calculations for minor reaction channels are shown to be most likely due to an overlooked process or critical values of statistical model parameters around closed nuclear shells.

M. Avrigeanu; V. Avrigeanu



Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005  

Energy.gov (U.S. Department of Energy (DOE))

This document contains the Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005


E-Print Network 3.0 - ammonium cap alpha Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Charles - Department of Physics, Harvard University Collection: Materials Science 96 George Gross, Millburn NJ March 2009Chem 13 News 19 Summary: to fill the flask with...


Optical Counterparts to Damped Lyman Alpha Systems  

E-Print Network (OSTI)

Previously we have shown (Maller et al, 1998) that the kinematics of Damped Lyman Alpha Systems (DLAS) as measured by Prochaska and Wolfe (1998) can be reproduced in a multiple disk model (MDM) if the gaseous disks are of sufficient radial extent. Here we discuss this model's predictions for the relationship between DLAS and Lyman break galaxies (LBGs), which we here take to be objects at z~3 brighter than R=25.5. We expect that future observations of the correlations between DLAS and LBGs will provide a new data set able to discriminate between different theoretical models of the DLAS. Djorgovski (1997) has already detected a few optical counterparts and more studies are underway.

Ariyeh H. Maller; Jason X. Prochaska; Rachel S. Somerville; Joel R. Primack




E-Print Network (OSTI)

HYPERSONIC INVESTIGATION OF THE A - T y p E PHASE TRANSITION IN AMMONIUM-CHLORIDE M. GROSS - D method.The hypersonic sound velocities and elastic constants have been measured in the immediate vicinity measurements. The difference between the present hypersonic measurement and previous ultrasonic results

Paris-Sud XI, Université de


Jet Production in ep Collisions at Low Q^2 and Determination of $\\alpha_{s}$  

E-Print Network (OSTI)

The production of jets is studied in deep-inelastic e+p scattering at low negative four momentum transfer squared 5alpha_s.

Aaron, FD; Alexa, C; Andreev, V; Antunovic, B; Backovic, S; Baghdasaryan, A; Barrelet, E; Bartel, W; Begzsuren, K; Belousov, A; Bizot, J C; Boudry, V; Bozovic-Jelisavcic, I; Bracinik, J; Brandt, G; Brinkmann, M; Brisson, V; Bruncko, D; Bunyatyan, A; Buschhorn, G; Bystritskaya, L; Campbell, A J; Cantun Avila, K B; Cerny, K; Cerny, V; Chekelian, V; Cholewa, A; Contreras, J G; Coughlan, J A; Cozzika, G; Cvach, J; Dainton, J B; Daum, K; Deak, M; Delcourt, B; Delvax, J; De Wolf, E A; Diaconu, C; Dodonov, V; Dossanov, A; Dubak, A; Eckerlin, G; Efremenko, V; Egli, S; Eliseev, A; Elsen, E; Falkiewicz, A; Favart, L; Fedotov, A; Felst, R; Feltesse, J; Ferencei, J; Fischer, D J; Fleischer, M; Fomenko, A; Gabathuler, E; Gayler, J; Ghazaryan, Samvel; Glazov, A; Glushkov, I; Goerlich, L; Gogitidze, N; Gouzevitch, M; Grab, C; Greenshaw, T; Grell, B R; Grindhammer, G; Habib, S; Haidt, D; Helebrant, C; Henderson, R C W; Hennekemper, E; Henschel, H; Herbst, M; Herrera, G; Hildebrandt, M; Hiller, K H; Hoffmann, D; Horisberger, R; Hreus, T; Jacquet, M; Janssen, X; Jonsson, L; Jung, A W; Jung, H; Kapichine, M; Katzy, J; Kenyon, I R; Kiesling, C; Klein, M; Kleinwort, C; Kluge, T; Knutsson, A; Kogler, R; Kosior, E; Kostka, P; Kraemer, M; Krastev, K; Kretzschmar, J; Kropivnitskaya, A; Kruger, K; Kutak, K; Landon, M P J; Lange, W; Lastovicka-Medin, G; Laycock, P; Lebedev, A; Lendermann, V; Levonian, S; Li, G; Lipka, K; Liptaj, A; List, B; List, J; Loktionova, N; Lopez-Fernandez, R; Lubimov, V; Makankine, A; Malinovski, E; Marage, P; Marti, Ll; Martyn, H U; Maxfield, S J; Mehta, A; Meyer, A B; Meyer, H; Meyer, H; Meyer, J; Mikocki, S; Milcewicz-Mika, I; Moreau, F; Morozov, A; Morris, J V; Mozer, M U; Mudrinic, M; Muller, K; Murin, P; Naumann, Th; Newman, P R; Niebuhr, C; Nikiforov, A; Nikitin, D; Nowak, G; Nowak, K; Olsson, J E; Osman, S; Ozerov, D; Palichik, V; Panagoulias, I; Pandurovic, M; Papadopoulou, Th; Pascaud, C; Patel, G D; Pejchal, O; Perez, E; Petrukhin, A; Picuric, I; Piec, S; Pitzl, D; Placakyte, R; Pokorny, B; Polifka, R; Povh, B; Radescu, V; Rahmat, A J; Raicevic, N; Raspiareza, A; Ravdandorj, T; Reimer, P; Rizvi, E; Robmann, P; Roland, B; Roosen, R; Rostovtsev, A; Rotaru, M; Tabasco, J E Ruiz; Rusakov, S; Salek, D; Sankey, D P C; Sauter, M; Sauvan, E; Schmitt, S; Schoeffel, L; Schoning, A; Schultz-Coulon, H C; Sefkow, F; Shaw-West, R N; Shtarkov, L N; Shushkevich, S; Sloan, T; Smiljanic, Ivan; Soloviev, Y; Sopicki, P; South, D; Spaskov, V; Specka, A; Staykova, Z; Steder, M; Stella, B; Stoicea, G; Straumann, U; Sunar, D; Sykora, T; Tchoulakov, V; Thompson, G; Thompson, P D; Toll, T; Tomasz, F; Tran, T H; Traynor, D; Trinh, T N; Truol, P; Tsakov, I; Tseepeldorj, B; Turnau, J; Urban, K; Valkarova, A; Vallee, C; Van Mechelen, P; Trevino, A Vargas; Vazdik, Y; Vinokurova, S; Volchinski, V; von den Driesch, M; Wegener, D; Wissing, Ch; Wunsch, E; Zacek, J; Zalesak, J; Zhang, Z; Zhokin, A; Zimmermann, T; Zohrabyan, H; Zomer, F



Escherichia coli produces a cytoplasmic alpha-amylase, AmyA.  

Science Journals Connector (OSTI)

...liquefying alpha-amylases of bacilli...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...

M Raha; I Kawagishi; V Mller; M Kihara; R M Macnab



New Advances in Alpha-Beta Searching Jonathan Schaeffer  

E-Print Network (OSTI)

New Advances in Alpha-Beta Searching Jonathan Schaeffer Dept. of Computing Science Alpha-Beta has been the algorithm of choice for game-tree search for over three decades. Its suc- cess the search efficiency. Although state-of- the-art game-playing programs build trees that are close in size

Dumas, Jean-Guillaume


Elastic alpha scattering experiments and the alpha-nucleus optical potential at low energies  

E-Print Network (OSTI)

High precision angular distribution data of ($\\alpha$,$\\alpha$) elastic scattering are presented for the nuclei $^{89}$Y, $^{92}$Mo, $^{106,110,116}$Cd, $^{112,124}$Sn, and $^{144}$Sm at energies around the Coulomb barrier. Such data with small experimental uncertainties over the full angular range (20-170 degrees) are the indispensable prerequisite for the extraction of local optical potentials and for the determination of the total reaction cross section $\\sigma_{\\rm{reac}}$. A systematic fitting procedure was applied to the presented experimental scattering data to obtain comprehensive local potential parameter sets which are composed of a real folding potential and an imaginary potential of Woods-Saxon surface type. The obtained potential parameters were used in turn to construct a new systematic $\\alpha$-nucleus potential with very few parameters. Although this new potential cannot reproduce the angular distributions with the same small deviations as the local potential, the new potential is able to predict the total reaction cross sections for all cases under study.

P. Mohr; G. G. Kiss; Zs. Flp; D. Galaviz; Gy. Gyrky; E. Somorjai



CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TRU TRU ALPHA LLWT Project CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Radiation Protection Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Quality Assurance - Oak Ridge National Laboratory TRU ALPHA Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Quality Assurance Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications


The alpha-cluster model applied to {sup 96}Ru  

SciTech Connect

The states of {sup 96}Ru are investigated in terms of the a alpha+ core structure. The ground state band of the alpha+{sup 92}Mo system is obtained through a local cluster-core potential which includes a fixed set of parameters employed in other mass regions. The calculated spectrum gives a good general description of the experimental {sup 96}Ru levels. The reduced alpha-widths, B(E2) transition rates and rms intercluster separations are determined for the members of the ground state band. The results show that the model can reproduce the order of magnitude of the experimental B(E2) values without the use of effective charges and indicate that the first members of the ground state band present a stronger alpha-cluster character. Predictions concerning a negative parity band of the alpha+{sup 92}Mo system are also shown.

Souza, M. A.; Miyake, H. [Institute of Physics, Universidade de Sao Paulo, Sao Paulo-SP (Brazil)



A Dynamical System Modelling Approach to Gross' Model of Emotion Regulation Tibor Bosse (tbosse@few.vu.nl) Matthijs Pontier (mpontier@few.vu.nl) Jan Treur (treur@few.vu.nl)  

E-Print Network (OSTI)

a computational model to simulate emotion regulation, based on the process model described informally by Gross to interact intensively with automated systems, it is useful if the system maintains a model of the emotional used is briefly introduced. After that, the simulation model formalising the model of Gross

Treur, Jan


Antihydrogen Trapped in the ALPHA Experiment  

ScienceCinema (OSTI)

In 2010 the ALPHA collaboration succeeded in trapping antihydrogen atoms for the first time.[i] Stored antihydrogen promises to be a unique tool for making high precision measurements of the structure of this first anti-atom. Achieving this milestone presented several substantial experimental challenges and this talk will describe how they were overcome. The unique design features of the ALPHA apparatus will be explained.[ii] These allow a high intensity positron source and an antiproton imaging detector similar to the one used in the ATHENA[iii] experiment to be combined with an innovative magnet design of the anti-atom trap. This seeks to minimise the perturbations to trapped charged particles which may cause particle loss and heating[iv]. The diagnostic techniques used to measure the diameter, number, density, and temperatures of both plasmas will be presented as will the methods developed to actively compress and cool of both plasma species to sizes and temperatures [v],[vi], [vii] where trapping attempts with a reasonable chance of success can be tried. The results of the successful trapping experiments will be outlined as well as some subsequent experiments to improve the trapping rate and storage time. [i] 'Trapped antihydrogen' G.B. Andresen et al., Nature 468, 673 (2010) [ii]'A Magnetic Trap for Antihydrogen Confinement' W. Bertsche et al., Nucl. Instr. Meth. Phys. Res. A566, 746 (2006) [iii] Production and detection of cold antihydrogen atoms M.Amoretti et al., Nature 419, 456 (2002). [iv]' Antihydrogen formation dynamics in a multipolar neutral anti-atom trap' G.B. Andresen et al., Phys. Lett. B 685, 141 (2010) [v]' Evaporative Cooling of Antiprotons to Cryogenic Temperatures', G.B. Andresen et al. Phys. Rev. Lett 105, 013003 (2010) [vi]'Compression of Antiproton Clouds for Antihydrogen Trapping' G. B. Andresen et al. Phys. Rev. Lett 100, 203401 (2008) [vii] 'Autoresonant Excitation of Antiproton Plasmas' G.B. Andresen et al., Phys. Rev. Lett. 106, 025002 (2011) Organizer: Ferdinand Hahn PH/DT Detector Seminar webpage




E-Print Network 3.0 - alpha gamma sur Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Alpha Delta Pi Summary: Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... : Sigma Gamma Rho 3.13 PHC: Alpha Xi...


Thalamocortical Mechanisms for the Anteriorization of Alpha Rhythms during Propofol-Induced Unconsciousness  

E-Print Network (OSTI)

As humans are induced into a state of general anesthesia via propofol, the normal alpha rhythm (813 Hz) in the occipital cortex disappears and a frontal alpha rhythm emerges. This spatial shift in alpha activity is called ...

Vijayan, Sujith


Measurement of microbial alpha-amylases with p-nitrophenyl glycosides as the substrate complex.  

Science Journals Connector (OSTI)

...Starch is acted on by alpha-amylase to yield alpha-amylose plus amylopectin. This enzymatic hydrolysis...on straight-chain amylose than on branched amylopectin. Fur- thermore, the alpha-amylase is not thought to...

R W Trepeta; S C Edberg



The atmospheric reactivity of. alpha. -methyltetrahydrofuran  

SciTech Connect

Biomass-derived {alpha}-methyltetrahydrofuran (MTHF) has been proposed as an automotive fuel additive. Since MTHF is a volatile organic compound, the environmental impact of evaporation to the atmosphere needs to be considered. The major loss process of MTHF in the atmosphere is expected to occur via reaction with hydroxyl radical; hence we have conducted a study of the kinetics of the reaction OH + MTHF {yields} products using both absolute (flash photolysis resonance fluorescence) and relative rate techniques. The absolute rate experiments were performed over the temperature range 240-400 K at total pressures of 35 Torr (4.7 kPa) argon; the relative rate experiments were conducted at 295 K in 740 Torr (99 kPa) synthetic air. The results from both techniques were in good agreement and yield k{sub 1} = (2.52 {plus minus} 0.74) {times} 10{sup {minus}12} exp-((650 {plus minus} 80)/T) cm{sup 3} molecule{sup {minus}1} s{sup {minus}1}, with k{sub 1} (298 K) = 2.2 {times} 10{sup {minus}11} cm{sup 3} molecule{sup {minus}1}. The implications of these results for the atmospheric chemistry of MTHF are discussed.

Wallington, T.J.; Siegl, W.O. (Ford Motor Company, Dearborn, MI (USA)); Liu, Renzhang; Zhang, Zhengyu; Huie, R.E.; Kurylo, M.J. (National Institute of Standards and Technology, Gaithersburg, MD (USA))



E-Print Network 3.0 - alpha particle emission Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

(or, positron-- the anti-particle to the beta-- emission) or alpha particle... Different types of radiation (alpha, beta, gammas, and neutrons) have different ways in which they...


E-Print Network 3.0 - alpha -bungarotoxin binding Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Limited Keywords: binding sites; protein structure; geometry; alpha... CPA, 4CPA, 5CPA, alpha-amylase 6TAA) their ... Source: Engelman, Donald M.- Department of Molecular...


Thick-Target Neutron Yield from the 19F(alpha,n) Reaction  

E-Print Network (OSTI)

Thick-target neutron yields from the 19F(alpha,n) reaction are reported for E(alpha) = 3.5 - 10.0 MeV.

E. B. Norman; T. E. Chupp; K. T. Lesko; G. L. Woodruff; P. J. Grant



E-Print Network 3.0 - alpha particle energy Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

to mirror machines can benefit this concept by efficiently redirecting alpha particle energy... -transverse wave propagation. As a result, modes suitable for alpha particle...


E-Print Network 3.0 - alpha particle effects Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

to mirror machines can benefit this concept by efficiently redirecting alpha particle energy... -transverse wave propagation. As a result, modes suitable for alpha particle...


Sensitive Immunoassay of a Biomarker TumorNecrosis Factor-[alpha...  

NLE Websites -- All DOE Office Websites (Extended Search)

Biomarker TumorNecrosis Factor-alpha Based on Poly(guanine)-Functionalized Silica Nanoparticle Sensitive Immunoassay of a Biomarker TumorNecrosis Factor-alpha Based on...


Thick-Target Neutron Yield from the 19F(alpha,n) Reaction  

E-Print Network (OSTI)

Thick-target neutron yields from the 19F(alpha,n) reaction are reported for E(alpha) = 3.5 - 10.0 MeV.

Norman, E B; Lesko, K T; Woodruff, G L; Grant, P J



E-Print Network 3.0 - alpha2-adrenoceptor antagonists studied...  

NLE Websites -- All DOE Office Websites (Extended Search)

Physiology & Behavior (2002) 76... . amic alpha1 and alpha2adrenoceptors and food intake in rats. 39. Dglucose 40. 41... nervous system in the regulation of these ......


E-Print Network 3.0 - alpha fetoprotein radioimmunoassay Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

test Alpha-fetoprotein (AFP), Estriol, h... , Benefits for Alpha-Fetoprotein IV Screening Test, Benefits for Treatment of Genetic Errors of Metabolism Source: Lammers, Peter J. -...


E-Print Network 3.0 - alpha reactions Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

resulting from... radioactive decay of the release an alpha particle from its parent isotope (e.g., alpha decay ... Source: Yucca Mountain Project, US EPA Collection:...


Generating long streams of $1/f^alpha$ noise  

E-Print Network (OSTI)

We review existing methods for generating long streams of 1/f^alpha noise ($0generator (white outside some bounds) in order to generate very long streams of noise without an exhaustive computer memory load. For $\\alpha=2$ it is shown why the process is equivalent to a random-walk and can be obtained simply by a first order filtering of white noise. As soon as $\\alphagenerators with $\\alpha>2$. The software is available from http://planck.lal.in2p3.fr/article.php3?id\\_article=8

S. Plaszczynski



Non-resonant triple alpha reaction rate at low temperature  

SciTech Connect

Our experimental goal is to study the non-resonant triple alpha reaction rate at low temperture (T < 10{sup 8} K). The {sup 13}C(p,d) reaction at 66 MeV has been used to probe the alpha-unbound continuum state in {sup 12}C just below the 2{sup nd} 0{sup +} state at 7.65 MeV. The transition strength to the continuum state is predicted to be sensitive to the non-resonant triple alpha reaction rate. The experiment has been performed at iThemba LABS. We report the present status of the experiment.

