Powered by Deep Web Technologies
Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


City of Grand Rapids - Green Building Requirements for Municipal...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 2006, the City of Grand Rapids approved a resolution detailing the city's sustainability policy for public buildings. The resolution directed city personnel to implement...


City of Grand Rapids- Green Building Requirements for Municipal Buildings  

Energy.gov (U.S. Department of Energy (DOE))

In January 2006, the City of Grand Rapids approved a resolution detailing the city's sustainability policy for public buildings. The resolution directed city personnel to implement the principles...


City of Grand Rapids Building Solar Roof Demonstration  

SciTech Connect

Grand Rapids, Michigan is striving to reduce it environmental footprint. The municipal government organization has established environmental sustainability policies with the goal of securing 100% of its energy from renewable sources by 2020. This report describes the process by which the City of Grand Rapids evaluated, selected and installed solar panels on the Water/Environmental Services Building. The solar panels are the first to be placed on a municipal building. Its new power monitoring system provides output data to assess energy efficiency and utilization. It is expected to generate enough clean solar energy to power 25 percent of the building. The benefit to the public includes the economic savings from reduced operational costs for the building; an improved environmentally sustainable area in which to live and work; and increased knowledge about the use of solar energy. It will serve as a model for future energy saving applications.

DeClercq, Mark; Martinez, Imelda



Grand Rapids Public Util Comm | Open Energy Information  

Open Energy Info (EERE)

Rapids Public Util Comm Rapids Public Util Comm Jump to: navigation, search Name Grand Rapids Public Util Comm Place Minnesota Utility Id 7489 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png CITY COMMERCIAL Commercial CITY LIGHT & POWER Lighting CITY RESIDENTIAL Residential CONTROLLED WATER HEATING (CITY) Commercial CONTROLLED WATER HEATING (RURAL) Commercial ENTERTAINMENT LIGHTING RATE (CITY) Lighting ENTERTAINMENT LIGHTING RATE (RURAL) Lighting INDUSTRIAL (CITY) Industrial


East Grand Rapids, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Rapids, Michigan: Energy Resources Rapids, Michigan: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.941139°, -85.6100277° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.941139,"lon":-85.6100277,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A Small City's Big Scandal: Municipal Corruption, Progressive Reform, and the Grand Rapids, Michigan Water Scandal, 1900-1906.  

E-Print Network (OSTI)

??At the turn of century the city of Grand Rapids, Michigan began debating plans for expanding its water supply. These debates quickly spawned corrupt dealings, (more)

Sarnacki, Brian F.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Grand Unified Theory  

NLE Websites -- All DOE Office Websites (Extended Search)

Grand Unified Theory Ungelste Rtsel Grand Unified Theory Heute besteht eines der Hauptziele der Teilchenphysik darin, die verschiedenen fundamentalen Krfte in einer Grossen...



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


EV Everywhere Grand Challenge Kick-Off  

NLE Websites -- All DOE Office Websites (Extended Search)

EV Everywhere Grand Challenge Kick-Off Thursday, June 21, 2012 - Hyatt Regency, Dearborn, MI Event Objective: To showcase existing DOE efforts in vehicle electrification and to obtain stakeholder input on the overall concept of the EV Everywhere Grand Challenge, the high-level strategy, and aggressive next-generation technology development necessary to enable U.S. companies to be the first in the world to produce plug-in electric vehicles (PEVs) that are as affordable and convenient for the average American family as today's gasoline-powered vehicles within the next 10 years. 8:30-8:35 AM CALL TO ORDER Mr. Patrick Davis, DOE EERE Vehicle Technologies Program 8:35-8:45 AM STRATEGIC SIGNIFICANCE OF PLUG-IN ELECTRIC VEHICLES


EMSL: Science: Biogeochemistry Grand Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Biogeochemistry Grand Challenge Shewanella oneidensis MR-1 growing on a hematite surface Shewanella oneidensis MR-1 growing on a hematite surface. A Grand Challenge in...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Mississippi Nuclear Profile - Grand Gulf  

U.S. Energy Information Administration (EIA) Indexed Site

Grand Gulf" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...



NLE Websites -- All DOE Office Websites (Extended Search)

Grande Praire Wind Farm, O'Neill, NE Grande Praire Wind Farm, O'Neill, NE The Western Area Power Administration (Western), an agency of the Department of Energy (DOE), intends to prepare an environmental impact statement (EIS) on the proposed interconnection of the Grande Prairie Wind Farm (Project) in Holt County, near the city of O'Neill, Nebraska. Grande Prairie Wind, LLC (Grande Prairie), a subsidiary of Midwest Wind Energy Development Group, LLC, has applied to Western to interconnect their proposed Project to Western's power transmission system. Western is issuing this notice to inform the public and interested parties about Western's intent to prepare an EIS, conduct a public scoping process, and invite the public to comment on the scope, proposed action, alternatives, and other issues to be addressed in the EIS.


Rio Grande Compact (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rio Grande Compact (Texas) Rio Grande Compact (Texas) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Grand Rapids, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

80134°, -89.7567693° 80134°, -89.7567693° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.380134,"lon":-89.7567693,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grand Rapids, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

633599°, -85.6680863° 633599°, -85.6680863° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9633599,"lon":-85.6680863,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grand Rapids, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

19963°, -83.8643852° 19963°, -83.8643852° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.4119963,"lon":-83.8643852,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Grand Rapids - Green Power Purchasing Policy | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

three-year renewable with http:www.consumersenergy.comcontent.aspx?ID1458 Consumers Energy to purchase Green-e Certified blocks of renewable energy valued at a reduced rate....



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Neutrino Mass and Grand Unification  

E-Print Network (OSTI)

Seesaw mechanism appears to be the simplest and most appealing way to understand small neutrino masses observed in recent experiments. It introduces three right handed neutrinos with heavy masses to the standard model, with at least one mass required by data to be close to the scale of conventional grand unified theories. This may be a hint that the new physics scale implied by neutrino masses and grand unification of forces are one and the same. Taking this point of view seriously, I explore different ways to resolve the puzzle of large neutrino mixings in grand unified theories such as SO(10) and models based on its subgroup $SU(2)_L\\times SU(2)_R\\times SU(4)_c$.

R. N. Mohapatra



Spelunking in La Cueva Grande  

Science Conference Proceedings (OSTI)

La Cueva Grande is the 5-sided immersive facility put into place at Los Alamos National Laboratory. It was the highest-resolution stereo immersive facility in the world at the time of first use in 2005. The design and common use cases of LCG are presented, ... Keywords: projection systems, virtual reality

Laura Monroe



Secretary Chu to Deliver Keynote on EV Everywhere Grand Challenge at  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Deliver Keynote on EV Everywhere Grand Challenge to Deliver Keynote on EV Everywhere Grand Challenge at Washington Auto Show Secretary Chu to Deliver Keynote on EV Everywhere Grand Challenge at Washington Auto Show January 30, 2013 - 1:37pm Addthis NEWS MEDIA CONTACT (202) 586-4940 WASHINGTON - Tomorrow, Thursday, January 31, 2013, Secretary Chu will deliver the government keynote address at the Washington Auto Show's Public Policy Day. His remarks will focus on the Energy Department's EV Everywhere Grand Challenge, including progress to date and a new initiative to strengthen American leadership in this rapidly growing global industry. Launched by President Obama in March 2012, EV-Everywhere is the second in a series of Energy Department "Clean Energy Grand Challenges" aimed at addressing the most pressing energy challenges of our time. The EV


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Grand Challenges in Energy by Secretary Steven Chu | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grand Challenges in Energy by Secretary Steven Chu Grand Challenges in Energy by Secretary Steven Chu Grand Challenges in Energy by Secretary Steven Chu More Documents &...


The Particle Adventure | Unsolved Mysteries | Grand Unified Theory  

NLE Websites -- All DOE Office Websites (Extended Search)

Unsolved Mysteries - Grand Unified Theory Grand Unified Theory Today, one of the major goals of particle physics is to unify the various fundamental forces in a Grand Unified...


PP-53 Rio Grande Electric Cooperative, Inc. | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 Rio Grande Electric Cooperative, Inc. PP-53 Rio Grande Electric Cooperative, Inc. Presidential Permit authorizing Rio Grande Electric Cooperative, Inc.to construct, operate, and...


PP-33 Rio Grande Electric Cooperative Inc | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rio Grande Electric Cooperative Inc PP-33 Rio Grande Electric Cooperative Inc Presidential permit authorizing Grande Electric Cooperative Inc to construct, operate, and maintain...


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


EV Everywhere Grand Challenge Blueprint  

NLE Websites -- All DOE Office Websites (Extended Search)

A Message from A Message from the Assistant Secretary Every challenge presents an even greater opportunity, and the EV Everywhere Grand Challenge is no exception. The need for clean energy solutions drives the most important economic development race of the 21st century, providing opportunity for America to invent, manufacture, and export clean energy technologies. Recognizing that vehicle electrification is an essential part of our country's "all-of-the above" energy strategy, President Obama issued the EV Everywhere Grand Challenge to the nation in March 2012 with the bold goal to be the first nation in the world to produce plug-in electric vehicles that are as affordable for the average American family as today's gasoline-powered vehicles within the next 10 years.


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Mountain View Grand | Open Energy Information  

Open Energy Info (EERE)

Grand Grand Jump to: navigation, search Name Mountain View Grand Facility Mountain View Grand Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Mountain View Grand Developer Sustainable Energy Developments Energy Purchaser Mountain View Grand Location Mountain View Grand Resort & Spa NH Coordinates 44.397987°, -71.590306° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.397987,"lon":-71.590306,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Vehicle Technologies Office: EV Everywhere Grand Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Charging Community and Fleet Readiness Workforce Development Plug-in Electric Vehicle Basics EV Everywhere Grand Challenge With their immense potential for increasing the...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Review: Red Pedagogy: Native American Social and Political Thought by Sandy Grande  

E-Print Network (OSTI)

and Political Thought by Sandy Grande. New York: Rowman &discourse. For these reasons, Sandy Grandes (2004) text

Caldern, Dolores



Microsoft Word - GrandCoulee_FONSI.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grand Coulee's Third Powerplant 500-kV Transmission Line Replacement Project Grand Coulee's Third Powerplant 500-kV Transmission Line Replacement Project BPA's Finding of No Significant Impact 1 Bonneville Power Administration's Finding of No Significant Impact (FONSI) for the Grand Coulee's Third Powerplant 500-kV Transmission Line Replacement Project DOE/EA-1679 SUMMARY The Bonneville Power Administration (BPA) announces its environmental findings on the Bureau of Reclamation's (Reclamation) Grand Coulee Third Powerplant 500-kV Transmission Line Replacement Project. This project involves replacing the six 500-kV transmission lines of the Third Powerplant (TPP) at Grand Coulee Dam. The transmission lines are presently installed within the dam and a two-chambered tunnel that leads to a Spreader Yard about a mile west of the TPP. BPA would design and construct


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


SunShot Grand Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Centers Field Sites Power Marketing Administration Other Agencies You are here Home SunShot Grand Challenge SunShot Grand Challenge Addthis SunShot Grand Challenge 1 of 28...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



EA-1950: Grand Coulee-Creston Transmission Line Rebuild; Grant...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Grand Coulee-Creston Transmission Line Rebuild; Grant and Lincoln Counties, Washington EA-1950: Grand Coulee-Creston Transmission Line Rebuild; Grant and Lincoln Counties,...


Secretary Chu to Deliver Keynote on EV Everywhere Grand Challenge...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Deliver Keynote on EV Everywhere Grand Challenge at Washington Auto Show Secretary Chu to Deliver Keynote on EV Everywhere Grand Challenge at Washington Auto Show January 30,...


Grand Meadow Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Grand Meadow Wind Farm Grand Meadow Wind Farm Jump to: navigation, search Name Grand Meadow Wind Farm Facility Grand Meadow Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner EnXco Developer EnXco Energy Purchaser Xcel Energy Location Dexter MN Coordinates 43.707798°, -92.654071° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.707798,"lon":-92.654071,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EV Everywhere Grand Challenge - Battery Workshop Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandalow, Under Secretary of Energy (acting) and Assistant Secretary for Policy and International Affairs 8:45-8:55 AM SETTING THE STAGE FOR THE EV EVERYWHERE GRAND CHALLENGE Dr....


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Rio Grande South | Open Energy Information  

Open Energy Info (EERE)

Rio Grande South Rio Grande South Facility Rio Grande South Sector Wind energy Facility Type Offshore Wind Facility Status Proposed Owner Baryonyx Corporation Developer Baryonyx Corporation Location Gulf of Mexico TX Coordinates 26.189°, -97.053° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":26.189,"lon":-97.053,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rio Grande North | Open Energy Information  

Open Energy Info (EERE)

Rio Grande North Rio Grande North Facility Rio Grande North Sector Wind energy Facility Type Offshore Wind Facility Status Proposed Owner Baryonyx Corporation Developer Baryonyx Corporation Location Offshore from South Padre Island TX Coordinates 26.364°, -97.078° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":26.364,"lon":-97.078,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


District-heating system, La Grande, Oregon  

DOE Green Energy (OSTI)

The area suggested for district heating feasibility study encompassed slightly over 400 acres extending north and south from the geographic center of the city. This district was subdivided into 8 areas, which include the Grande Ronde Hospital, Eastern Oregon State College, La Grande school district, one institutional area, one commercial area and three residential areas. Basic space heating loads developed for the various areas after a survey by county personnel and computation using a computer program form the basis for this economic feasibility study.

Not Available



SunShot Grand Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SunShot Grand Challenge SunShot Grand Challenge SunShot Grand Challenge Addthis SunShot Grand Challenge 1 of 28 SunShot Grand Challenge Participants gather for the plenary session at the SunShot Grand Challenge Summit and Technology Forum in Denver, Colorado. (Photo by DENNIS SCHROEDER / NREL) Date taken: 2012-06-13 07:10 Arun Majumdar, Founding Director, ARPA-E 2 of 28 Arun Majumdar, Founding Director, ARPA-E Arun Majumdar, Founding Director, ARPA-E gives the welcoming remarks. (Photo by DENNIS SCHROEDER / NREL) Date taken: 2012-06-13 07:16 Energy Secretary Steven Chu at SunShot Grand Challenge 3 of 28 Energy Secretary Steven Chu at SunShot Grand Challenge Energy Secretary Steven Chu gives the keynote address at the SunShot Grand Challenge Summit. (Photo by DENNIS SCHROEDER / NREL) Date taken: 2012-06-13 07:32


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...



Grand Unification with and without Supersymmetry  

Science Conference Proceedings (OSTI)

Grand Unified Theories based on the group SO(10) generically provide interesting and testable relations between the charged fermions and neutrino sector masses and mixings. In the light of the recent neutrino data, we reexamine these relations both in supersymmetric and non-supersymmetric models, and give a brief review of their present status.

Melfo, Alejandra [CFF, Universidad de Los Andes, Merida (Venezuela); Institute J. Stefan, Ljubljana (Slovenia)



EIS-0355: Remediation of the Moab Uranium Mill Tailings, Grand...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

355: Remediation of the Moab Uranium Mill Tailings, Grand and San Juan Counties, Utah EIS-0355: Remediation of the Moab Uranium Mill Tailings, Grand and San Juan Counties, Utah...


DOE - Office of Legacy Management -- Climax Uranium Co Grand...  

Office of Legacy Management (LM)

Climax Uranium Co Grand Junction Mill - CO 0-03 FUSRAP Considered Sites Site: Climax Uranium Co. (Grand Junction Mill) (CO.0-03) Designated Name: Alternate Name: Location:...


Energy Secretary Steven Chu to Attend Grand Opening of Recovery...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Steven Chu to Attend Grand Opening of Recovery Act-Funded A123 Systems Battery Plant Energy Secretary Steven Chu to Attend Grand Opening of Recovery Act-Funded A123...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Grand Ridge Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind Farm Wind Farm Jump to: navigation, search Name Grand Ridge Wind Farm Facility Grand Ridge Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Invenergy Developer Invenergy Location La Salle County IL Coordinates 40.999966°, -88.401693° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.999966,"lon":-88.401693,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rio Grande pipeline introduces LPG to Mexico  

SciTech Connect

Rio Grande Pipeline, a joint venture between Mid-America Pipeline Co., Amoco Pipeline Co. and Navajo Pipeline Co., has broken new ground in the energy industry as the first LPG pipeline to cross the US-Mexico border. Plans for the project were announced in November 1995 and first deliveries started three months ago on March 21, 1997. The 8-inch, 265-mile pipeline originates near Odessa, TX, where it receives an 85-15 propane-butane mix via a connection to Mid-America Pipeline. From Odessa, product moves west through the Texas desert and crosses the Rio Grande River about 15 miles south of El Paso near Clint, TX and extends 20 miles into Mexico. Capacity of the line is 24,000 bpd and it has been averaging about 22,000 bpd since line-fill. All in all, it sounded like a reasonably feasible, routine project. But perceptions can be deceiving, or at least misleading. In other words, the project can be summarized as follows: one river, two cultures and a world of difference. The official border crossing for pipeline construction took place on Dec. 2, 1996, with a directional drill under the Rio Grande River, but in actuality, the joint venture partners were continually bridging differences in language, laws, customs and norms with Pemex and contracted workers from Mexico.




Big Rapids, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Rapids, MI) Rapids, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.6980782°, -85.4836557° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.6980782,"lon":-85.4836557,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Agropecuaria e Industrial Serra Grande | Open Energy Information  

Open Energy Info (EERE)

Agropecuaria e Industrial Serra Grande Agropecuaria e Industrial Serra Grande Jump to: navigation, search Name Agropecuaria e Industrial Serra Grande Place São Raimundo das Mangabeiras, Maranhao, Brazil Product Privately owned Brazil based ethanol producer, located in the state of Maranhao. References Agropecuaria e Industrial Serra Grande[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Agropecuaria e Industrial Serra Grande is a company located in São Raimundo das Mangabeiras, Maranhao, Brazil . References ↑ "[ Agropecuaria e Industrial Serra Grande]" Retrieved from "http://en.openei.org/w/index.php?title=Agropecuaria_e_Industrial_Serra_Grande&oldid=341914" Categories:


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.




NLE Websites -- All DOE Office Websites (Extended Search)

Prototyping Manufacturing Technologies The Rapid Prototyping Laboratory (RPL) supports internal design, manufacturing, and process develop- ment with three rapid prototyping (RP)...


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EA-1173: Grande Ronde Basin Endemic Spring Chinook Salmon Supplemental  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3: Grande Ronde Basin Endemic Spring Chinook Salmon 3: Grande Ronde Basin Endemic Spring Chinook Salmon Supplemental Program (Preliminary), Oregon EA-1173: Grande Ronde Basin Endemic Spring Chinook Salmon Supplemental Program (Preliminary), Oregon SUMMARY This EA evaluates the environmental impacts for the U.S. Department of Energy Bonneville Power Administration's proposal to fund a program designed to prevent the extinction and begin the recovery of spring Chinook salmon stocks in the Grande Ronde River Basin in the Upper Grande Ronde River, Lostine River, and Catherine Creek in Northeastern Oregon. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD December 18, 2003 EA-1173-SA-01: Supplement Analysis Grande Ronde Basin Endemic Spring Chinook Salmon Supplementation Program


DOE - Office of Legacy Management -- Grand Junction Sites  

Office of Legacy Management (LM)

Site Fairfield Site Falls City Site Fernald Preserve Gasbuggy Site General Atomics Geothermal Gnome-Coach Site Grand Junction Sites Granite City Site Green River Site Gunnison...


Statement by Energy Secretary Steven Chu on Today's Grand Opening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Steven Chu issued the following statement on today's grand opening of the Nordex wind turbine manufacturing facility in Jonesboro. The facility was supported with funding from the...


Rio Grande Rift Geothermal Region | Open Energy Information  

Open Energy Info (EERE)

Rift Geothermal Region Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Rio Grande Rift Geothermal Region edit Details Areas (21) Power Plants (0) Projects (2)...


SunShot Grand Challenge Highlights Ambitious Efforts along the...  

NLE Websites -- All DOE Office Websites (Extended Search)

startups. Secretary Chu also announced a nationwide competition to drive down the cost of rooftop solar energy system. The SunShot Grand Challenge: Summit and Technology Forum...


Grand River Dam Authority | Open Energy Information  

Open Energy Info (EERE)

Dam Authority Dam Authority Jump to: navigation, search Name Grand River Dam Authority Place Oklahoma Utility Id 7490 Utility Location Yes Ownership S NERC Location SPP NERC SPP Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png general service Commercial general service commercial Commercial large general servic time of use distributional Commercial


Vehicle Technologies Office: EV Everywhere Grand Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Challenge Challenge With their immense potential for increasing the country's energy, economic, and environmental security, plug-in hybrid electric and all-electric vehicles (also known as plug-in electric vehicles, or PEVs) will play a key role in the country's transportation future. In fact, transitioning to electric drive vehicles (including hybrid-electric) could reduce U.S. oil dependence by more than 80% and greenhouse gas emissions by more than 60%. The EV Everywhere Grand Challenge focuses on the U.S. becoming the first nation in the world to produce plug-in electric vehicles that are as affordable for the average American family as today's gasoline-powered vehicles within the next 10 years. To learn more about electric vehicles, see our Plug-in Electric Vehicle Basics page. To help meet the EV Everywhere goals, the Vehicle Technologies Office supports efforts in a variety of areas:


Grand Electric Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Electric Coop, Inc Electric Coop, Inc Jump to: navigation, search Name Grand Electric Coop, Inc Place South Dakota Utility Id 7484 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Electric Heat Rate Commercial Farm and Residential Electric Heat Rate Residential Metered Security Light - 100 HPS Lighting Metered Security Light - 175 MV Lighting Metered Security Light - 250 HPS Lighting Metered Security Light - 400 MV Lighting Schedule A - Farm and Residential Residential Schedule ADF -Du al Fuel Service Residential


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Panel on grand challenges for modeling and simulation  

Science Conference Proceedings (OSTI)

It has been a decade since the Workshop on Grand Challenge for Modeling & Simulation (M&S) was held at Dagstuhl in Germany (www.dagstuhl.de/02351). Grand challenges provide a critical focal point for research and development and can potentially create ...

Simon J. E. Taylor; Richard Fujimoto; Ernest H. Page; Paul A. Fishwick; Adelinde M. Uhrmacher; Gabriel Wainer



MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The Particle Adventure | Unsolved Mysteries | Forces and the Grand Unified  

NLE Websites -- All DOE Office Websites (Extended Search)

Unsolved Mysteries - Forces and the Grand Unified Theory Unsolved Mysteries - Forces and the Grand Unified Theory Forces and the Grand Unified Theory Physicists hope that a Grand Unified Theory will unify the strong, weak, and electromagnetic interactions. There have been several proposed Unified Theories, but we need data to pick which, if any, of these theories describes nature. If a Grand Unification of all the interactions is possible, then all the interactions we observe are all different aspects of the same, unified interaction. However, how can this be the case if strong and weak and electromagnetic interactions are so different in strength and effect? Strangely enough, current data and theory suggests that these varied forces merge into one force when the particles being affected are at a high enough energy.


Grand Challenges | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Grand Challenges Grand Challenges Energy Frontier Research Centers (EFRCs) EFRCs Home Centers Research Basic Research Needs Grand Challenges Science Highlights News & Events Publications Contact BES Home Research Grand Challenges Print Text Size: A A A RSS Feeds FeedbackShare Page Grand Challenge Report The Basic Energy Sciences Advisory Committee (BESAC) report, Directing Matter and Energy: Five Challenges for Science and the Imagination was the culmination of a series of BES-sponsored workshops that began in 2001. Over and over, the recommendations from these workshops described similar themes that in this new era of science, we would design, discover, and synthesize new materials and molecular assemblies through atomic scale control; probe and control photon, phonon, electron, and ion interactions


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Rapid Multiplex PCR  

Science Conference Proceedings (OSTI)

Development of Rapid Multiplex PCR Techniques. Summary: Forensic DNA typing is currently conducted in approximately eight to ten hours. ...



EA-33-A and PP-33-1 Rio Grande Electric Cooperative, Inc. | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

-A and PP-33-1 Rio Grande Electric Cooperative, Inc. EA-33-A and PP-33-1 Rio Grande Electric Cooperative, Inc. Order authorizing Rio Grande Electric Cooperative, Inc to export...


A Geomorphological Assessment of Armored Deposits Along the Southern Flanks of Grand Mesa, CO, USA  

E-Print Network (OSTI)

A series of deposits, located along the southern flanks of Grand Mesa, Colorado, and extending to the south, are problematic, and the processes related to emplacement are not understood. The overall area is dominated by two landform systems, Grand Mesa, which supported a Pleistocene ice cap, and the North Fork Gunnison River drainage. Thus, one has to ask: Are these deposits the result of the melting of the ice cap or are they fluvial terraces associated with the evolution of the ancestral Gunnison River? The goal of this research was to map the areal extent of the deposits and to interpret the formation and climatic significance in understanding the evolution of the Pleistocene landscape in the region. An extensive exposure, parallel to State Highway 65 near Cory Grade, was used for detailed description and sampling. Three additional exposures, ~10 to 20 km (~6 to 12 mi) were used to extend the areal extent of sampling. The study area was mapped using aerial photography and traditional field mapping aided by GPS. From the field work, a detailed stratigraphic column, including lithology and erodability, was constructed. Vertical exposures of the deposits were described, mapped, and recorded in the field and using detailed photo mosaics. Samples were collected from each stratum of the deposits for grain-size, shape, and sorting analyses. Five distinct depositional facies were identified. Sieve analysis on collected samples shows that four distinct grain-sizes occur in the outcrops; coarse sand, very-coarse sand, granule, and pebble and boulder. Mean grain-sizes range from 0.0722 to 0.9617, -0.0948 to -0.9456, -1.0566 to -1.9053, and -2.0050 to -3.4643, respectively. Glacio-fluvial depositional environments were identified and supported with observations of sedimentary structures and clast composition. Two major environments of deposition are recorded in the deposits; fluvial deposits from glacial outburst floods, and debris flow deposits. Imbrication of clasts in the strata suggests the flow came from the direction of Grand Mesa to the north. Facies and subsequent sequences were constructed to portray evidence that supports the glacio-fluvial mode of deposition.

Brunk, Timothy J.



Data Compendium for the Logging Test Pits at the ERDA Grand Junction...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Data Compendium for the Logging Test Pits at the ERDA Grand Junction Compound (December 1975) Data Compendium for the Logging Test Pits at the ERDA Grand Junction Compound...

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



EA-0930: Facility Operations at the U.S. DOE Grand Junction Projects  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

30: Facility Operations at the U.S. DOE Grand Junction 30: Facility Operations at the U.S. DOE Grand Junction Projects Office, Grand Junction, Colorado EA-0930: Facility Operations at the U.S. DOE Grand Junction Projects Office, Grand Junction, Colorado SUMMARY This EA evaluates the environmental impacts of the proposal to expand and upgrade the U.S. Department of Energy's Grand Junction Projects Office facilities and operations in Grand Junction, Colorado. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD June 8, 1996 EA-0930: Finding of No Significant Impact Facility Operations at the U.S. DOE Grand Junction Projects Office, Grand Junction, Colorado June 8, 1996 EA-0930: Final Environmental Assessment Facility Operations at the U.S. DOE Grand Junction Projects Office, Grand


Thermomechanical models of the Rio Grande rift  

SciTech Connect

Fully two-dimensional, coupled thermochemical solutions of a continental rift and platform are used to model the crust and mantle structure of a hot, buoyant mantle diapir beneath the Rio Grande rift. The thermomechanical model includes both linear and nonlinear laws of the Weertman type relating shear stress and creep strain rate, viscosity which depends on temperature and pressure, and activation energy, temperature-dependent thermal conductivity, temperature-dependent coefficient of thermal expansion, the Boussinesq approximation for thermal bouyancy, material convection using a stress rate that is invariant to rigid rotations, an elastically deformable crust, and a free surface. The model determines the free surface velocities, solid state flow field in the mantle, and viscosity structure of lithosphere and asthenosphere. Regional topography and crustal heat flow are simulated. A suite of symmetric models, assumes continental geotherms on the right and the successively increasing rift geotherms on the left. These models predict an asthenospheric flow field which transfers cold material laterally toward the rift at > 300 km, hot, buoyant material approx. 200 km wide which ascends vertically at rates of 1 km/my between 175 to 325 km, and spreads laterally away from the rift at the base of the lithosphere. Crustal spreading rates are similar to uplift rates. The lithosphere acts as stiff, elastic cap, damping upward motion through decreased velocities of 1 km/10 my and spreading uplift laterally. A parameter study varying material coefficients for the Weertman flow law suggests asthenospheric viscosities of approx. 10/sup 22/ to 10/sup 23/ poise. Similar studies predict crustal viscosities of approx. 10/sup 25/ poise. The buoyant process of mantle flow narrows and concentrates heat transport beneath the rift, increases upward velocity, and broadly arches the lithosphere. 10 figures, 1 table.

Bridwell, R.J.; Anderson, C.A.



DOE Announces Awardees for the Industrial Energy Efficiency Grand Challenge  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Awardees for the Industrial Energy Efficiency Grand Awardees for the Industrial Energy Efficiency Grand Challenge DOE Announces Awardees for the Industrial Energy Efficiency Grand Challenge May 5, 2010 - 12:00am Addthis WASHINGTON, DC - The U.S. Department of Energy announced today that 48 research and development projects across the country have been selected as award winners of the Industrial Energy Efficiency Grand Challenge. The grantees will receive a total of $13 million to fund the development of transformational industrial processes and technologies that can significantly reduce greenhouse gas emissions throughout the industrial sector. The funding will be matched by more than $5 million in private industry funding to support a total of $18 million in projects that will enhance America's energy security and strengthen our economy.


Grand Blanc Generating Station Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Grand Blanc Generating Station Biomass Facility Grand Blanc Generating Station Biomass Facility Jump to: navigation, search Name Grand Blanc Generating Station Biomass Facility Facility Grand Blanc Generating Station Sector Biomass Facility Type Landfill Gas Location Genesee County, Michigan Coordinates 43.0777289°, -83.6773928° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.0777289,"lon":-83.6773928,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EA-1037: Uranium Lease Management Program, Grand Junction, Colorado |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

37: Uranium Lease Management Program, Grand Junction, Colorado 37: Uranium Lease Management Program, Grand Junction, Colorado EA-1037: Uranium Lease Management Program, Grand Junction, Colorado SUMMARY This EA evaluates the environmental impacts of the U.S. Department of Energy's Grand Junction Projects Office's proposal to maintain and preserve the nation's immediately accessible supply of domestic uranium and vanadium ores, to maintain a viable domestic mining and milling infrastructure required to produce and mill these ores, and to provide assurance of a fair monetary return to the U.S. Government. The Uranium Lease Management Program gives The Department of Energy the flexibility to continue leasing these lands. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD August 22, 1995


DOE Announces Awardees for the Industrial Energy Efficiency Grand Challenge  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Awardees for the Industrial Energy Efficiency Grand Awardees for the Industrial Energy Efficiency Grand Challenge DOE Announces Awardees for the Industrial Energy Efficiency Grand Challenge May 5, 2010 - 12:00am Addthis WASHINGTON, DC - The U.S. Department of Energy announced today that 48 research and development projects across the country have been selected as award winners of the Industrial Energy Efficiency Grand Challenge. The grantees will receive a total of $13 million to fund the development of transformational industrial processes and technologies that can significantly reduce greenhouse gas emissions throughout the industrial sector. The funding will be matched by more than $5 million in private industry funding to support a total of $18 million in projects that will enhance America's energy security and strengthen our economy.


SunShot Grand Challenge Summit 2014 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SunShot Grand Challenge Summit 2014 SunShot Grand Challenge Summit 2014 SunShot Grand Challenge Summit 2014 May 19, 2014 8:00AM PDT to May 22, 2014 5:00PM PDT Anaheim, California Hilton Anaheim The DOE SunShot Initiative Grand Challenge Summit 2014 will bring together more than 800 members of the solar community including SunShot-funded project teams, industry leaders, innovative researchers and scientists, and local, state and federal government policymakers to review the progress made and discuss the challenges ahead to make solar energy more affordable and widespread across America. The event will include activities that celebrate the accomplishments across more than 250 SunShot-funded projects and discuss the path forward for the U.S. solar energy industry. Plenary Sessions and Keynote Speakers - Top leaders from business,


Saft America Advanced Batteries Plant Celebrates Grand Opening in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Saft America Advanced Batteries Plant Celebrates Grand Opening in Saft America Advanced Batteries Plant Celebrates Grand Opening in Jacksonville Saft America Advanced Batteries Plant Celebrates Grand Opening in Jacksonville September 16, 2011 - 12:30pm Addthis Department of Energy Investment Helps Support Job Creation, U.S. Economic Competitiveness and Advanced Vehicle Industry WASHINGTON, D.C. - Today, Secretary Steven Chu joined with Saft America to announce the grand opening of the company's Jacksonville, Florida, factory, which will produce advanced lithium-ion batteries to power electric vehicles and other applications. Saft America estimates it will create nearly 280 permanent jobs at the factory, and the city of Jacksonville expects an additional 800 indirect jobs to be created within its community. The project has created or preserved an estimated 300


Alpine Extensional Detachment Tectonics In The Grande Kabylie Metamorphic  

Open Energy Info (EERE)

Extensional Detachment Tectonics In The Grande Kabylie Metamorphic Extensional Detachment Tectonics In The Grande Kabylie Metamorphic Core Complex Of The Maghrebides (Northern Algeria) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Alpine Extensional Detachment Tectonics In The Grande Kabylie Metamorphic Core Complex Of The Maghrebides (Northern Algeria) Details Activities (0) Areas (0) Regions (0) Abstract: The Maghrebides are part of the peri-Mediterranean Alpine orogen. They expose in their inner zone inliers of high-grade crystalline rocks surrounded by Oligo-Miocene and younger Miocene cover. Detailed mapping coupled with structural and petrological investigations in the Grande Kabylie massif, and the reinterpretation of the available geochronological data, allow us to refute the traditional concept of rigid behaviour of this


Empowering First Year Students by Immersion in a 'Grand Challenges'  

Science Conference Proceedings (OSTI)

Apr 19, 2010 ... Interestingly, this preceded the National Academy of Engineering Grand ... Within their lifetime they will witness burgeoning needs in energy resources, ... to statistics, environmental studies, to history and philosophyin...


SunShot Grand Challenge Highlights Ambitious Efforts along the...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu also announced a nationwide competition to drive down the cost of rooftop solar energy system. The SunShot Grand Challenge: Summit and Technology Forum kicked off in...


Vehicle Technologies Office: EV Everywhere Grand Challenge: DOE...  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE's 10-Year Vision for Plug-in Electric Vehicles to someone by E-mail Share Vehicle Technologies Office: EV Everywhere Grand Challenge: DOE's 10-Year Vision for Plug-in...


Wintertime Boundary Layer Structure in the Grand Canyon  

Science Conference Proceedings (OSTI)

Wintertime temperature profiles in the Grand Canyon exhibit a neutral to isothermal stratification during both daytime and nighttime, with only rare instances of actual temperature inversions. The canyon warms during daytime and cools during ...

C. David Whiteman; Shiyuan Zhong; Xindi Bian



Cambridge Grand Junction transit implementation : alternatives, scheduling, cost, and performance  

E-Print Network (OSTI)

The Grand Junction railroad lies at the heart of East Cambridge adjacent to the Kendall Square business district and the Massachusetts Institute of Technology campus. Over the last one hundred years the railroad has gone ...

Iglesias Cuervo, Jesus



Microsoft Word - GrandCoulee_FinalEA_CommentResponses.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grand Coulee's Third Powerplant Grand Coulee's Third Powerplant 500-kilovolt Transmission Line Replacement Project Revision Sheet for the Environmental Assessment Finding of No Significant Impact Mitigation Action Plan DOE/EA-1679 December 2011 Grand Coulee's Third Powerplant 500-kV Transmission Line Replacement Project Revision Sheet for the Environmental Assessment 2 SUMMARY This revision sheet documents the changes to be incorporated into the Grand Coulee's Third Powerplant 500-kilovolt (kV) Transmission Line Replacement Project Preliminary Environmental Assessment (EA). With the addition of these changes, the Preliminary EA will not be reprinted and will serve as the Final EA. On May 2, 2011, the Preliminary EA was sent to agencies and interested parties.


