Powered by Deep Web Technologies
Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Prececal, postileal and total tract starch digestion in ponies fed corn, oats, barley or sorghum grain  

E-Print Network [OSTI]

Barley Oats Corn Sorghum Sorghum Barley Oats Corn Whole grains were purchased from a local commercial supplier. All grains were elevator run. Prior to ration formulation grains were coarsely cracked in an automatic roller mill..., chromium and starch by the same procedures except 5 ml of wet sample was used for each analy- For determination of amylase content and viscosity, grains were pulverized in a laboratory Udy mill through a 1 mm screen. An alkaline hydroylsate was prepared...

Arnold, Fairfax Ferguson



And so can plants with high starch contents. [Cereal grains conversion to ethanol  

SciTech Connect (OSTI)

Researchers at Miles Laboratories are looking into the hydrolysis of starch using two enzymes - alpha-amylase and glucoamylase, as high concentrations of starch like those found in cereal grains can be converted into ethanol by way of sugars. It is estimated that to produce 1 gallon of ethanol requires about 56 lb of corn and with 85% fermentation efficiency, the enzyme cost per gallon of ethanol would be 6-7 cents.

Not Available




E-Print Network [OSTI]

RFID BASED GRAIN AND OIL PRODUCTS TRACEABILITY1 AND ITS COMPUTER IMPLEMENTATION Haiyan Hu ,*2 the study of the traceability of grain and oil products. Include the study contents, and a system we developed for traceability of grain and oil products, and the demonstration of the study. The system we

Boyer, Edmond


Systems simulation of oil additives to grain at terminal elevators  

E-Print Network [OSTI]

in Missouri and Texas. Several of these elevators are using oil additives on a regular basis. In addition to grain samples, operating data such as equipment capacities, operating hours and volume of grain handled were obtained. The grain samples were... in Missouri and Texas. Several of these elevators are using oil additives on a regular basis. In addition to grain samples, operating data such as equipment capacities, operating hours and volume of grain handled were obtained. The grain samples were...

Goforth, Kerry James



Performance evaluation of starch based polymer for enhanced oil recovery  

E-Print Network [OSTI]

for Elgin-56 sandstone before and after a 1. 0% polymer treatment. 27 3. 6 Fractional flow curve of water for Okesa-23 sandstone before and after a 1. 0% polymer treannent. 28 3. 7 Oil production rate vs. time for edge water influx grid systems with P... = 1. 5, 2. 0, and 3. 0. 34 Cumulative oil production vs. time for edge water influx grid systems with P = 1. 5, 2. 0, and 3. 0. 35 3. 9 Bottomhole pressure vs. time for edge water influx grid systems with P = 1. 5, 2. 0, and 3. 0. 35 3. 10 Oil...

Skurner, James Andrew



Starch characteristics of selected grain sorghums as related to human foods  

E-Print Network [OSTI]

with Watson (25) . The exception, number 17, was the sugary endosperm Kafir type, SA-5023-0-1-2. It contained 58 per cent total starch and was significantly different from the others (Table 4). Con- sidering that the total carbohydrate content of this type... IO I I \\Cl CI I S . ~ '0 N O Cl 20 The amylose percentages revealed significant differences ( Table 4). The waxy types, numbers 1, 2, 3, and 5, contained very little amylose. This agrees with Watson (25). The highest amylose content...

Miller, Oliver Harrell



Controlling lipid accumulation in cereal grains  

Science Journals Connector (OSTI)

Plant oils have so far been mostly directed toward food and feed production. Nowadays however, these oils are more and more used as competitive alternatives to mineral hydrocarbon-based products. This increasing demand for vegetable oils has led to a renewed interest in elucidating the metabolism of storage lipids and its regulation in various plant systems. Cereal grains store carbon in the form of starch in a large endosperm and as oil in an embryo of limited size. Complementary studies on kernel development and metabolism have paved the way for breeding or engineering new varieties with higher grain oil content. This could be achieved either by increasing the relative proportion of the oil-rich embryo within the grain, or by enhancing oil synthesis and accumulation in embryonic structures. For instance, diacylglycerol acyltransferase (DGAT) that catalyses the ultimate reaction in the biosynthesis of triacylglycerol appears to be a promising target for increasing oil content in maize embryos. Similarly, over-expression of the maize transcriptional regulators ZmLEAFY COTYLEDON1 and ZmWRINKLED1 efficiently stimulates oil accumulation in the kernels of transgenic lines. Redirecting carbon from starch to oil in the endosperm, though not yet realized, is discussed.

Guillaume Barthole; Loïc Lepiniec; Peter M. Rogowsky; Sébastien Baud



The effect of heat treatment on the digestibility of wheat gluten in a model food system containing wheat gluten, corn starch and corn oil  

E-Print Network [OSTI]

ntestinal epithelium to free amino acids (8, 9). The bioavailability of am1no acids in a protein depends on the protein source, the type of processing it undergoes and the inter- actions between the protein and other diet components (10). If a protein... of the batter. The protein used was wheat gluten (Teklad Test Diets, Ma'dison, Wise. ), the fat, corn oil (ICN Nutritional Biochemicals, Cleveland, Ohio) and the carbohydrate, corn starch (United States Biochemical Corp. , 19 Cleveland, Ohio). The batter...

Fox, Debra Marie Ruzicka



A Novel Factor FLOURY ENDOSPERM2 Is Involved in Regulation of Rice Grain Size and Starch Quality  

Science Journals Connector (OSTI)

...2B). Figure 2. Amylose Content and Amylopectin Composition of the...Wild-Type Grain. (A) Amylose content of the wild...amylopectins. Debranched amylopectin was compared with...and PGIb), and alpha-amylase (Amy3C, Amy3D...

Kao-Chih She; Hiroaki Kusano; Kazuyoshi Koizumi; Hiromoto Yamakawa; Makoto Hakata; Tomohiro Imamura; Masato Fukuda; Natsuka Naito; Yumi Tsurumaki; Mitsuhiro Yaeshima; Tomohiko Tsuge; Ken'ichiro Matsumoto; Mari Kudoh; Eiko Itoh; Shoshi Kikuchi; Naoki Kishimoto; Junshi Yazaki; Tsuyu Ando; Masahiro Yano; Takashi Aoyama; Tadamasa Sasaki; Hikaru Satoh; Hiroaki Shimada



Substitution relationship and economic optima for different combinations of grain sorghum and sunflower oil in swine rations, Chaco Province, Argentina  

E-Print Network [OSTI]

SUBSTITUTION RELATIONSHIPS AND CONOMIC OPTIMA FOR DIFFERENT COPZINATIONS Or GRAIN SORGHUM AND SUNf LOWER OIL IN SWINE RATIONS, CHACO PROVINCE, ARG ENT I NA. A Thesis by ABRAHAM MANUFL PLOTK IN Submitted to the Graduate College of Texas A... IN SWINE RATIONS CHACO PROVINCE& ARGENTINA A Thesis by ABRAHAM I':ANUEL PLOTKIIil Approved as to style and content by: . r~g (Chairman of Committee ) (Member ) (Head of Department) (Mer ' r) (I leriber ) l '/ ??j i. / (Miember ) Iiay l970...

Plotkin, Abraham Manuel



Studies of physical characteristics and animal response to reconstituted sorghum grain  

E-Print Network [OSTI]

date of reconstitution 35 Endosperm cells containing starch granules from dry grain (840X). 51 Endosperm cells containing starch granules from reconstituted grain (840X) 51 Starch granules from reconstituted grain (840X) 52 10 Reconstituted grain... sorghums *re excellent feed for all classes of livestock. They are generally equal to or better than other cereal grains, including corn, in the production of gain. Grain sorghum can fit into feed rations for fatten- ing all classes of livestock, creep...

Florence, Harold Douglas



Effect of calcium buffers and whole plant processing methods on starch digestibility of sorghum based diets in Holstein cows  

E-Print Network [OSTI]

. Significant rela- tionships were found between fecal starch percentage and fecal pH, starch digestibility and fecal pH, and fecal starch percentage and starch d ige st ibility. Experiment 3 was a comparison of the effect on digestibility of three methods... Relationship between starch digestibility and fecal pH in Experiment 2. 15 Relationship between whole plant grain sorghum processing for silage and fecal pH in Experiment 3 . 75 16 Relationship between fecal starch percentage and fecal pH in Experiment 3...

Fernandez, John Anthony



The Effects of Sorghum [Sorghum Bicolor (L.) Moench] Phenolic Compounds on Starch Digestibility of Porridges  

E-Print Network [OSTI]

of whole sorghum grain and ground whole sorghum grain. ............ 24 4. b* values of whole sorghum grain and ground whole sorghum grain. ............ 25 5. The residue of whole sorghum grain porridges after 18 h bacterial alpha amylase digestion.... Davis and Hoseney (1979) reported that tannins isolated from sorghum grain inhibited the enzyme alpha-amylase, and they also bind to the starch granule to varying degrees. Daiber (1975) and Beta et al (2000) found that condensed tannins inactivated...

Austin, Dilek



Characterization of Potato Leaf Starch  

Science Journals Connector (OSTI)

Characterization of Potato Leaf Starch ... Potatoes of the cultivar Producent were grown south of Uppsala, Sweden. ...

Stalin Santacruz; Kristine Koch; Roger Andersson; Per Åman



Continuous enzymatic liquefaction of starch for saccharification  

SciTech Connect (OSTI)

A process was explored for continuous enzymatic liquefaction of corn starch at high concentration and subsequent saccharification to glucose. The process appears to be quite efficient for conversion of starch to glucose and enzymatic liquefaction and should be readily adaptable to industrial fermentation processes. Preliminary work indicated that milled corn or other cereal grains also can be suitably converted by such a process. Essentially, the process involved incorporation of a thermostable, bacterial alpha-amylase for liquefaction and, subsequently, of a glucoamylase into the continuous mixer under conditions conductive to rapid enzymatic hydrolyses. Also studied was the effect on substrate liquefaction of variables such as starch concentration (40-70%), level of alpha-amylase (0.14-0.4%, dry starch basis), temperature (70-100 degrees C), pH (5.8-7.1), and residence time (6 and 12 minutes). The degree of liquefaction was assessed by determining 1) the Brookfield viscosity, 2) the amount of reducing groups, and 3) the rate and extent of glucose formed after glucoamylase treatment. Best liquefaction processing conditions were achieved by using 50-60% starch concentration, at 95 degrees C, with 0.4% alpha-amylase, and a 6 minute residence period in the mixer. Under these conditions, rates and extents of glucose obtained after glucoamylase treatment approached those obtained in longer laboratory batch liquefactions. The amount of glucose formed in 24 hours with the use of 0.4% glucoamylase was 86% of theory after a 6-min continuous liquefaction, compared to 90% for a 30-min laboratory batch liquefaction (95 degrees C, 0.4% alpha-amylase). (Refs. 15).

Carr, M.E.; Black, L.T.; Bagby, M.O.



Dissection of Maize Kernel Composition and Starch Production by Candidate Gene Association  

Science Journals Connector (OSTI)

...where protein, oil, and starch compositions...Proportion of Variance Cumulative Variance Interpretation...NIR-1 0.34 0.34 Oil and protein accumulation...NIR-2 0.13 0.47 Oil production versus protein production...winterH and summerC field seasons. Cumulatively...

Larissa M. Wilson; Sherry R. Whitt; Ana M. Ibáñez; Torbert R. Rocheford; Major M. Goodman; Edward S. Buckler IV



Microscopic Analysis of Corn Fiber Using Corn Starch- and Cellulose-Specific Molecular Probes  

SciTech Connect (OSTI)

Ethanol is the primary liquid transportation fuel produced from renewable feedstocks in the United States today. The majority of corn grain, the primary feedstock for ethanol production, has been historically processed in wet mills yielding products such as gluten feed, gluten meal, starch, and germ. Starch extracted from the grain is used to produce ethanol in saccharification and fermentation steps; however the extraction of starch is not 100% efficient. To better understand starch extraction during the wet milling process, we have developed fluorescent probes that can be used to visually localize starch and cellulose in samples using confocal microscopy. These probes are based on the binding specificities of two types of carbohydrate binding modules (CBMs), which are small substrate-specific protein domains derived from carbohydrate degrading enzymes. CBMs were fused, using molecular cloning techniques, to a green fluorescent protein (GFP) or to the red fluorescent protein DsRed (RFP). Using these engineered probes, we found that the binding of the starch-specific probe correlates with starch content in corn fiber samples. We also demonstrate that there is starch internally localized in the endosperm that may contribute to the high starch content in corn fiber. We also surprisingly found that the cellulose-specific probe did not bind to most corn fiber samples, but only to corn fiber that had been hydrolyzed using a thermochemical process that removes the residual starch and much of the hemicellulose. Our findings should be of interest to those working to increase the efficiency of the corn grain to ethanol process.

Porter, S. E.; Donohoe, B. S.; Beery, K. E.; Xu, Q.; Ding, S.-Y.; Vinzant, T. B.; Abbas, C. A.; Himmel, M. E.



Starch-Binding Domain Affects Catalysis in Two Lactobacillus ?-Amylases  

Science Journals Connector (OSTI)

...Starch. Amylase activity...starch, amylose, amylopectin, or corn...starch. Amylase activity...starch, amylose, amylopectin, or raw...B) a-amylases as measured...and 63C. , amylose; , soluble...starch; , amylopectin; , corn...

R. Rodríguez-Sanoja; B. Ruiz; J. P. Guyot; S. Sanchez



Analyzing the Limits and Extent of Alpha-Amylase Catalyzed Removal of Starch-Based Filter Cake  

E-Print Network [OSTI]

The ability of starch to impart functions including fluid-loss control, cuttings transport, and rheological characteristics to water-based drilling fluids has led to its widespread use in the oil industry. The filter cake deposited by these drilling...

Dharwadkar, Pavan S.



Molecular Genetic Analysis of Maize Starch Branching Isoforms: Modulation of Starch Branching Enzyme Isoform Activities in Maize to Produce Starch with Novel Branching Architecture and Properties  

SciTech Connect (OSTI)

Modulation of Starch Branching enzyme Isoform Activities in Maize to Produce Starch with Novel Branching Architecture and Properties.

Guiltinan, Mark J.; Thompson, Donald


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fatty acid compositions of lipids from corn and grain sorghum kernels  

Science Journals Connector (OSTI)

Characteristics and fatty acid compositions of the lipid components of the main fractions (germ, starch, gluten, and fiber) obtained in the wet milling of corn and grain sorghum kernels have been determined.

A. R. Baldwin; M. S. Sniegowski



Grain sorghum, reconstituted in whole and in ground forms, in finishing rations for beef cattle  

E-Print Network [OSTI]

grain. Baberlandt (1890), cited by Overbeek (1966), recognized that the aleurone layer is a gland which secretes the hydrolytic enzyme (alpha-amylase)responsible for liquifying the reserve starch. The presence of the embryo is required before... grain. Baberlandt (1890), cited by Overbeek (1966), recognized that the aleurone layer is a gland which secretes the hydrolytic enzyme (alpha-amylase)responsible for liquifying the reserve starch. The presence of the embryo is required before...

Penic, Peter



Nutritional value of sorghum grain after treatment with water and enzymes  

E-Print Network [OSTI]

. It appears that a breaking down oi the proteins and starch molecules of the ground grain by Protease and Amylase, respectively, into smaller molecules offered a better material for an anaerobic fermentation which might have caused the reduction... of the methionine and 45. 75/ of the cystine in the grain. It appears that a breaking down of the proteins and starch molecules by Protease and Amylase, respectively, into smaller molecules offered a better material for an anaerobic fermentation which might have...

Silva, Paulo Carlos



Brucite nanoplates reinforced starch bionanocomposites  

Science Journals Connector (OSTI)

In this paper the mechanical reinforcement of nano-sized brucite, Mg(OH)2 in a series of bionanocomposite films based on starch was investigated. Brucite nanoplates with an aspect ratio of 9.25 were synthesized by wet precipitation and incorporated into starch matrices at different concentrations (0–7.5 wt.%). Scanning electron microscopy revealed a high degree of nanoplate dispersion within the starch bionanocomposites and good interfacial adhesion between the filler and matrix. The brucite nanoplates formed agglomerates at high concentrations. The reinforcement factor values of the bionanocomposites were higher than the values predicted from the Halphin–Tsai model, which was attributed mainly to the high surface area of the nanoplates. Brucite (1 wt.%) nearly doubled the elastic modulus of starch films. Thermogravimetric analyses indicated some interaction between starch and the brucite that modified their decomposition profiles. Mechanical tests of glycerol plasticized bionanocomposites showed that the reinforcing efficiency of brucite remained high even at 10 wt.% and 20 wt.% of plasticizer.

Francys K.V. Moreira; Daniel C.A. Pedro; Gregory M. Glenn; José M. Marconcini; Luiz H.C. Mattoso



Water-soluble graft copolymers of starch-acrylamide and uses therefor  

DOE Patents [OSTI]

Graft copolymers having starch as the central chain with grafted side chains of acrylamide or acrylamide-acrylic acid, and a process for preparation of such copolymers in the presence of Ce.sup.+4 or other redox initiators. These copolymers are employed in preparing highly viscous aqueous solutions that are particularly useful in oil recovery from subterranean wells.

Butler, George B. (Gainesville, FL); Hogen-Esch, Thieo E. (Gainesville, FL); Meister, John J. (Dallas, TX); Pledger, Jr., Huey (Gainesville, FL)



Biochemical evidence that starch breakdown by Bacteroides thetaiotaomicron involves outer membrane starch-binding sites and periplasmic starch-degrading enzymes.  

Science Journals Connector (OSTI)

...cell-associated amylase, amylopectinase...associated with starch breakdown, alpha-glucosidase...cell-associated amylase, amylopectinase...associated with starch breakdown, alpha-glucosidase...inducer of the starch- degrading...inducers or that break- down of maltose...

K L Anderson; A A Salyers



Preparation of tailor-made starch-based aerogel microspheres by the emulsion-gelation method  

Science Journals Connector (OSTI)

The inherent biocompatibility and biodegradability of starch, a natural polysaccharide-based product, allows its use in the form of microspheres as a chemical carrier for life science applications. However, current methods of preparation of starch microspheres utilize chemical crosslinkers and drying methods (air drying, freeze drying) that leads to problems of degradability of the matrix and low specific surface areas and chemical loading capacities. In this work, corn starch aerogel microspheres, a special class of nanoporous materials, were prepared by the combination of an emulsion-gelation method and supercritical drying without the use of chemical crosslinkers. Effects of gelation temperature (368, 393 and 413 K), oil-to-aqueous starch solution ratio (1:1, 2:1, 3:1) and surfactant content (3, 6 and 10% (w/w)) on the textural and morphological properties of the aerogel material were studied. The obtained starch aerogels were characterized using nitrogen adsorption–desorption measurements, helium pycnometry, CHN elemental analyses, thermogravimetry and scanning electron microscopy. Spherical starch aerogel microspheres with tailor-made specific surface areas (34–120 m2 g?1 range) and particle sizes (215–1226 ?m diameter range) were obtained. Aerogel textural properties were mainly influenced by the gelation temperature used, whereas the particle morphology depended on the three processing parameters studied. High specific chemical loading capacity (1.1 × 10?3 g m?2) of the aerogel microspheres was obtained using ketoprofen as a model compound.

C.A. García-González; J.J. Uy; M. Alnaief; I. Smirnova



Cecropia peltata Accumulates Starch or Soluble Glycogen by Differentially Regulating Starch Biosynthetic Genes  

Science Journals Connector (OSTI)

...transporter MEX1 to fuel metabolism at...by concurrent degradation accompanying...required for starch degradation in Arabidopsis thaliana. Plant Cell 21 : 334-346...regulator of starch degradation in plants...transporter. Plant Cell 13 : 1907-1918...

Sylvain Bischof; Martin Umhang; Simona Eicke; Sebastian Streb; Weihong Qi; Samuel C. Zeeman



Bacterial Alpha Amylase Paper Disc Tests on Starch Agar  

Science Journals Connector (OSTI)

...Articles Bacterial Alpha Amylase Paper Disc Tests on Starch Agar Egon Stark Ralph...Mass. Bacterial Alpha Amylase Paper Disc Tests on Starch Agar EGON STARK...hydrolysis of soluble starch by a bacterial alpha-amylase preparation, so...

Egon Stark; Ralph Wellerson Jr.; Philip A. Tetrault; Carl F. Kossack



The unique features of starch metabolism in red algae  

Science Journals Connector (OSTI)

...unique features of starch metabolism in red algae Roberto Viola 1 * Pi Nyvall 2 Marianne...SE-106 91 Stockholm, Sweden Red algae (Rhodophyceae) are photosynthetic eukaryotes...plastids. The starch granules from red algae (floridean starch) show structural similarities...



Improved method for detection of starch hydrolysis  

SciTech Connect (OSTI)

A new starch hydrolysis detection method which does not rely on iodine staining or the use of color-complexed starch is described. A linear relationship was obtained with agar-starch plates when net clearing zones around colonies of yeasts were plotted against enzyme levels (semilogarithm scale) produced by the same yeast strains in liquid medium. A similar relationship between starch clearing zones and alpha-amylase levels from three different sources was observed. These observations suggest that the method is useful in mutant isolations, strain improvement programs, and the prediction of alpha-amylase activities in culture filtrates or column effluents. (Refs. 18).

Ohawale, M.R.; Wilson, J.J.; Khachatourians, G.G.; Ingledew, W.M.



Oil recovery from condensed corn distillers solubles.  

E-Print Network [OSTI]

??Condensed corn distillers solubles (CCDS) contains more oil than dried distillers grains with solubles (DDGS), 20 vs. 12% (dry weight basis). Therefore, significant amount of… (more)

Majoni, Sandra



Effect of ground corn steeping on starch properties  

Science Journals Connector (OSTI)

Pasting and thermal properties, and microstructure of starch from ground corn (GS) steeped at 52 °C in ... were investigated. The isolated starch obtained by wet milling was characterised by determining pasting p...

Monica Haros; Wioletta Blaszczak; Oscar E. Perez…



Evaluation of Exogenous Enzymes Targeting Non-starch Polysaccharides in Reduced Energy Diets on Broiler Growth Performance and Processing Parameters  

E-Print Network [OSTI]

(Bedford, 2000). The inclusion of xylanase, protease, or amylase improves FCR, increases AME, and starch digestibility in cereal grain diets (Choct et al., 1999; Kalmendal and Tauson, 2012; O’Neill et al., 2012). The inclusion of xylanase significantly.... Short contact time can lead to less absorption of these longer chain polysaccharides, representing a loss in digestible energy for the bird. Additionally, the inability for broilers to break down nutrients entrapped in the matrix of cell walls of feed...

Klein, Joseph Thomas



Coupling between grain growth and grain rotation  

Science Journals Connector (OSTI)

Grain boundary motion during grain growth or recrystallization is considered as a diffusion process of atomic movement across the boundary. It can be accompanied by subgrain rotation or nanograin rotation. However grain boundary migration can be achieved also by dislocation motion or creep. The evidence is the power law relationship between driving force and boundary velocity for large driving forces and an activation energy which approaches that of self-diffusion at low driving forces and decreases with increasing driving force. The creep mechanism may or may not involve grain rotation. Experimental evidences and dislocation models are discussed in reference to coupling between boundary migration and grain rotation.

Bhakta B. Rath; M. Winning; J. C. M. Li



E-Print Network 3.0 - affects starch accumulation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

starch Summary: the rate of starch synthesis and affects the composition of starch in potato tubers (Geigenber- ger et al... al. 1988) can accumulate as much as 15% of the normal...


E-Print Network 3.0 - amylose maize starches Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

THE GELATINIZATION PROPERTIES OF STANDARD MAIZE STARCH Summary: , high amylose maize, potato and lentil starches. The magnitude of these changes was found... in gelatinization...



E-Print Network [OSTI]

Seyitömer, Himmeto?lu and Hat?lda? oil shale deposits. The results demonstrate that these oil shales are

Fields (in-situ Combustion Approach; M. V. Kök; G. Guner; S. Bagci?


Assessing Impact of Biofuel Production on Regional Water Resource...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Jones et al. 2009 Multiple Products Produced from Biorefinery Biofuel Bio- electricity Biogas Animal feed Fertilizer Chemicals Agricultural residue, grain starch, oil seeds, forest...


Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

derived from grain starch, oil seed, animal fats, or other biomass; or produced from a biogas source, including any non-fossilized, decaying, organic matter capable of powering...

Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Utilization of diets with hydrolyzed potato starch, or glucose by juvenile white sturgeon (Acipenser transmontanus), as affected by Maillard reaction during feed processing  

E-Print Network [OSTI]

Utilization of hydrolysed potato starch by juvenile AtlanticWhite sturgeon; Hydrolyzed potato starch; Glucose; Plasmaglucose or hydrolyzed potato starch (HPS). Four diets

Deng, D F; Hemre, G I; Storebakken, T; Shiau, S Y; Hung, SSO



A family of starch-active polysaccharide monooxygenases  

Science Journals Connector (OSTI)

...addition to {alpha}(1?4) bonds...form between amylose and amylopectin in starch, which...degraded mainly by {alpha}-amylase and glucoamylase...Methods Materials. Amylopectin from maize (Sigma; 11020), amylose with average...

Van V. Vu; William T. Beeson; Elise A. Span; Erik R. Farquhar; Michael A. Marletta



Gourd and squash artifacts yield starch grains of feasting foods from preceramic Peru  

Science Journals Connector (OSTI)

...containers or serving vessels (Table 2...most often as wood for fuel or construction (30...regarding prehistoric consumption of algarrobo pods...gourd and squash serving vessels found in the pit, are...consistent with the refuse of consumption. Common Andean...

Neil A. Duncan; Deborah M. Pearsall; Robert A. Benfer; Jr.



Mutants of Arabidopsis with altered regulation of starch degradation  

SciTech Connect (OSTI)

Mutants of Arabidopsis thaliana (L.) Heynh. with altered regulation of starch degradation were identified by screening for plants that retained high levels of leaf starch after a period of extended darkness. The mutant phenotype was also expressed in seeds, flowers, and roots, indicating that the same pathway of starch degradation is used in these tissues. In many respects, the physiological consequences of the mutations were equivalent to the effects observed in previously characterized mutants of Arabidopsis that are unable to synthesize starch. One mutant line, which was characterized in detail, had normal levels of activity of the starch degradative enzymes {alpha}-amylase, {beta}-amylase, phosphorylase, D-enzyme, and debranching enzyme. Thus, it was not possible to establish a biochemical basis for the phenotype, which was due to a recessive mutant at a locus designated sex 1 at position 12.2 on chromosome 1. This raises the possibility that hitherto unidentified factors, altered by the mutation, play a key role in regulating or catalyzing starch degradation.

Caspar, T.; Lin, Tsanpiao; Kakefuda, G.; Benbow, L.; Preiss, J.; Somerville, C. (Michigan State Univ., East Lansing (USA))



Phosphoglucan-bound structure of starch phosphatase Starch Excess4 reveals the mechanism for C6 specificity  

Science Journals Connector (OSTI)

...glucose homopolymers amylose (10–25%) and amylopectin (75–90%) (1, 2). Amylose is a linear molecule formed from {alpha}-1,4-glycosidic...chains, whereas amylopectin is formed from...starch hydrolyzing amylases, and dephosphorylation...

David A. Meekins; Madushi Raththagala; Satrio Husodo; Cory J. White; Hou-Fu Guo; Oliver Kötting; Craig W. Vander Kooi; Matthew S. Gentry



Waxy Chlamydomonas reinhardtii: monocellular algal mutants defective in amylose biosynthesis and granule-bound starch synthase activity accumulate a structurally modified amylopectin.  

Science Journals Connector (OSTI)

...EC Starch Synthase | Alleles Amylopectin genetics metabolism Amylose genetics...metabolism Chloroplasts metabolism ultrastructure Kinetics...Selection, Genetic Starch chemistry Starch...Characterisation of starch granules from waxy, nonwaxy and hybrid seeds of Amaranthus hypochondriacus...

B Delrue; T Fontaine; F Routier; A Decq; J M Wieruszeski; N Van Den Koornhuyse; M L Maddelein; B Fournet; S Ball



„Peak Oil“  

Science Journals Connector (OSTI)

Wissenschaftliche Voraussagen deuten auf „Peak Oil“, das Maximum globaler Erdölförderung, in unserer ... der demokratischen Systeme führen. Psychoanalytische Betrachtung darf „Peak Oil“ für die Zivilisation als e...

Dr. Manuel Haus; Dr. med. Christoph Biermann



In Vitro Utilization of Amylopectin and High-Amylose Maize (Amylomaize) Starch Granules by Human Colonic Bacteria  

Science Journals Connector (OSTI)

...starch, the amylose/amylopectin ratio, the...interaction, amylose-lipid complexes...presence of amylase inhibitors...include both a-amylase and a-glucosidase...shown that both amylopectin maize starch and high-amylose maize starch...

Xin Wang; Patricia Lynne Conway; Ian Lewis Brown; Anthony John Evans




E-Print Network [OSTI]

??Starches differ with respect to both digestion rate and digestion extent in the small intestine. The portion of starch not hydrolyzed by pancreatic ?-amylase and… (more)

Saibene, Debora



Formation of a raw starch-hydrolyzing alpha-amylase by Clostridium 2021: Effect of carbon sources  

Science Journals Connector (OSTI)

Clostridium 2021 was found to produce ?-amylase effective at hydrolyzing raw starch. Of the carbohydrates examined, starch at 3 % concentration was found to be the best carbon sou...

M. C. Avendano; I. Cornejo



Result Demonstration Report Pigweed Control in Grain Sorghum Using Peak. 1996 to 1999  

E-Print Network [OSTI]

74 78 Peak + Methylated Oil 0.75 oz + 1 pt 78 88 93 1) WAT = Weeks after treatment application. #12Result Demonstration Report Pigweed Control in Grain Sorghum Using Peak. 1996 to 1999 Brent Bean Summary Studies were conducted from 1996 to 1999 to evaluate pigweed control in grain sorghum using Peak

Mukhtar, Saqib


Ethanol fermentation of cassava starch pretreated with alkali  

SciTech Connect (OSTI)

In view of the current industrial process for the conventional ethanol fermentation, in which raw starch materials are heated at 120 degrees C for 2 h, conditions for an alternative process were set: an overall time from saccharification to ethanol fermentation of within 3-4 days, an operation temperature of below 60 degrees C, an ethanol yield of over 93%, and a ratio of raw material to fermentation volume of within 1:4. To meet these conditions, previously a steeping method of starch materials in 0.5N HCl solution at 60 degrees C for 12 h were used, followed by combined actions of ..cap alpha..-amylase and glucoamylase. The ethanol yield from uncooked cassava starch treated under the conditions described was 95% after fermentation for 3 days with Saccharomyces cerevisiae. However, the use of a relatively higher concentration of acid for steeping is still a problem and gelatinization of starch materials is insufficient. This communication, therefore, describes effects of alkali steeping and structural change of starch granules on the ethanol fermentation. 8 references.

Shin, Y.C.; Lee, S.Y.; Choe, Y.K.; Kim, H.S.; Byun, S.M.



The Phosphoglucan Phosphatase Like Sex Four2 Dephosphorylates Starch at the C3-Position in Arabidopsis  

Science Journals Connector (OSTI)

...produce novel starches for industrial applications. The degree...from the Riken Bioresource Center (stock number pda16983...Eisenberg, D. (1992). Assessment of protein models with three-dimensional...starch-derived pastes for industrial applications. In Arabidopsis...

Diana Santelia; Oliver Kötting; David Seung; Mario Schubert; Matthias Thalmann; Sylvain Bischof; David A. Meekins; Andy Lutz; Nicola Patron; Matthew S. Gentry; Frédéric H.-T. Allain; Samuel C. Zeeman



Role of starch as a substrate for Bacteroides vulgatus growing in the human colon.  

Science Journals Connector (OSTI)

...the starches amylose and amylopectin. Amylase and alpha-glucosidase...the starches amylose and amylopectin. Amylase and alpha-glucosidase...2.1.20 alpha-Glucosidases | Amylases metabolism Amylopectin metabolism Amylose metabolism...

R E McCarthy; M Pajeau; A A Salyers



Obesity Management Using Diacylglycerol and Low Glycemic Index Starch in Dogs  

E-Print Network [OSTI]

) and amylopectin (branched glucose polymer containing both ?-1,4- and ?-1,6- linkages). Starch digestibility is afected not only by procesing but also by plant species. High-amylose corn (low glycemic index, LGI) starch is a starch from amylomaize corn that has... and 25% amylose (Thomison, 2004). Nguyen et al. (1998) reported that postprandial hyperglycemia and insulin secretion depend on the ratio of amylose to amylopectin consumed. These authors found a positive linear correlation betwen the starch content...

Nagaoka, Daisuke



Degradation of Raw Starch by a Wild Amylolytic Strain of Lactobacillus plantarum  

Science Journals Connector (OSTI)

...cassava, can break down cassava raw starch that has not...excreted a high alpha-amylase activity...Degradation of Raw Starch by a Wild Amylolytic...cassava, can break down cassava raw starch that has not...excreted a high alpha-amylase activity...

Eric Giraud; Alain Champailler; Maurice Raimbault



Estimating Corn Grain Yields  

E-Print Network [OSTI]

. Background Moisture stress caused by drought will reduce corn grain yields by dis- rupting kernel development, lowering grade, and impeding grain fill. Kernel development of the corn plant is most affected by drought during early vegeta- tive growth stages... stages of development (V8 and V9) also cause the corn plant to develop fewer kernels and to abort developing pollen tubes and kernels. The result is fewer filled rows and fewer developed kernels within each row of an ear, and an overall reduction...

Blumenthal, Jurg M.; Thompson, Wayne



Understanding for Grain Marketing  

E-Print Network [OSTI]

Understanding for Grain Marketing Commodity Futures and Options CIS1089 The Authors: L.D. MakusContracts A futures contract is a standard- ized contract that is traded on a futures market exchange. The contract. This bulletin presents some marketing tools to help producers recognize the sources of price risk

O'Laughlin, Jay


Grains, Water Introduction  

E-Print Network [OSTI]

Grains, Water & Wet Sand Onno Bokhove Introduction Dry Granular Chute Flows: Cantilever Water Waves: Bores Near the Shore Surf Induced Sand Dynamics Discussion Dry Granular Flows, Water Waves & Surf, Water & Wet Sand Onno Bokhove Introduction Dry Granular Chute Flows: Cantilever Water Waves: Bores Near

Wirosoetisno, Djoko


Extraction and Proteome Analysis of Starch Granule-Associated Proteins in Mature Wheat Kernel (Triticum aestivum L.)  

