Powered by Deep Web Technologies
Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CO2 Emissions - Ghana  

NLE Websites -- All DOE Office Websites (Extended Search)

Africa Ghana Graphics CO2 Emissions from Ghana Data graphic Data CO2 Emissions from Ghana image Per capita CO2 Emission Estimates for Ghana...


Ke Huang  

NLE Websites -- All DOE Office Websites (Extended Search)

Ke Huang China Energy Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 90R2002 Berkeley CA 94720 Office Location: 90-2117N (510) 486-4733 KeHuang@lbl.gov Ke Huang is...


Jing Ke  

NLE Websites -- All DOE Office Websites (Extended Search)

Jing Ke Jing Ke China Energy Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 90-4000 Berkeley CA 94720 Office Location: 90H-0113 (510) 486-4537 JKe@lbl.gov Jing Ke...


Ghana | OpenEI  

Open Energy Info (EERE)

Ghana Ghana Dataset Summary Description (Abstract): Raster GIS data, 50 m wind power density for Ghana. (Purpose): To provide information on the wind resource potential in Ghana. Source NREL Date Released September 02nd, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords GEF Ghana GIS maps NREL SWERA UNEP wind Data application/zip icon Download Maps (zip, 661.4 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access Average vote Your vote Overall rating Average vote Your vote Comments Login or register to post comments


OpenEI - Ghana  

Open Energy Info (EERE)

http:en.openei.orgdatasetstaxonomyterm2650 en Wind: wind power density maps at 50m above ground and 1km resolution for Ghana from NREL http:en.openei.orgdatasetsnode745...


NPP Tropical Forest: Kade, Ghana  

NLE Websites -- All DOE Office Websites (Extended Search)

Kade, Ghana, 1957-1972 Kade, Ghana, 1957-1972 [PHOTOGRAPH] Photograph: Forest after clearing of secondary growth at the Kade site (click on the photo to view a series of images from this site). Data Citation Cite this data set as follows: Nye, P. H., and D. J. Greenland. 1998. NPP Tropical Forest: Kade, Ghana, 1957-1972. Data set. Available on-line [http://www.daac.ornl.gov] from Oak Ridge National Laboratory Distributed Active Archive Center, Oak Ridge, Tennessee, U.S.A. Description Biomass and nutrient content of different vegetation components and soil for a secondary tropical forest were determined in the late 1950s at the Kade Agricultural Research Station of the former University College, Ghana. Net primary production (NPP) was estimated on the basis of standing biomass accumulation and litter fall. Later studies on litter and wood fall and


National Renewable Energy Report for SWERA: Ghana (Abstract...  

Open Energy Info (EERE)

Renewable Energy Report for SWERA: Ghana (Abstract):The National Renewable Energy Report describes the energy situation in Ghana and identifies solar and wind...


Technical Report - Ghana Wind Energy Resource Assessment  

Open Energy Info (EERE)

Ghana Wind Energy Resource Assessment (Abstract):This document describes the development of detailed high-resolution (1 km2) wind energy resource maps for...


Ghana-UNDP Climate Activities | Open Energy Information  

Open Energy Info (EERE)

UNDP Climate Activities UNDP Climate Activities Agency/Company /Organization United Nations Development Programme Topics Background analysis Website http://ccmap.undp.org/ Country Ghana Western Africa References UNDP Interactive Climate Projects Map[1] Ghana (17) Climate Change Adaptation Programme Climate Change and Development - Adapting by Reducing Vulnerability (CCDARE) Enhancing Access to Sustainable Energy Services Enhancing Access to Sustainable Energy Services for the Poor in Ghana Ghana National Capacity Assessment (Completed) Ghana: Establishing an Effective and Sustainable Structure for Implementing Multilateral Environment Agreements Ghana: Second national Communication to the UNFCCC Global Village Energy Partnership - Energy for Poverty Reduction Action Plan (Completed)


Designing sanitation projects in rural Ghana  

E-Print Network (OSTI)

Providing sanitation to rural areas in Ghana remains a huge challenge. Government funding is scarce while many international donor projects are ineffective. This thesis explores the difficulties with rural sanitation ...

Lau, Jonathan (Jonathan Ho Yin)



Assessment of rainwater harvesting in Northern Ghana  

E-Print Network (OSTI)

This study assesses the current state of rainwater harvesting in the Northern Region of Ghana and makes recommendations regarding if and how rainwater harvesting could be used to address Pure Home Water's goal of reaching ...

Barnes, David Allen



Ghana-Supporting Low Carbon Growth | Open Energy Information  

Open Energy Info (EERE)

Ghana-Supporting Low Carbon Growth Ghana-Supporting Low Carbon Growth Jump to: navigation, search Name Ghana-Supporting Low Carbon Growth Agency/Company /Organization Energy Research Centre of the Netherlands (ECN) Partner Ghana Energy Commission, Tokornoo and Associates, STEPRI, Kumasi Institute of Technology and Environment (KITE) Sector Energy Focus Area Non-renewable Energy, Energy Efficiency, People and Policy Topics Background analysis, Baseline projection, Co-benefits assessment, Low emission development planning Resource Type Publications Website http://www.ecn.nl/fileadmin/ec Program Start 2010 Program End 2011 Country Ghana Western Africa References Low Carbon Development in Ghana, ECN Ghana Policy Briefs [1] Marginal Abatement Cost (MAC) curve, ECN Ghana Policy Briefs[2]


Ghana-Ecobank DCA Guarantee | Open Energy Information  

Open Energy Info (EERE)

Ghana-Ecobank DCA Guarantee Ghana-Ecobank DCA Guarantee Jump to: navigation, search Name Ghana-Ecobank DCA Guarantee Agency/Company /Organization U.S. Agency for International Development Sector Energy Topics Finance, Background analysis Resource Type Publications Website http://www.usaid.gov/our_work/ Country Ghana Western Africa References Ghana-Ecobank DCA Guarantee[1] Overview "In response to this environment USAID/Ghana implemented two Development Credit Authority (DCA) loan guarantees with EcoBank, a prominent retail bank in Ghana. Under the guarantees USAID/Ghana agreed to cover 50 percent of EcoBank's losses of principle on guaranteed loans up to a specified ceiling on total loan value. The guarantees reduce the bank's risk and thereby encourage it to make loans to specific sectors that support


Ghana-World Bank Climate Projects | Open Energy Information  

Open Energy Info (EERE)

World Bank Climate Projects World Bank Climate Projects Agency/Company /Organization World Bank Sector Energy, Land Focus Area Renewable Energy, Forestry Topics Background analysis, Co-benefits assessment, - Energy Access, Finance Country Ghana Western Africa References World Bank Project Database - Ghana [1] Contents 1 Active World Bank Climate Projects in Ghana 1.1 Forest Carbon Partnership Facility Readiness Grant 1.2 Energy Development and Access Project (GEDAP) 1.3 Ghana Rural Energy Access - Global Env. Project 1.4 Ghana Natural Resources and Environmental Governance 2 References Active World Bank Climate Projects in Ghana Forest Carbon Partnership Facility Readiness Grant (.2M - Active) Energy Development and Access Project - IBRD/IDA (90M - Active) Ghana Rural Energy Access - Global Env. Project (5.5M - Active).


Ghana-NREL Rural Electrification | Open Energy Information  

Open Energy Info (EERE)

NREL Rural Electrification NREL Rural Electrification Jump to: navigation, search Logo: Ghana Rural Electrification Name Ghana Rural Electrification Agency/Company /Organization National Renewable Energy Laboratory Partner UNDP and GEF Sector Energy Topics Market analysis, Background analysis Program Start 1996 Program End 2002 Country Ghana Western Africa References NREL International Program Overview [1] Abstract From 1996-2002, NREL supported the development of a rural electrification project in Ghana in cooperation with UNDP and GEF. From 1996-2002, NREL supported the development of a rural electrification project in Ghana in cooperation with UNDP and GEF. NREL also piloted a business model for providing energy services in rural areas of Ghana.[1] References ↑ 1.0 1.1 NREL International Program Overview - Ghana


Ghana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ghana: Energy Resources Ghana: Energy Resources (Redirected from ECOWAS Gateway-Ghana) Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":8,"lon":-2,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Accra, Ghana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Accra, Ghana: Energy Resources Accra, Ghana: Energy Resources Jump to: navigation, search Name Accra, Ghana Equivalent URI DBpedia GeoNames ID 2306104 Coordinates 5.55°, -0.216667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":5.55,"lon":-0.216667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ghana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ghana: Energy Resources Ghana: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":8,"lon":-2,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


United States Announces New Bilateral Partnership with Ghana | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

United States Announces New Bilateral Partnership with Ghana United States Announces New Bilateral Partnership with Ghana United States Announces New Bilateral Partnership with Ghana March 16, 2012 - 2:16pm Addthis Washington, D.C. - The United States announced today that it has formed a new bilateral partnership with Ghana that will build on the strong bilateral ties between the two countries and support further cooperation on a range of economic development issues. On March 9, U.S. Energy Secretary Steven Chu and Ghana Finance Minister Kwabena Duffuor signed a Statement of Principles reaffirming our bilateral commitment to supporting President Obama's Partnership for Growth (PfG) Initiative. Ghana is one of the first four countries globally - including El Salvador, Tanzania, and the Philippines - to participate in the interagency PfG Initiative.


United States Announces New Bilateral Partnership with Ghana | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

United States Announces New Bilateral Partnership with Ghana United States Announces New Bilateral Partnership with Ghana United States Announces New Bilateral Partnership with Ghana March 16, 2012 - 2:16pm Addthis Washington, D.C. - The United States announced today that it has formed a new bilateral partnership with Ghana that will build on the strong bilateral ties between the two countries and support further cooperation on a range of economic development issues. On March 9, U.S. Energy Secretary Steven Chu and Ghana Finance Minister Kwabena Duffuor signed a Statement of Principles reaffirming our bilateral commitment to supporting President Obama's Partnership for Growth (PfG) Initiative. Ghana is one of the first four countries globally - including El Salvador, Tanzania, and the Philippines - to participate in the interagency PfG Initiative.

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ghana-IAEA Energy Planning | Open Energy Information  

Open Energy Info (EERE)

IAEA project database1 IAEA is working with Ghana on Evaluating the Role of Nuclear Power in Future Options for Electricity Generation activities. References "IAEA...


Refrigerator Efficiency in Ghana: Tailoring an Appliance Market...  

NLE Websites -- All DOE Office Websites (Extended Search)

Refrigerator Efficiency in Ghana: Tailoring an Appliance Market Transformation Program Design for Africa Publication Type Report LBNL Report Number LBNL-61251 Year of...


Ke An | ORNL Neutron Sciences  

NLE Websites -- All DOE Office Websites (Extended Search)

Ke An Ke An Lead Instrument Scientist: VULCAN Education Ph.D. Department of Engineering Science and Mechanics, Virginia Tech, 2003. M.S. Department of Chemical Engineering, Tianjin University, 2000. B.S. Department of Chemical Engineering, Tianjin University, 1998. B.S. Department of Management, Tianjin University, 1998. Honors/Awards 2011 Siemens Teachers as Researchers Mentor Performance Award Supplemental Performance Award, NSSD, ORNL, 2009 Excellence in Science and Technology Research and Development, Ministry of Education, China. 2003. "A Study on Low Cycle Fatigue of Metal Materials under Multiaxial Nonproportional Loading". Excellence in Science and Technology Research and Development, Government of Tianjin City, China. 2002, "Life Prediction of Multiaxial Low Cycle


Ghana-Forest Investment Program (FIP) | Open Energy Information  

Open Energy Info (EERE)

Ghana-Forest Investment Program (FIP) Ghana-Forest Investment Program (FIP) Jump to: navigation, search Name Ghana-Forest Investment Program (FIP) Agency/Company /Organization World Bank Sector Land Topics Background analysis, Finance, Implementation, Low emission development planning, Market analysis Website http://www.climatefundsupdate. Program Start 2008 Country Ghana Western Africa References Forest Investment Program (FIP)[1] Forest Investment Program[2] Brazil Specific Documents[3] Democratic Republic of Congo Specific Documents[4] Ghana Specific Documents[5] Indonesia Specific Documents[6] Laos Specific Documents[7] Mexico Specific Documents[8] Peru Specific Documents[9] Overview "The Forest Investment Program (FIP) is a targeted program of the Strategic Climate Fund (SCF), which is one of two funds within the framework of the


National Renewable Energy Report for SWERA: Ghana | OpenEI  

Open Energy Info (EERE)

Report for SWERA: Ghana Report for SWERA: Ghana Dataset Summary Description (Abstract): The National Renewable Energy Report describes the energy situation in Ghana and identifies solar and wind energy opportunities. (Purpose): To promote solar and wind energy investments. Source Ghana Energy Commission Date Released September 02nd, 2005 (9 years ago) Date Updated November 07th, 2007 (7 years ago) Keywords documentation Ghana renewable energy solar SWERA UNEP wind Data application/msword icon Download Document (doc, 1.2 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2005 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset


Ghana-Facilitating Implementation and Readiness for Mitigation (FIRM) |  

Open Energy Info (EERE)

Ghana-Facilitating Implementation and Readiness for Mitigation (FIRM) Ghana-Facilitating Implementation and Readiness for Mitigation (FIRM) Jump to: navigation, search Logo: Ghana-Facilitating Implementation and Readiness for Mitigation (FIRM) Name Ghana-Facilitating Implementation and Readiness for Mitigation (FIRM) Agency/Company /Organization United Nations Environment Programme (UNEP) Partner Global Environment Facility (GEF), Government of Denmark Sector Climate, Energy, Land Topics Adaptation, Co-benefits assessment, - Environmental and Biodiversity, Finance, Implementation, Low emission development planning Website http://www.unep.org/climatecha Program Start 2011 Program End 2013 Country Ghana UN Region Central America References Facilitating Implementation and Readiness for Mitigation (FIRM)[1] "The Government of Denmark will provide US$6 million to the new programme


Ghana-GTZ Sustainable Economic Development | Open Energy Information  

Open Energy Info (EERE)

Economic Development Economic Development Jump to: navigation, search Logo: Ghana-GTZ Sustainable Economic Development Name Ghana-GTZ Sustainable Economic Development Agency/Company /Organization Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Partner German Federal Ministry for Economic Cooperation and Development (BMZ) Sector Energy Topics Background analysis, Co-benefits assessment, - Energy Access Website http://www.gtz.de/en/weltweit/ Program Start 2006 Program End 2013 Country Ghana Western Africa References Sustainable Economic Development in Ghana[1] GTZ is working with Ghana on this project with the following objective: "The judicial, economic and institutional framework conditions and the access to energy as well as to financial and non-financial services has


KE Basin Sludge Flocculant Testing  

SciTech Connect

In the revised path forward and schedule for the K Basins Sludge Retrieval and Disposal Project, the sludge in K East (KE) Basin will be moved from the floor and pits and transferred to large, free-standing containers located in the pits (so as to isolate the sludge from the basin). When the sludge is pumped into the containers, it must settle fast enough and clarify sufficiently that the overflow water returned to the basin pool will not cloud the water or significantly increase the radiological dose rate to the operations staff as a result of increased suspended radioactive material. The approach being evaluated to enhance sludge settling and speed the rate of clarification is to add a flocculant to the sludge while it is being transferred to the containers. In February 2004, seven commercial flocculants were tested with a specific K Basin sludge simulant to identify those agents that demonstrated good performance over a broad range of slurry solids concentrations. From this testing, a cationic polymer flocculant, Nalco Optimer 7194 Plus (7194+), was shown to exhibit superior performance. Related prior testing with K Basin sludge and simulant in 1994/1996 had also identified this agent as promising. In March 2004, four series of jar tests were conducted with 7194+ and actual KE Basin sludge (prepared by combining selected archived KE sludge samples). The results from these jar tests show that 7194+ greatly improves settling of the sludge slurries and clarification of the supernatant.

Schmidt, Andrew J.; Hallen, Richard T.; Muzatko, Danielle S.; Gano, Sue



ECN-Supporting low carbon growth in Ghana | Open Energy Information  

Open Energy Info (EERE)

low carbon growth in Ghana low carbon growth in Ghana Jump to: navigation, search Name Supporting low carbon growth in Ghana Agency/Company /Organization Energy Research Centre of the Netherlands (ECN) Partner Ghana Energy Commission, Tokornoo and Associates, STEPRI, Kumasi Institute of Technology and Environment (KITE) Sector Energy Focus Area Non-renewable Energy, Energy Efficiency, People and Policy Topics Baseline projection, Low emission development planning, Co-benefits assessment, Background analysis Resource Type Publications Website http://www.ecn.nl/fileadmin/ec Program Start 2010 Program End 2011 Country Ghana Western Africa References Low Carbon Development in Ghana, ECN Ghana Policy Briefs [1] Marginal Abatement Cost (MAC) curve, ECN Ghana Policy Briefs[2] NAMAs and MRV, ECN Ghana Policy Briefs[3]


Energy Consumption of Refrigerators in Ghana - Outcomes of Household...  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Consumption of Refrigerators in Ghana - Outcomes of Household Surveys Speaker(s): Essel Ben Hagan Date: July 12, 2007 - 12:00pm Location: 90-3122 Seminar HostPoint of...


Ghana-REDD Readiness Requires Radical Reform | Open Energy Information  

Open Energy Info (EERE)

Readiness Requires Radical Reform Readiness Requires Radical Reform Jump to: navigation, search Name Ghana-REDD Readiness Requires Radical Reform Agency/Company /Organization UN-REDD Programme Sector Land Focus Area Forestry, Agriculture Topics Implementation, GHG inventory, Policies/deployment programs, Resource assessment, Pathways analysis, Background analysis Resource Type Maps, Guide/manual, Training materials Website http://environment.yale.edu/tf Country Ghana UN Region Western Africa References Ghana-REDD Readiness[1] Summary "The fundamental changes needed for sustainable forest management in Ghana have been known for years, and many large projects have been instigated accordingly. Yet real change has proved elusive. The key challenge now is to get REDD-plus right so that it makes a difference. Dialogue participants


Initiatives Related to Climate Change in Ghana | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Initiatives Related to Climate Change in Ghana Jump to: navigation, search Tool Summary Name: Initiatives Related to Climate Change in Ghana Agency/Company /Organization: Climate and Development Knowledge Network (CDKN), Energy Research Centre of the Netherlands (ECN) Sector: Energy, Land, Water, Climate Focus Area: Energy Efficiency, Renewable Energy, Transportation, Forestry Topics: Background analysis Resource Type: Publications Website: cdkn.org/wp-content/uploads/2011/04/Ghana-initiatives-mapping-climate- Country: Ghana Cost: Free UN Region: Western Africa


Energy Consumption of Refrigerators in Ghana - Outcomes of Household  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Consumption of Refrigerators in Ghana - Outcomes of Household Energy Consumption of Refrigerators in Ghana - Outcomes of Household Surveys Speaker(s): Essel Ben Hagan Date: July 12, 2007 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Robert Van Buskirk Galen Barbose As part of activities to develop refrigerator efficiency standards regulations in Ghana, a national survey on the energy consumption of refrigerators and refrigerator-freezers has been conducted. The survey covered 1000 households in urban, peri-urban and rural communities in various parts of the country. The survey found that, on average, refrigerators and refrigerator-freezers in Ghana use almost three times what is allowed by minimum efficiency standards in the U.S., and a few refrigerators had energy use at levels almost ten times the U.S.


Ghana Energy Development and Access Project (GEDAP) | Open Energy  

Open Energy Info (EERE)

Energy Development and Access Project (GEDAP) Energy Development and Access Project (GEDAP) Jump to: navigation, search Name of project Ghana Energy Development and Access Project (GEDAP) Location of project Ghana Energy Services Lighting, Cooking and water heating, Information and communications Year initiated 2007 Organization World Bank Website http://web.worldbank.org/exter Coordinates 7.946527°, -1.023194° References World Bank[1] The objective of the Energy Development and Access Project in Ghana is to improve the operational efficiency of the electricity distribution system and increase the population's access to electricity. This will also cause Ghana to support its transition to a low-carbon economy through the reduction of greenhouse gas emissions (GHG). The project has three main


Ghana-Climate Technology Initiative Private Financing Advisory Network (CTI  

Open Energy Info (EERE)

Ghana-Climate Technology Initiative Private Financing Advisory Network (CTI Ghana-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Jump to: navigation, search Logo: Ghana-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Name Ghana-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Agency/Company /Organization Climate Technology Initiative (CTI), United States Agency for International Development (USAID), Renewable Energy and Energy Efficiency Partnership (REEEP) Partner International Centre for Environmental Technology Transfer Sector Energy Focus Area Agriculture, Biomass, - Biofuels, - Landfill Gas, - Waste to Energy, Buildings, Energy Efficiency, Forestry, Geothermal, Greenhouse Gas, Solar, Transportation, Water Power, Wind Topics Adaptation, Co-benefits assessment, - Energy Access, - Environmental and Biodiversity, - Health, - Macroeconomic, Finance, Implementation, Low emission development planning, -NAMA, -TNA


Evaluation of the complementary use of the ceramic (Kosim) filter and Aquatabs in Northern Region, Ghana  

E-Print Network (OSTI)

The Kosim filter is a ceramic water filter that is currently used in Northern Ghana. Based on prior MIT research in Northern Ghana, this technology is effective at removing 92% of turbidity, 99.4% of total coliforms, and ...

Swanton, Andrew A



Hemispheric ceramic pot filter evaluation and quality assurance program in Northern Ghana  

E-Print Network (OSTI)

Pure Home Water (PHW) is a non-profit based in Ghana that seeks to bring safe drinking water to those most in need in Northern Ghana through the production, sale, and distribution of ceramic pot filters (CPF) and other ...

Miller, Matthew Rhodes



The impacts of oil and gas activities on fisheries in the western region of Ghana .  

E-Print Network (OSTI)

??Ghanas find of oil and gas in commercial quantities marks the beginning of a billion-dollar industry. The exploration and production of it is a major (more)

Egyir, Isaac Kwasi



Ceramic filter manufacturing in Northern Ghana : water storage and quality control  

E-Print Network (OSTI)

In 2009, Pure Home Water (PHW), a Ghana based non-profit organization working to provide affordable and safe drinking water to people in the Northern Region of Ghana, began the construction of a ceramic pot filter (CPF) ...

Kleiman, Shanti Lisa



Perspectives on types of schools from Ghana and Pakistan: revisiting the relationship between  

E-Print Network (OSTI)

Perspectives on types of schools from Ghana and Pakistan: revisiting the relationship between in both Ghana and Pakistan. While parents focus more on the economic opportunities that are becoming providers in the field of education in both Ghana and Pakistan. This has created a discernable rise

Travis, Adrian

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ghana-Support for Future National Climate Change Policy Framework | Open  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Ghana-Support for Future National Climate Change Policy Framework Jump to: navigation, search Name CDKN-Ghana-Support for Future National Climate Change Policy Framework Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development Partner Energy Research Centre of the Netherlands (ECN), University of Ghana Sector Climate, Energy, Land Topics Background analysis, Low emission development planning, Pathways analysis Website http://cdkn.org/project/assist Program Start 2010 Program End 2011 Country Ghana UN Region Western Africa References CDKN-Ghana-Support for Future National Climate Change Policy Framework[1] Policy brief[2]


XUAN Ke's music and life story  

E-Print Network (OSTI)

Han Chinese Traditional Music Performance By XUAN Kes Orchestra, Lijiang, Oct 2003 00:18 An introduction of the background of the music, by XUAN Ke. 02:49 No. I Eight Trigrams (??), a Taoist ritual music in Tang Dynasty (1741) 13:47 No. I Lang Tao...