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - CX-GrandCoulee-Creston_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5, 2011 5, 2011 REPLY TO ATTN OF: KEPR-Bell-1 SUBJECT: Environmental Clearance Memorandum Robert Keudell Robert Zeller Lineman Foreman III - TFWK-Grand Coulee Lineman Foreman I - TFWK-Grand Coulee Proposed Action: Selected wood pole replacement and minor access road maintenance along the Grand Coulee-Creston transmission line at miles 14, 15, 21 and 28. PP&A Project No: 1828 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance activities...for structures, rights of way, infrastructures such as roads, equipment...routine maintenance activities, corrective....are required to maintain... infrastructures... in a condition suitable for a facility to be used for its designed purpose.


Grand Ridge Elementary Wind Project | Open Energy Information  

Open Energy Info (EERE)

Grand Ridge Elementary Wind Project Grand Ridge Elementary Wind Project Facility Grand Ridge Elementary Sector Wind energy Facility Type Community Wind Location WA Coordinates 47.545883°, -122.005714° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.545883,"lon":-122.005714,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fernald Preserve Visitors Center Grand Opening and LEED Platinum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fernald Preserve Visitors Center Grand Opening and LEED Platinum Fernald Preserve Visitors Center Grand Opening and LEED Platinum Certification Fernald Preserve Visitors Center Grand Opening and LEED Platinum Certification October 16, 2008 - 4:14pm Addthis Remarks as Prepared for Acting Deputy Secretary Kupfer Thank you, Mike, for that introduction and to both you and Jane for hosting this event. You both have been instrumental in the dramatic transformation of this site. We made a commitment more than a decade ago to do three things here at Fernald: to close it, to clean it up and to give it back to the community. I'm proud to say we have fulfilled that commitment safely and ahead of schedule. Less than two years ago, I was here with Secretary Bodman as he announced the completion of a $4.4 billion clean up operation. Since then, we have


Grand Marais PUC - Residential Energy Efficiency Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grand Marais PUC - Residential Energy Efficiency Rebate Program Grand Marais PUC - Residential Energy Efficiency Rebate Program Grand Marais PUC - Residential Energy Efficiency Rebate Program < Back Eligibility Commercial Residential Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Appliances & Electronics Heat Pumps Commercial Lighting Lighting Program Info State Minnesota Program Type Utility Rebate Program Rebate Amount CFLs: $2/bulb or up to 50% of cost LEDs: $10 - $15/bulb Lighting Fixtures: $15 - $20/fixture Refrigerators: $25, plus $50 for recycling an old, working unit Freezers: $25, plus $50 for recycling an old, working unit Dishwashers: $25 Clothes Washers: $50 Dehumidifiers: $65 Room A/C: $25, plus $25 for recycling an old, working unit Central A/C: $100 - $200, plus additional rebate for efficiency ratings


GreenHunter Biodiesel Refinery Grand Opening | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GreenHunter Biodiesel Refinery Grand Opening GreenHunter Biodiesel Refinery Grand Opening GreenHunter Biodiesel Refinery Grand Opening June 2, 2008 - 12:51pm Addthis Remarks as Prepared for (Acting) Deputy Secretary Kupfer Today, Acting Deputy Secretary Jeffrey Kupfer delivered remarks at the launch of GreenHunter Energy's biodiesel refinery, which will be the nation's single largest biodiesel refinery, producing 105 million gallons of "white-water" B100 biodiesel per year. Thank you Gary. I'm pleased to join with Governor Perry, Congressmen Green and Lampson, and Mayor Garcia in celebrating this important occasion. Today, as we open the nation's largest biodiesel refinery, we reach another milestone in our effort to make America more energy secure. As you know, global energy demand is surging. We must act swiftly and aggressively to


Fernald Preserve Visitors Center Grand Opening and LEED Platinum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fernald Preserve Visitors Center Grand Opening and LEED Platinum Fernald Preserve Visitors Center Grand Opening and LEED Platinum Certification Fernald Preserve Visitors Center Grand Opening and LEED Platinum Certification October 16, 2008 - 4:14pm Addthis Remarks as Prepared for Acting Deputy Secretary Kupfer Thank you, Mike, for that introduction and to both you and Jane for hosting this event. You both have been instrumental in the dramatic transformation of this site. We made a commitment more than a decade ago to do three things here at Fernald: to close it, to clean it up and to give it back to the community. I'm proud to say we have fulfilled that commitment safely and ahead of schedule. Less than two years ago, I was here with Secretary Bodman as he announced the completion of a $4.4 billion clean up operation. Since then, we have


Moreau-Grand Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Moreau-Grand Electric Coop Inc Moreau-Grand Electric Coop Inc Jump to: navigation, search Name Moreau-Grand Electric Coop Inc Place South Dakota Utility Id 12915 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes ISO Other Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Commercial Industrial Small General Service Single Phase Commercial Small General Service Single Phase Well Commercial Small General Service Three Phase Commercial Average Rates Residential: $0.1090/kWh Commercial: $0.0798/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


City of Grand Junction, Iowa (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Grand Junction City of Grand Junction City of Place Iowa Utility Id 7486 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Operates Generating Plant Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Electric Commercial Demand Service Commercial Residential Eletric Residential Average Rates Residential: $0.1340/kWh Commercial: $0.1300/kWh Industrial: $0.0899/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Grand_Junction,_Iowa_(Utility_Company)&oldid=409673


Mutagenic potential of sediments from the Grand Calumet River  

Science Conference Proceedings (OSTI)

The Grand Calumet River/Indiana Harbor Canal is one of the International Joint Commission's Great Lakes Areas of Concern (AOC). Like many other AOCs, the Grand Calumet River is in a heavily industrialized area and has a history of chemical contamination. Many of the chemicals found in the industrial and municipal wastes that enter the waterway end up in sediment where they are concentrated to high levels. In order to assess the potential genotoxicity of sediments from the Grand Calumet River, the authors determined the mutagenic potential of organic extracts of sediments. The sediment extracts were assayed in the Salmonella/microsome mutagenicity test. In the Ames test, all ten sediment samples assayed were found to be mutagenic. In general, chemicals found in the sediments required metabolic activation before a positive mutagenic response was observed.

Maccubbin, A.E.; Ersing, N. (Roswell Park Cancer Inst., Buffalo, NY (United States))



Winners Announced for the NNSA Grand Challenge Competition | Department of  

NLE Websites -- All DOE Office Websites (Extended Search)

Winners Announced for the NNSA Grand Challenge Competition Winners Announced for the NNSA Grand Challenge Competition Winners Announced for the NNSA Grand Challenge Competition December 11, 2013 - 1:23pm Addthis President Carlton Brown of Clark Atlanta University pictured here with winning students junior Jules Henry (Electrical Engineering/Computer Science) and sophomore KeAndra Goodman (Electrical Engineering/Physics). President Carlton Brown of Clark Atlanta University pictured here with winning students junior Jules Henry (Electrical Engineering/Computer Science) and sophomore KeAndra Goodman (Electrical Engineering/Physics). Annie Whatley Annie Whatley Deputy Director, Office of Minority Economic Impact The first year of the Minority Serving Institution Partnership Program with the Department of Energy site Kansas City Plant was a fruitful one. The two


Grand Symmetry, Spectral Action, and the Higgs mass  

E-Print Network (OSTI)

In the context of the spectral action and the noncommutative geometry approach to the standard model, we build a model based on a larger symmetry. The latter satisfies all the requirements to have a noncommutative manifold, and mixes gauge and spin degrees of freedom without introducing extra fermions. With this "grand symmetry" it is natural to have the scalar field necessary to obtain the Higgs mass in the vicinity of 126 GeV. Requiring the noncommutative space to be an almost commutative geometry (i.e. the product of manifold by a finite dimensional internal space) gives conditions for the breaking of this grand symmetry to the standard model.

Agostino Devastato; Fedele Lizzi; Pierre Martinetti



"1. Grand Coulee","Hydroelectric","U S Bureau of Reclamation",7079  

U.S. Energy Information Administration (EIA) Indexed Site

Washington" Washington" "1. Grand Coulee","Hydroelectric","U S Bureau of Reclamation",7079 "2. Chief Joseph","Hydroelectric","USCE-North Pacific Division",2456 "3. Transalta Centralia Generation","Coal","TransAlta Centralia Gen LLC",1596 "4. Rocky Reach","Hydroelectric","PUD No 1 of Chelan County",1254 "5. Columbia Generating Station","Nuclear","Energy Northwest",1097 "6. Wanapum","Hydroelectric","PUD No 2 of Grant County",1059 "7. Boundary","Hydroelectric","Seattle City of",1040 "8. Priest Rapids","Hydroelectric","PUD No 2 of Grant County",932


Improving the sampling efficiency of the Grand Canonical Simulated Quenching approach  

SciTech Connect

Most common atomistic simulation techniques, like molecular dynamics or Metropolis Monte Carlo, operate under a constant interatomic Hamiltonian with a fixed number of atoms. Internal (atom positions or velocities) or external (simulation cell size or geometry) variables are then evolved dynamically or stochastically to yield sampling in different ensembles, such as microcanonical (NVE), canonical (NVT), isothermal-isobaric (NPT), etc. Averages are then taken to compute relevant physical properties. At least two limitations of these standard approaches can seriously hamper their application to many important systems: (1) they do not allow for the exchange of particles with a reservoir, and (2) the sampling efficiency is insufficient to allow the obtention of converged results because of the very long intrinsic timescales associated with these quantities. To fix ideas, one might want to identify low (free) energy configurations of grain boundaries (GB). In reality, grain boundaries are in contact the grains which act as reservoirs of defects (e.g., vacancies and interstitials). Since the GB can exchange particles with its environment, the most stable configuration cannot provably be found by sampling from NVE or NVT ensembles alone: one needs to allow the number of atoms in the sample to fluctuate. The first limitation can be circumvented by working in the grand canonical ensemble (TV ) or its derivatives (such as the semi-grand-canonical ensemble useful for the study of substitutional alloys). Monte Carlo methods have been the first to adapt to this kind of system where the number of atoms is allowed to fluctuate. Many of these methods are based on the Widom insertion method [Widom63] where the chemical potential of a given chemical species can be inferred from the potential energy changes upon random insertion of a new particle within the simulation cell. Other techniques, such as the Gibbs ensemble Monte Carlo [Panagiotopoulos87] where exchanges of particles are attempted to equilibrate the chemical potential between two cells and hence allow for the calculation of coexistence curves, exploit the same idea: particle insertion (or exchange) is attempted and accepted with a Metropolis-like rule that depends exponentially on the energy change upon insertion. A well known limitation of this kind of approach is that the probability of accepting such a move decreases extremely rapidly with increasing density, due to the extremely large short-range repulsion between atoms. In response to these difficulties it became apparent that a solution to the problem might be to avoid abrupt insertions but instead to proceed gradually, so as to allow the system to react and make way for the incoming particle. In this view of things, the 'occupation' of a certain atomic site can be viewed as a continuous variable, ranging between 0 and 1, representing 'how much' of the particle is present at any given time. These ideas proved ideal in Molecular Dynamics (MD) settings because equations of motions for these occupation variables can sometimes be obtained. For example, in the case of Grand Canonical Molecular Dynamics [Cagin91], one special particle is allowed to have a fractional occupation. This can lead to either its destruction (occupation = 0) or its complex creation (occupation = 1) so as to enforce a given chemical potential. These approaches proved useful, but mostly in the liquid state where the probability of successfully inserting a new particle is sufficiently high. At higher densities, convergence proved to be hampered by very inefficient sampling. In this work, we explore the use of a related MD-based grand canonical technique, the Grand Canonical Simulated Quenching (GCSQ) of Phillpot and Rickman [Phillpot92,Phillpot94], and explore its application to the grand canonical sampling of solid state systems. We show that, in conjunction with advanced sampling techniques, GCSQ can be a useful tool to sample conformations of complex systems, such as GBs, and assist in the identification of their most stable states and/or most likely d

Perez, Danny [Los Alamos National Laboratory; Vernon, Louis J. [Los Alamos National Laboratory



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



The verifying compiler: A grand challenge for computing research  

Science Conference Proceedings (OSTI)

This contribution proposes a set of criteria that distinguish a grand challenge in science or engineering from the many other kinds of short-term or long-term research problems that engage the interest of scientists and engineers. As an example drawn ...

Tony Hoare



The verifying compiler: a grand challenge for computing research  

Science Conference Proceedings (OSTI)

I propose a set of criteria which distinguish a grand challenge in science or engineering from the many other kinds of short-term or long-term research problems that engage the interest of scientists and engineers. As an example drawn from Computer Science, ...

Tony Hoare



Workshop and conference on Grand Challenges applications and software technology  

SciTech Connect

On May 4--7, 1993, nine federal agencies sponsored a four-day meeting on Grand Challenge applications and software technology. The objective was to bring High-Performance Computing and Communications (HPCC) Grand Challenge applications research groups supported under the federal HPCC program together with HPCC software technologists to: discuss multidisciplinary computational science research issues and approaches, identify major technology challenges facing users and providers, and refine software technology requirements for Grand Challenge applications research. The first day and a half focused on applications. Presentations were given by speakers from universities, national laboratories, and government agencies actively involved in Grand Challenge research. Five areas of research were covered: environmental and earth sciences; computational physics; computational biology, chemistry, and materials sciences; computational fluid and plasma dynamics; and applications of artificial intelligence. The next day and a half was spent in working groups in which the applications researchers were joined by software technologists. Nine breakout sessions took place: I/0, Data, and File Systems; Parallel Programming Paradigms; Performance Characterization and Evaluation of Massively Parallel Processing Applications; Program Development Tools; Building Multidisciplinary Applications; Algorithm and Libraries I; Algorithms and Libraries II; Graphics and Visualization; and National HPCC Infrastructure.



Overview of Rapid DNA Testing  

Science Conference Proceedings (OSTI)

... Recent Work with Rapid PCR At NIST we are working on new PCR methods ... Applications for Rapid PCR Integrated devices ('Lab on a Chip') ...



EA-1338: Transfer of the Department of Energy Grand Junction Office to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: Transfer of the Department of Energy Grand Junction Office 8: Transfer of the Department of Energy Grand Junction Office to Non-DOE Ownership, Grand Junction, Colorado EA-1338: Transfer of the Department of Energy Grand Junction Office to Non-DOE Ownership, Grand Junction, Colorado SUMMARY This EA evaluates the environmental impacts for the proposed transfer of real and personal property at the U.S. Department of Energy's Grand Junction Office to non-DOE ownership. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD April 25, 2000 EA-1338: Finding of No Significant Impact Transfer of the Department of Energy Grand Junction Office to Non-DOE Ownership April 25, 2000 EA-1338: Final Environmental Assessment Transfer of the Department of Energy Grand Junction Office to Non-DOE Ownership


Estimating commuter rail demand to Kendall Square along the Grand Junction Corridor  

E-Print Network (OSTI)

Since acquiring the Grand Junction Railroad in June 2010 from CSX, the Massachusetts Bay Transit Authority (MBTA) has explored the possibility of using the line for commuter rail service. In addition the Grand Junction ...

Bockelie, Adam


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


PP-33-1 and EA-33-A Rio Grande Electric Cooperative Inc | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

-1 and EA-33-A Rio Grande Electric Cooperative Inc PP-33-1 and EA-33-A Rio Grande Electric Cooperative Inc Rescission of Presidential Permit and Electricity Export Authorization...


Grande Ronde Basin Spring Chinook Salmon Captive Broodstock Program, 2008 Annual Report.  

DOE Green Energy (OSTI)

The Grande Ronde Basin Spring Chinook Salmon Captive Broodstock Program is designed to rapidly increase numbers of Chinook salmon in stocks that are in imminent danger of extirpation in Catherine Creek (CC), Lostine River (LR) and upper Grande Ronde River (GR). Natural parr are captured and reared to adulthood in captivity, spawned (within stocks) and their progeny reared to smoltification before being released into the natal stream of their parents. This program is co-managed by ODFW, National Marine Fisheries Service, Nez Perce Tribe and Confederated Tribes of the Umatilla Indian Reservation. Presmolt rearing was initially conducted at Lookingglass Fish Hatchery (LFH) but parr collected in 2003 and later were reared at Wallowa Fish Hatchery (WFH). Post-smolt rearing is conducted at Bonneville Fish Hatchery (BOH - freshwater) and at Manchester Research Station (MRS - saltwater). The CC and LR programs are being terminated, as these populations have achieved the goal of a consistent return of 150 naturally spawning adults, so the 2005 brood year was the last brood year collected for theses populations. The Grande Ronde River program continued with 300 fish collected each year. Currently, we are attempting to collect 150 natural parr and incorporate 150 parr collected as eggs from females with low ELISA levels from the upper Grande Ronde River Conventional Hatchery Program. This is part of a comparison of two methods of obtaining fish for a captive broodstock program: natural fish vs. those spawned in captivity. In August 2007, we collected 152 parr (BY 2006) from the upper Grande Ronde River and also have 155 Grande Ronde River parr (BY 2006) that were hatched from eyed eggs at LFH. During 2008, we were unable to collect natural parr from the upper Grande Ronde River. Therefore, we obtained 300 fish from low ELISA females from the upper Grande Ronde River Conventional Program. In October 2008 we obtained 170 eyed eggs from the upper Grande Ronde river Conventional Hatchery Program. We will attempt to collect natural parr in August 2009. This year 752 fish were removed from the captive population: 629 fish survived to gamete production and 123 fish died from various causes prior to spawning. Growth of the Captive Broodstock fish was similar to previous years. The saltwater fish have grown more slowly than those reared in freshwater. A total of 720 fish were sorted as maturing and 629 (87.4%) of them survived to spawn. We collected gametes from 273 females and 350 males from the 2002-2006 brood years in 2008, using 111 spawning matrices and collected 474,187 green eggs (1,737 eggs/female). All ripe males were spawned and no semen was collected for cryo-preservation. Of the 474,187 eggs collected for the BY 2008 F1 generation, 448,373 (94.6%) survived to the eyed stage. 68,612 (15.3%) were culled from females with high ELISA OD values for BKD prevention. For BY 2007, we collected a total of 477,048 eggs from all three populations and 407,369 (85.4%) reached the eyed stage, while 95,024 eyed eggs (23.3%) were culled for BKD prevention. Eyed eggs were hatched at Lookingglass Fish Hatchery, producing 267,131 fry. As parr, 153,371 fish were coded-wire tagged (CWT). For the 2006 F1 brood year, we collected 177,890 eggs and 149,073 (83.8%) reached the eyed stage. 83,826 eyed eggs (56.2%) were culled at the eyed stage for BKD prevention. 61,044 fry were produced (93.6%), 53,688 (88 %) survived to smolt. There were 54 bacterial kidney disease (BKD) mortalities at BOH and MRS, combined in this reporting period. Overall, there were fewer BKD mortalities in 2008 due to a reduced number of fish coming into the Captive Broodstock Program and a shift away from collecting wild parr to using eyed eggs from low ELISA females from the Conventional Hatchery Program. Unknown causes of death accounted for 32 deaths at MRS and BOH, combined in 2008. We continually examine and modify the operations of the Captive Broodstock Program to make improvements wherever possible. We continue to have difficulty with prevention and treatment of BKD outbreak

Hoffnagle, Timothy L.; Hair, Donald; Gee, Sally



Grand Traverse Band Renewable Energy Feasibility Study in Wind, Biomass and Solar  

DOE Green Energy (OSTI)

Renewable Energy Feasibility Study for wind, biomass, solar on the Grand Traverse Band tribal lands from 2005 - 2008

Suzanne McSawby, Project Director



Rapid road repair vehicle  

DOE Patents (OSTI)

Disclosed is a rapid road repair vehicle capable of moving over a surface to be repaired at near normal posted traffic speeds to scan for and find at the high rate of speed, imperfections in the pavement surface, prepare the surface imperfection for repair by air pressure and vacuum cleaning, applying a correct amount of the correct patching material to effect the repair, smooth the resulting repaired surface, and catalog the location and quality of the repairs for maintenance records of the road surface. The rapid road repair vehicle can repair surface imperfections at lower cost, improved quality, at a higher rate of speed than was not heretofor possible, with significantly reduced exposure to safety and health hazards associated with this kind of road repair activities in the past. 2 figs.

Mara, L.M.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


The Construction and Maintenance Plan for a Grand Banks Multi-Purpose Pipeline  

E-Print Network (OSTI)

The Construction and Maintenance Plan for a Grand Banks Multi-Purpose Pipeline D.W. (Don) Wilson, Director, North Atlantic Pipeline Partners, L.P. NOIA 2000 Conference June, 2000 #12;Grand Banks Multi-Purpose Pipeline Route January 2000 Grand Banks of Newfoundland Newfoundland Come by Chance St. John's Argentia 50o

Bruneau, Steve


A New Species of Parodia (Cactaceae, Notocacteae) from Rio Grande do Sul, Brazil  

E-Print Network (OSTI)

A New Species of Parodia (Cactaceae, Notocacteae) from Rio Grande do Sul, Brazil Marlon C. Machado Grande do Sul, Brazil. jlarocca@unisinos.br ABSTRACT . A new species, Parodia gaucha M. Machado & Larocca (Cactaceae, Notocacteae), from Encruzilhada do Sul, Rio Grande do Sul, Brazil, is described and illustrated

Zürich, Universität


Grand Forks, North Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Grand Forks, North Dakota: Energy Resources Grand Forks, North Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 47.9252568°, -97.0328547° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.9252568,"lon":-97.0328547,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GIS Data from LANL's Cerro Grande Rehabilitation Project (CGRP)  

DOE Data Explorer (OSTI)

The Los Alamos National Laboratorys Cerro Grande Rehabilitation Project (CGRP) involves many subprojects. One of them is a geographic information system for electronically storing and displaying geographically-related data about the fires effects. The data are used for research, planning, emergency response, and for informing the public. This website provides access to geospatial data relating to the May 2000 Cerro Grande Fire. This includes data generated by the Burned Area Emergency Rehabilitation (BAER) Team during and shortly after the fire as well as data resulting from the ongoing environmental monitoring programs related to the fire. These data are available from a data catalog in two forms: (i) direct download of individual geospatial files and (ii) image files.


East Grand St Bridge Snowmelt Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Bridge Snowmelt Low Temperature Geothermal Facility Bridge Snowmelt Low Temperature Geothermal Facility Jump to: navigation, search Name East Grand St Bridge Snowmelt Low Temperature Geothermal Facility Facility East Grand St Bridge Sector Geothermal energy Type Snowmelt Location Laramie, Wyoming Coordinates 41.3113669°, -105.5911007° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Grand Ridge II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

II Wind Farm II Wind Farm Jump to: navigation, search Name Grand Ridge II Wind Farm Facility Grand Ridge II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Invenergy Developer Invenergy Energy Purchaser AEP-Appalachian Power Location La Salle County IL Coordinates 41.15496°, -88.750234° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.15496,"lon":-88.750234,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Grand Island, Nebraska (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Grand Island City of Grand Island City of Place Nebraska Utility Id 40606 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes RTO SPP Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Flood Lighting Lighting Commercial Rate- Single Phase Commercial Commercial Rate- Three Phase Commercial Residential Rate Residential Three Phase Power Service Industrial


City of Grand Haven, Michigan (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Grand Haven Grand Haven Place Michigan Utility Id 7483 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Space Lighting Service - 100 Watt Lighting Area Space Lighting Service - 1000 Watt Lighting Area Space Lighting Service - 175 Watt Mercury Vapor Lighting Area Space Lighting Service - 400 Watt Mercury Vapor Lighting Area Space Lighting Service - Metal Halide 175 Watt Lighting


Arroyo Grande, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Arroyo Grande, California: Energy Resources Arroyo Grande, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 35.1185868°, -120.5907252° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.1185868,"lon":-120.5907252,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rio Grande Electric Coop, Inc (New Mexico) | Open Energy Information  

Open Energy Info (EERE)

New Mexico) New Mexico) Jump to: navigation, search Name Rio Grande Electric Coop, Inc Place New Mexico Utility Id 16057 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1560/kWh Commercial: $0.1630/kWh Industrial: $0.1170/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File2_2010" Retrieved from "http://en.openei.org/w/index.php?title=Rio_Grande_Electric_Coop,_Inc_(New_Mexico)&oldid=412780" Categories: EIA Utility Companies and Aliases Utility Companies Organizations Stubs What links here


Volume terms for charged colloids: a grand-canonical treatment  

E-Print Network (OSTI)

We present a study of thermodynamic properties of suspensions of charged colloids on the basis of linear Poisson-Boltzmann theory. We calculate the effective Hamiltonian of the colloids by integrating out the ionic degrees of freedom grand-canonically. This procedure not only yields the well-known pairwise screened-Coulomb interaction between the colloids, but also additional volume terms which affect the phase behavior and the thermodynamic properties such as the osmotic pressure. These calculations are greatly facilitated by the grand-canonical character of our treatment of the ions, and allow for relatively fast computations compared to earlier studies in the canonical ensemble. Moreover, the present derivation of the volume terms are relatively simple, make a direct connection with Donnan equilibrium, yield an explicit expression for the effective screening constant, and allow for extensions to include, for instance, nonlinear effects.

Bas Zoetekouw; Rene van Roij



Chattanooga Eagle Ford Rio Grande Embayment Texas- Louisiana-  

U.S. Energy Information Administration (EIA) Indexed Site

Rio Grande Rio Grande Embayment Texas- Louisiana- Mississippi Salt Basin Uinta Basin Appa lachia n Basin Utica Marcellus Devonian (Ohio) Antrim Barnett Bend New Albany Woodford Barnett- Woodford Lewis Hilliard- Baxter- Mancos Excello- Mulky Fayetteville Floyd- Neal Gammon Cody Haynesville Hermosa Mancos Pierre Conasauga Woodford- Caney Pearsall- Eagle Ford Michigan Basin Ft. Worth Basin Palo Duro Basin Permian Basin Illinois Basin Anadarko Basin Greater Green River Basin Cherokee Platform San Juan Basin Williston Basin Black Warrior Basin A r d m o r e B a s i n Paradox Basin Raton Basin Maverick Sub-Basin Montana Thrust Belt Marfa Basin Valley and Ridge Province Arkoma Basin Forest City Basin Piceance Basin Shale Gas Plays, Lower 48 States 0 200 400 100 300 Miles ± Source: Energy Information Administration based on data from various published studies


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Energy Coalition Michigan Green Fleets Upgrade to existing compressed natural gas (CNG) refueling station in Grand Rapids, MI. This CX form is for 1 location in this project...

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Field Studies of Geothermal Reservoirs Rio Grande Rift, New Mexico  

DOE Green Energy (OSTI)

The Rio Grande rift provides an excellent field laboratory to study the nature of geothermal systems in an extensional environment. Much of the geologic complexity that is found in the Basin and Range is absent because the rift is located on cratonic crust with a thin and well-characterized Phanerozoic stratigraphy and tectonic history. On the other hand, the Neogene thermo-tectonic history of the rift has many parallels with the Basin and Range to the west. The geology of the southern Rio Grande rift is among the best characterized of any rift system in the world. Also, most geologic maps for the region are rather unique in that detailed analyses of Quaternary stratigraphic and surficial unit are added in concert with the details of bedrock geology. Pleistocene to Holocene entrenchment of the Rio Grande and tributaries unroofs the alteration signatures and permeability attributes of paleo outflow plumes and upflow zones, associated with present-day, but hidden or ''blind,'' hydrothermal systems at Rincon and San Diego Mountain.

James C Witcher



Environmental assessment of facility operations at the U.S. Department of Energy Grand Junction Projects Office, Grand Junction, Colorado  

SciTech Connect

The US Department of Energy (DOE) has prepared a sitewide environmental assessment (EA) of the proposed action to continue and expand present-day activities on the DOE Grand Junction Projects Office (GJPO) facility in Grand Junction, Colorado. Because DOE-GJPO regularly proposes and conducts many different on-site activities, DOE decided to evaluate these activities in one sitewide EA rather than in multiple, activity-specific documents. On the basis of the information and analyses presented in the EA, DOE has determined that the proposed action does not constitute a major Federal action significantly affecting the quality of the human environment, as defined by the National Environmental Policy Act (NEPA) of 1969. Therefore, preparation of an environmental impact statement is not required for facility operations, and DOE is issuing this Finding of No Significant Impact (FONSI).




UMTRA project water sampling and analysis plan, Grand Junction, Colorado  

Science Conference Proceedings (OSTI)

Surface remedial action will be completed at the Grand Junction processing site during the summer of 1994. Results of 1993 water sampling indicate that ground water flow conditions and ground water quality at the processing site have remained relatively constant with time. Uranium concentrations in ground water continue to exceed the maximum concentration limits, providing the best indication of the extent of contaminated ground water. Evaluation of surface water quality of the Colorado River indicate no impact from uranium processing activities. No compliance monitoring at the Cheney disposal site has been proposed because ground water in the Dakota Sandstone (uppermost aquifer) is classified as limited-use (Class 111) and because the disposal cell is hydrogeologically isolated from the uppermost aquifer. The following water sampling and water level monitoring activities are planned for calendar year 1994: (i) Semiannual (early summer and late fall) sampling of six existing monitor wells at the former Grand Junction processing site. Analytical results from this sampling will be used to continue characterizing hydrogeochemical trends in background ground water quality and in the contaminated ground water area resulting from source term (tailings) removal. (ii) Water level monitoring of approximately three proposed monitor wells projected to be installed in the alluvium at the processing site in September 1994. Data loggers will be installed in these wells, and water levels will be electronically monitored six times a day. These long-term, continuous ground water level data will be collected to better understand the relationship between surface and ground water at the site. Water level and water quality data eventually will be used in future ground water modeling to establish boundary conditions in the vicinity of the Grand Junction processing site. Modeling results will be used to help demonstrate and document the potential remedial alternative of natural flushing.

Not Available



Gravitational Collapse and Radiation of Grand Unified Theory  

E-Print Network (OSTI)

The infinite gravitational collapse of any supermassive stars should pass through an energy scale of the grand unified theory (GUT). After nucleon-decays, the supermassive star will convert nearly all its mass into energy, and produce the radiation of GUT. It may probably explain some ultrahigh energy puzzles in astrophysics, for example, quasars and gamma-ray bursts (GRB), etc. This is similar with a process of the Big Bang Universe with a time-reversal evolution in much smaller space scale and mass scale. In this process the star seems be a true white hole.

Yi-Fang Chang



Grande Ronde Basin Fish Habitat Enhancement Project : 2000 Annual Report.  

DOE Green Energy (OSTI)

On July 1, 1984 the Bonneville Power Administration and the Oregon Department of Fish and Wildlife entered into an agreement to initiate fish habitat enhancement work in the Joseph Creek subbasin of the Grande Ronde River Basin in northeast Oregon. In July of 1985 the Upper and Middle Grande Ronde River, and Catherine Creek subbasins were included in the intergovernmental contract, and on March 1, 1996 the Wallowa River subbasin was added. The primary goal of ''The Grande Ronde Basin Fish Habitat Enhancement Project'' is to access, create, improve, protect, and restore riparian and instream habitat for anadromous salmonids, thereby maximizing opportunities for natural fish production within the basin. This project provided for implementation of Program Measure 703 (C)(1), Action Item 4.2 of the Northwest Power Planning Council's Columbia River Basin Fish and Wildlife Program (NPPC, 1987), and continues to be implemented as offsite mitigation for mainstem fishery losses caused by the Columbia River hydro-electric system. All work conducted by the Oregon Department of Fish and Wildlife is on private lands and therefore requires that considerable time be spent developing rapport with landowners to gain acceptance of, and continued cooperation with this program throughout 10-15 year lease periods. This project calls for passive regeneration of habitat, using riparian enclosure fencing as the primary method to restore degraded streams to a normative condition. Active remediation techniques using plantings, off-site water developments, site-specific instream structures, or whole channel alterations are also utilized where applicable. Individual projects contribute to and complement ecosystem and basin-wide watershed restoration efforts that are underway by state, federal, and tribal agencies, and local watershed councils. Work undertaken during 2000 included: (1) Implementing 2 new projects in the Grande Ronde drainage, and retrofitting one old project that will protect an additional 1.3 miles of stream and 298.3 acres of habitat; (2) Conducting instream work activities in 3 streams to enhance habitat and/or restore natural channel dimensions, patterns or profiles; (3) Improving fish passage in Bear Creek to restore tributary and mainstem access; (4) Planting and seeding 6.7 stream miles with 7,100 plants and 365 lbs. of seed; (5) Establishing 18 new photopoints and retaking 229 existing photopoint pictures; (6) Monitoring stream temperatures at 12 locations on 6 streams; (7) completing riparian fence, water gap and other maintenance on 98.7 miles of project fences. Since initiation of the project in 1984 over 62 miles of anadromous fish bearing streams and 1,910 acres of habitat have been protected, enhanced and maintained.

McGowan, Vance R.; Powell, Russ M.; Stennfeld, Scott P.



Grande Ronde Endemic Spring Chinook Project - ODFW, 2008 Annual Report.  

DOE Green Energy (OSTI)

Core activities of the Grande Ronde Endemic Spring Chinook Supplementation Program (GRESCSP) are funded through the authority of the Lower Snake River Fish and Wildlife Compensation Plan (LSRCP). The LSRCP program was approved by the Water Resources Development Act of 1976, PL 94-587, Section 102, 94th Congress substantially in accordance with the Special Report, LSRCP, June 1975 on file with the Chief of Engineers. The LSRCP was prepared and submitted in compliance with the Fish and Wildlife Coordination Act of 1958, PL 85-624, 85th Congress, August 12, 1958 to mitigate for the losses of fish and wildlife caused by the construction of dams on lower Snake River. The GRESCSP is an artificial propagation program that was initiated by Bonneville Power Administrations Fish and Wildlife program in the mid 1990's. The intent of this program was to change the mitigation aspect of the LSRCP program (harvest mitigation) to an integrated supplementation program; inasmuch as, hatchery produced fish could be experimentally used as a recovery tool and fish surplus to mitigation would be available for in-place and in-kind harvest. Fish production is still authorized by the LSRCP with the original mitigation return goal of 5,860 adult spring Chinook to the project area. The GRESCSP was developed with two primary components: (1) conventional broodstock (projects 199800702; 199800703; 199800704) and (2) captive brood (projects 199801001; 199801006). The GRESCSP relies on cooperative M&E efforts from the LSRCP including setting aside the Wenaha and Minam tributaries as natural production reserves components used for reference streams. The GRESCSP, coordinated with federal and tribal partners, identifies production levels for both propagation components and weir management strategies for each of the three supplemented tributary areas within the Grande Ronde Sub-basin. The three supplemented areas are Catherine Creek, Lostine River, and upper Grande Ronde River. Lookingglass Creek, an extirpated area, will be stocked (smolts and adults) with Catherine Creek origin salmon to initiate natural production in unseeded habitat, and to initiate future harvest opportunities. The current production levels have been incorporated into the U.S. v. Oregon Interim Management Agreement. The purpose of this contract is to integrate Bonneville Power Administration (BPA) efforts with the Lower Snake River Compensation Plan (LSRCP) program utilizing Lookingglass Hatchery as the primary rearing facility. BPA constructed an adult holding and spawning structure on the hatchery grounds; however, maintenance of this infrastructure was discontinued due to funding limitation and transferred to the LSRCP program in 2007. These integrated efforts focus on holding and spawning adults, rearing juveniles, fish health, and monitoring natural production (Redd counts) for Catherine Creek, Lostine River, and Upper Grande Ronde stocks.

Patterson, Scott



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


SunShot Grand Challenge Highlights Ambitious Efforts along the Entire Solar  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SunShot Grand Challenge Highlights Ambitious Efforts along the SunShot Grand Challenge Highlights Ambitious Efforts along the Entire Solar Spectrum SunShot Grand Challenge Highlights Ambitious Efforts along the Entire Solar Spectrum June 13, 2012 - 5:30pm Addthis Energy Secretary Steven Chu gives the keynote address at the SunShot Grand Challenge Summit in Denver, Colorado. | Photo by Dennis Schroeder/NREL. Energy Secretary Steven Chu gives the keynote address at the SunShot Grand Challenge Summit in Denver, Colorado. | Photo by Dennis Schroeder/NREL. Ramamoorthy Ramesh Former Director, SunShot Initiative & Solar Energy Technologies Program What are the key facts? Today at the SunShot Grand Challenge Summit Energy Secretary Chu announced up to $8 million to support clean energy startups. Secretary Chu also announced a nationwide competition to drive down


A Grand Delta(96) x SU(5) Flavour Model  

E-Print Network (OSTI)

Recent results from the Daya Bay and RENO reactor experiments have measured the smallest lepton mixing angle and found it to have a value of theta_13 approximately 9 degrees. This result presents a new challenge for the existing paradigms of discrete flavour symmetries which attempt to describe all quark and lepton masses and mixing angles. Here we propose a Supersymmetric Grand Unified Theory of Flavour based on Delta(96) x SU(5), together with a U(1) x Z3 symmetry, including a full discussion of Delta(96) in a convenient basis. The Grand Delta(96) x SU(5) Flavour Model relates the quark mixing angles and masses in the form of the Gatto-Sartori-Tonin relation and realises the Georgi-Jarlskog mass relations between the charged leptons and down-type quarks. We predict a Bi-trimaximal (not Tri-bimaximal) form of neutrino mixing matrix, which, after including charged lepton corrections with zero phase, leads to the following GUT scale predictions for the atmospheric, solar, and reactor mixing angles: theta_23=36...