Itoh, T.; Tamii, A.; Aoi, N.; Fujita, H.; Hashimoto, T.; Miki, K.; Ogata, K. [Research Center for Nuclear Physics, Osaka University, Ibaraki, Osaka 567-0047 (Japan); Carter, J.; Donaldson, L.; Sideras-Haddad, E. [Schools of Physics, University of Witwatersrand, Johannesburg 2050 (South Africa); Furuno, T.; Kawabata, T. [Departments of Physics, Kyoto University, Sakyo, Kyoto, 606-8502 (Japan); Kamimura, M. [RIKEN Nishina Center, Wako, Saitama, 351-0198 (Japan); Nemulodi, F.; Neveling, R.; Smit, F. D.; Swarts, C. [iThemba Laboratory for Accelerator Based Sciences Somerset, West, 7129 (South Africa)


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Methods of Using Alpha Channeling Together with Transformer Recharging |  

NLE Websites -- All DOE Office Websites (Extended Search)

Methods of Using Alpha Channeling Together with Transformer Recharging Methods of Using Alpha Channeling Together with Transformer Recharging A tokamak current can be sustained using rf waves for transformer recharging at low density and high-Z with high efficiency if the resistivity is kept high enough during the radio frequency recharging stage. At the same time, operation in the hot ion mode via alpha channeling increases the effective fusion reactivity. The two separate inventions can be made to work synergistically. Specifically, by operating the tokamak in a low-density recharge phase, the lower hybrid wave penetrates the plasma more effectively. High reactivity is obtained by operation in the hot ion mode through the alpha channeling technique. Then, by using a high temperature relaxation stage, not only is the plasma current sustained


City of Alpha, Minnesota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Alpha, Minnesota (Utility Company) Alpha, Minnesota (Utility Company) Jump to: navigation, search Name City of Alpha Place Minnesota Utility Id 266 Utility Location Yes Ownership M NERC Location MRO Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Residential Residential Average Rates Residential: $0.0758/kWh Commercial: $0.0957/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Alpha,_Minnesota_(Utility_Company)&oldid=409261" Categories:


Energetics of [alpha]-helix formation in peptides and proteins  

E-Print Network (OSTI)

This thesis focuses on the energetics of !-helix formation in peptides and proteins. The [alpha]-helix is the most prevalent type of secondary structure found in proteins, and has arguably dominated our thinking about ...

Schubert, Christian Reinhold



Use of S-. alpha. diagram for representing tokamak equilibrium  

SciTech Connect

A use of the S-{alpha} diagram is proposed as a tool for representing the plasma equilibrium with a qualitative characterization of its stability through pattern recognition. The diagram is an effective tool for visually presenting the relationship between the shear and dimensionless pressure gradient of an equilibrium. In the PBX-M tokamak, an H-mode operating regime with high poloidal {beta} and L-mode regime with high toroidal {beta}, obtained using different profile modification techniques, are found to have distinct S-{alpha} trajectory patterns. Pellet injection into a plasma in the H-mode regime with high toroidal {beta}, obtained using different profile modification techniques, are found to have distinct S-{alpha} trajectory patterns. Pellet injection into a plasma in the H-mode regime results in favorable qualities of both regimes. The {beta} collapse process and ELM event also manifest themselves as characteristic changes in the S-{alpha} pattern.

Takahashi, H.; Chance, M.; Kessel, C.; LeBlanc, B.; Manickam, J.; Okabayashi, M.



Quantum Monte Carlo calculations of neutron-alpha scattering  

E-Print Network (OSTI)

We describe a new method to treat low-energy scattering problems in few-nucleon systems, and we apply it to the five-body case of neutron-alpha scattering. The method allows precise calculations of low-lying resonances and their widths. We find that a good three-nucleon interaction is crucial to obtain an accurate description of neutron-alpha scattering.

Kenneth M. Nollett; Steven C. Pieper; R. B. Wiringa; J. Carlson; G. M. Hale



Chapter 12, Survey Design and Implementation Cross-Cutting Protocols for Estimating Gross Savings: The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chapter 12: Survey Design and Chapter 12: Survey Design and Implementation Cross-Cutting Protocols for Estimating Gross Savings Robert Baumgartner, Tetra Tech Subcontract Report NREL/SR-7A30-53827 April 2013 The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures 12 - 1 Chapter 12 - Table of Contents 1 Introduction ............................................................................................................................ 2 2 The Total Survey Error Framework ....................................................................................... 4 2.1 TSE Framework for Evaluating Survey and Data Quality .............................................. 4 2.2 Sampling Errors ............................................................................................................... 5


Natural Gas Gross Withdrawals  

Gasoline and Diesel Fuel Update (EIA)

May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History U.S. 2,541,055 2,443,946 2,550,349 2,546,415 2,466,292 2,574,401 1973-2013 Alaska 261,026 234,298 241,910 231,276 247,528 261,351 1991-2013 Federal Offshore Gulf of Mexico 114,382 103,384 110,472 103,769 106,596 102,840 1997-2013 Louisiana 207,497 197,842 207,415 197,786 182,508 181,677 1991-2013 New Mexico 114,592 111,779 113,921 114,129 109,438 114,219 1991-2013 Oklahoma 181,468 176,236 184,625 184,458 179,952 185,791 1991-2013 Texas 704,080 673,815 708,526 710,928 682,803 705,611 1991-2013 Wyoming 174,481 173,334 176,075 174,025 158,494 176,834 1991-2013 Other States Other States Total 783,530 773,258 807,404 830,044 798,974 846,078 1991-2013 Alabama


Natural Gas Gross Withdrawals  

Gasoline and Diesel Fuel Update (EIA)

24,663,656 25,636,257 26,056,893 26,816,085 28,479,026 29,542,313 24,663,656 25,636,257 26,056,893 26,816,085 28,479,026 29,542,313 1936-2012 U.S. Offshore 3,476,755 3,028,561 3,072,285 2,875,945 2,416,644 2,044,643 1977-2012 U.S. State Offshore 618,042 653,704 586,953 575,601 549,151 489,505 1978-2012 Federal Offshore U.S. 2,858,713 2,374,857 2,485,331 2,300,344 1,867,492 1,555,138 1977-2012 Alaska 3,479,290 3,415,884 3,312,386 3,197,100 3,162,922 3,164,791 1967-2012 Alaska Onshore 3,105,086 3,027,696 2,954,896 2,826,952 2,798,220 2,857,485 1992-2012 Alaska Offshore 374,204 388,188 357,490 370,148 364,702 307,306 1978-2012 Alaska State Offshore 374,204 388,188 357,490 370,148 364,702 307,306 1978-2012 Federal Offshore Gulf of Mexico 2,813,197 2,329,955 2,444,102 2,259,144 1,830,913 1,527,875


Characterization of salivary alpha-amylase binding to Streptococcus sanguis  

SciTech Connect

The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. (State Univ. of New York, Buffalo (USA))



Norepinephrine infusion with and without alpha-adrenergic blockade by phentolamine increases salivary alpha amylase in healthy men  

Science Journals Connector (OSTI)

AbstractBackground Mental stress reliably induces increases in salivary alpha amylase (sAA), a suggested surrogate marker for sympathetic nervous system (SNS) reactivity. While stress-induced sAA increases correlate with norepinephrine (NE) secretion, a potential mediating role of noradrenergic mechanisms remains unclear. In this study, we investigated for the first time in humans whether a NE-stress-reactivity mimicking NE-infusion with and without alpha-adrenergic blockade by phentolamine would induce changes in sAA. Methods In a single-blind placebo-controlled within-subjects design, 21 healthy men (2966 years) took part in three different experimental trials varying in terms of substance infusion with a 1-min first infusion followed by a 15-min second infusion: saline-infusion (trial-1), NE-infusion (5?g/min) without alpha-adrenergic blockade (trial-2), and with phentolamine-induced non-selective blockade of alpha1- and alpha2-adrenergic receptors (trial-3). Saliva samples were collected immediately before, during, and several times after substance infusion in addition to blood pressure and heart rate readings. Results Experimental trials significantly differed in sAA reactivity to substance-infusion (p=.001) with higher sAA reactivity following NE-infusion with (trial-3; p=.001) and without alpha-adrenergic-blockade (trial-2; p=.004) as compared to placebo-infusion (trial-1); sAA infusion reactivity did not differ between trial-2 and trial-3 (p=.29). Effective phentolamine application was verified by blood pressure and heart rate infusion reactivity. Salivary cortisol was not affected by NE, either with or without alpha-adrenergic-blockade. Conclusions We found that NE-infusion stimulates sAA secretion, regardless of co-administered non-selective alpha-adrenergic blockade by phentolamine, suggesting that the mechanism underlying stress-induced sAA increases may involve NE.

Ulrike Kuebler; Roland von Knel; Nadja Heimgartner; Claudia Zuccarella-Hackl; Guido Stirnimann; Ulrike Ehlert; Petra H. Wirtz



Purification and characterization of the extracellular alpha-amylase from Streptococcus bovis JB1.  

Science Journals Connector (OSTI)

...alpha-amylase. alpha-Amylase activity on...active on amylopectin as on amylose. The major...extracellular alpha-amylase from Streptococcus...active on amylopectin as on amylose. The major...2.1.1 alpha-Amylases | Amino Acid...

S N Freer



the International Civil Aviation Organization (ICAO) adopted a resolution that not only accepted a long-term strat-egy for reducing emissions but also excluded language intended to prevent unilateral application of EU legislation  

E-Print Network (OSTI)

of atmospheric pollution, airliners cross many borders and fly through many regula- tory jurisdictions a long-term strat- egy for reducing emissions but also excluded language intended to prevent unilateral-standing disagreement between in- dustrialized and developing countries about preventing climate change. Secondly

Sibille, Etienne


Jet Production in ep Collisions at High $Q^2$ and Determination of $\\alpha_s$  

E-Print Network (OSTI)

The production of jets is studied in deep-inelastic ep scattering at large negative four momentum transfer squared 150alpha_s(M_Z) = 0.1168 +/-0.0007 (exp.) +0.0046/-0.0030 (th.) +/-0.0016(pdf).

Aaron, FD; Alimujiang, K; Andreev, V; Antunovic, B; Asmone, A; Backovic, S; Baghdasaryan, A; Barrelet, E; Bartel, W; Begzsuren, K; Belousov, A; Bizot, J C; Boudry, V; Bozovic-Jelisavcic, I; Bracinik, J; Brandt, G; Brinkmann, M; Brisson, V; Bruncko, D; Bunyatyan, A; Buschhorn, G; Bystritskaya, L; Campbell, A J; Cantun Avila, K B; Cassol-Brunner, F; Cerny, K; Cerny, V; Chekelian, V; Cholewa, A; Contreras, J G; Coughlan, J A; Cozzika, G; Cvach, J; Dainton, J B; Daum, K; Deak, M; de Boer, Y; Delcourt, B; Del Degan, M; Delvax, J; De Roeck, A; De Wolf, E A; Diaconu, C; Dodonov, V; Dossanov, A; Dubak, A; Eckerlin, G; Efremenko, V; Egli, S; Eliseev, A; Elsen, E; Falkiewicz, A; Faulkner, P J W; Favart, L; Fedotov, A; Felst, R; Feltesse, J; Ferencei, J; Fischer, D -J; Fleischer, M; Fomenko, A; Gabathuler, E; Gayler, J; Ghazaryan, Samvel; Glazov, A; Glushkov, I; Goerlich, L; Gogitidze, N; Gouzevitch, M; Grab, C; Greenshaw, T; Grell, B R; Grindhammer, G; Habib, S; Haidt, D; Helebrant, C; Henderson, R C W; Hennekemper, E; Henschel, H; Herbst, M; Herrera, G; Hildebrandt, M; Hiller, K H; Hoffmann, D; Horisberger, R; Hreus, T; Jacquet, M; Janssen, M E; Janssen, X; Jemanov, V; Jonsson, L; Jung, Andreas Werner; Jung, H; Kapichine, M; Katzy, J; Kenyon, I R; Kiesling, C; Klein, M; Kleinwort, C; Kluge, T; Knutsson, A; Kogler, R; Korbel, V; Kostka, P; Kraemer, M; Krastev, K; Kretzschmar, J; Kropivnitskaya, A; Kruger, K; Kutak, K; Landon, M P J; Lange, W; Lastovicka-Medin, G; Laycock, P; Lebedev, A; Leibenguth, G; Lendermann, V; Levonian, S; Li, G; Lipka, K; Liptaj, A; List, B; List, J; Loktionova, N; Lopez-Fernandez, R; Lubimov, V; Lytkin, L; Makankine, A; Malinovski, E; Marage, P; Marti, Ll; Martyn, H -U; Maxfield, S J; Mehta, A; Meyer, A B; Meyer, H; Meyer, H; Meyer, J; Michels, V; Mikocki, S; Milcewicz-Mika, I; Moreau, F; Morozov, A; Morris, J V; Mozer, Matthias Ulrich; Mudrinic, M; Muller, K; Murin, P; Naroska, B; Naumann, Th; Newman, P R; Niebuhr, C; Nikiforov, A; Nowak, G; Nowak, K; Nozicka, M; Olivier, B; Olsson, J E; Osman, S; Ozerov, D; Palichik, V; Panagoulias, I; Pandurovic, M; Papadopoulou, Th; Pascaud, C; Patel, G D; Pejchal, O; Perez, E; Petrukhin, A; Picuric, I; Piec, S; Pitzl, D; Placakyte, R; Pokorny, B; Polifka, R; Povh, B; Preda, T; Radescu, V; Rahmat, A J; Raicevic, N; Raspiareza, A; Ravdandorj, T; Reimer, P; Rizvi, E; Robmann, P; Roland, B; Roosen, R; Rostovtsev, A; Rotaru, M; Ruiz Tabasco, J E; Rurikova, Z; Rusakov, S; Salek, D; Sankey, D P C; Sauter, M; Sauvan, E; Schmitt, S; Schmitz, C; Schoeffel, L; Schoning, A; Schultz-Coulon, H -C; Sefkow, F; Shaw-West, R N; Sheviakov, I; Shtarkov, L N; Shushkevich, S; Sloan, T; Smiljanic, Ivan; Soloviev, Y; Sopicki, P; South, D; Spaskov, V; Specka, Arnd E; Staykova, Z; Steder, M; Stella, B; Stoicea, G; Straumann, U; Sunar, D; Sykora, T; Tchoulakov, V; Thompson, G; Thompson, P D; Toll, T; Tomasz, F; Tran, T H; Traynor, D; Trinh, T N; Truol, P; Tsakov, I; Tseepeldorj, B; Turnau, J; Urban, K; Valkarova, A; Vallee, C; Van Mechelen, P; Vargas Trevino, A; Vazdik, Y; Vinokurova, S; Volchinski, V; von den Driesch, M; Wegener, D; Wissing, Ch; Wunsch, E; Zacek, J; Zalesak, J; Zhang, Z; Zhokin, A; Zimmermann, T; Zohrabyan, H; Zomer, F; Zus, R



E-Print Network 3.0 - alpha rara gene Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

found, some of the genes present... the classification, we excluded from Vijver's dataset all samples that presented mutations in the ... Source: Moscato, Pablo - Newcastle...


3alpha clustering in the excited states of 16C  

E-Print Network (OSTI)

The alpha cluster states of 16C are investigated by using the antisymmetrized molecular dynamics. It is shown that two different types of alpha cluster states exist: triangular and linear-chain states. The former has an approximate isosceles triangular configuration of alpha particles surrounded by four valence neutrons occupying sd-shell, while the latter has the linearly aligned alpha particles with two sd-shell neutrons and two pf-shell neutrons. It is found that the structure of the linear-chain state is qualitatively understood in terms of the 3/2 pi- and 1/2 sigma- molecular orbit as predicted by molecular-orbital model, but there exists non-negligible Be+alpha+2n correlation. The band-head energies of the triangular and linear-chain rotational bands are 8.0 and 15.5 MeV, and the latter is close to the He+Be threshold energy. It is also shown that the linear-chain state becomes the yrast sstate at J=10 with excitation energy 27.8 MeV owing to its very large moment-of-inertia comparable with hyperdeformation.

T. Baba; Y. Chiba; M. Kimura



Ly-alpha emission from GRB host galaxies  

E-Print Network (OSTI)

Ly-alpha emission is indicative of on-going star formation in a dust-poor environment. Ly-alpha imaging is therefore a probe of the star formation rate and of the dust-content of Gamma-Ray Burst host galaxies. Both of these parameters are central to our understanding of GRB progenitors and of how the environments affect the propagation of afterglow emission out of host galaxies. We have started a program aimed at imaging high redshift (z>2) host galaxies of GRBs at the Ly-alpha resonance line from neutral hydrogen. Here were report the results from imaging of the fields of GRB 000301C and GRB 000926 and outline upcoming observations of further hosts.

J. P. U. Fynbo; P. Moller; B. Thomsen; J. Hjorth; J. Gorosabel; M. I. Andersen; M. P. Egholm; S. Holland; B. L Jensen; H. Pedersen; M. Weidinger



Continuous air monitor for alpha-emitting aerosol particles  

SciTech Connect

A new alpha Continuous Air Monitor (CAM) sampler is being developed for use in detecting the presence of alpha-emitting aerosol particles. The effort involves design, fabrication and evaluation of systems for the collection of aerosol and for the processing of data to speciate and quantify the alpha emitters of interest. At the present time we have a prototype of the aerosol sampling system and we have performed wind tunnel tests to characterize the performance of the device for different particle sizes, wind speeds, flow rates and internal design parameters. The results presented herein deal with the aerosol sampling aspects of the new CAM sampler. Work on the data processing, display and alarm functions is being done in parallel with the particle sampling work and will be reported separately at a later date. 17 refs., 5 figs., 3 tabs.

McFarland, A.R.; Ortiz, C.A. (Texas A and M Univ., College Station, TX (USA). Dept. of Mechanical Engineering); Rodgers, J.C.; Nelson, D.C. (Los Alamos National Lab., NM (USA))



Indirect Measurements for (p,{alpha}) Reactions Involving Boron Isotopes  

SciTech Connect

Light elements lithium, beryllium and boron (LiBeB) were used in the last years as 'possible probe' for a deeper understanding of some extra-mixing phenomena occurring in young Main-Sequence stars. They are mainly destroyed by (p,{alpha}) reactions and cross section measurements for such channels are then needed. The Trojan Horse Method (THM) allows one to extract the astrophysical S(E)-factor without the experience of tunneling through the Coulomb barrier. In this work a resume of the recent results about the {sup 11}B(p,{alpha}{sub 0}){sup 8}Be and {sup 10}B(p,{alpha}){sup 7}Be reactions is shown.