Xuan Ke, Alan Macfarlane



Documentation of high resolution solar resource assessment for Ghana  

Open Energy Info (EERE)

Ghana Ghana provided by DLR Dataset Summary Description (Abstract): Documentation of the satellite-based high resolution solar resource assessment for Ghana provided by DLR. The high resolution solar data (10kmx10km) provide country maps of the annual and monthly sums of hourly global horizontal and direct normal irradiance (GHI and DNI) for the year 2000, 2001 and 2002. Additionally, for selected sites hourly values of GHI and DNI are provided.The Documentation gives an overview about the used input data and used methodology, shows example maps and describes a comparison with ground data (if provided by the country) (Purpose): The data are helpful for the assessment of the solar potential of the country and can give projet developer a first impression of the solar resource of the country. For the selected


www.deafrica.net Botswana Ghana Mali Senegal Tanzania Zambia  

E-Print Network (OSTI)

to development and poverty alleviation. · Particular focus on M&E and impact analysis of energy projects Market conditions Can information on development impacts influence policy and project design? #12;7 DEA1 www.deafrica.net Botswana Ghana Mali Senegal Tanzania Zambia Development and Energy in Africa


Land-Cover Dynamics in an Urban Area of Ghana  

Science Conference Proceedings (OSTI)

The objectives of this study were to quantify land-cover changes. A short-term projection of land-cover distribution in a 2400-ha (1 ha = 10 000 m2 ) area of northern Ghana was generated. Landsat Thematic Mapper images acquired in 1984, 1992, and ...

Ademola K. Braimoh; Paul L. G. Vlek



Ghana-GTZ Electrification Component of the Promotion of Private Sector  

Open Energy Info (EERE)

Electrification Component of the Promotion of Private Sector Electrification Component of the Promotion of Private Sector Programme Jump to: navigation, search Logo: Ghana-GTZ Electrification Component of the Promotion of Private Sector Programme Name Ghana-GTZ Electrification Component of the Promotion of Private Sector Programme Agency/Company /Organization GTZ Sector Energy Focus Area Renewable Energy Topics Background analysis Website http://www.gtz.de/en/themen/um Country Ghana Western Africa References Electrification Component of the Promotion of Private Sector Programme in Ghana[1] This article is a stub. You can help OpenEI by expanding it. References ↑ "Electrification Component of the Promotion of Private Sector Programme in Ghana" Retrieved from "http://en.openei.org/w/index.php?title=Ghana-GTZ_Electrification_Component_of_the_Promotion_of_Private_Sector_Programme&oldid=328714"


On the 17-keV neutrino  

SciTech Connect

A brief review on the status of the 17-keV neutrino is presented. Several different experiments found spectral distortions which were consistently interpreted as evidence for a heavy neutrino admixture in [beta] decay. Recent experiments, however, rule out the existence of a 17-keV neutrino as well as escaping criticisms of earlier null results. Moreover, the majority of positive results have been reinterpreted in terms of instrumental effects, despite the need for a different explanation in each case. Anomalies persist in the low energy region of the tritium spectrum which deserve further investigation.

Hime, A.



On the 17-keV neutrino  

SciTech Connect

A brief review on the status of the 17-keV neutrino is presented. Several different experiments found spectral distortions which were consistently interpreted as evidence for a heavy neutrino admixture in {beta} decay. Recent experiments, however, rule out the existence of a 17-keV neutrino as well as escaping criticisms of earlier null results. Moreover, the majority of positive results have been reinterpreted in terms of instrumental effects, despite the need for a different explanation in each case. Anomalies persist in the low energy region of the tritium spectrum which deserve further investigation.

Hime, A.



KE Basin underwater visual fuel survey  

SciTech Connect

Results of an underwater video fuel survey in KE Basin using a high resolution camera system are presented. Quantitative and qualitative information on fuel degradation are given, and estimates of the total fraction of ruptured fuel elements are provided. Representative photographic illustrations showing the range of fuel conditions observed in the survey are included.

Pitner, A.L.



Integrated: Geospatial Toolkit for Ghana from NREL | OpenEI  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Stand-alone and easy to use geographic toolkit that allows non-GIS users to relate the renewable energy resource (solar and wind) data to other geographic data, such as land use, protected areas, elevation, etc. (Purpose): The Solar and Wind Energy Resource Assessment (SWERA) Geospatial Toolkit (GsT) is a map-based software application that can be used for decision making and policy analysis in addition to planning for future energy projects. The SWERA application utilizes Geographical Information Systems (GIS) to develop common scenarios to evaluate potential locations for solar or wind energy plants. (Supplemental Information): The zip file contains the geospatial toolkit executable, Getting Started Document, and metadata.


CDKN-Ghana-Support for Future National Climate Change Policy Framework |  

Open Energy Info (EERE)

Support for Future National Climate Change Policy Framework Support for Future National Climate Change Policy Framework Jump to: navigation, search Name CDKN-Ghana-Support for Future National Climate Change Policy Framework Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development Partner Energy Research Centre of the Netherlands (ECN), University of Ghana Sector Climate, Energy, Land Topics Background analysis, Low emission development planning, Pathways analysis Website http://cdkn.org/project/assist Program Start 2010 Program End 2011 Country Ghana UN Region Western Africa References CDKN-Ghana-Support for Future National Climate Change Policy Framework[1] Policy brief[2] "CDKN responded to a request by the Government of Ghana to help develop a


Report on the feasibility study for improving electric motor service centers in Ghana  

Science Conference Proceedings (OSTI)

On March 3 and 4, 1998, a visit was made to Oak Ridge National Laboratory (ORNL) by two officials from Ghana: Mr. I.K. Mintah, Acting Executive Director, Technical Wing, Ministry of Mines and Energy (MOME) and Dr. A.K. Ofosu-Ahenkorah, Coordinator, Energy Efficiency and Conservation Program, MOME. As a result of this visit, Dr. John S. Hsu of ORNL was invited by MOME to visit the Republic of Ghana in order to study the feasibility of improving electric motor service centers in Ghana.

Hsu, J.S.; Jallouk, P.A.; Staunton, R.H.



H2A Delivery: GH2 and LH2 Forecourt Land Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

GH2 and LH2 Forecourt GH2 and LH2 Forecourt GH2 and LH2 Forecourt Land Areas Land Areas Hydrogen Delivery Analysis Meeting May 8-9, 2007 Columbia, Maryland TIAX LLC Matthew Hooks 1601 S. D Anza Blvd. hooks.matthew@TIAXLLC.com Cupertino CA, 95014 Tel. 408-517-1550 Reference: D0348 © 2007 TIAX LLC General Assumptions ƒ Forecourt stations with fewer than 6 hydrogen dispensers will have both hydrogen and gasoline dispensers on-site (6 total) ƒ Forecourt area (not including convenience store) will be allocated based on relative number of hydrogen/gasoline dispensers ƒ All stations with more than 6 hydrogen dispensers will only dispense hydrogen ƒ 100% of forecourt area (not including convenience store) will be allocated to hydrogen delivery ƒ Area allocated to hydrogen storage will be in excess of the


Meteorology: typical meteorological data for selected stations in Ghana  

Open Energy Info (EERE)

data for selected stations in Ghana data for selected stations in Ghana from NREL Dataset Summary Description (Abstract): Each TMY is a data set of hourly values of solar radiation and meteorological elements for a 1-year period. Solar radiation is modeled using the NREL METSTAT model, with surface observed cloud cover being the principal model input. The container file contains one TMY file for each selected station in the region, plus documentation files and a TMY data reader file for use with Microsoft Excel. (Purpose): Simulations> (Supplemental Information): A TMY consists of months selected from individual years and concatenated to form a complete year. The intended use is for computer simulations of solar energy conversion systems and building systems. Because of the selection criteria, these TMYs are not appropriate for simulations of wind energy conversion systems. A TMY provides a standard for hourly data for solar radiation and other meteorological elements that permit performance comparisons of system types and configurations for one or more locations. A TMY is not necessarily a good indicator of conditions over the next year, or even the next 5 years. Rather, it represents conditions judged to be typical over a long period of time, such as 30 years. Because they represent typical rather than extreme conditions, they are not suited for designing systems and their components to meet the worst-case conditions occurring at a location.


Agricultural Progress in Cameroon, Mali and Ghana: Why it Happened and How  

Open Energy Info (EERE)

Agricultural Progress in Cameroon, Mali and Ghana: Why it Happened and How Agricultural Progress in Cameroon, Mali and Ghana: Why it Happened and How to Sustain It Jump to: navigation, search Tool Summary Name: Agricultural Progress in Cameroon, Mali and Ghana: Why is Happened and How to Sustain It Agency/Company /Organization: Organisation for Economic Co-Operation and Development Sector: Land Focus Area: Agriculture Topics: Background analysis Resource Type: Guide/manual, Lessons learned/best practices Website: www.oecd.org/dataoecd/38/58/41041414.pdf Country: Cameroon, Mali, Ghana UN Region: "Sub-Saharan Africa" is not in the list of possible values (Eastern Africa, Middle Africa, Northern Africa, Southern Africa, Western Africa, Caribbean, Central America, South America, Northern America, Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand, Melanesia, Micronesia, Polynesia, Latin America and the Caribbean) for this property.


Ghana-Paving the Way for Low Carbon Development Strategies | Open Energy  

Open Energy Info (EERE)

Ghana-Paving the Way for Low Carbon Development Strategies Ghana-Paving the Way for Low Carbon Development Strategies Jump to: navigation, search Name Ghana-Paving the Way for Low Carbon Development Strategies Agency/Company /Organization Energy Research Centre of the Netherlands Sector Energy Topics Background analysis, Low emission development planning Website http://www.ecn.nl/en/ Program Start 2009 Program End 2010 Country Ghana Western Africa References ECN Policy Studies[1] Paving the Way for Low Carbon Development Strategies[2] Overview The projects has three main goals: to provide input for a general methodology for developing Low Carbon Development Strategies to contribute to knowledge, mutual understanding and experience on the concept of Low Carbon Development Strategies with the aim to inform the international climate negotiations


Pilot study of horizontal roughing filtration in northern Ghana as pretreatment for highly turbid dugout water  

E-Print Network (OSTI)

In Northern Region Ghana (NRG), highly turbid rainwater runoff and intermittent streams are collected in earthen dams called dugouts. These dams serve as many communities' main source of drinking and domestic water despite ...

Losleben, Tamar



Water quality and business aspects of sachet-vended water in Tamale, Ghana  

E-Print Network (OSTI)

Microbial water quality analyses were conducted on 15 samples of factory-produced sachet water and 15 samples of hand-tied sachet water, sold in Tamale, Ghana. The tests included the membrane filtration (MF) test using ...

Okioga, Teshamulwa (Teshamulwa Irene)



Design of fuel efficient brick kiln for ceramic water filter firing in Ghana  

E-Print Network (OSTI)

Ceramic water filters are currently produced in Ghana in order to provide a household solution to contaminated water. These filters, locally branded with the name Kosim filter by originating from Potters for Peace-Nicaragua, ...

Adjorlolo, Eric (Eric James Kofi)



Water quality and business aspects of sachet-vended water in Tamale, Ghana.  

E-Print Network (OSTI)

??Microbial water quality analyses were conducted on 15 samples of factory-produced sachet water and 15 samples of hand-tied sachet water, sold in Tamale, Ghana. The (more)

Okioga, Teshamulwa (Teshamulwa Irene)


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cross-sectional epidemiological study on water and sanitation practices in the northern region of Ghana  

E-Print Network (OSTI)

A cross-sectional epidemiological study was conducted to obtain baseline data on drinking water and sanitation practices in the Northern Region of Ghana. This study was performed in conjunction with Pure Home Water (PHW) ...

Peletz, Rachel Louise



Historical and Future Land-Cover Change in a Municipality of Ghana  

Science Conference Proceedings (OSTI)

Urban land-cover change is increasing dramatically in most developing nations. In Africa and in the New Juaben municipality of Ghana in particular, political stability and active socioeconomic progress has pushed the urban frontier into the ...

Emmanuel M. Attua; Joshua B. Fisher



The Energy Sector in Ghana - The Potential of Standards and Labeling...  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Sector in Ghana - The Potential of Standards and Labeling Programs as a Tool for Saving Energy Speaker(s): A. B. Boadi-Mensah Date: August 30, 2001 - 12:00pm Location:...


Modification of a biosand filter in the northern region of Ghana  

E-Print Network (OSTI)

Four local plastic design (LPD) BSFs were constructed in Northern Region, Ghana, to test and evaluate an experimental modification of the LPD BSF for treatment of highly turbid water. Modifications of the LPD BSFs were ...

Kikkawa, Izumi



Household water treatment and safe storage options for Northern Region Ghana : consumer preference and relative cost  

E-Print Network (OSTI)

A range of household water treatment and safe storage (HWTS) products are available in Northern Region Ghana which have the potential to significantly improve local drinking water quality. However, to date, the region has ...

Green, Vanessa (Vanessa Layton)



Ghana-Enhancing Low-carbon Development by Greening the Economy: Policy  

Open Energy Info (EERE)

Ghana-Enhancing Low-carbon Development by Greening the Economy: Policy Ghana-Enhancing Low-carbon Development by Greening the Economy: Policy Dialogue, Advisory Services, Benchmarking Jump to: navigation, search Name Ghana-Enhancing Low-carbon Development by Greening the Economy: Policy Dialogue, Advisory Services, Benchmarking Agency/Company /Organization Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Sector Climate Focus Area Renewable Energy Topics Low emission development planning, -LEDS, -NAMA, -Roadmap, Market analysis, Pathways analysis Program Start 2011 Program End 2014 Country Ghana Western Africa References Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ)[1] Program Overview The project will promote Green Economy in developing countries and emerging economies as a realistic approach towards low-carbon development. It will


Technical Report - Ghana Wind Energy Resource Assessment | OpenEI  

Open Energy Info (EERE)

Ghana Wind Energy Resource Assessment Ghana Wind Energy Resource Assessment Dataset Summary Description (Abstract): This document describes the development of detailed high-resolution (1 km2) wind energy resource maps for Ghana. (Purpose): To provide information on the wind resource potential within Ghana. Source NREL Date Released August 21st, 2006 (8 years ago) Date Updated August 21st, 2006 (8 years ago) Keywords documentation GEF Ghana GIS NREL SWERA UNEP wind Data application/pdf icon Download Report (pdf, 54.3 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2006 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Restrictions to use (Use Constraints): This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Midwest Research Institute for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.


Microsoft Word - Ghana_10km_solar_country_report.doc  

Open Energy Info (EERE)

Assessment (SWERA) Assessment (SWERA) High Resolution Solar Radiation Assessment for Ghana Final country report prepared by Christoph Schillings 1 Richard Meyer 2 Franz Trieb 1 1 Deutsches Zentrum für Luft- und Raumfahrt, DLR-Stuttgart, Institut für Technische Thermodynamik, Pfaffenwaldring 38-40, D-70569 Stuttgart, Germany 2 Deutsches Zentrum für Luft- und Raumfahrt, DLR-Oberpfaffenhofen, Institut für Physik der Atmosphäre, D-82234 Weßling, Germany submitted to UNEP / GEF October 2004 Content 1. Method description (satellite data, GHI-method, DNI-method) 2. Model output (GHI, DNI) 3. Comparison with ground measurements (if available) 4. References Notice This report was prepared as an account of work within the SWERA project funded by GEF / UNEP.


Microsoft Word - ghana-document_de-dh.doc  

Open Energy Info (EERE)

Wind Energy Resource Mapping Activity Wind Energy Resource Mapping Activity Introduction This document describes the development of detailed high-resolution (1 km 2 ) wind energy resource maps for the country of Ghana. These maps were created at the United States Department of Energy's National Renewable Energy Laboratory (NREL) as part of the Solar and Wind Energy Resource Assessment (SWERA) project for the United Nations Environment Programme. The wind mapping activity covered approximately 110,000 km 2 of land area and, including offshore areas, more than 150,000 km 2 . The maps can be found in a separate part of the SWERA archive. NREL's Wind Resource Assessment and Mapping System (WRAMS) is a combination of analytical, numerical, and empirical methods using Geographic Information System (GIS) mapping tools and data


Refrigerator Efficiency in Ghana: Tailoring an appliance markettransformation program design for Africa  

SciTech Connect

A simple replication of developed country applianceefficiency labels and standards is unlikely to be feasible in Ghana andmany other countries in Africa. Yet by creatively modifying the developedcountry appliance efficiency market transformation model, it should bepossible to achieve dramatic energy use reductions. As was true indeveloped countries in the previous two decades, refrigeration efficiencyimprovements provide the greatest energy savings potential in theresidential electricity sector in Ghana. Although Ghana, like manyAfrican countries may impose standards on imports since Ghana does nothave manufacturing facilities for appliances in country. This approachmay hurt some consumers who patronize a very diverse market of usedappliances imported from Europe. We discuss how meeting the challenges ofthe Ghanaian market will require modification of the usual energyefficiency labeling and standards paradigm. But once a refrigeratormarket transformation is accomplished in Ghana, we estimate an averageenergy savings potential of 550 kWh/refrigerator/year, and a monetarysavings of more than $35/refrigerator/year. We discuss how this modifiedrefrigerator efficiency market transformation may occur in the Ghanaiancontext. If successful, this market transformation is likely to be anexample for many other African countries.

Ben Hagan, Essel; Van Buskirk, Robert; Ofosu-Ahenkorah, Alfred; McNeil, Michael A.



Ghana Goes for Green Growth: National Engagement on Climate Change | Open  

Open Energy Info (EERE)

Ghana Goes for Green Growth: National Engagement on Climate Change Ghana Goes for Green Growth: National Engagement on Climate Change Jump to: navigation, search Tool Summary Name: Ghana Goes for Green Growth: National Engagement on Climate Change Agency/Company /Organization: Government of Ghana Sector: Energy, Land Topics: Background analysis Resource Type: Publications Website: www.ecn.nl/nl/home/ Country: Ghana UN Region: Western Africa Coordinates: 7.946527°, -1.023194° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":7.946527,"lon":-1.023194,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ghana-Assessing Policy Options for Increasing the Use of Renewable Energy  

Open Energy Info (EERE)

Options for Increasing the Use of Renewable Energy Options for Increasing the Use of Renewable Energy for Sustainable Development Jump to: navigation, search Name Assessing Policy Options for Increasing the Use of Renewable Energy for Sustainable Development: Modelling Energy Scenarios for Ghana Agency/Company /Organization United Nations Industrial Development Organization, Food and Agriculture Organization of the United Nations, United Nations Environment Programme, United Nations International Atomic Energy Agency Sector Energy Focus Area Energy Efficiency, Renewable Energy Topics Policies/deployment programs, Background analysis Resource Type Software/modeling tools, Publications, Lessons learned/best practices Website http://esa.un.org/un-energy/pd Country Ghana UN Region Western Africa References Ghana-Assessing Policy Options for Increasing the Use of Renewable Energy for Sustainable Development[1]


Science Journalism in Ghana: A Study of Journalists Who Cover Science  

E-Print Network (OSTI)

Science journalism has been studied from the perspectives of science journalists in the West. However, studies of science journalism from the perspectives of general reporters in developing or developed countries are scarce. This study was a survey of general reporters in Ghana belonging to the Ghana Journalists Association. In all, 151 members responded to a self-administered questionnaire that the researcher delivered to their worksites and a central location. Respondents were asked mainly about their demographic and professional characteristics, sources used for reporting science, number of science stories reported in the past 12 months, topics of science reporting interest, factors motivating or serving as barriers to science reporting, and the future of science journalism in Ghana. Data were analyzed using statistical tools and content analysis. The demographic and professional characteristics resembled those found previously in Ghana and elsewhere. The most commonly cited format of science journalism training was workshops or seminars after graduation. Health professionals and scientists were perceived as very important sources for science stories, and the respondents recalled interviewing them more frequently than others. Generally, respondents reported writing more science news stories than science features. There was an inverse correlation between the number of years spent in journalism and the number of science features reported (p = 0.017). Health science was the most commonly cited topic of reporting interest. Most respondents indicated that training in science journalism or access to scientific research findings would motivate them to report science more. Many cited lack of training in science reporting or lack of contact information for scientific researchers as barriers to science reporting. Many respondents said the current status of science journalism in Ghana is low, and most favored increasing the amount of science journalism, in part to promote public literacy in science. The findings indicate that Ghana should consider offering more science journalism training, particularly in journalism schools, and should promote ready access of journalists to research findings and to contact information of scientific researchers.

Appiah, Bernard



Land-Cover Change Analyses in the Volta Basin of Ghana  

Science Conference Proceedings (OSTI)

Multitemporal Landsat Thematic Mapper (TM) images for 1984, 1992, and 1999 were used to map and detect land-cover changes in a 5400-km2 area within the Volta Lake basin of Ghana. The most dominant land-cover change was the conversion of natural ...

Ademola K. Braimoh; Paul L. G. Vlek



Mobile governance for development: strategies for migrant head porters in Ghana  

Science Conference Proceedings (OSTI)

A promising strategy to promote good governance is harnessing the opportunities provided by the use of mobile phones, widely accessible to most segments of the society, for delivering public information and services and for decision-making by government. ... Keywords: Ghana, ICT4D, development, e-governance, mobile phones, public policy

Johanna Awotwi; Adegboyega Ojo; Tomasz Janowski



Health and water quality monitoring of Pure Home Water's ceramic filter dissemination in the northern region of Ghana  

E-Print Network (OSTI)

Pure Home Water (PHW) is a social enterprise that promotes and disseminates household drinking water technologies in the Northern Region of Ghana. Currently their main product is a pot-shaped Potters for Peace-type ceramic ...

Johnson, Sophie M. (Sophie Marie)



Optimizing performance of ceramic pot filters in Northern Ghana and modeling flow through paraboloid-shaped filters/  

E-Print Network (OSTI)

This work aimed to inform the design of ceramic pot filters to be manufactured by the organization Pure Home Water (PHW) in Northern Ghana, and to model the flow through an innovative paraboloid-shaped ceramic pot filter. ...

Miller, Travis Reed



Investigation of I-WASH's community-led total sanitation and alternative decentralized sanitation models in rural Ghana  

E-Print Network (OSTI)

2.5 billion people worldwide do not have access to improved sanitation and Sub-Saharan Africa is not on track to meet the MDG sanitation target. As of 2010, Ghana has achieved 14% national improved sanitation coverage and ...

Questad, Adam (Adam David)



Seeded quantum FEL at 478 keV  

Science Conference Proceedings (OSTI)

We present for the first time the concept of a seeded {gamma} quantum Free-Electron-Laser (QFEL) at 478 keV, which has very different properties compared to a classical. The basic concept is to produce a highly brilliant {gamma} beam via SASE. To produce highly intense and coherent {gamma} beam, we intend to use a seeded FEL scheme. Important for the production of such a {gamma} beam are novel refractive {gamma}-lenses for focusing and an efficient monochromator, allowing to generate a very intense and coherent seed beam. The energy of the {gamma} beam is 478 keV, corresponding to a wavelength in the sub-Angstrom regime (1/38 A). To realize a coherent {gamma} beam at 478 keV, it is necessary to use a quantum FEL design. At such high radiation energies a classical description of the {gamma}-FEL becomes wrong.