King, Stephen F; Stuart, Alexander J



A Grand Delta(96) x SU(5) Flavour Model  

E-Print Network (OSTI)

Recent results from the Daya Bay and RENO reactor experiments have measured the smallest lepton mixing angle and found it to have a value of theta_13 approximately 9 degrees. This result presents a new challenge for the existing paradigms of discrete flavour symmetries which attempt to describe all quark and lepton masses and mixing angles. Here we propose a Supersymmetric Grand Unified Theory of Flavour based on Delta(96) x SU(5), together with a U(1) x Z3 symmetry, including a full discussion of Delta(96) in a convenient basis. The Grand Delta(96) x SU(5) Flavour Model relates the quark mixing angles and masses in the form of the Gatto-Sartori-Tonin relation and realises the Georgi-Jarlskog mass relations between the charged leptons and down-type quarks. We predict a Bi-trimaximal (not Tri-bimaximal) form of neutrino mixing matrix, which, after including charged lepton corrections with zero phase, leads to the following GUT scale predictions for the atmospheric, solar, and reactor mixing angles: theta_23=36.9 degrees, theta_12=32.7 degrees and theta_13=9.6 degrees, in good agreement with recent global fits, and a zero Dirac CP phase delta~0.

Stephen F. King; Christoph Luhn; Alexander J. Stuart



Geomorphology of plutonium in the Northern Rio Grande  

Science Conference Proceedings (OSTI)

Nearly all of the plutonium in the natural environment of the Northern Rio Grande is associated with soils and sediment, and river processes account for most of the mobility of these materials. A composite regional budget for plutonium based on multi-decadal averages for sediment and plutonium movement shows that 90 percent of the plutonium moving into the system is from atmospheric fallout. The remaining 10 percent is from releases at Los Alamos. Annual variation in plutonium flux and storage exceeds 100 percent. The contribution to the plutonium budget from Los Alamos is associated with relatively coarse sediment which often behaves as bedload in the Rio Grande. Infusion of these materials into the main stream were largest in 1951, 1952, 1957, and 1968. Because of the schedule of delivery of plutonium to Los Alamos for experimentation and weapons manufacturing, the latter two years are probably the most important. Although the Los Alamos contribution to the entire plutonium budget was relatively small, in these four critical years it constituted 71--86 percent of the plutonium in bedload immediately downstream from Otowi.

Graf, W.L. [Arizona Univ., Tempe, AZ (United States). Dept., of Geography] Arizona Univ., Tempe, AZ (United States). Dept., of Geography



2011 Annual Planning Summary for Office of Legacy Management (LM), Grand Junction (See LM APS)  

Energy.gov (U.S. Department of Energy (DOE))

The ongoing and projected Environmental Assessments and Environmental Impact Statements for 2011 and 2012 within the Office of Legacy Management (LM), Grand Junction (See LM APS).


EA-1679: Grand Coulee's Third Powerplant 500-kV Transmission...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

environmental impacts from the construction and operation of six new 500-kV overhead transmission lines to replace six existing underground lines at Grand Coulee Dam. DOE's...


Realistic Financial Planning and Rapid  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rapid Modification to Project Execution are Essential PMLL Identifier: PMLL-2010-LLNL-NIF-0001 (Source: User Submitted) Validator: Victoria Pratt Date: 4272010 Contact:...


Integrated Reservoir Characterization: Offshore Louisiana, Grand Isle Blocks 32 & 33  

E-Print Network (OSTI)

This thesis integrated geology, geophysics, and petroleum engineering data to build a detailed reservoir characterization models for three gas pay sands in the Grand Isle 33 & 43 fields, offshore Louisiana. The reservoirs are Late Miocene in age and include the upper (PM), middle (QH), and lower (RD) sands. The reservoir models address the stratigraphy of the upper (PM) sand and help delineate the lower (RD) reservoir. In addition, this research addresses the partially depleted QH-2 reservoir compartment. The detailed models were constructed by integrating seismic, well log, and production data. These detailed models can help locate recoverable oil and gas that has been left behind. The upper PM model further delineated that the PM sand has several areas that are shaled-out effectively creating a flow barrier within reservoir compartments. Due to the barrier in the PM-1 reservoir compartment, an area of potentially recoverable hydrocarbons remains. In Grand Isle 33, the middle QH sand was partially depleted in the QH-2 reservoir compartment by a series of development wells. Bottom hole pressure data from wells in Grand Isle 32 & 33 reveal that the two QH fault compartments are in communication across a leaking fault. Production wells in the QH-1 compartment produced reserves from the QH-2 compartment. The lower RD sand model helped further delineate the reservoir in the RD-2 compartment and show that this compartment has been depleted. The RD model also shows the possible presence of remaining recoverable hydrocarbons in the RD-1 compartment. It is estimated that about 6.7 billion cubic feet of gas might remain within this reservoir waiting to be recovered. A seismic amplitude anomaly response from the QH and RD sands is interpreted to be a lithologic indicator rather than the presence of hydrocarbons. Amplitude response from the PM level appears to be below the resolution of the seismic data. A synthetic seismogram model was generated to represent the PM and surrounding sands. This model shows that by increasing the frequency of the seismic data from 20 Hz to a dominant frequency of 30 Hz that the PM and surrounding sands could be seismically resolvable. Also the PM-1 compartment has possible recoverable hydrocarbons of 1.5 billion cubic feet of gas remaining.

Casey, Michael Chase



Indias Grand Strategy:Some Preliminary Thoughts  

E-Print Network (OSTI)

for an eventual nuclear test later in the decade. Asprogram, including the 1974 nuclear test! Events of the pastits rapid decision to test nuclear weaponsmight indicate a

HOYT, Timothy D.



Grand Ridge III Wind Farm | Open Energy Information  

Open Energy Info (EERE)

III Wind Farm III Wind Farm Facility Grand Ridge III Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Invenergy Developer Invenergy Energy Purchaser AEP-Appalachian Power Location La Salle County IL Coordinates 41.15496°, -88.750234° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.15496,"lon":-88.750234,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Grand Marais, Minnesota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Marais, Minnesota (Utility Company) Marais, Minnesota (Utility Company) Jump to: navigation, search Name City of Grand Marais Place Minnesota Utility Id 7487 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL - SINGLE PHASE Commercial COMMERCIAL - THREE PHASE Commercial DUAL FUEL(Single Phase) DUAL FUEL(Three Phase) RESIDENTIAL - SINGLE PHASE Residential RESIDENTIAL - THREE PHASE Residential YARD LIGHT METERED Lighting YARD LIGHT UNMETERED Lighting

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Grand Valley Rrl Pwr Line, Inc | Open Energy Information  

Open Energy Info (EERE)

Pwr Line, Inc Pwr Line, Inc Jump to: navigation, search Name Grand Valley Rrl Pwr Line, Inc Place Colorado Utility Id 7563 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial and Small Power Service, Three Phase Schedule (25)-CSP-1 Commercial Farm and Home (Residential) Service Schedule (10)-FH-1 Residential Industrial Service Schedule (50) -IND-1 Industrial Irrigation Service Schedule (40)-I-1 Commercial Large Power Service Schedule (30) -LP-1 Industrial Nonresidential - General Schedule (20)-NRG-1 Commercial


City of East Grand Forks, Minnesota (Utility Company) | Open Energy  

Open Energy Info (EERE)

Minnesota (Utility Company) Minnesota (Utility Company) Jump to: navigation, search Name East Grand Forks City of Place Minnesota Utility Id 5575 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Commercial Rate Commercial Off Peak Rates Commercial Residential Electric Heat Residential Residential General Electric Residential Small Commercial Rate Residential Average Rates Residential: $0.0943/kWh Commercial: $0.0740/kWh Industrial: $0.0789/kWh


EV Everywhere Grand Challenge - Electric Motors and Critical Materials Breakout  

NLE Websites -- All DOE Office Websites (Extended Search)

Electric Motors and Critical Electric Motors and Critical Materials Breakout Laura Marlino Oak Ridge National Laboratory Iver Anderson Ames Laboratory Facilitators July 24, 2012 EV Everywhere Grand Challenge Vehicle Technologies Program - Advanced Power Electronics and Electric Motors eere.energy.gov Electric Drive Status and Targets Current Status* PHEV 40** AEV 100** AEV 300+ System Cost $/kW 20 ($1100) 5 ($600) 14 ($1680) 4 ($600) Motor Specific Power kW/kg 1.3 1.9 1.5 2 PE Specific Power kW/kg 10.5 16 12 16.7 System Peak Efficiency % 90 97 91 98 2022 EV Everywhere Targets Extremely Aggressive Targets Especially Challenging for the Electric Motor * 55kW system ** 120kW system + 150 kW system Vehicle Technologies Program - Advanced Power Electronics and Electric Motors eere.energy.gov


Grande Ronde Basin Fish Habitat Enhancement Project : 2007 Annual Report.  

DOE Green Energy (OSTI)

On July 1, 1984 the Bonneville Power Administration and the Oregon Department of Fish and Wildlife entered into an intergovernmental contract to initiate fish habitat enhancement work in the Joseph Creek subbasin of the Grande Ronde River Basin in northeast Oregon. In 1985 the Upper and Middle Grande Ronde River, and Catherine Creek subbasins were included in the contract, and in 1996 the Wallowa River subbasin was added. The primary goal of 'The Grande Ronde Basin Fish Habitat Enhancement Project' is to create, protect, and restore riparian and instream habitat for anadromous salmonids, thereby maximizing opportunities for natural fish production within the basin. This project provided for implementation of Program Measure 703 (C)(1), Action Item 4.2 of the Northwest Power Planning Council's Columbia River Basin Fish and Wildlife Program (NPPC, 1987), and continues to be implemented as offsite mitigation for mainstem fishery losses caused by the Columbia River hydro-electric system. All work conducted by the Oregon Department of Fish and Wildlife and partners is on private lands and therefore requires that considerable time be spent developing rapport with landowners to gain acceptance of, and continued cooperation with this program throughout 10-15 year lease periods. Both passive and active restoration treatment techniques are used. Passive regeneration of habitat, using riparian exclosure fencing and alternate water sources are the primary method to restore degraded streams when restoration can be achieved primarily through changes in management. Active restoration techniques using plantings, bioengineering, site-specific instream structures, or whole stream channel alterations are utilized when streams are more severely degraded and not likely to recover in a reasonable timeframe. Individual projects contribute to and complement ecosystem and basin-wide watershed restoration efforts that are underway by state, federal, and tribal agencies, and coordinated by the Grande Ronde Model Watershed Program (Project. No.199202601). Work undertaken during 2007 included: (1) Starting 1 new fencing project in the NFJD subbasin that will protect an additional 1.82 miles of stream and 216.2 acres of habitat; (2) Constructing 0.47 miles of new channel on the Wallowa River to enhance habitat, restore natural channel dimensions, pattern and profile and reconnect approximately 18 acres of floodplain and wetland habitat; (3) Planting 22,100 plants along 3 streams totaling 3.6 stream miles; (4) Establishing 34 new photopoints on 5 projects and retaking 295 existing photopoint pictures; (5) Monitoring stream temperatures at 10 locations on 5 streams and conducting other monitoring activities; (6) Completing riparian fence, water gap and other maintenance on 116.8 miles of project fences; (7) Initiated writing of a comprehensive project summary report that will present a summary of conclusions of the benefits to focal species and management recommendations for the future. Since initiation of this program 56 individual projects have been implemented, monitored and maintained along 84.8 miles of anadromous fish bearing streams that protect and enhance 3,501 acres of riparian and instream habitat.

McGowan, Vance R.; Morton, Winston H.



Grand Ronde Basin Fish Habitat Enhancement Project, 2008 Annual Report.  

DOE Green Energy (OSTI)

On July 1, 1984 the Bonneville Power Administration and the Oregon Department of Fish and Wildlife entered into an intergovernmental contract to initiate fish habitat enhancement work in the Joseph Creek subbasin of the Grande Ronde River Basin in northeast Oregon. In 1985 the Upper and Middle Grande Ronde River, and Catherine Creek subbasins were included in the contract, and in 1996 the Wallowa River subbasin was added. The primary goal of 'The Grande Ronde Basin Fish Habitat Enhancement Project' is to create, protect, and restore riparian and instream habitat for anadromous salmonids, thereby maximizing the opportunities for natural fish production within the basin. This project originally provided for implementation of Program Measure 703 (C)(1), Action Item 4.2 of the Northwest Power Planning Council's Columbia River Basin Fish and Wildlife Program (NPPC, 1987), and continues to be implemented under revisions of the Fish and Wild Program as offsite mitigation for mainstem fishery losses caused by the Columbia River hydro-electric system. All work conducted by the Oregon Department of Fish and Wildlife and partners is on private lands and therefore requires considerable time be spent developing rapport with landowners to gain acceptance, and continued cooperation with this program throughout 10-15 year lease periods. Both passive and active restoration treatment techniques are used. Passive regeneration of habitat, using riparian exclosure fencing and alternate water sources, is the primary method to restore degraded streams when restoration can be achieved primarily through changes in management. Active restoration techniques using plantings, bioengineering, site-specific instream structures, or whole stream channel alterations are utilized when streams are more severely degraded and not likely to recover in a reasonable timeframe. Individual projects contribute to and complement ecosystem and basin-wide watershed restoration efforts that are underway by state, federal, and tribal agencies, and coordinated by the Grande Ronde Model Watershed Program (Project. No. 199202601). Work undertaken during 2008 included: (1) completing 1 new fencing project in the North Fork John Day subbasin that protects 1.82 miles of stream and 216.2 acres of habitat, and 1 fencing project in the Wallowa subbasin that protects an additional 0.59 miles of stream and 42.5 acres of habitat; (2) constructing 0.47 miles of new channel on the Wallowa river to enhance habitat, restore natural channel dimensions, pattern and profile and reconnect approximately 18 acres of floodplain and wetland habitat; (3) planting 10,084 plants along 0.5 miles of the Wallowa Riverproject; (4) establishing 34 new photopoints on 5 projects and retaking 295 existing photopoint pictures; (5) monitoring stream temperatures at 10 locations on 5 streams and conducting other monitoring activities; (6) completing riparian fence, water gap and other maintenance on 116.8 miles of project fences; and (7) completed a comprehensive project summary report to the Independent Scientific Review panel (ISRP) that provided our conclusions regarding benefits to focal species, along with management recommendations for the future. Since initiation of this program 57 individual projects have been implemented, monitoring and maintained along 84.9 miles of anadromous fish bearing streams, that protect and enhance 3,564 acres of riparian and instream habitat.

McGowan, Vance R.; Morton, Winston H. [Oregon Department of Fish and Wildlife



SU(5) x Z{sub 13} grand unification model  

SciTech Connect

We propose an SU(5) grand unified model with an invisible axion and the unification of the three coupling constants which is in agreement with the values, at M{sub Z}, of {alpha}, {alpha}{sub s}, and sin{sup 2}{theta}{sub W}. A discrete, anomalous, Z{sub 13} symmetry implies that the Peccei-Quinn symmetry is an automatic symmetry of the classical Lagrangian protecting, at the same time, the invisible axion against possible semiclassical gravity effects. Although the unification scale is of the order of the Peccei-Quinn scale the proton is stabilized by the fact that in this model the standard model fields form the SU(5) multiplets completed by new exotic fields and, also, because it is protected by the Z{sub 13} symmetry.

Dias, Alex G. [Centro de Ciencias Naturais e Humanas, Universidade Federal do ABC, Rua Santa Adelia 166, 09210-170, Santo Andre, SP (Brazil); Franco, Edison T.; Pleitez, Vicente [Instituto de Fisica Teorica, Universidade Estadual Paulista, Rua Pamplona 145, 01405-900, Sao Paulo, SP (Brazil)



An SU(5)$\\otimes$Z_{13} Grand Unification Model  

E-Print Network (OSTI)

We propose an SU(5) grand unified model with an invisible axion and the unification of the three coupling constants which is in agreement with the values, at $M_Z$, of $\\alpha$, $\\alpha_s$, and $\\sin^2\\theta_W$. A discrete, anomalous, $Z_{13}$ symmetry implies that the Peccei-Quinn symmetry is an automatic symmetry of the classical Lagrangian protecting, at the same time, the invisible axion against possible semi-classical gravity effects. Although the unification scale is of the order of the Peccei-Quinn scale the proton is stabilized by the fact that in this model the standard model fields form the SU(5) multiplets completed by new exotic fields and, also, because it is protected by the $Z_{13}$ symmetry.

Alex G. Dias; Edison T. Franco; Vicente Pleitez



A Graphical representation of the grand canonical partition function  

E-Print Network (OSTI)

In this paper we consider a stochastic partial differential equation defined on a Lattice $L_\\delta$ with coefficients of non-linearity with degree $p$. An analytic solution in the sense of formal power series is given. The obtained series can be re-expressed in terms of rooted trees with two types of leaves. Under the use of the so-called Cole-Hopf transformation and for the particular case $p=2$, one thus get the generalized Burger equation. A graphical representation of the solution and its logarithm is done in this paper. A discussion of the summability of the previous formal solutions is done in this paper using Borel sum. A graphical calculus of the correlation function is given. The special case when the noise is of L\\'evy type gives a simplified representations of the solution of the generalized Burger equation. From the previous results we recall a graphical representation of the grand canonical partition function.

Boubaker Smii



Higgs-boson effects in grand unified theories  

DOE Green Energy (OSTI)

It is argued that fine tuning of a minimal set of parameters, needed to fix the hierarchy of gauge-boson masses and a knowledge of intermediate symmetry groups, leads to ''natural'' mass scales for physical Higgs bosons in grand unified theories. This is applied to ..delta..B = 2 transitions in models based on SU(5), SO(10), SU(16), and (SU(2N))/sup 4/. It turns out that the Higgs bosons which mediate ..delta..B = 2 neutron-antineutron and hydrogen-antihydrogen oscillations become superheavy, and so such transitions can be observable only in theories with low unification scales, such as SU(16) and (SU(8))/sup 4/, if we adhere to the hypothesis of minimal fine tuning.

Mohapatra, R.N.; Senjanovic, G.



Heating facilities for the MGM Grand Hotel, Reno, Nevada  

SciTech Connect

The MGM Grand Hotel-Reno is located adjacent to an area with a well-documented geothermal resource. Currently, there is a number of entities seeking to determine the exact nature of the resource at the MGM site. This report concerns itself with identifying current natural gas loads within the MGM complex which could be met by geothermal should a source become available. The two principle assumptions upon which the following material is based are (1) that a source of 190/sup 0/F or higher temperature water is available and (2) all systems discussed would be installed in parallel with existing systems. That is, existing systems would remain in place providing 100 percent backup for the geothermal systems.



Is there a grand challenge or X-prize for data mining?  

Science Conference Proceedings (OSTI)

This panel will discuss possible exciting and motivating Grand Challenge problems for Data Mining, focusing on bioinformatics, multimedia mining, link mining, text mining, and web mining. Keywords: X-prize, bioinformatics, data mining, grand challenge, image mining, link mining, multimedia mining, text mining, video mining, web mining

Gregory Piatetsky-Shapiro; Robert Grossman; Chabane Djeraba; Ronen Feldman; Lise Getoor; Mohammed Zaki



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



An applied paleoecology case study: Bahia Grande, Texas prior to construction of the Brownsville Ship Channel  

E-Print Network (OSTI)

Bahia Grande is a large lagoon located within Laguna Atascosa National Wildlife Refuge in Cameron County, Texas. When the Brownsville Ship Channel was built along the southern end of the lagoon in 1936, Bahia Grande was cut off from the marine water of Laguna Madre. Since that time, Bahia Grande has been primarily dry with only ephemeral fresh water coming from heavy rainfall events, resulting in a severe decline in biological productivity. A restoration project led by the U.S. Fish and Wildlife Service has proposed to cut new channels between Bahia Grande and the Ship Channel to restore the connection with Laguna Madre. This is a large-scale project with major implications for the water quality, surrounding ecology, and associated biota in the region. Unfortunately, because very little is known about Bahia Grande prior to isolation, it is difficult to predict whether the results of the restoration will be comparable to the pre-Ship Channel environment. Paleoecological data provide the best opportunity to understand what Bahia Grande was like in the past. This study uses statistical analyses of the molluscan death assemblages from Bahia Grande to gain a better understanding of the environmental conditions in the lagoon before it was isolated. The first question addressed is how does Bahia Grande relate to other water bodies on the Texas coast? This may provide a modern analog to the past conditions in Bahia Grande. The second question inquires whether there are any local patterns or variations within Bahia Grande and several smaller surrounding lagoons. These results provide an important baseline for comparison with the restored lagoon. The results of this investigation show that, in a regional context, Bahia Grande was most similar to Alazan Bay and Baffin Bay, which are mostly enclosed shallow bays with high salinities due to the arid climate and limited freshwater inflow. Within Bahia Grande, there are several distinct molluscan assemblages. Salinity and water coverage are the most likely environmental factors responsible for the differences within Bahia Grande. Additionally, data from surrounding lagoons strongly indicate that some connections with Bahia Grande existed in the past.

Lichlyter, Stephen Alvah



Ground Gravity Survey At Rio Grande Rift Region (Aiken & Ander, 1981) |  

Open Energy Info (EERE)

Rio Grande Rift Region (Aiken & Ander, 1981) Rio Grande Rift Region (Aiken & Ander, 1981) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Ground Gravity Survey At Rio Grande Rift Region (Aiken & Ander, 1981) Exploration Activity Details Location Rio Grande Rift Geothermal Region Exploration Technique Ground Gravity Survey Activity Date Usefulness useful DOE-funding Unknown References Carlos L.V. Aiken, Mark E. Ander (1981) A Regional Strategy For Geothermal Exploration With Emphasis On Gravity And Magnetotellurics Retrieved from "http://en.openei.org/w/index.php?title=Ground_Gravity_Survey_At_Rio_Grande_Rift_Region_(Aiken_%26_Ander,_1981)&oldid=401473" Category: Exploration Activities What links here Related changes Special pages Printable version


Monitoring of the Airport Calibration Pads at Walker Field, Grand Junction,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Monitoring of the Airport Calibration Pads at Walker Field, Grand Monitoring of the Airport Calibration Pads at Walker Field, Grand Junction, Colorado, for Long-Term Radiation Variations (August 1978) Monitoring of the Airport Calibration Pads at Walker Field, Grand Junction, Colorado, for Long-Term Radiation Variations (August 1978) Monitoring of the Airport Calibration Pads at Walker Field, Grand Junction, Colorado, for Long-Term Radiation Variations (August 1978) Monitoring of the Airport Calibration Pads at Walker Field, Grand Junction, Colorado, for Long-Term Radiation Variations (August 1978) More Documents & Publications Field Calibration Facilities for Environmental Measurement of Radium, Thorium, and Potassium (October 2013) Long-Term Surveillance Operations and Maintenance Fiscal Year 2013 Year-End Summary Report


EA-1679: Grand Coulee's Third Powerplant 500-kV Transmission Line  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

79: Grand Coulee's Third Powerplant 500-kV Transmission Line 79: Grand Coulee's Third Powerplant 500-kV Transmission Line Replacement Project, Grant and Okanogon Counties, Washington EA-1679: Grand Coulee's Third Powerplant 500-kV Transmission Line Replacement Project, Grant and Okanogon Counties, Washington Summary This EA evaluates potential environmental impacts from the construction and operation of six new 500-kV overhead transmission lines to replace six existing underground lines at Grand Coulee Dam. DOE's Bonneville Power Administration (BPA), a cooperating agency, was asked by the U. S. Department of the Interior's Bureau of Reclamation to design and construct the proposed new transmission lines. A Finding of No Significant Impact was issued by BPA in December 2011. BPA website: http://efw.bpa.gov/environmental_services/Document_Library/Grand_Coulee/


Grand Junction, Colorado, Disposal Site Long-Term Surveillance and Maintenance Program Fact Sheet, July 2001  

Office of Legacy Management (LM)

Grand Junction Disposal Site Grand Junction Disposal Site Uranium ore was processed at the Climax millsite at Grand Junction, Colorado, between 1951 and 1970. The milling operations created process-related waste and tailings, a sandlike material containing radioactive materials and other contaminants. The tailings were an ideal and inexpensive construction material suitable for concrete, mortar, and fill. Accordingly, the tailings were widely used in the Grand Junction area for these purposes. The U.S. Department of Energy (DOE) encapsulated the tailings and other contaminated materials from the millsite and more than 4,000 vicinity properties in the Grand Junction area in an engineered disposal cell. Part of the disposal cell was completed in 1994; the remainder of the cell remains open until it is


Realistic Financial Planning and Rapid  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Realistic Financial Planning and Rapid Realistic Financial Planning and Rapid Modification to Project Execution are Essential PMLL Identifier: PMLL-2010-LLNL-NIF-0001 (Source: User Submitted) Validator: Victoria Pratt Date: 4/27/2010 Contact: 202-586-7358 Statement: Schedule and cost impacts can be reduced by accounting for potential annual funding delays as well as by adjusting project execution rapidly Discussion: The NIF Project was funding constrained, and planned (per Acquisition Executive direction) with the assumption that the full annual funding in the budget profile would be available early in October. Any delays or changes in the annual funding availability required extraordinary measures both for obtaining the funding required to avoid significant project impacts in a timely manner, and in rapidly adjusting project execution.


Rapid prototyping of green composites  

E-Print Network (OSTI)

Rapid prototyping employs digital fabrication techniques to quickly manufacture parts. However, the available materials are not yet suitable for making strong, large or durable objects. Composites are materials which are ...

Peek, Nadya (Nadya Meile)



Grand Challenges Grand Challenges  

Science Conference Proceedings (OSTI)

... adversely impact oceans, groundwater systems, streams ... Vulnerability of Interdependent ... interdependent systems, additional vulnerabilities can be ...


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...


Sheldon Glashow, the Electroweak Theory, and the Grand Unified Theory  

Office of Scientific and Technical Information (OSTI)

Sheldon Glashow and the Electroweak Theory Sheldon Glashow and the Electroweak Theory Resources with Additional Information Sheldon Glashow Courtesy AIP Emilio Segrè Visual Archives, Segrè Collection [Sheldon] 'Glashow shared the 1979 Nobel Prize for physics with Steven Weinberg and Abdus Salam for unifying the theories of weak and electromagnetic forces. The new "electroweak" theory underlies all of particle physics and provides a framework for understanding how the early universe evolved and how the chemical elements were created. ... "Glashow's work has been instrumental in our understanding of how our universe came into being," says Lawrence R. Sulak, chairman of the Boston University physics department. "In the years since winning the prize, Glashow has helped develop the Grand Unified Theory of all particles and all forces. Its predictions led to the construction of massive underground detectors, the refinement of the unification models, the first observation of neutrinos from a supernova, and the recent discovery that neutrinos have mass. Glashow has fueled an ongoing search for rare events and exotic effects that may shed further light on the evolution of the early universe."1


Grand challenge problems in environmental modeling and remediation: Groundwater contaminant transport. Final project report 1998  

SciTech Connect

The over-reaching goal of the Groundwater Grand Challenge component of the Partnership in Computational Science (PICS) was to develop and establish the massively parallel approach for the description of groundwater flow and transport and to address the problem of uncertainties in the data and its interpretation. This necessitated the development of innovative algorithms and the implementation of massively parallel computational tools to provide a suite of simulators for groundwater flow and transport in heterogeneous media. This report summarizes the activities and deliverables of the Groundwater Grand Challenge project funded through the High Performance Computing grand challenge program of the Department of Energy from 1995 through 1997.




Data Acquisition-Manipulation At Rio Grande Rift Region (Morgan, Et Al.,  

Open Energy Info (EERE)

Morgan, Et Al., Morgan, Et Al., 2010) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Data Acquisition-Manipulation At Rio Grande Rift Region (Morgan, Et Al., 2010) Exploration Activity Details Location Rio Grande Rift Geothermal Region Exploration Technique Data Acquisition-Manipulation Activity Date Usefulness useful regional reconnaissance DOE-funding Unknown Notes San Luis Basin (south-central CO) regional study. References Paul Morgan, Peter Barkmann, Charles Kluth, Matthew Sares (2010) Prospects For Electricity Generation In The San Luis Basin, Colorado, Usa Retrieved from "http://en.openei.org/w/index.php?title=Data_Acquisition-Manipulation_At_Rio_Grande_Rift_Region_(Morgan,_Et_Al.,_2010)&oldid=401472" Category: Exploration


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



How rapid is rapid prototyping? analysis of ESPADON programme results  

Science Conference Proceedings (OSTI)

New methodologies, engineering processes, and support environments are beginning to emerge for embedded signal processing systems. The main objectives are to enable defence industry to field state-of-the-art products in less time and with lower costs, ... Keywords: COTS, EDA tools, FPGA, beamformer, heterogeneous platform, model year, rapid prototyping

Bob K. Madahar; Ian D. Alston; Denis Aulagnier; Hans Schurer; Mark Thomas; Brigitte Saget



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Rapid DNA Testing Approaches for Reference Samples  

Science Conference Proceedings (OSTI)

... Page 12. Rapid PCR Protocols Rapid PCR with alternate polymerases ... 28 cycles = 19 min Rapid PCR Protocols: Thermal Cyclers 95oC 1 min 95oC ...



Biomass Rapid Analysis Network (BRAN)  

DOE Green Energy (OSTI)

Helping the emerging biotechnology industry develop new tools and methods for real-time analysis of biomass feedstocks, process intermediates and The Biomass Rapid Analysis Network is designed to fast track the development of modern tools and methods for biomass analysis to accelerate the development of the emerging industry. The network will be led by industry and organized and coordinated through the National Renewable Energy Lab. The network will provide training and other activities of interest to BRAN members. BRAN members will share the cost and work of rapid analysis method development, validate the new methods, and work together to develop the training for the future biomass conversion workforce.

Not Available



SunShot Shoots for the Moon with First Grand Challenge Event | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SunShot Shoots for the Moon with First Grand Challenge Event SunShot Shoots for the Moon with First Grand Challenge Event SunShot Shoots for the Moon with First Grand Challenge Event May 23, 2012 - 11:40am Addthis The Energy Department's SunShot Initiative focuses on making solar electricity cost-competitive by the end of the decade. | Photo courtesy of Dennis Schroeder/NREL. The Energy Department's SunShot Initiative focuses on making solar electricity cost-competitive by the end of the decade. | Photo courtesy of Dennis Schroeder/NREL. Ramamoorthy Ramesh Former Director, SunShot Initiative & Solar Energy Technologies Program How can I participate? The SunShot Initiative Grand Challenge: Summit and Technology Forum , taking place June 13 -14 in Denver, will focus on the progress made and challenges ahead for driving down the cost of solar technologies.


The SO2 Allowance Trading System: The Ironic History of a Grand Policy Experiment  

E-Print Network (OSTI)

Two decades have passed Two decades have passed since the Clean Air Act Amendments of 1990 launched a grand experiment in market-based environmental policy: the SO2 cap-and-trade system. That system performed well but ...

Schmalensee, Richard


Sierra Grande Lodge Pool & Spa Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Grande Lodge Pool & Spa Low Temperature Geothermal Facility Grande Lodge Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Sierra Grande Lodge Pool & Spa Low Temperature Geothermal Facility Facility Sierra Grande Lodge Sector Geothermal energy Type Pool and Spa Location Truth or Consequences, New Mexico Coordinates 33.1284047°, -107.2528069° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


EIS-0355: Remediation of the Moab Uranium Mill Tailings, Grand and San Juan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

355: Remediation of the Moab Uranium Mill Tailings, Grand and 355: Remediation of the Moab Uranium Mill Tailings, Grand and San Juan Counties, Utah EIS-0355: Remediation of the Moab Uranium Mill Tailings, Grand and San Juan Counties, Utah Summary The Remediation of the Moab Uranium Mill Tailings, Grand and San Juan Counties, Utah, Environmental Impact Statement and associated supplements and amendments provides information on the environmental impacts of the U.S. Department of Energy's (DOE's) proposal to (1) remediate approximately 11.9 million tons of contaminated materials located on the Moab site and approximately 39,700 tons located on nearby vicinity properties and (2) develop and implement a ground water compliance strategy for the Moab site using the framework of the Programmatic Environmental Impact Statement for the Uranium Mill Tailings Remedial Action Ground Water


Microsoft Word - CX-GrandCoulee-Bell3WestsideInsulatorRepAccessImprov_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mark Kjelland Mark Kjelland Project Manager - TEP-TPP-2 Proposed Action: Grand Coulee-Bell No. 3/Grand Coulee-Westside No. 1 double circuit 230-kV transmission line insulator replacement and access improvement project Budget Information: Work Order #00255064 PP&A Project No.: PP&A 1946 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance activities...for structures, rights-of-way, infrastructures such as roads, equipment... routine maintenance activities, corrective....are required to maintain... infrastructures...in a condition suitable for a facility to be used for its designated purpose. Proposed by: Bonneville Power Administration (BPA) Location: The proposed Grand Coulee-Bell No. 3/Grand Coulee-Westside No. 1 double circuit


A Preliminary Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand  

Open Energy Info (EERE)

Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand Canyon Of The Yellowstone River, Yellowstone Caldera, Wyoming Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: A Preliminary Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand Canyon Of The Yellowstone River, Yellowstone Caldera, Wyoming Details Activities (4) Areas (1) Regions (0) Abstract: Erosion in the Grand Canyon of the Yellowstone River, Yellowstone Caldera (640 ka), Wyoming, has exposed a cross section of older hydrothermal alteration in the canyon walls. The altered outcrops of the post-collapse tuff of Sulphur Creek (480 ka) extend from the canyon rim to more than 300 m beneath it. The hydrothermal minerals are zoned, with an advanced argillic alteration consisting of an association of quartz (opal)


The systemic and ideological sources of grand strategic doctrine : American foreign policy in the twentieth century  

E-Print Network (OSTI)

What explains the puzzling variation in America's foreign policy posture? This study proposes and tests a theory of American grand strategy that places an emphasis on two key variables: the ideological content of American ...

Green, Brendan Rittenhouse



Transport of a Power Plant Tracer Plume over Grand Canyon National Park  

Science Conference Proceedings (OSTI)

Meteorological and air-quality data, as well as surface tracer concentration values, were collected during 1990 to assess the impacts of Navajo Generating Station (NGS) emissions on Grand Canyon National Park (GCNP) air quality. These data have ...

Jun Chen; Robert Bornstein; Charles G. Lindsey



Monitoring Fine Sediment; Grande Ronde and John Day Rivers, 1999 Annual Report.  

DOE Green Energy (OSTI)

This project was initiated to monitor surface fine sediment levels and overwinter intrusion of fine sediment in spring chinook salmon spawning habitat in the North Folk John Day and Grande Ronde Rivers, for five years.

Rhodes, Jonathan J.; Greene, M. Jonas; Purser, Michael D. (Columbia River Inter-Tribal Fish Commission, Portland, OR)


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SunShot Shoots for the Moon with First Grand Challenge Event...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Centers Field Sites Power Marketing Administration Other Agencies You are here Home SunShot Shoots for the Moon with First Grand Challenge Event SunShot Shoots for the Moon with...


The great american navel : le grand roman amricain et le langage appropri.  

E-Print Network (OSTI)

??Ce mmoire a pour objectif d'analyser le phnomne du Grand Roman Amricain comme reprsentation de l'imaginaire national, en en faisant l'archologie. Je propose, partir (more)

Grenier, Daniel



Observations of Silver Iodide Plumes over the Grand Mesa of Colorado  

Science Conference Proceedings (OSTI)

A series of wintertime airborne tracing experiments was examined to determine some characteristics of the plumes of silver iodide smoke released either from the ground or from an aircraft over the Grand Mesa of Colorado. The plumes were ...