Lamia, L.; Spitaleri, C.; Romano, S.; Cherubini, S.; Crucilla, V.; Gulino, M.; La Cognata, M.; Pizzone, R. G.; Puglia, S. M. R.; Sergi, M. L.; Tudisco, S.; Tumino, A. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l'Ingegneria, Universita di Catania, Catania (Italy); Carlin, N.; Szanto, M. G. del; Liguori Neto, R.; Moura, M. M. de; Munhoz, M. G.; Souza, F. A.; Suaide, A. A. P.; Szanto, E. [Departamento de Fisica Nuclear, Universitade de Sao Paulo, Sao Paulo (Brazil)] (and others)



Automated docking of {alpha}-(1,4)- and {alpha}-(1,6)-linked glucosyl trisaccharides in the glucoamylase active site  

SciTech Connect

Low-energy conformers of five {alpha}-(1,4)- and {alpha}-(1,6)-linked glucosyl trisaccharides were flexibly docked into the glucoamylase active site using AutoDock 2.2. To ensure that all significant conformational space was searched, the starting trisaccharide conformers for docking were all possible combinations of the corresponding disaccharide low-energy conformers. All docked trisaccharides occupied subsites {minus}1 and +1 in very similar modes to those of corresponding nonreducing-end disaccharides. For linear substrates, full binding at subsite +2 occurred only when the substrate reducing end was {alpha}-(1,4)-linked, with hydrogen-bonding with the hydroxy-methyl group being the only polar interaction there. Given the absence of other important interactions at this subsite, multiple substrate conformations are allowed. For the one docked branched substrate, steric hindrance in the {alpha}-(1,6)-glycosidic oxygen suggests that the active-site residues have to change position for hydrolysis to occur. Subsite +1 of the glucoamylase active site allows flexibility in binding but, at least in Aspergillus glucoamylases, subsite +2 selectively binds substrates {alpha}-(1,4)-linked between subsites +1 and +2. Enzyme engineering to limit substrate flexibility at subsite +2 could improve glucoamylase industrial properties.

Countinho, P.M.; Reilly, P.J. [Iowa State Univ., Ames, IA (United States). Dept. of Chemical Engineering; Dowd, M.K. [Dept. of Agriculture, New Orleans, LA (United States). Southern Regional Research Center



Study of the Pygmy Dipole Resonance in {sup 124}Sn by means of the ({alpha},{alpha}'{gamma}) reaction  

SciTech Connect

In recent years {alpha}-{gamma} coincidence experiments at 136 MeV incident energy on {sup 48}Ca, {sup 140}Ce, {sup 138}Ba and {sup 124}Sn were performed at the KVI in Groningen to study the isospin character of electric dipole excitations below the particle threshold, frequently called Pygmy Dipole Resonance (PDR). An array of HPGe {gamma}-detectors has been used in coincidence with the Big-Bite Spectrometer (BBS) and a resolution of about 10 keV in the {gamma}-ray energy has been achieved. The results show that the excitation patterns of the PDR in the ({alpha},{alpha}') reaction seem to differ significantly from results obtained in Nuclear Resonance Fluorescence (NRF)({gamma},{gamma}') measurements. The PDR, which until now has been assigned to one excitation mode, splits up into two parts: One that is excited in ({alpha},{alpha}'{gamma}) and ({gamma},{gamma}') reactions (denoting a dominant isoscalar character), and one that is only excited in ({gamma},{gamma}')(denoting a dominant isovector character). This indicates that two different excitation mechanisms produce these low-lying E1 excitations [1], The preliminary results of the latest measurements on the N = 82 nucleus {sup 138}Ba and the Z = 50 nucleus {sup 124}Sn show that this break up into two parts is a common feature of the PDR in semi-magic nuclei.

Endres, J.; Zilges, A. [Institut fuer Kernphysik, Universitaet zu Koeln (Germany); Pietralla, N.; Savran, D.; Sonnabend, K. [Institut fuer Kernphysik, TU Darmstadt (Germany); Harakeh, M. N.; Stoica, V.; Woertche, H. [Kernfysisch Versneller Instituut, University of Groningen (Netherlands); Butler, P.; Herzberg, R. D.; Scheck, M. [Department of Physics, University of Liverpool (United Kingdom); Kruecken, R. [Physik-Department E12, TU Muenchen (Germany); Popescu, L. [SCK-CEN, Mol (Belgium); Harissopulos, S.; Lagoyannis, A. [I.N.P. NCSR Demokritos, Athens (Greece)


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Inclusive-jet photoproduction at HERA and determination of alphas  

E-Print Network (OSTI)

Inclusive-jet cross sections have been measured in the reaction ep->e+jet+X for photon virtuality Q2 energies in the region 142 energy, ETjet, and pseudorapidity, etajet, for jets with ETjet > 17 GeV and -1 energy-scale dependence of the coupling was determined. The value of alphas(Mz) extracted from the measurements based on the kT jet algorithm is alphas(Mz) = 0.1206 +0.0023 -0.0022 (exp.) +0.0042 -0.0035 (th.); the results from the anti-kT and SIScone algorithms are compatible with this value and have a similar precision.

ZEUS Collaboration; H. Abramowicz; I. Abt; L. Adamczyk; M. Adamus; R. Aggarwal; S. Antonelli; P. Antonioli; A. Antonov; M. Arneodo; V. Aushev; Y. Aushev; O. Bachynska; A. Bamberger; A. N. Barakbaev; G. Barbagli; G. Bari; F. Barreiro; N. Bartosik; D. Bartsch; M. Basile; O. Behnke; J. Behr; U. Behrens; L. Bellagamba; A. Bertolin; S. Bhadra; M. Bindi; C. Blohm; V. Bokhonov; T. Bold; K. Bondarenko; E. G. Boos; K. Borras; D. Boscherini; D. Bot; I. Brock; E. Brownson; R. Brugnera; N. Brummer; A. Bruni; G. Bruni; B. Brzozowska; P. J. Bussey; B. Bylsma; A. Caldwell; M. Capua; R. Carlin; C. D. Catterall; S. Chekanov; J. Chwastowski; J. Ciborowski; R. Ciesielski; L. Cifarelli; F. Cindolo; A. Contin; A. M. Cooper-Sarkar; N. Coppola; M. Corradi; F. Corriveau; M. Costa; G. D'Agostini; F. Dal Corso; J. del Peso; R. K. Dementiev; S. De Pasquale; M. Derrick; R. C. E. Devenish; D. Dobur; B. A. Dolgoshein; G. Dolinska; A. T. Doyle; V. Drugakov; L. S. Durkin; S. Dusini; Y. Eisenberg; P. F. Ermolov; A. Eskreys; S. Fang; S. Fazio; J. Ferrando; M. I. Ferrero; J. Figiel; M. Forrest; B. Foster; G. Gach; A. Galas; E. Gallo; A. Garfagnini; A. Geiser; I. Gialas; A. Gizhko; L. K. Gladilin; D. Gladkov; C. Glasman; O. Gogota; Yu. A. Golubkov; P. Gottlicher; I. Grabowska-Bold; J. Grebenyuk; I. Gregor; G. Grigorescu; G. Grzelak; O. Gueta; M. Guzik; C. Gwenlan; T. Haas; W. Hain; R. Hamatsu; J. C. Hart; H. Hartmann; G. Hartner; E. Hilger; D. Hochman; R. Hori; K. Horton; A. Huttmann; Z. A. Ibrahim; Y. Iga; R. Ingbir; M. Ishitsuka; H. -P. Jakob; F. Januschek; T. W. Jones; M. Jungst; I. Kadenko; B. Kahle; S. Kananov; T. Kanno; U. Karshon; F. Karstens; I. I. Katkov; M. Kaur; P. Kaur; A. Keramidas; L. A. Khein; J. Y. Kim; D. Kisielewska; S. Kitamura; R. Klanner; U. Klein; E. Koffeman; N. Kondrashova; O. Kononeko; P. Kooijman; Ie. Korol; I. A. Korzhavina; A. Kotanski; U. Kotz; H. Kowalski; O. Kuprash; M. Kuze; A. Lee; B. B. Levchenko; A. Levy; V. Libov; S. Limentani; T. Y. Ling; M. Lisovyi; E. Lobodzinska; W. Lohmann; B. Lohr; E. Lohrmann; K. R. Long; A. Longhin; D. Lontkovskyi; O. Yu. Lukina; J. Maeda; S. Magill; I. Makarenko; J. Malka; R. Mankel; A. Margotti; G. Marini; J. F. Martin; A. Mastroberardino; M. C. K. Mattingly; I. -A. Melzer-Pellmann; S. Mergelmeyer; S. Miglioranzi; F. Mohamad Idris; V. Monaco; A. Montanari; J. D. Morris; K. Mujkic; B. Musgrave; K. Nagano; T. Namsoo; R. Nania; A. Nigro; Y. Ning; T. Nobe; U. Noor; D. Notz; R. J. Nowak; A. E. Nuncio-Quiroz; B. Y. Oh; N. Okazaki; K. Oliver; K. Olkiewicz; Yu. Onishchuk; K. Papageorgiu; A. Parenti; E. Paul; J. M. Pawlak; B. Pawlik; P. G. Pelfer; A. Pellegrino; W. Perlanski; H. Perrey; K. Piotrzkowski; P. Plucinski; N. S. Pokrovskiy; A. Polini; A. S. Proskuryakov; M. Przybycien; A. Raval; D. D. Reeder; B. Reisert; Z. Ren; J. Repond; Y. D. Ri; A. Robertson; P. Roloff; I. Rubinsky; M. Ruspa; R. Sacchi; U. Samson; G. Sartorelli; A. A. Savin; D. H. Saxon; M. Schioppa; S. Schlenstedt; P. Schleper; W. B. Schmidke; U. Schneekloth; V. Schonberg; T. Schorner-Sadenius; J. Schwartz; F. Sciulli; L. M. Shcheglova; R. Shehzadi; S. Shimizu; I. Singh; I. O. Skillicorn; W. Slominski; W. H. Smith; V. Sola; A. Solano; D. Son; V. Sosnovtsev; A. Spiridonov; H. Stadie; L. Stanco; N. Stefaniuk; A. Stern; T. P. Stewart; A. Stifutkin; P. Stopa; S. Suchkov; G. Susinno; L. Suszycki; J. Sztuk-Dambietz; D. Szuba; J. Szuba; A. D. Tapper; E. Tassi; J. Terron; T. Theedt; H. Tiecke; K. Tokushuku; J. Tomaszewska; V. Trusov; T. Tsurugai; M. Turcato; O. Turkot; T. Tymieniecka; M. Vazquez; A. Verbytskyi; O. Viazlo; N. N. Vlasov; R. Walczak; W. A. T. Wan Abdullah; J. J. Whitmore; L. Wiggers; M. Wing; M. Wlasenko; G. Wolf; H. Wolfe; K. Wrona; A. G. Yagues-Molina; S. Yamada; Y. Yamazaki; R. Yoshida; C. Youngman; O. Zabiegalov; A. F. Zarnecki; L. Zawiejski; O. Zenaiev; W. Zeuner; B. O. Zhautykov; N. Zhmak; C. Zhou; A. Zichichi; Z. Zolkapli; D. S. Zotkin



Taking the Band Function Too Far: A Tale of Two $\\alpha$'s  

E-Print Network (OSTI)

The long standing problem of identifying the emission mechanism operating in gamma-ray bursts (GRBs) has produced a myriad of possible models that have the potential of explaining the observations. Generally, the empirical Band function is fit to the observed gamma-ray data and the fit parameters are used to infer which radiative mechanisms are at work in GRB outflows. In particular, the distribution of the Band function's low-energy power law index, $\\alpha$, has led to the so-called synchrotron "line-of-death" (LOD) which is a statement that the distribution cannot be explained by the simplest of synchrotron models alone. As an alternatively fitting model, a combination of a blackbody in addition to the Band function is used, which in many cases provide a better or equally good fit. It has been suggested that such fits would be able to alleviate the LOD problem for synchrotron emission in GRBs. However, these conclusions rely on the Band function's ability to fit a synchrotron spectrum within the observed e...

Burgess, J Michael; Yu, Hoi-Fung



Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005  

NLE Websites -- All DOE Office Websites (Extended Search)

Guidelines Establishing Criteria for Excluding Buildings Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005 January 27, 2006 These guidelines and accompanying criteria fulfill the requirement under Section 543(c)(3) of the National Energy Conservation Policy Act (NECPA) as amended by the Energy Policy Act of 2005 (EPACT). Section 543(c)(3) states that the Secretary of Energy shall issue guidelines that establish criteria for exclusions from the energy performance requirement for a fiscal year, any Federal building or collection of Federal buildings, within the statutory framework provided by the law. The purpose of these guidelines is to clarify and explicate, as necessary, the statutory


Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Guidelines Establishing Criteria for Excluding Buildings Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005 January 27, 2006 These guidelines and accompanying criteria fulfill the requirement under Section 543(c)(3) of the National Energy Conservation Policy Act (NECPA) as amended by the Energy Policy Act of 2005 (EPACT). Section 543(c)(3) states that the Secretary of Energy shall issue guidelines that establish criteria for exclusions from the energy performance requirement for a fiscal year, any Federal building or collection of Federal buildings, within the statutory framework provided by the law. The purpose of these guidelines is to clarify and explicate, as necessary, the statutory


Chapter Advisor E-mail Alpha Delta Pi Courtney O'Neill-Chapter Advisor courtneyoneill2004@yahoo.com  

E-Print Network (OSTI)

Chapter Advisor E-mail Alpha Delta Pi Courtney O'Neill- Chapter Advisor courtneyoneill2004@yahoo.com Alpha Delta Pi Kendra Stewart-On Campus stewartk@cofc.edu Alpha Epsilon Pi Alex Green - Chapter Advisor Magwood- Chapater Advisor graymag7@bellsouth.net Alpha Kappa Alpha Debbie Counts-On-Campus countsd

Kunkle, Tom


Young alpha-enriched giant stars in the solar neighbourhood  

E-Print Network (OSTI)

We derive age constraints for 1639 red giants in the APOKASC sample for which seismic parameters from Kepler, as well as effective temperatures, metallicities and [{\\alpha}/Fe] values from APOGEE DR12 are available. We investigate the relation between age and chemical abundances for these stars, using a simple and robust approach to obtain ages. We first derive stellar masses using standard seismic scaling relations, then determine the maximum possible age for each star as function of its mass and metallicity, independently of its evolutionary stage. While the overall trend between maximum age and chemical abundances is a declining fraction of young stars with increasing [{\\alpha}/Fe], at least 14 out of 241 stars with [{\\alpha}/Fe]>0.13 are younger than 6 Gyr. Five stars with [{\\alpha}/Fe]>0.2 have ages below 4 Gyr. We examine the effect of modifications in the standard seismic scaling relations, as well as the effect of very low helium fractions, but these changes are not enough to make these stars as old a...

Martig, Marie; Aguirre, Victor Silva; Hekker, Saskia; Mosser, Benoit; Elsworth, Yvonne; Bovy, Jo; Stello, Dennis; Anders, Friedrich; Garca, Rafael A; Tayar, Jamie; Rodrigues, Thase S; Basu, Sarbani; Carrera, Ricardo; Ceillier, Tugdual; Chaplin, William J; Chiappini, Cristina; Frinchaboy, Peter M; Garca-Hernndez, D A; Hearty, Fred R; Holtzman, Jon; Johnson, Jennifer A; Mathur, Savita; Mszros, Szabolcs; Miglio, Andrea; Nidever, David; Pinsonneault, Marc; Schiavon, Ricardo P; Schneider, Donald P; Serenelli, Aldo; Shetrone, Matthew; Zamora, Olga



Zinc oxide nanoparticles as novel alpha-amylase inhibitors  

Science Journals Connector (OSTI)

Amylase inhibitors also known as starch blockers contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense these materials are projected as having potential applications in diabetes control. In this context we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ? 18 ? nm stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique Fourier transform infrared spectroscopy UV-visible spectroscopy and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 ? ? g / ml ZnOnanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnOnanoparticles wherein an optimum dose of 20 ? ? g / ml was sufficient to exhibit 49% glucose inhibition at neutral p H and 35 ? C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor) thereby projecting ZnOnanoparticles as novel alpha-amylase inhibitors.

Sandip Dhobale; Trupti Thite; S. L. Laware; C. V. Rode; Soumya J. Koppikar; Ruchika-Kaul Ghanekar; S. N. Kale



CRAD, Management- Oak Ridge National Laboratory TRU ALPHA LLWT Project  

Energy.gov (U.S. Department of Energy (DOE))

A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Management Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project.



SciTech Connect

High-resolution spectroscopic observations of {alpha} Hya were acquired between 2003 and 2010. Analysis of line shifts, differential shifts, line widths, and line bisectors points to two regimes of velocity fields in the photosphere of {alpha} Hya: (1) normal granulation embedded in (2) large convection cells. Variations occur on a wide range of timescales, from several years on down. Radial velocity variations, which are irregular and span 786 m s{sup -1}, have a distribution consistent with a true mean rise velocity of the large cells of {approx}725 m s{sup -1} and a dispersion of {approx}220 m s{sup -1}. The distribution of granulation velocities, as measured from the widths of spectral lines, shows only small variations, consistent with the two regime concepts. On the multi-year timescale, radial velocity changes, small temperature variations ({approx}10 K), and small line-width variations ({approx}<0.8%) track each other, possibly with phase shifts. The granulation velocity gradient for {alpha} Hya is about half as large as the Sun's and no variation with time was seen, implying that any variation in velocity gradient from one large cell to the next must be less than a few percent. The asymmetry in the granulation velocity distribution, as specified in the flux deficit, is smaller than expected for {alpha} Hya's position in the HR diagram and appears to be variable.

Gray, David F., E-mail: dfgray@uwo.ca [Department of Physics and Astronomy, University of Western Ontario, London, Ontario N6A 3K7 (Canada)



The coronal Ne/O abundance of alpha Centauri  

E-Print Network (OSTI)

Recent improvements in the modeling of solar convection and line formation led to downward revisions of the solar photospheric abundances of the lighter elements, which in turn led to changes in the radiative opacity of the solar interior and hence to conflicts with the solar convection zone depth as inferred from helioseismic oscillation frequencies. An increase of the solar Ne/O abundance to values as observed for nearby stars has been proposed as a solution. Because of the absence of strong neon lines in the optical, neon abundances are difficult to measure and the correct solar and stellar Ne/O abundances are currently hotly debated. Based on X-ray spectra obtained with XMM-Newton, we determine a reference value of Ne/O for the inactive, solar-like star alpha Cen (primarily alpha Cen B, which is the dominant component in X-rays), with three independent, line-based methods, using differential emission measure reconstruction and an emission measure-independent method. Our results indicate a value of approx. 0.28 for Ne/O in alpha Cen, approximately twice the value measured for the Sun, but still below the average value obtained for other stars. The low Ne/O abundance of the Sun is peculiar when compared to alpha Cen and other stars; our results emphasize the necessity to obtain more and accurate Ne/O abundance measurements of low activity stars.