Guenther, M. M.; Jentschel, M.; Thirolf, P. G.; Seggebrock, T.; Habs, D. [Max-Planck-Institut fuer Quantenoptik, D-85748 Garching (Germany); Institut Laue-Langevin, F-38042 Grenoble (Germany); Ludwig-Maximilians-Universitaet Muenchen, D-85748 Garching (Germany); Ludwig-Maximilians-Universitaet Muenchen, D-85748 Garching, Germany and Max-Planck-Institut fuer Quantenoptik, D-85748 Garching (Germany)



Compact, maintainable 80-KeV neutral beam module  

DOE Patents (OSTI)

A compact, maintainable 80-keV arc chamber, extractor module for a neutral beam system immersed in a vacuum of <10.sup.-2 Torr, incorporating a nested 60-keV gradient shield located midway between the high voltage ion source and surrounding grounded frame. The shield reduces breakdown or arcing path length without increasing the voltage gradient, tends to keep electric fields normal to conducting surfaces rather than skewed and reduces the peak electric field around irregularities on the 80-keV electrodes. The arc chamber or ion source is mounted separately from the extractor or ion accelerator to reduce misalignment of the accelerator and to permit separate maintenance to be performed on these systems. The separate mounting of the ion source provides for maintaining same without removing the ion accelerator.

Fink, Joel H. (Livermore, CA); Molvik, Arthur W. (Livermore, CA)


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


4-Hydroxy-PCB106 acts as a direct thyroid hormone receptor agonist in rat GH3 cells  

E-Print Network (OSTI)

Polychlorinated biphenyls (PCBs) may interfere with thyroid hormone (TH) action by interacting directly with the TH receptor (TR). We found that the hydroxylated PCB metabolite, 4-OH-CB106, bound to the human TR?1 and significantly elevated endogenous growth hormone (GH) expression in GH3 cells in a manner similar to that of T3 itself. This effect was also observed using a consensus TH response element (TRE) in a luciferase expression system, and was blocked by a single base-pair substitution in this TRE. In addition, we found that 4-OH-CB106 did not alter the ability of TR?1 to physically interact with the TRE in the GH promoter, or with SRC1 or NCoR. These effects were directly parallel to effects of T3, indicating that 4-OH-CB106 exerts a direct agonistic effect on the TR?1.

Seo-hee You A; Kelly J. Gauger A; Ruby Bansal B; R. Thomas Zoeller A



Integrated: Geospatial Toolkit GIS data for Ghana from NREL | OpenEI  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Geographic Information Systems (GIS) data intended for use in the Geospatial toolkit or with any GIS software. (Purpose): The Solar and Wind Energy Resource Assessment (SWERA) Geospatial Toolkit (GsT) is a map-based software application that can be used for decision making and policy analysis in addition to planning for future energy projects. The SWERA application utilizes Geographical Information Systems (GIS) to develop common scenarios to evaluate potential locations for solar or wind energy plants. (Supplemental Information): The zip file contains the available geospatial toolkit data and metadata. Each country's data package depends on the data provided by the SWERA partners. ---------------------------------------------------------


Ghana's regional development in economics, education and natural resources, with a case study on customers' preferences for household water treatment & safe storage products  

E-Print Network (OSTI)

Ghana is one of the few countries that was re-classified from low-income country to low-middle income country in 2011 by the World Bank (World Bank, 2011a). At the same time, Ghana is still in the process of achieving the ...

Qiu, Weini



Ultrafast 25 keV backlighting for experiments on Z.  

Science Conference Proceedings (OSTI)

To extend the backlighting capabilities for Sandia's Z-Accelerator, Z-Petawatt, a laser which can provide laser pulses of 500 fs length and up to 120 J (100TW target area) or up to 450 J (Z/Petawatt target area) has been built over the last years. The main mission of this facility focuses on the generation of high energy X-rays, such as tin K{alpha} at 25 keV in ultra-short bursts. Achieving 25 keV radiographs with decent resolution and contrast required addressing multiple problems such as blocking of hot electrons, minimization of the source, development of suitable filters, and optimization of laser intensity. Due to the violent environment inside of Z, an additional very challenging task is finding massive debris and radiation protection measures without losing the functionality of the backlighting system. We will present the first experiments on 25 keV backlighting including an analysis of image quality and X-ray efficiency.

Headley, Daniel Ignacio; Rambo, Patrick K.; Geissel, Matthias; Schwarz, Jens; Sefkow, Adam B.; Atherton, Briggs W.; Kimmel, Mark W.; Pitts, Todd Alan; Robertson, Grafton Kincannon; Schollmeier, Marius; Speas, Christopher Shane



Ultrafast 25 keV backlighting for experiments on Z.  

Science Conference Proceedings (OSTI)

To extend the backlighting capabilities for Sandia's Z-Accelerator, Z-Petawatt, a laser which can provide laser pulses of 500 fs length and up to 120 J (100TW target area) or up to 450 J (Z / Petawatt target area) has been built over the last years. The main mission of this facility focuses on the generation of high energy X-rays, such as tin Ka at 25 keV in ultra-short bursts. Achieving 25 keV radiographs with decent resolution and contrast required addressing multiple problems such as blocking of hot electrons, minimization of the source, development of suitable filters, and optimization of laser intensity. Due to the violent environment inside of Z, an additional very challenging task is finding massive debris and radiation protection measures without losing the functionality of the backlighting system. We will present the first experiments on 25 keV backlighting including an analysis of image quality and X-ray efficiency.

Sefkow, Adam B.; Atherton, Briggs W.; Geissel, Matthias; Schollmeier, Marius; Pitts, Todd Alan; Rambo, Patrick K.; Schwarz, Jens; Kimmel, Mark W.



Significance of operating experience with poison splines at KE Reactor  

SciTech Connect

The demonstrated operating efficiency performance which has resulted from poison spline usage forces an economic decision concerning the self-supported and bumper fuel element programs. As originally conceived the projection fuel elements would preclude the insertion of a spline under the fuel charge; thus it is very important that means be devised either to make poison spline usage compatible with future pile loadings or to demonstrate that some other supplementary control system, which is compatible with future pile loadings, can approximate the effect the splines have an operating efficiency. This report shows the appreciable performance improvement which has been achieved at KE Reactor through the application of the poison spline system.

Franklin, F.C.



The value chain and e-business in exporting: Case studies from Ghana's non-traditional export (NTE) sector  

Science Conference Proceedings (OSTI)

Purpose: The purpose of this paper is to develop an understanding of the possibilities and challenges facing the application of e-business in the Ghanaian exporting sector. The paper also ascertains, from a value chain perspective, the extent of e-business ... Keywords: E-business, Exports, Ghana, Internet, Value chain

Robert Hinson



Collection and representation of GIS data to aid household water treatment and safe storage technology implementation in the northern region of Ghana  

E-Print Network (OSTI)

In 2005, a start-up social business called Pure Home Water (PHW) was begun in Ghana to promote and sell household water treatment and safe storage (HWTS) technologies. The original aim of the company was to offer a variety ...

VanCalcar, Jenny E. (Jenny Elizabeth)



Evidence of Coverage 3.2-1KE FS 624 HDBK  

E-Print Network (OSTI)

#12;#12;#12;#12;#12;Evidence of Coverage 3.2-1KE FS 624 HDBK TOC Table of Contents Required the Notice for detailed information regarding their privacy rights. KE FS 624 HDBK DIS #12;3.2-3 Welcome by Hospitals if they have questions about your coverage. KE FS 624 HDBK WEL #12;3.2-4 Using The HMO System

Boufadel, Michel


TUDE EN COINCIDENCE DE LA DSINTGRATION 177W 3 17TTa .. corrlation/3 384 keV-;r 113 keV de 177Lu.  

E-Print Network (OSTI)

'électrons en coïncidences avec la raie y de 417 keV. I 1 25 l L a X 10 50 'Oo Canol FIG.2. -CoïncidencesX x Y

Paris-Sud XI, Université de



Science Conference Proceedings (OSTI)

On December 15-16, 2009, a 100-KE Reactor Core Removal Project Alternative Analysis Workshop was conducted at the Washington State University Consolidated Information Center, Room 214. Colburn Kennedy, Project Director, CH2M HILL Plateau Remediation Company (CHPRC) requested the workshop and Richard Harrington provided facilitation. The purpose of the session was to select the preferred Bio Shield Alternative, for integration with the Thermal Shield and Core Removal and develop the path forward to proceed with project delivery. Prior to this workshop, the S.A. Robotics (SAR) Obstruction Removal Alternatives Analysis (565-DLV-062) report was issued, for use prior to and throughout the session, to all the team members. The multidisciplinary team consisted ofrepresentatives from 100-KE Project Management, Engineering, Radcon, Nuclear Safety, Fire Protection, Crane/Rigging, SAR Project Engineering, the Department of Energy Richland Field Office, Environmental Protection Agency, Washington State Department of Ecology, Defense Nuclear Facility Safety Board, and Deactivation and Decommission subject matter experts from corporate CH2M HILL and Lucas. Appendix D contains the workshop agenda, guidelines and expectations, opening remarks, and attendance roster going into followed throughout the workshop. The team was successful in selecting the preferred alternative and developing an eight-point path forward action plan to proceed with conceptual design. Conventional Demolition was selected as the preferred alternative over two other alternatives: Diamond Wire with Options, and Harmonic Delamination with Conventional Demolition. The teams preferred alternative aligned with the SAR Obstruction Removal Alternative Analysis report conclusion. However, the team identified several Path Forward actions, in Appendix A, which upon completion will solidify and potentially enhance the Conventional Demolition alternative with multiple options and approaches to achieve project delivery. In brief, the Path Forward was developed to reconsider potential open air demolition areas; characterize to determine if any zircaloy exists, evaluate existing concrete data to determine additional characterization needs, size the new building to accommodate human machine interface and tooling, consider bucket thumb and use ofshape-charges in design, and finally to utilize complex-wide and industry explosive demolition lessons learned in the design approach. Appendix B documents these results from the team's use ofValue Engineering process tools entitled Weighted Analysis Alternative Matrix, Matrix Conclusions, Evaluation Criteria, and Alternative Advantages and Disadvantages. These results were further supported with the team's validation of parking-lot information sheets: memories (potential ideas to consider), issues/concerns, and assumptions, contained in Appendix C. Appendix C also includes the recorded workshop flipchart notes taken from the SAR Alternatives and Project Overview presentations. The SAR workshop presentations, including a 3-D graphic illustration demonstration video have been retained in the CHPRC project file, and were not included in this report due to size limitations. The workshop concluded with a round robin close-out where each member was engaged for any last minute items and meeting utility. In summary, the team felt the session was value added and looked forward to proceeding with the recommended actions and conceptual design.




Comparison of municipal solid waste management systems in Canada and Ghana: A case study of the cities of London, Ontario, and Kumasi, Ghana  

SciTech Connect

Integrated waste management has been accepted as a sustainable approach to solid waste management in any region. It can be applied in both developed and developing countries. The difference is the approach taken to develop the integrated waste management system. This review looks at the integrated waste management system operating in the city of London, Ontario-Canada and how lessons can be drawn from the system's development and operation that will help implement a sustainable waste management system in the city of Kumasi, Ghana. The waste management system in London is designed such that all waste generated in the city is handled and disposed of appropriately. The responsibility of each sector handling waste is clearly defined and monitored. All major services are provided and delivered by a combination of public and private sector forces. The sustainability of the waste management in the city of London is attributed to the continuous improvement strategy framework adopted by the city based on the principles of integrated waste management. It is perceived that adopting a strategic framework based on the principles of integrated waste management with a strong political and social will, can transform the current waste management in Kumasi and other cities in developing countries in the bid for finding lasting solutions to the problems that have plagued the waste management system in these cities.

Asase, Mizpah [Department of Chemical Engineering, Kwame Nkrumah University of Science and Technology, Kumasi (Ghana); Yanful, Ernest K. [Department of Civil and Environmental Engineering, The University of Western Ontario London, Ontario, N6A 5B9 (Canada)], E-mail: eyanful@eng.uwo.ca; Mensah, Moses [Department of Chemical Engineering, Kwame Nkrumah University of Science and Technology, Kumasi (Ghana); Stanford, Jay [City of London, 300 Dufferin Ave. P.O. Box 5035, Ontario, N6A 4L9 (Canada); Amponsah, Samuel [Mathematics Department, Kwame Nkrumah University of Science and Technology, Kumasi (Ghana)



Radiation blistering of Nb implanted sequentially with helium ions of different energies (3-500 keV)  

SciTech Connect

Cold rolled, polycrystalline niobium samples were irradiated at room temperature with $sup 4$He$sup +$ ions sequentially at 14 different energies over an energy range from 3 keV--500 keV in steps of 50 keV. The dose for each energy was chosen to give an approximately uniform concentration of helium between the implant depths corresponding to 3 keV and 500 keV. In one set of experiments the irradiations were started at the Kurchatov Institute with 3 keV $sup 4$He$sup +$ ions and extended up to 80 keV in several steps. Subsequently, the same target area was irradiated with $sup 4$He$sup +$ ions at Argonne National Laboratory (ANL) starting at 100 keV and increased to 500 keV in steps of 50 keV. Another set of irradiations were started at ANL with 500 keV $sup 4$He$sup +$ ions and continued with decreasing ion energies to 100 keV. Subsequently, the same area was irradiated at the Kurchatov Institute starting at 80 keV and continued with decreasing ion energies to 3 keV. Both sets of irradiations were completed for two different total doses, 0.5 C cm$sup -2$ and 1.0 C cm$sup -2$.

Guseva, M.I.; Gusev, V.; Krasulin, U.L.; Martinenko, U.V.; Das, S.K.; Kaminsky, M.S.



Efficient multi?keV x?ray sources from Ti?doped aerogel targets  

Science Conference Proceedings (OSTI)

We have measured the production of hv ? 4.7 keV x?rays from low?density Ti?doped aerogel (? ? 3 mg/cc) targets at the OMEGA laser facility (University of Rochester)

K. B. Fournier; C. Constantin; G. Gregori; M. C. Miller; C. A. Back; L. J. Suter; J. Davis; J. Grun



Jing Ke  

NLE Websites -- All DOE Office Websites (Extended Search)

Berkeley National Laboratory. His research interests include energy analysis and industry energy efficiency, process modeling and optimization, signal analysis and processing. Dr....


Electron beam lithography at 10keV using an epoxy based high resolution negative resist  

Science Conference Proceedings (OSTI)

The behaviour of a new epoxy based resist (mr-EBL 6000.1 XP) as a negative resist for e-beam lithography is presented. We demonstrate that it is possible to define sub-100nm patterns when irradiating thin (120nm) layers of resist with a 10keV electron ... Keywords: EBL, Nanopatterning, Negative resist, Polymer technology

C. Martin; G. Rius; A. Llobera; A. Voigt; G. Gruetzner; F. Prez-Murano



Multi-keV x-ray sources from metal-lined cylindrical hohlraums  

SciTech Connect

As multi-keV x-ray sources, plastic hohlraums with inner walls coated with titanium, copper, and germanium have been fired on Omega in September 2009. For all the targets, the measured and calculated multi-keV x-ray power time histories are in a good qualitative agreement. In the same irradiation conditions, measured multi-keV x-ray conversion rates are {approx}6%-8% for titanium, {approx}2% for copper, and {approx}0.5% for germanium. For titanium and copper hohlraums, the measured conversion rates are about two times higher than those given by hydroradiative computations. Conversely, for the germanium hohlraum, a rather good agreement is found between measured and computed conversion rates. To explain these findings, multi-keV integrated emissivities calculated with RADIOM [M. Busquet, Phys. Fluids 85, 4191 (1993)], the nonlocal-thermal-equilibrium atomic physics model used in our computations, have been compared to emissivities obtained from different other models. These comparisons provide an attractive way to explain the discrepancies between experimental and calculated quantitative results.

Jacquet, L.; Girard, F.; Primout, M.; Villette, B.; Stemmler, Ph. [CEA, DAM, DIF, F-91297 Arpajon (France)



Verifying object-oriented programs with KeY: a tutorial  

Science Conference Proceedings (OSTI)

This paper is a tutorial on performing formal specification and semi-automatic verification of Java programs with the formal software development tool KeY. This tutorial aims to fill the gap between elementary introductions using toy examples and state-of-art ...

Wolfgang Ahrendt; Bernhard Beckert; Reiner Hhnle; Philipp Rmmer; Peter H. Schmitt



1 Gamma-Ray Burst Spectra and Time Histories From 2 to 400 keV  

E-Print Network (OSTI)

The Gamma-Ray burst detector on Ginga consisted of a proportional counter to observe the x-rays and a scintillation counter to observe the gamma-rays. It was ideally suited to study the x-rays associated with gammaray bursts (GRBs). Ginga detected ? 120 GRBs and 22 of them had sufficient statistics to determine spectra from 2 to 400 keV. Although the Ginga and BATSE trigger criteria were very similar, the distribution of spectral parameters was different. Ginga observed bend energies in the spectra down to 2 keV and had a larger fraction of bursts with low energy power law indexes greater than zero. The average ratio of energy in the x-ray band (2 to 10 keV) compared to the gamma-ray band (50 to 300 keV) was 24%. Some events had more energy in the x-ray band than in the gamma-ray band. One Ginga event had a period of time preceding the gamma rays that was effectively pure x-ray emission. This x-ray preactivity might be due to the penchant for the GRB time structure to be broader at lower energy rather than a different physical process. The x-rays tend to rise and fall slower than the gamma rays but they both tend to peak at about the same time. This argues against models involving the injection of relativistic electrons that cool by synchrotron radiation. 1.

E. E. Fenimore



Radioactive air emissions notice of construction fuel removal for 105-KE basin  

SciTech Connect

This document serves as a notice of construction (NOC), pursuant to the requirements of Washington Administrative Code (WAC) 246-247-060, and as a request for approval to construct pursuant to 40 Code of Federal Regulations (CFR) 61.96 for the modifications, installation of new equipment, and fuel removal and sludge relocation activities at 105-KE Basin. The 105-K east reactor and its associated spent nuclear fuel (SNF) storage basin (105-KE Basin) were constructed in the early 1950s and are located in the 100-K Area about 1,400 feet from the Columbia River. The 105-KE Basin contains 1,152 metric tons of SNF stored underwater in 3,673 open canisters. This SNF has been stored for varying periods of time ranging from 8 to 24 years. The 105-KE Basin is constructed of unlined concrete and contains approximately 1.3 million gallons of water with an asphaltic membrane beneath the pool. The fuel is corroding and an estimated 1,700 cubic feet of sludge, containing radionuclides and miscellaneous materials, have accumulated in the basin. The 105-KE Basin has leaked radiologically contaminated water to the soil beneath the basin in the past most likely at the construction joint between the foundation of the basin and the foundation of the reactor. The purpose of the activities described in this Notice of Construction (NOC) is to enable the retrieval and transport of the fuel to the Cold Vacuum Drying Facility (CVDF). This NOC describes modifications, the installation of new equipment, and fuel removal and sludge relocation activities expected to be routine in the future. Debris removal activities described in this NOC will supersede the previously approved NOC (DOE/RL-95-65). The proposed modifications described are scheduled to begin in calendar year 1997.

Kamberg, L.D., Fluor Daniel Hanford


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


183W Resonance Parameter Evaluation in the Neutron Energy Range Up to 5 keV  

SciTech Connect

We generated a preliminary set of resonance parameters for {sup 183}W in the neutron energy range of thermal up to 5 keV. In the analyzed energy range, this work represents a significant improvement over the current resonance evaluation in the ENDF/B-VII.1 library limited up to 2.2 keV. The evaluation methodology uses the Reich-Moore approximation to fit, with the R-matrix code SAMMY, the high-resolution measurements performed in 2007 at the GEel LINear Accelerator (GELINA) facility. The transmission data and the capture cross sections calculated with the set of resonance parameters are compared with the experimental values, and the average properties of the resonance parameters are discussed.

Pigni, Marco T [ORNL; Dunn, Michael E [ORNL; Guber, Klaus H [ORNL



Sub-5keV electron-beam lithography in hydrogen silsesquioxane resist  

Science Conference Proceedings (OSTI)

We fabricated 9-30nm half-pitch nested Ls and 13-15nm half-pitch dot arrays, using 2keV electron-beam lithography with hydrogen silsesquioxane (HSQ) as the resist. All structures with 15nm half-pitch and above were fully resolved. We observed that the ... Keywords: High resolution, Hydrogen silsesquioxane, Low-energy electron-beam lithography, Low-voltage electron-beam lithography, Proximity effect

Vitor R. Manfrinato; Lin Lee Cheong; Huigao Duan; Donald Winston; Henry I. Smith; Karl K. Berggren



Low Dose Radiation Research Program: 12.5 keV Xray Microbeam Bystander  

NLE Websites -- All DOE Office Websites (Extended Search)

12.5 keV Xray Microbeam Bystander Studies With Human Mammary 12.5 keV Xray Microbeam Bystander Studies With Human Mammary Epithelial Cells and Fibroblasts Authors: E. A. Blakely1, R. I. Schwarz1, A. C. Thompson2, K. A. Bjornstad1, P. Y. Chang1,3 C.J. Rosen1, and D. Sudar1 Institutions: Divisions of 1Life Sciences and 2Advanced Light Source, Lawrence Berkeley National Laboratory, Berkeley, CA. and 3SRI International, Menlo Park, CA. We are using a novel x-ray Microprobe Beamline at the Advanced Light Source (ALS) at LBNL to investigate bystander effects of low doses in well characterized human mammary epithelial cells (HMEC) and human skin fibroblasts (HSF). The ALS facility is capable of producing a beam of 12.5 keV x-rays with a focussed spot size of __m_ and a wide range of doses and dose-rates. Unlike normal x-ray sources, this beam has a very small background of either low-


Radioactive air emissions notice of construction debris removal 105-KE basin  

SciTech Connect

The 105-KE Basin contains 1,150 Metric Tonnes of Uranium (MTU) of N Reactor fuel, along with less than half a MTU of single pass reactor (SPR) fuel. In addition to the spent nuclear fuel (SNF) in the 105-KE Basin, extensive quantities of debris and a substantial amount of sludge have accumulated in the basin. The 105-KE Basin fuel and sludge are not encapsulated and, as a result, corroding fuel has produced contamination products that are deposited on the basin walls, floor, and equipment. contamination products produce radiation dose exposures to the workers. To decrease worker exposures, this Notice of Construction (NOC) describes dose reduction modifications under consideration to mitigate worker radiation exposure from the basin walls and exposed piping. The major equipment egress paths from the basin (the dummy elevator pit and the south loadout pit) are blocked completely with debris and/or empty canisters. Therefore in addition to dose reduction, this NOC also describes debris removal activities and equipment. Recently, the primary water treatment system has been without mechanical filtration capabilities. This NOC describes planned modifications to the primary water treatment system to restore mechanical filtration by restarting the cartridge filters. The proposed modifications described in this NOC are expected to commence in the Fall of 1995. Finally, the NOC describes two other basin activities, fuel and sludge movement, that are expected to be routine in the future.