Edmond W. Holroyd III; Jack T. McPartland; Arlin B. Super



Aspects of the Load Circulation at the Grand Canyon during the Fall Season  

Science Conference Proceedings (OSTI)

The atmosphere and circulation of air within, above, and around the Grand Canyon of the Colorado River was studied from an instrumented aircraft and from ground-based instruments in September and October 1984. Several patterns were identified. ...

L. P. Stearns



Proceedings of the 45th IEEE Conference on Decision & Control Manchester Grand Hyatt Hotel  

E-Print Network (OSTI)

Proceedings of the 45th IEEE Conference on Decision & Control Manchester Grand Hyatt Hotel San towards these two goals utilizing a minimal 3-CMG array to provide 646% singularity-free momentum


Views from the River Front: Rio Grande Decision Makers Rank Water Conservation Strategies  

E-Print Network (OSTI)

This publication details the results of a survey of elected city officials and water managers in the Rio Grande River Basin of Texas and New Mexico. The participants ranked water conservation strategies for their communities.

Silvy, Valeen; Lesikar, Bruce J.



DOE/Grand Junction Office Bluewater LTSP July 1997 Doc. No. S00012AA, Page iii  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE/Grand Junction Office Bluewater LTSP DOE/Grand Junction Office Bluewater LTSP July 1997 Doc. No. S00012AA, Page iii Contents Page 1.0 Introduction .........................................................................................................................................1 1.1 Purpose ................................................................................................................................1 1.2 Legal and Regulatory Requirements .................................................................................. 1 1.3 Role of the Department of Energy ..................................................................................... 2 1.4 Disposal of Mill Waste Containing Polychlorinated Biphenyls ........................................ 2 2.0 Bluewater Disposal Site .....................................................................................................................



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Grande Ronde Basin Spring Chinook Salmon Captive Broodstock Program, 1995-2002 Summary Report.  

DOE Green Energy (OSTI)

The Grande Ronde Basin once supported large runs of chinook salmon Oncorhynchus tshawytscha and estimated peak escapements in excess of 10,000 occurred as recently as the late 1950's (U.S. Army Corps of Engineers 1975). Natural escapement declines in the Grande Ronde Basin have been severe and parallel those of other Snake River populations. Reduced productivity has primarily been attributed to increased mortality associated with downstream and upstream migration past eight dams and reservoirs in the Snake and Columbia rivers. Reduced spawner numbers, combined with human manipulation of previously important spawning and rearing habitat in the Grande Ronde Basin, have resulted in decreased spawning distribution and population fragmentation of chinook salmon in the Grande Ronde Basin (Figure 1; Table 1). Escapement of spring/summer chinook salmon in the Snake River basin included 1,799 adults in 1995, less than half of the previous record low of 3,913 adults in 1994. Catherine Creek, Grande Ronde River and Lostine River were historically three of the most productive populations in the Grande Ronde Basin (Carmichael and Boyce 1986). However, productivity of these populations has been poor for recent brood years. Escapement (based on total redd counts) in Catherine Creek and Grande Ronde and Lostine rivers dropped to alarmingly low levels in 1994 and 1995. A total of 11, 3 and 16 redds were observed in 1994 in Catherine Creek, upper Grande Ronde River and Lostine River, respectively, and 14, 6 and 11 redds were observed in those same streams in 1995. In contrast, the maximum number of redds observed in the past was 505 in Catherine Creek (1971), 304 in the Grande Ronde River (1968) and 261 in 1956 in the Lostine River (Tranquilli et al 2003). Redd counts for index count areas (a standardized portion of the total stream) have also decreased dramatically for most Grande Ronde Basin streams from 1964-2002, dropping to as low as 37 redds in the 119.5 km in the index survey areas in 1995 from as high as 1,205 redds in the same area in 1969 (Table 1). All streams reached low points (0-6 redds in the index areas) in the 1990's, except those in which no redds were found for several years and surveys were discontinued, such as Spring, Sheep and Indian creeks which had a total of 109 redds in 1969. The Minam and Wenaha rivers are tributaries of the Grande Ronde River located primarily in wilderness areas. Chinook salmon numbers in these two streams (based on redd counts) also decreased dramatically beginning in the early 1970's (Table 1). Since then there have been a few years of increasing numbers of redds but counts have generally been 25-40% of the number seen in the 1960's. No hatchery fish have been released into either of these streams and we monitor them during spawning ground surveys for the presence of hatchery strays. These populations will be used as a type of control for evaluating our supplementation efforts in Catherine Creek, upper Grande Ronde River and Lostine River. In this way, we can attempt to filter out the effects of downstream variables, over which we have no control, when we interpret the results of the captive broodstock program as the F1 and F2 generations spawn and complete their life cycles in the wild. The Grande Ronde Basin Captive Broodstock Program was initiated because these chinook salmon populations had reached critical levels where dramatic and unprecedented efforts were needed to prevent extinction and preserve any future options for use of endemic fish for artificial propagation programs for recovery and mitigation. This program was designed to quickly increase numbers of returning adults, while maintaining the genetic integrity of each endemic population.

Hoffnagle, Timothy; Carmichael, Richard; Noll, William



Bonneville Power Administration Grand Coulee-Bell 500-kV Transmission Line Project Record of Decision  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grand Coulee-Bell 500-kV Transmission Line Project Grand Coulee-Bell 500-kV Transmission Line Project Record of Decision Decision The Bonneville Power Administration (BPA) has decided to construct the proposed Grand Coulee-Bell 500-kV Transmission Line Project in Douglas, Grant, Lincoln, and Spokane Counties, Washington. BPA has decided to implement the proposed action identified in the Grand Coulee-Bell 500-kV Transmission Line Project Final Environmental Impact Statement (DOE/EIS-0344, December 2002). The proposed action consists of constructing a new 500- kilovolt (kV) transmission line between the Bureau of Reclamation's (BOR) Grand Coulee 500- kV Switchyard near Grand Coulee, Washington, and BPA's Bell Substation near Spokane, a distance of 84 miles. The proposed action involves removing an existing 115-kV transmission


Rapid thermal processing by stamping  

DOE Patents (OSTI)

A rapid thermal processing device and methods are provided for thermal processing of samples such as semiconductor wafers. The device has components including a stamp (35) having a stamping surface and a heater or cooler (40) to bring it to a selected processing temperature, a sample holder (20) for holding a sample (10) in position for intimate contact with the stamping surface; and positioning components (25) for moving the stamping surface and the stamp (35) in and away from intimate, substantially non-pressured contact. Methods for using and making such devices are also provided. These devices and methods allow inexpensive, efficient, easily controllable thermal processing.

Stradins, Pauls; Wang, Qi



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Microsoft Word - CX-GrandCoulee-OkanoganWP-AR-Landing_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REPLY TO ATTN OF: KEPR-Bell-1 SUBJECT: Environmental Cleareance Memorandum Jim Semrau Robert Keudell Road Engineer - TELF-TPP-3 Line Foreman III - TFWK-Grand Coulee Todd Wehner Robert Zellar Road Engineer - TELF-TPP-3 Line Foreman I - TFWK-Grand Coulee Proposed Action: Wood pole replacement, equipment landing construction and access road construction/maintenance along the Grand Coulee-Okanogan #2 115-kV transmission line right-of-way (ROW). PP&A Project No: 1776 Work Order No.: 275584 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021):  B1.13 Construction, acquisition, and relocation of onsite pathways and short onsite access roads and railroads.  B1.3 Routine maintenance activities...for structures, rights-of-way, infrastructures such


Energy Secretary Steven Chu to Attend Grand Opening of Recovery Act-Funded  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Attend Grand Opening of Recovery Attend Grand Opening of Recovery Act-Funded A123 Systems Battery Plant Energy Secretary Steven Chu to Attend Grand Opening of Recovery Act-Funded A123 Systems Battery Plant September 10, 2010 - 12:00am Addthis Washington D.C. - This Monday, U.S. Energy Secretary Steven Chu will speak at the dedication ceremony for the largest lithium-ion automotive battery production facility in North America. Funded in part by $249 million from the Recovery Act, the A123 Systems battery plant is expected to create 3,000 jobs in Michigan by 2012 and help to establish the U.S. as a global leader in the manufacturing of electric vehicles. Following his speech, the Secretary will tour the production facility and participate in a media availability with elected officials and representatives from A123 Systems.


UMTRA Project water sampling and analysis plan, Grand Junction, Colorado. Revision 1, Version 6  

Science Conference Proceedings (OSTI)

This water sampling and analysis plan describes the planned, routine ground water sampling activities at the Grand Junction US DOE Uranium Mill Tailings Remedial Action (UMTRA) Project site (GRJ-01) in Grand Junction, Colorado, and at the Cheney Disposal Site (GRJ-03) near Grand Junction. The plan identifies and justifies the sampling locations, analytical parameters, detection limits, and sampling frequencies for the routine monitoring stations at the sites. Regulatory basis is in the US EPA regulations in 40 CFR Part 192 (1994) and EPA ground water quality standards of 1995 (60 FR 2854). This plan summarizes results of past water sampling activities, details water sampling activities planned for the next 2 years, and projects sampling activities for the next 5 years.




EA-1950: Grand Coulee-Creston Transmission Line Rebuild; Grant and Lincoln  

NLE Websites -- All DOE Office Websites (Extended Search)

50: Grand Coulee-Creston Transmission Line Rebuild; Grant and 50: Grand Coulee-Creston Transmission Line Rebuild; Grant and Lincoln Counties, Washington EA-1950: Grand Coulee-Creston Transmission Line Rebuild; Grant and Lincoln Counties, Washington SUMMARY Bonneville Power Administration is preparing this EA to assess the potential environmental impacts of the proposed rebuild of approximately 28 miles of transmission line between the cities of Coulee Dam in Grant County and Creston in Lincoln County, Washington. The proposed project would include replacing all wood pole structures and conductor, improving existing access roads, and developing temporary access roads. Additional information is available at the project website: http://www.bpa.gov/goto/CouleeCrestonRebuild. PUBLIC COMMENT OPPORTUNITIES Draft EA: Comment Period Ends 2/3/14.


Energy Secretary Steven Chu to Attend Grand Opening of Recovery Act-Funded  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Steven Chu to Attend Grand Opening of Recovery Steven Chu to Attend Grand Opening of Recovery Act-Funded A123 Systems Battery Plant Energy Secretary Steven Chu to Attend Grand Opening of Recovery Act-Funded A123 Systems Battery Plant September 10, 2010 - 12:00am Addthis Washington D.C. - This Monday, U.S. Energy Secretary Steven Chu will speak at the dedication ceremony for the largest lithium-ion automotive battery production facility in North America. Funded in part by $249 million from the Recovery Act, the A123 Systems battery plant is expected to create 3,000 jobs in Michigan by 2012 and help to establish the U.S. as a global leader in the manufacturing of electric vehicles. Following his speech, the Secretary will tour the production facility and participate in a media availability with elected officials and representatives from A123 Systems.


Microsoft Word - CX-GrandCoulee-ChiefJoseph_ARandWood Poles_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REPLY TO ATTN OF: KEPR-Bell-1 SUBJECT: Environmental Cleareance Memorandum Todd Wehner Road Engineer - TELF-TPP-3 Robert Keudell Line Foreman III - TFWK-Grand Coulee Robert Zellar Line Foreman I - TFWK-Grand Coulee Proposed Action: Wood pole replacement, equipment landing construction and access road construction/maintenance along portions of the Grand Coulee-Chief Joseph #1 and #2 230-kV transmission line rights-of-way. PP&A Project No: 1777 Work Order No.: 275582 and 275583 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021):  B1.13 Construction, acquisition, and relocation of onsite pathways and short onsite access roads and railroads.  B1.3 Routine maintenance activities...for structures, rights-of-way, infrastructures such

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Grande Ronde Endemic Spring Chinook Salmon Supplementation Program : Facility Operation and Maintenance Facilities, Annual Report 2003.  

DOE Green Energy (OSTI)

Anadromous salmonid stocks have declined in both the Grande Ronde River Basin (Lower Snake River Compensation Plan (LSRCP) Status Review Symposium 1998) and in the entire Snake River Basin (Nehlsen et al. 1991), many to the point of extinction. The Grande Ronde River Basin historically supported large populations of fall and spring chinook (Oncorhynchus tshawytscha), sockeye (O. nerka), and coho (O. kisutch) salmon and steelhead trout (O. mykiss) (Nehlsen et al. 1991). The decline of chinook salmon and steelhead populations and extirpation of coho and sockeye salmon in the Grande Ronde River Basin was, in part, a result of construction and operation of hydroelectric facilities, over fishing, and loss and degradation of critical spawning and rearing habitat in the Columbia and Snake River basins (Nehlsen et al. 1991). Hatcheries were built in Oregon, Washington and Idaho under the Lower Snake River Compensation Plan (LSRCP) to compensate for losses of anadromous salmonids due to the construction and operation of the lower four Snake River dams. Lookingglass Hatchery (LGH) on Lookingglass Creek, a tributary of the Grande Ronde River, was completed under LSRCP in 1982 and has served as the main incubation and rearing site for chinook salmon programs for Grande Ronde and Imnaha rivers in Oregon. Despite these hatchery programs, natural spring chinook populations continued to decline resulting in the National Marine Fisheries Service (NMFS) listing Snake River spring/summer chinook salmon as ''threatened'' under the federal Endangered Species Act (1973) on 22 April 1992. Continuing poor escapement levels and declining population trends indicated that Grande Ronde River basin spring chinook salmon were in imminent danger of extinction. These continuing trends led fisheries co-managers in the basin to initiate the Grande Ronde Endemic Spring Chinook Salmon Supplementation Program (GRESCSSP) in order to prevent extinction and preserve options for use of endemic fish stocks in future artificial propagation programs. The GRESCSSP was implemented in three Grande Ronde River basin tributaries; the Lostine and upper Grande Ronde rivers and Catherine Creek. The GRESCSSP employs two broodstock strategies utilizing captive and conventional brood sources. The captive brood program began in 1995, with the collection of parr from the three tributary areas. The conventional broodstock component of the program began in 1997 with the collection of natural adults returning to these tributary areas. Although LGH was available as the primary production facility for spring chinook programs in the Grande Ronde Basin, there were never any adult or juvenile satellite facilities developed in the tributary areas that were to be supplemented. An essential part of the GRESCSSP was the construction of adult traps and juvenile acclimation facilities in these tributary areas. Weirs were installed in 1997 for the collection of adult broodstock for the conventional component of the program. Juvenile facilities were built in 2000 for acclimation of the smolts produced by the captive and conventional broodstock programs and as release sites within the natural production areas of their natal streams. The Confederated Tribes of the Umatilla Indian Reservation (CTUIR) operate both the juvenile acclimation and adult trapping facilities located on Catherine Creek and the upper Grande Ronde River under this project. The Nez Perce Tribe (NPT) operate the facilities on the Lostine River under a sister project. Hatcheries were also built in Oregon, Washington and Idaho under the LSRCP to compensate for losses of summer steelhead due to the construction and operation of the lowest four Snake River dams. Despite these harvest-driven hatchery programs, natural summer steelhead populations continued to decline as evidenced by declining counts at Lower Granite Dam since 1995 (Columbia River Data Access in Real Time, DART) and low steelhead redd counts on index streams in the Grande Ronde Basin. Because of low escapement the Snake River summer steelhead were listed as threat

McLean, Michael L.; Seeger, Ryan; Hewitt, Laurie (Confederated Tribes of the Umatilla Indian Reservation, Department of Natural Resources, Pendleton, OR)



US Department of Energy Grand Junction Projects Office Remedial Action Project, final report of the decontamination and decommissioning of Building 36 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also is the remedial action contractor. Building 36 was found to be radiologically contaminated and was demolished in 1996. The soil beneath the building was remediated in accordance with identified standards and can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Widdop, M.R.



Rapid starting methanol reactor system  

DOE Patents (OSTI)

The invention relates to a methanol-to-hydrogen cracking reactor for use with a fuel cell vehicular power plant. The system is particularly designed for rapid start-up of the catalytic methanol cracking reactor after an extended shut-down period, i.e., after the vehicular fuel cell power plant has been inoperative overnight. Rapid system start-up is accomplished by a combination of direct and indirect heating of the cracking catalyst. Initially, liquid methanol is burned with a stoichiometric or slightly lean air mixture in the combustion chamber of the reactor assembly. The hot combustion gas travels down a flue gas chamber in heat exchange relationship with the catalytic cracking chamber transferring heat across the catalyst chamber wall to heat the catalyst indirectly. The combustion gas is then diverted back through the catalyst bed to heat the catalyst pellets directly. When the cracking reactor temperature reaches operating temperature, methanol combustion is stopped and a hot gas valve is switched to route the flue gas overboard, with methanol being fed directly to the catalytic cracking reactor. Thereafter, the burner operates on excess hydrogen from the fuel cells.

Chludzinski, Paul J. (38 Berkshire St., Swampscott, MA 01907); Dantowitz, Philip (39 Nancy Ave., Peabody, MA 01960); McElroy, James F. (12 Old Cart Rd., Hamilton, MA 01936)



Solid-State Lighting at Sandia National Laboratory - Grand Challenge LDRD  

NLE Websites -- All DOE Office Websites (Extended Search)

| | Sandia Press Releases & News Coverage | GRAND CHALLENGE LDRD PROJECT 6images of light To accelerate the development of the science and technology underlying Solid State Lighting, Sandia initiated, in October 2000, a multi-year Grand Challenge Laboratory Directed Research and Development (GCLDRD) project, " A Revolution in Lighting -- Building the Science and Technology Base for Ultra-Efficient Solid-State Lighting." This project is considered one of Sandia's most successful GCLDRDs. One way in which the SSL GCLDRD was different from others was that it coincided with a larger effort by the SSL community - primarily industrial companies investing in SSL, but also universities, trade organizations, and


Union County - La Grande, Oregon geothermal district heating: feasibility assessment. Final report  

DOE Green Energy (OSTI)

This report presents an assessment of geothermal district heating in the City of La Grande, Oregon. Eight study area districts were analyzed to determine their economic feasibility. Results from the analyses conclude that certain districts within the City of La Grande are economically feasible if certain assumptions are correct. Development of geothermal district heating for these areas would provide direct energy and dollar savings to the building owners and would also provide direct and indirect benefits to low and moderate income households within the City.

Jenkins, H. II; Giddings, M.; Hanson, P.



Northeast Oregon Hatchery Program Grande Ronde … Imnaha Spring Chinook Hatchery Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Northeast Oregon Hatchery Program Northeast Oregon Hatchery Program Grande Ronde - Imnaha Spring Chinook Hatchery Project Final Environmental Impact Statement Bonneville Power Administration July 2004 Northeast Oregon Hatchery Program -- Grande Ronde-Imnaha Spring Chinook Project i Table of Contents Page Chapter 1: Updated Summary and Project Description 1.1 Introduction..............................................................................................................1-1 1.2 Purpose and Need for the Proposed Action .............................................................1-2 1.3 Decisions to be Made and Responsible Officials ....................................................1-3 1.4 Summary of Public Involvement, Consultation, and Coordination.........................1-3


Wildlife Mitigation and Restoration for Grand Coulee Dam: Blue Creek Project, Phase 1.  

DOE Green Energy (OSTI)

This report is a recommendation from the Spokane Tribe to the Northwest Power Planning Council (NPPC) for partial mitigation for the extensive wildlife and wildlife habitat losses on the Spokane Indian Reservation caused by the construction of Grand Coulee Dam. NPPC`s interim wildlife goal over the next 7 years for the Columbia hydropower system, is to protect, mitigate and enhance approximately 35% basin wide of the lost habitat units. Grand Coulee Dam had the greatest habitat losses of any Dams of the Wildlife Rule.

Merker, Christopher



Rapid 500-mb Cyclogenesis and Anticyclogenesis  

Science Conference Proceedings (OSTI)

Rapid intensification of cyclones and anticyclones in National Meteorological Center 500-mb height analyses is investigated during the 198384 through 198687 cool seasons (September through May). Rapid intensification is defined by analyzed ...

Timothy L. Alberta; Stephen J. Colucci; J. Clay Davenport



Rapid Solar Mirror Characterization with Fringe Reflection ...  

Energy Analysis Rapid ... Technology Marketing Summary This technology is an automated system in which the ... Solar Energy; More Information Patent ...


Rapid automatic keyword extraction for information retrieval ...  

Methods and systems for rapid automatic keyword extraction for information retrieval and analysis. Embodiments can include parsing words in an ...


Functionalized Gold Nanoparticles for Rapid, Ultra- sensitive ...  

A rapid, highly sensitive, inexpensive method to detect and identify specific hazardous environmental pollutants has been invented by ORNL ...


Rapid Oscillations in Cataclysmic Variables  

E-Print Network (OSTI)

I give an overview of the rich phenomenology of dwarf nova oscillations (DNOs) and Quasi-periodic Oscillations (QPOs) observed in cataclysmic variable stars (CVs). The favoured interpretation of these rapid brightness modulations (3 - >1000 s time scales) is that they are magnetic in nature - magnetically channelled accretion from the inner accretion disc for DNOs and possible magnetically excited travelling waves in the disc for QPOs. There is increasing evidence for the magnetic aspects, which extend to lower field the well known properties of strong field (polars) and intermediate strength field (intermediate polars) CVs. The result is that almost all CVs show the presence of magnetic fields on their white dwarf primaries - though for many the intrinsic field may be locally enhanced by the accretion process itself. There are many parallel behaviours with the QPOs seen in X-Ray binaries, with high and low frequency X-Ray QPOs resembling respectively the DNOs and QPOs in CVs.

Brian Warner



DOE/EA-1312: Environmental Assessment of Ground Water Compliance at the Grand Junction UMTRA Project Site (Climax Uranium Millsite) (September 1999)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 2 Rev. 0 Environmental Assessment of Ground Water Compliance at the Grand Junction UMTRA Project Site (Climax Uranium Millsite) Final September 1999 Prepared by U.S. Department of Energy Grand Junction Office Grand Junction, Colorado Work Performed Under DOE Contract No. DE-AC13-96GJ87335 for the U.S. Department of Energy EA of Ground Water Compliance at the Grand Junction UMTRA Project Site DOE Grand Junction Office Page ii Final September 1999 Contents Executive Summary.........................................................................................................................v 1.0 Introduction...............................................................................................................................1 1.1 Grand Junction UMTRA Project Site Location and Description.........................................1


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Grand Rapids MI-City-Grand Rapids Location: City Grand Rapids MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Develop energy efficiency conservation strategy, 2) exterior glass replacement at City Hall, 3) lighting control retrofits, 4) light fixture replacement in ten buildings, 5) implement facility based energy tracking system, and 6) install (approximately 5-10 ton) closed-loop, geothermal ground source heating and cooling systems at fire stations. Conditions: Historic preservation clause applies to this application (Fire Stations--1734 S Division [84 yrs old], 1002 Chester St [108 yrs old], 38 LaGrave Ave [99 yrs old], and 2251 Plainfield Ave [59 yrs old] and MLK Park Lodge [91 yrs old], Refuse Center, Woodlawn Cemetery Service


Granby Pumping Plant Switchyard - Windy Gap Substation Transmission Line Rebuild, Grand County, Colorado: Final Environmental Impact Statement Appendices  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Into the Teeth of the Gale: The Remarkable Advance of a Cold Front at Grand Manan  

Science Conference Proceedings (OSTI)

The afternoon of 30 December 1962 saw the nearly simultaneous arrival at Grand Manan (an island in the Bay of Fundy) of an intense cold front, accompanied by northwesterly gales and snow, and an intense small cyclonic vortex, producing a mild ...

Robert M. Cunningham; Frederick Sanders



Using hydrodynamic modeling for estimating flooding and water depths in grand bay, alabama  

Science Conference Proceedings (OSTI)

This paper presents a methodology for using hydrodynamic modeling to estimate inundation areas and water depths during a hurricane event. The Environmental Fluid Dynamic Code (EFDC) is used in this research. EFDC is one of the most commonly applied models ... Keywords: EFDC, flooding, grand bay, grid generation, hydrodynamics, inundation, modeling

Vladimir J. Alarcon; William H. McAnally



Wind-Flow Patterns in the Grand Canyon as Revealed by Doppler Lidar  

Science Conference Proceedings (OSTI)

Many interesting flow patterns were found in the Grand Canyon by a scanning Doppler lidar deployed to the south rim during the 1990 Wintertime Visibility Study. Three are analyzed in this study: 1) flow reversal in the canyon, where the flow in ...

Robert M. Banta; Lisa S. Darby; Pirmin Kaufmann; David H. Levinson; Cui-Juan Zhu



EIS-0485: Interconnection of the Grande Prairie Wind Farm, Holt County, Nebraska  

Energy.gov (U.S. Department of Energy (DOE))

DOEs Western Area Power Administration is preparing this EIS to evaluate the environmental impacts of interconnecting the proposed Grande Prairie Wind Farm, in Holt County, near the city of ONeill, Nebraska, to Westerns power transmission system. The proposed wind energy generation project would include up to 266 wind turbines.


Grand Coulee Dam Wildlife Mitigation Program : Pygmy Rabbit Programmatic Management Plan, Douglas County, Washington.  

DOE Green Energy (OSTI)

The Northwest Power Planning Council and the Bonneville Power Administration approved the pygmy rabbit project as partial mitigation for impacts caused by the construction of Grand Coulee Dam. The focus of this project is the protection and enhancement of shrub-steppe/pygmy rabbit habitat in northeastern Washington.

Ashley, Paul


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Debris flow deposition and reworking by the Colorado River in Grand Canyon, Arizona  

E-Print Network (OSTI)

Debris flow deposition and reworking by the Colorado River in Grand Canyon, Arizona Brian J Canyon, Arizona, transport coarse-grained sediment onto debris fans adjacent to the Colorado River and Monument Creeks using photogrammetry of aerial photography taken from 1965 to 2000 and supplemented



Science Conference Proceedings (OSTI)

We use geomagnetic activity data to study the rise and fall over the past century of the solar wind flow speed V{sub SW}, the interplanetary magnetic field strength B, and the open solar flux F {sub S}. Our estimates include allowance for the kinematic effect of longitudinal structure in the solar wind flow speed. As well as solar cycle variations, all three parameters show a long-term rise during the first half of the 20th century followed by peaks around 1955 and 1986 and then a recent decline. Cosmogenic isotope data reveal that this constitutes a grand maximum of solar activity which began in 1920, using the definition that such grand maxima are when 25-year averages of the heliospheric modulation potential exceeds 600 MV. Extrapolating the linear declines seen in all three parameters since 1985, yields predictions that the grand maximum will end in the years 2013, 2014, or 2027 using V{sub SW}, F{sub S}, or B, respectively. These estimates are consistent with predictions based on the probability distribution of the durations of past grand solar maxima seen in cosmogenic isotope data. The data contradict any suggestions of a floor to the open solar flux: we show that the solar minimum open solar flux, kinematically corrected to allow for the excess flux effect, has halved over the past two solar cycles.

Lockwood, M.; Rouillard, A. P. [Space Environment Physics, School of Physics and Astronomy, Southampton University, Highfield, Southampton SO17 1BJ (United Kingdom); Finch, I. D. [Space Science and Technology Department, Rutherford Appleton Laboratory, Chilton, Didcot, Oxfordshire OX11 0QX (United Kingdom)], E-mail: mike.lockwood@stfc.ac.uk



Storm-Forced Baroclinic Near-Inertial Currents on the Grand Bank  

Science Conference Proceedings (OSTI)

Current meter data for six mouths from the Grand Bank are analyzed to study inertial currents generated by moving storms. It is found that during periods of strong winds, but no well-defined storm system, the inertial motion exhibits no simple ...

Brad De Young; C. L. Tang



Proceedings of the 45th IEEE Conference on Decision & Control Manchester Grand Hyatt Hotel  

E-Print Network (OSTI)

Proceedings of the 45th IEEE Conference on Decision & Control Manchester Grand Hyatt Hotel San can supply. For a DES, commonly applied performance metrics include average system time, utilization and operate the system or the resources that the system utilizes, such as communication channels, space, time

Cassandras, Christos G.


SICE Annual Conference 2010 August 18-21, 2010, The Grand Hotel, Taipei, Taiwan  

E-Print Network (OSTI)

SICE Annual Conference 2010 August 18-21, 2010, The Grand Hotel, Taipei, Taiwan ¥400 © 2010 SICE. Thus, the proposed system can potentially be utilized in the legged robots where the COM moves due utilized in various applications, including navigation (robots, vehicles, rockets, and etc) [2-4], state

Lin, Pei-Chun


Proceedings of the 45th IEEE Conference on Decision & Control Manchester Grand Hyatt Hotel  

E-Print Network (OSTI)

Proceedings of the 45th IEEE Conference on Decision & Control Manchester Grand Hyatt Hotel San describing the left and right turn minimum radius paths of the vehicle. Utilizing this construction, a weak then be utilized to plan shortest path segments in the presence of obstacles in future work. In order to avoid

Barth, Eric J.


Current System South and East of the Grand Banks of Newfoundland  

Science Conference Proceedings (OSTI)

During AprilJune 1972 three ships conducted a survey of the region between the Grand Banks and the Mid-Atlantic Ridge, including a grid of hydrographic stations, and two long lines of near-bottom current-meter moorings across the Gulf Stream and ...

R. Allyn Clarke; Harry W. Hill; Robert F. Reiniger; Bruce A. Warren



Prospect of Rapidity Asymmetry and Nuclear Modifications  

E-Print Network (OSTI)

In asymmetric heavy ion collisions like dA or pA, particle production yields are different in the forward (d- or p-side) and backward (A-side) rapidity directions. The rapidity distribution reflects the geometry and phase-space distribution of nuclear matter. These properties may depend on the time evolution of the collision. Due to the smallness of the backward-forward differences, the rapidity asymmetry factor can be useful to quantify nuclear modification effects, like e.g. shadowing and the EMC effect. Our work is a survey of the nuclear modification factor and the rapidity asymmetries at RHIC energies. We analyze the rapidity dependence and the strength of the nuclear effects. We focus on the high transverse momentum region, and make predictions for the role of nuclear modifications and rapidity asymmetries for future experimental measurements at increasing absolute values of rapidity.

G. G. Barnafldi; A. Adeluyi; G. Fai; P. Lvai; G. Papp



RAPID toolkit/FAQ | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » RAPID toolkit/FAQ Jump to: navigation, search Rapid selected.png RAPIDtoolkit About FAQ Contact Us Presentations Outreach Get Involved Tools Frequently Asked Questions What does RAPID offer? The RAPID web site provides tools to aid in the permitting of renewable energy and bulk transmission projects. RAPID covers federal and state regulations for selected states. Additional states and technologies are continuously being added, so check back for new information. Does RAPID address bills that have not been enacted or regulations that have not been fully approved? No. How is RAPID maintained?


Microsoft Word - CX-GrandCouleeDistrictWoodPoleReplacementsAccessRoadsFY13_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KEPR-Bell-1 SUBJECT: Environmental Clearance Memorandum Todd Wehner Civil Design/Access Roads - TELF-TPP-3 James Semrau Project Manager - TEP-TPP-1 Proposed Action: Wood pole replacement, equipment landing construction, and access road improvements along various transmission lines in Bonneville Power Administration's (BPA) Grand Coulee District. PP&A Project No.: 2152 (Grand Coulee-Chief Joseph No. 1), 2151 (Grand Coulee-Chief Joseph No. 2), 2121 (Grand Coulee-Foster Creek No. 1) and 1776 (Grand Coulee-Okanogan No. 2) Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance Location: Douglas and Okanogan counties, Washington. Refer to table below for project locations: Line Name Structure Township Range Section County


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



DOE/EA-1338: Finding of No Significant Impact Transfer of the Department of Energy Grand Junction Project Office To Non-DOE Ownership (04/25/00)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8 8 F I N A L Environmental Assessment for the Transfer of the Department of Energy Grand Junction Office to Non-DOE Ownership April 2000 U.S. Department of Energy * Grand Junction Office * 2597 B ¾ Road * Grand Junction, CO 81503 Grand Junction Office Environmental Assessment Final DOE/EA-1338 FINAL Environmental Assessment for the Transfer of the Department of Energy Grand Junction Office to Non-DOE Ownership April 2000 U.S. Department of Energy Grand Junction Office 2597 B ¾ Road Grand Junction, CO 81503 Grand Junction Office Environmental Assessment Final i April 2000 TABLE OF CONTENTS Title Page Table of Contents ......................................................................................................................................... i List of Figures ............................................................................................................................................iii


Functionalized Gold Nanoparticles for Rapid, Ultra- sensitive ...  

and Ocean Optics) Patent Baohua Gu. Functionalized Gold Surface-Enhanced Raman Scattering Substrate for Rapid and Ultra-Sensitive Detection of Anionic Species


Current Projects: Rapid Sampling Tools - Vulnerability Assessment...  

NLE Websites -- All DOE Office Websites (Extended Search)

Applications include counter-terrorism, emergency response teams, drug and environmental raids, and waste management. For more information visit Rapid Sampling from Sealed...


US Department of Energy Grand Junction Projects Office Remedial Action Project. Final report of the decontamination and decommissioning of Building 52 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also was the remedial action contractor. Building 52 was found to be radiologically contaminated and was demolished in 1994. The soil area within the footprint of the building has been remediated in accordance with the identified standards and the area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Krabacher, J.E.