C. Liefke; J. H. M. M. Schmitt



Physics of alpha channelling and related TFTR experiments  

E-Print Network (OSTI)

Physics of alpha channelling and related TFTR experiments N.J. Fisch Princeton Plasma Physics in magnetic fusion research centred on attaining plasmas close to thermonuclear condi- tions. Of particular interest was the heating of the plasma to thermonuclear temperatures, say, to at least 10 ke


Preparation of {alpha},{beta}-unsaturated carboxylic acids and esters  

DOE Patents (OSTI)

Disclosed is a process for the preparation of {alpha},{beta}-unsaturated carboxylic acids and esters thereof which comprises contacting formaldehyde or a source of formaldehyde with a carboxylic acid, ester or anhydride in the presence of a catalyst comprising an oxide of niobium.

Gogate, M.R.; Spivey, J.J.; Zoeller, J.R.



Probing Alpha-Vacua of Black Holes in LHC  

E-Print Network (OSTI)

Motivated by the idea of alpha-vacua in Schwarzschild spacetime, we studied the deformed spectrum of Hawking radiation. Such a deformation would leave signatures on the small black hole evaporation in LHC because their vacuum deviates from the Unruh state.

Tower Wang



Preparation of NIF Scale Poly ((alpha)-METHYLSTYRENE) Mandrels  

SciTech Connect

All planned National Ignition Facility (NIF) capsule targets except machined beryllium require a plastic mandrel upon which the ablator is applied. This mandrel must at least meet if not exceed the symmetry and surface finish requirements of the final capsule. The mandrels are produced by a two-step process. In the first step a thin-walled poly({alpha}-methylstyrene)(P{alpha}MS) shell is produced using microencapsulation techniques. This shell is overcoated with 10 to 15 {micro}m of glow discharge polymer (GDP) and then pyrolyzed at 300 C. This pyrolysis causes the P{alpha}MS to depolymerize to gas phase monomer that diffuses away through the more thermally stable plasma polymer shell, which retains all the symmetry of the original P{alpha}MS shell. Thus our challenge has been to produce 2-mm-diameter P{alpha}MS shells to serve as these initial ''decomposable'' mandrels that meet or exceed the current NIF design specifications. The basic microencapsulation process used in producing P{alpha}MS mandrels involves using a droplet generator to produce a water droplet (Wl) encapsulated by a fluorobenzene solution of P{alpha}MS (O), this compound droplet being suspended in a stirred aqueous bath (W2). Historically this bath has contained poly(vinyl alcohol) (PVA, 88% hydrolyzed, mol. wt. {approx}25,000 g/mol) to prevent agglomeration of the initially fluid compound droplets. As the compound droplets are stirred in the bath, the fluorobenzene solvent slowly dissipates leaving a solid P{alpha}MS shell. The internal water is subsequently removed by low temperature drying. We found using these techniques that 2-mm shells could easily be produced, however their low mode sphericity did not meet design specifications. In our last published report we detailed how replacement of the PVA with poly(acrylic acid) (PAA) resulted in a major improvement in sphericity due to a greatly increased interfacial tension between the bath and the compound droplet, relative to the use of PVA as the bath additive. P{alpha}MS mandrels produced using PAA in the bath along with slow curing to suppress Marangoni convection that was perturbing the mode 10 to 20 symmetry resulted in 2-mm-diameter P{alpha}MS shells with mode 2 out-of-round{sup 10} (OOR) of {approx}0.5 {micro}m (as well as non-concentricity (NC) < 1%) which meet the capsule design requirements. A representative set of equatorial traces produced by our AFM-based Spheremapper along with the computed power spectrum is shown in Figure 1 for an average shell. Although the power spectrum is at or below the design specification at nearly all modes one can see in the traces some degree of roughness which manifests itself at the very high modes in the power spectrum.

Takagi, M; Cook, R; McQuillan, B; Elsner, F; Stephens, R; Nikroo, A; Paguio, S




SciTech Connect

The nearby star {alpha} Oph (Ras Alhague) is a rapidly rotating A5IV star spinning at {approx} 89% of its breakup velocity. This system has been imaged extensively by interferometric techniques, giving a precise geometric model of the star's oblateness and the resulting temperature variation on the stellar surface. Fortuitously, {alpha} Oph has a previously known stellar companion, and characterization of the orbit provides an independent, dynamically based check of both the host star and the companion mass. Such measurements are crucial to constrain models of such rapidly rotating stars. In this study, we combine eight years of adaptive optics imaging data from the Palomar, AEOS, and CFHT telescopes to derive an improved, astrometric characterization of the companion orbit. We also use photometry from these observations to derive a model-based estimate of the companion mass. A fit was performed on the photocenter motion of this system to extract a component mass ratio. We find masses of 2.40{sup +0.23}{sub -0.37} M{sub sun} and 0.85{sup +0.06}{sub -0.04} M{sub sun} for {alpha} Oph A and {alpha} Oph B, respectively. Previous orbital studies of this system found a mass too high for this system, inconsistent with stellar evolutionary calculations. Our measurements of the host star mass are more consistent with these evolutionary calculations, but with slightly higher uncertainties. In addition to the dynamically derived masses, we use IJHK photometry to derive a model-based mass for {alpha} Oph B, of 0.77 {+-} 0.05 M{sub sun} marginally consistent with the dynamical masses derived from our orbit. Our model fits predict a periastron passage on 2012 April 19, with the two components having a 50 mas separation from 2012 March to May. A modest amount of interferometric and radial velocity data during this period could provide a mass determination of this star at the few percent level.

Hinkley, Sasha; Hillenbrand, Lynne; Crepp, Justin R. [Department of Astronomy, California Institute of Technology, 1200 E. California Blvd., MC 249-17, Pasadena, CA 91125 (United States); Monnier, John D. [Astronomy Department, University of Michigan, 941 Dennison Bldg., Ann Arbor, MI 48109-1090 (United States); Oppenheimer, Ben R.; Brenner, Douglas; Sivaramakrishnan, Anand [Astrophysics Department, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); Roberts, Lewis C. Jr; Zhao Ming; Vasisht, Gautam; Pueyo, Laurent [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Dr., Pasadena, CA 91109 (United States); Ireland, Michael [School of Physics, University of Sydney, NSW 2006 (Australia); Zimmerman, Neil [Department of Astronomy, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Parry, Ian R. [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom); Martinache, Frantz [National Astronomical Observatory of Japan, Subaru Telescope, Hilo, HI 96720 (United States); Lai, Olivier [CFHT Corp., 65-1238 Mamalahoa Hwy., Kamuela, HI 96743 (United States); Soummer, Remi [STScI, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Beichman, Charles [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Lloyd, James P.; Bernat, David [Department of Astronomy, Cornell University, Ithaca, NY 14853 (United States)



E-Print Network 3.0 - alpha particle driven Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle physics in the tokamak fusion test reactor Summary: . 5. Alpha-particle instabilities A search for the...


Trans-chalcone: a novel small molecule inhibitor of mammalian alpha-amylase  

Science Journals Connector (OSTI)

Trans...-chalcone (1,3-diphenyl-2-propen-1-one), a biphenolic core structure of flavonoids precursor was tested for inhibitory activity toward alpha-amylase. Porcine pancreatic alpha-amylase was ...

Mahmoud Najafian; Azadeh Ebrahim-Habibi; Nastaran Hezareh



E-Print Network 3.0 - alpha 1-adrenoceptor binding Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

of alpha-methyl d-glucopyranoside. Biochem J 109... binding site in hog pancreatic alpha-amylase. Biochemistry 15, 1987-93. 57 Sevilla, N., Steer, M. L... ., Helmreich, E....


Characterization and molecular cloning of thermostable alpha-amylase from Streptomyces sp.To1  

Science Journals Connector (OSTI)

A new thermophilic Streptomyces...sp. TO1, isolated from Tunisian soil, produced a thermostable alpha-amylase and pullulanase. The gene encoding for the alpha-amylase activity was cloned into the multicopy clonin...

Lotfi Mellouli; Raoudha Ghorbel; Alya Kammoun; Monia Mezghani



Determination of alpha-amylase activity in dextran, ficoll and polyethylene glycol solutions  

Science Journals Connector (OSTI)

A new insoluble chromolytic substrate for the spectrophotometric determination of alpha-amylase activity (starch cross-linked with 1,4 ... phase-forming polymers interfere with some commonly used alpha-amylase as...

Ivo afa?k; Miroslava afa?kov

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - alpha inhibits growth Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Miller,W., and Lipman,D.J. (1997) Summary: of the inhibition of alpha-glucosidase, alpha-amylase, and cyclomaltodextrin glucanosyltransferase by acarbose... ,W., Tanguy,M.,...


EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

05: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge...


EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge...


E-Print Network 3.0 - alpha pparalpha protects Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

GTTTTGCTTTCTCAGATCTT GGC P h PPAR-alpha... G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... identifies the NF-kappa...


E-Print Network 3.0 - acid receptor alpha Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

alpha Page: << < 1 2 3 4 5 > >> 1 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...


E-Print Network 3.0 - alpha particle loss Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

results for: alpha particle loss Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle...


E-Print Network 3.0 - alpha particle analysis Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

results for: alpha particle analysis Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle...


Purification and characterization of periplasmic alpha-amylase from Xanthomonas campestris K-11151.  

Science Journals Connector (OSTI)

...9005-82-7 Amylose 9037-22-3 Amylopectin 9057-02-7... alpha-Amylases EC 3.2.1...cyclomaltodextrinase | Amylopectin metabolism Amylose metabolism Cell...purification alpha-Amylases isolation & purification...

J Abe; N Onitsuka; T Nakano; Y Shibata; S Hizukuri; E Entani




Science Journals Connector (OSTI)

...induced biosynthesis of alpha-amylase in Pseudomonas saccharophila...INDUCED BIOSYNTHESIS OF ALPHA-AMYLASE IN PSEUDOMONAS SACCHAROPHILA...proteins of E. coli do not break down to their constituent...amylase synthesis by starch, P. saccharophila also...

Alvin Markovitz; Harold P. Klein



Recovery Cleanup Project at Y-12 Leaves Alpha 5 with an Empty...  

National Nuclear Security Administration (NNSA)

Office NPO News Releases Recovery Cleanup Project at Y-12 Leaves Alpha ... Recovery Cleanup Project at Y-12 Leaves Alpha 5 with an Empty Feeling applicationmsword icon R-10-21...


E-Print Network 3.0 - alpha centauri binary Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

the south later on. Crux the Southern Cross, with Beta and Alpha Centauri... than the sun. It is the fourth brightest star in the sky after Sirius, Canopus and Alpha Centauri....


E-Print Network 3.0 - alpha energy measurements Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

2) in front of two different detectors for alpha spectroscopy. At first, an energy measurement... L-97 On the evidence of high-energy alpha emitters (E 10.6 MeV) in monazite D....


E-Print Network 3.0 - alpha line profile Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

fusion test reactor Summary: -particle confinement and thermalization (solid and dashed lines). The alphas near their birth energy of 3.5 MeV can... of the alpha-energy spectrum...


E-Print Network 3.0 - alpha particle spectroscopy Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Isotopes 59 (2003) 363-366 Comparison among alpha-particle energy losses... July 2003 Abstract In the present work, we compare the alpha-particle energy losses in air...


E-Print Network 3.0 - alpha-decay recoil products Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary: .A., Sherriff, B.L., Fleet, M.E., McCammon, C., 1991. Alpha-decay damage in titanite: American Mineralogist, 76... , G.R., Ewing, R.C., 1988. Alpha decay damage in...


Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations  

Science Journals Connector (OSTI)

Three alpha-amylase producing strains of Aspergillus oryzae used for ... dense mycelium is more efficient in producing ?-amylase.

Anders Spohr; Morten Carlsen; Jens Nielsen; John Villadsen



Attention-modulated Alpha-band Oscillations Protect against Intrusion of Irrelevant Information  

E-Print Network (OSTI)

after a cue to attend to that hand, but shows in- creased power after a cue to attend to the foot alpha power. However, the alpha-band modulation was not simply locked to the cue offset. The tem- poral in the sequence, peri- stimulus alpha power predicted the degree to which that irrel- evant stimulus distorted

Sekuler, Robert


Words number: 25491 Assessment of salivary alpha-amylase -a stress biomarker -in2  

E-Print Network (OSTI)

1 Words number: 25491 Assessment of salivary alpha-amylase - a stress biomarker - in2 pregnant patients.3 4 Running tittle: Salivary alpha-amylase: a stress biomarker in pregnant patients5 6 Jean, Psychological5 Saliva6 Salivary alpha-Amylases7 Caesarean Section8 9 10 inserm-00847842,version1-24Jul2013 #12

Boyer, Edmond


alpha-amylase and Glucose Oxidase as Promising Improvers for Wheat Bread  

Science Journals Connector (OSTI)

The effects of alpha-amylase and glucose oxidase as bread improvers on the textural and thermal properties of bread were evaluated by the rapid viscosity analysis and differential scanning calorimetry. It was found that alpha-amylase and glucose oxidase ... Keywords: alpha-amylase, Glucose oxidase, viscosity, Bread quality

Jie Zeng; Haiyan Gao; Guanglei Li; Xinhong Liang



The Roles of Testosterone and Alpha-Amylase in Exercise-Induced Sexual Arousal in Women  

E-Print Network (OSTI)

The Roles of Testosterone and Alpha-Amylase in Exercise-Induced Sexual Arousal in Women Lisa Dawn EA, and Meston CM. The roles of testosterone and alpha-amylase in exercise-induced sexual arousal; Alpha-Amylase Introduction Dynamic, cardiovascular exercise has many well-documented health benefits

Meston, Cindy

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.  

Science Journals Connector (OSTI)

...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...metabolism Amylopectin metabolism Amylose metabolism...Extracellular Alpha- Amylase from Bacteroides...

S J McWethy; P A Hartman



Measurement of the CKM angle alpha with the B-factories  

E-Print Network (OSTI)

B-meson decays involving b->u transitions are sensitive to the Unitarity Triangle angle alpha (or phi_2). The B-factories at SLAC and KEK have made significant progress toward the measurement of alpha in recent years. This paper summarizes the results of the B-factories' constraints on alpha.

A. Bevan



Direct study of the alpha-nucleus optical potential at astrophysical energies using the 64Zn(p,alpha)61Cu reaction  

E-Print Network (OSTI)

In the model calculations of heavy element nucleosynthesis processes the nuclear reaction rates are taken from statistical model calculations which utilize various nuclear input parameters. It is found that in the case of reactions involving alpha particles the calculations bear a high uncertainty owing to the largely unknown low energy alpha-nucleus optical potential. Experiments are typically restricted to higher energies and therefore no direct astrophysical consequences can be drawn. In the present work a (p,alpha) reaction is used for the first time to study the alpha-nucleus optical potential. The measured 64Zn(p,alpha)61Cu cross section is uniquely sensitive to the alpha-nucleus potential and the measurement covers the whole astrophysically relevant energy range. By the comparison to model calculations, direct evidence is provided for the incorrectness of global optical potentials used in astrophysical models.

Gyrky, Gy; Halsz, Z; Kiss, G G; Szcs, T



Small-Molecule Inhibition of TNF-alpha  

NLE Websites -- All DOE Office Websites (Extended Search)

Small-Molecule Inhibition of TNF-alpha Tumour necrosis factor is a polypeptide cytokine involved in inflammation and the acute phase response. TNF-alpha is present in larger quantities in persons with rheumatoid arthritis or Crohn's disease. Direct inhibition of TNF-a by the commercial biological agents etanercept (Enbrel), infliximab (Remicade), adalimumab (Humira), has produced significant advances in rheumatoid arthritis treatment and validated the extra-cellular inhibition of this proinflammatory cytokine as an effective therapy. However, despite considerable incentives, viable leads for analogous small-molecule inhibitors of TNF-a have not been reported (1). Such drugs with attendant advantages in manufacturing, patient accessibility, administration, and compliance would represent a major advance in the treatment of TNF-a mediated diseases.


Anomalous loss of DT alpha particles in the Tokamak Fusion Test Reactor  

SciTech Connect

An escaping alpha collector probe has been developed for TFTR`s DT phase. Energy distributions of escaping alphas have been determined by measuring the range of {alpha}-particles implanted into nickel foils located within the alpha collector. Results at 1.0 MA of plasma current are in good agreement with predictions for first orbit alpha loss. Results at 1.8 MA, however, show a significant anomalous loss of partially thermalized alphas (in addition to the expected first orbit loss), which is not observed with the lost alpha scintillator detectors in DT plasmas, but does resemble the anomalous delayed loss seen in DD plasmas. None of the candidate explanations proposed thus far are fully consistent with the anomalous loss observations. An experiment designed to study the effect of plasma major radius shifts on {alpha}-particle loss has led to a better understanding of {alpha}-particle dynamics in tokamaks. Intuitively, one might suppose that confined marginally passing {alpha}-particles forced to move toward higher magnetic field during an inward major radius shift (i.e., compression) would mirror and become trapped particles, leading to increased alpha loss. Such an effect was looked for during the shift experiment, however, no significant changes in alpha loss to the 90{degree} lost alpha scintillator detector were observed during the shifts. It is calculated that the energy gained by an {alpha}-particle during the inward shift is sufficient to explain this result. However, an unexpected loss of partially thermalized {alpha}-particles near the passing/trapped boundary was observed to occur between inward and outward shifts at an intermediate value of plasma current (1.4 MA). This anomalous loss feature is not yet understood.

Herrmann, H.W.



Measurement of the CKM angle phi2 (alpha)  

E-Print Network (OSTI)

We present recent measurements of the unitarity triangle angle phi2(alpha) using B -> pi pi, B -> rho rho, and B -> rho pi decays. The measurements are based on data samples collected with the Belle and BaBar detectors at the KEKB and PEP-II e+e- colliders, respectively. We also report on a new measurement of a CP-violating asymmetry in B -> a_1+ pi- decay which will allow to constrain further the angle phi2.

A. Somov



Automatic alpha-track counting with image analysis systems  

E-Print Network (OSTI)

of Advisory Committee: Dr. Milton E. McLain Integrated measurements of radon gas concentrations in the air environment have been performed in recent years due to dosimetric concerns of the radioactive substance. Proper evaluation of the dose received from... radon, primarily to the lung of the exposed individual, requires accurate measurement of concentrations present in the atmosphere. In response, this project was undertaken to further improve alpha track measurement techniques currently in place...

Shymanski, Michael Joseph



Michrochannel plate for position sensitive alpha particle detection  

SciTech Connect

This paper will describe the use of a microchannel plate (MCP) as the associated particle detector on a sealed tube neutron generator. The generator produces neutrons and associated alpha particles for use as a probe to locate and identify hidden explosives in associated particle imaging (API). The MCP measures the position in two dimensions and precise timing of the incident alpha particle, information which is then used to calculate the emission time and direction of the corresponding neutron. The MCP replaces the position-sensitive photomultipler tube (PSPMT) which, until recently, had been the only detector available for measuring position and timing for alpha particles in neutron generator applications. Where the PSPMT uses charge division for generating position information, a process that requires a first order correction to each pulse, the MCP uses delay-line timing, which requires no correction. The result is a device with an order of magnitude improvement in both position resolution and timing compared to the PSPMT. Hardware and software development and the measurements made to characterize the MCP for API applications are described.