GuangZhou ZhongKe HengYuan Energy Tenchnology Co Ltd ZKenergy | Open Energy  

Open Energy Info (EERE)

GuangZhou ZhongKe HengYuan Energy Tenchnology Co Ltd ZKenergy GuangZhou ZhongKe HengYuan Energy Tenchnology Co Ltd ZKenergy Jump to: navigation, search Name GuangZhou ZhongKe HengYuan Energy Tenchnology Co Ltd (ZKenergy) Place Guangzhou, Guangdong Province, China Zip 510640 Sector Solar, Wind energy Product A high-tech industrialization enterprise dedicated to research, development, manufacture and marketing of full-permanent magnetic levitation (Maglev) wind turbines and wind-solar power mutual supplementary generator system. Coordinates 23.107389°, 113.267616° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":23.107389,"lon":113.267616,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Improving accuracy and reliability of 186-keV measurements for unattended enrichment monitoring  

SciTech Connect

Improving the quality of safeguards measurements at Gas Centrifuge Enrichment Plants (GCEPs), whilst reducing the inspection effort, is an important objective given the number of existing and new plants that need to be safeguarded. A useful tool in many safeguards approaches is the on-line monitoring of enrichment in process pipes. One aspect of this measurement is a simple, reliable and precise passive measurement of the 186-keV line from {sup 235}U. (The other information required is the amount of gas in the pipe. This can be obtained by transmission measurements or pressure measurements). In this paper we describe our research efforts towards such a passive measurement system. The system includes redundant measurements of the 186-keV line from the gas and separately from the wall deposits. The design also includes measures to reduce the effect of the potentially important background. Such an approach would practically eliminate false alarms and can maintain the operation of the system even with a hardware malfunction in one of the channels. The work involves Monte Carlo modeling and the construction of a proof-of-principle prototype. We will carry out experimental tests with UF{sub 6} gas in pipes with and without deposits in order to demonstrate the deposit correction.

Ianakiev, Kiril D [Los Alamos National Laboratory; Boyer, Brian D [Los Alamos National Laboratory; Swinhoe, Martyn T [Los Alamos National Laboratory; Moss, Cal E [Los Alamos National Laboratory; Goda, Joetta M [Los Alamos National Laboratory; Favalli, Andrea [Los Alamos National Laboratory; Lombardi, Marcie [Los Alamos National Laboratory; Paffet, Mark T [Los Alamos National Laboratory; Hill, Thomas R [Los Alamos National Laboratory; Mac Arthur, Duncan W [Los Alamos National Laboratory; Smith, Morag K [Los Alamos National Laboratory



Uranium Enrichment Measurements without Calibration Using Gamma Rays Above 100 keV  

DOE Green Energy (OSTI)

The verification of UF{sub 6} shipping cylinders is an important activity in routine safeguards inspections. Current measurement methods using either sodium-iodide or high-purity germanium detectors require calibrations that are not always appropriate for field measurements, because of changes in geometry or container wall thickness. The introduction of the MGAU code demonstrated the usefulness of intrinsically calibrated measurements for inspections. MGAU uses the 100-keV region of the uranium gamma-ray spectrum. The thick walls of UF{sub 6} shipping cylinders and the low-energy analysis preclude the routine use of MGAU for these measurements. We have developed a uranium enrichment measurement method for measurements using high-purity germanium detectors, which do not require calibration, and uranium gamma rays above 100 keV. The method uses seven gamma rays from {sup 235}U and {sup 238}U to determine their relative detection efficiency intrinsically and with an additional gamma ray from {sup 234}U, the relative abundance of these three uranium isotopes. The method uses a function that describes the basic physical processes that predominantly determine the relative detection efficiency curve. These are the detector efficiency, the absorption by the cylinder wall, and the self-absorption by the uranium contents. We will describe this model and initial testing on various uranium materials and detector types.

Ruhter, W D; Wang, T F; Hayden, C



Safety-Basis Thermal Analysis for KE Basin Sludge Transport and Storage  

DOE Green Energy (OSTI)

A series of safety-basis thermal and gas generation analyses were completed and independently reviewed to assess the thermal performance of a large diameter container (LDC) containing KE Basin sludge. The results demonstrate: (1) the sludge transport system (STS) containing a LDC can safely transport a KE basin sludge payload up to 2.0 m{sup 3} and, (2) large diameter containers with sludge payloads up to 2.0 m{sup 3} can be safely stored in a process cell at T Plant. The transport and storage analyses are based on a conservative set of assumptions, including limiting environmental conditions. Conclusions drawn from the transport and storage results were not impacted by changes in the radial gap between the cask and LDC, purge gas (i.e., either helium or nitrogen), sludge porosity, or thermal conductivity. The design of the transport cask and large diameter container can accommodate reasonable changes in these values. Both transport from KE Basin and long-term storage at T Plant are addressed for sludge payloads up to 2.0 m{sup 3}. Additional analyses determined the expected range of T Plant environmental temperatures, the hydrogen and oxygen generation rate due to the radiolysis of water, and the maximum hydrogen concentration within a process cell due to chemical reactions and the radiolysis of water. All sludge temperature and hydrogen concentration criteria for transport and storage are met. The analyses assumed a safety-basis sludge mixture defined as 60% by volume floor and 40% by volume canister sludge with 35% retained gas, and a conservative segregated (axial) distribution of metallic uranium (resulting from particulate settling) with associated safety-basis properties. The analyses recognized that the retrieval process would produce non-uniform sludge distributions. Four batch process loadings of 0.5m{sup 3} each are assumed. Each process batch loading will settle and segregate (separate) into two layers: an active layer containing all the metallic uranium which is chemically active, and a non-active layer containing uranium oxide, non-uranium material, and no metallic uranium. This is a conservative representation of operational controls designed to limit the metallic uranium concentration. The sludge layers are assumed to remain intact during transport and storage.




David Fridley, Nina Zheng, Nan Zhou, Jing Ke, Ali Hasanbeigi, Bill  

NLE Websites -- All DOE Office Websites (Extended Search)

China Energy and China Energy and Emissions Paths to 2030 David Fridley, Nina Zheng, Nan Zhou, Jing Ke, Ali Hasanbeigi, Bill Morrow, and Lynn Price China Energy Group, Energy Analysis Department Environmental Energy Technologies Division Lawrence Berkeley National Laboratory January 2011 This work was supported by the Research Institute of Innovative Technology for the Earth, Kyoto, Japan, through the U.S. Department of Energy under Contract No. DE- AC02-05CH11231. ERNEST ORLANDO LAWRENCE BERKELEY NATIONAL LABORATORY Disclaimer This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor The Regents of the


Preliminary resolved resonance region evaluation of copper-63 from 0 to 300 keV  

SciTech Connect

A new preliminary evaluation of Cu-63 was done in the energy region from 0 to 300 keV extending the resolved resonance region of the previous, ENDF/B-VII.0, evaluation three-fold. The new evaluation was based on three experimental transmission data sets; two measured at the Oak Ridge Electron Linear Accelerator (ORELA) and one from the Massachusetts Inst. of Technology Nuclear Reactor (MITR). A total of 275 new resonances were identified and a corresponding set of external resonances was approximated to mock up the external levels. The negative external levels (bound level) were modified to match the thermal cross section values. A preliminary benchmarking calculation was made using 11 ICSBEP benchmarks. This work is in support of the DOE Nuclear Criticality Safety Program. (authors)

Sobes, V.; Forget, B. [Dept. of Nuclear Science and Engineering, Massachusetts Inst. of Technology, Bldg. 24, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Leal, L.; Guber, K. [Oak Ridge National Laboratory, P.O. Box 2008, Oak Ridge, TN 37831 (United States)



Active detection of shielded SNM with 60-keV neutrons  

Science Conference Proceedings (OSTI)

Fissile materials, e.g. {sup 235}U and {sup 239}Pu, can be detected non-invasively by active neutron interrogation. A unique characteristic of fissile material exposed to neutrons is the prompt emission of high-energy (fast) fission neutrons. One promising mode of operation subjects the object to a beam of medium-energy (epithermal) neutrons, generated by a proton beam impinging on a Li target. The emergence of fast secondary neutrons then clearly indicates the presence of fissile material. Our interrogation system comprises a low-dose 60-keV neutron generator (5 x 10{sup 6}/s), and a 1 m{sup 2} array of scintillators for fast neutron detection. Preliminary experimental results demonstrate the detectability of small quantities (370 g) of HEU shielded by steel (200 g/cm{sup 2}) or plywood (30 g/cm{sup 2}), with a typical measurement time of 1 min.

Hagmann, C; Dietrich, D; Hall, J; Kerr, P; Nakae, L; Newby, R; Rowland, M; Snyderman, N; Stoeffl, W



Prospects for the CERN Axion Solar Telescope Sensitivity to 14.4 keV Axions  

E-Print Network (OSTI)

The CERN Axion Solar Telescope (CAST) is searching for solar axions using the 9.0 T strong and 9.26 m long transverse magnetic field of a twin aperture LHC test magnet, where axions could be converted into X-rays via reverse Primakoff process. Here we explore the potential of CAST to search for 14.4 keV axions that could be emitted from the Sun in M1 nuclear transition between the first, thermally excited state, and the ground state of 57Fe nuclide. Calculations of the expected signals, with respect to the axion-photon coupling, axion-nucleon coupling and axion mass, are presented in comparison with the experimental sensitivity.

Jakovcic, K; Aune, S; Avignone, F T; Barth, K; Belov, A; Beltrn, B; Bruninger, H; Carmona, J M; Cebrin, S; Collar, J I; Dafni, T; Davenport, M; Di Lella, L; Eleftheriadis, C; Fanourakis, G K; Ferrer-Ribas, E; Fischer, H; Franz, J; Friedrich, P; Geralis, T; Giomataris, Ioanis; Gninenko, S; Hasinoff, M D; Heinsius, F H; Hoffmann, Dieter H H; Irastorza, I G; Jacoby, J; Kang, D; Knigsmann, K; Kotthaus, R; Krcmar, M; Kousouris, a K; Kuster, M; Laki, B; Lasseur, C; Liolios, A; Ljubici, A; Lutz, G; Luzn, G; Miller, D W; Morales, A; Morales, J; Ortiz, A; Papaevangelou, T; Placci, A; Raffelt, G; Ruz, J; Riege, H; Semertzidis, Y K; Serpico, Pasquale Dario; Stewart, o L; Vieira, J D; Villar, J; Vogel, J; Walckiers, L; Zioutas, K; Jakovcic, Kresimir



Perspective of Systems Engineering Jing Ke, Lynn Price, Michael McNeil, Nina Zheng Khanna, Nan  

NLE Websites -- All DOE Office Websites (Extended Search)

and Practices of Energy and Practices of Energy Benchmarking for Industry from the Perspective of Systems Engineering Jing Ke, Lynn Price, Michael McNeil, Nina Zheng Khanna, Nan Zhou Environmental Energy Technologies Division Lawrence Berkeley National Laboratory Reprint version of journal article published in "Energy", Volume 54, Pages 32-44, June 2013 March 2013 This work was supported by the China Sustainable Energy Program of the Energy Foundation through the U.S. Department of Energy under Contract No. DE-AC02- 05CH11231. ERNEST ORLANDO LAWRENCE BERKELEY NATIONAL LABORATORY LBNL-6328E Disclaimer This document was prepared as an account of work sponsored by the United States Government. While


Nan Zhou, David Fridley, Michael McNeil, Nina Khanna, Wei Feng and Jing Ke  

NLE Websites -- All DOE Office Websites (Extended Search)

Quantifying the potential impact Quantifying the potential impact of energy efficiency and low carbon policies for China Nan Zhou, David Fridley, Michael McNeil, Nina Khanna, Wei Feng and Jing Ke China Energy Group Environmental Energy Technologies Division Lawrence Berkeley National Laboratory Pre-print version of proceedings of the European Council for an Energy-Efficient Economy's 2013 Summer Study on Energy Efficiency, held in Toulon, France, June 3 - 8, 2013 March 2013 This work was supported by the China Sustainable Energy Program of the Energy Foundation through the U.S. Department of Energy under Contract No. DE-AC02- 05CH11231. ERNEST ORLANDO LAWRENCE BERKELEY NATIONAL LABORATORY LBNL-6161E Disclaimer This document was prepared as an account of work sponsored by the United States Government. While



Science Conference Proceedings (OSTI)

We present a statistical survey of {approx}2-20 keV superhalo electrons in the solar wind measured by the SupraThermal Electron instrument on board the two STEREO spacecraft during quiet-time periods from 2007 March through 2009 March at solar minimum. The observed superhalo electrons have a nearly isotropic angular distribution and a power-law spectrum, f{proportional_to}v{sup -{gamma}}, with {gamma} ranging from 5 to 8.7, with nearly half between 6.5 and 7.5, and an average index of 6.69 {+-} 0.90. The observed power-law spectrum varies significantly on a spatial scale of {approx}>0.1 AU and a temporal scale of {approx}>several days. The integrated density of quiet-time superhalo electrons at 2-20 keV ranges from {approx}10{sup -8} cm{sup -3} to 10{sup -6} cm{sup -3}, about 10{sup -9}-10{sup -6} of the solar wind density, and, as well as the power-law spectrum, shows no correlation with solar wind proton density, velocity, or temperature. The density of superhalo electrons appears to show a solar-cycle variation at solar minimum, while the power-law spectral index {gamma} has no solar-cycle variation. These quiet-time superhalo electrons are present even in the absence of any solar activity-e.g., active regions, flares or microflares, type III radio bursts, etc.-suggesting that they may be accelerated by processes such as resonant wave-particle interactions in the interplanetary medium, or possibly by nonthermal processes related to the acceleration of the solar wind such as nanoflares, or by acceleration at the CIR forward shocks.

Wang, Linghua [Department of Geophysics, Peking University, 100871 Beijing (China); Lin, Robert P.; Salem, Chadi; Pulupa, Marc; Larson, Davin E.; Luhmann, Janet G. [Space Sciences Laboratory, University of California, Berkeley, CA 94720-7450 (United States); Yoon, Peter H., E-mail: wanglhwang@gmail.com [School of Space Research, Kyung Hee University, Yongin, Gyeonggi (Korea, Republic of)



Scintillation efficiency and ionization yield of liquid xenon for monoenergetic nuclear recoils down to 4 keV  

SciTech Connect

Liquid xenon (LXe) is an excellent material for experiments designed to detect dark matter in the form of weakly interacting massive particles (WIMPs). A low energy detection threshold is essential for a sensitive WIMP search. The understanding of the relative scintillation efficiency (L{sub eff}) and ionization yield of low energy nuclear recoils in LXe is limited for energies below 10 keV. In this article, we present new measurements that extend the energy down to 4 keV, finding that L{sub eff} decreases with decreasing energy. We also measure the quenching of scintillation efficiency caused by the electric field in LXe, finding no significant field dependence.

Manzur, A.; Curioni, A.; Kastens, L.; McKinsey, D. N.; Ni, K.; Wongjirad, T. [Department of Physics, Yale University, New Haven, Connecticut 06520 (United States)



Inelastic processes in K^(+)- He collisions in energy range 0.7 - 10 keV  

E-Print Network (OSTI)

Absolute cross sections for charge exchange, ionization, stripping and excitation in K^(+) - He collisions were measured in the ion energy range 0.7 - 10 keV. The experimental data and the schematic correlation diagrams are used to analyze and determine the mechanisms for these processes. The increase of the excitation probability of inelastic channels with the angle of scattering is revealed. An exceptionally highly excited state of He is observed and a peculiarity for the excitation function of the resonance line is explained. The intensity ratio for the excitation of the K II \\lambda = 60.1 nm and \\lambda = 61.2 nm lines is 5:1 which indicates the high probability for excitation of the singlet resonance level $^{1}$P$_{1}$ compared to the triplet level $^{3}$P$_{1}$. The similarity of the population of the 4p state of the potassium ion and atom as well as the anomalously small values of the excitation cross sections are explained.

R. A. Lomsadze; M. R. Gochitashvili; R. Ya. Kezerashvili; N. O. Mosulishvili; R. Phaneuf



Characteristics of KE Basin Sludge Samples Archived in the RPL - 2007  

SciTech Connect

Samples of sludge were collected from the K East fuel storage basin (KE Basin) floor, contiguous pits (Weasel Pit, North Load Out Pit, Dummy Elevator Pit, and Tech View Pit), and fuel storage canisters between 1995 and 2003 for chemical and radionuclide concentration analysis, physical property determination, and chemical process testing work. Because of the value of the sludge in this testing and because of the cost of obtaining additional fresh samples, an ongoing program of sludge preservation has taken place with the goals to track the sludge identities and preserve, as well as possible, the sludge composition by keeping the sludge in sealed jars and maintaining water coverage on the sludge consistent with the controlling Fluor Hanford (FH) Sampling and Analysis plans and FH contracts with the Pacific Northwest National Laboratory (PNNL). This work was originally initiated to provide material for planned hydrothermal treatment testing in accordance with the test plan for the Sludge Treatment Project (STP) corrosion process chemistry follow on testing (Delegard et al. 2007). Although most of the planned hydrothermal testing was canceled in July 2007 (as described in the forward of Delegard et al. 2007), sample consolidation and characterization was continued to identify a set of well-characterized sludge samples that are suited to support evolving STP initiatives. The work described in the letter was performed by the PNNL under the direction of the Sludge Treatment Project, managed by Fluor Hanford.

Delegard, Calvin H.; Schmidt, Andrew J.; Chenault, Jeffrey W.



The System of Nanosecond 280-KeV He+ Pulsed Beam  

SciTech Connect

At Fast Neutron Research Facility, the 150 kV-pulses neutron generator is being upgraded to a 280-kV-pulsed-He beam for time-of-flight Rutherford backscattering spectrometry. It involves replacing the existing beam line elements by a multicusp ion source, a 400-kV accelerating tube, 45{sup o}-double focusing dipole magnet and quadrupole lens. The multicusp ion source is a compact filament-driven of 2.6 cm in diameter and 8 cm in length. The current extracted is 20.4 {micro}A with 13 kV of extraction voltage and 8.8 kV of Einzel lens voltage. The beam emittance has found to vary between 6-12 mm mrad. The beam transport system has to be redesigned based on the new elements. The important part of a good pulsed beam depends on the pulsing system. The two main parts are the chopper and buncher. An optimized geometry for the 280 keV pulsed helium ion beam will be presented and discussed. The PARMELA code has been used to optimize the space charge effect, resulting in pulse width of less than 2 ns at a target. The calculated distance from a buncher to the target is 4.6 m. Effects of energy spread and phase angle between chopper and buncher have been included in the optimization of the bunch length.

Junphong, P.; Ano, V.; Lekprasert, B.; Suwannakachorn, D.; Thongnopparat, N.; Vilaithong, T.; /Chiang Mai U.; Wiedemann, H.; /SLAC /SLAC, SSRL



Characterization of Settler Tank, KW Container and KE Container Sludge Simulants  

Science Conference Proceedings (OSTI)

The Sludge Treatment Project (STP), managed by CH2M Hill Plateau Remediation Company (CHPRC) has specified base formulations for non-radioactive sludge simulants for use in the development and testing of equipment for sludge sampling, retrieval, transport, and processing. In general, the simulant formulations are based on the average or design-basis physical and chemical properties obtained by characterizing sludge samples. The simulants include surrogates for uranium metal, uranium oxides (agglomerates and fine particulate), and the predominant chemical phases (iron and aluminum hydroxides, sand). Specific surrogate components were selected to match the nominal particle-size distribution and particle-density data obtained from sludge sample analysis. Under contract to CHPRC, Pacific Northwest National Laboratory (PNNL) has performed physical and rheological characterization of simulants, and the results are reported here. Two base simulant types (dry) were prepared by STP staff at the Maintenance and Storage Facility and received by PNNL in February 2009: Settler Tank Simulant and KW Container Sludge Simulant. A third simulant, KE Container Sludge Simulant was received by PNNL in December 2010. The objectives of this simulant characterization effort were to provide baseline characterization data on simulants being used by STP for process development and equipment testing and provide a high-level comparison of the simulant characteristics to the targets used to formulate the simulants.

Burns, Carolyn A.; Luna, Maria L.; Schmidt, Andrew J.


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Conference Proceedings (OSTI)

We use interplanetary transport simulations to compute a database of electron Green's functions, i.e., differential intensities resulting at the spacecraft position from an impulsive injection of energetic (>20 keV) electrons close to the Sun, for a large number of values of two standard interplanetary transport parameters: the scattering mean free path and the solar wind speed. The nominal energy channels of the ACE, STEREO, and Wind spacecraft have been used in the interplanetary transport simulations to conceive a unique tool for the study of near-relativistic electron events observed at 1 AU. In this paper, we quantify the characteristic times of the Green's functions (onset and peak time, rise and decay phase duration) as a function of the interplanetary transport conditions. We use the database to calculate the FWHM of the pitch-angle distributions at different times of the event and under different scattering conditions. This allows us to provide a first quantitative result that can be compared with observations, and to assess the validity of the frequently used term beam-like pitch-angle distribution.

Agueda, N.; Sanahuja, B. [Departament d'Astronomia i Meteorologia, Institut de Ciencies del Cosmos, Universitat de Barcelona, Barcelona (Spain); Vainio, R. [Department of Physics, University of Helsinki, Helsinki (Finland)



Optima MDxt: A high throughput 335 keV mid-dose implanter  

SciTech Connect

The continuing demand for both energy purity and implant angle control along with high wafer throughput drove the development of the Axcelis Optima MDxt mid-dose ion implanter. The system utilizes electrostatic scanning, an electrostatic parallelizing lens and an electrostatic energy filter to produce energetically pure beams with high angular integrity. Based on field proven components, the Optima MDxt beamline architecture offers the high beam currents possible with singly charged species including arsenic at energies up to 335 keV as well as large currents from multiply charged species at energies extending over 1 MeV. Conversely, the excellent energy filtering capability allows high currents at low beam energies, since it is safe to utilize large deceleration ratios. This beamline is coupled with the >500 WPH capable endstation technology used on the Axcelis Optima XEx high energy ion implanter. The endstation includes in-situ angle measurements of the beam in order to maintain excellent beam-to-wafer implant angle control in both the horizontal and vertical directions. The Optima platform control system provides new generation dose control system that assures excellent dosimetry and charge control. This paper will describe the features and technologies that allow the Optima MDxt to provide superior process performance at the highest wafer throughput, and will provide examples of the process performance achievable.

Eisner, Edward; David, Jonathan; Justesen, Perry; Kamenitsa, Dennis; McIntyre, Edward; Rathmell, Robert; Ray, Andrew; Rzeszut, Richard [Axcelis Technologies, Inc., 108 Cherry Hill Drive, Beverly, MA 01915 (United States)



The Complex 0.1-100 keV X-Ray Spectrum of PKS2155-304  

E-Print Network (OSTI)

A long ($>100,000$ seconds) observation of the bright BL Lac object PKS 2155-304 has been carried out with the Narrow Field Instruments of the BeppoSAX satellite as part of the Science Verification Phase. The source was detected between 0.1 and about 100 keV at an intermediate intensity level compared to previous observations. The unique spectral coverage of BeppoSAX has allowed us to detect a number of spectral features. Between 0.1 and 10 keV the spectrum can be well described by a convex spectrum with (energy) slope gradually steepening from 1.1 to 1.6. At higher energies evidence for a sharp spectral hardening is found, while in the soft X-rays (0.1-1.0 keV) some evidence for an absorption feature was found. Indication for an emission line at 6.4 keV in the source rest frame is present. Repeated variability of $\\approx 20-30%$ around the mean flux is clearly detected on time scales of a few hours. From the symmetry and timescale of the observed variations we derive limits on the magnetic field and on the maximum energy of the emitting particles, implying that PKS 2155-304 should not be bright at TeV energies.