EV Everywhere Grand Challenge - Electric Drive (Power Electronics and Electric Machines) Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Electric Drive (Power Electric Drive (Power Electronics and Electric Machines) Workshop Tuesday, July 24, 2012 - Doubletree O'Hare, Chicago, IL Event Objective: DOE aims to obtain stakeholder input on the Power Electronics and Electric Machines (PEEM) goals of the EV Everywhere Grand Challenge. This input will advise the aggressive next-generation technology research and development necessary to enable U.S. companies to be the first in the world to produce plug-in electric vehicles (PEVs) that are as affordable and convenient for the average American family as today's gasoline-powered vehicles within the next 10 years. The EV Everywhere Grand Challenge Electric Drive (Power Electronics and Electric Machines) Workshop was attended by senior officials of the Department of Energy and representatives from the following


EV Everywhere EV Everywhere Grand Challenge - Electric Drive (Power Electronics and Electric Machines) Workshop Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

- 7/20/2012 - 7/20/2012 EV Everywhere Grand Challenge - Electric Drive (Power Electronics and Electric Machines) Workshop Tuesday, July 24, 2012 - Doubletree O'Hare, Chicago, IL Event Objective: DOE aims to obtain stakeholder input on the Power Electronics and Electric Machines (PEEM) goals of the EV Everywhere Grand Challenge. This input will advise the aggressive next- generation technology research and development necessary to enable U.S. companies to be the first in the world to produce plug-in electric vehicles (PEVs) that are as affordable and convenient for the average American family as today's gasoline-powered vehicles within the next 10 years. 8:30-8:35 AM CONTINENTAL BREAKFAST 8:30-8:35 AM CALL TO ORDER Mr. Patrick Davis, DOE EERE Vehicle Technologies Program


U.S. Department of Energy at Grand Junction 2003 Annual Inspection⎯Monticello, Utah  

Office of Legacy Management (LM)

at Grand Junction 2003 Annual Inspection⎯Monticello, Utah at Grand Junction 2003 Annual Inspection⎯Monticello, Utah November 2003 Page 1 2003 Annual Inspection of the Monticello Mill Tailings (USDOE) and Monticello Radioactively Contaminated Properties Sites Summary The Monticello site, which includes the U.S. Department of Energy (DOE) Monticello Mill Tailings Site (MMTS) and the Monticello Radioactively Contaminated Properties site, was inspected September 23-25, 2003. A follow-up inspection of the Soil and Sediment properties was conducted on October 8, 2003. The Monticello Radioactively Contaminated Properties site is also called the Monticello Vicinity Properties (MVP) and will be referred to as MVP in this report. Restoration work at MVP is complete and is nearly complete at MMTS. MVP is in good


Microsoft Word - CX-GrandRonde-Boyer-ImpairmentEmergency-FY13_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 3 REPLY TO ATTN OF: KEP-Alvey SUBJECT: Environmental Clearance Memorandum Jim Semrau Civil Engineer - TEP-TPP-1 Proposed Action: Wood pole replacement PP&A Project No.: 2760 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance Location: Structures 4/5 and 4/6 of Bonneville Power Administration's (BPA) 115-kilovolt Grand Ronde-Boyer No. 1 transmission line located in Polk County, Oregon (Willamette Meridian, T6S, R8W, section 8, se ¼ of se ¼). Proposed by: BPA Description of the Proposed Action: BPA proposes to fix two ground impairments between structures 4/5 and 4/6 on the Grand Ronde-Boyer No. 1 line. The impairments are required to be fixed within 30 days of detection due to concerns for public safety. The conductor on a typical


EV Everywhere Grand Challenge: Consumer Acceptance and Charging Infrastructure Workshop Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

7/26/2012 7/26/2012 EV Everywhere Grand Challenge: Consumer Acceptance and Charging Infrastructure Workshop Monday, July 30, 2012 - LAX Marriott, Los Angeles, CA Event Objective: DOE aims to obtain stakeholder input on the consumer acceptance and charging infrastructure barriers associated with the EV Everywhere Grand Challenge. This input will help guide the Challenge and the next-generation technology development necessary to enable U.S. companies to be the first in the world to produce plug-in electric vehicles (PEVs) that are as affordable and convenient for the average American family as today's gasoline-powered vehicles - and to do so within the next 10 years. 8:00-8:30AM CONTINENTAL BREAKFAST 8:30-8:35 AM CALL TO ORDER Mr. Patrick Davis, DOE EERE Vehicle Technologies Program

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE/EIS-0340; Grand Ronde … Imnaha Spring Chinook Hatchery Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 3 NORTHEAST OREGON HATCHERY PROGRAM GRANDE RONDE - IMNAHA SPRING CHINOOK HATCHERY PROJECT DOE/EIS-0340 Draft Environmental Impact Statement Northeast Oregon Hatchery Program Grande Ronde - Imnaha Spring Chinook Hatchery Project Draft Environmental Impact Statement (DOE/EIS-0340) Responsible Agency: U.S. Department of Energy, Bonneville Power Administration (BPA) Cooperating Federal Agencies: U.S. Department of Interior, Fish and Wildlife Service (USFWS); U.S. Department of Commerce, National Oceanic and Atmospheric Administration National Marine Fisheries Service (NOAA Fisheries); U.S. Department of Agriculture, Forest Service Cooperating Tribes: Nez Perce Tribe (NPT), Confederated Tribes of the Umatilla Indian Reservation (CTUIR) Cooperating State Agencies: Oregon Department of Fish and Wildlife (ODFW)


Microsoft Word - CX-GrandCouleeBellNo3-WestsideAgLand_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, 2011 , 2011 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Mark Kjelland Project Manager - TEP-TPP-2 Proposed Action: Insulator replacement in agricultural lands along the Grand Coulee-Bell No. 3/Grand Coulee-Westside No. 1 double circuit 230-kV transmission line Budget Information: Work Order #00255064 PP&A Project No.: PP&A 1909 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance activities...for structures, rights-of-way, infrastructures such as roads, equipment... routine maintenance activities, corrective....are required to maintain... infrastructures...in a condition suitable for a facility to be used for its designed purpose. Proposed by: Bonneville Power Administration (BPA)


Microsoft Word - CX-GrandCoulee-BellNo3ReconductoringFY12_WEB.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 4 SUBJECT: Environmental Clearance Memorandum Frank Weintraub Project Manager - TEP-TPP-1 Proposed Action: Grand Coulee-Bell No. 3 double circuit 230-kV transmission line reconductoring project Budget Information: Work Order #00280243 PP&A Project No.: PP&A 1946 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance Proposed by: Bonneville Power Administration (BPA) Location: The proposed Grand Coulee-Bell No. 3 Double Circuit 230-kV Transmission Line Reconductoring Project is located in Grant, Lincoln, and Spokane counties, Washington, in BPA's Spokane Operations and Maintenance District. Townships, Ranges, and Sections crossed by the proposed project listed below (Table 1).


Microsoft Word - CX-GrandCoulee-BellNo5InsultatorFY13_WEB.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 3 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Stacie Hensley Project Manager - TEP-TPP-4 Proposed Action: Grand Coulee-Bell No. 5 Dead End Insulator Replacement Project Budget Information: Work Order #00339638 PP&A Project No.: 2699 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance Proposed by: Bonneville Power Administration (BPA) Location: Grant and Lincoln counties, Washington, in BPA's Spokane Operations and Maintenance District. Townships, Ranges, and Sections crossed by the proposed project are listed below (Table 1). Table 1. Townships, Ranges, and Sections for the Grand Coulee-Bell No.5 Dead End Insulator Replacement Project. Township Range Sections


Efficient Irrigation for Water Conservation in the Rio Grande Basin: 2010/2011 Progress and Accomplishments  

E-Print Network (OSTI)

Since 2001, the Efficient Irrigation for Water Conservation in the Rio Grande Basin Federal Initiative-known as the Rio Grande Basin Initiative (RGBI)-has saved more than 5 million acre-feet of water. Researchers, Extension specialists, and county Extension agents from Texas AgriLife Research, the Texas AgriLife Extension Service, and the New Mexico State University Agricultural Experiment Station and Cooperative Extension Service work with local irrigation districts, agricultural producers, homeowners, and regional agencies to meet present and future water demand through water conservation and efficient irrigation measures. This project is funded through the U.S. Department of Agriculture National Institute of Food and Agriculture and is administered by the Texas Water Resources Institute and the New Mexico State University Water Task Force.

Kalisek, D.; Harris, B. L.; Runyan, C.; DeMouche, L.



Efficient Irrigation for Water conservation in the Rio Grande Basin: 2010-2011 Progress and Accomplishments  

E-Print Network (OSTI)

Since 2001, the Efficient Irrigation for Water Conservation in the Rio Grande Basin Federal Initiative known as the Rio Grande Basin Initiative (RGBI)has saved more than 5 million acre-feet of water. Researchers, Extension specialists, and county Extension agents from Texas AgriLife Research, the Texas AgriLife Extension Service, and the New Mexico State University Agricultural Experiment Station and Cooperative Extension Service work with local irrigation districts, agricultural producers, homeowners, and regional agencies to meet present and future water demand through water conservation and efficient irrigation measures. This project is funded through the U.S. Department of Agriculture National Institute of Food and Agriculture and is administered by the Texas Water Resources Institute and the New Mexico State University Water Task Force.

Kalisek, D.; Harris, B.L.; Runyan, C.; DeMouche, L.



Microsoft Word - Grand Coulee Transmission Line Replacement Project Prelim EA.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grand Coulee's Third Powerplant 500-kilovolt Transmission Line Replacement Project Preliminary Environmental Assessment May 2011 DOE/EA-1679 Agency Proposing Action. U.S. Bureau of Reclamation is the lead NEPA agency. The Bonneville Power Administration is assisting Reclamation through project design, environmental review and construction, if the Proposed Action is taken. Action. Reclamation is proposing to replace the six, 500- kV transmission lines of the Third Powerplant (TPP) at Grand Coulee Dam. The transmission lines are presently installed within the dam and a two-chambered tunnel that leads to a Spreader Yard about a mile away. Purpose and Need. The TPP's six generators and transmission lines are critical to the regional power supply.


Habitat Evaluation Procedures (HEP) Report : Grand Coulee Dam Mitigation, 1996-1999 Technical Report.  

DOE Green Energy (OSTI)

The purpose of this Habitat Evaluation Procedures (HEP) study was to determine baseline habitat units and to estimate future habitat units for Bonneville Power Administration (BPA) mitigation projects on the Spokane Indian Reservation. The mitigation between BPA and the Spokane Tribe of Indians (STOI) is for wildlife habitat losses on account of the construction of Grand Coulee Dam. Analysis of the HEP survey data will assist in mitigation crediting and appropriate management of the mitigation lands.

Kieffer, B.; Singer, Kelly; Abrahamson, Twa-le



Strobe Light Deterrent Efficacy Test and Fish Behavior Determination at Grand Coulee Dam Third Powerplant Forebay  

DOE Green Energy (OSTI)

This report documents the fourth year of a four-year study to assess the efficacy of a prototype strobe light system to elicit a negative phototactic response in kokanee salmon (Oncorhynchus nerka) and rainbow trout (O. mykiss) in the forebay to the third powerplant at Grand Coulee Dam. This work was conducted for the Bonneville Power Administration, U.S. Department of Energy, by Pacific Northwest National Laboratory (PNNL) in conjunction with the Confederated Tribes of the Colville Reservation (Colville Confederated Tribes).

Johnson, Robert L.; Simmons, Mary Ann; McKinstry, Craig A.; Simmons, Carver S.; Cook, Chris B.; Brown, Richard S.; Tano, Daniel K.; Thorsten, Susan L.; Faber, Derrek M.; Lecaire, Richard; Francis, Stephen



Study of the effects of a disaster at Grand Coulee Dam upon the Hanford Works  

SciTech Connect

Declassified 23 Nov 1973. It is assumed that the Grand Coulee Dam would be destroyed by one direct hit following detonation of an atomic bomb. Major effects of the explosion include flooding and isolation of Richland, flooding of Midway Substation, and flooding of surrounding areas. Maximum water elevations following a direct hit and indirect hits are estimated. Data are presented for flow through openings and flow through dam failure. (HLW)

Kramer, H.A.



Strobe Light Deterrent Efficacy Test and Fish Behavior Determination at Grand Coulee Dam Third Powerplant Forebay  

SciTech Connect

This report documents the third year of a four-year study to assess the efficacy of a prototype strobe light system to elicit a negative phototactic response in kokanee salmon (Oncorhynchus nerka) and rainbow trout (O. mykiss) in the forebay to the third powerplant at Grand Coulee Dam. This work was conducted for the Bonneville Power Administration, U.S. Department of Energy, by Pacific Northwest National Laboratory (PNNL) in conjunction with the Confederated Tribes of the Colville Reservation (Colville Confederated Tribes).

Simmons, Mary Ann; Johnson, Robert L.; McKinstry, Craig A.; Simmons, Carver S.; Cook, Chris B.; Brown, Richard S.; Tano, Daniel K.; Thorsten, Susan L.; Faber, Derrek M.; Lecaire, Richard; Francis, Stephen



Site observational work plan for the UMTRA project site at Grand Junction, Colorado  

Science Conference Proceedings (OSTI)

This site observational work plan (SOWP) is one of the first Uranium Mill Tailings Remedial Action (UMTRA) Ground Water Project documents developed to select a compliance strategy that meets the UMTRA ground water standards for the Grand Junction site. This SOWP applies information about the Grand Junction site to the compliance strategy selection framework developed in the UMTRA Ground Water Project draft programmatic environmental impact statement. This risk-based, decision-making framework identifies the decision logic for selecting compliance strategies that could be used to meet the ground water standards. The US Department of Energy (DOE) goal is to implement a cost-effective site strategy that complies with the ground water standards and protects human health and the environment. Based on an evaluation of the site characterization and risk assessment data available for the preparation of this SOWP, DOE proposes that the most likely compliance strategy for the Grand Junction site is no remediation with the application of supplemental standards. This proposed strategy is based on a conceptual site model that indicates site-related contamination is confined to a limited-use aquifer as defined in the ground water standards. The conceptual model demonstrates that the uranium processing-related contamination at the site has affected the unconfined alluvial aquifer, but not the deeper confined aquifer.




Final report of the radiological release survey of Building 19 at the Grand Junction Office Facility  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Grand Junction Office (GJO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore concentrates and mill tailings during vanadium refining activities of the Manhattan Engineer District, and during sampling, assaying, pilot milling, storage, and brokerage activities conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJO Remedial Action Project (GJORAP) to clean up and restore the facility lands, improvements, and underlying aquifer. WASTREN-Grand Junction is the site contractor for the facility and the remedial action contractor for GJORAP. Building 19 and the underlying soil were found not to be radiologically contaminated; therefore, the building can be released for unrestricted use. Placards have been placed at the building entrances indicating the completion of the radiological release survey and prohibiting the introduction of any radioactive materials within the building without written approvals from the GJO Facilities Operations Manager. This document was prepared in response to a DOE-GJO request for an individual final release report for each GJO building.

Johnson, R.K.; Corle, S.G.



Final report of the radiological release survey of Building 11 at the Grand Junction Office Facility  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Grand Junction Office (GJO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore concentrates and mill tailings during vanadium refining activities of the Manhattan Engineer District, and during sampling, assaying, pilot milling, storage, and brokerage activities conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJO Remedial Action Project (GJORAP) to clean up and restore the facility lands, improvements, and underlying aquifer. WASTREN-Grand Junction is the site contractor for the facility and the remedial action contractor for GJORAP. Building 11 and the underlying soil were found not to be radiologically contaminated; therefore, the building can be released for unrestricted use. Placards have been placed at the building entrances indicating the completion of the radiological release survey and prohibiting the introduction of any radioactive materials within the building without written approvals from the GJO Facilities Operations Manager. This document was prepared in response to a DOE-GJO request for an individual final release report for each GJO building.

Johnson, R.K.; Corle, S.G.



Final report of the radiological release survey of Building 29 at the Grand Junction Office Facility  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Grand Junction Office (GJO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore concentrates and mill tailing during vanadium refining activities of the Manhattan Engineer District, and during sampling, assaying, pilot milling, storage, and brokerage activities conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJO Remedial Action Project (GJORAP) to clean up and restore the facility lands, improvements, and underlying aquifer. WASTREN-Grand Junction is the site contractor for the facility and the remedial action contractor for GJORAP. Building 29 and the underlying soil were found not to be radiologically contaminated; therefore, the building can be released for unrestricted use. Placards have been placed at the building entrances indicating the completion of the radiological release survey and prohibiting the introduction of any radioactive materials within the building without written approvals from the GJO Facilities Operations Manager. This document was prepared in response to a DOE-GJO request for an individual final release report for each GJO building.

Johnson, R.K.; Corle, S.G.



Grand Challenge Problems in Environmental Modeling and Remediation: Groundwater Contaminant Transport (Partnerships in Computational Science)  

SciTech Connect

The over-reaching goal of the Groundwater Grand Challenge component of the Partnership in Computational Science (PICS) was to develop and establish the massively parallel approach for the description of groundwater flow and transport and to address the problem of uncertainties in the data and its interpretation. This necessitated the development of innovative algorithms and the implementation of massively parallel computational tools to provide a suite of simulators for groundwater flow and transport in heterogeneous media. This report summarizes the activities and deliverables of the University of South Carolina component of the Groundwater Grand Challenge project funded through the High Performance Computing grand challenge program of the Department of Energy from 1995 through 1997. Seven institutions were primarily involved in this project: Brookhaven National Laboratory, Oak Ridge National Laboratory, Princeton University, SUNY at Stony Brook, Texas A&M University, The University of South Carolina, and the University of Texas at Austin, with contributing efforts from the Westinghouse Savannah River Technology Center. Each institution had primary responsibility for specific research components, but strong collaboration among all institutions was essential for the success of the project and in producing the final deliverables. PICS deliverables include source code for the suite of research simulators and auxiliary HPC tools, associated documentation, and test problems. These materials will be available as indicated from each institution's web page or from the Center for Computational Sciences Oak Ridge National Laboratory in January 1998.

Sharpley, Robert C.



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Microsoft Word - NEPA_CX_Acquisition_of_OTEC_Disconnect_Switch_LaGrand_Substation_05-08-2012.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kelly Miller Kelly Miller Project Manager - TG-DITT-2 Proposed Action: BPA Acquisition of OTEC Disconnect Switch at the BPA LaGrande Substation Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): Appendix B 1.24 Property Transfer Location: BPA LaGrande Substation, in the City of LaGrande, Union County, Oregon Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to purchase the 230-kilovolt (kV) main bus disconnect switch (MB A-270) that is currently installed and operating within the BPA LaGrande Substation. The disconnect switch is owned by the Oregon Trail Electric Cooperative (OTEC). On October 7, 2011, the manager of engineering for OTEC requested that BPA purchase the disconnect switch. The disconnect switch is the only piece of equipment within


Granby Pumping Plant Switchyard - Windy Gap Substation Transmission Line Rebuild, Grand County, Colorado: Final Environmental Impact Statement Executive Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PUMPING PLANT SWITCHYARD - WINDY GAP PUMPING PLANT SWITCHYARD - WINDY GAP SUBSTATION TRANSMISSION LINE REBUILD, GRAND COUNTY, COLORADO DOE/EIS-0400 Final Environmental Impact Statement Executive Summary Grand County, Colorado June 2013 Granby Pumping Plant-Windy Gap Substation Transmission Line Rebuild Project FEIS Executive Summary ES-1 EXECUTIVE SUMMARY Introduction Western Area Power Administration (Western), a power marketing administration within the U.S. Department of Energy (DOE), is proposing to rebuild and upgrade the Granby Pumping Plant Switchyard-Windy Gap Substation transmission line in Grand County, Colorado (Grand County). This Environmental Impact Statement (EIS) analyzes the impacts associated with the proposal to remove approximately 13.6 miles of 69-kilovolt (kV) transmission line, construct approximately

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Meteorological Processes Affecting the Transport of Emissions from the Navajo Generating Station to Grand Canyon National Park  

Science Conference Proceedings (OSTI)

During the 1990 Navajo Generating Station (NGS) Winter Visibility Study, a network of surface and upper-air meteorological measurement systems was operated in and around Grand Canyon National Park to investigate atmospheric processes in complex ...

Charles G. Lindsey; Jun Chen; Timothy S. Dye; L. Willard Richards; Donald L. Blumenthal



Proceedings of the 45th IEEE Conference on Decision & Control ThAl8.6 Manchester Grand Hyatt Hotel  

E-Print Network (OSTI)

Proceedings of the 45th IEEE Conference on Decision & Control ThAl8.6 Manchester Grand Hyatt Hotel that the energy efficiency of wireless networks can be greatly improved by utilizing transmission control

Cassandras, Christos G.


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Early life history study of Grande Ronde River Basin chinook salmon. Annual progress report, September 1, 1994--August 31, 1995  

DOE Green Energy (OSTI)

The Grande Ronde River originates in the Blue Mountains in northeast Oregon and flows 334 kilometers to its confluence with the Snake River near Rogersburg, Washington. Historically, the Grande Ronde River produced an abundance of salmonids including stocks of spring, summer and fall chinook salmon, sockeye salmon, coho salmon, and summer steelhead. During the past century, numerous factors have caused the reduction of salmon stocks such that only stocks of spring chinook salmon and summer steelhead remain. The sizes of spring chinook salmon populations in the Grande Ronde basin also have been declining steadily and are substantially depressed from estimates of historic levels. It is estimated that prior to the construction of the Columbia and Snake River dams, more than 20,000 adult spring chinook salmon returned to spawn in the Grande Ronde River basin. A spawning escapement of 12,200 adults was estimated for the Grande Ronde River basin in 1957. Recent population estimates have been variable year to year, yet remain a degree of magnitude lower than historic estimates. In 1992, the escapement estimate for the basin was 1,022 adults (2.4 {times} number of redds observed). In addition to a decline in population abundance, a constriction of spring chinook salmon spawning distribution is evident in the Grande Ronde basin. Historically, 21 streams supported spawning chinook salmon, yet today the majority of production is limited to eight tributary streams and the mainstem upper Grande Ronde River. Numerous factors are thought to contribute to the decline of spring chinook salmon in the Snake River and its tributaries. These factors include passage problems and increased mortality of juvenile and adult migrants at mainstem Columbia and Snake river dams, overharvest, and habitat degradation associated with timber, agricultural, and land development practices. More than 80% of anadromous fish habitat in the upper Grande Ronde River is considered to be degraded.

Keefe, M.; Anderson, D.J.; Carmichasel, R.W.; Jonasson, B.C.



Grande Ronde Subbasin Gauging Station Operations, 2007-2008 Reporting Period.  

DOE Green Energy (OSTI)

The Grande Ronde Basin (GRB) in Northeast Oregon is a moderately dry climate receiving between 10 and 20 inches of precipitation per year with surrounding mountains accumulating up to 100 inches. Irrigated agriculture is a major part of the economy with water being diverted or pumped from surface and ground sources from April through October. Several ESA listed species exist in the basin including Chinook, steelhead, and bulltrout. Agriculture and ESA (Endangered Species Act) listed aquatic species combined with a dry climate demonstrate the need for a network of stream gauges. The GRB covers over 5,000 square miles and includes several thousand miles of perennial flowing streams. This project is in place to operate 12 existing stream gauges in combination with USGS (4 gauges) and OWRD (one gauge) who, independent of this project, operate five additional gauges (Grande Ronde at Troy, Imnaha R. at Imnaha, Minam R. at Minam, Lookingglass Creek, and Upper Catherine Cr.) to characterizes flow in both the Grande Ronde and Imnaha subbasins. These gauges are intended to assist in irrigation water management, fisheries management, long term flow and trend analysis, TMDL and SB1010 water quality management plan effectiveness, subbasin plan implementation, and provide essential information regarding cumulative effects response to conservation in the GRB. Headwater characteristics, land management influence, and basin outlet data are all selectively collected in this network of 17 flow gauges. Prior to the 2007 water year there were three separate stream gauging programs with similar objectives, protocol, and funding sources in the GRB. Each of these programs for the past ten years has operated under separate administration consuming more time and administrative money than is necessary to accomplish stated objectives. By combining all programs into one project costs have been reduced, each funding source has one contract instead of three, and the same amount of work has been done accomplishing the same objectives. This objective has been continued and realized in the 2008 water year.

Menton, R. Coby [Grande Ronde Model Watershed



Dynamic characterization and damage detection in the I-40 bridge over the Rio Grande  

Science Conference Proceedings (OSTI)

In the 1960`s and 1970`s over 2500 bridges were built in the U.S. with a design similar to those on Interstate 40 over the Rio Grande in Albuquerque, New Mexico. These bridges were built without structural redundancy and typically have only two plate girders carrying the entire dead and live loads. Failure of either girder is assumed to produce catastrophic failure of the bridge, hence these bridges are referred to as fracture-critical bridges. The Federal Highway Administration (FHWA) and the National Science Foundation (NSF) have provided funds to New Mexico State University (NMSU) through the New Mexico State Highway and Transportation Department (NMSH&TD) and The Alliance For Transportation Research (ATR) for evaluation and testing of the existing fracture critical bridges over the Rio Grande. Because the 1-40 bridges over the Rio Grande were to be razed during the summer of 1993, the investigators were able to introduce simulated fatigue cracks, similar to those observed in the field, into the structure in order to test various damage identification methods and to observe the changes in load paths through the structure caused by the cracking. To support this research effort, NMSU contracted Los Alamos National Laboratory (LANL) to perform experimental modal analyses, and to develop experimentally verified numerical models of the bridge. Scientists from the LANL`s Condensed Matter and Thermal Physics Group (P-10) applied state-of-the-art sensors and data acquisition software to the modal tests. Engineers from the LANL`s Advanced Engineering Technology Group (MEE-13) conducted ambient and forced vibration tests to verify detailed and simplified finite element models of the bridge. Forced vibration testing was done in conjunction with engineers from Sandia National Laboratory (SNL) who provided and operated a hydraulic shaker.

Farrar, C.R.; Baker, W.E.; Bell, T.M.; Cone, K.M.; Darling, T.W.; Duffey, T.A.; Eklund, A.; Migliori, A.



Long-term surveillance plan for the Cheney disposal site near Grand Junction, Colorado  

Science Conference Proceedings (OSTI)

This long-term surveillance plan (LTSP) describes the U.S. Department of Energy`s (DOE) long-term care program for the Uranium Mill Tailings Remedial Action (UMTRA) Project Cheney Disposal Site near Grand Junction, Colorado. This LSTP describes the long-term surveillance program the DOE will implement to ensure the Cheney Disposal Site performs as designed and is cared for in a manner that protects the public health and safety and the environment. Before each disposal site is licensed for custody and long-term care, the Nuclear Regulatory Commission (NRC) requires the DOE to submit such a site-specific LTSP.




Interim long-term surveillance plan for the Cheney disposal site near, Grand Junction, Colorado  

SciTech Connect

This interim long-term surveillance plan (LTSP) describes the U.S. Department of Energy`s (DOE) long-term care program for the Uranium Mill Tailings Remedial Action (UMTRA) Project Cheney Disposal Site in Mesa County near Grand Junction, Colorado. This LSTP describes the long-term surveillance program the DOE will implement to ensure the Cheney disposal site performs as designed and is cared for in a manner that protects the public health and safety and the environment. Before each disposal site is licensed for custody and long-term care, the Nuclear Regulatory Commission (NRC) requires the DOE to submit such a site-specific LTSP.




Select Economic Implications for the Biological Control of Arundo donax along the Rio Grande  

E-Print Network (OSTI)

Arundo donax, or giant reed, is a large, bamboo-like plant native to Spain that has invaded several thousand acres of the Rio Grande riparian in Texas. The plant grows to 18-24 feet, consuming large quantities of water per acre per year. With concern of increased water demands in the Texas Lower Rio Grande Valley region, the United States Department of Agriculture-Agricultural Research Service (USDA)ARS) is investigating four herbivorous insects as potential biological control agents for Arundo donax to facilitate increased water supply. This study examines select economic implications for agricultural water users in the United States of applying these biological control agents along the Rio Grande. The research includes (a) estimating the value of the water saved due to the reduction of Arundo donax, (b) a benefit-cost analysis, (c) regional economic impact analysis, and (d) an estimate of the per-unit cost of water saved over a 50-year planning horizon (2009 through 2058). The model ArundoEcon is used to perform a deterministic analyses using low- and high-marginal-composite acre values. Regional results indicate present values of farmlevel benefits ranging from $97.80 to $159.87 million. Benefit-cost ratios are calculated with normalized prices and range from 4.38 to 8.81. Sensitivity analyses provide a robust set of results for Arundo water use, replacement species water use, Arundo expansion rate after control, value of water, and the cost of the program. The pre-production processes and farm-gate economic impact analysis is estimated using multipliers from the IMPLAN model. Regional results reveal a range of $8.90 to $17.94 million annually in economic output and 197 to 351 new jobs for the year 2025. Further results show the cost per acre-foot of water saved is $44.08. This amount is comparable to other projects designed to conserve water in the region. The USDA)ARS, Weslaco, Texas Arundo donax biological control project realizes positive results for the benefit-cost ratios, economic impact analyses, and competitive results for the per-unit cost of saving water. These positive results indicate this project will have positive economic implications for the U.S. and the Texas Lower Rio Grande Valley.

Seawright, Emily Kaye



Toward Net Energy Buildings: Design, Construction, and Performance of the Grand Canyon House  

DOE Green Energy (OSTI)

The Grand Canyon house is a joint project of the DOE's National Renewable Energy Laboratory and the U.S. National Park Service and is part of the International Energy Agency Solar Heating and Cooling Programme Task 13 (Advanced Solar Low-Energy Buildings). Energy consumption of the house, designed using a whole-building low-energy approach, was reduced by 75% compared to an equivalent house built in accordance with American Building Officials Model Energy Code and the Home Energy Rating System criteria.

Balcomb, J. D.; Hancock, C. E.; Barker, G.



Results of the radiological survey at Diebold Safe Company, 1550 Grand Boulevard, Hamilton, Ohio (HO001)  

SciTech Connect

At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducted investigative radiological surveys at Diebold Safe Company, 1550 Grand Boulevard, Hamilton, Ohio in 1988 and 1989. The purpose of the surveys was to determine whether the property was contaminated with radioactive residues, principally {sup 238}U. The surveys included gamma scans; direct and transferable measurements of alpha, beta, and gamma radiation levels; and dust, debris, air, and soil sampling for radionuclide analyses. 6 refs., 6 figs., 5 tabs.

Foley, R.D.; Floyd, L.M.



PCB usage at the Grand Junction Area Office Facility. Final report  

Science Conference Proceedings (OSTI)

The development, implementation, and results of the polychlorinated biphenyl (PCB) identification project at the Grand Junction Area Office (GJAO) are summarized. Methodology for the PCB analysis is described, and results are tabulated. Of the 51 transformers and disconnects in use at GJAO, 15 unites were determined to be PCB-contaminated or filled with PCBs. This number falls within EPA's estimate of 25 to 40 percent of all transformers in use being at least contaminated. Approximately 324 gallons of PCBs and 515 gallons of PCB-contaminated fluids are being used currently. No contaminated transformers or disconnects are in a position to contaminate food or feed products at the facility.

Miller, M.E.; Donivan, S.



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Network discovery, characterization, and prediction : a grand challenge LDRD final report.  

SciTech Connect

This report is the final summation of Sandia's Grand Challenge LDRD project No.119351, 'Network Discovery, Characterization and Prediction' (the 'NGC') which ran from FY08 to FY10. The aim of the NGC, in a nutshell, was to research, develop, and evaluate relevant analysis capabilities that address adversarial networks. Unlike some Grand Challenge efforts, that ambition created cultural subgoals, as well as technical and programmatic ones, as the insistence on 'relevancy' required that the Sandia informatics research communities and the analyst user communities come to appreciate each others needs and capabilities in a very deep and concrete way. The NGC generated a number of technical, programmatic, and cultural advances, detailed in this report. There were new algorithmic insights and research that resulted in fifty-three refereed publications and presentations; this report concludes with an abstract-annotated bibliography pointing to them all. The NGC generated three substantial prototypes that not only achieved their intended goals of testing our algorithmic integration, but which also served as vehicles for customer education and program development. The NGC, as intended, has catalyzed future work in this domain; by the end it had already brought in, in new funding, as much funding as had been invested in it. Finally, the NGC knit together previously disparate research staff and user expertise in a fashion that not only addressed our immediate research goals, but which promises to have created an enduring cultural legacy of mutual understanding, in service of Sandia's national security responsibilities in cybersecurity and counter proliferation.

Kegelmeyer, W. Philip, Jr.



Grand Junction Projects Office site environmental report for calendar year 1992  

SciTech Connect

This report presents information pertaining to environmental activities conducted during calendar year 1992 at the US Department of Energy Grand Junction Projects Office (DOE-GJPO) facility in Colorado. Environmental activities conducted at the GJPO facility during 1992 included those associated with environmental compliance, site remediation, off-site dose modeling, and radiological and nonradiological monitoring. Four phases of the on-site Grand Junction Projects Office Remedial Action Project were completed in 1992. Remediation activities, which included the removal of 161,589 tons of uranium-mill-tailings-contaminated material from the facility, were conducted in compliance with all applicable permits. Off-site dose modeling for the GJPO was conducted to determine compliance with current National Emission Standards for Hazardous Air Pollutants, Subpart H, and applicable DOE Orders (5400.1 and 5400.5). The total off-site EDE to the public from all sources of radiation emanating from the facility (radon, air particulates, gamma) was calculated as 9 mrem/yr, which is well below the DOE dose limit of 100 mrem/yr above background. The radiological and nonradiological monitoring program at the GJPO facility included monitoring of activities that generate potentially hazardous or toxic wastes and monitoring of ambient air, surface water, and ground water.

Not Available



Characterization of Pump Flow at the Grand Coulee Pumping Station for Fish Passage, 2004  

DOE Green Energy (OSTI)

This report describes a study conducted by PNNL for the Bonneville Power Administration to characterized the conditions fish experience when entrained in pump flow at the Grand Coulee Dam. PNNL used the Sensor Fish to measure the acceleration and pressure conditions that might be experienced by fish who are pulled through the pumps and turbines at Grand Coulee Dam's pump generation station and transported up into the feeder canal leading to Banks Lake. The probability that fish would be struck by the pump generating plant's new 9-bladed turbines was also calculated using Monte Carlo simulations. Our measurements showed relatively low turbulence except in the immediate vicinity of the runner environment. The highest pressure experienced by the Sensor Fish was estimated at 157 psi (the pressure gauge saturated at 155 psi). The probability of strike was also calculated, based on the average length of hatchery-reared juvenile kokanee (land-locked sockeye). Strike probabilities ranged from 0.755 for 2.36-inch fish to 0.3890 for 11.8-inch fish. The probability of strike estimates indicate that the majority (77%) of kokanne would be carried through the pump without being struck and most likely without injury resulting from pressure and turbulence exposure. Of the 23% that might be struck it is expected that 60% would arrive in Banks Lake without visible external injuries. Thus more than 90% of entrained fish would be expected to arrive in Banks Lake without injury.

Carlson, Thomas J.; Duncan, Joanne P.; Johnson, Robert L.



KASCADE-Grande measurements of energy spectra for elemental groups of cosmic rays  

E-Print Network (OSTI)

The KASCADE-Grande experiment, located at KIT-Karlsruhe, Germany, consists of a large scintillator array for measurements of charged particles, N_ch, and of an array of shielded scintillation counters used for muon counting, N_mu. KASCADE-Grande is optimized for cosmic ray measurements in the energy range 10 PeV to 1000 PeV, thereby enabling the verification of a knee in the iron spectrum expected at approximately 100 PeV. Exploring the composition in this energy range is of fundamental importance for understanding the transition from galactic to extragalactic cosmic rays. Following earlier studies of elemental spectra reconstructed in the knee energy range from KASCADE data, we have now extended these measurements to beyond 100 PeV. By analysing the two-dimensional shower size spectrum N_ch vs. N_mu, we reconstruct the energy spectra of different mass groups by means of unfolding methods. The procedure and its results, giving evidence for a knee-like structure in the spectrum of iron nuclei, will be presente...

Fuhrmann, D; Arteaga-Velazquez, J C; Bekk, K; Bertaina, M; Bluemer, J; Bozdog, H; Brancus, I M; Cantoni, E; Chiavassa, A; Cossavella, F; Curcio, C; Daumiller, K; de Souza, V; Di Pierro, F; Doll, P; Engel, R; Engler, J; Fuchs, B; Gils, H J; Glasstetter, R; Grupen, C; Haungs, A; Heck, D; Hoerandel, J R; Huber, D; Huege, T; Kampert, K -H; Kang, D; Klages, H O; Link, K; Luczak, P; Ludwig, M; Mathes, H J; Mayer, H J; Melissas, M; Milke, J; Mitrica, B; Morello, C; Oehlschlaeger, J; Ostapchenko, S; Palmieri, N; Petcu, M; Pierog, T; Rebel, H; Roth, M; Schieler, H; Schoo, S; Schroeder, F G; Sima, O; Toma, G; Trinchero, G C; Ulrich, H; Weindl, A; Wochele, D; Wochele, J



China Papers No. 6 Canada in Chinas Grand Strategy  

E-Print Network (OSTI)

www.conseilinternationalducanada.org China Papers No. 6 The twisted course of Sino-Canadian relations since the Harper Conservative government acceded to power in January 2006 has rightly focused attention on the foundations of our bilateral relationship. This paper ventures a look at the basis of the bilateral relationship from the Chinese perspective. It looks at the overall objectives of Chinas political and diplomatic strategy, how Chinese policy is made and the explicit and implicit place allotted to Canada within Chinas overall foreign policy. Canadas place in Chinas grand strategy will be approached from two directions: the role assigned to bilateral relations with Canada as found in various Chinese foreign policy announcements and the potential role for Canada within the overall objectives of Chinas grand strategy. The paper also looks at the scale of cooperation under present conditions versus the scope for cooperation that could be articulated as compatible with Chinas overall foreign policy objectives consistent with Canadian foreign policy goals and objectives. The Canadian experience is offset by brief comparisons with France and Australia and some suggestions are offered on how to anchor the bilateral relationship on a sounder and more stable framework that takes into account Canadas unique opportunities given Chinas changing place in the global balance.

Jeremy Paltiel



Rock Rapids Municipal Utility | Open Energy Information  

Open Energy Info (EERE)

Rapids Municipal Utility Rapids Municipal Utility Jump to: navigation, search Name Rock Rapids Municipal Utility Place Iowa Utility Id 16206 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Power (Single-Phase) Commercial Commercial Power (Three-Phase) Commercial Residential Power Residential Average Rates Residential: $0.0807/kWh Commercial: $0.0633/kWh Industrial: $0.0899/kWh

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RRTT - Rapid Response Team for Transmission  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rapid Response Team- Rapid Response Team- Transmission Exploring the Business Link Opportunity: Transmission & Clean Energy Development in the West TRIBAL LEADER FORUM SERIES February 7, 2012 Laura Smith Morton Department of Energy Laura.morton@hq.doe.gov Nine Agency MOU * Improves uniformity, consistency, and transparency - Establishes the roles and responsibilities of the nine signatory agencies regarding electric transmission infrastructure project applicants * Provides single point of contact for coordinating all federal authorizations required to locate electric transmission facilities on federal land * Establishes DOE (under authority pursuant to section 216(h) of the FPA) as lead agency for coordinating all federal authorizations and related environmental


Preliminary Analysis of Grande Ronde Basalt Formation Flow Top Transmissivity as it Relates to Assessment and Site Selection Applications for Fluid/Energy Storage and Sequestration Projects  

SciTech Connect

Preliminary Analysis of Grande Ronde Basalt Formation Flow Top Transmissivity as it Relates to Assessment and Site Selection Applications for Fluid/Energy Storage and Sequestration Projects

Spane, Frank A.