Science Journals Connector (OSTI)

The presence of ?-amylase inside the starch granules indicates that this enzyme is needed to directly break down the starch polymer. ... (48, 49) This xylanase inhibitor also displays inhibitory activity toward barley alpha-amylases. ... (54) Some authors studied starch associated proteins from commercial wheat starches,(54) and found stress defense proteins including ?-amylase subtilisin inhibitor, chitinase and serpin. ...

Emmanuelle Bancel; Hélène Rogniaux; Clément Debiton; Christophe Chambon; Gérard Branlard


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Peak Oil  

Science Journals Connector (OSTI)

At the start of the new millennium, the expression “Peak Oil” was unknown. Nevertheless, a discussion about when the world’s rate of oil production would reach its maximum had already ... . King Hubbert presented...

Kjell Aleklett



Peak Oil  

Science Journals Connector (OSTI)

Between 2000 and 2010, world oil prices advanced from approximately $25 per barrel to more than $100 per barrel. The price appreciation of oil over the decade was around ten times the rate of inflation.

Robert Rapier



68 CEREAL CHEMISTRY Variability in Starch Acetylation Efficiency  

E-Print Network [OSTI]

. Six waxy corn (maize) hybrids from 1998 and five waxy corn hybrids from 1999 were wet-milled, and reduced retro- gradation upon cooling (Rutenberg and Solarek 1984). Corn (maize) starch obtained by wet influences numerous processes associated with corn milling. Peplinski et al (1989) dry-milled corn from


Effects of charge-carrying amino acids on the gelatinization and retrogradation properties of potato starch  

Science Journals Connector (OSTI)

Abstract The objective of this study was to evaluate the effects of charge-carrying amino acids (lysine (Lys), arginine (Arg), aspartic acid (Asp) and glutamic acid (Glu)) on the gelatinization and retrogradation properties of potato starch. Acidic amino acids (Asp and Glu) showed a decreasing trend in swelling power and granule size of potato starch, but increased amylose leaching and gelatinization temperature. Alkaline amino acid (Arg) showed an increasing trend in swelling power and granule size of potato starch, but decreasing amylose leaching and gelatinization temperature. Lys had no effect on the swelling power of potato starch, except at a high content (0.2 mol/kg). Like other two acidic amino acids, Lys also increased gelatinization temperature. Moreover, the addition of alkaline amino acids (Arg) decreased syneresis value of potato starch but acidic amino acids (Asp and Glu) increased it. Compared to Arg, the syneresis of potato starch with Lys was similar to that of its native starch.

Wenting Chen; Hongxian Zhou; Hong Yang; Min Cui



Considerations When Using Grain Contracts  

E-Print Network [OSTI]

Grain contracts can help farmers manage the increasing risks of production and the price volatility of the market. This publication explains grain contracts and how to use them wisely as a risk management tool....

Wisner, Robert; McCorkle, Dean



Starch Granule Initiation in Arabidopsis Requires the Presence of Either Class IV or Class III Starch Synthases  

Science Journals Connector (OSTI)

...as amylopectin structure, amylopectin/amylose ratio, shape, morphology...of the residual starch (amylose content, amylopectin chain length distribution...enzyme b 168 14.6 173 10.7 alpha-Amylase c 0.218 0.05 0.247...

Nicolas Szydlowski; Paula Ragel; Sandy Raynaud; M. Mercedes Lucas; Isaac Roldán; Manuel Montero; Francisco José Muñoz; Miroslav Ovecka; Abdellatif Bahaji; Véronique Planchot; Javier Pozueta-Romero; Christophe D'Hulst; Ángel Mérida



Effects of brewers` condensed solubles (BCS) on the production of ethanol from low-grade starch materials  

SciTech Connect (OSTI)

Yeast fermentation was performed on grain and bakery byproducts with and without adding the same volume of brewers` condensed solubles (BCS). Starch material in the grain and bakery byproducts effectively was converted to fermentable sugars with conversion ratios of 93-97% by successive treatments of samples with bacterial {alpha}-amylase and fungal glucoamylase. The yeast fermentation of these enzyme-digested byproducts alone showed that ethanol concentrations of 16.4-42.7 mL/100 g dry solid in the broth were achieved with fermentation efficiencies of 87-96%. Addition of BCS to the grain byproducts increased ethanol concentration by 10-86% by increasing the potential glucose content of the broth. The rates of fermentation measured by CO{sub 2} gas production demonstrated that BCS addition to bakery byproducts reduced the fermentation time from 62-72 h to 34-35 h. In bakery byproducts that were low in amino nitrogen, exhaustion of nitrogenous compounds in substrates was found to be a limiting factor for yeast growth. Because BCS is a rich source of nitrogen, adding BCS to these substrates markedly increased the fermentation rate. 15 refs., 4 figs., 3 tabs.

Choi, C.H.; Chung, D.S.; Seib, P.A. [Kansas State Univ., Manhattan, KS (United States)] [and others



Grain Destruction in Interstellar Shocks  

E-Print Network [OSTI]

Interstellar shock waves can erode and destroy grains present in the shocked gas, primarily as the result of sputtering and grain-grain collisions. Uncertainties in current estimates of sputtering yields are reviewed. Results are presented for the simple case of sputtering of fast grains being stopped in cold gas. An upper limit is derived for sputtering of refractory grains in C-type MHD shocks: shock speeds $v_s \\gtrsim 50 \\kms$ are required for return of more than 30\\% of the silicate to the gas phase. Sputtering can also be important for removing molecular ice mantles from grains in two-fluid MHD shock waves in molecular gas. Recent estimates of refractory grain lifetimes against destruction in shock waves are summarized, and the implications of these short lifetimes are discussed.

B. T. Draine



Application of genetics to the development of starch-fermenting yeasts  

SciTech Connect (OSTI)

Yeast strains capable of direct fermentation of manioc starch were developed by hybridizing strains of Saccharomyces diastaticus and Saccharomyces cerevisiae. Hybrids were evaluated for speed of alcohol production, and yields and speed of formation of glycoamylase. Up to 6% solutions of Lintner starch could be fermented directly with about 80% conversion to alcohol. Pretreatment of crude 40% manioc starch suspensions with alpha-amylase, followed by fermentations with a starch-fermenting yeast strain, permitted accumulation of 12% ethanol within three days. Starch conversion was almost 100%. A fragment of DNA was cloned from S. diastaticus using the yeast-E. coli shuttle vector, YEp13, and was used to transform a strain of S. cerevisiae to a starch-fermenting state. Supported by National Science Foundation grant INT 7927328 and National Institutes of Health grant GM 27860. Dr. Laluce was supported by a grant from Fundacao de Amparo a Pesquisa do Estado do Sao Paulo and by her university. (Refs. 5).

Mattoon, J.R.; Kim, K.; Laluce, C.



Alcohol production from various enzyme-converted starches with or without cooking  

SciTech Connect (OSTI)

The effectiveness of alcoholic fermentation was compared by measuring alcoholic yields from various starch mashes, both cooked and uncooked. Alcohol yields from cooked and liquefied starch by bacterial ..cap alpha..-amylase were 93.9% for corn, 92.0% for cassava, 90.6% for potato, and 73.0% for babassu, whereas alcohol yields from raw starch were 90.0% for corn, 89.0% for cassava, 48.9% for babassu, and 11.4% for potato. (JMT)

Park, Y.K.; Rivera, B.C.



Determination of total dietary fiber and resistant starch in processed corn and rice products  

E-Print Network [OSTI]

), and probably, Maillard reaction products. Values of TDF for rice products decreased up to 50% during milling, but remained unchanged with parboiling. Formation of RS around 1% in corn was found when consecutive heat treatments were applied (alkaline... starch" (RS) was first used by Englyst and Cummings in 1982 to describe starch that was resistant to pancreatic amylase. During heat treatments (boiling or baking), intermolecular hydrogen bonds between the starch granules are formed (crystallization...

Corujo Martinez, Juan Ignacio



Simultaneous saccharification of cassava starch and fermentation of algae for biodiesel production  

Science Journals Connector (OSTI)

A simpler approach to produce biodiesel from cassava starch was established, which successfully integrates the simultaneous saccharification and heterotrophic algal fermentation in an identical system. Batch e...

Yue Lu; Yi Ding; Qingyu Wu



Effect of repeated retrogradation on structural characteristics and in vitro digestibility of waxy potato starch  

Science Journals Connector (OSTI)

Abstract The effects of repeated retrogradation (RR) treatment on the structural characteristics and in vitro digestibility of waxy potato starch were investigated. The cycling times of RR ranging from 1 to 5 were designated as RR-1, RR-2, RR-3, RR-4, and RR-5, respectively. A maximum SDS content (40.41%) was obtained by RR-2 treatment with the time interval of 48 h. RR-2-treated starch product exhibited a narrower melting temperature range, a higher onset temperature and a lower melting enthalpy compared with RR-1 treatment. Compared with native starch, X-ray diffraction patterns of treated starches were altered from B-type to C-type. The variation in relative crystallinity of RR-treated starch products was consistent with that in melting enthalpy. Moreover, compared with RR-1-treated starch, a large number of cavities were observed on the surface of RR-2-treated starch product with a time interval of 48 h, whereas more smooth regions were found on the surface of RR-5-treated starch product. This study suggested that structural changes of waxy potato starch treated with different cycling times of RR significantly affected the digestibility.

Yao-Yu Xie; Xiao-Pei Hu; Zheng-Yu Jin; Xue-Ming Xu; Han-Qing Chen



Thermal Properties of Starch From New Corn Lines as Impacted by Environment and During Line Development  

SciTech Connect (OSTI)

The objectives of this research were to further characterize exotic by adapted corn inbreds by studying the impact of environment on their starch thermal properties, and investigating the development of starch thermal properties during kernel maturation by using differential scanning calorimetry (DSC). A method to expedite identification of unusual starch thermal traits was investigated by examining five corn kernels at a time, instead of one kernel, which the previous screening methods used. Corn lines with known thermal functions were blended with background starch (control) in ratios of unique starch to control starch, and analyzed by using DSC. Control starch was representative of typical corn starch. The values for each ratio within a mutant type were unique ({alpha} < 0.01) for most DSC measurements. These results supported the five-kernel method for rapidly screening large amounts of corn germplasm to identify unusual starch traits. The effects of 5 growing locations on starch thermal properties from exotic by adapted corn and Corn Belt lines were studied using DSC. The warmest location, Missouri, generally produced starch with greater gelatinization onset temperature (T{sub oG}), narrower range of gelatinization (R{sub G}), and greater enthalpy of gelatinization ({Delta}H{sub G}). The coolest location, Illinois, generally resulted in starch with lower T{sub oG}, wider R{sub G}, and lower {Delta}H{sub G}. Starch from the Ames 1 farm had thermal properties similar to those of Illinois, whereas starch from the Ames 2 farm had thermal properties similar to those of Missouri. The temperature at Ames 2 may have been warmer since it was located near a river; however, soil type and quality also were different. Final corn starch structure and function change during development and maturity. Thus, the changes in starch thermal properties during 5 stages of endosperm development from exotic by adapted corn and Corn Belt lines at two locations were studied by using DSC. The T{sub oG} tended to decrease during maturation of the kernel, whereas the {Delta}H{sub G} tended not to change. Retrogradation parameters did not vary greatly among days after pollination (DAP) and between locations. Genotypes were affected differently by environments and significant interactions were found between genotype, environment,and DAP.

Elizabeth M. Lenihan



Comparative Methodologies for Measuring Metabolizable Energy of Various Types of Resistant High Amylose Corn Starch  

Science Journals Connector (OSTI)

Comparative Methodologies for Measuring Metabolizable Energy of Various Types of Resistant High Amylose Corn Starch ... BACKGROUND: Knowledge of energetic availability of dietary fibres is important for human nutrition. ...

Richard T. Tulley; Marko J. Appel; Tanya G. Enos; Maren Hegsted; Kathleen L. McCutcheon; Jun Zhou; Anne M. Raggio; Roger Jeffcoat; Anne Birkett; Roy J. Martin; Michael J. Keenan



Correlated changes in structure and viscosity during gelatinization and gelation of tapioca starch granules  

Science Journals Connector (OSTI)

Melting of the semicrystalline structure of native tapioca starch granules is correlated to solution viscosity for elucidating gelatinization and gelation processes.

Huang, H.-K.



Application of hazard analysis (HACCP) in starch production by the wet milling of maize.  

E-Print Network [OSTI]

??This study is based on the Hazard Analysis in the Wet Milling of maize for the production of starch at the Bellville plant of African… (more)

Samuels, R. C.



Theory of Grain Boundary Diffusion  

Science Journals Connector (OSTI)

The previously proposed dependence of the structure of grain boundaries upon the angle of disorientation of the two grains is used as a basis of a quantitative consideration of diffusion along grain boundaries and in particular of the apparent activation energies. At small angles in the dislocation range the diffusion is controlled by volume diffusion mechanism. At high angles near 45° the model of a uniform grain boundary is applicable. In the intermediate range an array of rod-like areas of distorted lattice leads to low or even negative apparent activation energies. The theory is in good agreement with experiment.

R. Smoluchowski



Essays on Macroeconomics and Oil  

E-Print Network [OSTI]

Oil Production . . . . . . . . . . . . . . . . . . . . . . . . . . .Oil Production in Venezuela and Mexico . . . . . . . . . .Oil Production and Productivity in Venezuela and




Essays on Macroeconomics and Oil  

E-Print Network [OSTI]

the Oil Industry . . . . . . . . . . . . . . . . . . . . . .in the Venezuelan Oil Industry . . . . . . . . . . . . .and Productivity: Evidence from the Oil Industry . .



Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fourier Transform Infrared (FT-IR) Microspectroscopic Census of Single Starch Granules for Octenyl Succinate Ester Modification  

Science Journals Connector (OSTI)

Fourier transform infrared (FT-IR) microspectroscopy was used to investigate reaction homogeneity of octenyl succinic anhydride modification on waxy maize starch and detect uniformity of blends of modified and native starches. For the first time, the ...

Yanjie Bai; Yong-Cheng Shi; David L. Wetzel



Upper Mission Canyon coated-grain producing facies in Williston basin  

SciTech Connect (OSTI)

The upper Mission Canyon formation, along the northeastern flank of the Williston basin, is a regressive carbonate and evaporite sequence, which has been informally divided into log-defined intervals. Oil production locally occurs at the transition from anhydrite to carbonate for each of the regressive intervals. These carbonate shoreline reservoirs are limestones dominated by coated grains. Porosity is intergranular and vuggy, and production from these reservoirs locally exceeds 400,000 bbl of oil/well. Upper Mission Canyon beds are also productive in island-shoal reservoirs, which developed basinward of of shorelines. These limestone reservoirs are also dominated by coated grains and porosity is intergranular and vuggy. Oil production from these reservoirs is variable, but wells within the Sherwood field along the US-Canadian border have produced over 2.0 MMbbl of oil/well.

Hendricks, M.L. (Hendricks and Associates, Inc., Denver, CO (USA))



When incubated with PPA, the strands of spaghetti were solubilized and the starch  

E-Print Network [OSTI]

the pathway for the alpha-amylase to access starch. Pre-incu- bation with pepsin released starch concluded that the protein network does not constitute a complete physical bar- rier to alpha-amylase increased after 1 h of alpha-amylolysis (+ 10% at 24 h) due to the presence of contaminating proteases which

Paris-Sud XI, Université de


OIL IMPORTS: For and Against  

Science Journals Connector (OSTI)

OIL IMPORTS: For and Against ... The eight—Ashland Oil, Atlantic Richfield, Cities Service, Marathon Oil, Mobil Oil, Standard Oil (Ind.), ...



Design of an optimal process for enhanced production of bioethanol and biodiesel from algae oil via glycerol fermentation  

Science Journals Connector (OSTI)

Abstract In this paper, we optimize a process that integrates the use of glycerol to produce ethanol via fermentation within the simultaneous production of biodiesel and bioethanol from algae. The process consists of growing the algae, determining the optimal fraction of oil vs. starch, followed by oil extraction, starch liquefaction and saccharification, to sugars, oil transesterification, for which we consider two transesterification technologies (enzymes and alkali) and the fermentation of sugars and glycerol. The advantage of this process is that the dehydration technologies are common for the products of the glucose and glycerol fermentation. Simultaneous optimization and heat integration is performed using Duran and Grossmann’s model. The fermentation of glycerol to ethanol increases the production of bioethanol by at least 50%. The energy and water consumptions are competitive with other processes that either sell the glycerol or use it to obtain methanol. However, the price for the biofuels is only competitive if glycerol cannot be sold to the market.

Mariano Martín; Ignacio E. Grossmann



Alfvénic waves and alignment of large grains  

Science Journals Connector (OSTI)

The alignment of grains under the influence of the Alfvenic waves is discussed. It is shown that even small deviations from grain uniformity result in the alignment of large (l > 6?10?5 cm) grains. The latter res...

A. Lazarian



Bioconversion of Heavy oil.  

E-Print Network [OSTI]

??70 % of world?s oil reservoirs consist of heavy oil, and as the supply of conventional oil decreases, researchers are searching for new technologies to… (more)

Steinbakk, Sandra



5 World Oil Trends WORLD OIL TRENDS  

E-Print Network [OSTI]

5 World Oil Trends Chapter 1 WORLD OIL TRENDS INTRODUCTION In considering the outlook for California's petroleum supplies, it is important to give attention to expecta- tions of what the world oil market. Will world oil demand increase and, if so, by how much? How will world oil prices be affected


Dense, finely, grained composite materials  

DOE Patents [OSTI]

Dense, finely grained composite materials comprising one or more ceramic phase or phase and one or more metallic and/or intermetallic phase or phases are produced by combustion synthesis. Spherical ceramic grains are homogeneously dispersed within the matrix. Methods are provided, which include the step of applying mechanical pressure during or immediately after ignition, by which the microstructures in the resulting composites can be controllably selected.

Dunmead, Stephen D. (Davis, CA); Holt, Joseph B. (San Jose, CA); Kingman, Donald D. (Danville, CA); Munir, Zuhair A. (Davis, CA)



Middle Path Coarse Grain Parallelization  

E-Print Network [OSTI]

Backend OpenMP Fortran OpenMP Backend MPI Fortran MPI Backend ½ �� � BPA RB SB Program Near fine grain layer 3rd layer Near fine grain parallelism in loop body BPA RB SB BPA RB SB BPA RB SB BPA RB SB BPA RB SB BPA RB SB ¾ ¾º½º½ � � Á � � � ¾ Data Dependency Extended Contorol Dependency Conditional Branch

Kasahara, Hironori


Carbohydrate-Binding Module–Cyclodextrin Glycosyltransferase Fusion Enables Efficient Synthesis of 2-O-d-Glucopyranosyl-l-Ascorbic Acid with Soluble Starch as the Glycosyl Donor  

Science Journals Connector (OSTI)

...Engineering Laboratory for Cereal Fermentation Technology...AA-2G) from soluble starch by fusing a carbohydrate-binding...starch or glycogen metabolism. CBM20 members with affinity for starch are commonly referred...overnight. Then the seed culture was inoculated...l-AA and soluble starch), the final concentration...

Ruizhi Han; Jianghua Li; Hyun-Dong Shin; Rachel R. Chen; Guocheng Du; Long Liu; Jian Chen



of oil yields from enhanced oil recovery  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

oil yields from enhanced oil recovery (EOR) and CO oil yields from enhanced oil recovery (EOR) and CO 2 storage capacity in depleted oil reservoirs. The primary goal of the project is to demonstrate that remaining oil can be economically produced using CO 2 -EOR technology in untested areas of the United States. The Citronelle Field appears to be an ideal site for concurrent CO 2 storage and EOR because the field is composed of sandstone reservoirs



Science Journals Connector (OSTI)

...Carbides 19 AMiseellaneous volatile oils 20 Heavy benzine and pate-it...2:1 Lubricants of fats and oils 22 Beef and mutton tallow 23...synthetically and make it cheap, as the price of glycerin was getting to be...grain alcohol, vinegar, olive oil,castor oil, whale oil, starch...

Bernhard C. Hesse



Hydrotreating of oil from eastern oil shale  

SciTech Connect (OSTI)

Oil shale provides one of the major fossil energy reserves for the United States. The quantity of reserves in oil shale is less than the quantity in coal, but is much greater (by at least an order of magnitude) than the quantity of crude oil reserves. With so much oil potentially available from oil shale, efforts have been made to develop techniques for its utilization. In these efforts, hydrotreating has proved to be an acceptable technique for upgrading raw shale oil to make usuable products. The present work demonstrated the use of the hydrotreating technique for upgrading an oil from Indiana New Albany oil shale.

Scinta, J.; Garner, J.W.



Digestibility of Sugar, Starches, and Pentosans of Roughages.  

E-Print Network [OSTI]

gms. No. 3649-50. ..................... Eaten ........................................ Excreted 1491 gms. No. 3700.. .................. Sugars Mono. 55.8 2.6 53.2 1.5 51.7 97.2 97.5 F8.0 28.0 Starch. 212.4 10.0 202.4 6.7 195.7 96.6... 95.9 35.2 35.2 Di. 54.0 .3 -- 53.7 .7 53.5 99.6 99.7 12.8 12.8 .1 99.2 99.2 33.6 0 33.6 1.1 32.5 96.7 1.2 ................................. Digested. Reduc- ing sugar from hemi- cellulose. 111.2 5.2 106.0 48.8 57...

Fraps, G. S. (George Stronach)



Near Shore Submerged Oil Assessment  

E-Print Network [OSTI]

) oil spill in the Gulf of Mexico, submerged oil refers to near shore oil which has picked up sediments You Should Know About Submerged Oil 1. Submerged oil is relatively uncommon: DWH oil is a light crude


Adaptation to a Starch Environment and Regulation of alpha-Amylase in Drosophila  

Science Journals Connector (OSTI)

The adaptation to glucose and starch foods insix species, D. melanogaster, D.virilis, D. saltans, D. funebris,D. levanonensis and D. americana, wasstudied by measuring productivity. D.melanogaster and D. virilis ...

Junichi Fujimoto; Chie Kanou; Yozo Eguchi; Yoshinori Matsuo


Alpha-amylase assay with dyed-starch in polyethylene glycol and dextran solutions  

Science Journals Connector (OSTI)

The ?-amylase assay method with RBB-starch was shown to work well in the presence of polyethylene glycol and dextran, polymers commonly used in aqueous two-phase systems. Neither the polymer type, polymer conc...

Kyung Moon Park; Nam Sun Wang


Screening for and Identification of Starch-, Amylopectin-, and Pullulan-Degrading Activities in Bifidobacterial Strains  

Science Journals Connector (OSTI)

...oligosaccharides in soy by alpha-d-galactosidase...vitro utilization of amylopectin and high-amylose maize (Amylomaize...identification of starch-, amylopectin-, and pullulan-degrading...were screened for alpha-amylase and/or pullulanase...

Sinéad M. Ryan; Gerald F. Fitzgerald; Douwe van Sinderen



Regulation of starch accumulation by granule-associated plant 14-3-3 proteins  

Science Journals Connector (OSTI)

...involved in producing amylose, an {alpha}(1–4) glucan...in the synthesis of amylopectin, an {alpha}(1–6) branched...found together with amylose to form starch granules...catabolic enzymes such as amylase, {alpha}-glucosidase...

Paul C. Sehnke; Hwa-Jee Chung; Ke Wu; Robert J. Ferl


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


OIl Speculation  

Gasoline and Diesel Fuel Update (EIA)

Investor Investor Flows and the 2008 Boom/Bust in Oil Prices Kenneth J. Singleton 1 August 10, 2011 1 Graduate School of Business, Stanford University, kenneths@stanford.edu. This research is the outgrowth of a survey paper I prepared for the Air Transport Association of America. I am grateful to Kristoffer Laursen for research assistance and to Kristoffer and Stefan Nagel for their comments. Abstract This paper explores the impact of investor flows and financial market conditions on returns in crude-oil futures markets. I begin by arguing that informational frictions and the associated speculative activity may induce prices to drift away from "fundamental" values and show increased volatility. This is followed by a discussion of the interplay between imperfect infor- mation about real economic activity, including supply, demand, and inventory accumulation, and speculative


Wave propagation, stress relaxation, and grain-to-grain shearing in saturated, unconsolidated marine sediments  

E-Print Network [OSTI]

Wave propagation, stress relaxation, and grain-to-grain shearing in saturated, unconsolidated in saturated, unconsolidated granular materials, including marine sediments, is developed in this article

Buckingham, Michael


The use of starch matrices in slow release fungicide formulations and their efficacy in controlling Phymatotrichum omnivorum on cotton  

E-Print Network [OSTI]

P. omnivorum 23 First Experiment ? In Vitro Analysis of Hyphal Inhibition. Second Experiment - In Vitro Analysis of Inhib1tion of Sclerotial Germination. . . . . 23 24 Evaluation of the Release of Propiconazole from the Starch Matrices under... pesticide. . . . . . . . . . . . 14 Growth of Ph matotr1chum omnivorum hyphae on potato dextrose agar amended w1th decanted incubation water of slow release starch matrices with entrapped propiconazo le. . . . . . . . 46 Ouench curves for three starch...

Small, Theresa Marie



Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

derived from grain starch, oil seed, animal fat, or other biomass, or produced from a biogas source. GVWR Credit Less than 10,000 pounds (lbs.) Up to 2,400 10,000 to 26,000 lbs....


Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

derived from grain starch, oil seed, animal fat, or other biomass, or produced from a biogas source. Excess credits may be carried over for up to three years after the year in...


A comparison of the performance of waterfloods using similar refined and crude oils  

E-Print Network [OSTI]

of Brine-Oil Interfacial Tension with Saturation Pressure at 100 F. . . . . . 20 Effect of Reservo ir Pressure on Reservoir Gas Saturation . 21 Effect of Initial Gas Saturation on Residual Oil Satu rat iona afte r Ea ch P roduction Phase 22 Effect... of Initial Gas Saturation on Percent Recovery after Ea. ch Production Phase 25 Effect of Initial Gas Saturation on Residual Oil Saturations at Stock Tank Conditions after Each Production Phase . TABLES 1. Sand Grain Analysis 34 Effect of Saturation...

Walton, Daylon Lynn



China's Global Oil Strategy  

E-Print Network [OSTI]

capability to secure oil transport security. Additionally,international oil agreements: 1) ensuring energy security;security, and many argue that as the second-largest consumer of oil

Thomas, Bryan G



Understanding Crude Oil Prices  

E-Print Network [OSTI]

2007”. comparison, Mexico used 6.6— Chinese oil consumption17. Oil production from the North Sea, Mexico’s Cantarell,Mexico, Italy, France, Canada, US, and UK. Figure 10. Historical Chinese oil

Hamilton, James Douglas



Understanding Crude Oil Prices  

E-Print Network [OSTI]

2004. “OPEC’s Optimal Crude Oil Price,” Energy Policy 32(2),023 Understanding Crude Oil Prices James D. Hamilton Junedirectly. Understanding Crude Oil Prices* James D. Hamilton

Hamilton, James Douglas



Understanding Crude Oil Prices  

E-Print Network [OSTI]

business of having some oil in inventory, which is referredKnowledge of all the oil going into inventory today for salebe empty, because inventories of oil are essential for the

Hamilton, James Douglas



Understanding Crude Oil Prices  

E-Print Network [OSTI]

2004. “OPEC’s Optimal Crude Oil Price,” Energy Policy 32(2),percent change in real oil price. Figure 3. Price of crude023 Understanding Crude Oil Prices James D. Hamilton June

Hamilton, James Douglas



Understanding Crude Oil Prices  

E-Print Network [OSTI]

2004. “OPEC’s Optimal Crude Oil Price,” Energy Policy 32(2),percent change in real oil price. Figure 3. Price of crudein predicting quarterly real oil price change. variable real

Hamilton, James Douglas



China's Global Oil Strategy  

E-Print Network [OSTI]

by this point, China’s demand Oil Demand vs. Domestic Supplycurrent pace of growth in oil demand as staying consistentand predictions of oil supply and demand affected foreign

Thomas, Bryan G



Understanding Crude Oil Prices  

E-Print Network [OSTI]

and Income on Energy and Oil Demand,” Energy Journal 23(1),2006. “China’s Growing Demand for Oil and Its Impact on U.S.in the supply or demand for oil itself could be regarded as

Hamilton, James Douglas



Golden Grain Energy LLC | Open Energy Information  

Open Energy Info (EERE)

search Name: Golden Grain Energy LLC Place: Mason City, Iowa Zip: 50401 Product: Ethanol producer. References: Golden Grain Energy LLC1 This article is a stub. You can help...


Understanding Crude Oil Prices  

E-Print Network [OSTI]

2007”. comparison, Mexico used 6.6— Chinese oil consumption17. Oil production from the North Sea, Mexico’s Cantarell,

Hamilton, James Douglas



Desulfurization of heavy oil  

Science Journals Connector (OSTI)

Strategies for heavy oil desulfurization were evaluated by reviewing desulfurization literature and critically assessing the viability of the various methods for heavy oil. The desulfurization methods includin...

Rashad Javadli; Arno de Klerk



China's Global Oil Strategy  

E-Print Network [OSTI]

China’s domestic oil supply will peak, and demand Robertpeak will come around 2020, 24 and that by this point, China’s demand Oil

Thomas, Bryan G



Tall oil pitch  

Science Journals Connector (OSTI)

n....Undistilled residue from the distillation of crude tall oil. It is generally recognized that tall oil pitches contain some high-boiling esters and neutral...



China's Global Oil Strategy  

E-Print Network [OSTI]

Analysts agree that the Persian Gulf region will continue tos oil imports. 17 The Persian Gulf region is particularlyaccess to oil from the Persian Gulf because of conflict

Thomas, Bryan G


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

(dollars) (dollars) (dollars) (dollars) Table 1. Consumption and Expenditures in U.S. Households that Use Fuel OilKerosene, 1990 Residential Buildings Average Fuel Oil...


Oil Sands Feedstocks  

Broader source: Energy.gov (indexed) [DOE]

Centre for Upgrading Technology 'a Canada-Alberta alliance for bitumen and heavy oil research' Oil Sands Feedstocks C Fairbridge, Z Ring, Y Briker, D Hager National Centre...


Crude Oil Domestic Production  

U.S. Energy Information Administration (EIA) Indexed Site

Data Series: Crude Oil Domestic Production Refinery Crude Oil Inputs Refinery Gross Inputs Refinery Operable Capacity (Calendar Day) Refinery Percent Operable Utilization Net...


Grain boundary loops in graphene  

Science Journals Connector (OSTI)

Topological defects can affect the physical properties of graphene in unexpected ways. Harnessing their influence may lead to enhanced control of both material strength and electrical properties. Here we present a class of topological defects in graphene composed of a rotating sequence of dislocations that close on themselves, forming grain boundary loops that either conserve the number of atoms in the hexagonal lattice or accommodate vacancy or interstitial reconstruction, while leaving no unsatisfied bonds. One grain boundary loop is observed as a “flower” pattern in scanning tunneling microscopy studies of epitaxial graphene grown on SiC(0001). We show that the flower defect has the lowest energy per dislocation core of any known topological defect in graphene, providing a natural explanation for its growth via the coalescence of mobile dislocations.

Eric Cockayne; Gregory M. Rutter; Nathan P. Guisinger; Jason N. Crain; Phillip N. First; Joseph A. Stroscio



Gene Discovery and Product Development for Grain Quality Traits  

Science Journals Connector (OSTI)

...Soybean seeds with altered ratios of seed storage proteins...a number of starches have been created...production in cereals such as wheat...altered ratios of seed storage proteins...a number of starches have been created...production in cereals such as wheat...

Barbara Mazur; Enno Krebbers; Scott Tingey



Biochemically enhanced oil recovery and oil treatment  

DOE Patents [OSTI]

This invention relates to the preparation of new, modified organisms, through challenge growth processes, that are viable in the extreme temperature, pressure and pH conditions and salt concentrations of an oil reservoir and that are suitable for use in microbial enhanced oil recovery. The modified microorganisms of the present invention are used to enhance oil recovery and remove sulfur compounds and metals from the crude oil. 62 figures.

Premuzic, E.T.; Lin, M.



Biochemically enhanced oil recovery and oil treatment  

DOE Patents [OSTI]

This invention relates to the preparation of new, modified organisms, through challenge growth processes, that are viable in the extreme temperature, pressure and pH conditions and salt concentrations of an oil reservoir and that are suitable for use in microbial enhanced oil recovery. The modified microorganisms of the present invention are used to enhance oil recovery and remove sulfur compounds and metals from the crude oil.

Premuzic, Eugene T. (East Moriches, NY); Lin, Mow (Rocky Point, NY)



Expectations for Oil Shale Production (released in AEO2009)  

Reports and Publications (EIA)

Oil shales are fine-grained sedimentary rocks that contain relatively large amounts of kerogen, which can be converted into liquid and gaseous hydrocarbons (petroleum liquids, natural gas liquids, and methane) by heating the rock, usually in the absence of oxygen, to 650 to 700 degrees Fahrenheit (in situ retorting) or 900 to 950 degrees Fahrenheit (surface retorting). (Oil shale is, strictly speaking, a misnomer in that the rock is not necessarily a shale and contains no crude oil.) The richest U.S. oil shale deposits are located in Northwest Colorado, Northeast Utah, and Southwest Wyoming. Currently, those deposits are the focus of petroleum industry research and potential future production. Among the three states, the richest oil shale deposits are on federal lands in northwest Colorado.



Charging of Dust Grains in a Plasma  

Science Journals Connector (OSTI)

Charging of micron-sized dust grains in a plasma has been investigated experimentally. Dust grains were dispersed into a fully ionized, steady-state, magnetized plasma column consisting of electrons and K+ ions, both at a temperature of ?0.2 eV. Langmuir probe measurements were used to determine how the negative charge in the plasma is divided between free electrons and dust grains. By varying the ratio d?D between the intergrain spacing and the plasma Debye length, the predicted reduction in the grain charge for the case of "closely packed" grains d?D<1 has been demonstrated experimentally.