P. Giommi et al



First limits on the 3-200 keV X-ray spectrum of the quiet Sun using RHESSI  

E-Print Network (OSTI)

We present the first results using the Reuven Ramaty High-Energy Solar Spectroscopic Imager, RHESSI, to observe solar X-ray emission not associated with active regions, sunspots or flares (the quiet Sun). Using a newly developed chopping technique (fan-beam modulation) during seven periods of offpointing between June 2005 to October 2006, we obtained upper limits over 3-200 keV for the quietest times when the GOES12 1-8A flux fell below $10^{-8}$ Wm$^{-2}$. These values are smaller than previous limits in the 17-120 keV range and extend them to both lower and higher energies. The limit in 3-6 keV is consistent with a coronal temperature $\\leq 6$ MK. For quiet Sun periods when the GOES12 1-8A background flux was between $10^{-8}$ Wm$^{-2}$ and $10^{-7}$ Wm$^{-2}$, the RHESSI 3-6 keV flux correlates to this as a power-law, with an index of $1.08 \\pm 0.13$. The power-law correlation for microflares has a steeper index of $1.29 \\pm 0.06$. We also discuss the possibility of observing quiet Sun X-rays due to solar axions and use the RHESSI quiet Sun limits to estimate the axion-to-photon coupling constant for two different axion emission scenarios.

Iain G. Hannah; G. J Hurford; H. S. Hudson; R. P. Lin; K. van Bibber



Characterization of Compaction and Dryout Properties of KE Basin Sludge During Long-Term Storage  

SciTech Connect

The long-term behavior of Hanford Site K Basin sludge with respect to loss of supernatant water and solids compaction is important in designing sludge storage and handling systems. This report describes the results of laboratory tests performed to understand and predict K Basin sludge drying and compaction rates under extended (28-month) {approx}34 C hot cell storage. Tests were conducted with six K Basin sludge materials, a control sample of simulated K Basin sludge, and a control sample containing only K Basin supernatant liquid. All samples were held in graduated cylinders fitted with threaded plastic caps. Quantitative data were gathered on how the mass and volume of K Basin sludge, and its associated supernatant liquid, changed with respect to storage time. The tests showed that the K Basin sludge samples lost water unpredictably, depending on cap seal tightness, with projected dryout times for a 1-cm cover water depth ranging from 5 to 216 months. Though the ambient radiation field ({approx}5 Rad/hour) likely contributed to cap seal degradation, water evaporation rates were found to be independent of the contained material (water vs. sludge; radioactive vs. non-radioactive sludge). Although water was lost at variable rates from sludge samples during storage in the hot cell (and, presumably, in long-term containerized storage), the sludge itself had no intrinsic propensity to enhance or diminish the rate of water evaporation compared with that exhibited by water stored in the same environment. Most of the compaction of the six KE Basin sludges and the simulated sludge occurred in the first week. Subsequent compaction to 28-months time provided little additional increase in settled sludge density. Agitating the settled sludge likewise had little to no effect on the density. However, one tested sludge contained unreacted uranium metal that began to generate corrosion product hydrogen gas after 78 days of settling and strongly altered the apparent sludge density. T he lengthy induction time shows again that uranium metal-bearing sludge may lie quiescent for long periods, even at comparatively warm temperatures, before initiating gas generation. When the testing was completed, the sludge samples were removed from the graduated cylinders. Most sludge re-suspended readily but a canister sludge sample that had previously been allowed to dry out during storage self-cemented into a hard-cake monolith and could not be re-suspended. Settled sludge density and the concentrations of 154Eu, 241Am, and the plutonium isotopes were found to follow the dry basis uranium concentration in the sludge solids. These findings amplify observations made in prior characterization studies that showed that sludge density and radiolytic, fissile material, and TRU (primarily 241Am and 238,239,240Pu) concentrations are proportional to uranium concentration. The sludge pH, found to decrease from {approx}8 to {approx}5 with a dry basis uranium concentration increase from {approx}2.5 to 82 wt% , provides data useful in designing sludge storage and process equipment.

Delegard, Calvin H.; Poloski, Adam P.; Schmidt, Andrew J.; Chenault, Jeffrey W.



Single-Photon Entanglement in the keV Regime via Coherent Control of Nuclear Forward Scattering  

E-Print Network (OSTI)

Generation of single-photon entanglement is discussed in nuclear forward scattering. Using successive switchings of the direction of the nuclear hyperfine magnetic field, the coherent scattering of photons on nuclei is controlled such that two signal pulses are generated out of one initial pump pulse. The two time-resolved correlated signal pulses have different polarizations and energy in the keV regime. Spatial separation of the entangled field modes and extraction of the signal from the background can be achieved with the help of state-of-the-art x-ray polarizers and piezoelectric fast steering mirrors.

Adriana Plffy; Christoph H. Keitel; Jrg Evers



Curium-245 and curium-247 neutron cross sections between 10 keV and 10 MeV  

SciTech Connect

The optical model code 2PLUS and the statistical model codes COMNUC and CASCADE were used to compute neutron cross sections for Cm-245 and Cm-247 between 10 keV and 10 MeV. Cross sections for elastic and inelastic scattering, radiative capture, fission, and the (n,2n) reactions were computed. The parameters for the fission model were selected to yield agreement with the cross sections from the Physics-8 bomb shot. Pu-239 cross sections were calculated and compared with existing cross section evaluations to demonstrate the validity of the calculational methods.

Clifford, L.R.; McCrosson, F.J.



Absolute calibration of image plates for electrons at energy between 100 keV and 4 MeV  

SciTech Connect

We measured the absolute response of image plate (Fuji BAS SR2040) for electrons at energies between 100 keV and 4 MeV using an electron spectrometer. The electron source was produced from a short pulse laser irradiated on solid density targets. This paper presents the calibration results of image plate photon stimulated luminescence per electron at this energy range. The Monte Carlo radiation transport code MCNPX results are also presented for three representative incident angles onto the image plates and corresponding electron energy depositions at these angles. These provide a complete set of tools that allows extraction of our absolute calibration to other spectrometer setting at this electron energy range.

Chen Hui; Back, Norman L.; Eder, David C.; MacPhee, Andrew G.; Ping Yuan; Song, Peter M.; Throop, Alan [Lawrence Livermore National Laboratory, Livermore, California 94550-9234 (United States); Bartal, Teresa; Beg, F. N. [University of California, San Diego, La Jolla, California 92093 (United States); Link, Anthony J.; Van Woerkom, Linn [Ohio State University, Columbus, Ohio 43210 (United States)



Absolute Calibration of Image Plate for electrons at energy between 100 keV and 4 MeV  

SciTech Connect

The authors measured the absolute response of image plate (Fuji BAS SR2040) for electrons at energies between 100 keV to 4 MeV using an electron spectrometer. The electron source was produced from a short pulse laser irradiated on the solid density targets. This paper presents the calibration results of image plate Photon Stimulated Luminescence PSL per electrons at this energy range. The Monte Carlo radiation transport code MCNPX results are also presented for three representative incident angles onto the image plates and corresponding electron energies depositions at these angles. These provide a complete set of tools that allows extraction of the absolute calibration to other spectrometer setting at this electron energy range.

Chen, H; Back, N L; Eder, D C; Ping, Y; Song, P M; Throop, A



Reasons for decision in the matter of Imperial Oil Resources Limited and Boston Gas Company application pursuant to Part VI of the National Energy Board Act for a license to export natural gas: GH-1-99  

Science Conference Proceedings (OSTI)

This document provides the Reasons for Decision in the matter of Hearing Order GH-1-99, heard in Halifax, NS on May 4 and 5, 1999. The proceeding concerns an application for a gas export license from Imperial Oil Resources Ltd. (IORL) and Boston Gas for a proposed export for sale to Boston Gas for the period 1 Nov 1999 to 31 Mar 2007. The natural gas will be produced from the Sable Offshore Energy Project and replace IORL's Alberta natural gas supplies sold to Boston Gas. The document includes a discussion of the market-based procedure used by the Board to assess the merits of an application to obtain a gas export license.

Not Available



Characterization of leakage current in thin gate oxide subjected to 10 KeV X-ray irradiation  

SciTech Connect

Two components of the low-field current have been identified in thin oxides, following 10 KeV X-ray irradiation. The first component, observed in the direct tunneling region, can be removed by a 100 C anneal, and is also greatly suppressed if the irradiation is done in vacuum or in a nitrogen ambient, or if the oxide is preannealed before irradiation. The origin of this current is speculated to be related to adsorbed water molecules on the gate surface. The second component is observed to begin in the pre-Fowler-Nordheim tunneling (FNT) region and extends into the FNT region, only in oxides less than {approximately}8 nm thick, and persists even after several days of anneal at 300 C. This current exhibits a power law dependence on radiation dose. The origin of this second component is believed to be due to the trap-assisted tunneling via neutral electron traps, similar to the leakage current observed in the oxide after high-voltage stress.

Ling, C.H.; Ang, C.H.; Ang, D.S.



Properties of the 5- state at 839 keV in 176Lu and the s-process branching at A = 176  

E-Print Network (OSTI)

The s-process branching at mass number A = 176 depends on the coupling between the high-K ground state and a low-lying low-K isomer in 176Lu. This coupling is based on electromagnetic transitions via intermediate states at higher energies. The properties of the lowest experimentally confirmed intermediate state at 839 keV are reviewed, and the transition rate between low-K and high-K states under stellar conditions is calculated on the basis of new experimental data for the 839 keV state. Properties of further candidates for intermediate states are briefly analyzed. It is found that the coupling between the high-K ground state and the low-K isomer in 176Lu is at least one order of magnitude stronger than previously assumed leading to crucial consequences for the interpretation of the 176Lu/176Hf pair as an s-process thermometer.

P. Mohr; S. Bisterzo; R. Gallino; F. Kppeler; U. Kneissl; N. Winckler



Development of a soft x-ray diffractometer for a wideband multilayer grating with a novel layer structure in the 2-4 keV range  

Science Conference Proceedings (OSTI)

We have been developing a wavelength-dispersive soft x-ray spectrograph covering an energy region of 50-4000 eV to attach to a conventional electron microscope. Observation of soft x-ray emission in the 2-4 keV range needs a multilayer coated grating. In order to evaluate the performance of the optical component in the energy region, a goniometric apparatus has been newly developed and the preliminary performance has been tested using synchrotron radiation.

Imazono, Takashi; Koike, Masato; Kawachi, Tetsuya; Hasegawa, Noboru; Koeda, Masaru; Nagano, Tetsuya; Sasai, Hiroyuki; Oue, Yuki; Yonezawa, Zeno; Kuramoto, Satoshi; Terauchi, Masami; Takahashi, Hideyuki; Handa, Nobuo; Murano, Takanori [Quantum Beam Science Directorate, Japan Atomic Energy Agency, 8-1-7 Umemidai, Kizugawa, Kyoto 619-0215 (Japan); Device Dept., Shimadzu Corp., 1 Nishinokyo-Kuwabara-cho, Nakagyo-ku, Kyoto 604-8511 (Japan); IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); ECBU, JEOL Ltd., 3-1-2 Musashino, Akishima, Tokyo 196-8558 (Japan)



Electron collisional detachment processes for a 250 keV D/sup -/ ion beam in a partially ionized hydrogen target  

DOE Green Energy (OSTI)

Neutral atom beams with energies above 200 keV may be required for various purposes in magnetic fusion devices following TFTR, JET and MFTF-B. These beams can be produced much more efficiently by electron detachment from negative ion beams than by electron capture by positive ions. We have investigated the efficiency with which such neutral atoms can be produced by electron detachment in partially ionized hydrogen plasma neutralizers.

Savas, S.E.



X-ray microscopy of laser fusion targets in four energy bands from 0.7 to 4.0 keV  

SciTech Connect

A grazing x-ray microscope was shown to be able to photograph the x-ray emission from laser-produced plasmas between 0.8 and 4.0 keV with a spatial resolution of approximately 3 microns. The calibration of the x-ray mirror energy response functions and the x-ray film allow absolute measurements of the spatial and spectral distribution of the x-ray emission from laser fusion targets. (MOW)

Boyle, M.J.; Seward, F.D.; Harper, T.L.; Koppel, L.N.; Pettipiece, K.J.; Ahlstrom, H.G.



Hard x-ray (>100 keV) imager to measure hot electron preheat for indirectly driven capsule implosions on the NIF  

Science Conference Proceedings (OSTI)

We have fielded a hard x-ray (>100 keV) imager with high aspect ratio pinholes to measure the spatially resolved bremsstrahlung emission from energetic electrons slowing in a plastic ablator shell during indirectly driven implosions at the National Ignition Facility. These electrons are generated in laser plasma interactions and are a source of preheat to the deuterium-tritium fuel. First measurements show that hot electron preheat does not limit obtaining the fuel areal densities required for ignition and burn.

Doeppner, T.; Dewald, E. L.; Divol, L.; Thomas, C. A.; Burns, S.; Celliers, P. M.; Izumi, N.; LaCaille, G.; McNaney, J. M.; Prasad, R. R.; Robey, H. F.; Glenzer, S. H.; Landen, O. L. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Kline, J. L. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)



INTEGRAL observations of the cosmic X-ray background in the 5-100 keV range via occultation by the Earth  

E-Print Network (OSTI)

We study the spectrum of the cosmic X-ray background (CXB) in energy range $\\sim$5-100 keV. Early in 2006 the INTEGRAL observatory performed a series of four 30ksec observations with the Earth disk crossing the field of view of the instruments. The modulation of the aperture flux due to occultation of extragalactic objects by the Earth disk was used to obtain the spectrum of the Cosmic X-ray Background(CXB). Various sources of contamination were evaluated, including compact sources, Galactic Ridge emission, CXB reflection by the Earth atmosphere, cosmic ray induced emission by the Earth atmosphere and the Earth auroral emission. The spectrum of the cosmic X-ray background in the energy band 5-100 keV is obtained. The shape of the spectrum is consistent with that obtained previously by the HEAO-1 observatory, while the normalization is $\\sim$10% higher. This difference in normalization can (at least partly) be traced to the different assumptions on the absolute flux from the Crab Nebulae. The increase relative to the earlier adopted value of the absolute flux of the CXB near the energy of maximum luminosity (20-50 keV) has direct implications for the energy release of supermassive black holes in the Universe and their growth at the epoch of the CXB origin.

E. Churazov; R. Sunyaev; M. Revnivtsev; S. Sazonov; S. Molkov; S. Grebenev; C. Winkler; A. Parmar; A. Bazzano; M. Falanga; A. Gros; F. Lebrun; L. Natalucci; P. Ubertini; J. -P. Roques; L. Bouchet; E. Jourdain; J. Knoedlseder; R. Diehl; C. Budtz-Jorgensen; S. Brandt; N. Lund; N. J. Westergaard; A. Neronov; M. Turler; M. Chernyakova; R. Walter; N. Produit; N. Mowlavi; J. M. Mas-Hesse; A. Domingo; N. Gehrels; E. Kuulkers; P. Kretschmar; M. Schmidt



Efficient laser-induced 6-8 keV x-ray production from iron oxide aerogel and foil-lined cavity targets  

SciTech Connect

The performance of new iron-based laser-driven x-ray sources has been tested at the OMEGA laser facility for production of x rays in the 6.5-8.5 keV range. Two types of targets were experimentally investigated: low-density iron oxide aerogels (density 6-16 mg/cm{sup 3}) and stainless steel foil-lined cavity targets (steel thickness 1-5 {mu}m). The targets were irradiated by 40 beams of the OMEGA laser (500 J/beam, 1 ns pulse, wavelength 351 nm). All targets showed good coupling with the laser, with <5% of the incident laser light backscattered by the resulting plasma in all cases (typically <2.5%). The aerogel targets produced T{sub e}=2 to 3 keV, n{sub e}=0.12-0.2 critical density plasmas yielding a 40%-60% laser-to-x-ray total conversion efficiency (CE) (1.2%-3% in the Fe K-shell range). The foil cavity targets produced T{sub e}{approx} 2 keV, n{sub e}{approx} 0.15 critical density plasmas yielding a 60%-75% conversion efficiency (1.6%-2.2% in the Fe K-shell range). Time-resolved images illustrate that the volumetric heating of low-density aerogels allow them to emit a higher K-shell x-ray yield even though they contain fewer Fe atoms. However, their challenging fabrication process leads to a larger shot-to-shot variation than cavity targets.

Perez, F.; Kay, J. J.; Patterson, J. R.; Kane, J.; May, M.; Emig, J.; Colvin, J.; Gammon, S.; Satcher, J. H. Jr.; Fournier, K. B. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, California 94550 (United States); Villette, B.; Girard, F.; Reverdin, C. [CEA DAM DIF, F-91297 Arpajon (France); Sorce, C. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, California 94550 (United States); University of Rochester - Laboratory for Laser Energetics, 250 E. River Rd, Rochester, New York 14623-1299 (United States); Jaquez, J. [General Atomics, San Diego, California 92121 (United States)



A RIAF Interpretation for the Past Higher Activity of the Galactic Center Black Hole and the 511 keV Annihilation Emission  

E-Print Network (OSTI)

There are several lines of evidence that the super-massive black hole at the Galactic center had higher activities in the past than directly observed at present. Here I show that these lines of evidence can quantitatively and consistently be explained if the mean accretion rate during the past ~10^7 yrs has been ~10^{3-4} times higher than the current rate, by the picture of radiatively inefficient accretion flow (RIAF) and associated outflow that has been successfully applied to Sgr A*. I argue that this increased rate and its duration are theoretically reasonable in the Galactic center environment, while the accretion rate suddenly dropped about 300 years ago most likely because of the shell passage of the supernova remnant Sgr A East. The chance probability of witnessing Sgr A* in such a low state is not extremely small (~0.5%). The outflow energetics is sufficient to keep the hot (~8 keV) diffuse gas observed in the Galactic center region. Then, I show that a significant amount of positrons should have been created around the event horizon during the higher activity phase, and injected into interstellar medium by the outflow. The predicted positron production rate and propagation distance are close to those required to explain the observed 511 keV annihilation line emission from the Galactic bulge, giving a natural explanation for the large bulge-to-disk ratio of the emission. The expected injection energy into interstellar medium is about 1 MeV, which is also favorable as an explanation of the 511 keV line emission.

Tomonori Totani




SciTech Connect

We present results from three nearly simultaneous Nuclear Spectroscopic Telescope Array (NuSTAR) and Chandra monitoring observations between 2012 September 2 and 2012 November 16 of the local star-forming galaxy NGC 253. The 3-40 keV intensity of the inner {approx}20 arcsec ({approx}400 pc) nuclear region, as measured by NuSTAR, varied by a factor of {approx}2 across the three monitoring observations. The Chandra data reveal that the nuclear region contains three bright X-ray sources, including a luminous (L{sub 2-10{sub keV}} {approx} few Multiplication-Sign 10{sup 39} erg s{sup -1}) point source located {approx}1 arcsec from the dynamical center of the galaxy (within the 3{sigma} positional uncertainty of the dynamical center); this source drives the overall variability of the nuclear region at energies {approx}>3 keV. We make use of the variability to measure the spectra of this single hard X-ray source when it was in bright states. The spectra are well described by an absorbed (N{sub H} Almost-Equal-To 1.6 Multiplication-Sign 10{sup 23} cm{sup -2}) broken power-law model with spectral slopes and break energies that are typical of ultraluminous X-ray sources (ULXs), but not active galactic nuclei (AGNs). A previous Chandra observation in 2003 showed a hard X-ray point source of similar luminosity to the 2012 source that was also near the dynamical center ({theta} Almost-Equal-To 0.4 arcsec); however, this source was offset from the 2012 source position by Almost-Equal-To 1 arcsec. We show that the probability of the 2003 and 2012 hard X-ray sources being unrelated is >>99.99% based on the Chandra spatial localizations. Interestingly, the Chandra spectrum of the 2003 source (3-8 keV) is shallower in slope than that of the 2012 hard X-ray source. Its proximity to the dynamical center and harder Chandra spectrum indicate that the 2003 source is a better AGN candidate than any of the sources detected in our 2012 campaign; however, we were unable to rule out a ULX nature for this source. Future NuSTAR and Chandra monitoring would be well equipped to break the degeneracy between the AGN and ULX nature of the 2003 source, if again caught in a high state.

Lehmer, B. D. [Johns Hopkins University, Homewood Campus, Baltimore, MD 21218 (United States); Wik, D. R.; Hornschemeier, A. E.; Ptak, A.; Leyder, J.-C.; Venters, T.; Zhang, W. W. [NASA Goddard Space Flight Center, Code 662, Greenbelt, MD 20771 (United States); Antoniou, V. [Department of Physics and Astronomy, Iowa State University, 12 Physics Hall, Ames, IA 50011 (United States); Argo, M. K. [ASTRON, the Netherlands Institute for Radio Astronomy, Postbus 2, 7990 AA, Dwingeloo (Netherlands); Bechtol, K. [Kavli Institute for Cosmological Physics, Chicago, IL 60637 (United States); Boggs, S.; Craig, W. W.; Krivonos, R. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Christensen, F. E. [DTU Space-National Space Institute, Technical University of Denmark, Elektrovej 327, DK-2800 Lyngby (Denmark); Hailey, C. J. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Harrison, F. A. [Caltech Division of Physics, Mathematics and Astronomy, Pasadena, CA 91125 (United States); Maccarone, T. J. [School of Physics and Astronomy, University of Southampton, Highfield SO17 IBJ (United Kingdom); Stern, D. [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Zezas, A. [Physics Department, University of Crete, Heraklion (Greece)


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurement of the 20 and 90 keV Resonances in the {sup 18}O(p,{alpha}){sup 15}N Reaction via the Trojan Horse Method  

SciTech Connect

The {sup 18}O(p,{alpha}){sup 15}N reaction is of primary importance in several astrophysical scenarios, including fluorine nucleosynthesis inside asymptotic giant branch stars as well as oxygen and nitrogen isotopic ratios in meteorite grains. Thus the indirect measurement of the low energy region of the {sup 18}O(p,{alpha}){sup 15}N reaction has been performed to reduce the nuclear uncertainty on theoretical predictions. In particular the strength of the 20 and 90 keV resonances has been deduced and the change in the reaction rate evaluated.

La Cognata, M.; Spitaleri, C.; Cherubini, S.; Crucilla, V.; Gulino, M.; Lamia, L.; Pizzone, R. G.; Puglia, S. M. R.; Rapisarda, G. G.; Romano, S.; Sergi, M. L.; Tumino, A. [INFN Laboratori Nazionali del Sud and DMFCI Universita di Catania, 95123 Catania (Italy); Mukhamedzhanov, A. M.; Tribble, R. E.; Banu, A.; Goldberg, V. Z.; Tabacaru, G.; Trache, L. [Cyclotron Institute, Texas A and M University, College Station, 77843 Texas (United States); Irgaziev, B. [GIK Institute of Engineering Sciences and Technology, Topi (23640), NWFP Pakistan (Pakistan); Coc, A. [CSNSM, CNRS/IN2P3 Universite Paris Sud, F-91405 Orsay (France)] (and others)



Electron energy spectra of H{sup {minus}} autodetaching states resulting from collisions of H{sup {minus}} with He at 1 keV  

SciTech Connect

Electron energy spectra for H{sup {minus}} autodetaching states resulting from collisions H{sup {minus}} with He at 1 keV are rigorously calculated by including couplings between doubly excited states and continuum states and their interference with direct detachment processes. An energy sampling procedure, based on the Gauss quadratures, is used to discretize continuum states. The present theoretical result, for the first time, clarifies mechanisms of excitation to doubly excited states, quantitatively reproduces the experimental spectra first observed by Risley and Geballe in 1974, separates the contributions from each of three autodetaching states, and identifies the cause of the interference between autodetaching and direct-detaching excitation channels.