Paul Hurley and James Tinsley



State-of-the-Art Predictions for C-parameter and a Determination of alpha_s  

E-Print Network (OSTI)

The C-parameter event-shape distribution for e+e- annihilation into hadrons is computed in the framework of SCET including input from fixed-order perturbation theory. We calculate all missing ingredients for achieving N3LL resummation accuracy in the cross section, which is then matched onto O(alpha_s^3) fixed-order results. Hadronization power corrections are incorporated as a convolution with a nonperturbative shape function. Wide-angle soft radiation effects introduce an O(Lambda_QCD) renormalon ambiguity in the cross section, which we cure by switching to the Rgap short-distance scheme. We also include hadron mass effects, but find their effect is rather small. Performing fits to the tail of the C-parameter distribution for many center of mass energies we find that the strong coupling constant is alpha_s(mZ) = 0.1123 +-0.0015, with chi^2/dof=0.99.

Hoang, Andre H; Mateu, Vicent; Stewart, Iain W



K{alpha} satellite transitions in elements with 12{<=}Z{<=}30 produced by electron incidence  

SciTech Connect

The emission of x-ray satellite lines in the K{alpha} region of Mg, Si, Sc, Ti, Cr, Fe, Ni, and Zn induced by electron incidence was studied by means of wavelength dispersive spectroscopy. The satellite lines studied were K{alpha}{sup '}, K{alpha}{sub 3}, K{alpha}{sub 4}, K{alpha}{sub 5}, K{alpha}{sub 6}, and two transitions denoted here as K{alpha}{sub 22} and K{alpha}{sub 12}. Energy shifts with respect to the main K{alpha}{sub 1} diagram line and transition probabilities relative to the whole K{alpha} group were determined for a number of lines through a careful spectral processing. The dependence of these parameters, as well as of the K{beta}:K{alpha} intensity ratio, on the atomic number was compared with previous experimental and theoretical determinations when available. A discussion about the different mechanisms responsible for vacancy creation involved in the production of double-ionization satellites was performed in the light of the results obtained. Finally, the behavior of the satellite intensities as a function of the incidence energy was discussed for silicon.

Limandri, Silvina P.; Carreras, Alejo C.; Trincavelli, Jorge C. [Instituto de Fisica Enrique Gaviola, Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Facultad de Matematica, Astronomia y Fisica, Universidad Nacional de Cordoba, Cordoba (Argentina); Bonetto, Rita D. [Centro de Investigacion y Desarrollo en Ciencias Aplicadas Dr. Jorge Ronco (CINDECA), Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Facultad de Ciencias Exactas, Facultad de Ingenieria, Universidad Nacional de La Plata, La Plata (Argentina)



Questions and Answers - What are alpha rays? How are they produced?  

NLE Websites -- All DOE Office Websites (Extended Search)

Why do we use radioactivityto destroy cancers? Why do we use radioactivity<br>to destroy cancers? Previous Question (Why do we use radioactivity to destroy cancers?) Questions and Answers Main Index Next Question (What is an alpha particle?) What is an alpha particle? What are alpha rays? How are they produced? Alpha "rays" are actually high speed particles. Early researchers tended to refer to any form of energetic radiation as rays, and the term is still used. An alpha particle is made up of two protons and two neutrons, all held together by the same strong nuclear force that binds the nucleus of any atom. In fact, an alpha particle really is a nucleus - it's the same as the nucleus of a common atom of helium - but it doesn't have any electrons around it, and it's traveling very fast. Alpha particles are a type of


Synthesis and evaluation of novel [alpha]-heteroaryl-phenylpropanoic acid derivatives as PPAR[alpha/gamma] dual agonists  

SciTech Connect

The synthesis of a new series of phenylpropanoic acid derivatives incorporating an heteroaryl group at the {alpha}-position and their evaluation for binding and activation of PPAR{alpha} and PPAR{gamma} are presented in this report. Among the new compounds, (S)-3-{l_brace}4-[3-(5-methyl-2-phenyl-oxazol-4-yl)-propyl]-phenyl{r_brace}-2-1,2,3-triazol-2-yl-propionic acid (17j), was identified as a potent human PPAR{alpha}/{gamma} dual agonist (EC{sub 50} = 0.013 and 0.061 {micro}M, respectively) with demonstrated oral bioavailability in rat and dog. 17j was shown to decrease insulin levels, plasma glucose, and triglycerides in the ZDF female rat model. In the human apolipoprotein A-1/CETP transgenic mouse model 17j produced increases in hApoA1 and HDL-C and decreases in plasma triglycerides. The increased potency for binding and activation of both PPAR subtypes observed with 17j when compared to previous analogs in this series was explained based on results derived from crystallographic and modeling studies.

Casimiro-Garcia, Agustin; Bigge, Christopher F.; Davis, Jo Ann; Padalino, Teresa; Pulaski, James; Ohren, Jeffrey F.; McConnell, Patrick; Kane, Christopher D.; Royer, Lori J.; Stevens, Kimberly A.; Auerbach, Bruce; Collard, Wendy; McGregor, Christine; Song, Kun; Pfizer



Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor  

SciTech Connect

Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))



Organization Advisor Type Name Email Address Alpha Delta Pi Chapter Advisor Allison Thompson aburkethompson@hotmail.com  

E-Print Network (OSTI)

Organization Advisor Type Name Email Address Alpha Delta Pi Chapter Advisor Allison Thompson aburkethompson@hotmail.com Alpha Delta Pi On-Campus Advisor Kendra Stewart stewartk@cofc.edu Alpha Epsilon Pi Chapter Advisor Andrew London andrewlondon@london.com Alpha Epsilon Pi On-Campus Advisor Marsha Alterman

Young, Paul Thomas


Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}  

SciTech Connect

Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

Tsukasaki, Masayuki [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Aizawa, Ryo [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan) [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyazono, Agasa [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Morimura, Naoko [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan)] [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)



Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein  

SciTech Connect

Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (United States))



Role of Hepatocyte Nuclear Factor 4 alpha in Hepatocyte Proliferation  

E-Print Network (OSTI)

-binding domain and the ligand-binding domain for proper binding of HNF4? to its response elements. A lack of the ligand-binding domain can reduce the affinity of HNF4? for its response elements by 75-fold (Chandra, Huang et al. 2013). HNF4?s ligand..., 2013, with permission from American Physiological Society. Hepatology, 57(3): 2480-2490, Hepatocyte Nuclear Factor 4 alpha Deletion Promotes Diethylnitrosamine-induced Hepatocellular Carcinoma in Rodents, 2013, with permission from John Wiley & Sons...

Walesky, Chad Michael



Measurement of the CKM Angle Alpha at BaBar  

SciTech Connect

We present BABAR experiment studies to measure the CKM angle {alpha} of the Unitarity Triangle. The measurements are based on the B meson decays into the two-body state ({pi}{pi}), the quasi two-body state ({rho}{rho}), and the three-body state ({pi}{sup +}{pi}{sup -}{pi}{sup 0}). The results are obtained from data samples of about 230 million {Upsilon}(4S) {yields} B{bar B} decays collected between 1999 and 2004 with the BABAR detector at the PEP-II asymmetric-energy B Factory at SLAC.

Yeche, C.; /Saclay



Subthreshold K+ production in deuteron and alpha induced nuclear reactions  

E-Print Network (OSTI)

Double differential cross sections have been measured for pi+ and K+ emitted around midraidity in d+A and He+A collisions at a beam kinetic energy of 1.15 GeV/nucleon. The total pi+ yield increases by a factor of about 2 when using an alpha projectile instead of a deuteron whereas the K+ yield increases by a factor of about 4. According to transport calculations, the K+ enhancement depends both on the number of hadron-hadron collisions and on the energy available in those collisions: their center-of-mass energy increases with increasing number of projectile nucleons.

M. Debowski; P. Senger; M. Boivin; Y. LeBornec; P. Courtat; R. Gacougnolle; E. Grosse; S. Kabana; T. Kirchner; P. Koczon; M. Mang; E. Schwab; B. Tatischeff; A. Wagner; W. Walus; N. Willis; G. Wolf; R. Wurzinger; J. Yonnet



Alpha Decay of the Isomers of Fr214  

Science Journals Connector (OSTI)

Alpha decay from the ground state and an isomeric state of Fr214 has been observed. The ground state has a half-life of 5.00.2 msec, and the isomeric state, 3.350.05 msec, at an excitation energy of 123 keV. A level scheme for At210 based on several ? transitions observed is presented. The similarity of the energy levels of Bi208 with those of At210 suggests that the addition of a proton pair to Bi208 does not significantly alter the nature of the particle-hole interactions observed for Bi208.

David F. Torgerson; Richard A. Gough; Ronald D. Macfarlane


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TRU ALPHA LLWT TRU ALPHA LLWT Project CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Safety Basis portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Conduct of Operations - Oak Ridge National Laboratory TRU ALPHA LLWT


V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: EMC AlphaStor Command Injection and Format String Flaws Let 5: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code January 23, 2013 - 12:26am Addthis PROBLEM: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code PLATFORM: EMC AlphaStor 4.0 prior to build 800 (All platforms) ABSTRACT: Two vulnerabilities were reported in EMC AlphaStor. REFERENCE LINKS: ESA-2013-008: SecurityTracker Alert ID: 1028020 Secunia Advisory SA51930 CVE-2013-0928 CVE-2013-0929 IMPACT ASSESSMENT: Medium DISCUSSION: A remote user can send a specially crafted DCP run command to inject commands and cause the Device Manager (rrobotd.exe) to execute arbitrary code on the target system [CVE-2013-0928].


V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: EMC AlphaStor Command Injection and Format String Flaws Let 5: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code January 23, 2013 - 12:26am Addthis PROBLEM: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code PLATFORM: EMC AlphaStor 4.0 prior to build 800 (All platforms) ABSTRACT: Two vulnerabilities were reported in EMC AlphaStor. REFERENCE LINKS: ESA-2013-008: SecurityTracker Alert ID: 1028020 Secunia Advisory SA51930 CVE-2013-0928 CVE-2013-0929 IMPACT ASSESSMENT: Medium DISCUSSION: A remote user can send a specially crafted DCP run command to inject commands and cause the Device Manager (rrobotd.exe) to execute arbitrary code on the target system [CVE-2013-0928].


Alpha-decay Rates of Yb and Gd in Solar Neutrino Detectors  

E-Print Network (OSTI)

The $\\alpha$-decay rates for the nuclides $^{168,170,171,172,173,174,176}$Yb and $^{148,150,152,154}$Gd have been estimated from transmission probabilities in a systematic $\\alpha$-nucleus potential and from an improved fit to $\\alpha$-decay rates in the rare-earth mass region. Whereas ${\\alpha}$-decay of $^{152}$Gd in natural gadolinium is a severe obstacle for the use of gadolinium as a low-energy solar-neutrino detector, we show that ${\\alpha}$-decay does not contribute significantly to the background in a ytterbium detector. An extremely long ${\\alpha}$-decay lifetime of $^{168}$Yb is obtained from calculation, which may be close to the sensitivity limit in a low-background solar neutrino detector.

M. Fujiwara; T. Kawabata; P. Mohr



Alpha particle cluster states in fp-shell nuclei  

Science Journals Connector (OSTI)

Alpha particle cluster structure is known experimentally to persist throughout the mass range 16?A?20, and has been very successfully described in this region in terms of the Buck-Dover-Vary local potential cluster model. It is argued that an analogous cluster structure should be present in nuclei at the beginning of the fp shell, and the available experimental data are examined to determine likely alpha particle cluster state candidates in the mass range 40?A?44. Calculations of the cluster state spectra and mean square cluster-core separation distances (which may be readily used to evaluate E2 electromagnetic transition rates) for Ca40, Ca42, Sc42, Sc43, Ti43, and Ti44 using the above-mentioned model are presented, and compared with experimental measurements where possible. The agreement between theory and experiment is generally good (although inferior to that obtained in the sd shell), and points to the desirability of an extension and improvement of the measurements of the properties of the excited states in these nuclei.

A. C. Merchant



The impact of alpha/Fe enhanced stellar evolutionary tracks on the ages of elliptical galaxies  

E-Print Network (OSTI)

We complement our study of alpha/Fe enhanced stellar population models of Lick absorption indices (Thomas et al. 2003) by comparing two sets of alpha/Fe enhanced models. In both models the impact on Lick indices due to alpha/Fe enhancement is accounted for through a modification of the stellar absorption line-strengths using the response functions of Tripicco & Bell (1995). One set of models, however, uses solar-scaled, the other alpha/Fe enhanced stellar evolutionary tracks. Since the alpha/Fe enhanced tracks are hotter than the solar-scaled ones (Salasnich et al. 2000), the correspondent stellar population models have slightly weaker metallic indices (i.e. Mgb, etc.) and stronger Balmer line indices (Hbeta) (Maraston et al 2003). Here we explore quantitatively the impact of this effect on the alpha/Fe ratios, metallicities and ages that are derived for elliptical galaxies. We find that the modest decrease of the metallic indices Mgb and balance each other, such that fully consistent alpha/Fe ratios are derived for stellar systems using alpha/Fe enhanced models with either solar-scaled or alpha/Fe enhanced stellar tracks. The decrease of the metallic indices and the increase of Hbeta conspire in a way that also consistent metallicities are obtained. The derived ages, instead, are significantly different. The inclusion of alpha/Fe enhanced stellar tracks leads to the derivation of ages as high as 30 Gyr for elliptical galaxies. For the same objects, ages not older than 15 Gyr are obtained, if alpha/Fe enhanced models using solar-scaled tracks are adopted. This may indicate that current stellar evolutionary models overestimate the bluing of stellar evolutionary tracks due to alpha/Fe enhanced chemical mixtures at super-solar metallicities.

Daniel Thomas; Claudia Maraston



E-Print Network 3.0 - alpha-helical protein backbones Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

features (alpha helices hydrophobic or amphipathic) 12;Hydropathy plots... 12;From micro to nano 12;Ribosome makes proteins 12;From ribosome to 3D- Protein ... Source:...


E-Print Network 3.0 - alpha -hydroxy-5 cap Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

36 Relations between PET-derived measures of thalamic glucose metabolism and EEG alpha power Summary: Relations between PET-derived measures of thalamic glucose metabolism and...


E-Print Network 3.0 - alpha transitions producing Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Associazione Euratom-ENEA sulla Fusione ENEA C.R. Frascati Collection: Plasma Physics and Fusion 22 Alpha-Investing Sequential Control of Expected False Discoveries Summary: them...


E-Print Network 3.0 - alpha sources Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Imre Pzsit and Andreas Enqvist... (Rossi-alpha) methods, are used to determine the subcritical reactivity of the system. Although Source: Pzsit, Imre - Department of Reactor...


E-Print Network 3.0 - alpha compact lithotriptor Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

or the correlation... (Rossi-alpha) methods, are used to determine the subcritical reactivity of the system. Although Source: Pzsit, Imre - Department of Reactor...


E-Print Network 3.0 - alpha feto protein Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Online Material This supplement contains Summary: binding protein, putative CNG03730 alpha-amylase, putative CNC01390 peptide-N4-(N... , putative CNA05310 expressed protein...


Alpha-amylase inhibitor changes during processing of sweet potato and taro tubers  

Science Journals Connector (OSTI)

Alpha-amylase inhibitor changes during processing ofsweet potatoes (Ipomoea batatas) and taro (Colocasia esculenta...)indicated that varietal differences profoundly influence the thermalinactivation profile. The ...

M.R. Rekha; G. Padmaja



E-Print Network 3.0 - alpha-amylase inhibitor peptide Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

peptide Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-amylase inhibitor peptide Page: << < 1 2 3 4 5 > >> 1 Inferring Functional...


E-Print Network 3.0 - alpha synuclein induced Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

synuclein induced Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha synuclein induced Page: << < 1 2 3 4 5 > >> 1 The Aggregation and...


E-Print Network 3.0 - alpha-deuterium isotope effects Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

deuterium isotope effects Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-deuterium isotope effects Page: << < 1 2 3 4 5 > >> 1 ISOTOPE...


E-Print Network 3.0 - alpha7-nicotinic acetylcholine receptor...  

NLE Websites -- All DOE Office Websites (Extended Search)

lpyridazine-3-yloctahydropyrrolo3,4-c 11CA-582941 Summary: .B. Mikkelsen J.D. Cognitive improvement by activation of alpha7 nicotinic acetylcholine receptors: from...


E-Print Network 3.0 - alpha interacting tip60 Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Nitrocellulose Summary: the interaction of transferred receptor proteins with a polypep- tide ligand. We chose alpha... . Characterization of the Interaction of...


E-Print Network 3.0 - activated receptor alpha Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

C colon CA cholic acid CAR constitutive activeandrostane receptor CDCA... jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...


E-Print Network 3.0 - anti-il-2 receptor alpha Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Collection: Mathematics 2 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - alpha 2b-adrenergic receptor Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Biology and Medicine 5 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...


E-Print Network 3.0 - alpha administration zmiany Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Stetson University Collection: Mathematics 49 WilkersonSt University Dr Summary: Rd Four Towers New East Campus Parking Deck Aluxiliary Services Alpha Chi Omega Spec Towns Track...


E-Print Network 3.0 - alpha-induced nuclear reactions Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

nuclear reactions Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-induced nuclear reactions Page: << < 1 2 3 4 5 > >> 1 Scintillation of...


E-Print Network 3.0 - alpha phase predicts Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

enic instabilities driven by fusion- produced alpha particles is investigated by hybrid MHD-particle simulations... rates are quite small. The effects of nonlinear mode dynamics...


E-Print Network 3.0 - alpha coding sequence Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

will generate conservative Alpha code sequences for unaligned memory access. If the profile does not indicate... Pentium or a 200-MHz Pentium Pro when executing translated...


E-Print Network 3.0 - alpha 2-macroglobulin implications Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

receptor-associated protein. Proc. Natl... Tigue, K., Battey, J.F., and Argraves, W.S. (1991). Primary struc- ture of alpha 2-macroglobulin receptor... residues on...


E-Print Network 3.0 - alpha class glutathione Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

the Detoxification of 2-Phenylpropenal, a Reactive Summary: of the genotoxic aldehyde acrolein by human glutathione transferases of classes alpha, pi, and mu. Mol. Pharmacol......


E-Print Network 3.0 - alpha induced reactions Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

production balances the various energy losses and the fusion reaction is self-sustaining. The product ions... (alpha particles in the case of a deuterium-tritium plasma)...