Supplement Analysis for the Grande Ronde Basin Endemic Spring Chinook Salmon Supplementation Program EA (DOE/EA-1173/SA-01)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

December 18, 2003 December 18, 2003 REPLY TO ATTN OF: KEC-4 SUBJECT: Supplement Analysis for the Grande Ronde Basin Endemic Spring Chinook Salmon Supplementation Program EA (DOE/EA-1173/SA-01) Ken Kirkman - KEWU-4 TO: Fish and Wildlife Project Manager Proposed Action: Monitoring and Evaluation of Supplemented Spring Chinook Salmon and Life Histories of Wild Summer Steelhead in the Grande Ronde Basin Project No: 1998-007-03 Location: Union County, Oregon Proposed by: Bonneville Power Administration (BPA), Confederated Tribes of the Umatilla Indian Reservation (CTUIR) and Oregon Department of Fish and Wildlife (ODFW). Description of the Proposed Action: The CTUIR and ODFW propose to expand their monitoring and evaluation for the Grande Ronde spring chinook supplementation program to


Rapid Data Assimilation in the Indoor Environment: Theory and...  

NLE Websites -- All DOE Office Websites (Extended Search)

Rapid Data Assimilation in the Indoor Environment: Theory and Examples from Real-Time Interpretation of Indoor Plumes of Airborne Chemical Title Rapid Data Assimilation in the...


Rapid Data Assimilation in the Indoor Environment: theory and...  

NLE Websites -- All DOE Office Websites (Extended Search)

Rapid Data Assimilation in the Indoor Environment: theory and examples from real-time interpretation of indoor plumes of airborne chemicals Title Rapid Data Assimilation in the...


Revealing the rapid isothermal growth of graphene on catalytic...  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials Synthesis from Atoms to Systems Revealing the rapid isothermal growth of graphene on catalytic substrates July 01, 2013 Optical reflectivity tracks the rapid growth of...


Rapid low fidelity turbomachinery disk optimization  

Science Conference Proceedings (OSTI)

Turbomachinery disks are heavy, highly stressed components used in gas turbines. Improved design of turbomachinery disks could yield a significant reduction in engine weight. This paper focuses on rapid low fidelity design and optimization of isotropic ... Keywords: Flywheel, Optimization, Plane stress, Turbomachinery disk

David P. Gutzwiller; Mark G. Turner



GOES Observation of a Rapidly Melting Snowband  

Science Conference Proceedings (OSTI)

GOES observation of rapid dissipation of a 510 cm (24 inches) depth snowband over the central and upper Mississippi River valley on 15 April 1980 is presented. Differences in the local weather between the stations with and without melting snow ...

Carlyle H. Wash; Delain A. Edman; John Zapotocny



Rapid file system development using ptrace  

Science Conference Proceedings (OSTI)

Developing kernel-level file systems is a difficult task that requires a significant time investment. For experimental file systems, it is desirable to develop a prototype before investing the time required to develop a kernel-level file system. We have ... Keywords: monitors, rapid prototyping

Richard P. Spillane; Charles P. Wright; Gopalan Sivathanu; Erez Zadok



Impacts of the Cerro Grande fire on Homestead era and Manhattan Project properties at Los Alamos National Laboratory.  

SciTech Connect

In May of 2000, the Cerro Grande Fire burned approximately 8,000 acres of Department of Energy (DOE) managed land at the Los Alamos National Laboratory (LANL). Although the fire was generally of low intensity, it impacted a significant number of LANL's cultural resources. Historic wooden properties were affected more heavily than prehistoric archaeological sites. This paper will provide an overview of the Homestead and Manhattan Project Periods at LANL and will discuss the effects of the Cerro Grande Fire on historic wooden properties. Post-fire cultural resource management issues will also be discussed.

McGehee, E. D. (Ellen D.); Isaacson, J. (John)



Scientific Grand Challenges: Crosscutting Technologies for Computing at the Exascale - February 2-4, 2010, Washington, D.C.  

SciTech Connect

The goal of the "Scientific Grand Challenges - Crosscutting Technologies for Computing at the Exascale" workshop in February 2010, jointly sponsored by the U.S. Department of Energys Office of Advanced Scientific Computing Research and the National Nuclear Security Administration, was to identify the elements of a research and development agenda that will address these challenges and create a comprehensive exascale computing environment. This exascale computing environment will enable the science applications identified in the eight previously held Scientific Grand Challenges Workshop Series.

Khaleel, Mohammad A.



Impacts of the Cerro Grande fire on Homestead era and Manhattan Project properties at Los Alamos National Laboratory.  

SciTech Connect

In May of 2000, the Cerro Grande Fire burned approximately 8,000 acres of Department of Energy (DOE) managed land at the Los Alamos National Laboratory (LANL). Although the fire was generally of low intensity, it impacted a significant number of LANL's cultural resources. Historic wooden properties were affected more heavily than prehistoric archaeological sites. This paper will provide an overview of the Homestead and Manhattan Project Periods at LANL and will discuss the effects of the Cerro Grande Fire on historic wooden properties. Post-fire cultural resource management issues will also be discussed.

McGehee, E. D. (Ellen D.); Isaacson, J. (John)



Grand Coulee - Bell 500-kV Transmission Line Project, Draft Environmental Impact Statement  

Science Conference Proceedings (OSTI)

BPA is proposing to construct a 500-kilovolt (kV) transmission line that would extend approximately 84 miles between the Grand Coulee 500-kV Switchyard, near Grand Coulee Dam, and the Bell Substation, in Mead just north of Spokane. The new line would cross portions of Douglas, Grant, Lincoln, and Spokane counties. In addition to the transmission line, new equipment would be installed at the substations at each end of the new line and at other facilities. The proposed action would remove an existing 115-kV transmission line and replace it with the new 500-kV line on existing right-of-way for most of its length. Additional right-of-way would be needed in the first 3.5 miles out of the Grand Coulee Switchyard to connect to the existing 115-kV right-of-way. Since the mid-1990s, the transmission path west of Spokane, called the West of Hatwai transmission pathway, has grown increasingly constrained. To date, BPA has been able to manage operation of the path through available operating practices, and customer needed have been met while maintaining the reliability of the path. however, in early 2001, operations showed that the amount of electricity that needs to flow from east to west along this path creates severe transmission congestion. Under these conditions, the system is at risk of overloads and violation of industry safety and reliability standards. The problem is particularly acute in the spring and summer months because of the large amount of power generated by dams east of the path. Large amounts of water cannot be spilled during that time in order for BPA to fulfill its obligation to protect threatened and endangered fish. The amount of power that needs to move through this area during these months at times could exceed the carrying capacity of the existing transmission lines. In additional capacity is not added, BPA will run a significant risk that it will not be able to continue to meet its contractual obligations to deliver power and maintain reliability standards that minimize risks to public safety and to equipment. BPA is considering two construction alternatives, the Agency Proposed Action and the Alternative Action. The Alternative Action would include all the components of the Preferred Action except a double-circuit line would be constructed in the Spokane area between a point about 2 miles west of the Spokane River and Bell Substation, a distance of about 9 miles. BPA is also considering the No Action Alternative.

N /A



Grande Ronde Basin Fish Habitat Enhancement Project, Annual Report 2002-2003.  

DOE Green Energy (OSTI)

On July 1, 1984 the Bonneville Power Administration and the Oregon Department of Fish and Wildlife entered into an agreement to initiate fish habitat enhancement work in the Joseph Creek subbasin of the Grande Ronde River Basin in northeast Oregon. In July of 1985 the Upper and Middle Grande Ronde River, and Catherine Creek subbasins were included in the intergovernmental contract, and on March 1, 1996 the Wallowa River subbasin was added. The primary goal of 'The Grande Ronde Basin Fish Habitat Enhancement Project' is to create, protect, and restore riparian and instream habitat for anadromous salmonids, thereby maximizing opportunities for natural fish production within the basin. This project provided for implementation of Program Measure 703 (C)(1), Action Item 4.2 of the Northwest Power Planning Council's Columbia River Basin Fish and Wildlife Program (NPPC, 1987), and continues to be implemented as offsite mitigation for mainstem fishery losses caused by the Columbia River hydro-electric system. All work conducted by the Oregon Department of Fish and Wildlife is on private lands and therefore requires that considerable time be spent developing rapport with landowners to gain acceptance of, and continued cooperation with this program throughout 10-15 year lease periods. This project calls for passive regeneration of habitat, using riparian exclosure fencing as the primary method to restore degraded streams to a normative condition. Active remediation techniques using plantings, off-site water developments, site-specific instream structures, or whole channel alterations are also utilized where applicable. Individual projects contribute to and complement ecosystem and basin-wide watershed restoration efforts that are underway by state, federal, and tribal agencies, and local watershed councils. Work undertaken during 2002 included: (1) Implementing 1 new fencing project in the Wallowa subbasin that will protect an additional 0.95 miles of stream and 22.9 acres of habitat; (2) Conducting instream work activities in 3 streams to enhance habitat and/or restore natural channel dimensions, patterns or profiles; (3) Planting 31,733 plants along 3.7 stream miles, (4) Establishing 71 new photopoints and retaking 254 existing photopoint pictures; (5) Monitoring stream temperatures at 12 locations on 6 streams; (6) Completing riparian fence, water gap and other maintenance on 100.5 miles of project fences. Since initiation of the project in 1984 over 68.7 miles of anadromous fish bearing streams and 1,933 acres of habitat have been protected, enhanced and maintained.

McGowan, Vance



l!Jm~~Ut~'1CV GrandChalienge",regardiessexl,'Cpt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

,;,,,,,..<:,,) ,;,,,,,..<:,,) l!Jm~~Ut~'1CV GrandChalienge",regardiessexl,'Cpt tiide'rnJtlrsuant toP.,L 96-511,'asamended, and Natiunal i11lcnsifi.catiol1 capabHffies which yield.amatic cn~gf to a wide range chemical producti()n~ iB) High,. of stich inod refining, non.cmctallic.materials ·IKi[tHtle!tm4;ti. l't.~"<.4 u.an'~:1:;f:) .1.'<1 conventi onal hi gh jeat.!,\iltnillnl·l'AiJ1l~illl~t!l Recvvery - .... ,·"", :l~IWtlra.,;:c~ftjcjtl\tl'tsteaJn.PJtlfYd!uctio}jti!hilgh perr~lanceJllmacesand 5ustainability7 reduced ""liter and a carbQn t(lOtprint li)f indt.t,'}try; (D) Sustainable Manufacturing


Necessary conditions of the equivalence of canonical and grand canonical ensembles in Coulomb system thermodynamics  

SciTech Connect

It was found that the equivalence of the grand canonical and canonical ensembles for the Coulomb systems is possible only when charged particles of different types in calculating the physical quantities are considered as formally 'independent' ones, and the quasi-neutrality condition is used in the final stage of calculations. The phase equilibrium condition is obtained and the expression is derived for the isothermal compressibility of matter as a two-component Coulomb system, which corresponds to the known limit relations for static structure factors. On this basis, it is demonstrated that the critical point of matter, considering as the Coulomb system is determined from the condition of vanishing mean square of fluctuations of the total charge per unit volume.

Bobrov, V. B. [Joint Institute for High Temperatures, Russian Academy of Sciences, 13/19, Izhorskaia Str., Moscow 125412 (Russian Federation); Sokolov, I. M. [Institut fuer Physik, Humboldt-Universitaet zu Berlin, Newtonstrasse 15, D-12489 Berlin (Germany); Trigger, S. A. [Joint Institute for High Temperatures, Russian Academy of Sciences, 13/19, Izhorskaia Str., Moscow 125412 (Russian Federation); Institut fuer Physik, Humboldt-Universitaet zu Berlin, Newtonstrasse 15, D-12489 Berlin (Germany)



Assessment of cover systems at the Grand Junction, Colorado, uranium mill tailings pile: 1987 field measurements  

SciTech Connect

Four Pacific Northwest Laboratory (PNL) scientists and a technician conducted an onsite evaluation of radon gas exhalation, water content profiles, and plant and animal intrusion for a series of cover systems located on the uranium mill tailings pile at Grand Junction, Colorado. These six plots were sampled extensively down to the radon control layer (e.g., asphalt or wet clay) for soil moisture content and permeability. Radon gas emission through the surface was measured. Soil samples were collected and analyzed in the lab for particle-size distribution, particle density, bulk density, and ambient water content. Prairie dog burrows were excavated to discover the extent to which they penetrated the barriers. Plant type, density, and cover characteristics were measured.

Gee, G.W.; Campbell, M.D.; Freeman, H.D.; Cline, J.F.



Are Uranus & Neptune responsible for Solar Grand Minima and Solar Cycle Modulation?  

E-Print Network (OSTI)

Detailed solar Angular Momentum (AM) graphs produced from the Jet Propulsion Laboratory (JPL) DE405 ephemeris display cyclic perturbations that show a very strong correlation with prior solar activity slowdowns. These same AM perturbations also occur simultaneously with known solar path changes about the solar system barycentre (SSB). The AM perturbations can be measured and quantified allowing analysis of past solar cycle modulations along with the 11,500 year solar proxy records (C14 & 10Be). The detailed AM information also displays a recurring wave of modulation that aligns very closely with the observed sunspot record since 1650. The AM perturbation and modulation is a direct product of the outer gas giants (Uranus & Neptune), this information gives the opportunity to predict future grand minima along with normal solar cycle strength with some confidence. A proposed a mechanical link between solar activity and planetary influence via a discrepancy found in solar/planet AM along with current AM pe...

Sharp, Geoff



A Pedagogical Study of the Grand Unification Theorem with Realization of Some Standard Equations  

E-Print Network (OSTI)

The God Almighty Grand Unification Theory proposed by Oyibo to unify all known forces in nature and other possibly unknown force fields has remained controversial not just because of its ambitious claims but also because of its unconventional mathematical approach. He has adopted the mathematical approach from his experience at solving the Navier Stokes equations in fluid mechanics using invariance of an arbitrary function under a group of conformal transformations. However, this esoteric approach resulted in a sound mathematical formulation for the modelling philosophy of his theorem which is that since the fundamental characteristic of the universe is motion and motion can only be provided by force, then the universe could be viewed as a large force field. He then represented the conservation of this large force field at a given space time point in the universe by a set of generic equations from which he obtained his generic solutions whose specific applications depend on the initial/boundary conditions and other physical constraint conditions. An important achievement of the theorem methodology is that modelling with it is reduced to algebraic operations rather than differential equations for the most parts in previous methodologies. With this understanding from pedagogically studying the modelling philosophy and mathematics of the theorem, we have been able to recover from it simple standard equations such as in the Fermat principle for geometric optics. This is encouraging and therefore supports the possibility to recover more results and also to provide new ones, thereby supporting the theorem as a potential candidate for a grand unification theory.

Godfrey E. Akpojotor; Myron W. Echenim



Use of a dynamic simulation model to understand nitrogen cycling in the middle Rio Grande, NM.  

Science Conference Proceedings (OSTI)

Water quality often limits the potential uses of scarce water resources in semiarid and arid regions. To best manage water quality one must understand the sources and sinks of both solutes and water to the river system. Nutrient concentration patterns can identify source and sink locations, but cannot always determine biotic processes that affect nutrient concentrations. Modeling tools can provide insight into these large-scale processes. To address questions about large-scale nitrogen removal in the Middle Rio Grande, NM, we created a system dynamics nitrate model using an existing integrated surface water--groundwater model of the region to evaluate our conceptual models of uptake and denitrification as potential nitrate removal mechanisms. We modeled denitrification in groundwater as a first-order process dependent only on concentration and used a 5% denitrification rate. Uptake was assumed to be proportional to transpiration and was modeled as a percentage of the evapotranspiration calculated within the model multiplied by the nitrate concentration in the water being transpired. We modeled riparian uptake as 90% and agricultural uptake as 50% of the respective evapotranspiration rates. Using these removal rates, our model results suggest that riparian uptake, agricultural uptake and denitrification in groundwater are all needed to produce the observed nitrate concentrations in the groundwater, conveyance channels, and river as well as the seasonal concentration patterns. The model results indicate that a total of 497 metric tons of nitrate-N are removed from the Middle Rio Grande annually. Where river nitrate concentrations are low and there are no large nitrate sources, nitrate behaves nearly conservatively and riparian and agricultural uptake are the most important removal mechanisms. Downstream of a large wastewater nitrate source, denitrification and agricultural uptake were responsible for approximately 90% of the nitrogen removal.

Meixner, Tom (University of Arizona, Tucson, AZ); Tidwell, Vincent Carroll; Oelsner, Gretchen (University of Arizona, Tucson, AZ); Brooks, Paul (University of Arizona, Tucson, AZ); Roach, Jesse D.


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Live pathogens: rapid detection technique developed  

NLE Websites -- All DOE Office Websites (Extended Search)

January » January » Live Pathogens: Rapid Detection Technique Developed Live pathogens: rapid detection technique developed The technique relies on bacteria being critically dependent upon the key nutrient iron. January 24, 2013 Colorized scanning electron micrograph of E. coli. Colorized scanning electron micrograph of E. coli. Photo credit: US Centers for Disease Control and Prevention LANL's new method eliminates the need for laboratory culture and greatly speeds the process. Los Alamos researchers have developed a better technique for quick detection of live pathogens in the field. Identification of viable bacteria in a complex environment is scientifically challenging. Current detection and diagnostic techniques are inadequate in major public health emergencies, such as outbreaks of food-borne illness. Detection of live


Rapid Scan AERI Observations: Benefits and Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Rapid Scan AERI Observations: Benefits and Analysis Rapid Scan AERI Observations: Benefits and Analysis W. F. Feltz, D. D. Turner, R. O. Knuteson, and R. G. Dedecker Space Science and Engineering Center Cooperative Institute of Mesoscale Meteorological Studies University of Wisconsin-Madison Madison, Wisconsin D. D. Turner Pacific Northwest National Laboratory Richland, Washington Introduction The U.S. Department of Energy's (DOE's) Atmospheric Radiation Measurement (ARM) Program has funded the development of the atmospheric emitted radiance interferometer (AERI). This has led to a hardened, autonomous system that measures downwelling infrared (IR) radiance at high-spectral resolution. Seven AERI systems have been deployed around the world as part of the ARM Program. The initial goal of these instruments was to characterize the clear-sky IR emission from the atmosphere,


Why are gasoline prices falling so rapidly?  

Gasoline and Diesel Fuel Update (EIA)

Why are gasoline prices falling so rapidly? Why are gasoline prices falling so rapidly? As of October 29, 2001, the national average retail price of regular gasoline was $1.235 per gallon, its lowest level since November 8, 1999 (Figure 1). The average price has fallen 29 cents in 6 weeks since September 17, with further declines perhaps to come. The sharpest decline has been in the Midwest (Petroleum Administration for Defense District 2), where the average has dropped 57 cents in 8 weeks since Labor Day (September 3). Additionally, this decline comes on the heels of a 33-cent drop in the national average in 10 weeks from Memorial Day through August 6, interrupted only by a brief 17-cent rise in August. In total, the national average retail gasoline price has fallen nearly 48 cents from its peak on May 14. This is already the widest one-year range in retail prices


Cedar Rapids Wind Project | Open Energy Information  

Open Energy Info (EERE)

Wind Project Wind Project Jump to: navigation, search Name Cedar Rapids Wind Project Facility Cedar Rapids Sector Wind energy Facility Type Community Wind Location NE Coordinates 41.562199°, -98.148048° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.562199,"lon":-98.148048,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rapid scanning system for fuel drawers  

DOE Patents (OSTI)

A nondestructive method for uniqely distinguishing among and quantifying the mass of individual fuel plates in situ in fuel drawers utilized in nuclear reactors is described. The method is both rapid and passive, eliminating the personnel hazard of the commonly used irradiation techniques which require that the analysis be performed in proximity to an intense neutron source such as a reactor. In the present technique, only normally decaying nuclei are observed. This allows the analysis to be performed anywhere. This feature, combined with rapid scanning of a given fuel drawer (in approximately 30 s), and the computer data analysis allows the processing of large numbers of fuel drawers efficiently in the event of a loss alert.

Caldwell, John T. (Los Alamos, NM); Fehlau, Paul E. (Los Alamos, NM); France, Stephen W. (Los Alamos, NM)



Model Performance of Downscaling 19992004 Hydrometeorological Fields to the Upper Rio Grande Basin Using Different Forcing Datasets  

Science Conference Proceedings (OSTI)

This study downscaled more than five years of data (19992004) for hydrometeorological fields over the upper Rio Grande basin (URGB) to a 4-km resolution using a regional model [fifth-generation Pennsylvania State UniversityNational Center for ...

J. Li; X. Gao; S. Sorooshian



Submitted to HuffingtonPost.com Obama's Iran Nuclear Deadline: A Grand Bargain is Still Possible if Both Sides  

E-Print Network (OSTI)

nuclear program. Why then? For comparison sake, consider Pakistan and North Korea, two other states that recently developed nuclear weapons. Iran does not find itself in a situation like Pakistan, which, afterSubmitted to HuffingtonPost.com Obama's Iran Nuclear Deadline: A Grand Bargain is Still Possible

O'Donnell, Tom


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Grand Challenges for Biological and Environmental Research: A Long-Term Vision  

SciTech Connect

The interactions and feedbacks among plants, animals, microbes, humans, and the environment ultimately form the world in which we live. This world is now facing challenges from a growing and increasingly affluent human population whose numbers and lifestyles are driving ever greater energy demand and impacting climate. These and other contributing factors will make energy and climate sustainability extremely difficult to achieve over the 20-year time horizon that is the focus of this report. Despite these severe challenges, there is optimism that deeper understanding of our environment will enable us to mitigate detrimental effects, while also harnessing biological and climate systems to ensure a sustainable energy future. This effort is advanced by scientific inquiries in the fields of atmospheric chemistry and physics, biology, ecology, and subsurface science - all made possible by computing. The Office of Biological and Environmental Research (BER) within the Department of Energy's (DOE) Office of Science has a long history of bringing together researchers from different disciplines to address critical national needs in determining the biological and environmental impacts of energy production and use, characterizing the interplay of climate and energy, and collaborating with other agencies and DOE programs to improve the world's most powerful climate models. BER science focuses on three distinct areas: (1) What are the roles of Earth system components (atmosphere, land, oceans, sea ice, and the biosphere) in determining climate? (2) How is the information stored in a genome translated into microbial, plant, and ecosystem processes that influence biofuel production, climate feedbacks, and the natural cycling of carbon? (3) What are the biological, geochemical, and physical forces that govern the behavior of Earth's subsurface environment? Ultimately, the goal of BER science is to support experimentation and modeling that can reliably predict the outcomes and behaviors of complex biological and environmental systems, leading to robust solutions for DOE missions and strategic goals. In March 2010, the Biological and Environmental Research Advisory Committee held the Grand Challenges for Biological and Environmental Research: A Long-Term Vision workshop to identify scientific opportunities and grand challenges for BER science in the coming decades and to develop an overall strategy for drafting a long-term vision for BER. Key workshop goals included: (1) Identifying the greatest scientific challenges in biology, climate, and the environment that DOE will face over a 20-year time horizon. (2) Describing how BER should be positioned to address those challenges. (3) Determining the new and innovative tools needed to advance BER science. (4) Suggesting how the workforce of the future should be trained in integrative system science. This report lays out grand research challenges for BER - in biological systems, climate, energy sustainability, computing, and education and workforce training - that can put society on a path to achieve the scientific evidence and predictive understanding needed to inform decision making and planning to address future energy needs, climate change, water availability, and land use.

Arkin, A.; Baliga, N.; Braam, J.; Church, G.; Collins, J; Cottingham, R.; Ecker, J.; Gerstein, M.; Gilna, P.; Greenberg, J.; Handelsman, J.; Hubbard, S.; Joachimiak, A.; Liao, J.; Looger, L.; Meyerowitz, E.; Mjolness, E.; Petsko, G.; Sayler, G.; Simpson, M.; Stacey, G.; Sussman, M.; Tiedje, J.; Bader, D.; Cessi, P.; Collins, W.; Denning, S.; Dickinson, R.; Easterling, D.; Edmonds, J.; Feddema, J.; Field, C.; Fridlind, A.; Fung, I.; Held, I.; Jackson, R.; Janetos, A.; Large, W.; Leinen, M.; Leung, R.; Long, S.; Mace, G.; Masiello, C.; Meehl, G.; Ort, D.; Otto-Bliesner, B.; Penner, J.; Prather, M.; Randall, D.; Rasch, P.; Schneider, E.; Shugart, H.; Thornton, P.; Washington, W.; Wildung, R.; Wiscombe, W.; Zak, D.; Zhang, M.; Bielicki, J.; Buford, M.; Cleland, E.; Dale, V.; Duke, C.; Ehleringer, J.; Hecht, A.; Kammen, D.; Marland, G.; Pataki, D.; Riley, M. Robertson, P.; Hubbard, S.



Rapid Sampling Tools - Nuclear Engineering Multimedia  

NLE Websites -- All DOE Office Websites (Extended Search)

Nonproliferation and National Security Nonproliferation and National Security > Multimedia > Rapid Sampling Tools Director's Welcome Organization Achievements Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and Technology Legacy Opportunities within NE Division Visit Argonne Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE on Flickr Celebrating the 70th Anniversary of Chicago Pile 1 (CP-1) Argonne OutLoud on Nuclear Energy Argonne Energy Showcase 2012 Nonproliferation and National Security - Multimedia Bookmark and Share NPNS Multimedia, a collection of videos and audios featuring activities related to Nonproliferation and National Security



SciTech Connect

Disaster impact modeling and analysis uses huge volumes of image data that are produced immediately following a natural or an anthropogenic disaster event. Rapid damage assessment is the key to time critical decision support in disaster management to better utilize available response resources and accelerate recovery and relief efforts. But exploiting huge volumes of high resolution image data for identifying damaged areas with robust consistency in near real time is a challenging task. In this paper, we present an automated image analysis technique to identify areas of structural damage from high resolution optical satellite data using features based on image content.

Vijayaraj, Veeraraghavan [ORNL; Bright, Eddie A [ORNL; Bhaduri, Budhendra L [ORNL



Energy-beam-driven rapid fabrication system  

DOE Patents (OSTI)

An energy beam driven rapid fabrication system, in which an energy beam strikes a growth surface to form a molten puddle thereon. Feed powder is then injected into the molten puddle from a converging flow of feed powder. A portion of the feed powder becomes incorporated into the molten puddle, forcing some of the puddle contents to freeze on the growth surface, thereby adding an additional layer of material. By scanning the energy beam and the converging flow of feed powder across the growth surface, complex three-dimensional shapes can be formed, ready or nearly ready for use. Nearly any class of material can be fabricated using this system.

Keicher, David M. (Albuquerque, NM); Atwood, Clinton L. (Albuquerque, NM); Greene, Donald L. (Corrales, NM); Griffith, Michelle L. (Albuquerque, NM); Harwell, Lane D. (Albuquerque, NM); Jeantette, Francisco P. (Albuquerque, NM); Romero, Joseph A. (Albuquerque, NM); Schanwald, Lee P. (Albuquerque, NM); Schmale, David T. (Albuquerque, NM)



Rapid River Hatchery - Spring Chinook, Final Report  

SciTech Connect

This report presents the findings of the independent audit of the Rapid River Hatchery (Spring Chinook). The hatchery is located in the lower Snake River basin near Riggins Idaho. The hatchery is used for adult collection, egg incubation, and rearing of spring chinook. The audit was conducted in April 1996 as part of a two-year effort that will include 67 hatcheries and satellite facilities located on the Columbia and Snake River system in Idaho, Oregon, and Washington. The hatchery operating agencies include the US Fish and Wildlife Service, Idaho Department of Fish and Game, Oregon Department of Fish and Wildlife, and Washington Department of Fish and Wildlife.

Watson, M.



Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2000 Annual Report.  

DOE Green Energy (OSTI)

The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, commonly known as the Joint Stock Assessment Project (JSAP) is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (blocked area). The three-phase approach of this project will enhance the fisheries resources of the blocked area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information housed in a central location will allow managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP (NWPPC program measure 10.8B.26) is designed and guided jointly by fisheries managers in the blocked area and the Columbia Basin blocked area management plan (1998). The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of blocked area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the blocked area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. The use of common collection and analytical tools is essential to the process of streamlining joint management decisions. In 1999 and 2000 the project began to address some of the identified data gaps, throughout the blocked area, with a variety of newly developed sampling projects, as well as, continuing with ongoing data collection of established projects.

Crossley, Brian (Spokane Tribe of Indians, Department of Natural Resources, Wellpinit, WA); Lockwood, Jr., Neil W. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA)



Wildlife Protection, Mitigation and Enhancement Planning for Grand Coulee Dam, Final Report.  

SciTech Connect

The development and operation of Grand Coulee Dam inundated approximately 70,000 acres of wildlife habitat under the jurisdictions of the Colville Confederated Tribes, the Spokane Tribe, and the State of Washington. Under the provisions of the Pacific Northwest Electric Power Planning and Conservation Act of 1980, this study reviews losses to wildlife and habitat, and proposes mitigation for those losses. Wildlife loss estimates were developed from information available in the literature. Habitat losses and potential habitat gains through mitigation were estimated by a modified Habitat Evaluation Procedure. The mitigation plan proposes (1) acquisition of sufficient land or management rights to land to protect Habitat Units equivalent to those lost (approximately 73,000 acres of land would be required), (2) improvement and management of those lands to obtain and perpetuate target Habitat Units, and (3) protection and enhancement of suitable habitat for bald eagles. Mitigation is presented as four actions to be implemented over a 10-year period. A monitoring program is proposed to monitor mitigation success in terms of Habitat Units and wildlife population trends.

Creveling, Jennifer



Measurements of air contaminants during the Cerro Grande fire at Los Alamos National Laboratory  

Science Conference Proceedings (OSTI)

Ambient air sampling for radioactive air contaminants was continued throughout the Cerro Grande fire that burned part of Los Alamos National Laboratory. During the fire, samples were collected more frequently than normal because buildup of smoke particles on the filters was decreasing the air flow. Overall, actual sampling time was 96% of the total possible sampling time for the May 2000 samples. To evaluate potential human exposure to air contaminants, the samples were analyzed as soon as possible and for additional specific radionuclides. Analyses showed that the smoke from the fire included resuspended radon decay products that had been accumulating for many years on the vegetation and the forest floor that burned. Concentrations of plutonium, americium, and depleted uranium were also measurable, but at locations and concentrations comparable to non-fire periods. A continuous particulate matter sampler measured concentrations that exceeded the National Ambient Air Quality Standard for PM-10 (particles less than 10 micrometers in diameter). These high concentrations were caused by smoke from the fire when it was close to the sampler.

Eberhart, Craig



Long-term surveillance plan for the Cheney disposal site near Grand Junction, Colorado  

SciTech Connect

This long-term surveillance plan (LTSP) describes the U.S. Department of Energy`s (DOE) long-term care program for the Uranium Mill Tailings Remedial Action (UMTRA) Project Cheney disposal site. The site is in Mesa County near Grand Junction, Colorado. The U.S. Nuclear Regulatory Commission (NRC) has developed regulations for the issuance of a general license for the custody and long-term care of UMTRA Project disposal sites in 10 CFR Part 40. The purpose of this general license is to ensure that the UMTRA Project disposal sites are cared for in a manner that protects public health and safety and the environment. Before each disposal site may be licensed, the NRC requires the DOE to submit a site-specific LTSP. The DOE prepared this LTSP to meet this requirement for the Cheney disposal site. The general license becomes effective when the NRC concurs with the DOE`s determination that remedial action is complete and the NRC formally accepts this plan. This document describes the long-term surveillance program the DOE will implement to ensure that the Cheney disposal site performs as designed. The program is based on site inspections to identify potential threats to disposal cell integrity. The LTSP is based on the UMTRA Project long-term surveillance program guidance and meets the requirements of 10 CFR {section}40.27(b) and 40 CFR {section}192.03.




The integral formalism and the generating function of grand confluent hypergeometric function  

E-Print Network (OSTI)

Biconfluent Heun function, a confluent form of Heun function [1,2], is the special case of Grand Confluent Hypergeometric (GCH) function [4] replacing $\\mu$ and $\\varepsilon \\omega $ by 1 and -q: this has a regular singularity at x=0, and an irregular singularity at infinity of rank 2 (see (50) in Ref.[21]). In this paper I will apply three term recurrence formula [3] to the integral formalism of GCH function including all higher terms of A_n's and the generating function of GCH polynomial in which makes B_n term terminated. I show how to transform power series expansion in closed forms of GCH function to integral formalism analytically. This paper is 10th out of 10 in series "Special functions and three term recurrence formula (3TRF)". See section 6 for all the papers in the series. The previous paper in the series describes the power series expansion in closed forms of GCH function and its asymtotic behaviours [26].

Yoon Seok Choun



Assessing the local wind field at Sierra Grande Mountain in New Mexico with instrumentation  

DOE Green Energy (OSTI)

Six systems were installed on top of Sierra Grande, a nearly symmetrical mountain in New Mexico about halfway between Raton and Clayton, with a peak of 2659 m (8720 ft msl) standing over a wide mesa of approximately 1829 m (6000 ft msl). Two systems were on the peak, one at 10 m (33 ft) above the surface and the other at 20 m (66 ft) because the peak is often the most probable spot for the greatest wind energy. The two levels were needed to measure variations of speed with height. Four other systems with instruments at 10-m (33 ft) were located roughly north, east, south, and west from the center on secondary ridge lines to measure certain horizontal variations of the wind. The wind direction and speed were measured every 6 minutes, a time interval considerably shorter than the traditional 1 hour but long enough so that all WECS power outputs are expected to respond to these wind speed variations. All six systems were operated for a period of six months between 6 June 1979-5 December 1979.

Barnett, K.M.; Reynolds, R.D.



Superfund Record of Decision (EPA Region 2): Grand Street Mercury Site, Hoboken, NJ, September 30, 1997  

SciTech Connect

This Record of Decision presents the selected remedial action for the Grand Street Mercury Site. The major components of the selected remedy include: permanent relocation of the former residents of the Site; continuation of temporary relocation of the former residents until permanent relocation has been implemented; historic preservation mitigation measures for the buildings at the Site, as appropriate; gross mercury decontamination of the buildings at the Site including recovery of available mercury, whenever possible; identification and abatement of asbestos in the buildings at the Site; removal and recovery of reusable fixtures, appliances, and recyclable scrap metal and other building components; demolition of the two buildings at the Site using measures to minimize releases of mercury into the environment; removal and off-site disposal of all demolition debris at EPA-approved facilities; sampling of soils at the Site; excavation and off-site disposal of contaminated soils at EPA-approved facilities; sampling of soils at off-site adjacent locations; sampling of groundwater at the Site; and assessment of off-site soil and groundwater data to evaluate the need for future remedial action.


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


New capabilities in the HENP grand challenge storage access systemand its application at RHIC  

SciTech Connect

The High Energy and Nuclear Physics Data Access GrandChallenge project has developed an optimizing storage access softwaresystem that was prototyped at RHIC. It is currently undergoingintegration with the STAR experiment in preparation for data taking thatstarts in mid-2000. The behavior and lessons learned in the RHIC MockData Challenge exercises are described as well as the observedperformance under conditions designed to characterize scalability. Up to250 simultaneous queries were tested and up to 10 million events across 7event components were involved in these queries. The system coordinatesthe staging of "bundles" of files from the HPSS tape system, so that allthe needed components of each event are in disk cache when accessed bythe application software. The caching policy algorithm for thecoordinated bundle staging is described in the paper. The initialprototype implementation interfaced to the Objectivity/DB. In this latestversion, it evolved to work with arbitrary files and use CORBA interfacesto the tag database and file catalog services. The interface to the tagdatabase and the MySQL-based file catalog services used by STAR aredescribed along with the planned usage scenarios.

Bernardo, L.; Gibbard, B.; Malon, D.; Nordberg, H.; Olson, D.; Porter, R.; Shoshani, A.; Sim, A.; Vaniachine, A.; Wenaus, T.; Wu, K.; Zimmerman, D.