Kimura, M. [Argonne National Lab., IL (United States); Sato, H. [Argonne National Lab., IL (United States)]|[Rice Univ., Houston, TX (United States). Dept. of Physics; Hino, K.; Matsuzawa, M. [Univ. of Electro-Communications, Chofu, Tokyo (Japan). Dept. of Applied Physics and Chemistry



Total electron scattering cross sections of ethane, propane, n-butane, 1,3-butadiene and butylene in the energy range 0.3 to 4.0 keV.  

E-Print Network (OSTI)

??The total electron scattering cross sections of Ethane, Propane, n-Butane, 1,3-Butadiene and Butylene were measured in the energy range 0.3 to 4.0 keV using linear (more)

Wickramarachchi, Priyangika.



Study of n-? discrimination in low energy range (above 40 keVee) by charge comparison method with a BC501A liquid scintillation detector  

E-Print Network (OSTI)

A VME-based experiment system for n-{\\gamma} discrimination using the charge comparison method was established. A data acquisition program for controlling the programmable modules and processing data online via VME64X bus was developed through the use of LabVIEW. The two-dimensional (2D) scatter plots of the charge in the slow component vs. the total charge of recorded pulses from Am-Be and Cf neutron sources were presented. The 2D scatter plots of the energy vs. the ratio of the charge in the slow component to the total charge of the pulses were presented at the meantime. The quality of n-{\\gamma} discrimination was checked by the figure-of-merit, and the results showed good performance of n-{\\gamma} discrimination at low energy range. Neutrons and {\\gamma}-rays were separated above 50 keVee (electron-equivalent energy). The quality of n-{\\gamma} discrimination have been improved compared with others' results at 5 energies (150, 250, 350, 450, 550 keVee).

Yonghao Chen; Ximeng Chen; Xiaodong Zhang; Jiarong Lei; Li An; Jianxiong Shao; Pu Zheng; Xinhua Wang; Chuanxin Zhu; Tie He; Jian Yang



Measurements of distributions of energy loss and additivity of energy loss for 50 to 150 keV protons in hydrogen and nine hydrogen gases  

DOE Green Energy (OSTI)

Detailed measurements of energy-loss distributions were made for 51, 102 and 153 keV protons traversing hydrogen, methane, ethyne, ethene, ethane, propyne, propadiene, propene, cyclopropane and propane. Less detailed measurements were made at 76.5 and 127.5 keV. To simplify comparison with theory, all of the measurements were made at a gas density that gave a 4% energy loss. The mean energy, second central moment (a measure of the width of the distribution) and the third central moment (a measure of the skew) were calculated from the measured distributions. Stopping power values, calculated using the mean energy, agreed with the predictions of the theory by Bethe. For the second and third central moments, the best agreement between measurement and theory was obtained when the classical scattering probability was used for the calculations; but the agreement was not good. In all cases, variations were found in the data that could be correlated to the type of carbon binding in the molecule.

Thorngate, J.H.



2-20 ns interframe time 2-frame 6.151 keV x-ray imaging on the recently upgraded Z Accelerator: A progress report  

SciTech Connect

When used for the production of an x-ray imaging backlighter source on Sandia National Laboratories' recently upgraded 26 MA Z Accelerator, the terawatt-class, multikilojoule, 526.57 nm Z-Beamlet laser (ZBL) [P. K. Rambo et al., Appl. Opt. 44, 2421 (2005)], in conjunction with the 6.151 keV (1s{sup 2}-1s2p triplet line of He-like Mn) curved-crystal imager [D. B. Sinars et al., Rev. Sci. Instrum. 75, 3672 (2004); G. R. Bennett et al., Rev. Sci. Instrum. 77, 10E322 (2006)], is capable of providing a high quality x radiograph per Z shot for inertial confinement fusion (ICF), complex hydrodynamics, and other high-energy-density physics experiments. For example, this diagnostic has recently afforded microgram-scale mass perturbation measurements on an imploding ignition-scale 1 mg ICF capsule [G. R. Bennett et al., Phys. Rev. Lett. 99, 205003 (2007)], where the perturbation was initiated by a surrogate deuterium-tritium (DT) fuel fill tube. Using an angle-time multiplexing technique, ZBL now has the capability to provide two spatially and temporally separated foci in the Z chamber, allowing 'two-frame' imaging to be performed, with an interframe time range of 2-20 ns. This multiplexing technique allows the full area of the four-pass amplifiers to be used for the two pulses, rather than split the amplifiers effectively into two rectangular sections, with one leg delayed with respect to the other, which would otherwise double the power imposed onto the various optics thereby halving the damage threshold, for the same irradiance on target. The 6.151 keV two frame technique has recently been used to image imploding wire arrays, using a 7.3 ns interframe time. The diagnostic will soon be converted to operate with p-rather than s-polarized laser light for enhanced laser absorption in the Mn foil, plus other changes (e.g., operation at the possibly brighter 6.181 keV Mn 1s{sup 2}-1s2p singlet line), to increase x-ray yields. Also, a highly sensitive inline multiframe ultrafast (1 ns gate time) digital x-ray camera is being developed [G. R. Bennett et al., Rev. Sci. Instrum. 77, 10E322 (2006)] to extend the system to 'four-frame' and markedly improve the signal-to-noise ratio. [At present, time-integrating Fuji BAS-TR2025 image plate (scanned with a Fuji BAS-5000 device) forms the time-integrated image-plane detector.].

Bennett, G. R.; Smith, I. C.; Shores, J. E.; Sinars, D. B.; Robertson, G.; Atherton, B. W.; Jones, M. C.; Porter, J. L. [Sandia National Laboratories, P.O. Box 5800, Albuquerque, New Mexico 87185-1193 (United States)



Solar wind He pickup ions as source of tens-of-keV/n neutral He atoms observed by the HSTOF/SOHO detector  

E-Print Network (OSTI)

Context. The HSTOF instrument on board SOHO satellite measures since 1996, during periods of low solar activity, weak fluxes of He atoms of 28-58 keV/n (helium energetic neutral atoms - He ENA). The probable source region is the inner heliosheath. Aims. Understand the emission mechanism of He ENA based on knowledge of heliosheath spatial extent and plasma content resulting from Voyager 1 & 2 measurements in the period posterior to termination shock crossings. Methods. He ENA are generated by charge-exchange neutralization of energetic helium ions on interstellar neutral H and He. Energy spectra of helium ions in the heliosheath are calculated by following the evolution of their velocity distribution functions when carried by, and undergoing binary interactions with, plasma constituents of a background flow whose particle populations are modeled to approximately render post-termination shock Voyager data. Results. The observed HSTOF He ENA form a higher energy part of general heliospheric He ENA fluxes and...

Grzedzielski, S; Czechowski, A; Hilchenbach, M



Characteristics of STP Pre-2004 Archived KE Basin Sludge Samples Before and After Re-Jarring in the RPL - April 2012  

SciTech Connect

This report describes results of work performed in the Shielded Analytical Laboratory (SAL) at the Pacific Northwest National Laboratorys (PNNL) Radiochemical Processing Laboratory (RPL) with archive K East (KE) Basin sludge samples obtained before the year 2004, with some of them composited and initially characterized five years ago (Delegard et al. 2011). The previously performed testing included the physical properties determinations for selected samples (settled and particle densities, water and solids concentrations), the pH, as well as identification of crystalline phases by X-ray diffractometry (XRD) for selected samples. Another objective of the previous characterization and testing campaign was to transfer some sludge composites and individual samples into new storage containers to overcome the embrittlement effect which develops in original glass containers as a result of extended exposure to high radiation fields and which increases probability of sample loss.

Sinkov, Sergey I.; Delegard, Calvin H.; Schmidt, Andrew J.; Chenault, Jeffrey W.



Bragg diffraction using a 100 ps 17.5 keV x-ray backlighter and the Bragg diffraction imager  

Science Conference Proceedings (OSTI)

A new diagnostic for measuring Bragg diffraction of petawatt-generated high-energy x rays off a laser-compressed crystal was designed and tested successfully at the Omega EP laser facility on static Mo and Ta (111) oriented single crystal samples using a 17.5 keV Mo K{alpha} backlighter. The Bragg diffraction imager consists of a heavily shielded enclosure and a precisely positioned beam block attached to the enclosure by an aluminum arm. Fuji image plates are used as the x-ray detectors. The diffraction from Mo and Ta (222) crystal planes was clearly detected with a high signal-to-noise. This technique will be applied to shock- and quasi-isentropically loaded single crystals on the Omega EP laser.

Maddox, B. R.; Park, H.-S.; Hawreliak, J.; Elsholz, A.; Van Maren, R.; Remington, B. A. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Comley, A. [AWE, Reading, Berkshire RG7 4PR (United Kingdom); Wark, J. S. [Department of Physics, Clarendon Laboratory, University of Oxford, Parks Road, Oxford, OX1 3PU (United Kingdom)



Search for 14.4-KeV Solar Axions Emitted in the M1-Transition of Fe-57 Nuclei with CAST  

SciTech Connect

We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g{sub ay}|-1.19g{sub aN}{sup 0}+g{sub aN}{sup 3}| < 1.36 x 10{sup -16} GeV{sup -1} for ma < 0.03 eV at the 95% confidence level.

Andriamonje, S.; Aune, S.; /DAPNIA, Saclay; Autiero, D.; /CERN /Lyon, IPN; Barth, K.; /CERN; Belov, A.; /Moscow, INR; Beltran, B.; /Zaragoza U. /Queen's U., Kingston; Brauninger, H.; /Garching, Max Planck Inst., MPE; Carmona, J.M.; Cebrian, S.; /Zaragoza U.; Collar, J.I.; /Chicago U., EFI /Chicago U., KICP; Dafni, T.; /DAPNIA, Saclay /Darmstadt, Tech. Hochsch. /Zaragoza U.; Davenport, M.; /CERN; Di Lella, L.; /CERN /Pisa, Scuola Normale Superiore; Eleftheriadis, C.; /Aristotle U., Thessaloniki; Englhauser, J.; /Garching, Max Planck Inst., MPE; Fanourakis, G.; /Democritos Nucl. Res. Ctr.; Ferrer-Ribas, E.; /DAPNIA, Saclay; Fischer, H.; Franz, J.; /Freiburg U.; Friedrich, P.; /Garching, Max Planck Inst., MPE; Geralis, T.; /Democritos Nucl. Res. Ctr. /DAPNIA, Saclay /Moscow, INR /Zaragoza U. /British Columbia U. /Freiburg U. /Darmstadt, Tech. Hochsch. /DAPNIA, Saclay /Zaragoza U. /Frankfurt U. /Boskovic Inst., Zagreb /Freiburg U. /Munich, Max Planck Inst. /Boskovic Inst., Zagreb /Democritos Nucl. Res. Ctr. /Darmstadt, Tech. Hochsch. /Garching, Max Planck Inst., MPE /Boskovic Inst., Zagreb /CERN /Aristotle U., Thessaloniki /Boskovic Inst., Zagreb /Munich, Max Planck Inst. /Zaragoza U. /Chicago U., EFI /Chicago U., KICP /Stanford U., Phys. Dept. /SLAC /Zaragoza U. /CERN /DAPNIA, Saclay /CERN /Munich, Max Planck Inst. /Darmstadt, Tech. Hochsch. /Zaragoza U. /Aristotle U., Thessaloniki /Patras U. /Brookhaven /CERN /Munich, Max Planck Inst. /CERN /Chicago U., EFI /Chicago U., KICP /Zaragoza U. /Freiburg U. /CERN /CERN /Patras U.



Calibration of X-ray detectors in the 8 to 115 keV energy range and their application to diagnostics on the National Ignition Facility  

Science Conference Proceedings (OSTI)

The calibration of X-ray diagnostics is of paramount importance to the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL). National Security Technologies LLC (NSTec) fills this need by providing a wide variety of calibration and diagnostic development services in support of the ongoing research efforts at NIF. The X-ray source in the High Energy X-ray lab utilizes induced fluorescence in a variety of metal foils to produce a beam of characteristic X rays ranging from 8 to 111 keV. Presented are the methods used for calibrating a High Purity Germanium detector, which has been absolutely calibrated using radioactive check sources, compared against a silicon photodiode calibrated at Physikalisch Technische Bundesanstalt (PTB). Also included is a limited presentation of results from the recent calibration of the upgraded Filter Fluorescer X ray Spectrometer.

J. J. Lee, M. J. Haugh, G. LaCaille, and P. Torres



A multilayer grating with a novel layer structure for a flat-field spectrograph attached to transmission electron microscopes in energy region of 2-4 keV  

SciTech Connect

A multilayer mirror with a novel layer structure to uniformly enhance the reflectivity in a few keV energy range at a fixed angle of incidence is invented and applied to a multilayer grating for use in a flat-field spectrograph attached to a conventional electron microscope. The diffraction efficiency of the fabricated multilayer grating having the new layer structure is evaluated at the angle of incidence of 88.65 deg. in the energy region of 2.1-4.0 keV. It is shown that the multilayer grating is effective to uniformly enhance the diffraction efficiency and able to be practically used in this energy region.

Imazono, T.; Koike, M.; Koeda, M.; Nagano, T.; Sasai, H.; Oue, Y.; Yonezawa, Z.; Kuramoto, S.; Terauchi, M.; Takahashi, H.; Handa, N.; Murano, T. [QuBS, Japan Atomic Energy Agency (JAEA), 8-1-7 Umemidai, Kizugawa, Kyoto 619-0215 (Japan); Device Dept., Shimadzu Corp., 1 Nishinokyo-Kuwabarcho, Nakagyo-ku, Kyoto 604-8511 (Japan); IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); EC Business Unit, JEOL Ltd., 3-1-2 Musashino, Akishima, Tokyo 196-8558 (Japan)



Presentation to the Control Systems Security Outreach Coordination Meeting  

E-Print Network (OSTI)

23% Oil/Gas 18% Nuclear 17% Chemical 6% Water 6% Manufacturing 2% Transportation/Shipping 2% Natural Switzerland (.ch) 11 Ghana (.gh) 12 Pakistan (.pk) Rank Who? 1 Various ISPs 2 British-energy.com 3 Shell.com 4



Gasoline and Diesel Fuel Update (EIA)

60. Electric Power Projections for EMM Region (1 of 3) 60. Electric Power Projections for EMM Region (1 of 3) 01 - East Central Area Reliability Coordination Agreement 1998- 1998 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2020 Electricity Generating Capacity 1/ (gigawatts) Coal Steam 83.61 83.61 83.61 83.61 82.87 82.06 81.50 81.28 80.39 79.87 79.87 79.87 79.87 79.87 79.87 79.87 79.87 79.87 79.87 79.87 79.87 79.87 -0.2% Other Fossil Steam 2/ 3.56 3.56 3.70 3.70 3.70 3.70 3.70 3.70 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 3.53 0.0% Combined Cycle 0.34 0.34 1.39 1.39 1.39 1.39 1.39 1.39 1.53 1.53 2.67 3.42 3.80 4.16 4.37 4.64 5.10 5.86 6.91 7.90 9.42 10.22 16.8% Combustion Turbine/Diesel 9.05 9.63 10.11 11.87 14.09 14.44 17.63 18.24 20.89 23.04 25.09 25.83 27.75 27.96 28.63 29.05 29.56 30.80 32.38 34.33


(!)"0 12#)1"043)57698@ 0A BC15A 3 DFE"GH0 1BCG93)5PI4QQ@ AR 3"0A S)GT'(!6UDFIWVXXX Ya`Fb"cd ecfhgi p qrsaqttt7uvwyxvws aFa  

E-Print Network (OSTI)

DFE"GH0 1BCG93¢)§5PI4Q¢Q¢@ AR ¦3"0A S)§G¦T'(!6UDFIWV§X¢X¢X Ya`Fb"cd e§c¢fhg§i p q¢r§saq§t¢t¢t7u¦v§wyx§¢v§w¦s aFa¢§¢ § 1 DYNAMIC PARTIAL PREFETCH RANKING IN HYPERMEDIA NEIGHBORHOOD JAVED I. KHAN Media ¢¡ £¢¤¦¥§¥§¨© §£¢§¥ !" ¥¢¡#§$"© £§$¢%§&'£§ ¥¢¡ ¥¢§¤¦¥ £ (!)"0 1¢2#)§1"043¢)§57698¢@ 0A BC1§5A 3

Khan, Javed I.


Bragg diffraction using a 100ps 17.5 keV x-ray backlighter and the Bragg Diffraction Imager  

Science Conference Proceedings (OSTI)

A new diagnostic for measuring Bragg diffraction from a laser-driven crystal using a 100ps 17.5 kV x-ray backlighter source is designed and tested successfully at the Omega EP laser facility on static Mo and Ta single crystal samples using a Mo Ka backlighter. The Bragg Diffraction Imager (BDI) consists of a heavily shielded enclosure and a precisely positioned beam block, attached to the main enclosure by an Aluminum arm. Image plate is used as the x-ray detector. The diffraction lines from Mo and Ta planes are clearly detected with a high signal-to-noise using the 17.5 keV and 19.6 keV characteristic lines generated by a petawatt-driven Mo foil. This technique will be applied to shock and ramp-loaded single crystals on the Omega EP laser. Pulsed x-ray diffraction of shock- and ramp-compressed materials is an exciting new technique that can give insight into the dynamic behavior of materials at ultra-high pressure not achievable by any other means to date. X-ray diffraction can be used to determine not only the phase and compression of the lattice at high pressure, but by probing the lattice compression on a timescale equal to the 3D relaxation time of the material, information about dislocation mechanics, including dislocation multiplication rate and velocity, can also be derived. Both Bragg, or reflection, and Laue, or transmission, diffraction have been developed for shock-loaded low-Z crystalline structures such as Cu, Fe, and Si using nano-second scale low-energy implosion and He-{alpha} x-ray backlighters. However, higher-Z materials require higher x-ray probe energies to penetrate the samples, such as in Laue, or probe deep enough into the target, as in the case of Bragg diffraction. Petawatt laser-generated K{alpha} x-ray backlighters have been developed for use in high-energy radiography of dense targets and other HED applications requiring picosecond-scale burst of hard x-rays. While short pulse lasers are very efficient at producing high-energy x-rays, the characteristic x-rays produced in these thin foil targets are superimposed on a broad bremsstrahlung background and can easily saturate a detector if careful diagnostic shielding and experimental geometry are not implemented. A new diagnostic has been designed to measure Bragg diffraction from laser-driven crystal targets using characteristic x-rays from a short-pulse laser backlighter on the Omega EP laser. The Bragg Diffraction Imager, or BDI, is a TIM-mounted instrument consisting of a heavily shielded enclosure made from 3/8-inch thick Heavymet (W-Fe-Ni alloy) and a precisely positioned beam bock, attached to the main enclosure by an Aluminum arm. The beam block is made of 1-inch thick, Al-coated Heavymet and serves to block the x-rays directly from the petawatt backlight, while allowing the diffraction x-rays from the crystal to pass to the enclosure. A schematic of the BDI is shown in Fig. 1a. Image plates are used as the x-ray detector and are loaded through the top of the diagnostic in an Aluminum, light-tight cartridge. The front of the enclosure can be fitted with various filters to maximize the diffraction signal-to-noise.

Maddox, B R; Park, H; Hawreliak, J; Comley, A; Elsholz, A; Van Maren, R; Remington, B A; Wark, J



Discovery of Water Maser Emission in Five AGN and a Possible Correlation Between Water Maser and Nuclear 2-10 keV Luminosities  

E-Print Network (OSTI)

We report the discovery of water maser emission in five active galactic nuclei (AGN) with the 100-m Green Bank Telescope (GBT). The positions of the newly discovered masers, measured with the VLA, are consistent with the optical positions of the host nuclei to within 1 sigma (0.3 arcsec radio and 1.3 arcsec optical) and most likely mark the locations of the embedded central engines. The spectra of three sources, 2MASX J08362280+3327383, NGC 6264, and UGC 09618 NED02, display the characteristic spectral signature of emission from an edge-on accretion disk with maximum orbital velocity of ~700, ~800, and ~1300 km s^-1, respectively. We also present a GBT spectrum of a previously known source MRK 0034 and interpret the narrow Doppler components reported here as indirect evidence that the emission originates in an edge-on accretion disk with orbital velocity of ~500 km s^-1. We obtained a detection rate of 12 percent (5 out of 41) among Seyfert 2 and LINER systems with 10000 km s^-1 water masers with available hard X-ray data, we report a possible relationship between unabsorbed X-ray luminosity (2-10 keV) and total isotropic water maser luminosity, L_{2-10} proportional to L_{H2O}^{0.5+-0.1}, consistent with the model proposed by Neufeld and Maloney in which X-ray irradiation and heating of molecular accretion disk gas by the central engine excites the maser emission.

Paul T. Kondratko; Lincoln J. Greenhill; James M. Moran



Cross calibration of AGFA-D7 x-ray film against direct exposure film from 2 to 8.5 keV using laser generated x-rays  

SciTech Connect

Direct exposure film (DEF) is being discontinued. DEF film has been the workhorse in inertial confinement fusion (ICF) research and is used to record x-ray images and spectra. A previous search for a replacement [K. M. Chandler et al., Rev. Sci. Instrum. 76, 113111 (2005)] did not consider AGFA film. We present comparisons using the results of measurements using AGFA-D7 film, XAR, TMG, and Biomax-MS films in the same spectrometer recording a gold spectrum in the 2-4 keV range and the iron spectrum in the 5-8.5 keV range. AGFA film was found to have some unique properties useful in x-ray spectroscopy and imaging, especially when signal strength is not a concern.

Kyrala, George A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)



Tables and graphs of photon-interaction cross sections from 0. 1 keV to 100 MeV derived from the LLL Evaluated-Nuclear-Data Library  

SciTech Connect

Energy-dependent evaluated photon interaction cross sections and related parameters are presented for elements H through Cf (Z = 1 to 98). Data are given over the energy range from 0.1 keV to 100 MeV. The related parameters include form factors and average energy deposits per collision (with and without fluorescence). Fluorescence information is given for all atomic shells that can emit a photon with a kinetic energy of 0.1 keV or more. In addition, the following macroscopic properties are given: total mean free path and energy deposit per centimeter. This information is derived from the Livermore Evaluated-Nuclear-Data Library (ENDL) as of October 1978

Plechaty, E.F.; Cullen, D.E.; Howerton, R.J.