A. Barkan; N. D'Angelo; R. L. Merlino



Physical properties of soils contaminated by oil lakes, Kuwait  

SciTech Connect (OSTI)

In preparation for a marine assault by the coalition forces, the Iraqi Army heavily mined Kuwait`s coastal zone and the oil fields. Over a million mines were placed on the Kuwait soil. Burning of 732 oil wells in the State of Kuwait due to the Iraqi invasion caused damages which had direct and indirect effect on environment. A total of 20-22 million barrels of spilled crude oil were collected in natural desert depressions and drainage network which formed more than 300 oil lakes. The total area covered with oil reached 49 km{sup 2}. More than 375 trenches revealed the existence of hard, massive caliche (CaCO{sub 3}) subsoil which prevent leached oil from reaching deeper horizons, and limited the maximum depth of penetration to 1.75 m. Total volume of soil contaminated reached 22,652,500 m{sup 3} is still causing environmental problems and needs an urgent cleaning and rehabilitation. Kuwait Oil Company has recovered approximately 21 million barrels from the oil lakes since the liberation of Kuwait. In our examined representative soil profiles the oil penetration was not deeper than 45 cm. Infiltration rate, soil permeability, grain size distribution, aggregates formation and water holding capacity were assessed. 15 refs., 5 figs., 5 tabs.

Mohammad, A.S. [Kuwait Univ., Safat (Kuwait); Wahba, S.A.; Al-Khatieb, S.O. [Arabian Gulf Univ. (Bahrain)



Ships After Oil  

Science Journals Connector (OSTI)

Ships After Oil ... Special self-propelled tenders planned for offshore drilling operations in Gulf ...



OIL & GAS INSTITUTE Introduction  

E-Print Network [OSTI]

OIL & GAS INSTITUTE CONTENTS Introduction Asset Integrity Underpinning Capabilities 2 4 4 6 8 9 10 COMPETITIVENESS UNIVERSITY of STRATHCLYDE OIL & GAS INSTITUTE OIL & GAS EXPERTISE AND PARTNERSHIPS #12;1 The launch of the Strathclyde Oil & Gas Institute represents an important step forward for the University

Mottram, Nigel


Role of Streptococcus gordoniiAmylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation  

Science Journals Connector (OSTI)

...that both AbpA and amylase are required for maximal...defined media with potato starch as the predominant...wild-type strains on starch in the absence of amylase also suggests that...cooperation necessary to break down salivary glycoproteins...

Jeffrey D. Rogers; Robert J. Palmer Jr.; Paul E. Kolenbrander; Frank A. Scannapieco



Kinetics of enzymatic starch liquefaction: simulation of the high molecular weight product distribution  

SciTech Connect (OSTI)

Enzymatic corn starch liquefaction with alpha-amylase was carried out. Molecular weight distributions of the resulting hydrolysates are presented using aqueous size exclusion chromatographic techniques. It is demonstrated that despite the fact that the enzyme employed reacts in a random endoacting manner, the product distributions are nonrandom. The results are explained in part by a multimerization process whereby the polymeric substrate molecules preferentially associate, forming intermolecular aggregates. These aggregates are either a consequence of the manner in which the material is deposited into the native granular structure of starch or due to intrinsic physical chemical properties of the polysaccharide. In the latter case, the results are shown to correspond to known multimerized amylose, although complete characterization of the polysaccharide is currently not available. The results presented are used to develop a simplified kinetic model of starch liquefaction and shown to simulate the product distributions accurately. 44 references.

Rollings, J.E.; Thompson, R.W.



Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch  

SciTech Connect (OSTI)

Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

Fujii, M.; Kawamura, Y.



Oil | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Oil Oil Oil Oil Prices, 2000-2008 For the first time since 1995, U.S. oil production has surpassed imports. Explore the trend with our interactive chart. | Graphic by Daniel Wood, Energy Department. For the first time since 1995, U.S. oil production has surpassed imports. Explore the trend with our interactive chart. | Graphic by Daniel Wood, Energy Department. Oil is used for heating and transportation -- most notably, as fuel for gas-powered vehicles. America's dependence on foreign oil has declined in recent years, but oil prices have increased. The Energy Department supports research and policy options to increase our domestic supply of oil while ensuring environmentally sustainable supplies domestically and abroad, and is investing in research, technology and


Oil Dependencies and Peak Oil's Effects on Oil Consumption.  

E-Print Network [OSTI]

?? During the year of 2007, the world has experienced historically high oil prices both in nominal and in real terms, which has reopened discussions… (more)

Tekin, Josef



Turbine cooling waxy oil  

SciTech Connect (OSTI)

A process for pipelining a waxy oil to essentially eliminate deposition of wax on the pipeline wall is described comprising: providing a pressurized mixture of the waxy oil and a gas; effecting a sudden pressure drop of the mixture of the oil and the gas through an expansion turbine, thereby expanding the gas and quickly cooling the oil to below its cloud point in the substantial absence of wax deposition and forming a slurry of wax particles and oil; and pipelining the slurry.

Geer, J.S.



Characterisation of ‘Hadley’ grains by confocal microscopy  

Science Journals Connector (OSTI)

This work forms part of an exploratory study to investigate the use of fluorescent laser scanning confocal microscopy (LSCM) for imaging pores and voids in hardened mortar and concrete. The study has revealed the suitability of the technique for the characterisation of hollow shell (Hadley) hydration grains (these are grains that contain a void within the original boundary of the cement grain). It was found that Hadley grains could be imaged using fluorescent light techniques, subsequent to their impregnation by epoxy resin doped with a fluorescent dye. Prior to this work, it was not clear whether hollow grains were impregnated due to connections with capillary pores, or if they had been impregnated due to connections with damage caused during surface preparation (i.e. micro-cracks or deep surface scratches). However using the 3D LSCM imaging technique it was observed that connections between Hadley grains and hardened cement paste (HCP) capillary pores did exist, in different forms, at depths well below the surface providing ‘conduits’ along which resin was able to flow and impregnate the hollow grains. Other aspects of imaging Hadley grains are also described, such as the sectioning of ‘tips’ of larger grains often taken as separate smaller pores or grains in 2D images.

M.K. Head; H.S. Wong; N.R. Buenfeld



Modulated Release of a Volatile Compound from Starch Matrixes via Enzymatically Controlled Degradation  

Science Journals Connector (OSTI)

The activity of the liquid enzyme formulation (protein content was 38 mg/mL) was 120 KNU/g of enzyme formulation (1 Kilo Novo alpha-amylase Unit, KNU, activity unit is the amount of enzyme which breaks down 5.26 g of starch/h at 37 °C to dextrins and oligosaccharides at pH 5.6 (as given in the Termamyl product data sheet by Novo Nordisk). ... Although the amount of water was minimized, ?-amylase started to break down the matrix during the encapsulation process. ... (GCWS) starches (waxy maize, normal maize, Hylon-5, and Hylon-7; amylose content <1, 28, 54, and 68%, resp.) ...

Gülden Y?lmaz; Gaye Öngen; Remy O. J. Jongboom; Herman Feil; Cees van Dijk; Wim E. Hennink


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2013 Survey of Non-Starch Ethanol and Renewable Hydrocarbon Biofuels Producers  

SciTech Connect (OSTI)

In order to understand the status of the industry for non-starch ethanol and renewable hydrocarbon biofuels as of the end of calendar year 2013, the National Renewable Energy Laboratory (NREL) conducted the first of what is anticipated to be an annual survey of U.S. non-starch ethanol and renewable hydrocarbon biofuels producers. This report presents the results of this initial survey and describes the survey methodology. Subsequent surveys will report on the progress over time of the development of these facilities and companies.

Schwab, A.; Geiger, J.; Lewis, J.



The effects of storage on starch characteristics and chip quality of Texas Irish potatoes  

E-Print Network [OSTI]

THE EFFECTS OF STORAGE QN STARCH CHARACTERISTICS AND CHIP QUALITY OF TEXAS IRISH POTATOES A Thesis Roy Eric McDonald Submitted to the Graduate College of' the Te~s AEcM University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May& 1966 Major Subject: Horticulture THE EFFECTS OF STORAGE ON STARCH CHARACTERISTICS AND CHIP QUALITY OF TEXAS IRISH POTATOES A Thesis by Roy Eric McDonald Approved as to style and content by: (Chairman oi' ttee) (Heag...

McDonald, Roy E



Characterization of Irradiated Starches by Using FT-Raman and FTIR Spectroscopy  

Science Journals Connector (OSTI)

Degradation of starch polymers resulting in decreased viscosity and increased water solubility, and increased acidity with increasing radiation doses are potential changes observed in irradiated starches. ... FT-Raman spectra were obtained using a Nicolet 870 spectrometer with the Raman module 32B (Madison, WI) and Nd:YAG laser operating at 1064 nm with a maximum power of 2 W. The system was equipped with an InGaAs (Indium?Gallium Arsenide) detector, XT-KBr beam-splitter with 180° reflective optics, and a fully motorized sample position adjustment feature. ...

Ramazan Kizil; Joseph Irudayaraj; Koushik Seetharaman



Seed Lipids  

Science Journals Connector (OSTI)

...of corn processed for starch makes sizable quantities...for marketing. Legume seeds are usually rich in protein...many also contain either starch or galactomannan polysaccha-rides...on the average legume seeds are, like cereal grains, low in oil content...

Ivan A. Wolff



Essays on Macroeconomics and Oil  

E-Print Network [OSTI]

Oil Production in Venezuela and Mexico . . . . . . . . . .Venezuela with Mexico, another major oil pro- ducing countryOil Production and Productivity in Venezuela and Mexico . . . . . . . .




Essays on Macroeconomics and Oil  

E-Print Network [OSTI]

Oil Production in Venezuela and Mexico . . . . . . . . . .Oil Production and Productivity in Venezuela and Mexico . . . . . . . .2.6: Oil Production in Venezuela and Mexico 350 Productivity





E-Print Network [OSTI]

??An oil-life algorithm to calculate the remaining percentage of oil life is presented as a means to determine the right time to change the oil… (more)

Bommareddi, Anveshan



Economics of Peak Oil  

Science Journals Connector (OSTI)

Abstract ‘Peak oil’ refers to the future decline in world production of crude oil and the accompanying potentially calamitous effects. The peak oil literature typically rejects economic analysis. This article argues that economic analysis is indeed appropriate for analyzing oil scarcity because standard economic models can replicate the observed peaks in oil production. Moreover, the emphasis on peak oil is misplaced as peaking is not a good indicator of scarcity, peak oil techniques are overly simplistic, the catastrophes predicted by the peak oil literature are unlikely, and the literature does not contribute to correcting identified market failures. Efficiency of oil markets could be improved by instead focusing on remedying market failures such as excessive private discount rates, environmental externalities, market power, insufficient innovation incentives, incomplete futures markets, and insecure property rights.

S.P. Holland



Two pairing parameters in superconducting grains  

Science Journals Connector (OSTI)

Unlike bulk superconductivity, where one energy scale, the energy gap, characterizes pairing correlations, we show that in small superconducting grains there exist two different such quantities. The first characterizes collective properties of the grain, such as the condensation energy, and the second single-particle properties. To describe these two energy scales, we define two corresponding pairing parameters, and show that although both reduce to the bulk gap for large grains, this occurs at different size scales.

M. Schechter; J. von Delft; Y. Imry; Y. Levinson



Novel Bioplastics and biocomposites from Vegetable Oils  

SciTech Connect (OSTI)

Polymeric materials have been prevalent in our everyday lives for quite a long time. Most of today's polymeric materials are derived from nonrenewable petroleum-based feedstocks. Instabilities in the regions where petroleum is drilled, along with an increased demand in petroleum, have driven the price of crude oil to record high prices. This, in effect, increases the price of petroleum-based polymeric materials, which has caused a heightened awareness of renewable alternatives for polymeric feedstocks. Cellulose, starch, proteins and natural oils have all been examined as possible polymeric feedstocks. Natural oils are commercially available on a large scale and are relatively cheap. It is projected that the U.S. alone will produce 21 billion pounds of soybean oil in the period 2008/2009. Natural oils also have the advantages of inherent biodegradability, low toxicity, high purity and ready availability. Most natural oils possess a triglyceride structure as shown in Figure 1. Most natural oils have a unique distribution of fatty acid side chains, along with varying degrees of unsaturation per triglyceride. Common fatty acid side chains in naturally occurring oils are palmitic acid (C16:0), a 16 carbon fatty acid with no unsaturation; stearic acid (C18:0), an 18 carbon fatty acid with no unsaturation; oleic acid (C18:1), an 18 carbon fatty acid with one double bond; linoleic acid (C18:2), an 18 carbon fatty acid with two double bonds; and linolenic acid (C18:3), an 18 carbon fatty acid with three double bonds. Of course, there are other fatty acids with varying degrees of unsaturation, but their abundance is usually minimal. All of the unsaturated fatty acids mentioned have naturally occurring cis double bonds, which is common for most unsaturated fatty acids. In addition, the afore mentioned fatty acids have the first double bond at the position of carbon 9 (C9), followed by carbon 12 (C12), if there are two degrees of unsaturation, then at carbon 15 (C15), if there are three degrees of unsaturation. In addition, the double bonds are not in conjugation. Table 1 gives the fatty acid make-up of linseed oil. It can be seen that linseed oil has an average of 6.0 double bonds per triglyceride. Its fatty acid content consists of 5.4% palmitic acid (C16:0), 3.5% stearic acid (C18:0), 19% oleic acid (C18:1), 24 % linoleic acid (C18:2) and 47% linolenic (C18:3). Table 1 also gives the fatty acid composition and varying degrees of unsaturation for various other naturally-occurring natural vegetable oils. The regions of unsaturation in natural oils allow for interesting polymer chemistry to take place. Some of this interesting polymer science, however, involves chemical modification of the regions of unsaturation. Acrylated epoxidized soybean oil (AESO) is prepared by epoxidation of the double bonds, followed by ring opening with acrylic acid. The resulting oil has both acrylate groups and hydroxyl groups. Wool and colleagues have further reacted the hydroxyl groups within the oil with maleic anhydride to produce maleated acrylated epoxidized soybean oil (MAESO). The MAESO has been copolymerized with styrene free radically to produce promising thermosetting sheet molding resins. Petrovi? and co-workers have directly ring opened the epoxidized oil to produce polyols that produce promising polyurethanes through condensation polymerization with diisocyanates. Our group's work initially focused on direct cationic copolymerization of the double bonds or conjugated double bonds of natural oils with monomers, such as styrene and divinylbenzene, to produce promising thermosetting resins. The only modification of the oils that was carried out in these studies was conjugation of the double bonds to enhance the reactivity of the oil. This work has been expanded recently with the incorporation of glass fiber to produce promising composites. We have also explored thermal polymerization techniques to make novel thermosets. This dissertation is divided into four chapters. The first chapter discusses the synthesis and characterization of biobased

Phillip H. Henna



Apparatus for distilling shale oil from oil shale  

SciTech Connect (OSTI)

An apparatus for distilling shale oil from oil shale comprises: a vertical type distilling furnace which is divided by two vertical partitions each provided with a plurality of vent apertures into an oil shale treating chamber and two gas chambers, said oil shale treating chamber being located between said two gas chambers in said vertical type distilling furnace, said vertical type distilling furnace being further divided by at least one horizontal partition into an oil shale distilling chamber in the lower part thereof and at least one oil shale preheating chamber in the upper part thereof, said oil shale distilling chamber and said oil shale preheating chamber communication with each other through a gap provided at an end of said horizontal partition, an oil shale supplied continuously from an oil shale supply port provided in said oil shale treating chamber at the top thereof into said oil shale treating chamber continuously moving from the oil shale preheating chamber to the oil shale distilling chamber, a high-temperature gas blown into an oil shale distilling chamber passing horizontally through said oil shale in said oil shale treating chamber, thereby said oil shale is preheated in said oil shale preheating chamber, and a gaseous shale oil is distilled from said preheated oil shale in said oil shale distilling chamber; and a separator for separating by liquefaction a gaseous shale oil from a gas containing the gaseous shale oil discharged from the oil shale preheating chamber.

Shishido, T.; Sato, Y.



Grain orientations and distribution of  

Science Journals Connector (OSTI)

The local grain orientations and the distribution of Y2Ba4CuUOx (U-2411) phase are measured within melt-textured YBCO samples by means of electron backscatter diffraction (EBSD). In this work, several samples with varying addition (0.1–0.8 wt%) of depleted uranium oxide (DU) were analysed by means of EBSD. The embedded U-2411 particles were found to have sizes around 200 nm, some large particles being present in the samples with a high DU concentration. Combined EBSD and EDX analysis enabled the identification of the Kikuchi patterns of the U-2411 phase, so that a true three-phase EBSD scan (YBCO, Y2BaCuO5 and U-2411) becomes possible.

A Koblischka-Veneva; F Mücklich; M R Koblischka; N Hari Babu; D A Cardwell; M Murakami



Fatigue Threshold R-Curve Behavior of Grain Bridging Ceramics: Role of Grain Size and Grain-Boundary Adhesion  

E-Print Network [OSTI]

unless they experience environmentally assisted subcritical growth during cyclic loading.7 Fatigue-crack (moist air and dry N2). The fine-grained micro- structure showed higher fatigue thresholds at short crack sizes, while the coarse-grained microstructure demonstrated higher fatigue thresholds at long crack

Kruzic, Jamie


Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis  

SciTech Connect (OSTI)

Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.

Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer



Continuous bioconversion of starch to ethanol by calcium-alginate immobilized enzymes and yeasts  

SciTech Connect (OSTI)

Continuous bioconversion of starch to EtOH by immobilized enzymes and yeasts was studied. Commercial corn starch (10%) was 1st batch-liquefied with bacterial alpha-amylase. In continuous-flow systems, liquefied starch was then converted to glucose with Ca alginate-entrapped fungal glucoamylase, and the resulting glucose was fermented to EtOH by Ca alginate-entrapped active dry yeast. The continuous-flow saccharification-fermentation processes were performed in either 2-stage (sequential) or single-stage (simultaneous) operations. In the single-stage operation, immobilized glucoamylase produced glucose from liquefied starch continuously for 11 days. In the simultaneous saccharification technique using immobilized glucoamylase and yeast mixture in a single-stage column, EtOH production was 69% of theoretical for 5 days. In the 2-stage operation, in which immobilized glucoamylase and yeast were contained in separate columns connected in tandem, EtOH production averaged 97% of theoretical for 5 days. The overall alcoholic production efficiency was significantly greater in the 2-stage system than in the single-stage system.

McGhee, J.E.; Carr, M.E.; St. Julian, G.



Modeling of Turing Structures in the Chlorite—Iodide—Malonic Acid—Starch Reaction System  

Science Journals Connector (OSTI)

...through a column ofpolyacrylamide gel show that the latter do have significantly longer retention times. We may picture the Iions moving not in a simple gel but in a medium with many traps (gel-bound 12, starch) that capture I-for a period oftime...




Solution structure of the granular starch binding domain of Aspergillus niger glucoamylase bound to -cyclodextrin  

E-Print Network [OSTI]

starch strands apart thus increasing the hydrolyzable surface, or alternatively it may localize to the catalytic domain is attached is flexible, allowing the catalytic site to access a large surface area Cellulomonas fimi has two noncatalytic binding domains that clearly bind to different ligands; xylan binds only

Williamson, Mike P.


Biodegradability and mechanical properties of poly-(beta-hydroxybutyrate-co-beta-hydroxyvalerate)-starch blends.  

Science Journals Connector (OSTI)

...A 400-ml inoculum from an anaerobic digester and an activated sludge unit was added...wt/wt) or 21% (vol/vol) starch. Wool et al. (13) described this relationship...Biotechnol. Tech. 4:221-226. 13. Wool, R. P., J. S. Peanasky, J. M...

B A Ramsay; V Langlade; P J Carreau; J A Ramsay



Genetic dissection of floridean starch synthesis in the cytosol of the model dinoflagellate Crypthecodinium cohnii  

Science Journals Connector (OSTI)

...respectively, in amylose and amylopectin synthesis. They...hydrolases (amylases, glucosidases...enzymes, {alpha}-1,4...polysaccharide of amylose ({lambda...max of amylopectin. We confirmed...modification in amylopectin CL distribution...beta}-amylase and subjected...from the {alpha}-1,6...starches of high amylose mutants of...

David Dauvillée; Philippe Deschamps; Jean-Philippe Ral; Charlotte Plancke; Jean-Luc Putaux; Jimi Devassine; Amandine Durand-Terrasson; Aline Devin; Steven G. Ball



Convergent Evolution of Polysaccharide Debranching Defines a Common Mechanism for Starch Accumulation in Cyanobacteria and Plants  

Science Journals Connector (OSTI)

...indirect DBE-like alpha-1,6 glucosidase...the presence of amylose, which yielded...from that of amylopectin-like polymers...by the starch amylopectin- or glycogen-containing...enzymes (e.g., amylases, branching enzymes, and alpha-1,4 glucanotransferase...

Ugo Cenci; Malika Chabi; Mathieu Ducatez; Catherine Tirtiaux; Jennifer Nirmal-Raj; Yoshinori Utsumi; Daiki Kobayashi; Satoshi Sasaki; Eiji Suzuki; Yasunori Nakamura; Jean-Luc Putaux; Xavier Roussel; Amandine Durand-Terrasson; Debashish Bhattacharya; Anne-Sophie Vercoutter-Edouart; Emmanuel Maes; Maria Cecilia Arias; Monica Palcic; Lyann Sim; Steven G. Ball; Christophe Colleoni


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Protein Phosphorylation in Amyloplasts Regulates Starch Branching Enzyme Activity and Proteinâ??Protein Interactions  

Science Journals Connector (OSTI)

...example, the amylose extender...in beta-amylase (EC 3...in beta-amylase migration...formation of alpha-(16)-branches in amylopectin, are regulated...Total Starch Amylose Fraction...mg of the alpha-amylase inhibitor...1948). Amylose and amylopectin fractionated...

Ian J. Tetlow; Robin Wait; Zhenxiao Lu; Rut Akkasaeng; Caroline G. Bowsher; Sergio Esposito; Behjat Kosar-Hashemi; Matthew K. Morell; Michael J. Emes



Starch granule initiation is controlled by a heteromultimeric isoamylase in potato tubers  

Science Journals Connector (OSTI)

...limit-dextrinase, {alpha}-amylase, and {beta}-amylase (Table 2, which is published as supporting information...much lower than that for amylopectin from potato starch (see...and relative amounts of amylose and amylopectin were examined by gel permeation...

Regla Bustos; Brendan Fahy; Christopher M. Hylton; Robert Seale; N. Miranda Nebane; Anne Edwards; Cathie Martin; Alison M. Smith



Starch composites reinforced by bamboo cellulosic crystals Dagang Liu a,c  

E-Print Network [OSTI]

Agricultural Center, Baton Rouge, LA 70803, USA a r t i c l e i n f o Article history: Received 9 March 2009, competitiveness in price, and applicability to various industries (Yang et al., 2007; Lenz, 1993; Pandey et al energy or by incorporation of a plasticizing agent (e.g., water, amide, and/or polyols), starch can



E-Print Network [OSTI]

1 EFFECT OF HYDROTHERMAL TREATMENT ON PHYSICOCHEMICAL1 PROPERTIES OF WHEAT, WAXY AND STANDARD MAIZE.10.005 #12;2 ABSTRACT18 Standard maize (SMS), waxy maize (WMS) and wheat (WTS) starches were19 hydrothermally treated at three pressure levels. Effects of D.I.C. processing conditions20 on thermal characteristics

Paris-Sud XI, Université de


Oil and Gas Supply Module  

Gasoline and Diesel Fuel Update (EIA)

Onshore Lower 48 Oil and Gas Supply Submodule, Offshore Oil and Gas Supply Submodule, Oil Shale Supply Submodule1, and Alaska Oil and Gas Supply Submodule. A detailed description...


Oil and Gas Supply Module  

Gasoline and Diesel Fuel Update (EIA)

Onshore Lower 48 Oil and Gas Supply Submodule, Offshore Oil and Gas Supply Submodule, Oil Shale Supply Submodule, and Alaska Oil and Gas Supply Submodule. A detailed description of...


Oil and Gas Exploration  

E-Print Network [OSTI]

Metals Industrial Minerals Oil and Gas Geothermal Exploration Development Mining Processing Nevada, oil and gas, and geothermal activities and accomplishments in Nevada: production statistics, exploration and development including drilling for petroleum and geothermal resources, discoveries of ore

Tingley, Joseph V.


China's Global Oil Strategy  

E-Print Network [OSTI]

21, 2008. Ying, Wang. “ China, Venezuela firms to co-developApril 21, “China and Venezuela sign oil agreements. ” Chinaaccessed April 21, “Venezuela and China sign oil deal. ” BBC

Thomas, Bryan G



Using Oils As Pesticides  

E-Print Network [OSTI]

Petroleum and plant-derived spray oils show increasing potential for use as part of Integrated Pest Management systems for control of soft-bodied pests on fruit trees, shade trees, woody ornamentals and household plants. Sources of oils, preparing...

Bogran, Carlos E.; Ludwig, Scott; Metz, Bradley



Residential heating oil price  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

heating oil price decreases The average retail price for home heating oil fell 6.3 cents from a week ago to 2.91 per gallon. That's down 1.10 from a year ago, based on the...


Residential heating oil price  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil price decreases The average retail price for home heating oil fell 7.5 cents from a week ago to 2.84 per gallon. That's down 1.22 from a year ago, based on the...


Residential heating oil price  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

heating oil price decreases The average retail price for home heating oil fell 7.6 cents from a week ago to 2.97 per gallon. That's down 1.05 from a year ago, based on the...


Residential heating oil price  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

heating oil price decreases The average retail price for home heating oil fell 3.6 cents from a week ago to 3.04 per gallon. That's down 99.4 cents from a year ago, based on the...


US Crude oil exports  

Gasoline and Diesel Fuel Update (EIA)

2014 EIA Energy Conference U.S. Crude Oil Exports July 14, 2014 By Lynn D. Westfall U.S. Energy Information Administration U.S. crude oil production has grown by almost 50% since...


Oil shale retorted underground  

Science Journals Connector (OSTI)

Oil shale retorted underground ... Low-temperature underground retorting of oil shale produces a crude oil with many attractive properties, Dr. George R. Hill of the University of Utah told a meeting of the American Institute of Mining, Metallurgical, and Petroleum Engineers last week in Los Angeles. ... Typical above-ground retorting of oil shale uses temperatures of 900° to 1100° F. because of the economic need ... ...



Biochemical upgrading of oils  

DOE Patents [OSTI]

A process for biochemical conversion of heavy crude oils is provided. The process includes contacting heavy crude oils with adapted biocatalysts. The resulting upgraded oil shows, a relative increase in saturated hydrocarbons, emulsions and oxygenates and a decrease in compounds containing organic sulfur, organic nitrogen and trace metals. Adapted microorganisms which have been modified under challenged growth processes are also disclosed. 121 figs.

Premuzic, E.T.; Lin, M.S.



Exploiting heavy oil reserves  

E-Print Network [OSTI]

North Sea investment potential Exploiting heavy oil reserves Beneath the waves in 3D Aberdeen the potential of heavy oil 8/9 Taking the legal lessons learned in the north Sea to a global audience 10 potential Exploiting heavy oil reserves Aberdeen: A community of science AT WORK FOR THE ENERGY SECTOR ISSUE

Levi, Ran


Utah Heavy Oil Program  

SciTech Connect (OSTI)

The Utah Heavy Oil Program (UHOP) was established in June 2006 to provide multidisciplinary research support to federal and state constituents for addressing the wide-ranging issues surrounding the creation of an industry for unconventional oil production in the United States. Additionally, UHOP was to serve as an on-going source of unbiased information to the nation surrounding technical, economic, legal and environmental aspects of developing heavy oil, oil sands, and oil shale resources. UHOP fulGilled its role by completing three tasks. First, in response to the Energy Policy Act of 2005 Section 369(p), UHOP published an update report to the 1987 technical and economic assessment of domestic heavy oil resources that was prepared by the Interstate Oil and Gas Compact Commission. The UHOP report, entitled 'A Technical, Economic, and Legal Assessment of North American Heavy Oil, Oil Sands, and Oil Shale Resources' was published in electronic and hard copy form in October 2007. Second, UHOP developed of a comprehensive, publicly accessible online repository of unconventional oil resources in North America based on the DSpace software platform. An interactive map was also developed as a source of geospatial information and as a means to interact with the repository from a geospatial setting. All documents uploaded to the repository are fully searchable by author, title, and keywords. Third, UHOP sponsored Give research projects related to unconventional fuels development. Two projects looked at issues associated with oil shale production, including oil shale pyrolysis kinetics, resource heterogeneity, and reservoir simulation. One project evaluated in situ production from Utah oil sands. Another project focused on water availability and produced water treatments. The last project considered commercial oil shale leasing from a policy, environmental, and economic perspective.

J. Bauman; S. Burian; M. Deo; E. Eddings; R. Gani; R. Goel; C.K. Huang; M. Hogue; R. Keiter; L. Li; J. Ruple; T. Ring; P. Rose; M. Skliar; P.J. Smith; J.P. Spinti; P. Tiwari; J. Wilkey; K. Uchitel



Manufacture of refrigeration oils  

SciTech Connect (OSTI)

Lubricating oils suitable for use in refrigeration equipment in admixture with fluorinated hydrocarbon refrigerants are produced by solvent extraction of naphthenic lubricating oil base stocks, cooling the resulting extract mixture, optionally with the addition of a solvent modifier, to form a secondary raffinate and a secondary extract, and recovering a dewaxed oil fraction of lowered pour point from the secondary raffinate as a refrigeration oil product. The process of the invention obviates the need for a separate dewaxing operation, such as dewaxing with urea, as conventionally employed for the production of refrigeration oils.

Chesluk, R.P.; Platte, H.J.; Sequeira, A.J.



Trials and Tribulations of Ancient Starch Research: An Investigation of Contamination and Earth Ovens at Fort Hood, Texas  

E-Print Network [OSTI]

and control samples. Laboratory and field equipment were processed and analyzed for contamination. Only one feature (Feature 4 from 41 CV984) yielded starch granules that are unambiguously archaeological in origin, rather than the result of contamination...

Laurence, Andrew


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Carcinogenicity Studies of Estonian Oil Shale Soots  

E-Print Network [OSTI]

determine the carcinogenicity of Estonian oil shale soot as well as the soot from oil shale fuel oil. All

A. Vosamae


Crude Oil, Heating Oil, and Propane Market Outlook  

Gasoline and Diesel Fuel Update (EIA)

Oil, Heating Oil, and Propane Market Outlook Oil, Heating Oil, and Propane Market Outlook 8/13/01 Click here to start Table of Contents Crude Oil, Heating Oil, and Propane Market Outlook Short-Term World Oil Price Forecast Price Movements Related to Supply/Demand Balance OPEC Production Likely To Remain Low U.S. Reflects World Market Crude Oil Outlook Conclusions Distillate Prices Increase With Crude Oil Distillate Stocks on the East Coast Were Very Low Entering Last Winter Distillate Demand Strong Last Winter More Supply Possible This Fall than Forecast Distillate Fuel Oil Imports Could Be Available - For A Price Distillate Supply/Demand Balance Reflected in Spreads Distillate Stocks Expected to Remain Low Winter Crude Oil and Distillate Price Outlook Heating Oil Outlook Conclusion Propane Prices Follow Crude Oil


Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes  

SciTech Connect (OSTI)

Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.



Development of rapidly fermenting strains of Saccharomyces diastaticus for direct conversion of starch and dextrins to ethanol  

SciTech Connect (OSTI)

Alcoholic fermentation, growth, and glucoamylase production by 12 strains of Saccharomyces diastaticus were compared by using starch and dextrins as substrates. Haploid progeny produced from a rapidly fermenting strain, SD2, were used for hybridization with other S. diastaticus and Saccharomyces cerevisiae haploids. Alcoholic fermentation and enzyme production by hybrid diploids and their haploid parents were evaluated. Although the dosage of the STA or DEX (starch or dextrin fermentation) genes may enhance ethanol production, epistatic effects in certain strain combinations caused decreases in starch-fermenting activity. Both the nature of the starch or dextrin used and the fermentation medium pH had substantial effects on alcohol production. Commercial dextrin was not as good a substrate as dextrins prepared by digesting starch with ..cap alpha..-amylase. Crude manioc starch digested by ..cap alpha..-amylase was fermented directly by selected hybrids with almost 100% conversion efficiency. The manioc preparation contained adequate minerals and growth factors. This procedure should be suitable for direct commercial application in manioc-producing regions in Brazil and elsewhere. A rapidly fermenting haploid strain, SD2-A8, descended from strain SD2, contains two unlinked genes controlling formation of extracellular amylase. A convenient method for detecting these genes (STA genes) in replica plates containing large numbers of meiotic progeny was developed.

Laluce, C.; Mattoon, J.R.



Crude Oil Analysis Database  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The composition and physical properties of crude oil vary widely from one reservoir to another within an oil field, as well as from one field or region to another. Although all oils consist of hydrocarbons and their derivatives, the proportions of various types of compounds differ greatly. This makes some oils more suitable than others for specific refining processes and uses. To take advantage of this diversity, one needs access to information in a large database of crude oil analyses. The Crude Oil Analysis Database (COADB) currently satisfies this need by offering 9,056 crude oil analyses. Of these, 8,500 are United States domestic oils. The database contains results of analysis of the general properties and chemical composition, as well as the field, formation, and geographic location of the crude oil sample. [Taken from the Introduction to COAMDATA_DESC.pdf, part of the zipped software and database file at http://www.netl.doe.gov/technologies/oil-gas/Software/database.html] Save the zipped file to your PC. When opened, it will contain PDF documents and a large Excel spreadsheet. It will also contain the database in Microsoft Access 2002.

Shay, Johanna Y.


Advancing Biorefining of Distiller's Grain and Corn Stover Blends...  

Broader source: Energy.gov (indexed) [DOE]

Advancing Biorefining of Distiller's Grain and Corn Stover Blends Advancing Biorefining of Distiller's Grain and Corn Stover Blends This fact sheet summarizes a U.S. Department of...


Band-Gap Engineering of Carbon Nanotubes with Grain Boundaries...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Band-Gap Engineering of Carbon Nanotubes with Grain Boundaries. Band-Gap Engineering of Carbon Nanotubes with Grain Boundaries. Abstract: Structure and electronic properties of...