Grand Junction Projects Office Remedial Action Project Building 2 public dose evaluation. Final report  

SciTech Connect

Building 2 on the U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) site, which is operated by Rust Geotech, is part of the GJPO Remedial Action Program. This report describes measurements and modeling efforts to evaluate the radiation dose to members of the public who might someday occupy or tear down Building 2. The assessment of future doses to those occupying or demolishing Building 2 is based on assumptions about future uses of the building, measured data when available, and predictive modeling when necessary. Future use of the building is likely to be as an office facility. The DOE sponsored program, RESRAD-BUILD, Version. 1.5 was chosen for the modeling tool. Releasing the building for unrestricted use instead of demolishing it now could save a substantial amount of money compared with the baseline cost estimate because the site telecommunications system, housed in Building 2, would not be disabled and replaced. The information developed in this analysis may be used as part of an as low as reasonably achievable (ALARA) cost/benefit determination regarding disposition of Building 2.

Morris, R.



Technical basis for radiological release of Grand Junction Office Building 2. Volume 1, dose assessment  

SciTech Connect

Building 2 on the US Department of Energy (DOE) Grand Junction Office (GJO) site is part of the GJO Remedial Action Program (GJORAP). During evaluation of Building 2 for determination of radiological release disposition, some inaccessible surface contamination measurements were detected to be greater than the generic surface contamination guidelines of DOE Order 5400.5 (which are functionally equivalent to US Nuclear Regulatory Commission [NRC] Regulatory Guide 1.86). Although the building is nominal in size, it houses the site telecommunications system, that is critical to continued GJO operations, and demolition is estimated at $1.9 million. Because unrestricted release under generic surface contamination guidelines is cost-prohibitive, supplemental standards consistent with DOE Order 5400.5 are being pursued. This report describes measurements and dose analysis modeling efforts to evaluate the radiation dose to members of the public who might occupy or demolish Building 2, a 2,480 square-foot (ft) building constructed in 1944. The north portion of the building was used as a shower facility for Manhattan Project uranium-processing mill workers and the south portion was a warehouse. Many originally exposed surfaces are no longer accessible for contamination surveys because expensive telecommunications equipment have been installed on the floors and mounted on panels covering the walls. These inaccessible surfaces are contaminated above generic contamination limits.

Morris, R.; Warga, J.; Thorne, D.



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



E3: Success Story - Rapid-Line Inc. | Economy Energy ...  

Science Conference Proceedings (OSTI)

... Lindquist and other Rapid-Line staff worked with the Green ... is true and not just a short-lived trend in ... Mark Lindquist, President, Rapid-Line Inc. ...



A Three-Dimensional Balance Theory for Rapidly Rotating Vortices  

Science Conference Proceedings (OSTI)

A three-dimensional balance formulation for rapidly rotating vortices, such as hurricanes, is presented. The asymmetric balance (AB) theory represents a new mathematical framework for studying the slow evolution of rapidly rotating fluid systems. ...

Lloyd J. Shapiro; Michael T. Montgomery




Science Conference Proceedings (OSTI)

A new method for the determination of radiostrontium in seawater samples has been developed at the Savannah River National Laboratory (SRNL) that allows rapid preconcentration and separation of strontium and yttrium isotopes in seawater samples for measurement. The new SRNL method employs a novel and effective pre-concentration step that utilizes a blend of calcium phosphate with iron hydroxide to collect both strontium and yttrium rapidly from the seawater matrix with enhanced chemical yields. The pre-concentration steps, in combination with rapid Sr Resin and DGA Resin cartridge separation options using vacuum box technology, allow seawater samples up to 10 liters to be analyzed. The total {sup 89}Sr + {sup 90}Sr activity may be determined by gas flow proportional counting and recounted after ingrowth of {sup 90}Y to differentiate {sup 89}Sr from {sup 90}Sr. Gas flow proportional counting provides a lower method detection limit than liquid scintillation or Cerenkov counting and allows simultaneous counting of samples. Simultaneous counting allows for longer count times and lower method detection limits without handling very large aliquots of seawater. Seawater samples up to 6 liters may be analyzed using Sr Resin for {sup 89}Sr and {sup 90}Sr with a Minimum Detectable Activity (MDA) of 1-10 mBq/L, depending on count times. Seawater samples up to 10 liters may be analyzed for {sup 90}Sr using a DGA Resin method via collection and purification of {sup 90}Y only. If {sup 89}Sr and other fission products are present, then {sup 91}Y (beta energy 1.55 MeV, 58.5 day half-life) is also likely to be present. {sup 91}Y interferes with attempts to collect {sup 90}Y directly from the seawater sample without initial purification of Sr isotopes first and {sup 90}Y ingrowth. The DGA Resin option can be used to determine {sup 90}Sr, and if {sup 91}Y is also present, an ingrowth option with using DGA Resin again to collect {sup 90}Y can be performed. An MDA for {sup 90}Sr of <1 mBq/L for an 8 hour count may be obtained using 10 liter seawater sample aliquots.

Maxwell, S.



RAPID-CURE COATINGS SYSTEM - Home - Energy Innovation Portal  

Technology Marketing Summary The Naval Research Laboratory has developed a durable, rapid cure coatings system that is designed for harsh ...


SLIDER - Rapid Optical Deflector for Recording Ultrafast Signals  

home \\ technologies \\ slider. Technologies: Ready-to-Sign Licenses: Software: Patents: SLIDER - Rapid Optical Deflector for Recording Ultrafast Signals. Contact.


Rapid reconnaissance of geothermal prospects using shallow temperature...  

Open Energy Info (EERE)

reconnaissance of geothermal prospects using shallow temperature surveys. Second technical report Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Rapid...


Microsoft Word - CX-Olympia-GrandCoulee85-5RelocationFY12_WEB.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9, 2012 9, 2012 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Amanda Williams Project Manager - TEP-TPP-1 Proposed Action: Olympia-Grand Coulee Structure 85/5 Relocation Project Budget Information: Work Order #00291628 PP&A Project No.: PP&A 1984 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance Proposed by: Bonneville Power Administration (BPA) Location: The proposed Olympia-Grand Coulee Structure 85/5 Relocation Project is located in King County, Washington, within the Mt. Baker-Snoqualmie National Forest (MBS), in BPA's Covington Operations and Maintenance District. Township, Range, and Section crossed by the proposed project are listed below:


A Rapid Loss Index for Tropical Cyclone Disasters in China  

Science Conference Proceedings (OSTI)

Disaster emergency response needs rapid estimation on disaster loss. In China it is of great importance to develop a loss index for rapidly assessing tropical cyclone (TC) disaster loss. In this paper, a new composite loss index for TC landing on China ... Keywords: Tropical Cyclone, Disaster, Loss Index, Rapid Loss Assessment

Ying Li; Weihua Fang



Chemical Equilibrium in Heavy Ion Collisions: Rapidity Dependence  

E-Print Network (OSTI)

Particle yields in heavy ion collisions show an overwhelming evidence for chemical or relative chemical equilibrium at all beam energies. The rapidity dependence of the thermal parameters $T$ and $\\mu_B$ can now be determined over a wide range of rapidities and show a systematic behavior towards an increase in $\\mu_B$ away from mid-rapidity.

F. Becattini; J. Cleymans



Rapid Gas Hydrate Formation Process Opportunity  

NLE Websites -- All DOE Office Websites (Extended Search)

Gas Hydrate Formation Process Gas Hydrate Formation Process Opportunity The Department of Energy's National Energy Technology Laboratory (NETL) is seeking collaborative research and licensing partners interested in implementing United States Non-provisional Patent Application entitled "Rapid Gas Hydrate Formation Process." Disclosed in this application is a method and device for producing gas hydrates from a two-phase mixture of water and a hydrate forming gas such as methane (CH 4 ) or carbon dioxide (CO 2 ). The two-phase mixture is created in a mixing zone, which may be contained within the body of the spray nozzle. The two-phase mixture is subsequently sprayed into a reaction vessel, under pressure and temperature conditions suitable for gas hydrate formation. The reaction


World NGL markets continue rapid expansion  

Science Conference Proceedings (OSTI)

The international LPG industry has expanded rapidly during the 1990s and undergone significant changes. LPG consumption has expanded at nearly twice the rate of world petroleum demand. In particular, LPG use in residential and commercial markets has more than doubled in many developing countries. Markets for LPG and other petroleum products have been opened in many countries, accelerating demand growth and creating investment opportunities in all downstream segments. This has led to an overall strengthening of global LPG pricing and the development of many new export gas-processing projects. The paper discusses world LPG demand in residential and commercial markets and in petrochemicals, world LPG supply, regional increases, international trade, the US situation in natural gas, NGL supply, and NGL demand.

Otto, K.; Gist, R.; Whitley, C. [Purvin and Gertz, Houston, TX (United States); Haun, R. [Purvin and Gertz, Dallas, TX (United States)



RTDS: A continuous, rapid, thermal synthesis mode  

SciTech Connect

The Rapid Thermal Decomposition of precursors in Solution (RTDS) Process is a flow-through hydrothermal powder synthesis method capable of producing nanophase oxide and oxyhydroxide catalysts and catalyst precursors. The RTDS technique utilizes a brief exposure of dissolved precursors to high pressure/high temperature aqueous conditions to initiate crystallite nucleation. The resulting nanocrystalline suspension is removed from the hydrothermal environment through a pressure let-down device before significant crystallite growth can occur. The RTDS process is discussed as a method to produce nanocrystalline iron oxide and oxyhydroxide powders that exhibit high activity as carbon-carbon bond cleavage catalyst precursors. Nanocrystalline TiO{sub 2} and ZrO{sub 2} powders having prospective catalytic applications are also produced by the RTDS process.

Matson, D.W.; Linehan, J.C.; Darab, J.D.; Buehler, M.F.; Phelps, M.R.; Neuenschwander, G.G.



peu de radium D. En outre, la liqueur contient encore la plus grande partie du radium D ;  

E-Print Network (OSTI)

ajoute ensuite un peu d'eau oxygénée. Au bout d'une heurte on a déjà un léger précipité dhy peroxyde d'uranium déter- mine sont déplacées aussi bien vers les petites que vers les grandes longueurs d'onde. Au

Paris-Sud XI, Université de


Final report of the radiological release survey of Building 30B at the Grand Junction Office Facility  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Grand Junction Office (GJO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore concentrates and mill tailings during vanadium refining activities of the Manhattan Engineer District, and during sampling, assaying, pilot milling, storage, and brokerage activities conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJO Remedial Action Project (GJORAP) to clean up and restore the facility lands, improvements, and underlying aquifer. WASTREN-Grand Junction is the site contractor for the facility and the remedial action contractor for GJORAP. Building 30B and the underlying soil were found not to be radiologically contaminated; therefore, the building can be released for unrestricted use. Placards have been placed at the building entrances indicating the completion of the radiological release survey and prohibiting the introduction of any radioactive materials within the building without written approvals from the GJO Facilities Operations Manager. This document was prepared in response to a DOE-GJO request for an individual final release report for each GJO building.

Krauland, P.A.; Corle, S.G.



Final report of the decontamination and decommissioning of Building 34 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7 acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the Grand Junction Projects Office Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, was also the remedial action contractor. Building 34 was radiologically contaminated and the building was demolished in 1996. The soil area within the footprint of the building was analyzed and found to be not contaminated. The area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual closeout report for each contaminated GJPO building.

Widdop, M.R.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


I Cant Walk! Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2002-2003 Annual Report.  

DOE Green Energy (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial and native fish assemblages in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. The project began addressing identified data gaps throughout the Blocked Area in 1999. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, Spokane River below Spokane Falls, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002 and 2003. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife); Butler, Chris (Spokane Tribe of Indians, Wellpinit, WA)



Resident Fish Stock above Chief Joseph and Grand Coulee Dams; 2002 Annual Report.  

DOE Green Energy (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. In 1999, 2000, and 2001 the project began addressing some of the identified data gaps throughout the Blocked Area. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Department of Natural Resources, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA); Butler, Chris (Spokane Tribe of Indians, Department of Natural Resources, Wellpinit, WA)



Resident Fish Stock above Chief Joseph and Grand Coulee Dams; 2003-2004 Annual Report.  

DOE Green Energy (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial and native fish assemblages in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. The project began addressing identified data gaps throughout the Blocked Area in 1999. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, Spokane River below Spokane Falls, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002 and 2003. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Olympia, WA); Butler, Chris (Spokane Tribe of Indians, Wellpinit, WA)



Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2001 Annual Report.  

DOE Green Energy (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power Planning Council (NPPC). The NPPC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPPC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area and the Columbia Basin Blocked Area Management Plan (1998). The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. In 1999, 2000, and 2001 the project began addressing some of the identified data gaps throughout the Blocked Area. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of seven streams and four lakes on the Spokane Indian Reservation were completed by 2000. Assessments of the Little Spokane River and its tributaries, tributaries to the Pend Oreille River, small lakes in southern Pend Oreille County, and water bodies within and near the Spokane Indian Reservation were conducted in 2001. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispell Department of Natural Resources, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA); O'Connor, Dick (Washington Department of Fish and Wildlife, Olympia, WA)



Annotated bibliography for the humpback chub (Gila cypha) with emphasis on the Grand Canyon population.  

DOE Green Energy (OSTI)

Glen Canyon Dam is a hydroelectric facility located on the Colorado River in Arizona that is operated by the U.S. Bureau of Reclamation (Reclamation) for multiple purposes including water storage, flood control, power generation, recreation, and enhancement of fish and wildlife. Glen Canyon Dam operations have been managed for the last several years to improve conditions for the humpback chub (Gila cypha) and other ecosystem components. An extensive amount of literature has been produced on the humpback chub. We developed this annotated bibliography to assist managers and researchers in the Grand Canyon as they perform assessments, refine management strategies, and develop new studies to examine the factors affecting humpback chub. The U.S. Geological Survey recently created a multispecies bibliography (including references on the humpback chub) entitled Bibliography of Native Colorado River Big Fishes (available at www.fort.usgs.gov/Products/data/COFishBib). That bibliography, while quite extensive and broader in scope than ours, is not annotated, and, therefore, does not provide any of the information in the original literature. In developing this annotated bibliography, we have attempted to assemble abstracts from relevant published literature. We present here abstracts taken unmodified from individual reports and articles except where noted. The bibliography spans references from 1976 to 2009 and is organized in five broad topical areas, including: (1) biology, (2) ecology, (3) impacts of dam operations, (4) other impacts, and (5) conservation and management, and includes twenty subcategories. Within each subcategory, we present abstracts alphabetically by author and chronologically by year. We present relevant articles not specific to either the humpback chub or Glen Canyon Dam, but cited in other included reports, under the Supporting Articles subcategory. We provide all citations in alphabetical order in Section 7.

Goulet, C. T.; LaGory, K. E.; Environmental Science Division



Energy from renewable sources for rural communities of the state of Rio Grande Do Sul, Brazil  

SciTech Connect

Rural communities of the state of Rio Grande do Sul developed on the basis of various ethenic origin, and distinctly took root in the regions of different topography. On the south and the west nearly half of the state is mainly flat land, where the inhabitants are racially heterogenous and live pricipally in small towns with large farm lands around. The rest of the state consists of high lands that gradually rise from the northwest to maximum 1200m altitude at the northeast. In the foothills, industrial base was developed by the German settelers, whereas the Italian immigrants settled on the hills. The hilly region is composed of small rural properties with area varying from 10 to 50 hectares. They are scattered all over the region, which make it economically unfeasable to distribute electricity from the main grid, due to high investment cost unlikely to be paid off by the energy consumption rate of the rural properietors. It could be verified from the fact that till to-date the local federation of the cooperatives of rural electrification achieved to supply electricity to only 15% of the total area and its future expansion is getting limited. This paper describes a pilot project initiated in the county 'Tres Coroa' of this region, that is being developed under the guidance of the energy group of the Federal University of RGS, coordinated with balanced technical, agronomical, economical and ecilogical activities to meet its energy demand, that could be supplied with the locally available resources. It is aimed in this project to provide the rural habitants adequate energy for a decent living i.e., electricity for lights, TV and small domestic appliances, thermal energy for hot water supply and fuel to run the agricultural machineries. In future, other nearby counties could follow this experiment with proper and adequate modifications to suite the need and the type of resources available there.

Bristotti, A.; Sadhu, D.



A simulation model of Rio Grande wild turkey dynamics in the Edwards Plateau of Texas  

E-Print Network (OSTI)

I investigated the effect of precipitation and predator abundance on Rio Grande wild turkey (Meleagris gallopavo; RGWT) in Texas. My results suggested that RGWT production was strongly correlated with cumulative winter precipitation over the range of the RGWT in Texas. However, I found no evidence that predator abundance influenced RGWT production, although spatial-asynchrony of predator populations at multiple spatial scales might have masked broad-scale effects. Using the results of these analyses, as well as empirical data derived from the literature and from field studies in the southern Edwards Plateau, I developed a stochastic, density-dependent, sex- and agespecific simulation model of wild turkey population dynamics. I used the model to evaluate the effect of alternative harvest management strategies on turkey populations. Sensitivity analysis of the model suggested that shape of the density-dependence relationship, clutch size, hatchability, juvenile sex ratio, poult survival, juvenile survival, and nonbreeding hen mortality most strongly influenced model outcome. Of these, density-dependence, sex ratio, and juvenile survival were least understood and merit further research. My evaluation of fall hen harvest suggested that current rates do not pose a threat to turkey populations. Moreover, it appears that hen harvest can be extended to other portions of the RGWT range without reducing turkey abundance, assuming that population dynamics and harvest rates are similar to those in the current fall harvest zone. Finally, simulation of alternative hen harvest rates suggested that rates ?5% of the fall hen population resulted in significant declines in the simulated population after 25 years, and rates ?15% resulted in significant risk of extinction to the simulated population.

Schwertner, Thomas Wayne



Comments and responses on the Remedial Action Plan and site design for stabilization of the Inactive Uranium Mill Tailings Site, Grand Junction, Colorado. Revision 1  

SciTech Connect

This report contains information concerning public comments and responses on the remedial action plan and site design for stabilization of the inactive uranium mill tailings site in Grand Junction, Colorado.




Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Survival and mammalian predation of Rio Grande Turkeys on the Edwards Plateau, Texas.  

E-Print Network (OSTI)

Trends in Rio Grande wild turkey (Meleagris gallopavo intermedia) abundance on the Edwards Plateau (EP), Texas, have been either stable or in decline since the 1970s. Four study areas, 2 each within stable (Stable Area A, SAA; Stable Area B, SAB) and declining regions (Declining Area A, DAA; Declining Area B, DAB), were delineated to examine (1) both annual and seasonal survival, (2) relative mammalian predator mean abundance (RMA), and (3) potential effects of lunar phase on scent-station visitation. During February 2001-March 2003, 257 turkeys were captured and instrumented with radio transmitters. Survival probabilities were generated using a Kaplan-Meier product limit estimator; a log-rank test tested for differences among sites. Annual survival was statistically different between regions (stable 0.566 0.081; declining 0.737 0.094; X2 = 3.68, P = 0.055) in 2002. Seasonal survival differed between regions (stable 0.812 0.103; declining 0.718 0.130; X2 = 3.88, P = 0.049) in spring 2003. Annual survival results during 2002 were counterintuitive with turkey trend data. Scent-station transects were established on non-paved ranch roads within study regions. Scent-station indices revealed higher (H = 19.653, P ? 0.001) RMA of opossum (Didelphis virginiana) and skunk (eastern spotted [Spilogale putorius], striped [Mephitis mephitis], or western spotted [S. gracilis]) (SAA, x? = 0.0148; SAB, x? = 0.0151; DAA, x? = 0.0042; DAB, x? = 0.0065) on stable areas. Higher RMA of coyotes (Canis latrans) on declining areas (SAA, x? = 0.0067; SAB, x? = 0.0022; DAA x? = 0.0234; DAB x? = 0.0434) suggested a possible causative factor of the decline, but abundance indices were not verified by empirical data though. Lunar phase was not a significant (T = -0.225, P = 0.822) covariate in scent-station visits by raccoons, opossums (new, x? = 0.0111; full, x? = 0.0324), or unidentified tracks (new, x? = 0.0649; full, x? = 0.0375). Nightly precipitation and wind speed probably influence mammalian use of scent stations more so than lunar illumination.

Willsey, Beau Judson



Structural fabric of the Palisades Monocline: a study of positive inversion, Grand Canyon, Arizona  

E-Print Network (OSTI)

A field study of positive inversion is conducted to describe associated structural fabrics and to infer kinematic development of the Palisades Monocline, Grand Canyon, Arizona. These features are then compared to sand, clay and solid rock models of positive inversion to test model results and improve understanding of inversion processes. The N40W 90 oriented Palisades fault underlying the monocline has experienced northeast-southwest Precambrian extension and subsequent northeastsouthwest Laramide contraction. The magnitude of inversion is estimated to be 25% based on vertical offset across the fault, although this does not account for flexure or horizontal shortening. The preferred N50W 90 joint and vein orientation and N50W 68 NE and SW conjugate normal faults are consistent with the Palisades fault and northeastsouthwest extension. The N45E 90 joint orientation and approximately N40W 28 NE and SW conjugate thrust faults are consistent with northeast-southwest contraction. The deformation is characterized by three domains across the fault zone: 1) the hanging wall, 2) the footwall, and 3) an interior, fault-bounded zone between the hanging wall and footwall. Extensional features are preserved and dominate the hanging wall, contractional features define footwall deformation, and the interior, fault-bounded zone is marked by the co-existence of extensional and contractional features. Extension caused a master normal fault and hanging wall roll-over with distributed joints, veinsand normal faults. During inversion, contraction induced reverse reactivation of existing hanging wall faults, footwall folding and footwall thrust-faulting. Precambrian normal slip along the master normal fault and subsequent Laramide reverse slip along the new footwall bounding fault created an uplifted domain of relatively oldest strata between the hanging wall and footwall. Physical models of co-axial inversion suggest consistent development of the three domains of deformation described at the Palisades fault, however the models often require magnitudes of inversion greater than 50%. Although vertical block motion during horizontal compression is not predicted directly by the Mohr-Coulomb criterion, physical models and analytical solutions (incorporating Mohr- Coulomb criterion) suggest maximum stress trajectories and near vertical failure above high angle basement faults that compare favorably with the Palisades fault zone.

Orofino, James Cory



Grande Ronde Model Watershed Project; Dark Canyon Riparian Exclosure, Completion Report 2002.  

DOE Green Energy (OSTI)

The Baker Field Office, Vale District Bureau of Land Management (BLM) submitted a project proposal for funding in 2002 through the Grande Ronde Model Watershed Program (GRMWP). The project consisted of constructing two riparian exclosures to prevent livestock grazing in the riparian areas of Dark Canyon and Meadow Creek. The BLM completed the NEPA documentation and supplied the fencing materials. Funding from BPA through the GRMWP was used to complete the construction of the two exclosures. This project was completed in the fall of 2002. The project area is located in Union County, Oregon on BLM managed land adjacent to Dark Canyon and Meadow Creek, T. 3. S., R. 35 E., Section 24 and 25. Section 24 is along Dark Canyon Creek and section 25 is along Meadow Creek. Approximately 0.4 miles of stream would be protected from grazing with the construction of the two exclosures. A two person crew was hired to construct a four-strand barbed wire fence. The fence enclosed the riparian area on both sides of each creek so that no grazing would occur within the riparian area on BLM managed land. Total fence length is approximately 1.25 miles. Materials consisted of metal fence posts, barbed wire, rockjacks, fence stays, and 2 x 4's. The fence was constructed in the fall of 2002. The riparian area is effectively excluded from livestock grazing at this time. The construction of the exclosures should enhance riparian vegetation, increase bank stability, and improve riparian and in-stream habitat by exclusion of livestock in the riparian areas. Monitoring will ensure that the exclosures continues to be effective. Annual monitoring will include photo-points and compliance checks during the grazing season by BLM personnel. The BLM will submit a monitoring report, which includes the results of the annual monitoring, to the GRMWP in years 2005 and 2007. The exclosures do cross the creeks so maintenance may be needed on occasion, especially after high flow events in the creeks. Material such as logs which are mobilized during high stream flows may damage the exclosures requiring maintenance to keep cattle from grazing in the riparian areas. The BLM spent approximately $4,000 on fencing materials and $1,375 on NEPA compliance. In addition, the estimated cost of the monitoring over five years is expected to be approximately $1,600. The $5,050 that the BLM received from the BPA for the project was used to hire two temporary employees to construct the exclosures.

Kuck, Todd



Vegetation, soils, and surface hydrology of playa landforms in the Rio Grande Plains, Texas  

E-Print Network (OSTI)

Playas in the Rio Grande Plains of southern Texas were compared with respect to their: 1) size, shape, soil properties, and microtopography, 2) vegetation composition and structure, 3) surface water accumulation potential, and 4) disturbance history. Transitions from playa to drainage woodlands were also quantified with respect to soils and vegetation. Playas were typically oval shaped basins ranging from 0.14 to 3.81 ha in size. Physiognomy ranged from grassland (treeless) to savanna (woody basal area 70 m/ha). When trees were present, Prosopis glandulosa or Acacia smallii were typically dominant or co-dominant. Neighboring woodlands on sandy loam drainage landforms had a greater overstory woody density (255 [] 58 stems/ha) than playas (18 [] 3.6 stems/ha); however, overstory woody basal area was not significantly different between the landforms. Three woody species (Acacia smallii, Sesbania drummondii, and Parkinsonia aculeata) were unique to playas. Herbaceous standing crop biomass was statistically different between playas (81 [] 24.4 to 198 [] 29.8 g/m) and inversely correlated with tree basal area (r = 0.36), with the contribution of grasses to total biomass ranging from 55% to 92%. Playa soils were Vertisols or vertic Mollisols consisting of clayey surfaces with shrink-swell properties. Mean surface pH values (6.5 [] 0.1), EC (0.231 [] 0.03 and 0.350 [] 0.05 dS/m), clay content (~ 40%), and bulk densities (1.8 [] 0.02 g/m) for both subgroup classifications were not comparable. Thus, there was no apparent edaphic basis for the observed differences in vegetation. The extent and duration of inundation varied among playas, depending on basin microtopography. Despite anaerobic conditions associated with inundation, woody plant cover has increased in five of the eight playas in the past 44 years. Decreases in woody density occurred in two playas subjected to prescribed fire and herbicide treatments. The third basin has been grass-dominated and treeless since 1950, apparently owing to its retention of standing water for extended periods. With the exception of this deep playa basin, disturbance (e.g. fire, herbiciding, and chaining) appears to have been more important than topographic factors in shaping vegetation structure and composition in playas.

Farley, Andrea Lee



Rapid quantitative assay for chloramphenicol acetyltransferase  

SciTech Connect

Measuring the expression of exogenous genetic material in mammalian cells is commonly done by fusing the DNA of interest to a gene encoding an easily-detected enzyme. Chloramphenicol acetyltransferase(CAT) is a convenient marker because it is not normally found in eukaryotes. CAT activity has usually been detected using a thin-layer chromatographic separation followed by autoradiography. An organic solvent extraction-based method for CAT detection has also been described, as well as a procedure utilizing HPLC analysis. Building on the extraction technique, they developed a rapid sensitive kinetic method for measuring CAT activity in cell homogenates. The method exploits the differential organic solubility of the substrate ((/sup 3/H) or (/sup 14/C)acetyl CoA) and the product (labeled acetylchloramphenicol). The assay is a simple one-vial, two-phase procedure and requires no tedious manipulations after the initial setup. Briefly, a 0.25 ml reaction with 100mM Tris-HCL, 1mM chloramphenicol, 0.1mM (/sup 14/C)acetyl CoA and variable amounts of cell homogenate is pipetted into a miniscintillation vial, overlaid with 5 ml of a water-immiscible fluor, and incubated at 37/sup 0/C. At suitable intervals the vial is counted and the CAT level is quantitatively determined as the rate of increase in counts/min of the labeled product as it diffuses into the fluor phase, compared to a standard curve. When used to measure CAT in transfected Balb 3T3 cells the method correlated well with the other techniques.

Neumann, J.R.; Morency, C.A.; Russian, K.O.



Bus Rapid Transit Planning Guide | Open Energy Information  

Open Energy Info (EERE)

Bus Rapid Transit Planning Guide Bus Rapid Transit Planning Guide Jump to: navigation, search Tool Summary Name: Bus Rapid Transit Planning Guide Agency/Company /Organization: Institute for Transportation & Development Policy Focus Area: Public Transit & Infrastructure Topics: Best Practices Resource Type: Reports, Journal Articles, & Tools Website: www.itdp.org/microsites/bus-rapid-transit-planning-guide/ The Bus Rapid Transit Planning Guide is the most comprehensive resource for planning a bus rapid transit (BRT) system, beginning with project preparation all the way through to implementation. How to Use This Tool This tool is most helpful when using these strategies: Improve - Enhance infrastructure & policies Learn more about the avoid, shift, improve framework for limiting air


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Grand Rapids City of Grand Rapids EE DE-EE0003653 BETD 2010 Frank Chynoweth 7/1/2010 - 12/31/2011 Grand Rapids, MI City of Grand Rapids Solar Roof Demonstration Project The city of Grand Rapids Solar Roof Demonstration Project's goal is to place a photovoltaic array on or adjacent to a city of Grand Rapids building. CX covers design, eval. & planning activities only. 05 24 2010 Frank Chynoweth Digitally signed by Frank Chynoweth DN: cn=Frank Chynoweth, o=NETL, ou=BETD, email=frank.chynoweth@netl.doe.gov, c=US Date: 2010.05.24 07:35:40 -04'00' 06 11 2010 john ganz Digitally signed by john ganz DN: cn=john ganz, o=NETL- DOE, ou=140 OPFC, email=john.ganz@netl.doe.gov, c=US Date: 2010.06.11 13:44:37 -04'00' Activities associated with actual preparation, ancillary improvements, and installation of PV panels


Rapid Assessment of City Emissions (RACE) for Low Carbon Cities...  

Open Energy Info (EERE)

Assessment of City Emissions (RACE) for Low Carbon Cities: Transport and Building Electricity Use Jump to: navigation, search Name Rapid Assessment of City Emissions (RACE) for...


Modeling Fragility in Rapidly Evolving Disaster Response Systems  

E-Print Network (OSTI)

Multi-Organizational Disaster Response Systems." Pittsburgh,in Rapidly Evolving Disaster Response Systems Louise K.capacity in an actual disaster response system to determine

Comfort, Louise K.; Ko, Kilkon; Zagorecki, Adam


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Rapid increases in electricity demand challenge both generating ...  

U.S. Energy Information Administration (EIA)

Because supply and demand for electricity must balance in real-time, rapid changes in demand create operational challenges for the electric system and generating unit ...


Rapid Modeling of Power Electronics Thermal Management Technologies: Preprint  

DOE Green Energy (OSTI)

Describes a method of rapidly evaluating trade-offs associated with alternative packaging configurations and thermal management technologies for power electronics packaging.

Bennion, K.; Kelly, K.



Method of Rapidly Screening Buffer Layers in Photovoltaics  

ORNL 2010-G0647/jcn UT-B ID 200902275 Method of Rapidly Screening Buffer Layers in Photovoltaics Technology Summary This ORNL invention offers a new method to ...


Sustainable Urban Development Priorities - Development of a Rapid...  

Open Energy Info (EERE)

Development Priorities - Development of a Rapid Assessment Tool for Urban Mobility in Cities with Data Scarcity Jump to: navigation, search Tool Summary Name: Sustainable Urban...


Rapid reconnaissance of geothermal prospects using shallow temperature...  

Open Energy Info (EERE)

reconnaissance of geothermal prospects using shallow temperature surveys. Semi-annual technical report Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Rapid...


Development of Protocols for Rapid Amplification of STR ...  

Science Conference Proceedings (OSTI)

... Rapid PCR Applications Faster sample-to-answer ... Cycling for most STR kits is run in '9600 emulation mode' (1oC/s) PCR Thermal Cycling Profile ...



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Logic foundry: rapid prototyping for FPGA-based DSP systems  

Science Conference Proceedings (OSTI)

We introduce the Logic Foundry, a system for the rapid creation and integration of FPGA-based digital signal processing systems. Recognizing that some of the greatest challenges in creating FPGA-based systems occur in the integration of the various components, ... Keywords: CAD tools, DSP, FPGA, design methodology, integration, rapid prototyping

Gary Spivey; Shuvra S. Bhattacharyya; Kazuo Nakajima



Final report of the decontamination and decommissioning of Building 1 at the Grand Junction Projects Office Facility  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also is the remedial action contractor. Building 1 was found to be radiologically contaminated and was demolished in 1996. The soil beneath and adjacent to the building was remediated in accordance with identified standards and can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Widdop, M.R.



Final report of the decontamination and decommissioning of Building 18 at the Grand Junction Projects Office Facility  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also is the remedial action contractor. The soil beneath Building 18 was found to be radiologically contaminated; the building was not contaminated. The soil was remediated in accordance with identified standards. Building 18 and the underlying soil can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Widdop, M.R.



Residential and commercial space heating and cooling with possible greenhouse operation; Baca Grande development, San Luis Valley, Colorado. Final report  

DOE Green Energy (OSTI)

A feasibility study was performed to evaluate the potential of multipurpose applications of moderate-temperature geothermal waters in the vicinity of the Baca Grande community development in the San Luis Valley, Colorado. The project resource assessment, based on a thorough review of existing data, indicates that a substantial resource likely exists in the Baca Grande region capable of supporting residential and light industrial activity. Engineering designs were developed for geothermal district heating systems for space heating and domestic hot water heating for residences, including a mobile home park, an existing motel, a greenhouse complex, and other small commercial uses such as aquaculture. In addition, a thorough institutional analysis of the study area was performed to highlight factors which might pose barriers to the ultimate commercial development of the resource. Finally, an environmental evaluation of the possible impacts of the proposed action was also performed. The feasibility evaluation indicates the economics of the residential areas are dependent on the continued rate of housing construction. If essentially complete development could occur over a 30-year period, the economics are favorable as compared to existing alternatives. For the commercial area, the economics are good as compared to existing conventional energy sources. This is especially true as related to proposed greenhouse operations. The institutional and environmental analyses indicates that no significant barriers to development are apparent.

Goering, S.W.; Garing, K.L.; Coury, G.E.; Fritzler, E.A.



Final report of the decontamination and decommission of Building 31 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the domestic uranium procurement program funded by the U.S. Atomic Energy Commission. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also was the remedial action contractor. Radiological contamination was identified in Building 31 and the building was demolished in 1992. The soil area within the footprint of the building has been remediated in accordance with the identified standards and the area can be released for unlimited exposure and unrestricted use. This area was addressed in the summary final report of the remediation of the exterior areas of the GJPO facility. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Krabacher, J.E.



Final report of the decontamination and decommissioning of Building 44 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Junction Projects Office (GJPO) occupies a 61.7 acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the Grand Junction Projects Office Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, is also the remedial action contractor. Building 44 was radiologically contaminated and the building was demolished in 1994. The soil area within the footprint of the building was not contaminated; it complies with the identified standards and the area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Widdop, M.R.



Final report of the decontamination and decommissioning of Building 6 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the domestic uranium procurement program funded by the U.S. Atomic Energy Commission. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, is also the remedial action contractor. Radiological contamination was identified in Building 6, and the building was demolished in 1992. The soil area within the footprint of the building has been remediated in accordance with the identified standards and the area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Widdop, M.R.



Final report of the decontamination and decommissioning of Building 39 at the Grand Junction Projects Office Facility  

SciTech Connect

The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission`s domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, is also the remedial action contractor. The soil beneath Building 39 was radiologically contaminated and the building was demolished in 1992. The soil area within the footprint of the building has been remediated in accordance with the identified standards and the area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building.

Widdop, M.R.