High-brightness, high-spatial-resolution, 6.151 keV x-ray imaging of inertial confinement fusion capsule implosion and complex hydrodynamics experiments on Sandia's Z accelerator (invited)  

SciTech Connect

When used for the production of an x-ray imaging backlighter source on Sandia National Laboratories' 20 MA, 100 ns rise-time Z accelerator [M. K. Matzen et al., Phys. Plasmas 12, 055503 (2005)], the terawatt-class, multikilojoule, 526.57 nm Z-Beamlet laser (ZBL) [P. K. Rambo et al., Appl. Opt. 44, 2421 (2005)], in conjunction with the 6.151 keV, Mn-He{sub {alpha}} curved-crystal imager [D. B. Sinars et al., Rev. Sci. Instrum. 75, 3672 (2004)], is capable of providing a high quality x radiograph per Z shot for various high-energy-density physics experiments. Enhancements to this imaging system during 2005 have led to the capture of inertial confinement fusion capsule implosion and complex hydrodynamics images of significantly higher quality. The three main improvements, all leading effectively to enhanced image plane brightness, were bringing the source inside the Rowland circle to approximately double the collection solid angle, replacing direct exposure film with Fuji BAS-TR2025 image plate (read with a Fuji BAS-5000 scanner), and generating a 0.3-0.6 ns, {approx}200 J prepulse 2 ns before the 1.0 ns, {approx}1 kJ main pulse to more than double the 6.151 keV flux produced compared with a single 1 kJ pulse. It appears that the 20{+-}5 {mu}m imaging resolution is limited by the 25 {mu}m scanning resolution of the BAS-5000 unit, and to this end, a higher resolution scanner will replace it. ZBL is presently undergoing modifications to provide two temporally separated images ('two-frame') per Z shot for this system before the accelerator closes down in summer 2006 for the Z-refurbished (ZR) upgrade. In 2008, after ZR, it is anticipated that the high-energy petawatt (HEPW) addition to ZBL will be completed, possibly allowing high-energy 11.2224 and 15.7751 keV K{alpha}{sub 1} curved-crystal imaging to be performed. With an ongoing several-year project to develop a highly sensitive multiframe ultrafast digital x-ray camera (MUDXC), it is expected that two-frame HEPW 11 and 16 keV imaging and four-frame ZBL 6.151 keV curved-crystal imaging will be possible. MUDXC will be based on the technology of highly cooled silicon and germanium photodiode arrays and ultrafast, radiation-hardened integrated circuitry.

Bennett, G. R.; Sinars, D. B.; Wenger, D. F.; Cuneo, M. E.; Adams, R. G.; Barnard, W. J.; Beutler, D. E.; Burr, R. A.; Campbell, D. V.; Claus, L. D.; Foresi, J. S.; Johnson, D. W.; Keller, K. L.; Lackey, C.; Leifeste, G. T.; McPherson, L. A.; Mulville, T. D.; Neely, K. A.; Rambo, P. K.; Rovang, D. C. [Sandia National Laboratories, P.O. Box 5800, Albuquerque, New Mexico 87185-1106 (United States)] (and others)


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Efficient and Renewable Energy Programs in Ghana  

NLE Websites -- All DOE Office Websites (Extended Search)

These collaborative projects complement the Institute's own efforts in the areas of biogas, biodiesel, and small-scale wind power demonstration. In the next year, we plan on...


Integrated: Geospatial Toolkit for Ghana from NREL  

Open Energy Info (EERE)

and easy to use geographic toolkit that allows non-GIS users to relate the renewable energy resource (solar and wind) data to other geographic data, such as land use, protected...


Evaluation of Money Laundering Regulations in Ghana.  

E-Print Network (OSTI)

??Purpose: The purpose of this thesis is to identify and appraise within the Ghanaian environment the level of regulations in combat of money laundering and (more)

Tontoh, Francis



Export.gov - Ghana - Trade Leads  

NLE Websites -- All DOE Office Websites (Extended Search)

operations and in commercialresidential property development. Price and financing terms are key considerations for buyers due to the low accesshigh cost of local credit....


Siphon filter assessment for Northern Ghana  

E-Print Network (OSTI)

The siphon filter is a household water filter developed by the Basic Water Needs Foundation based on the design of ceramic candle filters. The siphon filter is marketed under brand names CrystalPur and Tulip and is sold ...

Ziff, Sara Elizabeth



Microsoft Word - GhanaFridgeEff20060227.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

concerning the generation and sale of energy are known. These include: Current prices for electricity paid by residential consumers (according to prevailing tariff structures);...


Beyond Elmina: The Slave Trade in Northern Ghana  

E-Print Network (OSTI)

prefcrs to embed it as they havc? AGAMBA References Agmnba,those of Nalerigu and Ulo havc been rcduccd to stumps oflibation at the slavc grounds havc slave ancestry or not.

Agamba, Joachim Jack



Prefabricated housing, a solution for Ghana's housing shortage  

E-Print Network (OSTI)

Sub-Saharan Africa has been experiencing phenomenal population growth since the beginning of the 20th Century, following several centuries of population stagnation attributable to the slave trade and colonization. The ...

Essienyi, Evans K. (Evans Kofi)



Forecasting the Demand of Woodfuels in Ghana - The Process Analysis...  

NLE Websites -- All DOE Office Websites (Extended Search)

conducted to cover various categories of households to determine their basic energy demand for cooking, which is used to make more reliable projections in the future demand of...


Ghana - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

What is shale gas and why is it important? ... OPEC Revenues Fact Sheet; World Oil Transit Chokepoints; Country Analysis Note. After discovering the Jubilee oil field ...


Ghana-REEEP Energy Activities | Open Energy Information  

Open Energy Info (EERE)

REEEP Energy Activities AgencyCompany Organization Renewable Energy and Energy Efficiency Partnership Sector Energy Focus Area Energy Efficiency, Renewable Energy Topics...


Agricultural Progress in Cameroon, Mali and Ghana: Why it Happened...  

Open Energy Info (EERE)

both domestically and internationally. Analysis of agricultural performance focused on trends in output, factor use, and productivity. Analysis of agricultural policy featured...


Ghana-DLR Resource Assessments | Open Energy Information  

Open Energy Info (EERE)

Energy, Solar Topics Resource assessment, Background analysis Resource Type Dataset, Maps, Softwaremodeling tools Website http:www.dlr.dettdesktopde Program Start 2001...


The Ghana Refrigerator Efficiency Initiative - An Overview of...  

NLE Websites -- All DOE Office Websites (Extended Search)

refrigeration services the most expensive of energy services in residential Ghanaian households, posing serious financial burden on households. --The problem that this project...


Integrated: Geospatial Toolkit GIS data for Ghana from NREL ...  

Open Energy Info (EERE)

that can be used for decision making and policy analysis in addition to planning for future energy projects. The SWERA application utilizes Geographical Information Systems...


Forecasting and Policy Analysis of Woodfuels Use in Ghana  

NLE Websites -- All DOE Office Websites (Extended Search)

fuels and electricity), it has not been possible to compile historical data on consumption of woodfuels, and no reliable forecasting technique exists to enhance a...


Ghana - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy Information Administration ... nuclear reactors, ... and distributing petroleum revenue and mandates a certain percentage to help fund the national budget.


Ghana - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

US EIA provides data, forecasts, country analysis brief and other analyses, focusing on the energy industry including oil, natural gas and electricity.



E-Print Network (OSTI)

heat load and the heat capacity of the grids determine thepulse. To measure the heat load to the grids we fabricated lines; the average heat load to each grid could thus be

Berkner, K.H.



Microsoft PowerPoint - KE EIA21.ppt  

U.S. Energy Information Administration (EIA) Indexed Site

Copyright: Copyright: SIPC LNG: Demand opportunities and supply challenges Kathleen Eisbrenner Executive Vice-President, Global LNG Shell Gas & Power EIA 2008 Energy Conference Washington D.C., 7 th April 2008 The energy challenge * Population growth * Economic growth * More affluent society * End of 'easy oil' * Resource nationalism * More unconventionals * Hydrocarbons remain dominant * CO2 consequences 1. RISING DEMAND 2. SECURITY OF SUPPLY 3. ENVIRONMENT & SOCIETY Major economies are climbing the energy ladder The growing role of LNG 0 1000 2000 3000 4000 2000 2006 2010 2020 TCF Indigenous & Pipeline Imports LNG % increase over 2000 344% 53% Sources: BP Statistical Review 2007, CERA 2006, EIA 2006 Global market developments Shell analysis TODAY 2012 29 2012 LNG importers # Countries 70.6% 17

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Reading contamination : an environmental education center at the Wells G&H Superfund Site  

E-Print Network (OSTI)

This thesis proposes and architectural and programmatic methodology which makes legible the processes and consequences of site contamination. This methodology is chiefly demonstrated through a plan for the site which emerges ...

Berry, Rebecca Lynn, 1973-



Using synthetic biology to screen for functional diversity of GH1 enzymes  

DOE Green Energy (OSTI)

Advances in next-generation sequencing technologies have enabled single genomes as well as complex environmental samples (metagenomes) to be comprehensively sequenced on a routine basis. Bioinformatics analysis of the resulting sequencing data reveals a continually expanding catalogue of predicted proteins ( 14 million as of April 2011), 75 percent of which are associated with functional annotation (COG, Pfam, Enzyme, Kegg, etc). These predicted proteins cover the full spectrum of known pathways and functional activities, including many novel biocatalysts that are expected to significantly contribute to the development of clean technologies including biomass degradation, lipid transformation for biodiesel generation, intermediates for polymer production, carbon capture, and bioremediation.

Deutsch, Sam; Datta, Supratim; Hamilton, Matthew; Friedland, Greg; D'Haeseleer, Patrik; Chen, Jan-Fang; Chivian, Dylan; Egan, Rob; Sale, Kenneth; Simmons, Blake; Rubin, Eddy



bersicht ber die Durchfhrung der Fachpraktika Master Gym Bachelor BEU / Master GH / R  

E-Print Network (OSTI)

) WiSe od. SoSe 2) WiSe 1) 4) WiSe od. SoSe 2) Chemie SoSe SoSe 5) ______ SoSe 5) _____ _____ _____ _____ Deutsch WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. So

Kallenrode, May-Britt


ATLAS I: A Singlechip ATM switch for NOWs Manolis G.H. Katevenis Panagiota Vatsolaki  

E-Print Network (OSTI)

; these are handled in either of two ways. Some networks allow packets/cells to be dropped, and use end latency, and and (ii) they drop cells when (even short­term) congestion happens. In this paper, we present­ pressure (credit­based) flow control which never drops ATM cells. The architecture of ATLAS I has been

Markatos, Evangelos P.


The Bui Dam impact on Ghana-China relations : transparency, accountability and development outcomes from China's Sino Hydro Dam Project in Ghana  

E-Print Network (OSTI)

The current Afro-Chinese relations on development projects in Sub Saharan Africa has come under a lot of scrutiny, with some experts in the South-to-South relationship discourse claiming the above short-gun-marriage will ...

Habia, James K



ATLAS I: A Single-chip ATM switch for NOWs Manolis G.H. Katevenis Panagiota Vatsolaki  

E-Print Network (OSTI)

ows these are handled in either of two ways. Some networks allow packets/cells to be dropped, and use latency, and and (ii) they drop cells when (even short-term) congestion happens. In this paper, we present- pressure (credit-based) ow control which never drops ATM cells. The architecture of ATLAS I has been fully

Markatos, Evangelos P.


Research in Ghanaian public universities : perceptions and experiences of academic staff at the University of Ghana.  

E-Print Network (OSTI)

??With the advent of the knowledge economies, research is recognised as a catalyst for accelerated national growth. Many countries are therefore investing hugely in university (more)

Gyan, George



A Strategic Overview of the Forest Sector in Ghana Odoom Domson  

E-Print Network (OSTI)

geothermal, 52 hydroelectric, 3 photovoltaic and 4 wind power plants, making up 408 MW out of Alaska's 2. ACKNOWLEDGMENTS This research was funded by the U.S. Department of Energy's Wind Powering America Program://www.eere.energy.gov/windpoweringameri ca/pdfs/workshops/2002_wind_diesel/alaska.pdf Renewable Energy Research Laboratory (NREL), Renewables


Monitoring effective use of household water treatment and safe storage technologies in Ethiopia and Ghana  

E-Print Network (OSTI)

Household water treatment and storage (HWTS) technologies dissemination is beginning to scale-up to reach the almost 900 million people without access to an improved water supply (WHO/UNICEF/JMP, 2008). Without well-informed ...

Stevenson, Matthew M



Efficacy of gravity-fed chlorination system for community-scale water disinfection in northern Ghana  

E-Print Network (OSTI)

Although chlorine is one of the lowest cost ways of providing disinfection, currently billions of people lack drinking water that has had this simple treatment. Arch Chemical's Pulsar 1 unit is an innovation in chlorine ...

Fitzpatrick, Daniel Cash



Ghana Community Information Centers (CiCs) e-Governance Success or Mirage?  

Science Conference Proceedings (OSTI)

Following the initial implementation of Information and Communication Technologies for development (ICT4D) projects in rural Africa, many did not yield the anticipated outcomes, and interest has been waning. People then began talking about "sustainable ...

Johanna Ekua Awowi



Refrigerator Efficiency in Ghana: Tailoring an appliance market transformation program design for Africa  

E-Print Network (OSTI)

A Guidebood for Appliances, Equipment, and Lighting, 2ndCollaborative Labeling and Appliance Standards Program (the Potential Impact of Appliance Performance Standards in

Ben Hagan, Essel; Van Buskirk, Robert; Ofosu-Ahenkorah, Alfred; McNeil, Michael A.



SPONSORED PROJECTS 1. Pending: "Feasibility Studies and Training to Support Landfill Gas Recovery in Ghana"  

E-Print Network (OSTI)

SPONSORED PROJECTS 1. Pending: "Feasibility Studies and Training to Support Landfill Gas Recovery: PI. 4. "An Improved Model to Predict Gas Generation from Landfills based on Waste Composition-2015, Role: Co-PI. 3. "Field Measurement of Emissions from Natural Gas Drilling, Production, and Distribution

Texas at Arlington, University of


Developing effective chronic disease interventions in Africa: insights from Ghana and Cameroon  

E-Print Network (OSTI)

.8 61.3 11 18 Physical Activity (insufficient in last 7 days) 7.8 13.2 - - Fruit and Vegetable Intake (insufficient intake) 39.6 38.2 - - Overweight prevalence (women) - 17.2 - 20.6 Obesity prevalence (women) 8.1 8.2 Sources: *IDF, 2003, cited by Mbanya... ) the majority of programme recipients remembered key aspects of the nutrition and healthy lifestyles messages; (2) the easiest lifestyles to adopt were drinking more water and eating more fruits and vegetables, a challeng- ing lifestyle was increasing physical...

de-Graft Aikins, Ama; Boynton, Petra; Atanga, Lem L



Effects of computer-assisted instruction on performance of senior high school biology students in Ghana  

Science Conference Proceedings (OSTI)

This study investigated the comparative efficiency of computer-assisted instruction (CAI) and conventional teaching method in biology on senior high school students. A science class was selected in each of two randomly selected schools. The pretest-posttest ... Keywords: Achievement, Cell cycle, Computer-assisted instruction, Conventional approach, ICT and senior high school

K. A. Owusu; K. A. Monney; J. Y. Appiah; E. M. Wilmot



Refrigerator Efficiency in Ghana: Tailoring an appliance market transformation program design for Africa  

E-Print Network (OSTI)

energy policy formulation and change within relevant governmentenergy policy formulation and change within relevant government

Ben Hagan, Essel; Van Buskirk, Robert; Ofosu-Ahenkorah, Alfred; McNeil, Michael A.



Refrigerator Efficiency in Ghana: Tailoring an appliance market transformation program design for Africa  

E-Print Network (OSTI)

U.S. household electricity consumption of 10,656 kWh/year/electricity consumption of slightly less than 1000 kWh/year/year. Furthermore we used a sample distribution of monthly household electricity consumption

Ben Hagan, Essel; Van Buskirk, Robert; Ofosu-Ahenkorah, Alfred; McNeil, Michael A.



Barriers facing disables in getting jobs in Ghana : quality of life situation.  

E-Print Network (OSTI)

??Abstract Discrimination against persons with disabilities the world over in the realm of employment has been a real problem especially in developing countries such as (more)

Ntibea, Juliana



Evaluation of Drug Management of Essential Hypertension in the University of Cape Coast Hospital, Ghana.  

E-Print Network (OSTI)

??Hypertension and hypertension-related admissions, complications and death showed an increasing incidence and increasing rate respectively between 2004 and 2006 in the University of Cape Coast (more)

Kizzie-Hayford Arimathea, Joseph



An analysis of the performance of Ghanaian canned tuna export to EU market (1999-2009) .  

E-Print Network (OSTI)

??The tuna fishery is an important sector in Ghana. In 2009, total landing of tuna in Ghana represented about 24% of total catches in the (more)

Mensah, Isaac


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Essel Ben Hagan  

NLE Websites -- All DOE Office Websites (Extended Search)

of proven industrial technologies to support Ghana's industrial sector, particularly small and medium-scale enterprises. Dr. Hagan is also the President of Ghana Institution...


KeV Ion Beam Induced Surface Modification of SiC Hydrogen Sensor  

DOE Green Energy (OSTI)

Silicon carbide, a wide-bandgap semiconductor, is currently used to fabricate an efficient high temperature hydrogen sensor. When a palladium coating is applied on the exposed surface of silicon carbide, the chemical reaction between palladium and hydrogen produces a detectable change in the surface chemical potential. Rather than applying a palladium film, we have implanted palladium ions into the silicon face of 6H, n-type Sic samples. The implantation energies and fluences, as well as the results obtained by monitoring the current through the sample in the presence of hydrogen are included in this paper.

Muntele, C.I.; Ila, D.; Williams, E.K.; Poker, D.B.; Hensley, D.K.



A survey of energy loss calculations for heavy ions between 1 and 100 keV  

E-Print Network (OSTI)

The original Lindhard-Scharff-Schitt (LSS) theory and the more recent Tilinin theory for calculating the nuclear and electronic stopping powers of slow heavy ions are compared with predictions from the SRIM code by Ziegler. While little discrepancies are present for the nuclear contribution to the energy loss, large differences are found in the electronic one. When full ion recoil cascade simulations are tested against the elastic neutron scattering data available in the literature, it can be concluded that the LSS theory is the more accurate.

J. Pinto Da Cunha A; P. Sona D



SPiKE: engineering malware analysis tools using unobtrusive binary-instrumentation  

Science Conference Proceedings (OSTI)

Malware -- a generic term that encompasses viruses, trojans, spywares and other intrusive code -- is widespread today. Malware analysis is a multi-step process providing insight into malware structure and functionality, facilitating the development of ... Keywords: instrumentation, malware, security

Amit Vasudevan; Ramesh Yerraballi



Supernova explosions, 511 keV photons, gamma ray bursts and mirror matter  

E-Print Network (OSTI)

There are three astroparticle physics puzzles which fire the imagination: the origin of the ``Great Positron Producer'' in the galactic bulge, the nature of the gamma-ray bursts central engine and the mechanism of supernova explosions. We show that the mirror matter model has the potential to solve all three of these puzzles in one beautifully simple strike.

R. Foot; Z. K. Silagadze



Application of the ``Ke'' model to open channel flows in a magnetic field  

E-Print Network (OSTI)

.C. Wilcox, in: Turbulence Modeling for CFD, second ed., DCW Industries, 1998, p. 540. [14] O. Widlund, S

Abdou, Mohamed


Measurements of scattering processes in negative ion-atom collisions. [3 to 50 keV  

DOE Green Energy (OSTI)

This Technical Progress Report describes the progress made on the research objectives during the past twelve months. This research project is designed to provide measurements of various scattering processes which occur in H[sup [minus

Kvale, T.J.




Science Conference Proceedings (OSTI)

... Brazil Chile Egypt Ghana Jordan Malawi Mexico Phillipines Thailand Tunisia UWWY Zambia ... inventory), Turkey Thailand, ...



)1024365')7 85'9) #&(@"A&B )DC'56B4E56"FB G(H) CI95PQ)  

E-Print Network (OSTI)

byexaminationalone.For admis- ADMISSION, REGISTRATIONANDENROLLMENTI slon of nonresident applicants by this method

Paris-Sud XI, Université de


Scale-Dependent Relationships between Land-Use Change and Its Determinants in the Volta Basin of Ghana  

Science Conference Proceedings (OSTI)

Relationships between cropland change and presumed determinants were analyzed at scales ranging from 30 to 5100 m using logistic regression. The plot of the odds ratio across the spatial scales indicated that both biophysical and social variables ...

Ademola K. Braimoh; Paul L. G. Vlek



The effects of an intermittent piped water network and storage practices on household water quality in Tamale, Ghana  

E-Print Network (OSTI)

The United Nations Millennium Development Goals include a target to halve the number of people without access to "improved" water sources, which include piped water supply. However, an "improved" source of water does not ...

Vacs Renwick, Deborah Alexandra



Evaluating the technical performance and social acceptability of keg-shaped ceramic water filters in Northern Ghana  

E-Print Network (OSTI)

The Kosim Water Keg (KWK) is a new ceramic water filter designed have faster filtration rates and integrate better with consumers' water habits. The design seals together two ceramic pot filters (CPFs) to form a keg shape. ...

Cummings, Joanna (Joanna Katherine)



Market organisation and the process of economic development: the case of the partially liberalised cocoa market in Ghana.  

E-Print Network (OSTI)

??Within the last twenty years the link between market organisation and development has come under increased scrutiny in response to the implementation of World Bank (more)

Granleese, Michael



Measurements of relativistic effects in collective Thomson scattering at electron temperatures less than 1 keV  

E-Print Network (OSTI)

Thomson scattering on the NIF . . 7.1.2 Electron featureon reduced-scale targets at the nif and omega lasers, Janparameter. . . . . . . Figure 1.2: A NIF Au hohlraum target

Ross, James Steven



Production test IP-466-A test of the 190 turbine pumps at KE(KW) Rector (Project CGI-844)  

SciTech Connect

The purpose of this test is to provide for adequate testing of the new steam turbine pumps. This will cover the tests required for the acceptance of these new items as per ATP-2588 and for any additional testing required to ensure reactor emergency cooling adequacy and reliability. A further objective is to provide the safety requiring by which the objectives of the ATP-2588 may be accomplished. A steam pump is being installed in each of the 190-K buildings to provide an additional secondary supply of reactor coolant. The basis for this test is presented in ATP-2588. Briefly, it is to authorize the required reactor down time and to assure reactor safety in the performance of the required testing procedures. These tests will develop the necessary and pertinent information concerning the cooling adequacy of this new system. At the same time, information will be obtained concerning the in situ characteristics of the steam turbine pump and the flow to the reactor when one side of the process lines is closed.

Jones, S.S.




E-Print Network (OSTI)

and Reactor Start-up", 4th Inter national Conference on Plasma Physics and Controlled Nuclear Fusion

Savas, S.E.



The Implications of a Gasoline Price Floor for the California Budget and Greenhouse Gas Emissions  

E-Print Network (OSTI)

Gas Daily Quantity Daily GhG Emissions Oil Price Price elasGas Daily Quantity Daily GhG Emissions Oil Price Price elasDaily Quantity Daily GhG Emissions Surcharge Revenues Oil

Borenstein, Severin



New Cellulase Identification Method Holds Promise for Lower-Cost...  

NLE Websites -- All DOE Office Websites (Extended Search)

within the protein family GH48, a key component for degrading lignocellulose for biofuels. Cellulase enzymes, particularly from the glycoside hydrolase family 48 (GH48), are a...


Measuring clay property variation and effects on ceramic pot filter performance  

E-Print Network (OSTI)

Pure Home Water (PHW) is a non-profit organization in Ghana whose mission is to provide safe drinking water to Ghana's Northern Region - the poorest part of the country. Originally a distributor of ceramic pot filters ...

Hester, Joshua (Joshua C.)



Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

Wind: wind power density maps at 50m above ground and 1km resolution for Ghana from NREL

(Abstract):Raster GIS data, 50 m wind power density for Ghana.