E-Print Network 3.0 - alpha particle degradation Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

24 James W. Van Dam US Burning Plasma Organization Summary: dominantly self-heated by fusion products (e.g., alpha particles) from thermonuclear reactions in the plasma......


E-Print Network 3.0 - alpha particle destabilization Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

26 James W. Van Dam US Burning Plasma Organization Summary: dominantly self-heated by fusion products (e.g., alpha particles) from thermonuclear reactions in the plasma......


E-Print Network 3.0 - alpha1-proteinase inhibitor api Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

api Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha1-proteinase inhibitor api Page: << < 1 2 3 4 5 > >> 1 Protease Inhibitors -Application...


E-Print Network 3.0 - alpha angle measurement Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

9 Calibration of the University of North Dakota's Citation Summary: Measurement Unit 12;12;Calibration Procedure Heading Angle Offset Alpha Angle Calibration Beta...


E-Print Network 3.0 - alpha satellite subset Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

and Astronautics, Massachusetts Institute of Technology (MIT) Collection: Engineering 40 WIND Measurements of Proton and Alpha Particle Flow and Number Density J. T. Steinberg...


E-Print Network 3.0 - ancestral alpha satellites Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

College London Collection: Environmental Sciences and Ecology ; Biology and Medicine 30 WIND Measurements of Proton and Alpha Particle Flow and Number Density J. T. Steinberg...


E-Print Network 3.0 - alpha-voltaic power source Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Albuquerque, New Mexico, January 2000 Miniaturized Radioisotope Solid State Power Sources Summary: for an alpha-voltaic or a hybrid thermoelectricalpha-voltaic power...


E-Print Network 3.0 - alpha-recoil damaged minerals Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary: ... 7.1 7.1.2 Alpha-Recoil and Uranium Series Disequilibrium... (VI) in the Hanford subsurface is retarded by both...


Comparison of MCNP6 and experimental results for neutron counts, Rossi-{alpha}, and Feynman-{alpha} distributions  

SciTech Connect

MCNP6, the general-purpose Monte Carlo N-Particle code, has the capability to perform time-dependent calculations by tracking the time interval between successive events of the neutron random walk. In fixed-source calculations for a subcritical assembly, the zero time value is assigned at the moment the neutron is emitted by the external neutron source. The PTRAC and F8 cards of MCNP allow to tally the time when a neutron is captured by {sup 3}He(n, p) reactions in the neutron detector. From this information, it is possible to build three different time distributions: neutron counts, Rossi-{alpha}, and Feynman-{alpha}. The neutron counts time distribution represents the number of neutrons captured as a function of time. The Rossi-a distribution represents the number of neutron pairs captured as a function of the time interval between two capture events. The Feynman-a distribution represents the variance-to-mean ratio, minus one, of the neutron counts array as a function of a fixed time interval. The MCNP6 results for these three time distributions have been compared with the experimental data of the YALINA Thermal facility and have been found to be in quite good agreement. (authors)

Talamo, A.; Gohar, Y. [Argonne National Laboratory, 9700 S. Cass Ave., Lemont, IL 60439 (United States); Sadovich, S.; Kiyavitskaya, H.; Bournos, V.; Fokov, Y.; Routkovskaya, C. [Joint Institute for Power and Nuclear Research-Sosny, 99 Academician A.K. Krasin Str., Minsk 220109 (Belarus)



Semiautomatic technique for defining the internal gross tumor volume of lung tumors close to liver/spleen cupola by 4D-CT  

SciTech Connect

Purpose: It has been shown that in cases of lung tumors close to the liver cupola, the four dimensional (4D)-CT postprocessing maximum intensity projection (MIP) algorithm does not fully recover the radiotherapy internal gross tumor volume (IGTV). In this work, a semiautomatic technique was evaluated by which the residual IGTV that was not included into the IGTV by MIP algorithm was actually added. Methods: A moving phantom and five selected patients were considered. The various IGTVs produced by the semiautomatic approach were compared to those generated by 4D-CT manual contouring. Results: In all cases, the radiation oncologist qualitatively concurred with the semiautomatic IGTV. A quantitative difference in volume of 2.6% was found in the phantom study, whereas a mean difference of 0.1{+-}4.6% was obtained in the patient studies. Conclusions: A semiautomatic technique to include the residual part of IGTV covered by liver/spleen cupola when using MIP algorithm was validated on phantom and on selected patients, revealing the possibility of defining the IGTV for patients with lesions located near liver/spleen cupola by performing only the contours on the MIP series.

Mancosu, Pietro; Sghedoni, Roberto; Bettinardi, Valentino; Aquilina, Mark Anthony; Navarria, Piera; Cattaneo, Giovanni Mauro; Di Muzio, Nadia; Cozzi, Luca; Scorsetti, Marta [Department of Radiotherapy, IRCCS Istituto Clinico Humanitas, Rozzano, 20089 Milano (Italy); Department of Medical Physics, Arcispedale S. Maria Nuova, Reggio, 42100 Emilia (Italy); Department of Nuclear Medicine, Scientific Institute H. S. Raffaele, 20089 Milan (Italy); Department of Radiotherapy, IRCCS Istituto Clinico Humanitas, 20089 Rozzano, Milano (Italy); Department of Medical Physics, San Raffaele Scientific Institute, 20133 Milan (Italy); Department of Radiotherapy, San Raffaele Scientific Institute, 20133 Milan (Italy); Medical Physics Unit, Oncology Institute of Southern Switzerland, 6504 Bellinzona (Switzerland); Department of Radiotherapy, IRCCS Istituto Clinico Humanitas, 20089 Rozzano, Milano (Italy)



Relationships among oil density, gross composition, and thermal maturity indicators in northeastern Williston basin oils and their significance for expulsion thresholds and migration pathways  

SciTech Connect

Oil density ({degree}API), gross composition, and biological market thermal maturity variations in northeastern Williston basin have stratigraphic and geographic significance controlled by migration pathways and source rock composition as it affects hydrocarbon generation and expulsion characteristics. When the depth and density of oil pools is compared to relationships predicted using the correlation between source rock thermal maturity and oil density, several different migration pathways can be inferred. Winnipegosis source oils indicate four paths. Most small pinnacle reef pools are sourced locally, but larger coalesced reefs contain oils migrated long distances through the Lower Member Winnipegosis Formation. Among oils that have migrated past Prairie salts, both locally sourced oils, like those on the flank of the Hummingbird Trough, and more mature, longer migrated oils in Saskatchewan Group reservoirs can be identified. Bakken oils have the longest migration pathways, controlled primarily by a lowstand shoreline sandstone on the eastern side of the basin. Lodgepole-sourced oils dominate Madison Group plays. Northwest of Steelman field, oil density increases primarily due to thermal maturity differences but also because of increasing biodegradation and water-washing that affect the western edge of the play trend. Along the margin of the Hummingbird Trough are a number of deep, medium-gravity pools whose oil compositions are entirely attributable to low thermal maturity and local migration pathways.

Osadetz, K.G.; Snowdon, L.R.; Brooks, P.W. (Geological Survey of Canada, Calgary, Alberta (Canada))



working lunch menus prices excludes VAT  

E-Print Network (OSTI)

person +2 items £12.50 per person +3 items £15.00 per person +4 items £17.50 per person meat » mini pie with a coconut dipping sauce » all butter pastry mini sausage roll » traditional melton mowbray pork pie » scotch

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Possible Draft HAB Comments for  

NLE Websites -- All DOE Office Websites (Extended Search)

analysis are all of the co-extracted contaminants of concern. Antimony, arsenic, cadmium, carbon tetrachloride, chloroform, cobalt, copper, fluoride, gross alpha, gross beta, iron,...


Properties of planar Nb/{alpha}-Si/Nb Josephson junctions with various degrees of doping of the {alpha}-Si layer  

SciTech Connect

The properties of Nb/{alpha}-Si/Nb planar Josephson junctions with various degrees of doping of the amorphous silicon layer are experimentally studied. Tungsten is used as a doping impurity. The properties of the Josephson junctions are shown to change substantially when the degree of doping of the {alpha}-Si layer changes: a current transport mechanism and the shape of the current-voltage characteristic of the junctions change. Josephson junctions with SNS-type conduction are formed in the case of a fully degenerate {alpha}-Si layer. The properties of such junctions are described by a classical resistive model. Josephson junctions with a resonance mechanism of current transport through impurity centers are formed at a lower degree of doping of the {alpha}-Si layer. The high-frequency properties of such junctions are shown to change. The experimental results demonstrate that these junctions are close to SINIS-type Josephson junctions.

Gudkov, A. L., E-mail: gudkov@niifp.ru [Lukin Scientific Research Institute of Physical Problems, ZAO Kompelst (Russian Federation); Kupriyanov, M. Yu. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation); Samus', A. N. [Lukin Scientific Research Institute of Physical Problems, ZAO Kompelst (Russian Federation)



Search for Antimatter in Space with the Alpha Magnetic Spectrometer  

E-Print Network (OSTI)

The Alpha Magnetic Spectrometer (AMS) is a state of the art particle physics experiment for the extraterrestrial study of antimatter, matter and missing matter. AMS successfully completed the precursor STS91 Discovery flight (June 2nd-12th, 1998), completing 152 orbits at 52 degrees of latitude and about 400 km of height, collecting more than 100 million CR events. In this paper we report on the first flight experience and we present preliminary results on the search for nuclear antimatter. No antimatter nuclei with Z>=2 were detected. We obtain a model dependent upper limit on the anti-He /He flux 2, improving the results of previous published searches performed with stratospheric balloons.

Roberto Battiston



Reconciling steady-state Kalman and alpha-beta filter design  

E-Print Network (OSTI)

The deterministic design of the alpha-beta filter and the stochastic design of its Kalman counterpart are placed on a common basis. The first step is to find the continuous-time filter architecture which transforms into the alpha-beta discrete...

Painter, John H.; Kerstetter, D.; Jowers, S.


PPPL-2878 UC-426 February 1993 Tritium Diagnostics by Balmer-alpha Emission  

E-Print Network (OSTI)

PPPL-2878 UC-426 February 1993 Tritium Diagnostics by Balmer-alpha Emission C H Skinner, A T Ramsey emission from tritium in a plasma may be distinguished from deuterium emission by a small isotope shift. A diagnostic system to measure tritium Balmer-alpha emission from the plasma edge has been installed on TFTR


Alpha-ketoglutarate dehydrogenase: a target and generator of oxidative stress  

Science Journals Connector (OSTI)

...dehydrogenase: a target and generator of oxidative stress Laszlo...therefore could contribute to the induction of oxidative stress. This...nitration. 2. alpha-KGDH as a generator of oxidative stress It is...dehydrogenase: a target and generator of oxidative stress. | Alpha-ketoglutarate...



Haloalkaliphilic maltotriose-forming alpha-amylase from the archaebacterium Natronococcus sp. strain Ah-36.  

Science Journals Connector (OSTI)

...N-bromosuccinimide. The amylase hydrolyzed...starch, amylose, amylopectin, and, more...glucose of an alpha-configuration...substrate. The amylase hydrolyzed...N-bromosuccinimide. The amylase hydrolyzed...starch, amylose, amylopectin, and, more...glucose of an alpha-configuration...

T Kobayashi; H Kanai; T Hayashi; T Akiba; R Akaboshi; K Horikoshi




E-Print Network (OSTI)

Technical NoteFEASIBILITY STUDIES OF ALPHA-PARTICLE CHANNELING IN MIRROR MACHINES A. I. ZHMOGINOV such as mirror machines can benefit this concept by efficiently redirecting a-particle energy to fuel ion heating designs and for proof-of-principle experiments. KEYWORDS: alpha channeling, mirror machines, ray tracing


Clostridium perfringens Alpha-toxin Recognizes the GM1a-TrkA Complex*S  

E-Print Network (OSTI)

-toxin. Clostridiumperfringensalpha-toxinisthemajorvirulencefactor in the pathogenesis of gas gangrene. Alpha-toxin is a 43-kDa pro and induces a signal transduction cascade that promotes the release of chemokines. Therefore, we conclude, the pathogenic bacterium most widely distributed in nature (6), produces one PLC alpha-toxin that is highly cyto

Gleeson, Joseph G.


Ten channel background alpha radiometer for nondestructive analysis of low activity samples  

SciTech Connect

The description of a ten-channel alpha-radiometer based on large-area semiconductor detectors is presented in this paper. The radiometer is intended for determination of soil pollution by alpha-active radionuclides using thick samples. The analysis of isotopes is also provided. The concentrations of Pu and Am isotopes in soil samples are determined.

Pugatch, V.M.; Pavlenko, Y.N.; Vasiliev, Y.O.; Nenakhov, A.N.; Tkatch, N.M.; Barabash, L.I.; Berdnichenko, S.V.; Litovchenko, P.G.; Rosenfeld, A.B.; Zinets, O.S. (Inst. for Nuclear Research, Kiev (USSR))



Structural and Biophysical Studies of the Human IL-7/IL-7R[alpha] Complex  

SciTech Connect

IL-7 and IL-7R{alpha} bind the {gamma}{sub c} receptor, forming a complex crucial to several signaling cascades leading to the development and homeostasis of T and B cells. We report that the IL-7R{alpha} ectodomain uses glycosylation to modulate its binding constants to IL-7, unlike the other receptors in the {gamma}{sub c} family. IL-7 binds glycosylated IL-7R{alpha} 300-fold more tightly than unglycosylated IL-7R{alpha}, and the enhanced affinity is attributed primarily to an accelerated on rate. Structural comparison of IL-7 in complex to both forms of IL-7R{alpha} reveals that glycosylation does not participate directly in the binding interface. The SCID mutations of IL-7R{alpha} locate outside the binding interface with IL-7, suggesting that the expressed mutations cause protein folding defects in IL-7R{alpha}. The IL-7/IL-7R{alpha} structures provide a window into the molecular recognition events of the IL-7 signaling cascade and provide sites to target for designing new therapeutics to treat IL-7-related diseases.

McElroy, Craig A.; Dohm, Julie A.; Walsh, Scott T.R.; (OSU); (UPENN)



Is alpha-Pinene a Substrate for Permeability-Glycoprotein in Wood Rats?  

E-Print Network (OSTI)

Is alpha-Pinene a Substrate for Permeability- Glycoprotein in Wood Rats? Adam K. Green & Shannon L Media, Inc. 2006 Abstract alpha-Pinene is the dominant monoterpene in Juniperus monosperma. Wood rat generalist, and Sprague-Dawley rats, and (2) in Caco-2 cells that over express Pgp. We also measured Pgp

Mladenoff, David


Measurements of the Release of Alpha Quartz: A New Standard for Impedance-Matching Experiments  

SciTech Connect

Measurements of the release of alpha quartz into SiO2 aerogel are found to agree well with previous near-direct measurements for that aerogel Hugoniot. The results establish alpha quartz as an impedance-matching standard that, because of its transparency, enables higher-accuracy measurements and knowledge of the pressure profile in the pusher.

Boehly, T.R.; Miller, J.E.; Meyerhofer, D.D.; Eggert, J.H.; Celliers, P.M.; Hicks, D.G.; Collins, G.W.



EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak Ridge  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

05: Treating Transuranic (TRU)/Alpha Low-Level at the Oak 05: Treating Transuranic (TRU)/Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee SUMMARY This EIS evaluates DOE's proposal to construct, operate, and decontaminate/decommission a Transuranic (TRU) Waste Treatment Facility in Oak Ridge, Tennessee. The four waste types that would be treated at the proposed facility would be remote-handled TRU mixed waste sludge, liquid low-level waste associated with the sludge, contact-handled TRU/alpha low-level waste solids, and remote-handled TRU/alpha low-level waste solids. The mixed waste sludge and some of the solid waste contain metals regulated under the Resource Conservation and Recovery Act and may be


Building the bridge between Damped Ly-alpha Absorbers and Lyman Break galaxies  

E-Print Network (OSTI)

In 2000, we started the program ``Building the Bridge between Damped Ly-alpha Absorbers and Lyman-Break Galaxies: Ly-alpha Selection of Galaxies'' at the European Southern Observatory's Very Large Telescope. This project is an attempt to use Ly-alpha selection of high-z galaxies to bridge the gap between absorption- and emission-selected galaxies by creating a large database of z=3 galaxies belonging to the abundant population of faint (R>25.5) galaxies probed by the Damped Ly-alpha Absorbers (DLAs). Here we present the first results of our program, namely the results from a deep Ly-alpha study of the field of the z=2.85 DLA towards Q2138-4427.

J. P. U. Fynbo; C. Ledoux; P. Moller; B. Thomsen; I. Burud; B. Leibundgut



Calculating alpha Eigenvalues in a Continuous-Energy Infinite Medium with Monte Carlo  

SciTech Connect

The {alpha} eigenvalue has implications for time-dependent problems where the system is sub- or supercritical. We present methods and results from calculating the {alpha}-eigenvalue spectrum for a continuous-energy infinite medium with a simplified Monte Carlo transport code. We formulate the {alpha}-eigenvalue problem, detail the Monte Carlo code physics, and provide verification and results. We have a method for calculating the {alpha}-eigenvalue spectrum in a continuous-energy infinite-medium. The continuous-time Markov process described by the transition rate matrix provides a way of obtaining the {alpha}-eigenvalue spectrum and kinetic modes. These are useful for the approximation of the time dependence of the system.

Betzler, Benjamin R. [Los Alamos National Laboratory; Kiedrowski, Brian C. [Los Alamos National Laboratory; Brown, Forrest B. [Los Alamos National Laboratory; Martin, William R. [Los Alamos National Laboratory



Comparison of Rigid and Adaptive Methods of Propagating Gross Tumor Volume Through Respiratory Phases of Four-Dimensional Computed Tomography Image Data Set  

SciTech Connect

Purpose: To compare three different methods of propagating the gross tumor volume (GTV) through the respiratory phases that constitute a four-dimensional computed tomography image data set. Methods and Materials: Four-dimensional computed tomography data sets of 20 patients who had undergone definitive hypofractionated radiotherapy to the lung were acquired. The GTV regions of interest (ROIs) were manually delineated on each phase of the four-dimensional computed tomography data set. The ROI from the end-expiration phase was propagated to the remaining nine phases of respiration using the following three techniques: (1) rigid-image registration using in-house software, (2) rigid image registration using research software from a commercial radiotherapy planning system vendor, and (3) rigid-image registration followed by deformable adaptation originally intended for organ-at-risk delineation using the same software. The internal GTVs generated from the various propagation methods were compared with the manual internal GTV using the normalized Dice similarity coefficient (DSC) index. Results: The normalized DSC index of 1.01 {+-} 0.06 (SD) for rigid propagation using the in-house software program was identical to the normalized DSC index of 1.01 {+-} 0.06 for rigid propagation achieved with the vendor's research software. Adaptive propagation yielded poorer results, with a normalized DSC index of 0.89 {+-} 0.10 (paired t test, p <0.001). Conclusion: Propagation of the GTV ROIs through the respiratory phases using rigid- body registration is an acceptable method within a 1-mm margin of uncertainty. The adaptive organ-at-risk propagation method was not applicable to propagating GTV ROIs, resulting in an unacceptable reduction of the volume and distortion of the ROIs.