Heartland Grain Fuels LP | Open Energy Information  

Open Energy Info (EERE)

Grain Fuels LP Grain Fuels LP Jump to: navigation, search Name Heartland Grain Fuels LP Place Aberdeen, South Dakota Zip 57401 Sector Bioenergy Product Heartland Grain Fuels is a cooperatively-owned producer of corn-derived ethanol that was acquired by Advanced Bioenergy in November 2006. Coordinates 46.975867°, -123.81598° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.975867,"lon":-123.81598,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Large Grain Superconducting RF Cavities at DESY  

SciTech Connect (OSTI)

The DESY R and D program on cavities fabricated from large grain niobium explores the potential of this material for the production of approx. 1000 nine-cell cavities for the European XFEL. The program investigates basic material properties, comparing large grain material to standard sheet niobium, as well as fabrication and preparation aspects. Several single-cell cavities of TESLA shape have been fabricated from large grain niobium. A gradient up to 41 MV/m at Q0 = 1.4{center_dot}1010 (TB = 2K) was measured after electropolishing. The first three large grain nine-cell cavities worldwide have been produced under contract of DESY with ACCEL Instruments Co. The first tests have shown that all three cavities reach an accelerating gradient up to 30 MV/m after BCP (Buffered Chemical Polishing) treatment, what exceeds the XFEL requirements for RF test in the vertical cryostat.

Singer, W.; Brinkmann, A.; Ermakov, A.; Iversen, J.; Kreps, G.; Matheisen, A.; Proch, D.; Reschke, D.; Singer, X.; Spiwek, M.; Wen, H.; Brokmeier, H. G. [DESY, Notkestrasse 85, D-22607 Hamburg (Germany); GKSS, Max-Planck-Strasse, D-21502 Geesthacht (Germany)



Central Carbon Metabolism and Electron Transport in Chlamydomonas reinhardtii: Metabolic Constraints for Carbon Partitioning between Oil and Starch  

Science Journals Connector (OSTI)

...the green alga Chlamydomonas. Alternative oxidase...of excess energy. However...where an energy loss of about...as well to algae in darkness...conditions, the energy requirement...mechanisms and alternative electron transfer...

Xenie Johnson; Jean Alric



Microstructural characterization of a Canadian oil sand  

E-Print Network [OSTI]

The microstructure of oil sand samples extracted at a depth of 75 m from the estuarine Middle McMurray formation (Alberta, Canada) has been investigated by using high resolution 3D X-Ray microtomography ($\\mu$CT) and Cryo Scanning Electron Microscopy (CryoSEM). $\\mu$CT images evidenced some dense areas composed of highly angular grains surrounded by fluids that are separated by larger pores full of gas. 3D Image analysis provided in dense areas porosity values compatible with in-situ log data and macroscopic laboratory determinations, showing that they are representative of intact states. $\\mu$CT hence provided some information on the morphology of the cracks and disturbance created by gas expansion. The CryoSEM technique, in which the sample is freeze fractured within the SEM chamber prior to observation, provided pictures in which the (frozen) bitumen clearly appears between the sand grains. No evidence of the existence of a thin connate water layer between grains and the bitumen, frequently mentioned in th...

Dinh, Hong Doan; Nauroy, Jean-François; Tang, Anh-Minh; Souhail, Youssef; 10.1139/T2012-072



Process of converting starch to glucose and glucose to lactic acid  

SciTech Connect (OSTI)

This document describes a method for converting starch into lactic acid of sufficient purity for use as a substrate for biodegradable plastics. The process is designed to work on industrial food waste streams such as potato wastes or cheese whey permeate. For potato waste, {alpha}-amylase and calcium chloride are added to the starch containing waste and incubated at a pH of 4--7, a temperature of 90--130{degree}C, and a pressure above 15 psi for not less than 15 minutes. At this point, glucoamylase is added and the mixture is incubated at a temperature of 50--70{degree}C and a pH below 6.5 for 4 hours. This results in the conversion of more than 90% of the starch into glucose, which is substantially free of microbial contamination. The hydrolysate is filtered, and introduced with additional nutrients to a fermentor containing a lactose producing microorganism to form a fermentation broth. This results in the fermentation of glucose to lactose, which is filtered and subjected to electrodialysis for purification. Conversion of glucose to lactic acid or lactate occurs with an efficiency of over 95%. 1 fig. (MHB)

Tsai, TenLin; Sanville, C.Y.; Coleman, R.D.; Schertz, W.W.



Process of converting starch to glucose and glucose to lactic acid  

SciTech Connect (OSTI)

This document describes a method for converting starch into lactic acid of sufficient purity for use as a substrate for biodegradable plastics. The process is designed to work on industrial food waste streams such as potato wastes or cheese whey permeate. For potato waste, {alpha}-amylase and calcium chloride are added to the starch containing waste and incubated at a pH of 4--7, a temperature of 90--130{degree}C, and a pressure above 15 psi for not less than 15 minutes. At this point, glucoamylase is added and the mixture is incubated at a temperature of 50--70{degree}C and a pH below 6.5 for 4 hours. This results in the conversion of more than 90% of the starch into glucose, which is substantially free of microbial contamination. The hydrolysate is filtered, and introduced with additional nutrients to a fermentor containing a lactose producing microorganism to form a fermentation broth. This results in the fermentation of glucose to lactose, which is filtered and subjected to electrodialysis for purification. Conversion of glucose to lactic acid or lactate occurs with an efficiency of over 95%. 1 fig. (MHB)

Tsai, TenLin; Sanville, C.Y.; Coleman, R.D.; Schertz, W.W.



Preparation and characterization of bionanocomposite films based on potato starch/halloysite nanoclay  

Science Journals Connector (OSTI)

Abstract In this research casting method was used to prepare potato starch based bio-nanocomposite films with halloysite nanoclay as the reinforcing materials. The composition included potato starch with 40% (w/w) of a mixture of sorbitol/glycerol (weight ratio of 3 to 1as plasticizer) with nanoclay (0–5% w/w). The films were dried under controlled conditions. Physicochemical properties such as solubility in water, water absorption capacity (WAC), water vapour permeability (WVP), oxygen permeability, and mechanical properties of the films were measured. Results showed that by increasing the concentration of nanoclay, mechanical properties of films were improved. Tensile strength was increased from 7.33 to 9.82 MPa, and elongation at break decreased from 68.0 to 44.0%. Solubility in water decreased from 35 to 23%, and heat seal strength increased from 375 to 580 N/m. Also incorporation of clay nanoparticles in the structure of biopolymer decreased permeability of the gaseous molecules. In summary, addition of halloysite nanoclay, improve the barrier and mechanical properties of potato starch films and this bionanocomposites have high potential to be used for food packaging purposes.

Fatemeh Sadegh-Hassani; Abdorreza Mohammadi Nafchi



World Oil: Market or Mayhem?  

E-Print Network [OSTI]

The world oil market is regarded by many as a puzzle. Why are oil prices so volatile? What is OPEC and what does OPEC do? Where are oil prices headed in the long run? Is “peak oil” a genuine concern? Why did oil prices ...

Smith, James L.



Vegetable oil fuel  

SciTech Connect (OSTI)

In this article, the future role of renewable agricultural resources in providing fuel is discussed. it was only during this century that U.S. farmers began to use petroleum as a fuel for tractors as opposed to forage crop as fuel for work animals. Now farmers may again turn to crops as fuel for agricultural production - the possible use of sunflower oil, soybean oil and rapeseed oil as substitutes for diesel fuel is discussed.

Bartholomew, D.



Determination of the structural changes by Raman and {sup 13}C CP/MAS NMR spectroscopy on native corn starch with plasticizers  

SciTech Connect (OSTI)

The plasticizing - antiplasticizing effect of water and glycerol contents on native corn starch samples is investigated by FT-Raman and {sup 13}C CP/MAS NMR spectroscopy. The presence of both amorphous and crystalline structural phases was evidenced in pure native corn starch and also in the samples containing plasticizers. Among the crystalline starch structures, the A- and V- types were suggested by CP/MAS NMR spectra.

Cozar, O. [Academy of Romanian Scientists, Splaiul Independentei 54, 050094, Bucharest, Romania and National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch (Romania)] [Academy of Romanian Scientists, Splaiul Independentei 54, 050094, Bucharest, Romania and National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch (Romania); Filip, C.; Tripon, C. [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania)] [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania); Cioica, N.; Co?a, C.; Nagy, E. M. [National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch, RO-400458 Cluj-Napoca (Romania)] [National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch, RO-400458 Cluj-Napoca (Romania)



US oil consumption, oil prices, and the macroeconomy  

Science Journals Connector (OSTI)

Since the oil price shock of 1973–74, researchers have waged ... national income. Studies examining the relationship between oil prices, oil consumption, and real output have produced remarkably ... to dramatical...

Ali F. Darrat; Otis W. Gilley; Don J. Meyer



Lower oil prices also cutting winter heating oil and propane...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lower oil prices also cutting winter heating oil and propane bills Lower oil prices are not only driving down gasoline costs, but U.S. consumers will also see a bigger savings in...


Effects of Oil and Oil Dispersants on the Marine Environment  

Science Journals Connector (OSTI)

13 April 1971 research-article Effects of Oil and Oil Dispersants on the Marine Environment R. G. J. Shelton In the context of marine pollution, the term 'oil' can cover a very wide range of substances and usually...


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Enhanced Oil Recovery to Fuel Future Oil Demands | GE Global...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to Fuel Future Oil Demands Enhanced Oil Recovery to Fuel Future Oil Demands Trevor Kirsten 2013.10.02 I'm Trevor Kirsten and I lead a team of GE researchers that investigate a...


Oil and Gas (Indiana)  

Broader source: Energy.gov [DOE]

This division of the Indiana Department of Natural Resources provides information on the regulation of oil and gas exploration, wells and well spacings, drilling, plugging and abandonment, and...


Waste oil reduction: GKN  

SciTech Connect (OSTI)

This report details the steps required to establish a waste oil management program. Such a program can reduce operational costs, cut wastewater treatment costs and produce a better quality wastewater effluent through such means as: reducing the volume of oils used; segregating oils at the source of generation for recovery and reuse; and reducing the quality of oily wastewater generated. It discusses the metal-working fluid recovery options available for such a program, namely settling, filtration, hydrocyclone, and centrifugation. Included are source lists for vendors of oil skimmer equipment and coolant recovery systems.

Hunt, G.



Understanding Crude Oil Prices  

E-Print Network [OSTI]

disruptions, and the peak in U.S. oil production account foroil increased 81.1% (logarithmically) between January 1979 and the peak

Hamilton, James Douglas



What substitutes for oil?  

Science Journals Connector (OSTI)

... bagasse, ethyl alcohol, vegetable oils, methane and hydrogen; as well as hydro and nuclear power generation, conservation methods, and solar, wind and tidal energy.

David Spurgeon



Crude Oil Prices  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Information AdministrationPetroleum Marketing Annual 2001 41 Table 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) - Continued Year Month PAD District II...


Crude Oil Prices  

U.S. Energy Information Administration (EIA) Indexed Site

Information AdministrationPetroleum Marketing Annual 2002 41 Table 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) - Continued Year Month PAD District II...


Crude Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

Information AdministrationPetroleum Marketing Annual 2000 41 Table 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) - Continued Year Month PAD District II...


Crude Oil Prices  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Information AdministrationPetroleum Marketing Annual 1999 41 Table 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) - Continued Year Month PAD District II...


Crude Oil Prices  

U.S. Energy Information Administration (EIA) Indexed Site

Information AdministrationPetroleum Marketing Annual 1998 41 Table 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) - Continued Year Month PAD District II...


NETL: Oil & Gas  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oil & Gas Publications KMD Contacts Project Summaries EPAct 2005 Arctic Energy Office Announcements Software Stripper Wells Efficient recovery of our nation's fossil fuel resources...


PIA - Northeast Home Heating Oil Reserve System (Heating Oil...  

Office of Environmental Management (EM)

Home Heating Oil Reserve System (Heating Oil) More Documents & Publications PIA - WEB Physical Security Major Application PIA - GovTrip (DOE data) PIA - WEB Unclassified...


Lead Corrosion and Oil Oxidation  

Science Journals Connector (OSTI)

... tests the horn was AISI 304, the balls were variously high purity Al, Cu, SAE 52100 steel, and Pb. The oil was a refined paraffinic mineral oil into which ... oil Bearing




Oil shale technology  

SciTech Connect (OSTI)

Oil shale is undoubtedly an excellent energy source that has great abundance and world-wide distribution. Oil shale industries have seen ups and downs over more than 100 years, depending on the availability and price of conventional petroleum crudes. Market forces as well as environmental factors will greatly affect the interest in development of oil shale. Besides competing with conventional crude oil and natural gas, shale oil will have to compete favorably with coal-derived fuels for similar markets. Crude shale oil is obtained from oil shale by a relatively simple process called retorting. However, the process economics are greatly affected by the thermal efficiencies, the richness of shale, the mass transfer effectiveness, the conversion efficiency, the design of retort, the environmental post-treatment, etc. A great many process ideas and patents related to the oil shale pyrolysis have been developed; however, relatively few field and engineering data have been published. Due to the vast heterogeneity of oil shale and to the complexities of physicochemical process mechanisms, scientific or technological generalization of oil shale retorting is difficult to achieve. Dwindling supplied of worldwide petroleum reserves, as well as the unprecedented appetite of mankind for clean liquid fuel, has made the public concern for future energy market grow rapidly. the clean coal technology and the alternate fuel technology are currently of great significance not only to policy makers, but also to process and chemical researchers. In this book, efforts have been made to make a comprehensive text for the science and technology of oil shale utilization. Therefore, subjects dealing with the terminological definitions, geology and petrology, chemistry, characterization, process engineering, mathematical modeling, chemical reaction engineering, experimental methods, and statistical experimental design, etc. are covered in detail.

Lee, S. (Akron Univ., OH (United States). Dept. of Chemical Engineering)



Metal precipitation at grain boundaries in silicon: Dependence on grain boundary character and dislocation decoration  

E-Print Network [OSTI]

are combined to determine the dependence of metal silicide precipitate formation on grain boundary character and microstructure in multicrystalline silicon mc-Si . Metal silicide precipitate decoration is observed to increase the local metal silicide precipitate concentrations at various types of grain boundaries, identifying clear


Internetwork chromospheric bright grains observed with IRIS  

E-Print Network [OSTI]

The Interface Region Imaging Spectrograph (IRIS) reveals small-scale rapid brightenings in the form of bright grains all over coronal holes and the quiet sun. These bright grains are seen with the IRIS 1330 \\AA, 1400 \\AA\\ and 2796 \\AA\\ slit-jaw filters. We combine coordinated observations with IRIS and from the ground with the Swedish 1-m Solar Telescope (SST) which allows us to have chromospheric (Ca II 8542 \\AA, Ca II H 3968 \\AA, H\\alpha, and Mg II k 2796 \\AA), and transition region (C II 1334 \\AA, Si IV 1402) spectral imaging, and single-wavelength Stokes maps in Fe I 6302 \\AA at high spatial (0.33"), temporal and spectral resolution. We conclude that the IRIS slit-jaw grains are the counterpart of so-called acoustic grains, i.e., resulting from chromospheric acoustic waves in a non-magnetic environment. We compare slit-jaw images with spectra from the IRIS spectrograph. We conclude that the grain intensity in the 2796 \\AA\\ slit-jaw filter comes from both the Mg II k core and wings. The signal in the C II ...

Martínez-Sykora, Juan; Carlsson, Mats; De Pontieu, Bart; Pereira, Tiago M D; Boerner, Paul; Hurlburt, Neal; Kleint, Lucia; Lemen, James; Tarbell, Ted D; Title, Alan; Wuelser, Jean-Pierre; Hansteen, Viggo H; Golub, Leon; McKillop, Sean; Reeves, Kathy K; Saar, Steven; Testa, Paola; Tian, Hui; Jaeggli, Sarah; Kankelborg, Charles




Science Journals Connector (OSTI)

IN PACKED HEARINGS last week before angry members of Congress, the heads of BP, ExxonMobil, Chevron, ConocoPhillips, and Shell Oil defended their industry in light of the April 20 BP oil rig explosion in the Gulf of Mexico, which has led to the worst ...




Oil Quantity : The histori  

E-Print Network [OSTI]

model for Prudhoe Bay. Figure 11: Historical Prudhoe Bay oil production data, modeled economically Production (million bbl per Month) Historical Production Best Fit (Hist. Tax w/ELF, Ref. P) High Price 120 140 160 19 Oil Quantity Con Wel N E A N N ng Results e Bay : The histori Bay over tim : Prudhoe Ba

Lin, C.-Y. Cynthia


The Geopolitics of Oil  

Science Journals Connector (OSTI)

...reduce their production by a similar...barrels ofoil a day. Although the...barrels of oil per day. It is likely...Virtually all the OPEC producers, particularly...their oil. In 1973, 90 percent...increase indigenous production, and ac-celerate...



Balancing oil and environment... responsibly.  

SciTech Connect (OSTI)

Balancing Oil and Environment…Responsibly As the price of oil continues to skyrocket and global oil production nears the brink, pursuing unconventional oil supplies, such as oil shale, oil sands, heavy oils, and oils from biomass and coal has become increasingly attractive. Of particular significance to the American way is that our continent has significant quantities of these resources. Tapping into these new resources, however, requires cutting-edge technologies for identification, production, processing and environmental management. This job needs a super hero or two for a job of this size and proportion…

Weimer, Walter C.; Teske, Lisa


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Essays on Macroeconomics and Oil  

E-Print Network [OSTI]

Oil Production in Venezuela and Mexico . . . . . . . . . .and Productivity in Venezuela and Mexico . . . . . . . . OilEllner, ”Organized Labor in Venezuela 1958-1991: Behavior




Chinaâs Oil Diplomacy with Russia.  

E-Print Network [OSTI]

??In Chinaâs view, it is necessary to get crude oil and oil pipeline. Under Russia and China strategic partnership, China tries to obtain âlong term… (more)

Chao, Jiun-chuan



Peak oil: diverging discursive pipelines.  

E-Print Network [OSTI]

??Peak oil is the claimed moment in time when global oil production reaches its maximum rate and henceforth forever declines. It is highly controversial as… (more)

Doctor, Jeff



oil | OpenEI  

Open Energy Info (EERE)

oil oil Dataset Summary Description This dataset comes from the Energy Information Administration (EIA), and is part of the 2011 Annual Energy Outlook Report (AEO2011). This dataset is table 134, and contains only the reference case. The data is broken down into Crude oil, dry natural gas. Source EIA Date Released April 26th, 2011 (3 years ago) Date Updated Unknown Keywords 2011 AEO EIA end-of-year reserves gas oil Data application/vnd.ms-excel icon AEO2011: Oil and Gas End-of-Year Reserves and Annual Reserve Additions- Reference Case (xls, 58.4 KiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Annually Time Period 2008-2035 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset


Chapter 5 - Crude Oil  

Science Journals Connector (OSTI)

Abstract Oil has been the number one source of energy in the world since the middle of the twentieth century. The world is very dependent on petroleum for transportation fuels, petrochemicals and asphalt. But ever increasing demand has caused the price of oil to spike in recent years, and only the world economic crisis has been able to temper demand and bring the price down to more reasonable levels. However, the demand and price are likely to shoot up again when the economy recovers. At the same time, the peak oil theory of M. King Hubbert predicts that world oil production is likely to peak soon. This prediction raises questions about what source of energy will come to the fore when oil is not able to keep up.

Brian F. Towler



Midwest Grain Processors MGP | Open Energy Information  

Open Energy Info (EERE)

Midwest Grain Processors MGP Midwest Grain Processors MGP Jump to: navigation, search Name Midwest Grain Processors (MGP) Place Lakota, Iowa Zip 50451 Product Iowa-based bioethanol producer using corn as feedstock. Coordinates 48.042535°, -98.335979° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.042535,"lon":-98.335979,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Selected Abstracts & Bibliography of International Oil Spill Research, through 1998  

E-Print Network [OSTI]

Kuwait, Middle East, oil and gas fields, oil refinery, oil waste, oil well,Equipment Kuwait Oil Co. 1991. Mideast well fire, oil spillKuwait, Persian Gulf, Saudia Arabia, Oil spill, cleanup, oil spills, crude, oil spill incidents, oil spills-pipeline, warfare, oil skimmers, oil wells,

Louisiana Applied Oil Spill Research & Development Program Electronic Bibliography




SciTech Connect (OSTI)

Granular starch hydrolyzing enzymes (GSHE) can hydrolyze starch at low temperature (32°C). The dry grind process using GSHE (GSH process) has fewer unit operations and no changes in process conditions (pH 4.0 and 32°C) compared to the conventional process because it dispenses with the cooking and liquefaction step. In this study, the effects of endosperm hardness, protease, urea, and GSHE levels on GSH process were evaluated. Ground corn, soft endosperm, and hard endosperm were processed using two GSHE levels (0.1 and 0.4 mL per 100 g ground material) and four treatments of protease and urea addition. Soft and hard endosperm materials were obtained by grinding and sifting flaking grits from a dry milling pilot plant; classifications were confirmed using scanning electron microscopy. During 72 h of simultaneous granular starch hydrolysis and fermentation (GSHF), ethanol and glucose profiles were determined using HPLC. Soft endosperm resulted in higher final ethanol concentrations compared to ground corn or hard endosperm. Addition of urea increased final ethanol concentrations for soft and hard endosperm. Protease addition increased ethanol concentrations and fermentation rates for soft endosperm, hard endosperm, and ground corn. The effect of protease addition on ethanol concentrations and fermentation rates was most predominant for soft endosperm, less for hard endosperm, and least for ground corn. Samples (soft endosperm, hard endosperm, or corn) with protease resulted in higher (1.0% to 10.5% v/v) ethanol concentration compared to samples with urea. The GSH process with protease requires little or no urea addition. For fermentation of soft endosperm, GSHE dose can be reduced. Due to nutrients (lipids, minerals, and soluble proteins) present in corn that enhance yeast growth, ground corn fermented faster at the beginning than hard and soft endosperm.

P. Wang; W. Liu, D. B; Johnston, K. D; Rausch, S. J; Schmidt, M. E; Tumbleson, V. Singh



OpenEI - oil  

Open Energy Info (EERE)

/0 en AEO2011: Oil and Gas /0 en AEO2011: Oil and Gas End-of-Year Reserves and Annual Reserve Additions http://en.openei.org/datasets/node/805 This dataset comes from the Energy Information Administration (EIA), and is part of the 2011 Annual Energy Outlook Report (AEO2011). This dataset is table 134, and contains only the reference case. The data is broken down into Crude oil, dry natural gas. 

Type of License: 


Investigation of potato starch and sonicated RAS as alternative carbon sources for biological nitrogen removal  

Science Journals Connector (OSTI)

High nitrogen discharge from wastewater impacts negatively on the marine environment. Under the South Australian Environmental Improvement Program, metropolitan wastewater treatment plants are reconfigured to meet the new nitrogen discharge guideline. The denitrification process is carbon limited with carbon supplementation required to meet discharge guidelines, hence molasses is used for carbon source. Although molasses is inexpensive, other carbon sources particularly industrial waste potato starch and sonicated Return Activated Sludge (RAS) are explored. Research to evaluate soluble carbon release is quantified and preliminary results are presented suggesting that sonicated RAS may be an attractive substitute for molasses.

Gideon Kuncoro; Yung Ngothai; Uwe Kaeding; David Sweeney; Brian O'Neill



Potential of waxy sorghum and modified starches in production of Chinese Lunar New Year Cake  

E-Print Network [OSTI]

BQQ -99Q 220 c Le" s than 30 Unit Chain Leng th of. End Grouo (4 of glucose) Swelling Power at 95 C o Retrogr ada. tion of gel 20 ? 2B 56f S 1 owg Slowg a: V' dal, A. J. and Juliano, B. O. (5) b: JuI iano, B. O. et al. (13) c: PaI miano, E... of amylopectin and the gran- ular structure of amylopectin were the two main factor s af- fecting the free ze-thaw stability of cereal starch gels. The physical structure, chemical composition and physicochemical properties of waxy sor ghum have not been...

Kuo, Chung-Kung Mike



Growth of Smaller Grain Attached on Larger One: Algorithm to Overcome Unphysical Overlap between Grain  

E-Print Network [OSTI]

As a smaller grain, which is attached on larger one, is growing, it pushes also the larger one and other grains in its surrounding. In a simulation of similar system, repulsive force such as contact force based on linear spring-dashpot model can not accommodate this situation when cell growing rate is faster than simulation time step, since it produces sudden large overlap between grains that makes unphysical result. An algorithm that preserves system linear momentum by introducing additional velocity induced by cell growth is presented in this work. It should be performed in an implicit step. The algorithm has successfully eliminated unphysical overlap.

Acep Purqon; Sparisoma Viridi



The Grain Milling Oilseed Processing Industry  

E-Print Network [OSTI]

& 10 Prepared by: Sondra Rademacher ­ Business Service Specialist, Mankato, Mn. Garey Ferguson ­ Business Service Specialist, Fairmont, Mn. Sue Wold ­ Business Services Specialist, Faribault, Mn. David-19 Diamond of Advantage for Grain and Oilseed Processing Industry Attachment A Minnesota's Food Manufacturing

Levinson, David M.


The Flow of Cohesionless Grains in Fluids  

Science Journals Connector (OSTI)

...magnitude of a certain 'bed load' of grains in transit...tangential stress. The bed load is independent both of...any additional suspended load and of the degree of dispersion...found with experimental data both for wind-blown...the square or the first power of the rate of shear...




Broader source: Energy.gov (indexed) [DOE]

Oil Oil Fossil Energy Study Guide: Oil Pet roleum-or cr ude oil-is a fossil fuel that is found in large quantities beneath the Earth's sur face and is often used as a fuel or raw material in the chemical indust r y. It is a smelly, yellow-to-black liquid and is usually found in underg round areas called reser voirs. If you could look down an oil well and see oil where Nature created it, you might be surprised. You wouldn't see a big underground lake, as a lot of people think. Oil doesn't exist in deep, black pools. In fact, an underground oil formation-an "oil reservoir"-looks very much like any other rock formation. Oil exists in this underground formation as tiny droplets trapped inside the open spaces, called "pores," inside rocks. Th



Broader source: Energy.gov (indexed) [DOE]

LOOKING DOWN AN OIL WELL LOOKING DOWN AN OIL WELL Ever wonder what oil looks like underground, down deep, hundreds or thousands of feet below the surface, buried under millions of tons of rock and dirt? If you could look down an oil well and see oil where nature created it, you might be surprised. You wouldn't see a big underground lake, as a lot of people think. Oil doesn't exist in deep, black pools. In fact, an underground oil formation-called an "oil reservoir" -looks very much like any other rock formation. It looks a lot like...well, rock. Oil exists underground as tiny droplets trapped inside the open spaces, called "pores," inside rocks. Th e "pores" and the oil droplets can be seen only through a microscope. Th e droplets cling to the rock, like drops of water cling


Oil and Gas Supply Module  

U.S. Energy Information Administration (EIA) Indexed Site

Oil and Gas Supply Module Oil and Gas Supply Module This page inTenTionally lefT blank 119 U.S. Energy Information Administration | Assumptions to the Annual Energy Outlook 2013 Oil and Gas Supply Module The NEMS Oil and Gas Supply Module (OGSM) constitutes a comprehensive framework with which to analyze crude oil and natural gas exploration and development on a regional basis (Figure 8). The OGSM is organized into 4 submodules: Onshore Lower 48 Oil and Gas Supply Submodule, Offshore Oil and Gas Supply Submodule, Oil Shale Supply Submodule[1], and Alaska Oil and Gas Supply Submodule. A detailed description of the OGSM is provided in the EIA publication, Model Documentation Report: The Oil and Gas Supply Module (OGSM), DOE/EIA-M063(2011), (Washington, DC, 2011). The OGSM provides


Oil Price Volatility  

U.S. Energy Information Administration (EIA) Indexed Site

Speculation and Oil Price Volatility Speculation and Oil Price Volatility Robert J. Weiner Robert J. Weiner Professor of International Business, Public Policy & Professor of International Business, Public Policy & Public Administration, and International Affairs Public Administration, and International Affairs George Washington University; George Washington University; Membre Associ Membre Associ é é , GREEN, Universit , GREEN, Universit é é Laval Laval EIA Annual Conference Washington Washington 7 April 2009 7 April 2009 1 FACTORS DRIVNG OIL PRICE VOLATILITY FACTORS DRIVNG OIL PRICE VOLATILITY ► ► Market fundamentals Market fundamentals . . Fluctuations in supply, Fluctuations in supply, demand, and market power demand, and market power Some fundamentals related to expectations of Some fundamentals related to expectations of


Winter Crude Oil and  

Gasoline and Diesel Fuel Update (EIA)

4 4 Notes: While the relatively low stock forecast (although not as low as last winter) adds some extra pressure to prices, the price of crude oil could be the major factor affecting heating oil prices this winter. The current EIA forecast shows residential prices averaging $1.29 this winter, assuming no volatility. The average retail price is about 7 cents less than last winter, but last winter included the price spike in November 2000, December 2000, and January 2001. Underlying crude oil prices are currently expected to be at or below those seen last winter. WTI averaged over $30 per barrel last winter, and is currently forecast to average about $27.50 per barrel this winter. As those of you who watch the markets know, there is tremendous uncertainty in the amount of crude oil supply that will be available this winter. Less


Oil Market Assessment  

Gasoline and Diesel Fuel Update (EIA)

Logo Oil Market Assessment - September Logo Oil Market Assessment - September 12, 2001 EIA Home Page Based on Energy Information Administration (EIA) contacts and trade press reports, overall U.S. and global oil supplies appear to have been minimally impacted by yesterday's terrorist attacks on the World Trade Center and the Pentagon. Rumors of scattered closures of U.S. refineries, pipelines, and terminals were reported, and Louisiana Offshore Oil Port operations were partially suspended. While the NYMEX and New York Harbor were temporarily closed, operations are expected to resume soon. Most, if not all petroleum industry infrastructure is expected to resume normal operations today or in the very near term. Prices at all levels (where markets were open) posted increases yesterday, but many prices fell today, as initial reactions

Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Residential Heating Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

This chart highlights residential heating oil prices for the current and This chart highlights residential heating oil prices for the current and past heating season. As you can see, prices have started the heating season, about 40 to 50 cents per gallon higher than last year at this time. The data presented are from EIA's State Heating Oil and Propane Program. We normally collect and publish this data twice a month, but given the low stocks and high prices, we started tracking the prices weekly. These data will also be used to determine the price trigger mechanism for the Northeast Heating Oil Reserve. The data are published at a State and regional level on our web site. The slide is to give you some perspective of what is happening in these markets, since you probably will get a number of calls from local residents about their heating fuels bills


India: Becoming well oiled  

Science Journals Connector (OSTI)

... been stirred into vigorous action and its redoubled efforts to find more oil onshore and offshore are beginning to yield results. From onshore fields in Assam and Gujarat, production this ... figure will go up to 11 million tonnes.




Production of Shale Oil  

E-Print Network [OSTI]

Intensive pre-project feasibility and engineering studies begun in 1979 have produced an outline plan for development of a major project for production of shale oil from private lands in the Piceance Basin in western Colorado. This outline plan...

Loper, R. D.



Steadying of oil prices  

Science Journals Connector (OSTI)

Oil prices have fallen below the 30 dollar mark ... in the lower half of OPEC’s target price band. Will OPEC manage to maintain high prices and revenues by restricting production?

Klaus Matthies


Imbibition assisted oil recovery  

E-Print Network [OSTI]

analyzed in detail to investigate oil recovery during spontaneous imbibition with different types of boundary conditions. The results of these studies have been upscaled to the field dimensions. The validity of the new definition of characteristic length...

Pashayev, Orkhan H.



Sound Oil Company  

Broader source: Energy.gov (indexed) [DOE]

Sound Oil Company Sound Oil Company file:///C|/Documents%20and%20Settings/blackard/Desktop/EIA/LEE0152.HTM[11/29/2012 2:30:44 PM] DECISION AND ORDER OF THE DEPARTMENT OF ENERGY Application for Exception Name of Petitioner: Sound Oil Company Date of Filing: August 16, 1994 Case Number: LEE-0152 On August 16, 1994, Sound Oil Company (Sound) of Seattle Washington, filed an Application for Exception with the Office of Hearings and Appeals of the Department of Energy. In its Application, Sound requests that it be relieved of the requirement that it file the Energy Information Administration's (EIA) form entitled "Resellers'/Retailers' Monthly Petroleum Product Sales Report" (Form EIA-782B). As explained below, we have determined that the Application for Exception should be denied.


Oil Reserves and Production  

Science Journals Connector (OSTI)

...research-article Oil Reserves and Production Eric Drake The growth of world energy requirements over the last...remaining proved recoverable reserves will probably decline continuously...to grow. The declining reserves will be insufficient to...



Crude Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

20.86 20.67 20.47 20.24 20.32 19.57 See footnotes at end of table. 21. Domestic Crude Oil First Purchase Prices Energy Information Administration Petroleum Marketing Annual...


Crude Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

19.11 18.73 18.63 17.97 18.75 18.10 See footnotes at end of table. 21. Domestic Crude Oil First Purchase Prices Energy Information Administration Petroleum Marketing Annual...


Oil shale research in China  

SciTech Connect (OSTI)

There have been continued efforts and new emergence in oil shale research in Chine since 1980. In this paper, the studies carried out in universities, academic, research and industrial laboratories in recent years are summarized. The research areas cover the chemical structure of kerogen; thermal behavior of oil shale; drying, pyrolysis and combustion of oil shale; shale oil upgrading; chemical utilization of oil shale; retorting waste water treatment and economic assessment.

Jianqiu, W.; Jialin, Q. (Beijing Graduate School, Petroleum Univ., Beijing (CN))



Biocatalysis in Oil Refining  

SciTech Connect (OSTI)

Biocatalysis in Oil Refining focuses on petroleum refining bioprocesses, establishing a connection between science and technology. The micro organisms and biomolecules examined for biocatalytic purposes for oil refining processes are thoroughly detailed. Terminology used by biologists, chemists and engineers is brought into a common language, aiding the understanding of complex biological-chemical-engineering issues. Problems to be addressed by the future R&D activities and by new technologies are described and summarized in the last chapter.