Global Bus Rapid Transit (BRT) Database | Open Energy Information  

Open Energy Info (EERE)

Global Bus Rapid Transit (BRT) Database Global Bus Rapid Transit (BRT) Database Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Global Bus Rapid Transit (BRT) Database Agency/Company /Organization: EMBARQ Complexity/Ease of Use: Not Available Website: www.brtdata.org/ Equivalent URI: cleanenergysolutions.org/content/global-bus-rapid-transit-brt-database Language: English Related Tools European Green Cars Initiative Guidelines and Toolkits for Urban Transport Development in Medium Sized Cities in India Making Car Sharing and Car Clubs Work: Final Report ... further results Find Another Tool FIND TRANSPORTATION TOOLS This tool provides public access to current data about bus rapid transit systems around the world, including data for the design, performance, and cost of these systems. The database can be filtered by location or


DOE/EIS-0340-SA-01: Supplement Analysis for NEOH Grande Ronde-Imnaha Spring Chinook Hatchery Project (03/23/06)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3, 2006 3, 2006 REPLY TO ATTN OF: KEC-4 SUBJECT: Supplement Analysis for NEOH Grande Ronde - Imnaha Spring Chinook Hatchery Project (DOE/EIS-0340-SA-01) Ken Kirkman - KEWU-4 Project Manager Proposed Action: Grande Ronde - Imnaha Spring Chinook Hatchery Project Modifications Resulting from Final Design Project No.: 1988-053-01 Location: Wallowa County, Oregon Proposed By: Bonneville Power Administration (BPA) and Nez Perce Tribe Introduction: BPA, in its March 11, 2005 Record of Decision (ROD) on the Grande Ronde - Imnaha Spring Chinook Hatchery Project, decided to fund value engineering, land acquisition and final design of fish production facilities to support an ongoing program of Snake River spring chinook propagation for conservation and recovery of the species. BPA analyzed the


Rapidly Rotating Suns and Active Nests of Convection  

E-Print Network (OSTI)

In the solar convection zone, rotation couples with intensely turbulent convection to drive a strong differential rotation and achieve complex magnetic dynamo action. Our sun must have rotated more rapidly in its past, as is suggested by observations of many rapidly rotating young solar-type stars. Here we explore the effects of more rapid rotation on the global-scale patterns of convection in such stars and the flows of differential rotation and meridional circulation which are self-consistently established. The convection in these systems is richly time dependent and in our most rapidly rotating suns a striking pattern of localized convection emerges. Convection near the equator in these systems is dominated by one or two nests in longitude of locally enhanced convection, with quiescent streaming flow in between at the highest rotation rates. These active nests of convection maintain a strong differential rotation despite their small size. The structure of differential rotation is similar in all of our more rapidly rotating suns, with fast equators and slower poles. We find that the total shear in differential rotation Delta Omega grows with more rapid rotation while the relative shear Delta Omega/Omega_0 decreases. In contrast, at more rapid rotation the meridional circulations decrease in energy and peak velocities and break into multiple cells of circulation in both radius and latitude.

Benjamin P. Brown; Matthew K. Browning; Allan Sacha Brun; Mark S. Miesch; Juri Toomre




Science Conference Proceedings (OSTI)

We present the results of a search for unusually rapidly rotating giant stars in a large sample of K giants ({approx}1300 stars) that had been spectroscopically monitored as potential targets for the Space Interferometry Mission's Astrometric Grid. The stars in this catalog are much fainter and typically more metal-poor than those of other catalogs of red giant star rotational velocities, but the spectra generally only have signal-to-noise ratio (S/N) of {approx}20-60, making the measurement of the widths of individual lines difficult. To compensate for this, we have developed a cross-correlation method to derive rotational velocities in moderate S/N echelle spectra to efficiently probe this sample for rapid rotator candidates. We have discovered 28 new red giant rapid rotators as well as one extreme rapid rotator with a vsin i of 86.4 km s{sup -1}. Rapid rotators comprise 2.2% of our sample, which is consistent with other surveys of brighter, more metal-rich K giant stars. Although we find that the temperature distribution of rapid rotators is similar to that of the slow rotators, this may not be the case with the distributions of surface gravity and metallicity. The rapid rotators show a slight overabundance of low-gravity stars and as a group are significantly more metal-poor than the slow rotators, which may indicate that the rotators are tidally locked binaries.

Carlberg, Joleen K.; Majewski, Steven R.; Patterson, Richard J. [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Bizyaev, Dmitry [Apache Point Observatory, Sunspot, NM (United States); Smith, Verne V.; Cunha, Katia, E-mail: jkm9n@virginia.edu, E-mail: srm4n@virginia.edu, E-mail: ricky@virginia.edu, E-mail: dmbiz@apo.nmsu.edu, E-mail: vsmith@noao.edu, E-mail: cunha@noao.edu [NOAO, Tucson, AZ (United States)



Rapid Characterization of Drill Core and Cutting Mineralogy using Infrared  

Open Energy Info (EERE)

Rapid Characterization of Drill Core and Cutting Mineralogy using Infrared Rapid Characterization of Drill Core and Cutting Mineralogy using Infrared Spectroscopy Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Rapid Characterization of Drill Core and Cutting Mineralogy using Infrared Spectroscopy Abstract Infrared spectroscopy is particularly good at identifying awide variety of hydrothermally altered minerals with no samplepreparation, and is especially helpful in discrimination amongclay minerals. We have performed several promising pilot studieson geothermal drill core and cuttings that suggest the efficiencyof the technique to sample continuously and provide alterationlogs similar to geophysical logs. We have successfully identifiedlayered silicates, zeolites, opal, calcite, and iron oxides and

Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Rapid Assessment of City Emissions (RACE): Case of Batangas City,  

Open Energy Info (EERE)

Rapid Assessment of City Emissions (RACE): Case of Batangas City, Rapid Assessment of City Emissions (RACE): Case of Batangas City, Philippines Jump to: navigation, search Tool Summary Name: Rapid Assessment of City Emissions (RACE): Case of Batangas City, Philippines Agency/Company /Organization: International Resources Group (IRG), Clean Air Asia, Chreod Ltd. Partner: United States Agency for International Development (USAID), Ministry of Planning Sector: Land Focus Area: Buildings, Economic Development, Energy Efficiency, Greenhouse Gas, Land Use, People and Policy, Transportation Topics: Background analysis, Baseline projection, Co-benefits assessment, - Environmental and Biodiversity, GHG inventory, Low emission development planning, -LEDS, Market analysis, Pathways analysis, Policies/deployment programs Resource Type: Case studies/examples


Sustainable Urban Development Priorities - Development of a Rapid  

Open Energy Info (EERE)

Sustainable Urban Development Priorities - Development of a Rapid Sustainable Urban Development Priorities - Development of a Rapid Assessment Tool for Urban Mobility in Cities with Data Scarcity Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Sustainable Urban Development Priorities - Development of a Rapid Assessment Tool for Urban Mobility in Cities with Data Scarcity Agency/Company /Organization: Clean Air Asia, The Institute for Transportation and Development Policy (ITDP) Partner: UN Habitat Sector: Land Focus Area: Greenhouse Gas, People and Policy, Transportation Topics: Background analysis, Baseline projection, Co-benefits assessment, - Environmental and Biodiversity, GHG inventory, Low emission development planning, -LEDS, Policies/deployment programs Website: cleanairinitiative.org/portal/node/7870


FUPWG Meeting Agenda - Rapid City, South Dakota | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rapid City, South Dakota Rapid City, South Dakota FUPWG Meeting Agenda - Rapid City, South Dakota October 7, 2013 - 2:48pm Addthis Image of the FUPWG logo which displays an illustration of Mount Rushmore. The logo reads Achieving Energy Efficiency on a Monumental Scale; FUPWG October 20-21, 2010; Rapid City, South Dakota. Wednesday, October, 2010 8:30 am Welcome Dennis Haider, MDU Mark Howard, Ellsworth AF Base 8:40 am Introductions & Washington, D.C., Update National Renewable Energy Laboratory (NREL) BioEnergy Atlas David McAndrew, Federal Energy Management Program (FEMP) 9:00 am Special Presentation Owl Feather War Bonnet Ken Haukaas, Rosebud Sioux Tribe 9:30 am Electric Vehicle Update Amanda Sahl, FEMP 10:15 am Networking Break 10:45 am O&M/Commissioning Panel Moderator - Ab Ream, FEMP


Stochastic approaches for solving Rapid Transit Network Design ...  

E-Print Network (OSTI)

the estimation of the future demand will have in the design of new rapid transit ... is based on the current mobility patterns for which a new infrastructure does not.


Rapid Development of the Tropical Cyclone Warm Core  

Science Conference Proceedings (OSTI)

This paper presents a simple theoretical argument to isolate the conditions under which a tropical cyclone can rapidly develop a warm-core thermal structure and subsequently approach a steady state. The theoretical argument is based on the ...

Jonathan L. Vigh; Wayne H. Schubert



Rapid replenishment at a consumer product goods manufacturer  

E-Print Network (OSTI)

Increasing supply chain velocity has adverse consequences for consumer product goods manufacturers, but creates value and flexibility for retail stores. This thesis outlines a case study of a rapid replenishment pilot ...

Becker, Deborah Eugenia



A Rapid Radiative Transfer Model for Reflection of Solar Radiation  

Science Conference Proceedings (OSTI)

A rapid analytical radiative transfer model for reflection of solar radiation in plane-parallel atmospheres is developed based on the Sobolev approach and the delta function transformation technique. A distinct advantage of this model over ...

X. Xiang; E. A. Smith; C. G. Justus



Production of jets at forward rapidities in hadronic collisions  

E-Print Network (OSTI)

We discuss high-pT production processes at forward rapidities in hadron-hadron collisions, and describe recent results from using QCD high-energy factorization in forward jet production at the LHC.

F. Hautmann



SLAC National Accelerator Laboratory - Rapid Beam-switching Allows...  

NLE Websites -- All DOE Office Websites (Extended Search)

Rapid Beam-switching Allows SLAC X-ray Laser to Multitask By Glenn Roberts Jr. August 9, 2013 A high-energy SLAC laser that creates shock waves and superhot plasmas needs to cool...


New Computer Software Enables Rapid Response to Time-critical...  

NLE Websites -- All DOE Office Websites (Extended Search)

New Computer Software Enables Rapid Response to Time-critical Emergencies November 3, 2006 Tweet EmailPrint The U.S. Department of Energy's Argonne National Laboratory and...


The Rapid-Sampling Vertical Profiler: An Evaluation  

Science Conference Proceedings (OSTI)

Evaluation of the Rapid-Sampling Vertical Profiler, which was developed for sampling the hydrophysical fields in the upper ocean from a moving vessel, shows that the instrument is useful for near-microscale measurements of temperature and ...

D. R. Caldwell; T. M. Dillon; J. N. Moum



Grande Ronde Endemic Spring Chinook Salmon Supplementation Project; Lostine River Operations and Maintenance 2007 Smolt Acclimation and Adult Return Report.  

DOE Green Energy (OSTI)

The Nez Perce Tribe (NPT), through funding provided by the Bonneville Power Administration (BPA), has implemented a Chinook salmon supplementation program (250,000 smolts) on the Lostine River, a tributary to the Grande Ronde River of Oregon. The Grande Ronde Endemic Spring Chinook Salmon Supplementation project, which involves supplementation of the Upper Grande Ronde River and Catherine Creek in addition to the Lostine River, was established to prevent extirpation and increase the number of threatened Snake River spring/summer Chinook salmon (Oncorhynchus tshawytscha) returning to the Grande Ronde River. This report covers the eleventh season (1997-2007) of adult Chinook salmon broodstock collection in the Lostine River and the ninth season (1999-2007) of acclimation of resulting Lostine River progeny. Production of Lostine River spring Chinook salmon smolts currently occurs at Lookingglass Fish Hatchery (LGH). The Lostine River supplementation program utilizes two strategies to obtain egg source for production of smolts for supplementation: captive broodstock and conventional broodstock. The captive broodstock strategy involves (1) capture of natural juvenile spring Chinook salmon smolts from the Lostine River, (2) rearing those to adult and spawning them, and (3) rearing the resultant progeny for eventual acclimation and release back into the Lostine River. The conventional broodstock strategy involves (1) capture of natural and hatchery origin adults returning to the Lostine River, (2) holding those adults and spawning them, and (3) rearing the resultant progeny for acclimation and release back into the Lostine River. This report focuses on (1) the trapping and collection of adult spring Chinook salmon that return to the Lostine River, which provides the broodstock source for the conventional strategy and (2) the acclimation and release of juvenile spring Chinook salmon produced from the captive broodstock and conventional broodstock strategies In 2007, acclimation of Lostine River spring Chinook salmon smolts occurred from 3/5/07 through to 4/17/07 and a total of 230,010 smolts were acclimated and released. These smolts were produced from the brood year (BY) 2005 egg source and included captive brood (24,604) and conventional (205,406) origin smolts that were all progeny of Lostine River spring Chinook salmon. Operation of the Lostine River adult monitoring and collection facility in 2007 began May 14th. The first Chinook was captured on June 2, 2007 and the last Chinook was captured on September 25, 2007. The weir and trap were removed on October 1, 2007. A total of 637 adult Chinook, including jacks, were captured during the season. The composition of the run included 240 natural origin fish and 397 hatchery supplementation fish. There were no identified 'stray' hatchery fish from other programs trapped. Of the fish captured, 41 natural and 81 hatchery supplementation adults were retained for broodstock and transported to LGH for holding and spawning, 403 adult Chinook were passed or transported above the weir to spawn naturally, and only hatchery origin jack Chinook were transported and outplanted in the Wallowa River and Bear Creek in underseeded habitat. Of the 122 adult fish retained for broodstock, 20 natural females and 40 supplementation females were represented in spawning. The eggs from these females produced a total of 267,350 eggs at fertilization. Eye-up was 86.73% which yielded a total of 231,882 conventional program eyed eggs. The fecundity averaged 4,456 eggs per female. These eggs will be incubated and reared at Lookingglass Hatchery until they are smolts in the spring of 2009. Captive brood program eggs/fish will be added to the conventional program eggs to make up the entire juvenile release for the Lostine River program in 2009. Due to the success of the 2007 egg collection, the number of fish produced exceeded program needs and facility capabilities. As a result, there are plans to outplant fry in 2008 and parr in early 2009 to underseeded habitat in the Wallowa River.

Zollman, Richard L.; Eschler, Russell; Sealey, Shawn [Nez Perce Tribe



Grande Ronde Endemic Spring Chinook Salmon Supplementation Project; Lostine River Operations and Maintenance 2006 Smolt Acclimation and Adult Return Report.  

DOE Green Energy (OSTI)

The Nez Perce Tribe (NPT), through funding provided by the Bonneville Power Administration (BPA), has implemented a Chinook salmon supplementation program (250,000 smolts) on the Lostine River, a tributary to the Grande Ronde River of Oregon. The Grande Ronde Endemic Spring Chinook Salmon Supplementation project, which involves supplementation of the Upper Grande Ronde River and Catherine Creek in addition to the Lostine River, was established to prevent extirpation and increase the number of threatened Snake River spring/summer Chinook salmon (Oncorhynchus tshawytscha) returning to the Grande Ronde River. This report covers the tenth season (1997-2006) of adult Chinook salmon broodstock collection in the Lostine River and the eighth season (1999-2006) of acclimation of resulting Lostine River progeny. Production of Lostine River spring Chinook salmon smolts currently occurs at Lookingglass Fish Hatchery (LGH). The Lostine River supplementation program utilizes two strategies to obtain egg source for production of smolts for supplementation: captive broodstock and conventional broodstock. The captive broodstock strategy involves (1) capture of natural juvenile spring Chinook salmon smolts from the Lostine River, (2) rearing those to adult and spawning them, and (3) rearing the resultant progeny for eventual acclimation and release back into the Lostine River. The conventional broodstock strategy involves (1) capture of natural and hatchery origin adults returning to the Lostine River, (2) holding those adults and spawning them, and (3) rearing the resultant progeny for acclimation and release back into the Lostine River. This report focuses on (1) the trapping and collection of adult spring Chinook salmon that return to the Lostine River, which provides the broodstock source for the conventional strategy and (2) the acclimation and release of juvenile spring Chinook salmon produced from the captive broodstock and conventional broodstock strategies In 2006, acclimation of Lostine River spring Chinook salmon smolts occurred from February 27, 2006 through to April 10, 2006 and a total of 240,568 smolts were acclimated and released. These smolts were produced from the brood year (BY) 2004 egg source and included captive brood (40,982) and conventional (199,586) origin smolts that were all progeny of Lostine River spring Chinook salmon. Operation of the Lostine River adult monitoring and collection facility in 2006 began May 15th, the first Chinook was captured on June 14, 2006 and the last Chinook was captured on September 27, 2006. The weir and trap were removed on October 1, 2006. A total of 534 adult Chinook, including jacks, were captured during the season. The composition of the run included 205 natural origin fish and 329 hatchery supplementation fish. There were no identified 'stray' hatchery fish from other programs trapped. Of the fish captured, 33 natural and 120 hatchery supplementation adults were retained for broodstock and transported to LGH for holding and spawning and 397 adult Chinook were passed or transported above the weir to spawn naturally. In 2006, no hatchery origin adult Chinook were transported and out planted in the Wallowa River and Bear Creek to spawn in under seeded habitat. In order to meet egg take goals for the conventional portion of the program, a determination was made that approximately 147 adults were needed for broodstock. As a result 16 (8 males and 8 females) of the 153 fish collected for broodstock were returned to the Lostine River to spawn naturally. Females that were spawned and provided the brood source were made up of 12 natural females and 45 supplementation females. One of these females tested positive for high levels of Bacterial Kidney Disease and consequently this females eggs were destroyed. The remaining females produced a total of 241,372 eggs at fertilization. Eye-up was 85.47% which yielded a total of 206,309 conventional program eyed eggs. The fecundity averaged 4,162 eggs per female. The brood year 2006 eggs will be incubated and reared at Lookingglass Hatchery until

Zollman, Richard L.; Eschler, Russell; Sealey, Shawn [Nez Perce Tribe



Grande Ronde Endemic Spring Chinook Salmon Supplementation Project; Lostine River Operations and Maintenance 2003 Smolt Acclimation and Adult Return Report.  

DOE Green Energy (OSTI)

The Nez Perce Tribe (NPT), through funding provided by the Bonneville Power Administration (BPA), has implemented a Chinook salmon supplementation program (250,000 smolts) on the Lostine River, a tributary to the Grande Ronde River of Oregon. The Grande Ronde Endemic Spring Chinook Salmon Supplementation project, which involves supplementation of the Upper Grande Ronde River and Catherine Creek in addition to the Lostine River, was established to prevent extirpation and increase the number of threatened Snake River spring/summer Chinook salmon (Oncorhynchus tshawytscha) returning to the Grande Ronde River. This report covers the seventh season (1997-2003) of adult Chinook salmon broodstock collection in the Lostine River and the fifth season (1999-2003) of acclimating the resultant progeny. Production of Lostine River spring Chinook salmon smolts currently occurs at Lookingglass Fish Hatchery (LGH). The Lostine River supplementation program utilizes two strategies to obtain egg source for production of smolts for supplementation: captive broodstock and conventional broodstock. The captive broodstock strategy involves (1) capture of natural juvenile spring Chinook salmon smolts from the Lostine River, (2) rearing those to adult and spawning them, and (3) rearing the resultant progeny for eventual acclimation and release back into the Lostine River. The conventional broodstock strategy involves (1) capture of natural and hatchery origin adults returning to the Lostine River, (2) holding those adults and spawning them, and (3) rearing the resultant progeny for acclimation and release back into the Lostine River. This report focuses on (1) the trapping and collection of adult spring Chinook salmon that return to the Lostine River, which provides the broodstock source for the conventional strategy and (2) the acclimation and release of juvenile spring Chinook salmon produced from the captive broodstock and conventional broodstock strategies. In 2003, acclimation of Lostine River spring Chinook salmon smolts occurred from March 3, 2003 through to April 14, 2003 and a total of 242,776 smolts were acclimated and released. These smolts were produced from the brood year (BY) 2001 egg source and included captive broodstock (141,860) and conventional broodstock (100,916) origin smolts that were all progeny of Lostine River spring Chinook salmon. Operation of the Lostine River adult monitoring and collection facility in 2003 began April 30th, the first Chinook was captured on May 16, 2003 and the last Chinook was captured on September 21, 2003. The weir and trap were removed on October 1, 2003. A total of 464 adult Chinook, including jacks, were captured during the season. The composition of the run included 239 natural origin fish and 225 hatchery supplementation fish. There were no identified 'stray' hatchery fish from other programs trapped. Of the fish captured, 45 natural and 4 hatchery supplementation adults were retained for broodstock and transported to LGH for holding and spawning, 366 adult Chinook were passed or transported above the weir to spawn naturally, and 49 hatchery origin adult jack Chinook were transported and outplanted in the Wallowa River and Bear Creek to spawn in underseeded habitat. Of the 49 adults retained for broodstock at Lookingglass Hatchery, 21 natural females and no hatchery origin females were represented in spawning. These females produced a total of 106,609 eggs at fertilization. Eye-up was 95.50% which yielded a total of 101,811 conventional program eyed eggs. The fecundity averaged 5,077 eggs per female. These eggs were incubated and at Lookingglass Hatchery until eyed stage. At eye they were transferred to Oxbow Hatchery where they were reared to the fingerling state at which time they were transported back to LGH until they were smolts in the spring of 2005. Captive brood program eggs/fish will be added to the conventional program eggs to make up the entire juvenile release for the Lostine River program in 2005.

Zollman, Richard L.; Eschler, Russell; Sealey, Shawn [Nez Perce Tribe



Grande Ronde Endemic Spring Chinook Salmon Supplementation Project; Lostine River Operations and Maintenance 2004 Smolt Acclimation and Adult Return Report.  

DOE Green Energy (OSTI)

The Nez Perce Tribe (NPT), through funding provided by the Bonneville Power Administration (BPA), has implemented a Chinook salmon supplementation program (250,000 smolts) on the Lostine River, a tributary to the Grande Ronde River of Oregon. The Grande Ronde Endemic Spring Chinook Salmon Supplementation project, which involves supplementation of the Upper Grande Ronde River and Catherine Creek in addition to the Lostine River, was established to prevent extirpation and increase the number of threatened Snake River spring/summer Chinook salmon (Oncorhynchus tshawytscha) returning to the Grande Ronde River. This report covers the eighth season (1997-2004) of adult Chinook salmon broodstock collection in the Lostine River and the sixth season (1999-2004) of acclimation of resulting Lostine River progeny. Production of Lostine River spring Chinook salmon smolts currently occurs at Lookingglass Fish Hatchery (LGH). The Lostine River supplementation program utilizes two strategies to obtain egg source for production of smolts for supplementation: captive broodstock and conventional broodstock. The captive broodstock strategy involves (1) capture of natural juvenile spring Chinook salmon smolts from the Lostine River, (2) rearing those to adult and spawning them, and (3) rearing the resultant progeny for eventual acclimation and release back into the Lostine River. The conventional broodstock strategy involves (1) capture of natural and hatchery origin adults returning to the Lostine River, (2) holding those adults and spawning them, and (3) rearing the resultant progency for acclimation and release back into the Lostine River. This report focuses on (1) the trapping and collection of adult spring Chinook salmon that return to the Lostine River, which provides the broodstock source for the conventional strategy and (2) the acclimation and release of juvenile spring Chinook salmon produced from the captive broodstock and conventional broodstock strategies. In 2004, acclimation of Lostine River spring Chinook salmon smolts occurred from March 1, 2004 through to April 14, 2004 and a total of 250,249 smolts were acclimated and released. These smolts were produced from the brood year (BY) 2002 egg source and included captive brood (133,781) and conventional (116,468) origin smolts that were all progeny of Lostine River spring Chinook salmon. Operation of the Lostine River adult monitoring and collection facility in 2004 began May 10, the first Chinook was captured on May 19, 2004 and the last Chinook was captured on September 16, 2004. The weir and trap were removed on October 1, 2004. A total of 1,091 adult Chinook, including jacks, were captured during the season. The composition of the run included 299 natural origin fish and 792 hatchery supplementation fish. There were no identified 'stray' hatchery fish from other programs trapped. Of the fish captured, 46 natural and 69 hatchery supplementation adults were retained for broodstock and transported to Lookingglass Hatchery for holding and spawning, 537 adult Chinook were passed or transported above the weir to spawn naturally, and 447 hatchery origin adult Chinook were transported and outplanted in the Wallowa River and Bear Creek to spawn in underseeded habitat. Of the 107 adults retained (eight additional hatchery females were collected and then later returned to the Lostine River to spawn naturally) for broodstock at Lookingglass Hatchery, 22 natural females and 30 supplementation females were represented in spawning. These females produced a total of 221,889 eggs at fertilization. Eye-up was 94.9% which yielded a total of 210,661 conventional program eyed eggs. The fecundity averaged 4,267 eggs per female. These eggs were incubated and at Lookingglass Hatchery until eyed stage and then transferred to Oxbow Hatchery where they will be reared to the fingerling stage. They will then be transported back to LGH and reared to the smolt stage and then transported to the Lostine acclimation facility for release in the spring of 2006. Captive brood program eggs/fish will be added to

Zollman, Richard L.; Eschler, Russell; Sealey, Shawn [Nez Perce Tribe



Grand Challenges of Advanced Computing for Energy Innovation Report from the Workshop Held July 31-August 2, 2012  

SciTech Connect

On July 31-August 2 of 2012, the U.S. Department of Energy (DOE) held a workshop entitled Grand Challenges of Advanced Computing for Energy Innovation. This workshop built on three earlier workshops that clearly identified the potential for the Department and its national laboratories to enable energy innovation. The specific goal of the workshop was to identify the key challenges that the nation must overcome to apply the full benefit of taxpayer-funded advanced computing technologies to U.S. energy innovation in the ways that the country produces, moves, stores, and uses energy. Perhaps more importantly, the workshop also developed a set of recommendations to help the Department overcome those challenges. These recommendations provide an action plan for what the Department can do in the coming years to improve the nations energy future.

Larzelere, Alex R.; Ashby, Steven F.; Christensen, Dana C.; Crawford, Dona L.; Khaleel, Mohammad A.; John, Grosh; Stults, B. Ray; Lee, Steven L.; Hammond, Steven W.; Grover, Benjamin T.; Neely, Rob; Dudney, Lee Ann; Goldstein, Noah C.; Wells, Jack; Peltz, Jim




SciTech Connect

A new rapid method for the determination of {sup 210}Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that can be used for emergency response or routine water analyses. If a radiological dispersive device (RDD) event or a radiological attack associated with drinking water supplies occurs, there will be an urgent need for rapid analyses of water samples, including drinking water, ground water and other water effluents. Current analytical methods for the assay of {sup 210}Po in water samples have typically involved spontaneous auto-deposition of {sup 210}Po onto silver or other metal disks followed by counting by alpha spectrometry. The auto-deposition times range from 90 minutes to 24 hours or more, at times with yields that may be less than desirable. If sample interferences are present, decreased yields and degraded alpha spectrums can occur due to unpredictable thickening in the deposited layer. Separation methods have focused on the use of Sr Resin?, often in combination with 210Pb analysis. A new rapid method for {sup 210}Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that utilizes a rapid calcium phosphate co-precipitation method, separation using DGA Resin? (N,N,N?,N? tetraoctyldiglycolamide extractant-coated resin, Eichrom Technologies or Triskem-International), followed by rapid microprecipitation of {sup 210}Po using bismuth phosphate for counting by alpha spectrometry. This new method can be performed quickly with excellent removal of interferences, high chemical yields and very good alpha peak resolution, eliminating any potential problems with the alpha source preparation for emergency or routine samples. A rapid sequential separation method to separate {sup 210} Po and actinide isotopes was also developed. This new approach, rapid separation with DGA Resin plus microprecipitation for alpha source preparation, is a significant advance in radiochemistry for the rapid determination of {sup 210}Po.

Maxwell, S.



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



PURDUE UNIVERSITY LEADERSHIP IN ENERGY RESEARCH Recognizing the grand-challenge problems of global energy demands with evidence of climate change  

E-Print Network (OSTI)

PURDUE UNIVERSITY LEADERSHIP IN ENERGY RESEARCH Recognizing the grand-challenge problems of global energy demands with evidence of climate change and broader environmental impacts, Purdue is building of energy including fossil fuels, nuclear, solar, wind and bioenergy. The activities incorporate socio


Microphysical Effects of Wintertime Cloud Seeding with Silver Iodide over the Rocky Mountains. Part III: Observations over the Grand Mesa, Colorado  

Science Conference Proceedings (OSTI)

During March 1986, several airborne and ground-based silver iodide (AgI) seeding experiments were conducted over the Grand Mesa, Colorado, during a three-day period of northerly flow and shallow orographic cloud. While little natural snowfall was ...

Arlin B. Super; Bruce A. Boe


Note: This page contains sample records for the topic "grand rapids mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Le mode d'emergence du Reel - L'avenement des manifestations de la base (gzhi snang) selon les conceptions de la Grande Perfection  

E-Print Network (OSTI)

/ gzhi ka dag chen pozhes bya ste/ ngo bo rang bzhin thugs rje rnam pa gsum du gnas so/ ngo bo de mi gyur bai ye shesma gags par gsal ba gzhon nu bum pai skui gnas lugs zhes byao/ rang bzhin od lngai snang bama gags so/ thugs rjei snang ba ni... ) rayonnante de lumire (od du gsal ba). Voir inter alia Mi pham, rDo rjesnying po, p. 358.17 Klong chen pa, Theg mchog mdzod, I, p. 295. Ici, la Compassion na pas ici expressment decaractre thique ; voir ce sujet Chgyel Namkhai Norbu & Adriano Clemente...

Achard, Jean-Luc



Polychlorinated Biphenyls (PCBs) in Catfish and Carp Collected from the Rio Grande Upstream and Downstream of Los Alamos National Laboratory: Revision 1  

Science Conference Proceedings (OSTI)

Concern has existed for years that the Los Alamos National Laboratory (LANL), a complex of nuclear weapons research and support facilities, has released polychlorinated biphenyls (PCBs) to the environment that may have reached adjacent bodies of water through canyons that connect them. In 1997, LANL's Ecology Group began measuring PCBs in fish in the Rio Grande upstream and downstream of ephemeral streams that cross LANL and later began sampling fish in Abiquiu and Cochiti reservoirs, which are situated on the Rio Chama and Rio Grande upstream and downstream of LANL, respectively. In 2002, we electroshocked channel catfish (Ictalurus punctatus) and common carp (Carpiodes carpio) in the Rio Grande upstream and downstream of LANL and analyzed fillets for PCB congeners. We also sampled soils along the Rio Chama and Rio Grande drainages to discern whether a background atmospheric source of PCBs that could impact surface water adjacent to LANL might exist. Trace concentrations of PCBs measured in soil (mean = 4.7E-05 {micro}g/g-ww) appear to be from background global atmospheric sources, at least in part, because the bimodal distribution of low-chlorinated PCB congeners and mid-chlorinated PCB congeners in the soil samples is interpreted to be typical of volatilized PCB congeners that are found in the atmosphere and dust from global fallout. Upstream catfish (n = 5) contained statistically (P = 0.047) higher concentrations of total PCBs (mean = 2.80E-02 {micro}g/g-ww) than downstream catfish (n = 10) (mean = 1.50E-02 {micro}g/g-ww). Similarly, upstream carp (n = 4) contained higher concentrations of total PCBs (mean = 7.98E-02 {micro}g/g-ww) than downstream carp (n = 4) (3.07E-02 {micro}g/g-ww); however, the difference was not statistically significant (P = 0.42). The dominant PCB homologue in all fish samples was hexachlorobiphenyls. Total PCB concentrations in fish in 2002 are lower than 1997; however, differences in analytical methods and other uncertainties exist. A review of historical quantitative PCB data for fish from the Rio Grande and Abiquiu and Cochiti reservoirs does not indicate a distinct contribution of PCBs from LANL to fish in the Rio Grande or Cochiti. Analysis of homologue patterns for fish does not provide sufficient evidence of a LANL contribution. Nevertheless, concentrations of PCBs in fillets of fish sampled from the Rio Grande are indicative of potential adverse chronic health impact from consumption of these fish on a long-term basis.

Gilbert J. Gonzales Philip R. Fresquez




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Wisconsin Rapids W W & L Comm | Open Energy Information  

Open Energy Info (EERE)

Rapids W W & L Comm Rapids W W & L Comm Jump to: navigation, search Name Wisconsin Rapids W W & L Comm Place Wisconsin Utility Id 20862 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Athletic Field Lighting Service Lighting General Service Three Phase Commercial General Service Single Phase Commercial General Service TOU Single Phase (8am to 8pm) Commercial General Service TOU Single Phase(7am to 7pm) Commercial General Service TOU Single Phase(9 am to 9pm) Commercial


City of Coon Rapids, Iowa (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Coon Rapids, Iowa (Utility Company) Coon Rapids, Iowa (Utility Company) Jump to: navigation, search Name City of Coon Rapids Place Iowa Utility Id 4305 Utility Location Yes Ownership M Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GENERAL DEMAND SERVICE RATE SCHEDULE Commercial GENERAL SERVICE RATE SCHEDULE 1 Commercial GENERAL SERVICE RATE SCHEDULE 2 Commercial GENERAL SERVICE RATE SCHEDULE 3 Commercial LARGE-VOLUME DEMAND SERVICE RATE SCHEDULE Commercial


Innovation Ecosystems Spur Rapid Growth for Startups, Entrepreneurs |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Innovation Ecosystems Spur Rapid Growth for Startups, Entrepreneurs Innovation Ecosystems Spur Rapid Growth for Startups, Entrepreneurs Innovation Ecosystems Spur Rapid Growth for Startups, Entrepreneurs September 14, 2011 - 4:22pm Addthis Rich Earley, CEO of Clean Urban Energy presents at Clean Energy Trust's Clean Energy Challenge in March 2011 | Courtesy of Clean Energy Trust Rich Earley, CEO of Clean Urban Energy presents at Clean Energy Trust's Clean Energy Challenge in March 2011 | Courtesy of Clean Energy Trust Sarah Jane Maxted Special Assistant, Office of Energy Efficiency & Renewable Energy What does this project do? Smart grid start-up company Clean Urban Energy secured $75,000 for its energy storage and smart grid performance optimization technology. Their system harnesses a building's inherent thermal mass to drive


Staged venting of fuel cell system during rapid shutdown  

DOE Patents (OSTI)

A venting methodology and system for rapid shutdown of a fuel cell apparatus of the type used in a vehicle propulsion system. H.sub.2 and air flows to the fuel cell stack are slowly bypassed to the combustor upon receipt of a rapid shutdown command. The bypass occurs over a period of time (for example one to five seconds) using conveniently-sized bypass valves. Upon receipt of the rapid shutdown command, the anode inlet of the fuel cell stack is instantaneously vented to a remote vent to remove all H.sub.2 from the stack. Airflow to the cathode inlet of the fuel cell stack gradually diminishes over the bypass period, and when the airflow bypass is complete the cathode inlet is also instantaneously vented to a remote vent to eliminate pressure differentials across the stack.

Clingerman, Bruce J. (Palmyra, NY); Doan, Tien M. (Columbia, MD); Keskula, Donald H. (Webster, NY)



Rapid Gas Hydrate Formation Processes: Will They Work?  

SciTech Connect

Researchers at DOEs National Energy Technology Laboratory (NETL) have been investigating the formation of synthetic gas hydrates, with an emphasis on rapid and continuous hydrate formation techniques. The investigations focused on unconventional methods to reduce dissolution, induction, nucleation and crystallization times associated with natural and synthetic hydrates studies conducted in the laboratory. Numerous experiments were conducted with various high-pressure cells equipped with instrumentation to study rapid and continuous hydrate formation. The cells ranged in size from 100 mL for screening studies to proof-of-concept studies with NETLs 15-Liter Hydrate Cell. Results from this work demonstrate that the rapid and continuous formation of methane hydrate is possible at predetermined temperatures and pressures within the stability zone of a Methane Hydrate Stability Curve (see Figure 1).

Brown, T.D.; Taylor, C.E.; Bernardo, M.P.



Rapid Sampling from Sealed Containers - Vulnerability Assessment Team -  

NLE Websites -- All DOE Office Websites (Extended Search)

Nonproliferation and Nonproliferation and National Security > VAT > Current Projects > Rapid Sampling Tools > ... from Sealed Containers VAT Projects Introducing the VAT Adversarial Vulnerability Assessments Safety Tags & Product Counterfeiting Election Security Spoofing GPS Defeating Existing Tamper-Indicating Seals Specialty Field Tools & Sampling Tools Tamper & Intrusion Detection Rapid Sampling from Sealed Containers Demo video Insider Threat Mitigation Drug Testing Security Microprocessor Prototypes The Journal of Physical Security Vulnerability Assessments Vulnerability Assessments Insanely Fast µProcessor Shop Insanely Fast µProcessor Shop Seals About Seals Applications of Seals Common Myths about Tamper Indicating Seals Definitions Findings and Lessons Learned