Ezhil, Muthuveni [Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States)], E-mail: veniezhil@hotmail.com; Choi, Bum; Starkschall, George [Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Bucci, M. Kara [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Vedam, Sastry; Balter, Peter [Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States)



Assessment of Gross Tumor Volume Regression and Motion Changes During Radiotherapy for Non-Small-Cell Lung Cancer as Measured by Four-Dimensional Computed Tomography  

SciTech Connect

Purpose: To investigate the magnitudes of the changes in mobility and volume of locally advanced non-small-cell lung cancer (NSCLC) tumors during radiotherapy, using four-dimensional computed tomography (4DCT). Methods and Materials: Five to ten 4DCT data sets were acquired weekly for each of 8 patients throughout treatment. Gross tumor volumes (GTVs) were outlined on each data set. Volumes and coordinates of the GTV centroids were calculated at the 0 (end-inspiration) and 50% (end-expiration) respiration phases. Trends in magnitudes of intrafraction and interfraction positional variations were assessed for the GTV and internal target volume (ITV) during treatment. Results: Tumor volume reduction ranged from 20% to 71% (end-inspiration) and from 15% to 70% (end-expiration). Increased tumor mobility was observed in the superior-inferior and anterior-posterior directions. However, no trends in tumor motion were observed. Motion along the superior-inferior direction was significantly greater (p < 0.001), with mean {+-} SD values of 0.86 {+-} 0.19 cm, as compared with 0.39 {+-} 0.08 cm and 0.19 {+-} 0.05 cm in the anterior-posterior and right-left directions, respectively. A marginally significant (p = 0.049) increase in total GTV positional variation was observed with increasing treatment weeks, and similar results were seen for the interfractional ITV mobility. Conclusions: Because of changes in tumor size and mobility, an explicit initial determination of the ITV may not be sufficient, especially where small setup margins are used. Repeat 4DCT scans might be warranted for highly mobile tumors to reduce the potential for missing the tumor.

Britton, Keith R. [Radiation Oncology Division, Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston TX (United States)]. E-mail: kbritton@mdanderson.org; Starkschall, George [Radiation Oncology Division, Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Tucker, Susan L. [Department of Biostatistics and Applied Mathematics, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Pan Tinsu [Department of Imaging Physics, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Nelson, Christopher [Radiation Oncology Division, Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Chang, Joe Y. [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Cox, James D. [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Mohan, Radhe [Radiation Oncology Division, Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston TX (United States); Komaki, Ritsuko [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston TX (United States)



Sound Propagation in Gross Mixtures  

Science Journals Connector (OSTI)

For low acoustic frequencies a mixture (a porous medium or a suspension) is shown to have an effective density which differs slightly from the density given by Archimedes' principle. This effective density is computed from a physically elementary consideration of viscous incompressible fluid flow. For higher frequencies pore or particle size in the mixture becomes comparable with the wavelength of shear waves in the fluid while still small compared with dilatational wavelength. The theory is extended to such frequencies through the known formula for the fluid's resistance to the oscillations of a rigid sphere. In both cases the effective compressibility of the mixture is taken to be the volume?average of the component compressibilities. From the effective density and compressibility the acoustic properties of the mixture are predicted. Predictions are compared with previous theories and with experimental results.

W. S. Ament



alpha-Amylase biosynthesis: signal sequence prevents normal conversion of the unprocessed precursor molecule to the biologically active form  

Science Journals Connector (OSTI)

alpha-Amylase biosynthesis: signal sequence prevents...processed and glycosylated form of alpha-amylase molecules. The two precursors as well...in the series "Enzymic mechanism of starch break- down in germinating rice seeds." Paper...

S Miyata; T Akazawa


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Daytime Secretion of Salivary Cortisol and Alpha-Amylase in Preschool-Aged Children with Autism and Typically Developing Children  

Science Journals Connector (OSTI)

We examined daytime salivary cortisol and salivary alpha-amylase (sAA) secretion levels and variability in...

Sharon A. Kidd; Blythe A. Corbett



Spatially Resolved Gas Kinematics within a Ly$\\alpha$ Nebula: Evidence for Large-scale Rotation  

E-Print Network (OSTI)

We use spatially extended measurements of Ly$\\alpha$ as well as less optically thick emission lines from an $\\approx$80 kpc Ly$\\alpha$ nebula at $z\\approx1.67$ to assess the role of resonant scattering and to disentangle kinematic signatures from Ly$\\alpha$ radiative transfer effects. We find that the Ly$\\alpha$, CIV, HeII, and CIII] emission lines all tell a similar story in this system, and that the kinematics are broadly consistent with large-scale rotation. First, the observed surface brightness profiles are similar in extent in all four lines, strongly favoring a picture in which the Ly$\\alpha$ photons are produced in situ instead of being resonantly scattered from a central source. Second, we see low kinematic offsets between Ly$\\alpha$ and the less optically thick HeII line ($\\sim$100-200 km s$^{-1}$), providing further support for the argument that the Ly$\\alpha$ and other emission lines are all being produced within the spatially extended gas. Finally, the full velocity field of the system shows cohe...

Prescott, Moire K M; Dey, Arjun



First-principles study of the crystal and electronic structures of {alpha}-tetragonal boron  

SciTech Connect

The crystal and electronic structures of {alpha}-tetragonal ({alpha}-t) boron were investigated by first-principles calculation. Application of a simple model assuming 50 atoms in the unit cell indicated that {alpha}-t boron had a metallic density of state, thus contradicting the experimental fact that it is a p-type semiconductor. The presence of an additional two interstitial boron atoms at the 4c site made {alpha}-t boron semiconductive and the most stable. The cohesive energy per atom was as high as those of {alpha}- and {beta}-rhombohedral boron, suggesting that {alpha}-t boron is produced more easily than was previously thought. The experimentally obtained {alpha}-t boron in nanobelt form had about two interstitial atoms at the 8i sites. We consider that the shallow potential at 8i sites generates low-energy phonon modes, which increase the entropy and consequently decrease the free energy at high temperatures. Calculation of the electronic band structure showed that the highest valence band had a larger dispersion from {Gamma} to Z than from {Gamma} to X; this indicated a strong anisotropy in hole conduction. - Graphical abstract: Calculated electron densities of B{sub 50} and B{sub 50}+2B at site 4c (configuration B).

Hayami, Wataru, E-mail: hayami.wataru@nims.go.j [Exploratory Nanomaterials Research Laboratory, National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Otani, Shigeki [Exploratory Nanomaterials Research Laboratory, National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan)



Measurement of the cross section of charmed hadrons and the nuclear dependence alpha  

SciTech Connect

With data from the SELEX experiment we study charm hadro-production. We report the differential production cross sections as function of the longitudinal and transverse momentum, as well as for two different target materials, of 14 charmed hadron and/or their decay modes. This is the most extensive study to date. SELEX is a fixed target experiment at Fermilab with high forward acceptance; it took data during 1996-1997 with 600 GeV/c {Sigma}{sup -} and {pi}{sup -}, and 540 GeV/c proton and {pi}{sup +} beams. It used 5 target foils (two copper and three diamond). We use the results to determine {alpha}, used in parametrizing the production cross section as {infinity} A{sup {alpha}}, where A is the mass number of the target nuclei. We found within our statistics that {alpha} is independent of the longitudinal momentum fraction x{sub F} in the interval 0.1 < x{sub F} < 1.0, with {alpha} = 0.778 {+-} 0.014. The average value of {alpha} for charm production by pion beams is {alpha}{sub meson} = 0.850 {+-} 0.028. This is somewhat larger than the corresponding average {alpha}{sub baryon} = 0.755 {+-} 0.016 for charm production by baryon beams ({Sigma}{sup -} and protons).

Blanco-Covarrubias, E.Alejandro; /San Luis Potosi U.



Kelvin--Helmholtz instability in solar H-alpha surges  

E-Print Network (OSTI)

We study the evolutionary conditions for Kelvin--Helmholtz (KH) instability in a H-alpha solar surge observed in NOAA AR 8227 on 1998 May 30. The jet with speeds in the range of 45--50 km/s, width of 7 Mm, and electron number density of 3.83 x 10^{10} cm^{-3} is assumed to be confined in a twisted magnetic flux tube embedded in a magnetic field of 7 G. The temperature of the plasma flow is of the order of 10^5 K while that of its environment is taken to be 2 x 10^6 K. The electron number density of surrounding magnetized plasma has a typical for the TR/lower corona region value of 2 x 10^{9} cm^{-3}. Under these conditions, the Alfven speed inside the jet is equal to 78.3 km/s. We model the surge as a moving magnetic flux tube for two magnetic field configurations: (i) a twisted tube surrounded by plasma with homogeneous background magnetic field, and (ii) a twisted tube which environment is plasma with also twisted magnetic field. The magnetic field twist in given region is characterized by the ratio of azim...

Zhelyazkov, I; Chandra, R; Srivastava, A K; Mishonov, T



Making Damped Lyman Alpha Systems in Semi-Analytic Models  

E-Print Network (OSTI)

The velocity profiles of weak metal absorption lines can be used to observationally probe the kinematic state of gas in damped Lyman-alpha systems. Prochaska and Wolfe have argued that the flat distribution of velocity widths combined with the asymmetric line profiles indicate that the DLAS are disks with large rotation velocities. An alternative explanation has been proposed by Haehnelt, Steinmetz, and Rauch, in which the observed large velocity widths and asymmetric profiles can be produced by lines of sight passing through two or more clumps each having relatively small internal velocity dispersions. We investigate the plausibility of this scenario in the context of semi-analytic models based on hierarchical merging trees and including simple treatments of gas dynamics, star formation, supernova feedback, and chemical evolution. We find that all the observed properties of the metal-line systems including the distribution of velocities and the asymmetric profiles, can be reproduced by lines of sight passing through sub-clumps that are bound within larger virialized dark matter halos. In order to produce enough multiple hits, we find that the cold gas must be considerably more extended than the optical radius of the proto-galaxies, perhaps even beyond the tidal radius of the sub-halo. This could occur due to tidal stripping or supernova-driven outflows.

Ariyeh H. Maller; Rachel S. Somerville; Jason X. Prochaska; Joel R. Primack



Performance of International Space Station Alpha electric power systems  

SciTech Connect

The International Space Station Alpha (ISSA) will be an Earth-orbiting laboratory in space. It will house experimental payloads, distribute resource utilities, and support human habitation for conducting research and science experiments in a microgravity environment. Electrical power is a major utility to support successful achievement of the mission goal. The ISSA United States On-Orbit Segment (USOS) Electric Power System (EPS) power generation capability will vary with orbital parameters, natural and induced environment, and hardware aging/replacement throughout the ISSA life. Power capability will be further restricted by various assembly configurations during ISSA buildup, by various flight attitudes, by shadowing on the solar arrays, by EPS operational constraints, such as pointing accuracy, battery charging, as well as operating voltage setpoints, and by ISSA operational constraints either to avoid long-term solar array shadowing from the adjacent solar array or to accommodate ISSA maneuver during proximity operations with other space vehicles, mating, and departing. Design of the ISSA USOS EPS takes into consideration the various equipment degradation modes, operation constraints, and orbital conditions to make it compatible with the environments and to meet power, lifetime, and performance requirements.

Hill, R.; Lu, C.Y.; Padhye, V.; Hajela, G.; Hague, L. [Rockwell International, Canoga Park, CA (United States). Rocketdyne Division



Shadow prediction model for the International Space Station Alpha  

SciTech Connect

A Fortran computer model, SHADOW5, was developed to predict shadows on the solar arrays of the International Space Station Alpha (ISSA) for general flight modes. This shadow model was incorporated into the EPSOP-F (Electrical Power System On-Orbit Performance) program to conduct ISSA power analyses for various operating conditions. This paper describes the mathematical methods of the model and shows the typical results predicted with the model. Vector analyses with coordinate transformations were used to trace the shadows between the potential shadowing and shadowed components of the station during the sun portion of the orbit. Including the space shuttle orbiter, 40 components were modeled. The basic shapes of the components were assumed to be either planar or cylindrical. The elemental areas obtained from the Cartesian grid lines allocated on the component surfaces were projected in the sun vector direction to reconstruct shadows on the shadowed planar surface. Comparison of predicted results with other models showed good agreement. Ease of preparing input data and relatively short CPU time make this model suitable for shadow analyses required for the many design and flight configurations of the space station.

Chung, D.K. [Rockwell International, Canoga Park, CA (United States). Rocketdyne Division




SciTech Connect

Chromospheric wave activity around flares and filaments has been a research focus for years, and could provide indirect measurements of local conditions that are not otherwise accessible. One interesting observed phenomenon is oscillations in filaments, activated by distant flares and the large-scale waves they produce. Characteristics of these oscillations, such as periods, amplitudes, and lifetimes, can provide unique information about the filament. We measure oscillation properties in flares and filaments from H{alpha} chromospheric data using a new method that provides important spatial and frequency content of the dynamics. We apply the method to two flare events where filaments are observed to oscillate and determine their properties. We find strong oscillatory signal in flaring active regions in the chromosphere over a range of frequencies. Two filaments are found to oscillate without any detectable chromospheric wave acting as an activation mechanism. We find that filaments oscillate with periods of tens of minutes, but variations are significant at small spatial scales along the filamentary region. The results suggest that there is a frequency dependence of the oscillation amplitude, as well as a spatial dependence along single filaments that is more difficult to quantify. It also appears that the strength of the oscillations does not necessarily depend on the strength of the trigger, although there are other possible effects that make this conclusion preliminary. Applications of this technique to other events and different data sets will provide important new insights into the local energy densities and magnetic fields associated with dynamic chromospheric structures.

Jackiewicz, Jason [New Mexico State University, Department of Astronomy, P.O. Box 30001, MSC 4500, Las Cruces, NM 88003 (United States)] [New Mexico State University, Department of Astronomy, P.O. Box 30001, MSC 4500, Las Cruces, NM 88003 (United States); Balasubramaniam, K. S., E-mail: jasonj@nmsu.edu [Space Vehicles Directorate, Air Force Research Laboratory, Kirtland AFB, NM 87114 (United States)



Nonradioactive demonstration of the Alpha D and D Pilot Facility  

SciTech Connect

The Alpha-Contained Decontamination and Disassembly (AD and D) pilot facility was designed to demonstrate the process flowsheet under conditions typical to those expected in a production facility. To achieve this, nonradioactive waste items similar to those in retrievable storage at the Savannah River Plant burial ground (e.g. gloveboxes), were chemically sprayed and size reduced. During process runs, parameters such as feed rate, oxide removal, etching rate, and secondary waste generation were determined. The exhaust system was monitored during operation to ensure that exhaust from the facility was sufficiently filtered before release to the atmosphere. The strategy for decontamination techniques required development during the nonradioactive testing period. Under investigation during process runs were both once-through and recirculating washes, and their correlation to oxide removal and etching rates on the stainless steel feed items. Wash products of the decontamination process were analyzed for concentration of Ni, Cr, Fe, Mn, and Si, major components of stainless steel. Size reduction techniques were also developed during the nonradioactive testing period. An array of conventional power and pneumatic tools were tested and evaluated. Plasma arc torch operating parameters; standoff distance, ampere setting, and cutting angle were determined.

Wobser, J.K.



Comparison of nonerythroid alpha-spectrin genes reveals strict homology among diverse species.  

Science Journals Connector (OSTI)

...excluded by four discordant hybrids. LITERATURE CITED 1. Barton...q24) by somatic cell hybrid analysis and in situ hybridization...x human diploid fibroblast hybrids. Somatic Cell Genet. 7...V. T. 1985. Stabilizing infrastructure of cell mem- branes. Annu...

T L Leto; D Fortugno-Erikson; D Barton; T L Yang-Feng; U Francke; A S Harris; J S Morrow; V T Marchesi; E J Benz Jr



alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases  

SciTech Connect

The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. (Georg-August-Univ., Gottingen (Germany))



Vegetation uptake from burial ground alpha waste trenches  

SciTech Connect

This study was conducted as part of an evaluation of the potential radiological consequences of reinhabiting the SRS burial ground. The objective was to determine the uptake of buried, low-level, transuranic waste from unlined earthen trenches by forest vegetation. Two tree plots were established in 1979. One plot was put over a trench containing alpha waste and the other in an area without trenches. When the tree seedlings were sampled during 1979 and 1980, and analysized for {sup 239}Pu and {sup 238}Pu, there was only a small difference in radionuclude concentration between trees planted over the trench and those planted on the control plot because of the limited root intrusion into the trench by the seedlings. However, when trees were sample in 1986, 1987, and 1988 and analyzed for {sup 241}Am, {sup 238}Pu, {sup 239}Pu, and {sup 237}Np activity, the average activity of all of these isotopes was significantly higher over the trenches than in the control plot. These measurements indicate that tree roots will extract transuranic isotopes from buried, low-level waste. The amount of radioisotopes moved from the trenches to the surface is small and the level in the trees is low enough that dose from exposure will be small. The long term effects of transport of radioisotopes from the trenches to the surface soil was evaluated by estimating the accumulation in the surface soil. Transuranic activity in selected food crops was calculated using the soil activity and the literature derived concentration factors. In all cases, the activity of the transuranic isotopes in the edible portion of the plants was quite low. The activity in the leaf tissue was much higher than in the seed. However, it should be noted that in only one case was the activity higher than the naturally occurring activity of {sup 40}K in the pine foliage.

Murphy, C.E. Jr.; Tuckfield, R.C.



E-Print Network 3.0 - alpha-tocopherol beta-carotene cancer Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

beta-carotene cancer Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-tocopherol beta-carotene cancer Page: << < 1 2 3 4 5 > >> 1 Consommation...


E-Print Network 3.0 - anti-tcr alpha beta Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies and Information Sciences 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...


E-Print Network 3.0 - alpha -trihydroxy-5 beta Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies and Information Sciences 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...


E-Print Network 3.0 - alpha beta t-cell Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies and Information Sciences 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...


E-Print Network 3.0 - alpha 1i chain Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

de Mxico Collection: Mathematics 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: Chi 2 II 6 Sigma Alpha Epsilon 1 I I 7 Phi Psi II III 8 Phi Gamma Delta 4 I...