Borole, Abhijeet P [ORNL; Ramirez-Corredores, M. M. [BP Global Fuels Technology



Oil spill response resources  

E-Print Network [OSTI]

from Marathon Oil Company for their encouragement and support. Last, but not least, I would like to thank Lynette Schlandt for her help during my stay at this University. vu TABLE OF CONTENTS Page ABSTRACT. . . . . nl DEDICATION... tool for control. The State of Texas passed and implemented OSPRA (Oil Spill Prevention and Response Act) of 1991. The most significant requirement for both these laws was the need for a Facility Response Plan for the companies. This would help a...

Muthukrishnan, Shankar



Oil/gas collector/separator for underwater oil leaks  

DOE Patents [OSTI]

An oil/gas collector/separator for recovery of oil leaking, for example, from an offshore or underwater oil well. The separator is floated over the point of the leak and tethered in place so as to receive oil/gas floating, or forced under pressure, toward the water surface from either a broken or leaking oil well casing, line, or sunken ship. The separator is provided with a downwardly extending skirt to contain the oil/gas which floats or is forced upward into a dome wherein the gas is separated from the oil/water, with the gas being flared (burned) at the top of the dome, and the oil is separated from water and pumped to a point of use. Since the density of oil is less than that of water it can be easily separated from any water entering the dome.

Henning, Carl D. (Livermore, CA)



Grain Refinement of Permanent Mold Cast Copper Base Alloys  

SciTech Connect (OSTI)

Grain refinement is a well established process for many cast and wrought alloys. The mechanical properties of various alloys could be enhanced by reducing the grain size. Refinement is also known to improve casting characteristics such as fluidity and hot tearing. Grain refinement of copper-base alloys is not widely used, especially in sand casting process. However, in permanent mold casting of copper alloys it is now common to use grain refinement to counteract the problem of severe hot tearing which also improves the pressure tightness of plumbing components. The mechanism of grain refinement in copper-base alloys is not well understood. The issues to be studied include the effect of minor alloy additions on the microstructure, their interaction with the grain refiner, effect of cooling rate, and loss of grain refinement (fading). In this investigation, efforts were made to explore and understand grain refinement of copper alloys, especially in permanent mold casting conditions.

M.Sadayappan; J.P.Thomson; M.Elboujdaini; G.Ping Gu; M. Sahoo



Increasing the Consumption of Whole Grain Foods in School Meals  

E-Print Network [OSTI]

nutritious meals in their cafeterias, while maintaining customer acceptance of the foods. Whether or not students consume whole grains determines if these foods are served again. Input from participants determined which whole grain were foods tested...

Warren, Cynthia Ann



Optimising the Use of Spent Oil Shale.  

E-Print Network [OSTI]

??Worldwide deposits of oil shales are thought to represent ~3 trillion barrels of oil. Jordanian oil shale deposits are extensive and high quality, and could… (more)





E-Print Network [OSTI]

during oil shale retorting: retort water and gas condensate.commercial oil shale plant, retort water and gas condensateunique to an oil shale retort water, gas condensate, and

Fox, J.P.



Enhanced Oil Recovery | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Enhanced Oil Recovery Enhanced Oil Recovery Cross-section illustrating how carbon dioxide and water can be used to flush residual oil from a subsurface rock formation between...


Oil Prices and Long-Run Risk.  

E-Print Network [OSTI]

??I show that relative levels of aggregate consumption and personal oil consumption provide anexcellent proxy for oil prices, and that high oil prices predict low… (more)




heavy_oil | netl.doe.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Heavy Oil Publications KMD Contacts Project Summaries EPAct 2005 Arctic Energy Office Announcements Software Stripper Wells Heavy oil is a vast U.S. oil resource that is...

Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Deepwater Oil & Gas Resources | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Deepwater Oil & Gas Resources Deepwater Oil & Gas Resources The United States has significant natural gas and oil reserves. But many of these resources are increasingly harder to...


Oil and Gas Supply Module  

Gasoline and Diesel Fuel Update (EIA)

1 1 U.S. Energy Information Administration | Assumptions to the Annual Energy Outlook 2012 Oil and Gas Supply Module The NEMS Oil and Gas Supply Module (OGSM) constitutes a comprehensive framework with which to analyze crude oil and natural gas exploration and development on a regional basis (Figure 8). The OGSM is organized into 4 submodules: Onshore Lower 48 Oil and Gas Supply Submodule, Offshore Oil and Gas Supply Submodule, Oil Shale Supply Submodule[1], and Alaska Oil and Gas Supply Submodule. A detailed description of the OGSM is provided in the EIA publication, Model Documentation Report: The Oil and Gas Supply Module (OGSM), DOE/EIA-M063(2011), (Washington, DC, 2011). The OGSM provides crude oil and natural gas short-term supply parameters to both the Natural Gas Transmission and Distribution Module and the Petroleum


Economic effects of peak oil  

Science Journals Connector (OSTI)

Assuming that global oil production peaked, this paper uses scenario analysis to show the economic effects of a possible supply shortage and corresponding rise in oil prices in the next decade on different sectors in Germany and other major economies such as the US, Japan, China, the OPEC or Russia. Due to the price-inelasticity of oil demand the supply shortage leads to a sharp increase in oil prices in the second scenario, with high effects on GDP comparable to the magnitude of the global financial crises in 2008/09. Oil exporting countries benefit from high oil prices, whereas oil importing countries are negatively affected. Generally, the effects in the third scenario are significantly smaller than in the second, showing that energy efficiency measures and the switch to renewable energy sources decreases the countries' dependence on oil imports and hence reduces their vulnerability to oil price shocks on the world market.

Christian Lutz; Ulrike Lehr; Kirsten S. Wiebe



Suggestions for Controlling Insects in Farm-Stored Grain.  

E-Print Network [OSTI]

storage structures, or too high temperatures and high grain moisture at binning. Importance of Keeping Insects Out of Stored Grains Grain prices are based on clean, dry, wholesome grain. Anythirig that lowers quality also lowers its price. Insect... tetrachloride odor Ethyhme Yes Poor None Sweet Depresses dibromide Ethylene Yes Poor High Ether Little dichloride odor Chloropicrin Yes Poor None Tear gas Depresses Sulfur dioxide Yes None Irritating Destroys Methyl Yes Excellent None None Depresses...

Hamman, Philip J.



Molecular Aspects of Storage Protein and Starch Synthesis in Wheat and Rice Seeds  

Science Journals Connector (OSTI)

Seed formation in cereals is accompanied by the mobilization and transport of nitrogen from leaves and other source tissues to the developing cereal grain. Nitrogen enters the seed primarily as amino acids, of...

Thomas Okita; Arun Aryan; Christopher Reeves; Woo Taek Kim…



Synthesis of fine-grained TATB  

DOE Patents [OSTI]

A method for producing fine-grained triamino-trinitrobenzene (TATB) powders having improved detonation-spreading performance and hence increased shock sensitivity when compared with that for ultrafine TATB is described. A single-step, sonochemical amination of trichloro-trinitrobenzene using ammonium hydroxide solution in a sealed vessel yields TATB having approximately 6 .mu.m median particle diameter and increased shock sensitivity.

Lee, Kien-Yin (Santa Fe, NM); Kennedy, James E. (Santa Fe, NM)



ANNIVERSARY REVIEW Grain boundary energy anisotropy: a review  

E-Print Network [OSTI]

grain boundary energy anisot- ropy. Experimental methods for measuring the grain boundary energy. The paper contains a brief survey of historical concepts and grain boundary energy measurements. Next an excess free energy per unit area. This is evident by the fact that during most thermal and chemical

Rohrer, Gregory S.


Overexpression of the maize Corngrass1 microRNA prevents flowering, improves digestibility, and increases starch content of switchgrass  

Science Journals Connector (OSTI)

...accumulates in stems.Cg1 switchgrass aerial stems store starch and initiate both roots...maize . Plant Cell 6 : 1343 – 1355 . 28 Fukushima RS Hatfield RD ( 2004 ) Comparison of the acetyl bromide...CAAGTGCTACGGCAAGGAGG CGTGAGGGTCATTGTCTTCTGC 1. Fukushima RS, Hatfield RD (2004) Comparison...

George S. Chuck; Christian Tobias; Lan Sun; Florian Kraemer; Chenlin Li; Dean Dibble; Rohit Arora; Jennifer N. Bragg; John P. Vogel; Seema Singh; Blake A. Simmons; Markus Pauly; Sarah Hake




E-Print Network [OSTI]

INFLUENCE OF D.I.C HYDROTHERMAL PROCESS CONDITIONS ON THE GELATINIZATION PROPERTIES OF STANDARD ABSTRACT Standard maize starch was hydrothermally treated at residual moisture content (~12 %) by Instantaneous Controlled Pressure Drop for various pressure levels and processing times. In order to examine

Paris-Sud XI, Université de


Structure of the Arabidopsis Glucan Phosphatase LIKE SEX FOUR2 Reveals a Unique Mechanism for Starch Dephosphorylation  

Science Journals Connector (OSTI)

...diets and a key constituent in many manufacturing processes. Starch is composed of two...F162A/W136A/R157A/F261A) show additive effects, implying that the sites function...physicochemical properties, thus enhancing manufacturing of feedstock for both food and nonfood...

David A. Meekins; Hou-Fu Guo; Satrio Husodo; Bradley C. Paasch; Travis M. Bridges; Diana Santelia; Oliver Kötting; Craig W. Vander Kooi; Matthew S. Gentry



Apple Maturity Protocol Tests for apple flesh firmness and starch conversion are important tools for monitoring crop  

E-Print Network [OSTI]

Apple Maturity Protocol Tests for apple flesh firmness and starch conversion are important tools for monitoring crop maturity. Flesh firmness, as measured with a pressure gauge, determines how long apples can adequate firmness for fresh market or processing uses. A second common assay for apple maturity


Process for producing large grain cadmium telluride  

DOE Patents [OSTI]

A process is described for producing a cadmium telluride polycrystalline film having grain sizes greater than about 20 {micro}m. The process comprises providing a substrate upon which cadmium telluride can be deposited and placing that substrate within a vacuum chamber containing a cadmium telluride effusion cell. A polycrystalline film is then deposited on the substrate through the steps of evacuating the vacuum chamber to a pressure of at least 10{sup {minus}6} torr.; heating the effusion cell to a temperature whereat the cell releases stoichiometric amounts of cadmium telluride usable as a molecular beam source for growth of grains on the substrate; heating the substrate to a temperature whereat a stoichiometric film of cadmium telluride can be deposited; and releasing cadmium telluride from the effusion cell for deposition as a film on the substrate. The substrate then is placed in a furnace having an inert gas atmosphere and heated for a sufficient period of time at an annealing temperature whereat cadmium telluride grains on the substrate grow to sizes greater than about 20 {micro}m.

Hasoon, F.S.; Nelson, A.J.



Abandoned oil fields in Oklahoma  

SciTech Connect (OSTI)

Data are presented for approximately 165 abandoned oil fields in Oklahoma that have produced 10,000 or more barrels of oil prior to abandonment. The following information is provided for each field: county; DOE field code; field name; AAPG geologic province code; discovery date of field; year of last production, if known; discovery well operator; proven acreage; formation thickness; depth of field; gravity of oil production; calendar year; yearly field oil production; yearly field gas production; cumulative oil production; cumulative gas production; number abandoned fields in county; cumulative production of oil from fields; and cumulative production of gas from fields. (ATT)

Chism, J.



Used oil re-refining  

SciTech Connect (OSTI)

Used oils, especially used lubricating oils which are normally considered waste and are discarded or burned, are reclaimed for reuse by a re-refining procedure involving the steps of: heat soaking the used oil; distilling the heat soaked oil; passing the distillate through a guard bed of activated material; hydrotreating the guard bed treated distillate under standard hydrotreating conditions. If the used oil to be re-refined contains a quantity of water and/or fuel fraction which the practioner considers sufficiently large to be detrimental, the used oil may be subjected to a dewatering/defueling step prior to being heat soaked.

Reid, L. E.; Ryan, D. G.; Yao, K. C.



MECS Fuel Oil Tables  

U.S. Energy Information Administration (EIA) Indexed Site

: Actual, Minimum and Maximum Use Values for Fuel Oils and Natural Gas : Actual, Minimum and Maximum Use Values for Fuel Oils and Natural Gas Year Distillate Fuel Oil (TBtu) Actual Minimum Maximum Discretionary Rate 1985 185 148 1224 3.4% 1994 152 125 1020 3.1% Residual Fuel Oil (TBtu) Actual Minimum Maximum Discretionary Rate 1985 505 290 1577 16.7% 1994 441 241 1249 19.8% Natural Gas (TBtu) Actual Minimum Maximum Discretionary Rate 1985 4656 2702 5233 77.2% 1994 6141 4435 6758 73.4% Source: Energy Information Administration, Office of Energy Markets and End Use, 1985 and 1994 Manufacturing Energy Consumption Surveys. Table 2: Establishments That Actually Switched Between Natural Gas and Residual Fuel Oil Type of Switch Number of Establishments in Population Number That Use Original Fuel Percentage That Use Original Fuel Number That Can Switch to Another Fuel Percentage That Can Switch to Another Fuel Number That Actually Made a Switch Percentage That Actually Made a Switch


Enhanced Oil Recovery and Other Oil Resources projects  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Enhanced Oil Recovery and Other Oil Resources Enhanced Oil Recovery and Other Oil Resources Enhanced Oil Recovery and Other Oil Resources CO2 EOR | Other EOR & Oil Resources | Environmental | Completed Oil Projects Project Number Project Name Primary Performer DE-FE0013723 Development of Nanoparticle-Stabilized Foams To Improve Performance of Water-less Hydraulic Fracturing The University of Texas at Austin DE-FE0010799 Small Molecular Associative Carbon Dioxide (CO2) Thickeners for Improved Mobility Control University of Pittsburgh DE-FE0006011 Development of Real Time Semi-autonomous Geophysical Data Acquisition and Processing System to Monitor Flood Performance White River Technologies DE-FE0005979 Nanoparticle-stabilized CO2 Foam for CO2 EOR Application New Mexico Institute of Mining and Technology


Oil Prices, Opec and the Poor Oil Consuming Countries  

Science Journals Connector (OSTI)

In 1950, the year O.P.E.C. (Organisation of Petroleum Exporting Countries) was formed, the world oil industry was dominated by a group of seven oligopolistic major international oil companies, who were collective...

Biplab Dasgupta



Compare All CBECS Activities: Fuel Oil Use  

Gasoline and Diesel Fuel Update (EIA)

of fuel oil in 1999. Only six building types had any statistically significant fuel oil usage, with education buildings using the most total fuel oil. Figure showing total fuel oil...


Used Oil and Filter Disposal Used Oil: Create a segregated storage area or container. Label the container "Waste Oil Only".  

E-Print Network [OSTI]

Used Oil and Filter Disposal Used Oil: Create a segregated storage area or container. Label the container "Waste Oil Only". Maintain a written log to document all amounts and types of oil added to the container. No solvents, oil contaminated with solvents, PCBs, non-petroleum based oils, or any other

Maroncelli, Mark


Spot-Oiling Johnsongrass.  

E-Print Network [OSTI]

I TEXAS AGRICULTURAL EXTENSIO-N SERVICE G. G. Gibson, Director, College Station, Texas [Blank Page in Original Bulletin] I the bast I ir used the low I . .. 1 the fol or mort , needed SPOT-OILING JOHNSONGRASS H. E. Rea, M. J. Norris..., and Fred C. Elliott* Texas A. & M. College System ~HNSONGRASS CAN BE killed to the i ground by the application of 1 / 3 teaspoonful of a herbicidal oil to the crown of each stem. Eradication of established Johnsongrass can be obtained in a single...

Elliott, Fred C.; Norris, M. J.; Rea, H. E.


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


STEO September 2012 - oil production  

U.S. Energy Information Administration (EIA) Indexed Site

oil production forecast to rise almost 700,000 bpd this oil production forecast to rise almost 700,000 bpd this year, help cut U.S. petroleum imports U.S. crude oil production is expected to average 6.3 million barrels per day in 2012. That's up nearly 700,000 barrels per day from last year and the highest annual oil output since 1997 says the U.S. Energy Information Administration in its new monthly short-term energy outlook for September. EIA analyst Sam Gorgen explains: "Higher oil supplies, especially from North Dakota and Texas, boosted U.S. oil production. The number of on-shore drilling rigs targeting oil nationwide has increased by around 200 so far this year to just under 1,400 rigs." Higher domestic oil production will help cut U.S. petroleum imports. The share of total U.S.


Regional Residential Heating Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

One of the first places where consumers are feeling the impact of One of the first places where consumers are feeling the impact of this winter's market pressures is in home heating oil prices. This chart shows prices through February 28, the most recent EIA data available. The general level of heating oil prices each year is largely a function of crude oil prices, and the price range over the course of the heating season is typically about 10 cents per gallon. Exceptions occur in unusual circumstances, such as very cold weather, large changes in crude oil prices, or supply problems. Heating oil prices for East Coast consumers started this winter at just over $1 per gallon, but rising crude oil prices drove them up nearly 21 cents through mid-January. With the continuing upward pressure from crude oil markets, magnified by a regional shortfall of heating oil


Oil and Gas Conservation (Montana)  

Broader source: Energy.gov [DOE]

Parts 1 and 2 of this chapter contain a broad range of regulations pertaining to oil and gas conservation, including requirements for the regulation of oil and gas exploration and extraction by the...


Residential heating oil prices decrease  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil prices decrease The average retail price for home heating oil fell 1.7 cents from a week ago to 4.02 per gallon. That's up 1.7 cents from a year ago, based on the...


Residential heating oil price decreases  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

heating oil price decreases The average retail price for home heating oil fell 7.8 cents from a week ago to 3.14 per gallon. That's down 81.1 cents from a year ago, based on the...


Residential heating oil price decreases  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

heating oil price decreases The average retail price for home heating oil fell 10.5 cents from a week ago to 3.22 per gallon. That's down 73.6 cents from a year ago, based on the...


Residential heating oil price decreases  

Gasoline and Diesel Fuel Update (EIA)

heating oil price decreases The average retail price for home heating oil fell 1.8 cents from a week ago to 2.82 per gallon. That's down 1.36 from a year ago, based on the...


Residential heating oil prices decline  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

heating oil price decreases The average retail price for home heating oil fell 2 cents from a week ago to 3.36 per gallon. That's down 52.5 cents from a year ago, based on the...


Residential heating oil prices increase  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil prices increase The average retail price for home heating oil rose 3.9 cents last week to 3.96 per gallon. That's down 2.6 cents from a year ago, based on the...


Residential heating oil price decreases  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

05, 2014 Residential heating oil price decreases The average retail price for home heating oil fell 1.9 cents from a week ago to 3.43 per gallon. That's down 39 cents from a year...


Residential heating oil price decreases  

U.S. Energy Information Administration (EIA) Indexed Site

4 Residential heating oil price decreases The average retail price for home heating oil fell 1.6 cents from a week ago to 3.42 per gallon. That's down 39.5 cents from a year ago,...


Residential heating oil prices decrease  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

heating oil price decreases The average retail price for home heating oil fell 2.9 cents from a week ago to 3.45 per gallon. That's down 36.6 cents from a year ago, based on the...


Residential heating oil prices decline  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil price decreases The average retail price for home heating oil fell 3.3 cents from a week ago to 3.38 per gallon. That's down 43.9 cents from a year ago, based on the...


Residential heating oil prices increase  

U.S. Energy Information Administration (EIA) Indexed Site

5, 2014 Residential heating oil prices increase The average retail price for home heating oil rose 6.5 cents from a week ago to 4.24 per gallon. That's up 14.9 cents from a year...


Residential heating oil price decreases  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

6, 2014 Residential heating oil price decreases The average retail price for home heating oil rose 1.6 cents from a week ago to 4.24 per gallon. That's up 8.9 cents from a year...


Residential heating oil prices decline  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

heating oil price decreases The average retail price for home heating oil fell 6.3 cents from a week ago to 3.08 per gallon. That's down 90.3 cents from a year ago, based on the...


Residential heating oil price decreases  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil price decreases The average retail price for home heating oil fell 3.8 cents from a week ago to 3.33 per gallon. That's down 59.1 cents from a year ago, based on the...


Residential heating oil prices increase  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil prices increase The average retail price for home heating oil rose 5.4 cents from a week ago to 4.04 per gallon. That's up 4.9 cents from a year ago, based on the...


Residential heating oil prices increase  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil prices increase The average retail price for home heating oil rose 2.9 cents from a week ago to 3.98 per gallon. That's up 6-tenths of a penny from a year ago, based...


Residential heating oil prices increase  

U.S. Energy Information Administration (EIA) Indexed Site

3, 2014 Residential heating oil prices increase The average retail price for home heating oil rose 4.4 cents from a week ago to 4.06 per gallon. That's up 4.1 cents from a year...

Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Residential heating oil prices decline  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil prices decline The average retail price for home heating oil is 3.48 per gallon. That's down 4.5 cents from a week ago, based on the residential heating fuel survey by...


Residential heating oil prices decrease  

U.S. Energy Information Administration (EIA) Indexed Site

5, 2014 Residential heating oil prices decrease The average retail price for home heating oil fell 1.8 cents from a week ago to 4.00 per gallon. That's down 2-tenths of a cent...


Residential heating oil prices increase  

U.S. Energy Information Administration (EIA) Indexed Site

heating oil prices increase The average retail price for home heating oil rose 12 cents from a week ago to 4.18 per gallon. That's up 13 cents from a year ago, based on the...


Cooling power of quenching oils  

Science Journals Connector (OSTI)

Industrial oils 20 and 20V have the best cooling powers of all quenching oils (used in the USSR). They secure high cooling rates at low temperatures, have a satisfactory...

L. V. Petrash



Virent is Replacing Crude Oil  

Broader source: Energy.gov [DOE]

Breakout Session 2A—Conversion Technologies II: Bio-Oils, Sugar Intermediates, Precursors, Distributed Models, and Refinery Co-Processing Virent is Replacing Crude Oil Randy Cortright, Founder & Chief Technology Officer, Virent



E-Print Network [OSTI]

)-based simulation tools to a modified in-situ process for production of oil from oil shale. The simulation tools

Michal Hradisky; Philip J. Smith; Doe Award; No. De-fe



invert(ed) (oil) emulsion (drilling) mud  

Science Journals Connector (OSTI)

invert(ed) (oil) emulsion (drilling) mud, water-in-oil (drilling) mud ? Wasser-in-Öl-(Bohr)...m, (f)



water-in-oil (drilling) mud  

Science Journals Connector (OSTI)

water-in-oil (drilling) mud, invert(ed) (oil) emulsion (drilling) mud ? Wasser-in-Öl-(Bohr)...m, (f)



Process for the production of refrigerator oil  

SciTech Connect (OSTI)

A process for producing a high quality refrigerator oil from an oil fraction boiling at a temperature within boiling point of lubricating oil by contacting said oil fraction with a solvent to extract undesirable components thereby lowering % C..cap alpha.. of said oil fraction, hydrogenating said solvent extracted fraction under the specific conditions, and then contacting said hydrogenated oil with a solid absorbant to remove impurities; said oil fraction being obtained from a low grade naphthenic crude oil.

Kunihiro, T.; Tsuchiya, K.



Biomass Derivatives Competitive with Heating Oil Costs.  

Broader source: Energy.gov [DOE]

Presentation at the May 9, 2012, Pyrolysis Oil Workship on biomass derivatives competitive with heating oil costs.


Nineteenth oil shale symposium proceedings  

SciTech Connect (OSTI)

This book contains 23 selections. Some of the titles are: Effects of maturation on hydrocarbon recoveries from Canadian oil shale deposits; Dust and pressure generated during commercial oil shale mine blasting: Part II; The petrosix project in Brazil - An update; Pathway of some trace elements during fluidized-bed combustion of Israeli Oil Shale; and Decommissioning of the U.S. Department of Energy Anvil Points Oil Shale Research Facility.

Gary, J.H.



Heating Oil and Propane Update  

Gasoline and Diesel Fuel Update (EIA)

Maps of states participating in Winter Fuels Survey Residential propane PADD map Residential heating oil PADD map...


Indicators of Success When Incorporating Whole Grains into School Meals: HealthierUS School Challenge  

E-Print Network [OSTI]

blend whole grain products compared to those made from 100% whole wheat. Additionally, survey participants reported barriers to whole grain food incorporation which included: product acceptability, whole grain product identification, whole grain product...

Sceets, Christine Elizabeth



Oil shale: Technology status report  

SciTech Connect (OSTI)

This report documents the status of the US Department of Energy's (DOE) Oil Shale Program as of the end of FY 86. The report consists of (1) a status of oil shale development, (2) a description of the DOE Oil Shale Program, (3) an FY 86 oil shale research summary, and (4) a summary of FY 86 accomplishments. Discoveries were made in FY 86 about the physical and chemical properties and behavior of oil shales, process chemistry and kinetics, in situ retorting, advanced processes, and the environmental behavior and fate of wastes. The DOE Oil Shale Program shows an increasing emphasis on eastern US oil shales and in the development of advanced oil shale processing concepts. With the award to Foster Wheeler for the design of oil shale conceptual plants, the first step in the development of a systems analysis capability for the complete oil shale process has been taken. Unocal's Parachute Creek project, the only commercial oil shale plant operating in the United States, is operating at about 4000 bbl/day. The shale oil is upgraded at Parachute Creek for input to a conventional refinery. 67 refs., 21 figs., 3 tabs.

Not Available




E-Print Network [OSTI]

OIL ANALYSIS LAB TRIVECTOR ANALYSIS This test method is a good routine test for the overall condition of the oil, the cleanliness, and can indicate the presence of wear metals that could be coming of magnetic metal particles within the oil. This may represent metals being worn from components (i


The effects of grain moisture content and grain temperature on the penetration of hydrogen cyanide  

E-Print Network [OSTI]

as the post fumigation time increased (fig. 12). The greatest rate of 24 Figure 7z Penetration of HCN in interstitial air at concentrations of 5G ppm as effected by moisture and temperature at 4 hours. 17 15 65o Rpo 95' 13 lyon j-57 Figure 8... of the requirements for the degree of MASTER OF SCIENCE (Mionth) 1262 (Year) Mayor Subject ghtdlggllQJLK THE EFFECTS OF GRAIN MOISTURE CONTENT JBD GRAIN TEMPERATURE ON THE PENETRATION OF HYDROGEN CYANIDE A Thesis SIDNEY EDNUND KUNZ Approved as to style...

Kunz, Sidney E



Baltic oil: Moving offshore  

Science Journals Connector (OSTI)

... the consortium of Soviet, Polish and East German oil interests, will sink its first offshore bore-hole in the Baltic. This move follows four years of intensive prospecting, which ... findings. For a time, plans were afort to buy or hire a Vexco drilling rig, but when these had to be abondoned for lack of hard currency, the shut ...

Vera Rich



Oil from Coal  

Science Journals Connector (OSTI)

... sources are not capable of indefinite expansion, since their industrial stability is dependent upon adequate markets for the main products—coke of various kinds or gas. They were, however, ... gallon and remain in operation until 1950, and that it should be extended to include diesel oil used in motor vehicles. It might be feared that this extension would involve ...




Naphthenic lube oils  

SciTech Connect (OSTI)

A process is disclosed for increasing the volume of lubricating oil base stocks recovered from a crude oil. A fraction having an atmospheric boiling range of about 675/sup 0/ to 1100/sup 0/ F. is recovered by vacuum distillation. This fraction is treated with furfural to extract a hydrocarbon mixture containing at least 50 volume % aromatic hydrocarbons. The raffinate is a lubricating oil base stock very high in paraffinic hydrocarbons and low in naphthenic hydrocarbons. The fraction extracted by the furfural contains at least about 50 volume % aromatic hydrocarbons and less than about 10 volume % paraffinic hydrocarbons. The mixture is hydrotreated to hydrogenate a substantial portion of the aromatic hydrocarbons. The hydrotreated product then is catalytically dewaxed. After removal of low boiling components, the finished lubricating oil base stock has a viscosity of at least about 200 SUS at 100/sup 0/ F., a pour point of less than 20/sup 0/ F. and contains at least 50 volume % of naphthenic hydrocarbons, a maximum of about 40 volume % aromatic hydrocarbons, and a maximum of about 10 volume % paraffinic hydrocarbons.

Hettinger Jr., W. P.; Beck, H. W.; Rozman, G. J.; Turrill, F. H.



China and Peak Oil  

Science Journals Connector (OSTI)

In the mid-1950s there was a severe oil shortage in China. Fighter jets and tanks stood still and the buses on Beijing’s streets were fueled from large bags of gas on their roofs. Several drilling teams travel...

Kjell Aleklett


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


North Slope: Oil Rush  

Science Journals Connector (OSTI)

...place of about 46,000, situated on the Chena slough of the Tanana River. It has become...permafrost. The Trans Alaska PipelineW carrying hot oil, may face worse problems. [L. A...Despite all the unanswered questions about hot pipelines and permafrost, the restoring...

Luther J. Carter



Peak oil supply or oil not for sale?  

Science Journals Connector (OSTI)

Abstract The restrictions imposed by climate change are inevitable and will be exerted either via precautionary mitigation of (mainly energy-related) CO2 emissions or via irreversible impacts on ecosystems and on human habitats. Either way, oil markets are bound to incur drastic shrinking. Concern over peak oil supply will crumble when the irrevocable peak oil demand is created. Replacing oil in the world's energy economies requires redirected market forces, notably in the form of steadily increasing oil end-use prices. Yet, thus far, crude oil prices have obeyed the market fundamentals of expanding-contracting demand and oligopolistic supply. A hockey stick supply curve supports high sales prices, providing large rents to submarginal sources. Cutting oil demand and maintaining high prices implies reducing the supply hockey stick's length by curtailing some oil producers. In such a scenario, the alliances, goals, and tactics of oil geopolitics are set to change. We identify a distribution over friendly and hostile oil suppliers, with others drifting in between the two sides. Conflicts and warfare are less aimed at conquering oil fields for exploitation than at paralyzing production capabilities of opponents or of unreliable transient sources. Covert warfare and instigation of internal conflicts are likely tactics to exhaust hostile opponents.

Aviel Verbruggen; Thijs Van de Graaf



Coarse grained open system quantum dynamics  

SciTech Connect (OSTI)

We show that the quantum dynamics of a system comprised of a subspace Q coupled to a larger subspace P can be recast as a reduced set of 'coarse grained' ordinary differential equations with constant coefficients. These equations can be solved by a single diagonalization of a general complex matrix. The method makes no assumptions about the strength of the couplings between the Q and the P subspaces, nor is there any limitation on the initial population in P. The utility of the method is demonstrated via computations in three following areas: molecular compounds, photonic materials, and condensed phases.

Thanopulos, Ioannis [Department of Chemistry, University of British Columbia, Vancouver V6T 1Z3 (Canada); Brumer, Paul [Chemical Physics Theory Group, Department of Chemistry, and Center of Quantum Information and Quantum Control, University of Toronto, Toronto, Ontario M5S 3H6 (Canada); Shapiro, Moshe [Department of Chemistry, University of British Columbia, Vancouver V6T 1Z3 (Canada); Department of Chemical Physics, Weizmann Institute, Rehovot 76100 (Israel)




SciTech Connect (OSTI)

Density functional theory was employed to investigate grain boundary (GB) properties of W alloys. A range of substitutional solutes across the Periodic Table was investigated to understand the behavior of different electronic orbitals in changing the GB cleavage energy in the ?27a[110]{525} GB. A number of transition metals were predicted to enhance the GB cohesion. This includes Ru, Re, Os, Ir, V, Cr, Mn, Fe, Co, Ti, Hf, Ta and Nb. While lanthanides, s and p elements were tended to cause GB embrittlement.

Setyawan, Wahyu; Kurtz, Richard J.



Structural Oil Pan With Integrated Oil Filtration And Cooling System  

DOE Patents [OSTI]

An oil pan for an internal combustion engine includes a body defining a reservoir for collecting engine coolant. The reservoir has a bottom and side walls extending upwardly from the bottom to present a flanged lip through which the oil pan may be mounted to the engine. An oil cooler assembly is housed within the body of the oil pan for cooling lubricant received from the engine. The body includes an oil inlet passage formed integrally therewith for receiving lubricant from the engine and delivering lubricant to the oil cooler. In addition, the body also includes an oil pick up passage formed integrally therewith for providing fluid communication between the reservoir and the engine through the flanged lip.

Freese, V, Charles Edwin (Westland, MI)



Distinct Characteristics of Single Starch-Binding Domain SBD1 Derived from Tandem Domains SBD1-SBD2 of Halophilic Kocuria varians Alpha-Amylase  

Science Journals Connector (OSTI)

Kocuria varians alpha-amylase contains tandem starch-binding domains SBD1-SBD2...Escherichia coli. The circular dichroism (CD) spectrum of His-SBD12 was characterized by a positive peak at 233 nm...

Rui Yamaguchi; Tsutomu Arakawa; Hiroko Tokunaga; Matsujiro Ishibashi…



β-AMYLASE4, a Noncatalytic Protein Required for Starch Breakdown, Acts Upstream of Three Active β-Amylases in Arabidopsis Chloroplasts  

Science Journals Connector (OSTI)

...clarified. Two enzymes, alpha-amylase and beta-amylase, could potentially produce...through the hydrolysis of amylopectin and amylose, the glucans that constitute starch. alpha-Amylase is an endohydrolase and...

Daniel C. Fulton; Michaela Stettler; Tabea Mettler; Cara K. Vaughan; Jing Li; Perigio Francisco; Manuel Gil; Heike Reinhold; Simona Eicke; Gaëlle Messerli; Gary Dorken; Karen Halliday; Alison M. Smith; Steven M. Smith; Samuel C. Zeeman



Use of functionalized metallocene copolymers from ethylene and polar olefins as compatibilizers for low-density-polyethylene/starch and low-density-polyethylene/dextran blends .  