E-Print Network 3.0 - alpha 1-3gal beta Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Biotechnology ; Biology and Medicine 5 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...


E-Print Network 3.0 - alpha -fetoprotein controls Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering ; Mathematics 65 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha bravo charlie Two of the...

Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - alpha 1-microglobulin destroys Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies and Information Sciences 4 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha bravo charlie Two of the...


E-Print Network 3.0 - alpha -spectrometric determination Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

to determine its configuration. These files are all flat, or ASCII files, and must... and Internet addresses: alpha bravo charlie Two of the...


E-Print Network 3.0 - alpha -chloro ethers Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies and Information Sciences 31 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha bravo charlie Two of the...


E-Print Network 3.0 - alpha indirect conversion Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies and Information Sciences 77 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha bravo charlie Two of the...


E-Print Network 3.0 - alpha -reductase activity Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Biology and Medicine ; Chemistry 82 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha bravo charlie Two of the...


E-Print Network 3.0 - alpha-synuclein processing aggregation...  

NLE Websites -- All DOE Office Websites (Extended Search)

FEBS Lett. 2002;522(1-3):9-13. 25... and Aggregation of Alpha-Synuclein in Organic Solvents: Modeling the Effects of Membranes. Biochemistry. 2003... the conformation of...


E-Print Network 3.0 - alpha ligands activate Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

256, 201213 The Automatic Search for Ligand Binding Sites in Summary: CPA, 4CPA, 5CPA, alpha-amylase 6TAA) their binding location was predicted as a part of the active site......


Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars  

Science Journals Connector (OSTI)

The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in...Triticum durum, 2n = 4x = 28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in commo...

V. P. Netsvetaev; E. D. Badaeva



Selection and characterization of alpha-amylase-overproducing recombinant Escherichia coli containing the bacterial hemoglobin gene  

Science Journals Connector (OSTI)

We previously reported that the presence of the bacterial (Vitreoscilla) hemoglobin gene enhances alpha-amylase production in recombinant Escherichia coli...strain MK79. Using the growth of MK79 on starch as a se...

Shie-Chau Liu; Besim Ogretmen; Yao-Yu Chuang



Neutron diffraction of. cap alpha. ,. beta. and. gamma. cyclodextrins: hydrogen bonding patterns  

SciTech Connect

Cyclodextrins (CD's) are torus-shaped molecules composed of six (..cap alpha..), seven (..beta..) or eight (..gamma..) (1 ..-->.. 4) linked glucoses. ..cap alpha..-CD has been shown to have two different structures with well-defined hydrogen bonds, one tense and the other relaxed. An induced-fit-like mechanism for ..cap alpha..-CD complex formation has been proposed. Circular hydrogen bond networks have also been found for ..cap alpha..-CD due to the energetically favored cooperative effect. ..beta..-CD with a disordered water structure possesses an unusual flip-flop hydrogen bonding system of the type O-H H-O representing an equilibrium between two states; O-H O reversible H-O. ..gamma..-CD with a disordered water structure similar to ..beta..-CD also possesses the flip-flop hydrogen bond. This study demonstrates that hydrogen bonds are operative in disordered systems and display dynamics even in the solid state.

Hingerty, B.E.; Klar, B.; Hardgrove, G.; Betzel, C.; Saenger, W.



E-Print Network 3.0 - alpha implication des Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Zhang,J., Zhang,Z., Miller,W., and Lipman,D.J. (1997) Summary: functional annotations of alpha- amylase-related proteins. Protein Eng Des Sel 19: 555-562. 198. Steyn... ,W.,...


Effect of lecturing to 200 students on heart rate variability and alpha-amylase activity  

Science Journals Connector (OSTI)

The aim of this study was to examine cardiovascular [heart rate variability (HRV)] and autonomic nervous system activation (by evaluating salivary alpha-amylase activity) that occur in professors both to...P ...

Edith Filaire; Hugues Portier; Alain Massart



Preparation of a nuclease-free alpha-amylase and its use in DNA purification  

Science Journals Connector (OSTI)

A thermostable alpha-amylase fromBacillus licheniformis...when heated to 80C for 20 min retains >90% of its activity but loses all DNAase activity. This allows the amylase to be used to purify yeast DNA.

Stewart D. Finlayson; Fiona Bain; David R Berry


E-Print Network 3.0 - alpha 2-plasmin inhibitor Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

12 Pesq. agropec. bras., Braslia, v.39, n.3, p.201-208, mar. 2004 Mutants of common bean alpha-amylase inhibitor-2 201 Summary: -amylase inhibitor-2 201 Mutants of common bean...


Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch  

SciTech Connect

Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

Fujii, M.; Kawamura, Y.



Continuous alpha-amylase production using Bacillus amyloliquefaciens adsorbed on an ion exchange resin  

Science Journals Connector (OSTI)

A method for the continuous production of extracellular alpha amylase by surface immobilized cells of Bacillus amyloliquefaciens...NRC 2147 has been developed. A large-pore, macroreticular anionic exchange resin ...

Carl A. Groom; Andrew J. Daugulis



Effect of sexual steroids upon ontogeny of alpha-amylase of rat parotid gland  

Science Journals Connector (OSTI)

The effect of gonadectomy (at the 10th day of life) and treatment with sexual steroids (during the first month) upon development of alpha-amylase activity in rat parotid gland has been...

S. L. Bellavia; E. G. Sanz; N. T. Vermouth



A new microtiter plate-based screening method for microorganisms producing Alpha-amylase inhibitors  

Science Journals Connector (OSTI)

Alpha-amylase inhibitors are widely used by the pharmaceutical...?-amylase inhibitor producing strains or mutants with higher ?-amylase inhibitor productivity. This method relies on absorbance...?-amylase catalyz...

Zhi-Hua Feng; Yuan-Shan Wang; Yu-Guo Zheng



Comparative profiles of fungal alpha amylase production by submerged and surface fermentation  

Science Journals Connector (OSTI)

Parameters for the production and recovery of pharmaceutical grade alpha amylase fromAspergillus oryzae...SMC strain have been optimized. As compared with a submerged fermentation, a surface fermentation was more...

N. K. Shah; V. Ramamurthy; R. M. Kothari



Polyclonal antibody based immunopurification of an acid stable alpha-amylase produced byTalaromyces emersonii  

Science Journals Connector (OSTI)

A polyclonal antibody preparation specific for an alpha-amylase produced by the thermophilci fungusTalaromyces emersonii...has been raised in rabbits. Using an enzyme linked immunoadsorbant assay ...

L. Bunni; A. P. McHale


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Relationship between QTLs for preharvest sprouting and alpha-amylase activity in rye grain  

Science Journals Connector (OSTI)

Preharvest sprouting (PHS) and high alpha-amylase activity (AA) negatively affect quality of...2...mapping populations representing wide variation range of both traits. Sixteen QTLs for AA were detected on chromo...

Piotr Masoj?; Pawe? Milczarski



E-Print Network 3.0 - alpha -proteinase inhibitor Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

4 Pesq. agropec. bras., Braslia, v.39, n.3, p.201-208, mar. 2004 Mutants of common bean alpha-amylase inhibitor-2 201 Summary: -amylase inhibitor-2 201 Mutants of common bean...


E-Print Network 3.0 - alpha 1-proteinase inhibitor Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

34 Pesq. agropec. bras., Braslia, v.39, n.3, p.201-208, mar. 2004 Mutants of common bean alpha-amylase inhibitor-2 201 Summary: -amylase inhibitor-2 201 Mutants of common bean...


Biochemical, Nutritional and Toxicological Aspects of Alpha-Amylase Inhibitors from Plant Foods  

Science Journals Connector (OSTI)

This paper is a critical review of the available data on plant protein inhibitors active either on animal or endogenous plant alpha-amylases. The First Section is a review ... . The Second Section deals with prop...

Vincenzo Buonocore; Vittorio Silano



Purification of an Alpha Amylase Inhibitor from Seeds of Little Millet (Panicum sumatrens Roth)  

Science Journals Connector (OSTI)

An insect specific alpha-amylase inhibitor (?-Al) from seeds of...Panicum sumatrens...Roth) was isolated and purified to homogeneity following ammonium sulfate precipitation, successive chromatographic separation...

P. Rajendran; B. Thayumanavan



E-Print Network 3.0 - alpha -hydroxyisobutyrate ree Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Pi Greek Woman of the Year Ann... Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... of the Year Carl Braunlich Philanthropy...


E-Print Network 3.0 - alpha muzka ostajotsja Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Pi Greek Woman of the Year Ann... Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... of the Year Carl Braunlich Philanthropy...


E-Print Network 3.0 - alpha particle transfer Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

then be transferred or channeled to the rf fields rather than to the electrons, with the cold alpha particles promptly... in tokamaks exploits the higher population of high-energy...


Thalamocortical model for a propofol-induced alpha rhythm associated with loss of consciousness  

E-Print Network (OSTI)

Recent data reveal that the general anesthetic propofol gives rise to a frontal ?-rhythm [alpha rhythm] at dose levels sufficient to induce loss of consciousness. In this work, a computational model is developed that ...

Ching, Shinung


E-Print Network 3.0 - alpha phase transition Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

by Explorit Topic List Advanced Search Sample search results for: alpha phase transition Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed...


E-Print Network 3.0 - alpha-product induces expression Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

the very high... . 0741-3335:89 3.00+ .OO C 1989 IOP Publishing Ltd. and Pergamon Press plc ALPHA PARTICLE INDUCED... , particle diffusion and thermal conduction effects. Using...


E-Print Network 3.0 - alpha-toxin encoding plc Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

toxin encoding plc Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-toxin encoding plc Page: << < 1 2 3 4 5 > >> 1 INFECTION AND IMMUNITY,...


E-Print Network 3.0 - alpha subunit peptide Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

-terminal beta-barrel domain of the alpha and beta subunits in the yeast F1-ATPase. J Bioenerg Biomembr 1999... stained bands (Fig. 1A) were eluted, digested with trypsin, and ......


E-Print Network 3.0 - alpha-1 antitrypsin serpina1 Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

profiles in human epithelial cells Summary: G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... of SLs such as parthenolide. The...


E-Print Network 3.0 - alpha 1-antitrypsin Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

profiles in human epithelial cells Summary: G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... of SLs such as parthenolide. The...


E-Print Network 3.0 - alpha 1-antitrypsin deficiency Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

profiles in human epithelial cells Summary: G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... of SLs such as parthenolide. The...


E-Print Network 3.0 - alpha 1-antitrypsin gene Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

profiles in human epithelial cells Summary: G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... of SLs such as parthenolide. The...


E-Print Network 3.0 - alpha-amylase inhibitors lipid Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

inhibitors lipid Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-amylase inhibitors lipid Page: << < 1 2 3 4 5 > >> 1 1 Stryer,L. (1988)...


Measurement of the {sup 12}C({alpha},{gamma}){sup 16}O reaction at TRIAC  

SciTech Connect

We have measured the {gamma}-ray angular distribution of the {sup 12}C({alpha},{gamma}){sup 16}O reaction at TRIAC (Tokai Radioactive Ion Accelerator Complex) to accurately determine the E1 and E2 cross sections. In this experiment, we used high efficiency anti-Compton NaI(T1) spectrometers to detect a {gamma}-ray from the reaction with large S/N ratio, intense pulsed {alpha}-beams to discriminate true event from background events due to neutrons from {sup 13}C({alpha},n){sup 16}O reaction with a time-of-flight (TOF) method. We succeeded in removing a background events due to neutrons and clearly detected {gamma}-ray from the {sup 12}C({alpha}{gamma}){sup 16}O reaction with high statistics.

Makii, H.; Miyatake, H.; Wakabayashi, Y.; Ishiyama, H.; Niki, K.; Okada, M.; Imai, N.; Watanabe, Y. X.; Hirayama, Y.; Jeong, S. C.; Shima, T.; Nishinaka, I.; Mitsuoka, S.; Nishio, K.; Chiba, S. [Japan Atomic Energy Agency, Tokai, Ibaraki 319-1195 (Japan); High Energy Accelerator Research Organization, Tsukuba, Ibaraki, 305-0801 (Japan); Japan Atomic Energy Agency, Tokai, Ibaraki 319-1195 (Japan); High Energy Accelerator Research Organization, Tsukuba, Ibaraki, 305-0801 (Japan); Osaka University, Ibaraki, Osaka 567-0047 (Japan); Japan Atomic Energy Agency, Tokai, Ibaraki 319-1195 (Japan)



Odd p isotope 113In: Measurement of alpha-induced reactions  

E-Print Network (OSTI)

One of the few p nuclei with an odd number of protons is 113In. Reaction cross sections of 113In(alpha,gamma)117Sb and 113In(alpha,n)116Sb have been measured with the activation method at center-of-mass energies between 8.66 and 13.64 MeV, close to the astrophysically relevant energy range. The experiments were carried out at the cyclotron accelerator of ATOMKI. The activities were determined by off-line detection of the decay gamma rays with a HPGe detector. Measured cross sections and astrophysical S factor results are presented and compared with statistical model calculations using three different alpha+nucleus potentials. The comparison indicates that the standard rates used in the majority of network calculations for these reactions were too fast due to the energy dependence of the optical alpha potential at low energy.

C. Yal?n; R. T. Gray; N. zkan; S. Kutlu; Gy. Gyrky; J. Farkas; G. G. Kiss; Zs. Flp; A. Simon; E. Somorjai; T. Rauscher


Note: This page contains sample records for the topic "gross alpha excluding" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - alpha receptor antagosist Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Page: << < 1 2 3 4 5 > >> 1 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...


E-Print Network 3.0 - alpha-lactalbumin prevents involution Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Function: A Comprehensive Survey with Application Summary: d1lmn LCARAT Alpha-lactalbumin precursor LYC1PIG 3... to prevent double matches, i.e....


E-Print Network 3.0 - alpha induced nuclear Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

nuclear Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha induced nuclear Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997)...


E-Print Network 3.0 - alpha-particle-induced nuclear reactions...  

NLE Websites -- All DOE Office Websites (Extended Search)

particle-induced nuclear reactions Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-particle-induced nuclear reactions Page: << < 1 2 3 4 5 >...


Alpha Emission Near 100Sn and the Termination of the rp Process  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha Emission Near 100 Sn and the Termination of the rp Process The astrophysical rp-process is thought to reach a termination point in the region of 100 Sn, via the...


E-Print Network 3.0 - ap-1 regulates alpha2beta1 Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Electricity Markets under a New Model of Real-Time Retail Pricing with Summary: Demand Mass Approximation Model N 10 random initial demand between 0.5 and 5.5 alpha2...


Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.  

Science Journals Connector (OSTI)

...electrophoresis. One ofthese amylases was purified by...extracellular a-amylase were: opti- mum...characteristic of alpha-type amylases. The relative...lose, soluble starch, amylopectin...in rumen starch break- down. MATERIALS AND...

S J McWethy; P A Hartman



E-Print Network 3.0 - alpha-glucosidases Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Science 82 SPISE2009 1 SPISE2009, the second symposium on sensory evaluation in ASEAN, was held on August 7 Summary: cannot produce the enzyme acid alpha- glucosidase, or...


Measurements of Charmless B Decays Related to alpha at BaBar  

SciTech Connect

We report recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory. In addition to improved constraints on {alpha} from the decays B{sup {+-}} {yields} {rho}{sup {+-}}{rho}{sup 0}, we also present preliminary results of neutral and charged B meson decays to K{sub 1}(1270){pi} and K{sub 1}(1400){pi} and its impact on the estimate for the CKM angle {alpha} based on time-dependent analysis of CP-violating asymmetries in B{sup 0} {yields} a{sub 1}(1260){sup {+-}} {pi}{sup {-+}}. Moreover we report the first observation of the decay B {yields} a{sub 1}(1260){sup {+-}}a{sub 1}(1260){sup {-+}}; this mode can be used, in principle, to provide an independent measurement of {alpha}.

Lombardo, Vincenzo; /INFN, Milan



E-Print Network 3.0 - alpha 7l test Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

7l test Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha 7l test Page: << < 1 2 3 4 5 > >> 1 Maple-Worksheet for Gayen's (1949) method based...


Dependence of the activation energy of vacancy formation on the zinc content in alpha brasses  

Science Journals Connector (OSTI)

Observations on quenched-in resistivity in alpha brasses showed an apparent decrease in the activation energy of vacancy formation with increasing zinc content from a value of 085 eV ... up to a concentration of...

R. Kamel; T. H. Youssef



E-Print Network 3.0 - alpha chain cd25 Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

administration of anti- CD25 (interleukin-2 receptor alpha) monoclonal antibody. Cancer Res. 59:3128-3133. 9... occurring CD25+CD4+ regulatory T cells (T reg cells) are...


Metabolic Regulation of Protein N-Alpha-Acetylation by Bcl-xL Promotes Cell Survival  

E-Print Network (OSTI)

Previous experiments suggest a connection between the N-alpha-acetylation of proteins and sensitivity of cells to apoptotic signals. Here, we describe a biochemical assay to detect the acetylation status of proteins and ...

Yi, CarolineH.


E-Print Network 3.0 - alpha radioactivity measurement Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

SITE ENVIRONMENTAL REPORT4-1 Summary: a range in air of only an inch or so. Naturally occurring radioactive elements such as radon emit alpha... . This is a measure of the rate at...


HIV-1 Tat protein down regulates interleukin-7 receptor alpha on CD8 T cells .  

E-Print Network (OSTI)

??Expression of the IL-7 receptor alpha-chain (CD127) is decreased on CD8 T-cells in HIV infected patients and recovers in those receiving antiretroviral therapy with sustained (more)

Faller, Elliott M



E-Print Network 3.0 - alpha beams Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

beams Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha beams Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283....


E-Print Network 3.0 - alpha tagged x-ray Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

-X-ray pinhole camera -Fast electron beam spatial distribution 5m... ? Fusion Energy Fast Ignition Optimisation high power laser-driven ion -Cu K-alpha imaging system -X-ray... and...


E-Print Network 3.0 - alpha xn reactions Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

in Great Britain 01982 Pergamon Press Ltd. Summary: of the efficiency of a gas phase SN2 reaction. Thus, in terms of eq l, the gas phase SN2 behavior of the alpha......


E-Print Network 3.0 - alpha-chlorohydrin-induced infertile rats...  

NLE Websites -- All DOE Office Websites (Extended Search)

chlorohydrin-induced infertile rats Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-chlorohydrin-induced infertile rats Page: << < 1 2 3 4 5...


E-Print Network 3.0 - alpha fine structure Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

were unable to improve upon the image fits; relaxing the re... (Alpha) is an unconsolidated gravitational aggregate with a spin period 2.8 hours, bulk density 2 grams... is...