E-Print Network [OSTI]

??Functionalized metallocene copolymers synthesized from ethylene with 5-hexen-1-ol and ethylene with 10-undecen-1-ol were used as compatibilizers in LDPE/starch and LDPE/dextran blends in order to improve… (more)

Domínguez Barceló, Ana María



Grain boundary compositon in NiAl  

SciTech Connect (OSTI)

The high temperature strength and oxidation resistance of many transition metal aluminides makes these intermetallic materials attractive for high temperature applications. However, these aluminides are generally brittle at low temperatures and this restricts their technological applications. However, these aluminides are generally brittle at low temperatures and this restricts their technological applications. It has been demonstrated that the addition of more than 200 ppm of boron to the L1{sub 2}-ordered Ni{sub 3}Al changes the fracture behavior from intergranular to transgranular and increases the ductility. The B2-ordered NiAl nickel aluminide is particularly attractive because of its low density and high melting temperature. This aluminide also fractures intergranularly at room temperature. However, no improvement in ductility is observed with similar boron additions even though the intergranular fracture is suppressed and there is a significant increase in the yield strength. In this paper, the results of an atom probe field ion microscopy investigation of the compositions of the grain boundaries in undoped and boron-doped NiAl are presented. The suitability of the atom probe field ion microscopy technique for the characterization of boundaries has clearly been demonstrated in many previous investigations including the characterization of boron segregation to grain boundaries and other planar features in Ni{sub 3}Al.

Miller, M.K.; Jayaram, R.; Camus, P.P. (Metals and Ceramics Div., Oak Ridge National Lab., Oak Ridge, TN (US))



oil supply | OpenEI  

Open Energy Info (EERE)

oil supply oil supply Dataset Summary Description CIA: World Factbook assessment of proved reserves of crude oil in barrels (bbl). Proved reserves are those quantities of petroleum which, by analysis of geological and engineering data, can be estimated with a high degree of confidence to be commercially recoverable from a given date forward, from known reservoirs and under current economic conditions. Estimated as of January 1st, 2010. Source CIA Date Released January 01st, 2010 (4 years ago) Date Updated Unknown Keywords crude oil energy energy data international oil oil supply Data text/csv icon 2010 Proved Oil Reserves (csv, 4.6 KiB) text/plain icon Original Text Format (txt, 6.5 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency


Measuring Dependence on Imported Oil  

Gasoline and Diesel Fuel Update (EIA)

Dependence on Imported Oil Dependence on Imported Oil by C. William Skinner* U.S. dependence on imported oil** can be measured in at least two ways. The differences hinge largely on whether oil imports are defined as net imports (total imports minus exports) or as total imports. EIA believes that the net-imports definition gives a clearer indication of the fraction of oil consumed that could not have been supplied from domestic sources and is thus the most appropriate measure. With this issue of the Monthly Energy Review, the Energy Information Administration (EIA) introduces a revised table that expresses depend- ence on imports in terms of both measures. How dependent is the United States on foreign oil? How dependent are we on oil from the Persian Gulf or other sensitive areas? Do we import more than we produce domes-


Regional Residential Heating Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

Slide 2 of 11 Notes: One of the first places where consumers are feeling the impact of this winter’s market pressures is in home heating oil prices. This chart shows prices through February 7, the most recent EIA data available. The general level of heating oil prices each year is largely a function of crude oil prices, and the price range over the course of the heating season is typically about 10 cents per gallon. Exceptions occur in unusual circumstances, such as very cold weather, large changes in crude oil prices, or supply problems. Heating oil prices for East Coast consumers started this winter at just over $1 per gallon, but rising crude oil prices drove them up nearly 21 cents per gallon through mid-January. With the continuing upward pressure from crude oil markets, magnified by a regional shortfall of


Oil consumption, pollutant emission, oil proce volatility and economic activities in selected Asian Developing Economies.  

E-Print Network [OSTI]

??It is now well established in the literature that oil consumption, oil price shocks, and oil price volatility may impact the economic activities negatively. Studies… (more)

Rafiq, Shuddhasattwa



Selected Operating Costs for Storage of Sorghum Grain.  

E-Print Network [OSTI]

Selected Operating Costs for Storage Of Sorghum Grain TEXAS A&M UNIVERSITY This is the third of three bulletins reporting the results of a study of sorghum grain storage and handling practices in Texas. The first dealt with marketing and on...-farm storage; the second with com- mercial storage and handling practices. This bulletin reports the results of a study of the costs of com- mercial grain handling practices. Three areas representing a cross section of physical and economic conditions...

Bonnen, C. A. (Clarence Alfred); Cunningham, William C.



Highly exfoliated eco-friendly thermoplastic starch (TPS)/poly (lactic acid)(PLA)/clay nanocomposites using unmodified nanoclay  

Science Journals Connector (OSTI)

Abstract Highly exfoliated, biodegradable thermoplastic starch (TPS)/polylactic acid (PLA)/sodium montmorillonite (NaMMT) nanocomposites were prepared by an eco-friendly approach, involving in-situ gelatinization of potato starch in presence of dispersed nanoclay followed by melt mixing with PLA. The morphological analysis revealed that the NaMMT was selectively dispersed into the TPS in a highly delaminated manner. An increase in mechanical as well as thermomechanical properties was evident in the presence of PLA and more influenced in the presence of clay. The water absorption was significantly decreased in the presence of PLA (?8%) itself and both PLA and clay (?8–12%) in the nanocomposites. The improved mechanical properties along with its biodegradability might lead to a new green material in the area of packaging.

Ayana B.; Supratim Suin; B.B. Khatua



MECS Fuel Oil Figures  

U.S. Energy Information Administration (EIA) Indexed Site

: Percentage of Total Purchased Fuels by Type of Fuel : Percentage of Total Purchased Fuels by Type of Fuel Figure 1. Percent of Total Purchased Fuel Sources: Energy Information Administration. Office of Energy Markets and End Use, Manufacturing Energy Consumption Survey (MECS): Consumption of Energy; U.S. Department of Commerce, Bureau of the Census, Annual Survey of Manufactures (ASM): Statistics for Industry Groups and Industries: Statistical Abstract of the United States. Note: The years below the line on the "X" Axis are interpolated data--not directly from the Manufacturing Energy Consumption Survey or the Annual Survey of Manufactures. Figure 2: Changes in the Ratios of Distillate Fuel Oil to Natural Gas Figure 2. Changes in the Ratios of Distillate Fuel Oil to Natural Gas Sources: Energy Information Administration. Office of



U.S. Energy Information Administration (EIA) Indexed Site

Fuel Oil Usage Form Fuel Oil Usage Form 1999 Commercial Buildings Energy Consumption Survey (CBECS) 1. Timely submission of this report is mandatory under Public Law 93-275, as amended. 2. This completed report is due by 3. Data reported on this questionnaire are for the entire building identified in the label to the right. 4. Data may be submitted directly on this questionnaire or in any other format, such as a computer-generated listing, which provides the same i nformation and is conve nient for y our company. a. You may submit a single report for the entire building, or if it i s easier, a separate report for each of several accounts in the building. These will then be aggregated by the survey contractor. b. If you are concerned about your individual account information, you may c


Shale oil recovery process  

DOE Patents [OSTI]

A process of producing within a subterranean oil shale deposit a retort chamber containing permeable fragmented material wherein a series of explosive charges are emplaced in the deposit in a particular configuration comprising an initiating round which functions to produce an upward flexure of the overburden and to initiate fragmentation of the oil shale within the area of the retort chamber to be formed, the initiating round being followed in a predetermined time sequence by retreating lines of emplaced charges developing further fragmentation within the retort zone and continued lateral upward flexure of the overburden. The initiating round is characterized by a plurality of 5-spot patterns and the retreating lines of charges are positioned and fired along zigzag lines generally forming retreating rows of W's. Particular time delays in the firing of successive charges are disclosed.

Zerga, Daniel P. (Concord, CA)



Oil shale retort apparatus  

DOE Patents [OSTI]

A retorting apparatus including a vertical kiln and a plurality of tubes for delivering rock to the top of the kiln and removal of processed rock from the bottom of the kiln so that the rock descends through the kiln as a moving bed. Distributors are provided for delivering gas to the kiln to effect heating of the rock and to disturb the rock particles during their descent. The distributors are constructed and disposed to deliver gas uniformly to the kiln and to withstand and overcome adverse conditions resulting from heat and from the descending rock. The rock delivery tubes are geometrically sized, spaced and positioned so as to deliver the shale uniformly into the kiln and form symmetrically disposed generally vertical paths, or "rock chimneys", through the descending shale which offer least resistance to upward flow of gas. When retorting oil shale, a delineated collection chamber near the top of the kiln collects gas and entrained oil mist rising through the kiln.

Reeves, Adam A. (Grand Junction, CO); Mast, Earl L. (Norman, OK); Greaves, Melvin J. (Littleton, CO)



Heating oils, 1982  

SciTech Connect (OSTI)

Properties of 235 heating oils marketed in the United States were submitted for study and compilation under agreement between BETC and API. The fuels were manufactured by 25 petroleum refining companies in 88 domestic refineries. The data are tabulated according to six grades of fuel and subdivided into five geographic regions in which the fuels are marketed. The five regions containing a total of 16 marketing districts are shown on a map in the report. Trend charts are included showing average properties of the six grades of fuel for the past several years. Summaries of the results of the tests by grade and by region for 1982 compared with data for 1981 are tabulated. Analyses of grade 6 foreign import oils are presented.

Shelton, E.M.


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Heating oils, 1980  

SciTech Connect (OSTI)

Properties of 247 heating oils marketed in the United States were submitted for study and compilation under agreement between the Bartlesville Energy Technology Center and the American Petroleum Institute. The fuels were manufactured by 26 petroleum refining companies in 87 domestic refineries. The data are tabulated according to six grades of fuel and subdivided into five geographic regions in which the fuels are marketed. The six grades of fuel are defined by the American Society for Testing and Materials Specification D396. The five regions containing a total of 16 marketing districts are shown on a map in the report. Trend charts are included showing average properties of the six grades of fuel for the past several years. Summaries of the results of the tests by grade and by region for 1980 compared with data for 1979 are shown in tables. Analyses of grades 2, 5(light), and 6 foreign import oils are presented.

Shelton, E.M.



Heating oils, 1981  

SciTech Connect (OSTI)

Properties of 249 heating oils marketed in the United States were submitted for study and compilation under agreement between the Bartlesville Energy Technology Center (BETC) and the American Petroleum Institute (API). The fuels were manufactured by 28 petroleum refining companies in 92 domestic refineries. The data are tabulated according to six grades of fuel and subdivided into five geographic regions in which the fuels are marketed. The six grades of fuels are defined by the American Society for Testing and Materials (ASTM) Specification D396. The five regions containing a total of 16 marketing districts are shown on a map in the report. Trend charts are included showing average properties of the six grades of fuel for the past several years. Summaries of the results of the tests by grade and by region for 1981 compared with data for 1980 are shown in Tables 1 through 6. Analyses of grade 6 foreign import oils are presented in Table 13.

Shelton, E.M.



New Process for Grain Refinement of Aluminum. Final Report  

SciTech Connect (OSTI)

A new method of grain refining aluminum involving in-situ formation of boride nuclei in molten aluminum just prior to casting has been developed in the subject DOE program over the last thirty months by a team consisting of JDC, Inc., Alcoa Technical Center, GRAS, Inc., Touchstone Labs, and GKS Engineering Services. The Manufacturing process to make boron trichloride for grain refining is much simpler than preparing conventional grain refiners, with attendant environmental, capital, and energy savings. The manufacture of boride grain refining nuclei using the fy-Gem process avoids clusters, salt and oxide inclusions that cause quality problems in aluminum today.

Dr. Joseph A. Megy



General Schema for [001] Tilt Grain Boundaries in Dense Packing...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

as showing the frustration of symmetry caused by the incorporation of point defects (vacancies and impurities). This general model for grain boundary structures can, in principle,...


Emulsified industrial oils recycling  

SciTech Connect (OSTI)

The industrial lubricant market has been analyzed with emphasis on current and/or developing recycling and re-refining technologies. This task has been performed for the United States and other industrialized countries, specifically France, West Germany, Italy and Japan. Attention has been focused at emulsion-type fluids regardless of the industrial application involved. It was found that emulsion-type fluids in the United States represent a much higher percentage of the total fluids used than in other industrialized countries. While recycling is an active matter explored by the industry, re-refining is rather a result of other issues than the mere fact that oil can be regenerated from a used industrial emulsion. To extend the longevity of an emulsion is a logical step to keep expenses down by using the emulsion as long as possible. There is, however, another important factor influencing this issue: regulations governing the disposal of such fluids. The ecological question, the respect for nature and the natural balances, is often seen now as everybody's task. Regulations forbid dumping used emulsions in the environment without prior treatment of the water phase and separation of the oil phase. This is a costly procedure, so recycling is attractive since it postpones the problem. It is questionable whether re-refining of these emulsions - as a business - could stand on its own if these emulsions did not have to be taken apart for disposal purposes. Once the emulsion is separated into a water and an oil phase, however, re-refining of the oil does become economical.

Gabris, T.



STEO December 2012 - oil production  

U.S. Energy Information Administration (EIA) Indexed Site

Rise in 2012 U.S. oil production largest since 1859, output in 2013 seen Rise in 2012 U.S. oil production largest since 1859, output in 2013 seen topping 7 million bpd U.S. crude oil production is now expected to rise by about 760,000 barrels per day in 2012, the biggest annual increase in oil output since U.S. commercial crude oil production began in 1859. American oil producers are expected to pump a daily average of 6.4 million barrels of crude oil this year, according to the U.S. Energy Information Administrator's new monthly energy forecast. The annual increase in oil output tops the previous record set in 1951 and marks the largest yearly production increase ever. Most of the increase in crude oil production is driven by drilling activity in shale formations located in Texas, North Dakota and Montana. U.S. crude oil production next year is expected to top 7 million barrels per day for the first time


Using simple models to describe oil production from unconventional reservoirs.  

E-Print Network [OSTI]

??Shale oil (tight oil) is oil trapped in low permeability shale or sandstone. Shale oil is a resource with great potential as it is heavily… (more)

Song, Dong Hee



Coarse grained description of protein folding  

Science Journals Connector (OSTI)

We consider two- and three-dimensional lattice models of proteins that were characterized previously. We coarse grain their folding dynamics by reducing it to transitions between effective states. We consider two methods of selection of the effective states. The first method is based on the steepest descent mapping of states to underlying local energy minima and the other involves an additional projection to maximally compact conformations. Both methods generate connectivity patterns that allow one to distinguish between the good and bad folders. Connectivity graphs corresponding to the folding funnel have few loops and are thus treelike. The Arrhenius law for the median folding time of a 16-monomer sequence is established and the corresponding barrier is related to easily identifiable kinetic trap states.

Marek Cieplak and Trinh Xuan Hoang



Chapter 1 - Refining Heavy Oil and Extra-heavy Oil  

Science Journals Connector (OSTI)

The definitions of heavy oil, extra-heavy oil, and tar sand bitumen are inadequate insofar as the definitions rely upon a single physical property to define a complex feedstock. This chapter presents viable options to the antiquated definitions of the heavy feedstocks (heavy oil, extra-heavy oil, and tar sand bitumen) as well as an introduction to the various aspects of heavy feedstock refining in order for the reader to place each feedstock in the correct context of properties, behavior, and refining needs.

James G. Speight



Unconventional oil market assessment: ex situ oil shale.  

E-Print Network [OSTI]

??This thesis focused on exploring the economic limitations for the development of western oil shale. The analysis was developed by scaling a known process and… (more)

Castro-Dominguez, Bernardo



Crude Oil Prices Table 21. Domestic Crude Oil First Purchase...  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Information Administration Petroleum Marketing Annual 1995 41 Table 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) - Continued Year Month PAD District II...


Validated HPLC Method and Temperature Stabilities for Oil-Soluble Organosulfur Compounds in Garlic Macerated Oil  

Science Journals Connector (OSTI)

......HPLC Method and Temperature Stabilities for Oil-Soluble Organosulfur Compounds in Garlic Macerated Oil Miyoung Yoo Sunyoung Kim Sanghee Lee Dongbin...enhance the utilization of garlic macerated oil as functional foods, oil-soluble organosulfur......

Miyoung Yoo; Sunyoung Kim; Sanghee Lee; Dongbin Shin



Consumer Winter Heating Oil Costs  

Gasoline and Diesel Fuel Update (EIA)

5 5 Notes: Using the Northeast as a regional focus for heating oil, the typical oil-heated household consumes about 680 gallons of oil during the winter, assuming that weather is "normal." The previous three winters were warmer than average and generated below normal consumption rates. Last winter, consumers saw large increases over the very low heating oil prices seen during the winter of 1998-1999 but, outside of the cold period in late January/early February they saw relatively low consumption rates due to generally warm weather. Even without particularly sharp cold weather events this winter, we think consumers are likely to see higher average heating oil prices than were seen last winter. If weather is normal, our projections imply New England heating oil


Retail Diesel Fuel Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

Along with heating oil prices, the distillate supply squeeze has Along with heating oil prices, the distillate supply squeeze has severely impacted diesel fuel prices, especially in the Northeast. Diesel fuel is bascially the same product as home heating oil. The primary difference is that diesel has a lower sulfur content. When heating oil is in short supply, low sulfur diesel fuel can be diverted to heating oil supply. Thus, diesel fuel prices rise with heating heating oil prices. Retail diesel fuel prices nationally, along with those of most other petroleum prices, increased steadily through most of 1999. But prices in the Northeast jumped dramatically in the third week of January. Diesel fuel prices in New England rose nearly 68 cents per gallon, or 47 percent, between January 17 and February 7. While EIA does not have


Northeast Home Heating Oil Reserve  

Gasoline and Diesel Fuel Update (EIA)

Northeast Home Heating Oil Reserve Northeast Home Heating Oil Reserve Information on the Northeast Home Heating Oil Reserve is available from the U.S. Department of Energy (DOE) Office of Petroleum Reserves web site at http://www.fossil.energy.gov/programs/reserves/heatingoil/. Northeast Home Heating Oil Reserve (NEHHOR) inventories now classified as ultra-low sulfur distillate (15 parts per million) are not considered to be in the commercial sector and therefore are excluded from distillate fuel oil supply and disposition statistics in Energy Information Administration publications, such as the Weekly Petroleum Status Report, Petroleum Supply Monthly, and This Week In Petroleum. Northeast Home Heating Oil Reserve Terminal Operator Location (Thousand Barrels) Hess Corp. Groton, CT 500*


International Oil Supplies and Demands  

SciTech Connect (OSTI)

The eleventh Energy Modeling Forum (EMF) working group met four times over the 1989--90 period to compare alternative perspectives on international oil supplies and demands through 2010 and to discuss how alternative supply and demand trends influence the world's dependence upon Middle Eastern oil. Proprietors of eleven economic models of the world oil market used their respective models to simulate a dozen scenarios using standardized assumptions. From its inception, the study was not designed to focus on the short-run impacts of disruptions on oil markets. Nor did the working group attempt to provide a forecast or just a single view of the likely future path for oil prices. The model results guided the group's thinking about many important longer-run market relationships and helped to identify differences of opinion about future oil supplies, demands, and dependence.

Not Available



International Oil Supplies and Demands  

SciTech Connect (OSTI)

The eleventh Energy Modeling Forum (EMF) working group met four times over the 1989--1990 period to compare alternative perspectives on international oil supplies and demands through 2010 and to discuss how alternative supply and demand trends influence the world's dependence upon Middle Eastern oil. Proprietors of eleven economic models of the world oil market used their respective models to simulate a dozen scenarios using standardized assumptions. From its inception, the study was not designed to focus on the short-run impacts of disruptions on oil markets. Nor did the working group attempt to provide a forecast or just a single view of the likely future path for oil prices. The model results guided the group's thinking about many important longer-run market relationships and helped to identify differences of opinion about future oil supplies, demands, and dependence.

Not Available



The twentieth oil shale symposium proceedings  

SciTech Connect (OSTI)

This book contains 20 selections. Some of the titles are: The technical contributions of John Ward Smith in oil shale research; Oil shale rubble fires: ignition and extinguishment; Fragmentation of eastern oil shale for in situ recovery; A study of thermal properties of Chinese oil shale; and Natural invasion of native plants on retorted oil shale.

Gary, J.H.



Rheological Behavior of Castor Oil Biodiesel  

Science Journals Connector (OSTI)

Rheological Behavior of Castor Oil Biodiesel ... This work aims at assessing the rheological behavior of castor oil, castor oil biodiesel, and undegraded and degraded biodiesel at different exposure times and temperatures. ... Castor oil biodiesel presents viscosity higher than diesel oil, but this drawback can be corrected by means of blends of both components at different proportions. ...

Marta M. Conceição; Roberlúcia A. Candeia; Hermesson J. Dantas; Luiz E. B. Soledade; Valter J. Fernandes, Jr.; Antonio G. Souza



BP Oil Spill November 10, 2011  

E-Print Network [OSTI]

BP Oil Spill Qiyam Tung November 10, 2011 1 Introduction Figure 1: BP Oil spill (source: http://thefoxisblack.com/2010/05/02/the-bp-oil-spill-in-the-gulf-of-mexico/) Last year, there was a major oil spill caused major techniques to minimize the threat once it happened. What kind of damage would an oil spill like this cause

Lega, Joceline

Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Composition of Forage and Grain from Second-Generation Insect-Protected Corn MON 89034 Is Equivalent to That of Conventional Corn (Zea mays L.)  

Science Journals Connector (OSTI)

The TDF was estimated by gelatinizing the samples with alpha-amylase and by digesting with enzymes to break down the starch and protein. ... like CM-cellulose, polydextrose, lactulose, enzymic like modified starches and starch syrups or microbial like xanthan and gellan gum. ...

Suzanne M. Drury; Tracey L. Reynolds; William P. Ridley; Natalia Bogdanova; Susan Riordan; Margaret A. Nemeth; Roy Sorbet; William A. Trujillo; Matthew L. Breeze



Solar retorting of oil shale  

DOE Patents [OSTI]

An apparatus and method for retorting oil shale using solar radiation. Oil shale is introduced into a first retorting chamber having a solar focus zone. There the oil shale is exposed to solar radiation and rapidly brought to a predetermined retorting temperature. Once the shale has reached this temperature, it is removed from the solar focus zone and transferred to a second retorting chamber where it is heated. In a second chamber, the oil shale is maintained at the retorting temperature, without direct exposure to solar radiation, until the retorting is complete.

Gregg, David W. (Morago, CA)



Oil cooled, hermetic refrigerant compressor  

DOE Patents [OSTI]

A hermetic refrigerant compressor having an electric motor and compressor assembly in a hermetic shell is cooled by oil which is first cooled in an external cooler 18 and is then delivered through the shell to the top of the motor rotor 24 where most of it is flung radially outwardly within the confined space provided by the cap 50 which channels the flow of most of the oil around the top of the stator 26 and then out to a multiplicity of holes 52 to flow down to the sump and provide further cooling of the motor and compressor. Part of the oil descends internally of the motor to the annular chamber 58 to provide oil cooling of the lower part of the motor, with this oil exiting through vent hole 62 also to the sump. Suction gas with entrained oil and liquid refrigerant therein is delivered to an oil separator 68 from which the suction gas passes by a confined path in pipe 66 to the suction plenum 64 and the separated oil drops from the separator to the sump. By providing the oil cooling of the parts, the suction gas is not used for cooling purposes and accordingly increase in superheat is substantially avoided in the passage of the suction gas through the shell to the suction plenum 64.

English, William A. (Murrysville, PA); Young, Robert R. (Murrysville, PA)



Oil cooled, hermetic refrigerant compressor  

DOE Patents [OSTI]

A hermetic refrigerant compressor having an electric motor and compressor assembly in a hermetic shell is cooled by oil which is first cooled in an external cooler and is then delivered through the shell to the top of the motor rotor where most of it is flung radially outwardly within the confined space provided by the cap which channels the flow of most of the oil around the top of the stator and then out to a multiplicity of holes to flow down to the sump and provide further cooling of the motor and compressor. Part of the oil descends internally of the motor to the annular chamber to provide oil cooling of the lower part of the motor, with this oil exiting through vent hole also to the sump. Suction gas with entrained oil and liquid refrigerant therein is delivered to an oil separator from which the suction gas passes by a confined path in pipe to the suction plenum and the separated oil drops from the separator to the sump. By providing the oil cooling of the parts, the suction gas is not used for cooling purposes and accordingly increase in superheat is substantially avoided in the passage of the suction gas through the shell to the suction plenum. 3 figs.

English, W.A.; Young, R.R.



Charge Transport Anisotropy Due to Grain Boundaries in Directionally  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Charge Transport Anisotropy Due to Grain Charge Transport Anisotropy Due to Grain Boundaries in Directionally Crystallized Thin Films of Regio-Regular Poly(3-hexylthiophene) Semicrystalline polymers, such as polythiophenes, hold much promise as active layers in printable electronic devices such as photovoltaic cells, sensors, and thin film transistors. As organic semiconductors approach commercialization, there is a need to better understand the relationship between charge transport and microstructure, in particular, to identify the inherent bottlenecks to charge transport. In semicrystalline and polycrystalline materials, charge transport is most likely dominated by grain-boundary effects, although the exact mechanism is not well understood. Unfortunately, grain boundaries in semicrystalline thin films are difficult to characterize: the grains are too small to allow for measurements across individual grain boundaries (as is often done for polycrystalline films of small molecules) and bulk measurements are complicated by the unknown orientation of polymer chains within the grain. To better understand the effect of chain orientation on grain boundaries, we use anisotropic thin films of poly(3-hexylthiophene) (P3HT) - one of the most well-studied polymeric semiconductors, as a tool to study charge transport.



E-Print Network [OSTI]

and Boron isotope and elemental analyses have been acquired from pristine pre-solar silicon carbide grains chondrites. We determined presolar grain abundance in the ordinary chondrites and discussed alteration] Nanodiamonds are found in carbonaceous chondrites and contain different isotopically anormous noble gases

Rathbun, Julie A.


Distribution of Grain Boundary Planes and Misorientations in Magnesium Oxide  

E-Print Network [OSTI]

Distribution of Grain Boundary Planes and Misorientations in Magnesium Oxide D.M. Saylor 1 , A distribution, magnesium oxide. Abstract. We have developed a technique that allows the geometry of polycrystalline magnesium oxide. Using these data, we have specified the distribution of grain boundaries within

Rohrer, Gregory S.


Artocarpus heterophyllus L. seed starch-blended gellan gum mucoadhesive beads of metformin \\{HCl\\}  

Science Journals Connector (OSTI)

Abstract Jackfruit (Artocarpus heterophyllus Lam., family: Moraceae) seed starch (JFSS)–gellan gum (GG) mucoadhesive beads containing metformin \\{HCl\\} were developed through ionotropic gelation technique. The effect of GG to JFSS ratio and CaCl2 concentration on the drug encapsulation efficiency (DEE, %) and cumulative drug release at 10 h (R10h, %) was optimized and analyzed using response surface methodology based on 32 factorial design. The optimized JFSS–GG beads containing metformin \\{HCl\\} showed DEE of 92.67 ± 4.46%, \\{R10h\\} of 61.30 ± 2.37%, and mean diameter of 1.67 ± 0.27 mm. The optimized beads showed pH-dependent swelling and mucoadhesivity with the goat intestinal mucosa. The in vitro drug release from all these JFSS–GG beads containing metformin \\{HCl\\} was followed zero-order pattern (R2 = 0.9907–0.9975) with super case-II transport mechanism over a period of 10 h. The beads were also characterized by SEM and FTIR. The optimized JFSS–GG beads containing metformin \\{HCl\\} exhibited significant hypoglycemic effect in alloxan-induced diabetic rats over prolonged period after oral administration.

Amit Kumar Nayak; Dilipkumar Pal; Kousik Santra



Sorbitol accumulation in male and female rats consuming starch or fructose diets with or without copper  

SciTech Connect (OSTI)

The present study was designed to examine the relationship between the sex of the rats, tissue sorbitol accumulation and copper deficiency in rats consuming dietary fructose. Rats were provided with a diet containing either 62.7% fructose or starch, and either 6.0 or 0.6 {mu}g copper/g for three weeks. Hepatic copper concentration of all rats consuming the copper-deficient diets was about 40% of copper sufficient rats. Hepatic, renal and thymic sorbitol concentrations were significantly elevated in males consuming the fructose, copper-deficient diet when compared to all other dietary groups regardless of the sex of the rat. Hepatic, renal the thymic fructose concentrations were significantly higher in rats eating fructose as compared to female rats. Hepatic glucose concentration was higher in males and females consuming the fructose, copper-deficient diet when compared to all other dietary groups. Renal glucose concentration was elevated in males as compared to females. These results demonstrate that the pathology and complications of copper deficiency in the male rat consuming fructose closely parallel aberration in tissue sorbitol accumulation.

Lewis, C.G.; Fields, M.; Beal, T. (Dept. of Agriculture, Beltsville, MD (USA))



Simultaneous Saccharification and Fermentation of Dry-grind Highly Digestible Grain Sorghum Lines for Ethanol Production  

E-Print Network [OSTI]

with food and feed production. To be able to meet the enormous amount of corn or starch based material needed to produce the projected 15 billion gallon per year leveling capacity of corn ethanol, there is a need to develop alternative crops for bioenergy... production for sustainable supply of sugar, starch and lignocellosic biomass. There are several different species possible to be used as dedicated bioenergy crops. Sorghum (Sorghum bicolor L. Moench) is one of those species for several reasons. First...

Hernandez, Joan R.



Performance and nutrient utilization of steers fed short term reconstituted grains  

E-Print Network [OSTI]

enzymes whi ch migrate to the al eurone layer of the seed. These enzymes stimulate the production of amylases and proteases by the aleurone. The amylases stimu- late starch solubilization and the proteases advance protein hydrolysis. The peripheral... enzymes whi ch migrate to the al eurone layer of the seed. These enzymes stimulate the production of amylases and proteases by the aleurone. The amylases stimu- late starch solubilization and the proteases advance protein hydrolysis. The peripheral...

Simpson, Edward James



Science at the interface : grain boundaries in nanocrystalline metals.  

SciTech Connect (OSTI)

Interfaces are a critical determinant of the full range of materials properties, especially at the nanoscale. Computational and experimental methods developed a comprehensive understanding of nanograin evolution based on a fundamental understanding of internal interfaces in nanocrystalline nickel. It has recently been shown that nanocrystals with a bi-modal grain-size distribution possess a unique combination of high-strength, ductility and wear-resistance. We performed a combined experimental and theoretical investigation of the structure and motion of internal interfaces in nanograined metal and the resulting grain evolution. The properties of grain boundaries are computed for an unprecedented range of boundaries. The presence of roughening transitions in grain boundaries is explored and related to dramatic changes in boundary mobility. Experimental observations show that abnormal grain growth in nanograined materials is unlike conventional scale material in both the level of defects and the formation of unfavored phases. Molecular dynamics simulations address the origins of some of these phenomena.

Rodriguez, Mark Andrew; Follstaedt, David Martin; Knapp, James Arthur; Brewer, Luke N.; Holm, Elizabeth Ann; Foiles, Stephen Martin; Hattar, Khalid M.; Clark, Blythe B.; Olmsted, David L.; Medlin, Douglas L.



Grain Alignment by Radiation in Dark Clouds and Cores  

E-Print Network [OSTI]

We study alignment of grains by radiative torques. We found steep rise of radiative torque efficiency as grain size increases. This allows larger grains that are known to exist within molecular clouds to be aligned by the attenuated and reddened interstellar radiation field. In particular, we found that, even deep inside giant molecular clouds, e.g. at optical depths corresponding to less than Av of 10 large grains can still be aligned by radiative torque. This means that, contrary to earlier claims, far-infrared/submillimeter polarimetry provides a reliable tool to study magnetic fields of pre-stellar cores. Our results show that the grain size distribution is important for determining the relation between the degree of polarization and intensity.

J. Cho; A. Lazarian



Finite-Size Effects on the Structure of Grain Boundaries  

Science Journals Connector (OSTI)

We present a combined experimental and theoretical analysis of the structure of finite-sized ?3 {112} grain boundaries in Au. High-resolution electron microscopy shows lattice translations at the grain boundary, with the magnitude of the translation varying along the finite-sized grain boundaries. The presence of this structural profile is explained using continuum elasticity theory and first-principles calculations as originating from a competition between elastic energy and the energy cost of forming continuous {111} planes across the boundary. This competition leads to a structural transition between offset-free and nontrivial grain boundary structures at a critical grain boundary size, in agreement with the experiments. We also provide a method to estimate the energy barrier of the ? surface.

E. A. Marquis; J. C. Hamilton; D. L. Medlin; F. Léonard



Granular Gases of Rod-Shaped Grains in Microgravity  

Science Journals Connector (OSTI)

Granular gases are convenient model systems to investigate the statistical physics of nonequilibrium systems. In the literature, one finds numerous theoretical predictions, but only few experiments. We study a weakly excited dilute gas of rods, confined in a cuboid container in microgravity during a suborbital rocket flight. With respect to a gas of spherical grains at comparable filling fraction, the mean free path is considerably reduced. This guarantees a dominance of grain-grain collisions over grain-wall collisions. No clustering was observed, unlike in similar experiments with spherical grains. Rod positions and orientations were determined and tracked. Translational and rotational velocity distributions are non-Gaussian. Equipartition of kinetic energy between translations and rotations is violated.

K. Harth; U. Kornek; T. Trittel; U. Strachauer; S. Höme; K. Will; R. Stannarius



European Market Study for BioOil (Pyrolysis Oil)  

E-Print Network [OSTI]

European Market Study for BioOil (Pyrolysis Oil) Dec 15, 2006 Doug Bradley President Climate Change Solutions National Team Leader- IEA Bioenergy Task 40- Bio-trade 402 Third Avenue ·Ottawa, Ontario ·Canada K. Market Determining Factors 5. EU Country Perspectives 6. Potential European Markets 6.1. Pulp Mill Lime


Rheological properties of heavy oils and heavy oil emulsions  

SciTech Connect (OSTI)

In this study, the author investigated the effects of a number of process variables such as shear rate, measurement temperature, pressure, the influence of pretreatment, and the role of various amounts of added water on the rheology of the resulting heavy oil or the emulsion. Rheological properties of heavy oils and the corresponding emulsions are important from transportation and processing standpoints.

Khan, M.R. [Texaco, Inc., Beacon, NY (United States). Fuels and Lubricants Technology Dept.



Rerefined Oil: An Option that Saves Oil, Minimizes Pollution  

Science Journals Connector (OSTI)

...of the annual oil consumption of the United States...desirably, burned as a fuel under carefully...percent of U.S. consumption of petroleum. About...oil was burned as fuel. Another 200 million...from gasoline and diesel fuel, carbon...me-tallic particles from engine wear, and metals...




Oil burner nozzle  

DOE Patents [OSTI]

An oil burner nozzle for use with liquid fuels and solid-containing liquid fuels. The nozzle comprises a fuel-carrying pipe, a barrel concentrically disposed about the pipe, and an outer sleeve retaining member for the barrel. An atomizing vapor passes along an axial passageway in the barrel, through a bore in the barrel and then along the outer surface of the front portion of the barrel. The atomizing vapor is directed by the outer sleeve across the path of the fuel as it emerges from the barrel. The fuel is atomized and may then be ignited.

Wright, Donald G. (Rockville Center, NY)



Research on patterns in the fluctuation of the co-movement between crude oil futures and spot prices: A complex network approach  

Science Journals Connector (OSTI)

Abstract The price of crude oil is fluctuating. Researchers focus on the fluctuation of crude oil prices or relationship between crude oil futures and spot prices. However, the relationship also presents fluctuation which draws our attention. This paper designed a complex network approach for examining the dynamics of the co-movement between crude oil futures and spot prices. We defined the co-movement modes by a coarse-graining procedure and analyzed the transformation characteristics between the modes by weighted complex network models and evolutionary models. We analyzed the parameters of these models by using the West Texas Intermediate crude oil future prices and the Daqing (China) crude oil spot prices from November 25, 2002 to March 22, 2011 as sample data. The results indicate that the co-movement modes of the crude oil futures and spot prices are clustered around a few critical modes during the evolution. The co-movement of the crude oil prices has the characteristic of grouping, and the conversion of the co-movement modes requires an average of 5–7 days. There are some important transitional phases in the evolution of prices, and the results validate the current trend of rising oil prices. This research may provide information for the oil price decision-making process, and more importantly, provides a new approach for examining the co-movement between variables.

Haizhong An; Xiangyun Gao; Wei Fang; Yinghui Ding; Weiqiong Zhong


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Oil resources: the key to prosperity or to poverty? : Influence of oil price shocks on spending of oil revenues.  

E-Print Network [OSTI]

??Abundant natural resources, in particular oil, play an important role in the economics of many countries. The oil price shocks that have been happening continuously… (more)

Selivanova, Olga




E-Print Network [OSTI]

is in intimate contact with oil and shale during In in-situin contact with the oil and shale. These methods and othersWaters from Green River Oil Shale," Chem. and Ind. , 1. ,

Fox, J.P.



This Week In Petroleum Crude Oil Section  

Gasoline and Diesel Fuel Update (EIA)

Crude oil futures and estimated contract prices (dollars per barrel) Contract 1 Contract 2 Contract 3 Contract 4 Crude oil futures price contract 1 graph Crude oil futures price...



E-Print Network [OSTI]

Waters from Green River Oil Shale," Chem. and Ind. , 1. ,Effluents from In-Situ oil Shale Processing," in Proceedingsin the Treatment of Oil Shale Retort Waters," in Proceedings

Fox, J.P.




E-Print Network [OSTI]

CORROSION OF METALS IN OIL SHALE ENVIRONMENTS A. Levy and R.of Metals in In-Situ Oil Shale Retorts," NACE Corrosion 80,Elevated Temperature Corrosion of Oil Shale Retort Component

Bellman Jr., R.




E-Print Network [OSTI]

III, "Method of Breaking Shale Oil-Water Emulsion," U. S.and Biological Treatment of Shale Oil Retort Water, DraftPA (1979). H. H. Peters, Shale Oil Waste Water Recovery by

Fox, J.P.




E-Print Network [OSTI]

temperature, type of shale and oil content of shale iscontent of the shale, and shale oil content of the rock cantemperatures. Lean and Rich Shale Oil shales vary in their

Bellman Jr., R.



Peak Oil Futures: Same Crisis, Different Responses  

Science Journals Connector (OSTI)

Peak oil theory predicts that global oil production will soon start a terminal decline. ... resource and technology will be available to replace oil as the backbone resource of industrial society. ... understand ...

Jörg Friedrichs



Oil droplets as light absorbents in seawater  

Science Journals Connector (OSTI)

This paper presents spectra of light absorption coefficient of oil-in-water emulsion, derived using the Mie theory. In order to achieve that concentration of oil, degree of oil...

Otremba, Zbigniew



Membrane degumming of crude vegetable oil  

E-Print Network [OSTI]

Crude vegetable oils contain various minor substances like phospholipids, coloring pigments, and free fatty acids (FFA) that may affect quality of the oil. Reduction of energy costs and waste disposal are major concerns for many oil refiners who...

Lin, Lan



Taming Density Functional Theory by Coarse-Graining  

E-Print Network [OSTI]

The standard (``fine-grained'') interpretation of quantum density functional theory, in which densities are specified with infinitely-fine spatial resolution, is mathematically unruly. Here, a coarse-grained version of DFT, featuring limited spatial resolution, and its relation to the fine-grained theory in the $L^1\\cap L^3$ formulation of Lieb, is studied, with the object of showing it to be not only mathematically well-behaved, but consonant with the spirit of DFT, practically (computationally) adequate and sufficiently close to the standard interpretation as to accurately reflect its non-pathological properties. The coarse-grained interpretation is shown to be a good model of formal DFT in the sense that: all densities are (ensemble)-V-representable; the intrinsic energy functional $F$ is a continuous function of the density and the representing external potential is the (directional) functional derivative of the intrinsic energy. Also, the representing potential $v[\\rho]$ is quasi-continuous, in that $v[\\rho]\\rho$ is continuous as a function of $\\rho$. The limit of coarse-graining scale going to zero is studied to see if convergence to the non-pathological aspects of the fine-grained theory is adequate to justify regarding coarse-graining as a good approximation. Suitable limiting behaviors or intrinsic energy, densities and representing potentials are found. Intrinsic energy converges monotonically, coarse-grained densities converge uniformly strongly to their low-intrinsic-energy fine-grainings, and $L^{3/2}+L^\\infty$ representability of a density is equivalent to the existence of a convergent sequence of coarse-grained potential/ground-state density pairs.

Paul E. Lammert



Crude oil and crude oil derivatives transactions by oil and gas producers.  

E-Print Network [OSTI]

??This study attempts to resolve two important issues. First, it investigates the diversification benefit of crude oil for equities. Second, it examines whether or not… (more)

Xu, He



Foamy Oil Flow and its Role in Heavy Oil Production  

Science Journals Connector (OSTI)

Two?phase oil?gas flow in porous media is often encountered during oil production from oil bearing sedimentary rocks. Traditionally such flow is modeled by extending the Darcy’s law to two?phase flow by employing the concept of saturation dependent relative permeability. This model is remarkably successful as long as the fluid distribution within the porous medium is controlled by capillary forces. Under this condition the two fluids appear to flow in their own continuous flow channels. This flow description is applicable to most reservoir flow scenarios encountered in light oil production. However in primary production of heavy oil under solution?gas drive this flow model often fails to provide a satisfactory match of the observed behaviour.

Brij B. Maini; Bashir Busahmin



80From Dust Grains to Dust Balls A cosmic dust grain about 0.1mm across captured by a  

E-Print Network [OSTI]

-altitude aircraft. Probably debris from a passing comet Planets are built in several stages. The first Problem 2 ­Answer: The change in the mass, dM, occurs as a quantity of dust grains land on the surface in the interstellar gas, times the speed of the grains landing on the surface. This leads to m x N x V where m


Desulfurization and de-ashing of a mixture of subbituminous coal and gangue minerals by selective oil agglomeration  

SciTech Connect (OSTI)

The aim of this study was to investigate desulfurization and de-ashing of a mixture of subbituminous coal and gangue minerals by the agglomeration method. For this purpose, experimental studies were conducted on a mixture containing subbituminous coal, pyrite, quartz and calcite. The effects of some parameters that markedly influence the effectiveness of selective oil agglomeration, such as solid concentration, pH, bridging liquid type and concentration, and depressant type and amount, were investigated. Agglomeration results showed that the usage of various depressants (Na{sub 2}SiO{sub 3}, FeCl3, corn starch, wheat starch) in the agglomeration medium has a positive effect on the reduction of ash and total sulfur content of agglomerates. It was found that an agglomerate product containing 3.03% total sulfur and 25.01% ash with a total sulfur reduction of 56.71% was obtained from a feed that contained 7% total sulfur and 43.58% ash when FeCl{sub 3} was used in the agglomeration medium.

Ayhan, F.D. [Dicle University, Diyarbakir (Turkey). Dept. of Mining Engineering



www.fightbac.o anola oil is  

E-Print Network [OSTI]

Ca co Th Ca "Canola" c which is Addition Ca he Ca in Th ca Ca m C know? anola oil is ooking oils. he average anola oil is comes fro s another nal Inform anola oil is eart healthy anola oil is n the world. he part of th anola meal anola oil ca many crop va ano the lowest . canola see a good sou m


Irradiation Assisted Grain Boundary Segregation in Steels  

SciTech Connect (OSTI)

The understanding of radiation-induced grain boundary segregation (RIS) has considerably improved over the past decade. New models have been introduced and much effort has been devoted to obtaining comprehensive information on segregation from the literature. Analytical techniques have also improved so that chemical analysis of layers 1 nm thick is almost routine. This invited paper will review the major methods used currently for RIS prediction: namely, Rate Theory, Inverse Kirkendall, and Solute Drag approaches. A summary is made of the available data on phosphorus RIS in reactor pressure vessel (RPV) steels. This will be discussed in the light of the predictions of the various models in an effort to show which models are the most reliable and easy to use for forecasting P segregation behaviour in steels. A consequence of RIS in RPV steels is a radiation induced shift in the ductile to brittle transition temperature (DBTT). It will be shown how it is possible to relate radiation-induced P segregation levels to DBTT shift. Examples of this exercise will be given for RPV steels and for ferritic steels being considered for first wall fusion applications. Cr RIS in high alloy stainless steels and associated irradiation-assisted stress corrosion cracking (IASCC) will be briefly discussed. (authors)

Lu, Zheng; Faulkner, Roy G. [IPTME, Loughborough University, Loughborough, Leics (United Kingdom)



Crude Oil Supply  

Gasoline and Diesel Fuel Update (EIA)

Crude Oil Supply Domestic Production (a) .......................................... 6.22 6.29 6.42 7.02 7.11 7.29 7.61 7.97 8.26 8.45 8.57 8.86 6.49 7.50 8.54 Alaska .................................................................. 0.58 0.53 0.44 0.55 0.54 0.51 0.48 0.52 0.51 0.47 0.42 0.49 0.53 0.51 0.47 Federal Gulf of Mexico (b) .................................... 1.34 1.19 1.18 1.36 1.30 1.22 1.27 1.29 1.34 1.36 1.37 1.45 1.27 1.27 1.38 Lower 48 States (excl GOM) ................................ 4.31 4.57 4.80 5.11 5.28 5.56 5.87 6.16 6.41 6.61 6.77 6.91 4.70 5.72 6.68 Crude Oil Net Imports (c) ......................................... 8.55 8.88 8.52 7.89 7.47 7.61 7.94 7.36 6.66 6.78 6.83 6.06 8.46 7.60 6.58 SPR Net Withdrawals ..............................................


Process oil manufacturing process  

SciTech Connect (OSTI)

A method is described for producing a naphthenic process oil having reduced sulfur, nitrogen and polynuclear aromatics contents from a naphthenic feed containing same and having an atmospheric boiling range of about 650/sup 0/ to about 1200/sup 0/F. comprising: A. passing the feed into a first hydrotreating stage having a hydrotreating catalyst therein, the stage maintained at a temperature of about 600/sup 0/ to about 750/sup 0/F. and at a hydrogen partial pressure of about 400 to about 1500 psig, to convert at least a portion of the sulfur to hydrogen sulfide and the nitrogen to ammonia; B. passing the hydrotreated feed from the first hydrotreating stage in an intermediate stripping stage wherein hydrogen sulfide, ammonia, or both is removed; C. passing the hydrotreated feed from the intermediate stage into a second hydrotreating stage having therein a hydrotreating catalyst selected from the group consisting of nickel-molybdenum, cobalt-molybdenum, nickel-tungsten and mixtures thereof, the second hydrotreating stage maintained at a temperature lower than that of the first hydrotreating stage and at a hydrogen partial pressure ranging between about 400 and about 1,500 psig; D. monitoring the polynuclear aromatics content, the degree of saturation, or both of the product exiting the second hydrotreating stage; and, E. adjusting the temperature in the second hydrotreating stage to keep the polynuclear aromatics content, the degree of saturation, or both below a limit suitable for process oil.

Corman, B.G.; Korbach, P.F.; Webber, K.M.



Soybean Oil as Diesel Fuel  

Science Journals Connector (OSTI)

Soybean Oil as Diesel Fuel ... TESTS are reported from Japan on the use of soybean oil as Diesel fuel in a 12-horsepower engine of 150-mm. ... This trouble was overcome by passing through some of the Diesel cooling water to heat the fuel tank and supply line. ...



Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Oil shale - Heir to the petroleum kingdom  

Science Journals Connector (OSTI)

Oil shale - Heir to the petroleum kingdom ... A discussion of oil shale provides students with real-world problems that require chemical literacy. ...

Y. Schachter



low-solids oil emulsion (drilling) mud  

Science Journals Connector (OSTI)

low-solids oil emulsion (drilling) mud, low-solids oil-in-water (drilling) mud ? öl-in-Wasser-(Bohr)...m, (f) mit geringem Feststoffanteil



Compositional changes in heavy oil steamflood simulators.  

E-Print Network [OSTI]

??The numerical simulation of heavy oil steamfloods has generally been conducted assuming that the oil is non-volatile. Reservoir simulation has traditionally ignored compositional effect s… (more)

Lolley, Christopher Scott



Marine Fuel Oil on a Mixed Base  

Science Journals Connector (OSTI)

Three grades of high–viscosity marine fuel oil are manufactured according to TU 38. ... developing the composition and technology for production of marine fuel oils [1– 4].

S. V. Kotov; A. G. Oltyrev; I. N. Kankaeva…



Biomass Derivatives Competitive with Heating Oil Costs.  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Biomass Derivatives Competitive with Heating Oil Costs Transportation fuel Heat or electricity * Data are from literature, except heating oil is adjusted from 2011 winter average *...


Oil & Gas Technology Center | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Global Research Oil & Gas Technology Center GE Global Research Oil & Gas Technology Center Mark Little, SVP and chief technology officer for GE, and Eric Gebhardt, vice president...


Review of EIA Oil Production Outlooks  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Review of EIA oil production outlooks For 2014 EIA Energy Conference July 15, 2014 | Washington, DC By Samuel Gorgen, Upstream Analyst Overview Gorgen, Tight Oil Production Trends...


Oil market in international and Norwegian perspectives.  

E-Print Network [OSTI]

??Crude oil is the most important energy source in global perspective. About 35 percent of the world’s primary energy consumption is supplied by oil, followed… (more)

Singsaas, Julia Nazyrova



U.S. Crude Oil Export Policy  

Gasoline and Diesel Fuel Update (EIA)

or use therein. * Crude exported from Alaska's Cook Inlet. * Heavy California crude oil. * Exports connected to refining or exchange of petroleum reserve oil. * Re-exportation...


Distillate Fuel Oil Sales for Residential Use  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

End Use Product: Residential - Distillate Fuel Oil Residential - No. 1 Residential - No. 2 Residential - Kerosene Commercial - Distillate Fuel Oil Commercial - No. 1 Distillate...


Oil and Gas Research| GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oil & Gas We're balancing the increasing demand for finite resources with technology that ensures access to energy for generations to come. Home > Innovation > Oil & Gas Innovation...


Enhanced Oil Recovery | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Enhanced Oil Recovery Enhanced Oil Recovery Thanks in part to innovations supported by the Office of Fossil Energy's National Energy Technology Laboratory over the past 30 years,...


United Oil Company | Open Energy Information  

Open Energy Info (EERE)

Company Jump to: navigation, search Name: United Oil Company Place: Pittsburgh, Pennsylvania Product: Vegetable-Oil producer Biodiesel producer based in Pittsburgh, PA References:...


AEO Early Release 2013 - oil  

U.S. Energy Information Administration (EIA) Indexed Site

Growing U.S. oil output and rising vehicle fuel economy to cut Growing U.S. oil output and rising vehicle fuel economy to cut U.S. reliance on foreign oil The United States is expected to continue cutting its dependence on petroleum and liquid fuels imports over the rest of this decade because of growing domestic crude oil production and more fuel-efficient vehicles on America's highways. The new long-term outlook from the U.S. Energy Information Administration shows America's dependence on imported petroleum and liquid fuels will decline from 45 percent of domestic demand last year to 34 percent by 2019. U.S. dependence on imported oil had reached 60 percent as recently as 2005. EIA Administrator Adam Sieminski explains: "The United States will be able to meet more of its own energy needs because of two key


Heavy oil transportation by pipeline  

SciTech Connect (OSTI)

Worldwide there are a number of pipelines used to transport heavy crude oils. The operations are facilitated in a variety of ways. For example, the Alyeska pipeline is an insulated pipeline transporting warm oil over 800 miles. This 48-inch line experiences limited heat loss due to the insulation, volume of oil contained, and heat gain due to friction and pumping. Some European trunk lines periodically handle heavy and waxy crudes. This is achieved by proper sizing of batches, following waxy crudes with non-waxy crudes, and increased use of scrapers. In a former Soviet republic, the transportation of heavy crude oil by pipeline has been facilitated by blending with a lighter Siberian crude. The paper describes the pipeline transport of heavy crudes by Interprovincial Pipe Line Inc. The paper describes enhancing heavy oil transportation by emulsion formation, droplet suspension, dilution, drag reducing agents, and heating.

Gerez, J.M.; Pick, A.R. [Interprovincial Pipe Line Inc., Edmonton, Alberta (Canada)



Process for oil shale retorting  

DOE Patents [OSTI]

Particulate oil shale is subjected to a pyrolysis with a hot, non-oxygenous gas in a pyrolysis vessel, with the products of the pyrolysis of the shale contained kerogen being withdrawn as an entrained mist of shale oil droplets in a gas for a separation of the liquid from the gas. Hot retorted shale withdrawn from the pyrolysis vessel is treated in a separate container with an oxygenous gas so as to provide combustion of residual carbon retained on the shale, producing a high temperature gas for the production of some steam and for heating the non-oxygenous gas used in the oil shale retorting process in the first vessel. The net energy recovery includes essentially complete recovery of the organic hydrocarbon material in the oil shale as a liquid shale oil, a high BTU gas, and high temperature steam.

Jones, John B. (300 Enterprise Bldg., Grand Junction, CO 80501); Kunchal, S. Kumar (300 Enterprise Bldg., Grand Junction, CO 80501)



Consumer Winter Heating Oil Costs  

Gasoline and Diesel Fuel Update (EIA)

6 6 Notes: The outlook for heating oil costs this winter, due to high crude oil costs and tight heating oil supplies, breaks down to an expected increase in heating expenditures for a typical oil-heated household of more than $200 this winter, the result of an 18% increase in the average price and an 11% increase in consumption. The consumption increase is due to the colder than normal temperatures experienced so far this winter and our expectations of normal winter weather for the rest of this heating season. Last winter, Northeast heating oil (and diesel fuel) markets experienced an extremely sharp spike in prices when a severe weather situation developed in late January. It is virtually impossible to gauge the probability of a similar (or worse) price shock recurring this winter,


Feasibility Study for Co-Locating and Integrating Ethanol Production Plants from Corn Starch and Lignocellulosic Feedstocks (Revised)  

SciTech Connect (OSTI)

Analysis of the feasibility of co-locating corn-grain-to-ethanol and lignocellulosic ethanol plants and potential savings from combining utilities, ethanol purification, product processing, and fermentation. Although none of the scenarios identified could produce ethanol at lower cost than a straight grain ethanol plant, several were lower cost than a straight cellulosic ethanol plant.

Wallace, R.; Ibsen, K.; McAloon, A.; Yee, W.




SciTech Connect (OSTI)

The United States continues to rely heavily on petroleum fossil fuels as a primary energy source, while domestic reserves dwindle. However, so-called heavy oil (10 to 20{sup o}API) remains an underutilized resource of tremendous potential. Heavy oils are much more viscous than conventional oils. As a result, they are difficult to produce with conventional recovery methods such as pressure depletion and water injection. Thermal recovery is especially important for this class of reservoirs because adding heat, usually via steam injection, generally reduces oil viscosity dramatically. This improves displacement efficiency. The research described here was directed toward improved understanding of thermal and heavy-oil production mechanisms and is categorized into: (1) flow and rock properties; (2) in-situ combustion; (3) additives to improve mobility control; (4) reservoir definition; and (5) support services. The scope of activities extended over a three-year period. Significant work was accomplished in the area of flow properties of steam, water, and oil in consolidated and unconsolidated porous media, transport in fractured porous media, foam generation and flow in homogeneous and heterogeneous porous media, the effects of displacement pattern geometry and mobility ratio on oil recovery, and analytical representation of water influx. Significant results are described.

Anthony R. Kovscek; William E. Brigham



Separation of oil-soluble sulfonates from sulfonated oils  

SciTech Connect (OSTI)

The authors aimed at developing a method for the complete recovery, from oil solutions, of oil-water-soluble sulfonates meeting the specifications, along with oils at least 99% pure, suitable for further processing. As the starting material the authors used an experimental batch of sulfonated and neutralized distillate lube stocks produced by selective solvent treatment. In determining the optimal extraction parameters, the authors investigated the influence of the solvent to original feed (S:F) weight ratio and the influence of the isopropyl alcohol (IPA) concentration on the composition of the sulfonates and oils recovered at 60/sup 0/C with a settling time of 2 h. The optimal conditions for two-stage extraction were found through a study of the influence of temperature and settling time on the compositions of the sulfonates and oils with S:F = 1.2:1 and with an IPA concentration of 40%. The process technology for two-stage recovery of oils and sulfonates from oil solutions was worked out in a pilot unit.

Ul'yanenko, V.I.; Yur'eva, N.P.; Sergeev, V.P.


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Manufacturing process to reduce large grain growth in zirconium alloys  

DOE Patents [OSTI]

It is an object of the present invention to provide a procedure for desensitizing zirconium-based alloys to large grain growth (LGG) during thermal treatment above the recrystallization temperature of the alloy. It is a further object of the present invention to provide a method for treating zirconium-based alloys which have been cold-worked in the range of 2 to 8% strain to reduce large grain growth. It is another object of the present invention to provide a method for fabricating a zirconium alloy clad nuclear fuel element wherein the zirconium clad is resistant to large grain growth.

Rosecrans, P.M.



Kapitza Resistance of the Grain Boundaries in Ceria  

SciTech Connect (OSTI)

Thermal conductivity is one of the key performance metrics of the nuclear fuels. In electrical insulators, such as most ubiquitous nuclear fuel – UO2, thermal transport is due to phonons, or lattice waves. Their propagation is impeded by any lattice defect, such as impurities or vacancies, as well as larger microstructural features: grain boundaries, dislocations and pores/bubbles. Detailed description of the phonons interactions with these features is still lacking. In this work, we elucidate the dependence of the grain boundary thermal resistance, also known as a Kapitza resistance, on the type and misorientation angle of the grain boundary in model system of CeO2.

David Bai; Jian Gan; Aleksandr Chernatynskiy



Competition among different height genotypes of grain sorghum hybrids  

E-Print Network [OSTI]

of differences from check for Temple (test 3), 45 Summary of differences from check for Temple (test 4). 46 vii LIST OF FIGURES Figures Page Deviations of treatments from the mean yield of grain in pounds per acre for the 3x3 hybrids over- all locations... Deviations of treatments from the mean yield of grain in pounds per acre for the 3x4 hybrids over- all locations 18 Deviations of treatments from the mean yield of grain in pounds per acre for the 4x4 hy'bride over- all locations Deviations of treatments...

Miller, Frederick Robert



Research on oil recovery mechanisms in heavy oil reservoirs  

SciTech Connect (OSTI)

The research described here was directed toward improved understanding of thermal and heavy-oil production mechanisms and is categorized into: (1) flow and rock properties, (2) in-situ combustion, (3) additives to improve mobility control, (4) reservoir definition, and (5) support services. The scope of activities extended over a three-year period. Significant work was accomplished in the area of flow properties of steam, water, and oil in consolidated and unconsolidated porous media, transport in fractured porous media, foam generation and flow in homogeneous and heterogeneous porous media, the effects of displacement pattern geometry and mobility ratio on oil recovery, and analytical representation of water influx.

Kovscek, Anthony R.; Brigham, William E., Castanier, Louis M.



No Oil: The coming Utopia/Dystopia and Communal Possibilities  

E-Print Network [OSTI]

supplies of conventional oil, and exploitable supplies of alternative forms of oil and related hydrocarbons, including tar sands and oil shale. Because new supplies of conventional oil are declining steadily, there is quite a lot of activity in the oil... to exploit the huge deposits of oil sands in Canada. Oil sands and oil shale look good because they contain vast amounts of oil. The problem is that of turning the reserves, locked into other geological formations, into useful oil. According to current...

Miller, Timothy



Water issues associated with heavy oil production.  

SciTech Connect (OSTI)

Crude oil occurs in many different forms throughout the world. An important characteristic of crude oil that affects the ease with which it can be produced is its density and viscosity. Lighter crude oil typically can be produced more easily and at lower cost than heavier crude oil. Historically, much of the nation's oil supply came from domestic or international light or medium crude oil sources. California's extensive heavy oil production for more than a century is a notable exception. Oil and gas companies are actively looking toward heavier crude oil sources to help meet demands and to take advantage of large heavy oil reserves located in North and South America. Heavy oil includes very viscous oil resources like those found in some fields in California and Venezuela, oil shale, and tar sands (called oil sands in Canada). These are described in more detail in the next chapter. Water is integrally associated with conventional oil production. Produced water is the largest byproduct associated with oil production. The cost of managing large volumes of produced water is an important component of the overall cost of producing oil. Most mature oil fields rely on injected water to maintain formation pressure during production. The processes involved with heavy oil production often require external water supplies for steam generation, washing, and other steps. While some heavy oil processes generate produced water, others generate different types of industrial wastewater. Management and disposition of the wastewater presents challenges and costs for the operators. This report describes water requirements relating to heavy oil production and potential sources for that water. The report also describes how water is used and the resulting water quality impacts associated with heavy oil production.

Veil, J. A.; Quinn, J. J.; Environmental Science Division



Total OECD Oil Stocks*  

Gasoline and Diesel Fuel Update (EIA)

6 6 Notes: The most recent data show OECD inventories remaining at very low levels. EIA expects inventories to remain low through the coming year. This increases the potential for price volatility through the rest of the winter, and into the next gasoline season. Inventories are a good measure of the supply/demand balance that affects prices. A large over-supply (production greater than demand) will put downward pressure on prices, while under-supply will push prices upward. As global oil production changed relative to demand, the world moved from a period of over-supply in 1998 to one of under-supply in 1999 and 2000. OECD inventories illustrate the changes in the world petroleum balance. OECD inventories rose to high levels during 1997 and 1998 when production exceeded demand and prices dropped to around $10 per barrel in


Total OECD Oil Stocks*  

Gasoline and Diesel Fuel Update (EIA)

The most recent data show OECD inventories remaining at very low The most recent data show OECD inventories remaining at very low levels. EIA expects inventories to remain low through the coming year. This increases the potential for price volatility through the winter, and even extending to the next gasoline season. Inventories are a good measure of the supply/demand balance that effects prices. A large over-supply (production greater than demand) will put downward pressure on prices, while under-supply will push prices upward. As global oil production changed relative to demand, the world moved from a period of over-supply in 1998 to one of under-supply in 1999 and 2000. OECD inventories illustrate the changes in the world petroleum balance. OECD inventories rose to high levels during 1997 and 1998 when production exceeded demand and prices dropped to around $10 per barrel in


Total OECD Oil Stocks*  

Gasoline and Diesel Fuel Update (EIA)

9 9 Notes: The most recent data show OECD inventories remaining at very low levels. EIA expects inventories to remain low through the coming year. This increases the potential for price volatility through the winter, and even extending to the next gasoline season. Inventories are a good measure of the supply/demand balance that effects prices. A large over-supply (production greater than demand) will put downward pressure on prices, while under-supply will push prices upward. As global oil production changed relative to demand, the world moved from a period of over-supply in 1998 to one of under-supply in 1999 and 2000. OECD inventories illustrate the changes in the world petroleum balance. OECD inventories rose to high levels during 1997 and 1998 when production exceeded demand and prices dropped to around $10 per barrel in


Diesel fuel oils, 1980  

SciTech Connect (OSTI)

Properties of diesel fuels produced during 1980 were submitted for study and compilation under a cooperative agreement between the Department of Energy, Bartlesville Energy Technology Center, Bartlesville, Oklahoma and the American Petroleum Institute. Tests of 192 samples of diesel fuel oils from 95 refineries throughout the country were made by 28 petroleum groups according to type of diesel fuel. Each group of analyses is subdivided into five tabulations according to five general regions of the country where the fuels are marketed. The regions, containing a total of 16 districts, are shown on a map in the report. Data from 13 laboratory tests on each individual diesel fuel sample are listed and arranged by geographic marketing districts in decreasing order of sales volumes. Charts are included showing trends of averages of certain properties for the four types of diesel fuels for the years 1960-1980. Summaries of the results of the 1980 survey, compared with similar data for 1979, are shown.

Shelton, E.M.



Heating oils, 1983  

SciTech Connect (OSTI)

Properties of 195 heating oils marketed in the United States were submitted for study and compilation under agreement between the Bartlesville Energy Technology Center (BETC) and the American Petroleum Institute (API). The fuels were manufactured by 25 petroleum refining companies in 83 domestic refineries. The data are tabulated according to six grades of fuel and subdivided into five geographic regions in which the fuels are marketed. The six grades of fuels are defined by the American Society for Testing and Materials (ASTM) Specification D396. The five regions containing a total of 16 marketing districts are shown on a map in the report. Trend charts are included showing average properties of the six grades of fuel for the past several years. Summaries of the results of the tests by grade and by region for 1983 are compared with data for 1982. 7 figures, 12 tables.

Shelton, E.M.



SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules  

SciTech Connect (OSTI)

SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

Koropatkin, Nicole M.; Smith, Thomas J. (Danforth)



Grain-Boundary Physics in Polycrystalline Photovoltaic Materials: Preprint  

SciTech Connect (OSTI)

This paper describes a study of the atomic structure and electronic effects of grain boundaries in polycrystalline photovoltaic materials such as Si, CdTe, CuInSe2, and CuGaSe2.

Yan, Y.; Jiang, C. S.; Wu, X. Z.; Noufi, R.; Wei, S. H.; Al-Jassim, M. M.



Quantitative grain size evaluation using ultrasonic backscattered echoes  

Science Journals Connector (OSTI)

Grain size characterization using ultrasonicbackscattered signals is an important problem in nondestructive testing of materials. In this paper a heuristic model which relates the statistical characteristics of the measured signal to the mean ultrasonicwavelet and attenuation coefficient in different regions of the sample is investigated. The losses in the backscattered signal are examined using temporal averaging correlation and probability distribution functions of the segmented data. Furthermore homomorphic processing is used in a novel application to estimate the mean ultrasonicwavelet (as it propagates through the sample) and the frequency?dependent attenuation. In the work presented heat?treated stainless steel samples with various grain sizes are examined. The processed experimental results support the feasibility of the grain size evaluation techniques presented here using the backscattered grain signal.

Jafar Saniie; Nihat M. Bilgutay



Managing Insect and Mite Pests of Texas Small Grains  

E-Print Network [OSTI]

Small grain crops are important for fall and winter livestock grazing. Pests such as small wireworms and cutworms cause significant damage to these crops. Complete information about sampling, economic thresholds, and control of these pests...

Patrick, Carl D.; Knutson, Allen E.




SciTech Connect (OSTI)

Micron-sized stardust grains that originated in ancient stars are recovered from meteorites and analyzed using high-resolution mass spectrometry. The most widely studied type of stardust is silicon carbide (SiC). Thousands of these grains have been analyzed with high precision for their Si isotopic composition. Here we show that the distribution of the Si isotopic composition of the vast majority of stardust SiC grains carries the imprints of a spread in the age-metallicity distribution of their parent stars and of a power-law increase of the relative formation efficiency of SiC dust with the metallicity. This result offers a solution for the long-standing problem of silicon in stardust SiC grains, confirms the necessity of coupling chemistry and dynamics in simulations of the chemical evolution of our Galaxy, and constrains the modeling of dust condensation in stellar winds as a function of the metallicity.

Lewis, Karen M.; Lugaro, Maria; Gibson, Brad K.; Pilkington, Kate, E-mail: maria.lugaro@monash.edu, E-mail: karen.michelle.lewis@gmail.com, E-mail: bkgibson@uclan.ac.uk, E-mail: kpilkington@uclan.ac.uk [Monash Centre for Astrophysics (MoCA), Monash University, Clayton VIC 3800 (Australia)



Decoding the message from meteoritic stardust silicon carbide grains  

E-Print Network [OSTI]

Micron-sized stardust grains that originated in ancient stars are recovered from meteorites and analysed using high-resolution mass spectrometry. The most widely studied type of stardust is silicon carbide (SiC). Thousands of these grains have been analysed with high precision for their Si isotopic composition. Here we show that the distribution of the Si isotopic composition of the vast majority of stardust SiC grains carry the imprints of a spread in the age-metallicity distribution of their parent stars and of a power-law increase of the relative formation efficiency of SiC dust with the metallicity. This result offers a solution for the long-standing problem of silicon in stardust SiC grains, confirms the necessity of coupling chemistry and dynamics in simulations of the chemical evolution of our Galaxy, and constrains the modelling of dust condensation in stellar winds as function of the metallicity.

Lewis, Karen M; Gibson, Brad K; Pilkington, Kate



Modelling the wetting and cooking of a single cereal grain  

Science Journals Connector (OSTI)

......compared. Regions where the penetration rate is approximately linear are...compared. Regions where the penetration rate is approximately linear are...grains, compared with moisture penetration rates. 52 M. J. MCGVWNESS ETAL......




Grain characteristics and engineering properties of coal ash  

Science Journals Connector (OSTI)

?Ash produced by the coal fired thermal plants is often used as ... the grain characteristics and the engineering properties of coal ash. The results of x-ray diffraction, ... characteristic that may be used for ...

A. Trivedi; V. K. Sud



The King’s Grain and the Retreat from Liberalization  

Science Journals Connector (OSTI)

Whereas Laverdy used the king’s grain to facilitate the transition from a police to a liberal regime, Terray used it to facilitate the transition from a liberal to a police regime. There are of course other im...

Steven L. Kaplan


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Effect of tensile strain on grain connectivity and flux pinning...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

tensile strain on grain connectivity and flux pinning in Bi 2 Sr 2 Ca 2 Cu 3 O x tapes D. C. van der Laan and J. W. Ekin National Institute of Standards and Technology, Boulder,...


Multiresolution methods for materials modeling via coarse-graining  

E-Print Network [OSTI]

(cont.) time, while obtaining useful information about the thermodynamic behavior of the system. We show how statistical mechanics can be formulated using the wavelet transform as a coarse-graining technique. For small ...

Ismail, Ahmed E. (Ahmed Emad), 1977-



NETL: Oil & Natural Gas Projects: Alaska Heavy Oils  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Fluid and Rock Property Controls On Production and Seismic Monitoring Alaska Heavy Oils Last Reviewed 12/20/2012 Fluid and Rock Property Controls On Production and Seismic Monitoring Alaska Heavy Oils Last Reviewed 12/20/2012 DE-NT0005663 Goal The goal of this project is to improve recovery of Alaskan North Slope (ANS) heavy oil resources in the Ugnu formation by improving our understanding of the formation’s vertical and lateral heterogeneities via core evaluation, evaluating possible recovery processes, and employing geophysical monitoring to assess production and modify production operations. Performers Colorado School of Mines, Golden, CO 80401 University of Houston, Houston, TX 77204 Earthworks, Newtown, CT 06470 BP, Anchorage, AK 99519 Background Although the reserves of heavy oil on the North Slope of Alaska are enormous (estimates are up to 10 billion barrels in place), difficult


International Oil and Gas Board International Oil and Gas Board...  

Open Energy Info (EERE)

Oil and Gas Board Address Place Zip Website Abu Dhabi Supreme Petroleum Council Abu Dhabi Supreme Petroleum Council Abu Dhabi http www abudhabi ae egovPoolPortal WAR appmanager...


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California


EIA - Projections of Oil Production Capacity and Oil Production In three  

Gasoline and Diesel Fuel Update (EIA)

Projections of Oil Production Capacity and Oil Production in Three Cases (1990-2030) Projections of Oil Production Capacity and Oil Production in Three Cases (1990-2030) International Energy Outlook 2006 Projections of Oil Production Capacity and Oil Production In Three Cases Data Tables (1990-2030) Formats Table Data Titles (1 to 6 complete) Projections of Oil Production Capacity and Oil Production In Three Cases Tables. Need help, contact the National Energy Information Center at 202-586-8800. Projections of Oil Production Capacity and Oil Production In Three Cases Tables. Need help, contact the National Energy Information Center at 202-586-8800. Table E1 World Oil Production Capacity by Region and Country, Reference Case Projections of Oil Production Capacity and Oil Production In Three Cases Tables. Need help, contact the National Energy Information Center at 202-586-8800.


Interior acts on oil shale  

Science Journals Connector (OSTI)

Interior acts on oil shale ... The Interior Department has taken the first step to open up the vast oil-shale deposits on public lands. ... According to Secretary of the Interior Stewart L. Udall, the new program is designed to encourage competition in developing oil-shale resources, prevent speculation and windfall profits, promote mining operation and production practices that are consistent with good conservation management, encourage the fullest use of the resources, and provide reasonable revenues to the states and to the Federal Government. ...



Combustion heater for oil shale  

DOE Patents [OSTI]

A combustion heater for oil shale heats particles of spent oil shale containing unburned char by burning the char. A delayed fall is produced by flowing the shale particles down through a stack of downwardly sloped overlapping baffles alternately extending from opposite sides of a vertical column. The delayed fall and flow reversal occurring in passing from each baffle to the next increase the residence time and increase the contact of the oil shale particles with combustion supporting gas flowed across the column to heat the shale to about 650 to 700/sup 0/C for use as a process heat source.

Mallon, R.; Walton, O.; Lewis, A.E.; Braun, R.



Combustion heater for oil shale  

DOE Patents [OSTI]

A combustion heater for oil shale heats particles of spent oil shale containing unburned char by burning the char. A delayed fall is produced by flowing the shale particles down through a stack of downwardly sloped overlapping baffles alternately extending from opposite sides of a vertical column. The delayed fall and flow reversal occurring in passing from each baffle to the next increase the residence time and increase the contact of the oil shale particles with combustion supporting gas flowed across the column to heat the shale to about 650.degree.-700.degree. C. for use as a process heat source.

Mallon, Richard G. (Livermore, CA); Walton, Otis R. (Livermore, CA); Lewis, Arthur E. (Los Altos, CA); Braun, Robert L. (Livermore, CA)



Oil Shale Research in the United States  

Broader source: Energy.gov [DOE]

Profiles of Oil Shale Research and Development Activities In Universities, National Laboratories, and Public Agencies


EMPLOYEE BENEFIT SERVICE Signature Service Oil Change  

E-Print Network [OSTI]

UNM Staff EMPLOYEE BENEFIT SERVICE Jiffy Lube Signature Service Oil Change Fast - No Appointment We change your oil with up to 5 quarts of major brand motor oil We install a new oil fi We visually inspect. ASE training programs · Jiffy Lube uses top quality products that meet or exceed vehicle warranty

New Mexico, University of


Liens for Oil and Gas Operations (Nebraska)  

Broader source: Energy.gov [DOE]

This section contains regulations concerning lien allowances made to operators of oil and gas operations.


Favorable conditions noted for Australia shale oil  

SciTech Connect (OSTI)

After brief descriptions of the Rundle, Condor, and Stuart/Kerosene Creek oil shale projects in Queensland, the competitive advantages of oil shale development and the state and federal governments' attitudes towards an oil shale industry in Australia are discussed. It is concluded that Australia is the ideal country in which to start an oil shale industry.

Not Available



Bureau of Land Management Oil Shale Development  

E-Print Network [OSTI]

Bureau of Land Management Oil Shale Development Unconventional Fuels Conference University of Utah May 17, 2011 #12;#12;Domestic Oil Shale Resources Primary oil shale resources in the U.S. are in the Green River Formation in Wyoming, Utah, and Colorado. 72 % of this oil shale resource is on Federal

Utah, University of


Fire and explosion hazards of oil shale  

SciTech Connect (OSTI)

The US Bureau of Mines publication presents the results of investigations into the fire and explosion hazards of oil shale rocks and dust. Three areas have been examined: the explosibility and ignitability of oil shale dust clouds, the fire hazards of oil shale dust layers on hot surfaces, and the ignitability and extinguishment of oil shale rubble piles. 10 refs., 54 figs., 29 tabs.

Not Available



Declining oil prices boost chemical profits  

Science Journals Connector (OSTI)

Declining oil prices boost chemical profits ... As a consequence of the oil price drop, the composition of feedstocks to steam crackers, which are sources for major-volume olefins and many aromatics, is being changed. ... Where possible, more heavy feedstocks obtained from crude oil—naphthas and gas oils—are used in place of light hydrocarbons such as ethane. ...



1 What is Oil ? General information  

E-Print Network [OSTI]

of petroleum products manufactured from crude oil. Many are for specific purposes, for example motor gasoline gasoline to heavier ones such as fuel oil. Oil #12;Crude oil Natural gas liquids Other hydrocarbons Aviation gasoline White spirit + SBP Gasoline type jet fuel Lubricants Unleaded gasoline Bitumen Leaded

Kammen, Daniel M.


OIL & GAS HISTORY 1 History in California  

E-Print Network [OSTI]

OIL & GAS HISTORY 1 History in California 4 Superior figures refer to references at the end of the essay. OIL AND GAS PRODUCTION California oil was always a valued commodity. When the Spanish explorers landed in California in the 1500s, they found Indians gathering asphaltum (very thick oil) from natural


Grained composite materials prepared by combustion synthesis under mechanical pressure  

DOE Patents [OSTI]

Dense, finely grained composite materials comprising one or more ceramic phase or phase and one or more metallic and/or intermetallic phase or phases are produced by combustion synthesis. Spherical ceramic grains are homogeneously dispersed within the matrix. Methods are provided, which include the step of applying mechanical pressure during or immediately after ignition, by which the microstructures in the resulting composites can be controllably selected.

Dunmead, Stephen D. (Davis, CA); Holt, Joseph B. (San Jose, CA); Kingman, Donald D. (Danville, CA); Munir, Zuhair A. (Davis, CA)



Thermal conductivity and specific heat of sorghum grain  

E-Print Network [OSTI]

Formation of Test Canister Ice Jacket ~ Sealing Test Canister in Calorimeter. . 43 44 Testing of Samples. Initial Calorimeter Observations. 49 Insertion of Grain Samples into Calorimeter. . . . 50 Final Test Observations Processing of Data. 54... to Contain the Grain Sample 38 for the Determination of Specific Heat 39 12. Top View of Calorimeter. 40 13. Galvanized Iron Cylinder Used to Form the Ice Jacket Around the Test Canister 42 VIII Figures 14. Clamping Device Used to Hold Test Canister...

Miller, Clinton Frank


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Research on Oil Recovery Mechanisms in Heavy Oil Reservoirs  

SciTech Connect (OSTI)

The goal of this project is to increase recovery of heavy oils. Towards that goal studies are being conducted in how to assess the influence of temperature and pressure on the absolute and relative permeability to oil and water and on capillary pressure; to evaluate the effect of different reservoir parameters on the in site combustion process; to develop and understand mechanisms of surfactants on for the reduction of gravity override and channeling of steam; and to improve techniques of formation evaluation.

Louis M. Castanier; William E. Brigham



OilEd: a Reason-able Ontology Editor for the Semantic Web  

E-Print Network [OSTI]

the full power of an expressive web ontology language (OIL). OilEd uses reasoning to support ontology been merged under the name DAML+OIL, although there are some differences between the approaches usedOilEd: a Reason-able Ontology Editor for the Semantic Web Sean Bechhofer, Ian Horrocks, Carole

Stevens, Robert


Plant-wide Control for Better De-oiling of Produced Water in Offshore Oil & Gas  

E-Print Network [OSTI]

Plant-wide Control for Better De-oiling of Produced Water in Offshore Oil & Gas Production Zhenyu (PWT) in offshore oil & gas production processes. Different from most existing facility- or material offshore and the oil industry expects this share to grow continuously in the future. In last decade, oil

Yang, Zhenyu


Oil and Gas CDT Development of a SUNTANS Baroclinic Model for 3D Oil  

E-Print Network [OSTI]

Oil and Gas CDT Development of a SUNTANS Baroclinic Model for 3D Oil Pollution Tracking Heriot) Key Words Oil Spill, HF Radar, Trajectory Forecasting, Hydrodynamic Modelling, Oil Chemistry Overview In an oil spill emergency, an operational system must forecast ocean and weather conditions in addition

Henderson, Gideon


OIL IN THE OPEN WATER Oil in the open water may a ect the health of  

E-Print Network [OSTI]

OIL IN THE OPEN WATER Oil in the open water may a ect the health of microscopic plants and animals. Far beneath the surface, corals and other deepwater communities might also be a ected. OIL AND HUMAN AND SEDIMENTS · Water quality surveys · Transect surveys to detect submerged oil · Oil plume modeling · Sediment


Oil shale: The environmental challenges III  

SciTech Connect (OSTI)

This book presents the papers of a symposium whose purpose was to discuss the environmental and socio-economic aspects of oil shale development. Topics considered include oil shale solid waste disposal, modeling spent shale disposal, water management, assessing the effects of oil shale facilities on water quality, wastewater treatment and use at oil shale facilities, potential air emissions from oil shale retorting, the control of air pollutant emissions from oil shale facilities, oil shale air emission control, socioeconomic research, a framework for mitigation agreements, the Garfield County approach to impact mitigation, the relationship of applied industrial hygiene programs and experimental toxicology programs, and industrial hygiene programs.

Petersen, K.K.



Enhanced Oil Recovery | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Enhanced Oil Recovery Enhanced Oil Recovery Enhanced Oil Recovery Cross-section illustrating how carbon dioxide and water can be used to flush residual oil from a subsurface rock formation between wells. Cross-section illustrating how carbon dioxide and water can be used to flush residual oil from a subsurface rock formation between wells. Crude oil development and production in U.S. oil reservoirs can include up to three distinct phases: primary, secondary, and tertiary (or enhanced) recovery. During primary recovery, the natural pressure of the reservoir or gravity drive oil into the wellbore, combined with artificial lift techniques (such as pumps) which bring the oil to the surface. But only about 10 percent of a reservoir's original oil in place is typically produced during primary recovery. Secondary recovery techniques extend a


International Energy Outlook 1999 - World Oil Markets  

Gasoline and Diesel Fuel Update (EIA)

oil.gif (4669 bytes) oil.gif (4669 bytes) A moderate view of future oil market developments is reflected in IEO99. Sustained high levels of oil prices are not expected, whereas continued expansion of the oil resource base is anticipated. The crude oil market was wracked with turbulence during 1998, as prices fell by one-third on average from 1997 levels. Even without adjusting for inflation, the world oil price in 1998 was the lowest since 1973. The declining oil prices were influenced by an unexpected slowdown in the growth of energy demand worldwide—less than any year since 1990—and by increases in oil supply, particularly in 1997. Although the increase in world oil production in 1998 was smaller than in any year since 1993, efforts to bolster prices by imposing further limits on production were


Long Term World Oil Supply  

Gasoline and Diesel Fuel Update (EIA)

0 0 Notes: The following pages summarize a recent EIA presentation on estimates of the world conventional oil resource base and the year when production from it will peak and then begin to decline. A version of this presentation was given by former EIA Administrator Jay Hakes to the April 18, 2000 meeting of the American Association of Petroleum Geologists in New Orleans, Louisiana. Specific information about this presentation may be obtained from John Wood (john.wood@eia.doe.gov), Gary Long (gary.long@eia.doe.gov) or David Morehouse (david.morehouse@eia.doe.gov). Long Term World Oil Supply http://www.eia.doe.gov/pub/oil_gas/petroleum/presentations/2000/long_term_supply/sld001.htm [8/10/2000 4:56:23 PM] Slide 2 of 20 http://www.eia.doe.gov/pub/oil_gas/petroleum/presentations/2000/long_term_supply/sld002.htm [8/10/2000 4:56:24 PM]


crude oil | OpenEI  

Open Energy Info (EERE)

crude oil crude oil Dataset Summary Description This dataset comes from the Energy Information Administration (EIA), and is part of the 2011 Annual Energy Outlook Report (AEO2011). This dataset is table 132, and contains only the reference case. The data is broken down into Production, lower 48 onshore and lower 48 offshore. Source EIA Date Released April 26th, 2011 (3 years ago) Date Updated Unknown Keywords 2011 AEO crude oil EIA prices Data application/vnd.ms-excel icon AEO2011: Lower 48 Crude Oil Production and Wellhead Prices by Supply Region- Reference Case (xls, 54.9 KiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Annually Time Period 2008-2035 License License Open Data Commons Public Domain Dedication and Licence (PDDL)


RMOTC - Testing - Enhanced Oil Recovery  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Enhanced Oil Recovery Enhanced Oil Recovery Notice: As of July 15th 2013, the Department of Energy announced the intent to sell Naval Petroleum Reserve Number 3 (NPR3). The sale of NPR-3 will also include the sale of all equipment and materials onsite. A decision has been made by the Department of Energy to complete testing at RMOTC by July 1st, 2014. RMOTC will complete testing in the coming year with the currently scheduled testing partners. For more information on the sale of NPR-3 and sale of RMOTC equipment and materials please join our mailing list here. RMOTC will play a significant role in continued enhanced oil recovery (EOR) technology development and field demonstration. A scoping engineering study on Naval Petroleum Reserve No. 3's (NPR-3) enhanced oil recovery


Essential Oils as Green Solvents  

Science Journals Connector (OSTI)

This chapter introduces the solvency of essential oils (EOs) as green solvents, in particular, application of terpenes as solvents in extraction. The physiochemical properties of such solvents are predicted in co...

Ying Li; Anne-Sylvie Fabiano-Tixier…



Bakken Shale Oil Production Trends  

E-Print Network [OSTI]

) database and in the format of monthly production for oil, water and gas. Additional 95 well data including daily production rate, completion, Pressure Volume Temperature (PVT), pressure data are given from companies who sponsor for this research study...

Tran, Tan



Fuel Oil Use in Manufacturing  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

of fuel oil relative to other fuels is that manufacturers must maintain large storage tanks. This can prove to be an added expense beyond the price of the fuel. Manufacturers...


Method for retorting oil shale  

DOE Patents [OSTI]

The recovery of oil from oil shale is provided in a fluidized bed by using a fluidizing medium of a binary mixture of carbon dioxide and 5 steam. The mixture with a steam concentration in the range of about 20 to 75 volume percent steam provides an increase in oil yield over that achievable by using a fluidizing gas of carbon dioxide or steam alone when the mixture contains higher steam concentrations. The operating parameters for the fluidized bed retorted are essentially the same as those utilized with other gaseous fluidizing mediums with the significant gain being in the oil yield recovered which is attributable solely to the use of the binary mixture of carbon dioxide and steam. 2 figs.

Shang, Jer-Yu; Lui, A.P.



Oil Prices: 1985 and 1990  

Science Journals Connector (OSTI)

Today oil is the world’s major energy resource. It accounts for about 54 percent of the world’s total energy consumption. Because of conservation and the development of alternative resources in industrialized ...

Thomas L. Saaty; Luis G. Vargas



Figure 4. World Oil Prices  

U.S. Energy Information Administration (EIA) Indexed Site

4. World Oil Prices" " (2007 dollars per barrel)" ,2007,2008,2009,2010,2011,2012,2013,2014,2015,2016,2017,2018,2019,2020,2021,2022,2023,2024,2025,2026,2027,2028,2029,2030...


Peak of the Oil Age  

Science Journals Connector (OSTI)

In late October 2003 The Economist published an article titled, “The End of the Oil Age” [1]. In the article’s introduction reference was made to a statement by Sheikh Yamani who served as Saudi Arabia’s minister...

Kjell Aleklett



Peaking of World Oil Production  

Science Journals Connector (OSTI)

Nonrenewable and renewable energy sources make up the two major energy categories of interest to our industrial civilization. Nonrenewable energy includes different fossil fuels (coal, oil, natural gas) th...

J. Edward Gates



The future of oil supply  

Science Journals Connector (OSTI)

...substituting non-liquid energy carriers such as gas or electricity...demand for the relevant energy services). Both the...impacts. The recovery and conversion of kerogen oil is extremely...efficiency limits for energy conversion devices. Energy 35...


Note: This page contains sample records for the topic "grain starch oil" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Residential heating oil prices available  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ago, based on the U.S. Energy Information Administration's weekly residential heating fuel price survey. Heating oil prices in the New England region are at 3.48 per gallon,...


Western Hemisphere Oil Products Balance  

Gasoline and Diesel Fuel Update (EIA)

Western Hemisphere Oil Products Balance Ramn Espinasa, Ph.D. Lead Specialist July 2014 The Energy Innovation Center Energy Division 3 The views expressed by the author do not...


Heating Oil and Propane Update  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

data not collected over the summer? The residential pricing data collected on heating oil and propane prices are for the Winter Heating Fuels Survey. The purpose of this survey...


Method for enhanced oil recovery  

DOE Patents [OSTI]

The present invention is directed to an improved method for enhanced recovery of oil from relatively "cold" reservoirs by carbon dioxide flooding. In oil reservoirs at a temperature less than the critical temperature of 87.7.degree. F. and at a pore pressure greater than the saturation pressure of carbon dioxide at the temperature of the reservoir, the carbon dioxide remains in the liquid state which does not satisfactorily mix with the oil. However, applicants have found that carbon dioxide can be vaporized in situ in the reservoir by selectively reducing the pore pressure in the reservoir to a value less than the particular saturated vapor pressure so as to greatly enhance the mixing of the carbon dioxide with the oil.

Comberiati, Joseph R. (Morgantown, WV); Locke, Charles D. (Morgantown, WV); Kamath, Krishna I. (Chicago, IL)



Oil shale, tar sands, and related materials  

SciTech Connect (OSTI)

This sixteen-chapter book focuses on the many problems and the new methodology associated with the commercialization of the oil shale and tar sand industry. Topics discussed include: an overview of the Department of Energy's oil shale R, D, and D program; computer simulation of explosive fracture of oil shale; fracturing of oil shale by treatment with liquid sulfur dioxide; chemistry of shale oil cracking; hydrogen sulfide evolution from Colorado oil shale; a possible mechanism of alkene/alkane production in oil shale retorting; oil shale retorting kinetics; kinetics of oil shale char gasification; a comparison of asphaltenes from naturally occurring shale bitumen and retorted shale oils: the influence of temperature on asphaltene structure; beneficiation of Green River oil shale by density methods; beneficiation of Green River oil shale pelletization; shell pellet heat exchange retorting: the SPHER energy-efficient process for retorting oil shale; retorted oil shale disposal research; an investigation into the potential economics of large-scale shale oil production; commercial scale refining of Paraho crude shale oil into military specification fuels; relation between fuel properties and chemical composition; chemical characterization/physical properties of US Navy shale-II fuels; relation between fuel properties and chemical composition: stability of oil shale-derived jet fuel; pyrolysis of shale oil residual fractions; synfuel stability: degradation mechanisms and actual findings; the chemistry of shale oil and its refined products; the reactivity of Cold Lake asphaltenes; influence of thermal processing on the properties of Cold Lake asphaltenes: the effect of distillation; thermal recovery of oil from tar sands by an energy-efficient process; and hydropyrolysis: the potential for primary upgrading of tar sand bitumen.

Stauffer, H.C.




SciTech Connect (OSTI)

Grain refinement behavior of copper alloys cast in permanent molds was investigated. This is one of the least studied subjects in copper alloy castings. Grain refinement is not widely practiced for leaded copper alloys cast in sand molds. Aluminum bronzes and high strength yellow brasses, cast in sand and permanent molds, were usually fine grained due to the presence of more than 2% iron. Grain refinement of the most common permanent mold casting alloys, leaded yellow brass and its lead-free replacement EnviroBrass III, is not universally accepted due to the perceived problem of hard spots in finished castings and for the same reason these alloys contain very low amounts of iron. The yellow brasses and Cu-Si alloys are gaining popularity in North America due to their low lead content and amenability for permanent mold casting. These alloys are prone to hot tearing in permanent mold casting. Grain refinement is one of the solutions for reducing this problem. However, to use this technique it is necessary to understand the mechanism of grain refinement and other issues involved in the process. The following issues were studied during this three year project funded by the US Department of Energy and the copper casting industry: (1) Effect of alloying additions on the grain size of Cu-Zn alloys and their interaction with grain refiners; (2) Effect of two grain refining elements, boron and zirconium, on the grain size of four copper alloys, yellow brass, EnviroBrass II, silicon brass and silicon bronze and the duration of their effect (fading); (3) Prediction of grain refinement using cooling curve analysis and use of this method as an on-line quality control tool; (4) Hard spot formation in yellow brass and EnviroBrass due to grain refinement; (5) Corrosion resistance of the grain refined alloys; (6) Transfer the technology to permanent mold casting foundries; It was found that alloying elements such as tin and zinc do not change the grain size of Cu-Zn alloys. Aluminum promoted b phase formation and modified the grain structure from dendritic to equiaxed. Lead or bismuth reduces the size of grains, but not change the morphology of the structure in Cu-Zn alloys. The grain size of the Cu-Zn-alloy can be reduced from 3000 mm to 300 mm after the addition of aluminum and lead. Similar effects were observed in EnviroBrass III after the addition of aluminum and bismuth. Boron refined the structure of yellow brasses in the presence of iron. At least 50 ppm of iron and 3 ppm of boron are necessary to cause grain refinement in these alloys. Precipitation of iron from the melt is identified as the cause of grain refinement. Boron initiates the precipitation of iron which could not be explained at this time. On the other hand zirconium causes some reduction in grain size in all four alloys investigated. The critical limit for the zirconium was found to be around 100 ppm below which not much refinement could be observed. The mechanism of grain refinement in the presence of zirconium could not be explained. Grain refinement by boron and iron can remain over a long period of time, at least for 72 hours of holding or after remelting few times. It is necessary to have the iron and boron contents above the critical limits mentioned earlier. On the other hand, refinement by zirconium is lost quite rapidly, some times within one hour of holding, mostly due to the loss of zirconium, most probably by oxidation, from the melt. In all the cases it is possible to revive the refinement by adding more of the appropriate refining element. Cooling curve analysis (thermal analysis) can be used successfully to predict the grain refinement in yellow brasses. The precipitation of iron in the liquid metal causes the metal to solidify without undercooling. Absence of this reaction, as indicated by the time-temperature (t-T) and its first derivative (dt/dT) curves, proved to be an indicator of refinement. The viability of the technique as an on-line quality control tool was proved in two foundries. The method can also correctly predict the onset of fading. Th




Panama: World Oil Report 1991  

SciTech Connect (OSTI)

This paper reports that Texaco signed a contract to explore 1.1 million acres in Blocks 1 and 2, on and offshore the northwestern coast. The firm has not revealed any plans beyond conducting a preliminary analysis. No drilling was reported last year. Switzerland-based Idria Oil and Gas, which drilled and abandoned three offshore wells with oil and gas shows in 1989, the it has no plans for 1991. However, the firm the it may drill three wells in 1992.

Not Available



Putting oil prices in perspective  

SciTech Connect (OSTI)

The author discusses the flawed'' energy policy of the US that seems to be: protect access to Persian Gulf oil with every means at its disposal. He discusses in general terms the real cost of oil which should include the military cost of the continuing conflicts in the Middle East. Full-cycle measurement (from the point of origin to the point of use) to determine energy costs would show natural gas and alternative fuels in their true cost.

Kauffmann, B.



Thermophilic hydrogen production from starch wastewater using two-phase sequencing batch fermentation coupled with UASB methanogenic effluent recycling  

Science Journals Connector (OSTI)

Abstract The aim of this study was to evaluate the performance of thermophilic hydrogenesis coupled with mesophilic methanogenesis in which the effluent was recycled to the hydrogen reactor for starch wastewater treatment. With this system, the hydrogen production rate and yield were 3.45 ± 0.25 L H2/(L·d) and 5.79 ± 0.41 mmol H2/g \\{CODadded\\} respectively, and thus higher than the values of the control group without methanogenic effluent recycling. In addition, relatively higher contents of acetate and butyrate were obtained in the hydrogen reactor with recirculation. The methane reactors were operated with the effluent from the hydrogen reactor, and methane yield was stabilized at 0.21–0.23 L/g \\{CODremoval\\} in both. Analysis of the microbial communities further showed that methanogenic effluent recirculation enriched microbial communities in the hydrogen reactor. Two species of bacteria effective in hydrogenesis, Thermoanaerobacterium thermosaccharolyticum and Clostridium thermosaccharolyticum, dominated during hydrogen production, whereas archaea belonging to Euryarchaeota were detected and cultured in the methane reactor. The recycled effluent supplied alkaline substrates for the hydrogen producing bacteria. Alkali balance calculations showed that the amount of added alkali was reduced by 88%. This amount, required for hydrogen production from starch wastewater, was contributed by alkali in the methanogenic effluent, (2225 ± 140 mg CaCO3/L), resulting in lower operational costs.

Li Xie; Nanshi Dong; Lei Wang; Qi Zhou



Heavy Oil Upgrading from Electron Beam (E-Beam) Irradiation  

E-Print Network [OSTI]

-heavy oil, and oil shale. Tremendous amounts of heavy oil resources are available in the world. Fig. 1.1 shows the total world oil reserves, and indicates that heavy oil, extra heavy oil, and bitumen make up about 70% of the world?s total oil resources...

Yang, Daegil



Economic vulnerability to Peak Oil  

Science Journals Connector (OSTI)

Abstract Peak Oil, which refers to the maximum possible global oil production rate, is increasingly gaining attention in both science and policy discourses. However, little is known about how this phenomenon will impact economies, despite its apparent imminence and potential dangers. In this paper, we construct a vulnerability map of the U.S. economy, combining two approaches for analyzing economic systems, i.e. input–output analysis and social network analysis (applied to economic data). Our approach reveals the relative importance of individual economic sectors, and how vulnerable they are to oil price shocks. As such, our dual-analysis helps identify which sectors, due to their strategic position, could put the entire U.S. economy at risk from Peak Oil. For the U.S., such sectors would include Iron Mills, Fertilizer Production and Transport by Air. Our findings thus provide early warnings to downstream companies about potential ‘trouble’ in their supply chain, and inform policy action for Peak Oil. Although our analysis is embedded in a Peak Oil narrative, it is just as valid and useful in the context of developing a climate roadmap toward a low carbon economy.

Christian Kerschner; Christina Prell; Kuishuang Feng; Klaus Hubacek



Enhanced oil recovery from heavy oil reservoirs utilizing a displacement agent  

Science Journals Connector (OSTI)

An oil displacement agent consisting of nonionic and anionic surfactants and emulsion stabilizers has been developed to enhance oil recovery from heavy oil reservoirs. The experimental results show that the pr...

Fusheng Zhang; Jian Ouyang; Xintong Ma…



Oil Price and Stock Returns of Consumers and Producers of Crude Oil  

Science Journals Connector (OSTI)

Abstract In this paper we investigate how differently stock returns of oil producers and oil consumers are affected from oil price changes. We find that stock returns of oil producers are affected positively by oil price changes regardless of whether oil price is increasing or decreasing. For oil consumers, oil price changes do not affect all consumer sub-sectors and where it does, this effect is heterogeneous. We find that oil price returns have an asymmetric effect on stock returns for most sub-sectors. We devise simple trading strategies and find that while both consumers and producers of oil can make statistically significant profits, investors in oil producer sectors make relatively more profits than investors in oil consumer sectors

Dinh Hoang Bach Phan; Susan Sunila Sharma; Paresh Kumar Narayan



Oil transportation in the global landscape : the Murmansk Oil Terminal and Pipeline proposal evaluated  

E-Print Network [OSTI]

Oil and transportation have been commingled since the first oil reserves were discovered. The importance of energy, namely oil, and the transportation of that energy from the producers to the consumers is persistently ...

Roy, Ankur, 1976-



State Oil and Gas Board State Oil and Gas Board Address Place...  

Open Energy Info (EERE)

Board State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Alabama http www gsa state al us ogb ogb html Alaska...


Simulation of Oil Displacement from Oil-Wet Cores by Interfacial Tension Reduction and Wettability Alteration  

E-Print Network [OSTI]

Waterflooding in oil-wet naturally fractured reservoirs is not successful because the ability of matrix blocks to imbibe the injected water and displace the oil into the fracture system is poor. Chemical enhanced oil recovery methods...

Kalaei, Mohammad Hosein



Diesel fuel oils, 1982  

SciTech Connect (OSTI)

Properties of diesel fuels produced during 1982 were submitted for study and compilation under a cooperative agreement between the Department of Energy (DOE), Bartlesville Energy Technology Center (BETC), Bartlesville, Oklahoma and the American Petroleum Institute (API). Tests of 184 samples of diesel fuel oils from 83 refineries throughout the country were made by 27 petroleum groups according to type of diesel fuel. Each group of analyses is subdivided into five tabulations according to five general regions of the country where the fuels are marketed. The regions, containing a total of 16 districts, are shown on a map in the report. Data from 13 laboratory tests on each individual diesel fuel sample are listed and arranged by geographic marketing districts in decreasing order of sales volumes. Charts are included showing trends of averages of certain properties for the four types of diesel fuels for the years 1960 to 1982. Summaries of the results of the 1982 survey, compared with similar data for 1981, are shown in Tables 1 through 4 of the report. A summary of 1-D and 2-D fuels are presented in Tables 5 and 6 respectively.

Shelton, E.M.



Diesel fuel oils, 1981  

SciTech Connect (OSTI)

Properties of diesel fuels produced during 1981 were submitted for study and compilation under a cooperative agreement between the Department of Energy (DOE), Bartlesville Energy Technology Center (BETC), Bartlesville, Oklahoma and the American Petroleum Institute (API). Tests of 160 samples of diesel fuel oils from 77 refineries throughout the country were made by 26 petroleum groups according to type of diesel fuel. Each group of analyses is subdivided into five tabulations according to five general regions of the country where the fuels are marketed. The regions, containing a total of 16 districts, are shown on a map in the report. Data from 13 laboratory tests on each individual diesel fuel sample are listed and arranged by geographic marketing districts in decreasing order of sales volumes. Charts are included showing trends of averages of certain properties for the four types of diesel fuels for the years 1960 to 1981. Summaries of the results of the 1981 survey, compared with similar data for 1980, are shown.

Shelton, E.M.



Oil Mist Compliance  

SciTech Connect (OSTI)

This report summarizes activities at the KCP related to evaluating and modifying machine tools in order to be in compliance with Section 23 of DOE 10 CFR 851, Worker Safety and Health Program. Section 851.23 (a) states that “Contractors must comply with the following safety and health standards that are applicable to the hazards in their covered workplace”, and subsection 9 contains the following applicable standard: “American Congress of Governmental Industrial Hygienists (ACGIH), ‘Threshold Limit Values for Chemical Substances and Physical Agents and Biological Exposure Indices,’ (2005) (incorporated by reference, see §851.27) when the ACGIH Threshold Limit Values are lower (more protective) than permissible exposure limits in 29 CFR 1910.” In the 2005 ACGIH – Threshold Limit Value book a Notice of Change was issued for exposure to mineral oil mist used in metalworking fluids (MWFs). The effects of planning for the new facility and which machine tools would be making the transition to the new facility affected which machine tools were modified.

Lazarus, Lloyd



Hydrocarbon analysis of shrimp from oil polluted waters  

E-Print Network [OSTI]

), serious pollution problems are caused by crude oils, residual fuel oils, lubricating oils and miscel- laneous tank washings, sludges and tarsi known collectively as persis- tant oils, to distinguish them from light fuel oils such as gasoline, kerosene... obtained from crude oil, die- sel oil and lubricating oil. These "fingerprints" were compared to "fingerprints" from shrimp to obtain parameters for assessing pollution of shrimp by crude oil and its derivatives. Using these parameters, contaminated...

DeWitt, Bernard John