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Table of Contents Health Sciences Information .......................................................................................... 3  

E-Print Network (OSTI)

for the Humanities and Sciences. 2006. DVD. 61 min. Former President of Ghana, Jerry Rawlings, and Kenyan law student

Mohaghegh, Shahab



E-Print Network (OSTI)

Production and Utilization, a Cowpea Stakeholders Workshop was organized at the M Plaza Hotel in Accra Ghana IN AFRICA Report of Cowpea Stakeholders Workshop on February 10 ­ 12, 2004 M Plaza Hotel, Accra, Ghana AAA Workshop, M Plaza Hotel , Accra Ghana. February 10 ­ 12, 2004 #12;3 Contents List of Abbreviations

Ginzel, Matthew


Challenges, uncertainties and issues facing gas production from gas hydrate deposits  

E-Print Network (OSTI)

shales, silts, and non-commercial sand stringers above the target GH reservoirs. High gas production

Moridis, G.J.



Household ceramic water filter evaluation using three simple low-cost methods : membrane filtration, 3M Petrifilm and hydrogen sulfide bacteria in northern region, Ghana  

E-Print Network (OSTI)

Drinking water continues to be a major source of waterborne diseases and death in the world because many points of water collection remain unsafe. This thesis reports high level of fecal contamination found in rivers and ...

Mattelet, Claire (Claire Eliane H. Y.)



High density polyethylene (HDPE) containers as an alternative to polyethylene terephthalate (PET) bottles for solar disinfection of drinking water in northern region, Ghana  

E-Print Network (OSTI)

The purpose of this study is to investigate the technical feasibility of high density polyethylene (HDPE) containers as an alternative to polyethylene terephthalate (PET) bottles for the solar disinfection of drinking water ...

Yazdani, Iman



ORGANIZERS n Brandeis University n African Foundation for International Law n Faculty of Law of the University of Ghana n West African Research Center  

E-Print Network (OSTI)

interest" clause in the Nuclear Non- Proliferation Treaty (NPT) to withdraw from the treaty, expel IAEA of proliferation: The more places in which this work is done, the harder it is to monitor. Weapons have been, and the technology seems to be not that hard to master or acquire. BURTON RICHTER Reducing Proliferation Risk

Fraden, Seth


Nanocrystalline Silicon Thin Film Transistors on Optically Clear Polymer Foil Substrates Alex Kattamis, I-Chun Cheng, Ke Long, James C. Sturm, Sigurd Wagner  

E-Print Network (OSTI)

with bottom-emitting organic light emitting diodes, such devices will allow for a 10x reduction in pixel TFT light emitting diode (AMOLED) displays. There is growing interest in AMOLED displays because active



E-Print Network (OSTI)

M. Bacal for bringing the heat-pipe target concept to ourthat target length in a heat pipe can change with changing

Schlachter, A.S.




E-Print Network (OSTI)

of the S-matrix theory of nuclear reactions. A parametric expression is obtained. A 3/2- level is located-matrix theory [11

Paris-Sud XI, Université de


Direct Marketing When There Are Voluntary Buyers Yi-Ting Lai and Ke Wang Daymond Ling, Hua Shi, and Jason Zhang  

E-Print Network (OSTI)

. Each customer record is associated with a number of individual characteristics (e.g. age, income be the set of decided customers in S, and U be the set of undecided customers in S. |X| denote the number campaigns, M1 and M2, each contact the same number of customers. We illustrate this in Figures 1 and 2

Wang, Ke


Development and Fabrication of New Accelerator Grid Modules for Ion Sources in the 80 keV Neutral Beam Lines for DIII-D (A25176)  

E-Print Network (OSTI)

Proc. Of 21st IEEE/NPSS Symposium On Fusion Engineering 2005, Knoxville, Tennessee, 2005, To Be Published21st IEEE/NPSS Symposium on Fusion Engineering Knoxville Tennessee, US, 2005999611065

Grunloh, H.J.



Development and Fabrication of New Accelerator Grid Modules for Ion Sources in the 80 keV Neutral Beam Lines for DIII-D (A25176)  

E-Print Network (OSTI)

Proc. Of 21st IEEE/NPSS Symposium On Fusion Engineering 2005, Knoxville, Tennessee, 2005, To Be Published21st IEEE/NPSS Symposium on Fusion Engineering Knoxville Tennessee, US, 2005999611070

Grunloh, H.J.



Browse wiki | Open Energy Information  

Open Energy Info (EERE)

Browse wiki Jump to: navigation, search Kumasi Institute of Technology and Environment (KITE) Address P. O. Box AT 720, Achimota, Accra, Ghana. + Coordinates 5.555717,...


Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Peru; Aug 2013; Bolivia; Aug 2013; Italy; Aug 2013; Romania; Aug 2013; Ghana; Aug 2013; See Today in Energy articles on international topics. Who are the major ...



E-Print Network (OSTI)

??This study uses the National Survey of Adolescents in Ghana (2004) to examine the relationship between media exposure modality and frequency and condom use at (more)

Acosta, Paola



Energy Research Centre of the Netherlands (ECN) | Open Energy...  

Open Energy Info (EERE)

a Range of Supported Mitigation Activities in Selected Countries to the Next Level Carbon Capture and Storage in Southern Africa ECN-Supporting low carbon growth in Ghana...


Global Nuclear Energy Partnership Inaugural Steering Group Meeting...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ghana, Hungary, Italy, Japan, Jordan, Kazakhstan, Lithuania, Poland, Republic of Korea, Romania, Russia, Slovenia and Ukraine and three international organizations as...


Program Program Organization Country Region Topic Sector Sector  

Open Energy Info (EERE)

UNEP Armenia Azerbaijan Barbados Burkina Faso China Egypt Ghana Indonesia Jordan Kenya Korea Mali Mexico Moldova Mongolia Montenegro Morocco Namibia Nepal Peru Philippines Russia...


Dancing Africa in Bahia : dance, embodied authenticity and the consumption of "Africa" in Bahia, Brazil  

E-Print Network (OSTI)

Formation in Contemporary Brazil." In On Edge: The Crisis ofof Bahia, Northeastern Brazil. National Library of Ghana.197-204. Rio de Janeiro, Brazil: UNESCO. Centro de Estudos

Ahlberg, Meredith A.



Reply to comment | OSTI, US Dept of Energy, Office of Scientific...  

Office of Scientific and Technical Information (OSTI)

current member states of the UN Commission on Science and Technology for development: Brazil Chile China Democratic Republic of Congo Cuba Finland France Ghana India Latvia...

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

states of the UN Commission on Science and Technology for development: Brazil Chile China Democratic Republic of Congo Cuba Finland France Ghana India Latvia Lesotho Mauritius...


Interpol AFIS service  

Science Conference Proceedings (OSTI)

... Ghana : 3 Kyrgystan : 3 Monaco : 3 Armenia : 2 Barbados : 2 Finland : 2 Georgia : 2 Kazakhstan : 2 Portugal : 2 Greece : 1 Ireland : 1 Jordan : 1 ...



Global Nuclear Energy Partnership Inaugural Steering Group Meeting...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

members, Australia, Bulgaria, Canada, China, France, Ghana, Hungary, Italy, Japan, Jordan, Kazakhstan, Lithuania, Poland, Republic of Korea, Romania, Russia, Slovenia and...


Secretary Bodman and Rosatom Director Kiriyenko Meet to Discuss...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to nuclear power, including: Australia, Bulgaria, Canada, Ghana, Hungary, Italy, Jordan, Kazakhstan, Lithuania, Poland, Republic of Korea, Romania, Senegal, Slovenia, and...


Nigeria - Analysis - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Current recipients are Volta River Authority's Takoradi Thermal Power Plant in Ghana and Electricity Community of Benin (CEB), a company co-owned by Benin and Togo.


What's your plan for 2025?  

Science Conference Proceedings (OSTI)

... Jute 98% India, Bangladesh, China, Myanmar Soybeans 88% USA, Brazil, Argentina, China Cocoa 78% Cte d'Ivoire, Indonesia, Ghana, Nigeria ...



Questionnaire | BNL Guest, User and Visitor Center  

NLE Websites -- All DOE Office Websites (Extended Search)

Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guinea Guinea-Bissau Guyana Haiti Heard...


Better Buildings Neighborhood Program: Contacts  

NLE Websites -- All DOE Office Websites (Extended Search)

Gambia Georgia, Republic of Germany Ghana Gibraltar Great Britain andNorthern Ireland Greece Greenland Grenada Guadeloupe Guatemala Guinea Guinea-Bissau Guyana Haiti Honduras Hong...


Biogeosciences, 4, 597612, 2007 www.biogeosciences.net/4/597/2007/  

E-Print Network (OSTI)

.7 Flame shape visualizations using OH , in a coaxial LOx/GH2 injector [Ju- niper 2001]: (a) instantaneous visualizations using OH , in a coaxial LOx/GH2 injector [Ju- niper 2001]: (a) instantaneous image, (b) top: time

Paris-Sud XI, Université de


Temperate Mountain Glacier-Melting Rates for the Period 200130: Estimates from Three Coupled GCM Simulations for the Greater Himalayas  

Science Conference Proceedings (OSTI)

The temperate glaciers in the greater Himalayas (GH) and the neighboring region contribute to the freshwater supply for almost one-half of the people on earth. Under global warming conditions, the GH glaciers may melt more rapidly than high-...

Diandong Ren; David J. Karoly; Lance M. Leslie



Wind: wind power density maps at 50m above ground and 1km resolution for  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Raster GIS data, 50 m wind power density for Ghana. (Purpose): To provide information on the wind resource potential in Ghana. Source NREL Date Released September 02nd, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords GEF Ghana GIS maps NREL SWERA UNEP wind Data application/zip icon Download Maps (zip, 661.4 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access Average vote Your vote Overall rating Average vote Your vote


Solar: hourly global horizontal (GHI) and direct normal (DNI) data for  

Open Energy Info (EERE)

Ghana from DLR Ghana from DLR Dataset Summary Description (Abstract): Hourly time series of GHI and DNI for the years 2000, 2001 and 2002 for selected sites in Ghana. The hourly data are stored in ASCII files for each station. Please read the documentation file for additional information. (Purpose): For the selected sites, the hourly time series can be used for the simulation of Photovoltaic (PV)-systems or Concentrating Solar Power (CSP)-systems. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI Ghana GHI hourly data solar SWERA TILT TMY UNEP Data application/zip icon ghanaDLRtimeseries_103.zip (zip, 2.7 MiB) Quality Metrics Level of Review Some Review Comment


CO{sub 2} emissions from developing countries: Better understanding the role of energy in the long term. Volume 4, Ghana, Sierra Leone, Nigeria and the Gulf Cooperation Council (GCC) countries  

Science Conference Proceedings (OSTI)

Recent years have witnessed a growing recognition of the link between emissions of carbon dioxide (CO{sub 2}) and changes in the global climate. of all anthropogenic activities, energy production and use generate the single largest portion of these greenhouse gases. Although developing countries currently account for a small share of global carbon emissions, their contribution is increasing rapidly. Due to the rapid expansion of energy demand in these nations, the developing world`s share in global modern energy use rose from 16 to 27 percent between 1970 and 1990. If the growth rates observed over the past 20 years persist, energy demand in developing nations will surpass that in the countries of the Organization for Economic Cooperation and Development (OECD) early in the 21st century. The study seeks to examine the forces that galvanize the growth of energy use and carbon emissions, to assess the likely future levels of energy and CO{sub 2} in selected developing nations and to identify opportunities for restraining this growth. The purpose of this report is to provide the quantitative information needed to develop effective policy options, not to identify the options themselves. A combined study was carried out for the countries of the Gulf Cooperation Council (Bahrain, Kuwait, Oman, Qatar, Saudi Arabia and the United Arab Emirates).

Sathaye, J.; Goldman, N. [eds.



Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin  

Science Conference Proceedings (OSTI)

The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie (Vermont); (Utah)



New Cellulase Identification Method Holds Promise for Lower-Cost Biofuels (Fact Sheet)  

SciTech Connect

A new computational approach to genomic data effectively distinguishes cellulases and non-cellulases within the protein family GH48, a key component for degrading lignocellulose for biofuels.

Not Available



Microsoft Word - 2006FactSR116.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Including Corrosive Contaminants Typical of Those Arising by Using Alternate Fuels in Gas Turbines Fact Sheet I. PROJECT PARTICIPANTS G.H. Meier, Mechanical Engineering and...


International Workshop: MFE Roadmapping in the ITER Era | Princeton...  

NLE Websites -- All DOE Office Websites (Extended Search)

Princeton University Princeton, NJ International Workshop: MFE Roadmapping in the ITER Era Princeton University Princeton, NJ Host: G.H. Neilson Coordinator: Pamela Hampton...


Flows and Decompositions of Games: Harmonic and Potential Games  

E-Print Network (OSTI)

142154, Washington, DC, USA, 2005. IEEE Computer Society. [15] G.H. Golub and C.F. Van Loan. Matrix computations. Johns Hopkins University Press, 1996.


Data:D6065448-af60-410e-83ea-d320f8298417 | Open Energy Information  

Open Energy Info (EERE)

Effective date: 20090101 End date if known: Rate name: SCHEDULE GH GENERAL SERVICE- HEATING (RESIDENTIAL) VERSION 2 Sector: Residential Description: The amount determined under...


Data:16a0459a-cecd-44d7-a3e7-75f9e929766a | Open Energy Information  

Open Energy Info (EERE)

Effective date: 20090101 End date if known: Rate name: SCHEDULE GH GENERAL SERVICE - HEATING (RESIDENTIAL) Sector: Residential Description: Additional Info: AVAILABILITY: Service...

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ultracapacitor Technologies and Application in Hybrid and Electric Vehicles  

E-Print Network (OSTI)

Moderate Hybrid-electric Vehicles. ESScap06, Switzerland,GH. SIMPLEV: A Simple Electric Vehicle Simulation Program-Ultracapacitors in Hybrid- electric Vehicle Applications.

Burke, Andy



Magnetic Order in Superconductors  

Science Conference Proceedings (OSTI)

... Intrinsically Localized Mode in a-uranium as a Precursor to a Solid-state Phase Transition, ME Manley, JW Lynn, Y. Chen, and GH Lander, Phys. ...


Challenges, uncertainties and issues facing gas production from gas hydrate deposits  

E-Print Network (OSTI)

focus of GH exploration and production studies in northernoil and gas exploration and production activities; includingGas hydrate exploration and production activities will be

Moridis, G.J.



Cast Alloys for Advanced Ultra Supercritical Steam Turbines  

Science Conference Proceedings (OSTI)

Abstract Scope, The proposed steam inlet temperature in the Advanced Ultra ... 15 - The Effect of Primary ?' Distribution on Grain Growth Behavior of GH720Li...


Mathematical Programming Approaches for Generating p-Efficient ...  

E-Print Network (OSTI)

[4] Charnes A, Cooper, W.W, Symonds, G.H. Cost Horizons and Certainty Equivalents: An Approach to. Stochastic Programming of Heating Oil. Management...


Selected Topics in Robust Convex Optimization  

E-Print Network (OSTI)

Charnes, A., Cooper, W.W., Symonds, G.H.: Cost horizons and certainty equivalents: an approach to stochastic programming of heating oil. Manage-.


Microsoft Word - Agenda F&I Update 090804.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conference Room GH-019 Agenda Call in Number 301-903-6379 Confirmation Number 253041 Internet Access and Projector Will Be Available The presentations will be available via...


Solar: monthly and annual average direct normal (DNI) GIS data at 10km  

Open Energy Info (EERE)

Ghana from DLR Ghana from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for Ghana for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI Ghana solar SWERA UNEP Data text/csv icon Download Data (csv, 1 MiB) application/zip icon Download Shapefile (zip, 519.6 KiB)


Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

Ghana from DLR Ghana from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Ghana for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the documentation file for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR Ghana GHI GIS solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 504 KiB) text/csv icon Download Data (csv, 1 MiB)


The effect of compositional and geometrical changes to the bending strength of the Ghanaian ceramic pot filter  

E-Print Network (OSTI)

Pure Home Water (PHW) is a non-profit organization with the goal of providing safe drinking water through household water treatment and storage (HWTS) to the inhabitants of Ghana, particularly in the Northern Region. To ...

Watters, Travis (Travis Russell)



Analysis and sourcing of the mechanical equipment required for a ceramic pot filter production facility  

E-Print Network (OSTI)

Research was done into identifying and sourcing the mechanical equipment required for manufacturing ceramic pot filters, specifically for use in the Pure Home Water factory in Northern Ghana. The pieces of equipment ...

Getachew, Julian (Julian B.)



International Programs Oregon State University,  

E-Print Network (OSTI)

Philippines Vietnam Azerbaijan Ghana* Malawi Slovakia Cambodia Guatemala Mexico South Korea AVAILABILITY, AZERBAIJAN Major: Industrial Engineering, minor: Business, Senior Education: Crescent Valley High School (FLEX exchange program); Qafqaz University (Azerbaijan), 2005-07 Experience: Future Leaders Exchange

Escher, Christine


Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

Wind: wind power density GIS data at 50m above ground and 1km resolution for Ghana from NREL

(Abstract):Raster GIS data, exported as BIL file, 50 m wind...


Kade Site Image #1  

NLE Websites -- All DOE Office Websites (Extended Search)

growth at the Kade tropical forest site, Ghana. (typically, the area would now be ready for burning and planting. Photograph taken 1958 by Dr. P.H. Nye, Beckley, Oxon., UK...


2012 DOE Facility Representatives/SSO Workshop Presentation ?...  

NLE Websites -- All DOE Office Websites (Extended Search)

as new. 5 The Solution that became a Problem 6 The Solution that became a Problem 7 Basel Convention - 1989 8 Nigeria - 2005 9 Ghana - 2009 10 China - Guiyu 11 China - Guiyu 12...


Documentation of high resolution solar resource assessment for...  

Open Energy Info (EERE)

resolution solar resource assessment for Ghana provided by DLR. The high resolution solar data (10kmx10km) provide country maps of the annual and monthly sums of hourly global...


Putting the press to the test : effects of temperature on Shea nut oil output  

E-Print Network (OSTI)

In northern Ghana, part of a belt reaching from Sub-Saharan Africa to northern Uganda, women collect and process Shea nuts for their valuable oil. This oil is then used in various cosmetic, cooking, and medicinal products. ...

Tacoronte, Lisa Cristina



Promoting of Appliance Energy Efficiency and Transformation of...  

NLE Websites -- All DOE Office Websites (Extended Search)

Promoting of Appliance Energy Efficiency and Transformation of the Refrigerating Appliances Market in Ghana Speaker(s): Essel Ben Hagan Date: October 13, 2009 - 12:00pm Location:...


Contract no. EIE/04/201/s07.43094 Development and Energy in Africa  

E-Print Network (OSTI)

), and in partnership with six African Centres: · Botswana: EECG · Ghana: KITE · Mali: Mali Folkecenter (MFC) · Senegal....................................24 APPENDIX 5: FLIP CHARTS FROM DAY 1 GREEN/RED EXERCISE ..........34 APPENDIX 6: CASE STUDY


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


HyLights -- Tools to Prepare the Large-Scale European Demonstration...  

NLE Websites -- All DOE Office Websites (Extended Search)

(Finnmark) LH 2 LH 2 GT GT SMR SMR Chain 4b Chain 4a Chain 3b Chain 3a Chain 2b Chain 2a LNG LNG LH 2 LH 2 H 2 H 2 SMR SMR NG NG H 2 H 2 Chain 1a Chain 1b GH 2 GH 2 SMR SMR LH 2 LH...


Challenges, uncertainties and issues facing gas production from gas hydrate deposits  

SciTech Connect

The current paper complements the Moridis et al. (2009) review of the status of the effort toward commercial gas production from hydrates. We aim to describe the concept of the gas hydrate petroleum system, to discuss advances, requirement and suggested practices in gas hydrate (GH) prospecting and GH deposit characterization, and to review the associated technical, economic and environmental challenges and uncertainties, including: the accurate assessment of producible fractions of the GH resource, the development of methodologies for identifying suitable production targets, the sampling of hydrate-bearing sediments and sample analysis, the analysis and interpretation of geophysical surveys of GH reservoirs, well testing methods and interpretation of the results, geomechanical and reservoir/well stability concerns, well design, operation and installation, field operations and extending production beyond sand-dominated GH reservoirs, monitoring production and geomechanical stability, laboratory investigations, fundamental knowledge of hydrate behavior, the economics of commercial gas production from hydrates, and the associated environmental concerns.

Moridis, G.J.; Collett, T.S.; Pooladi-Darvish, M.; Hancock, S.; Santamarina, C.; Boswell, R.; Kneafsey, T.; Rutqvist, J.; Kowalsky, M.; Reagan, M.T.; Sloan, E.D.; Sum, A.K.; Koh, C.



Time-optimal Control of Spin Systems  

E-Print Network (OSTI)

The paper discusses various aspects of time-optimal control of quantum spin systems, modelled as right-invariant systems on a compact Lie group G. The main results are the reduction of such a system to an equivalent system on a homogeneous space G/H, and the explicit determination of optimal trajectories on G/H in the case where G/H is a Riemannian symmetric space. These results are mainly obtained by using methods from Lie theory and geometric control.

Jan Swoboda



Solar: monthly and annual average global horizontal (GHI) GIS data at 40km  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Monthly Average Solar Resource for horizontal flat-plate collectors for Ghana. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented horizontally. (Supplemental Information): These data provide monthly average and annual average daily total solar resource averaged over surface cells of approximately 40 km by 40 km in size. The solar resource value is represented as watt-hours per square meter per day for each month. The data were developed from NREL's Climatological Solar Radiation (CSR) Model. This model uses information on cloud cover, atmospheric water


Solar: monthly and annual average latitude tilt GIS data at 40km resolution  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Monthly Average Solar Resource for flat-plate collectors tilted at latitude for Ghana. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented horizontally. (Supplemental Information): These data provide monthly average and annual average daily total solar resource averaged over surface cells of approximately 40 km by 40 km in size. The solar resource value is represented as watt-hours per square meter per day for each month. The data were developed from NREL's Climatological Solar Radiation (CSR) Model. This model uses information on cloud cover, atmospheric water vapor and trace gases, and the amount of aerosols in the atmosphere to


Promoting of Appliance Energy Efficiency and Transformation of the  

NLE Websites -- All DOE Office Websites (Extended Search)

Promoting of Appliance Energy Efficiency and Transformation of the Promoting of Appliance Energy Efficiency and Transformation of the Refrigerating Appliances Market in Ghana Speaker(s): Essel Ben Hagan Date: October 13, 2009 - 12:00pm Location: 90-3122 As part of the national initiatives to promote energy savings in Ghana, a program is being implemented with the aim to use standards and labels as the main tool for transforming the refrigerators and refrigerator-freezers market in Ghana towards more energy efficient appliances. The program is intended to generate large electricity savings, as well as reduce the associated greenhouse gas emissions. The key initial outcome of the program is the development of the draft Legislative Instrument "Energy Efficiency Standards and Labeling (Refrigerator, Refrigerator-Freezer and Freezer)


Solar: monthly and annual average direct normal (DNI) GIS data at 40km  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Monthly Average Solar Resource for 2-axis tracking concentrating collectors for Ghana. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a concentrating collector, such as a dish collector, which tracks the sun continuously. (Supplemental Information): These data provide monthly average and annual average daily total solar resource averaged over surface cells of approximately 40 km by 40 km in size. The solar resource value is represented as watt-hours per square meter per day for each month. The data were developed from NREL's Climatological Solar Radiation (CSR) Model. This model uses information on cloud cover, atmospheric water


Wind: wind power density GIS data at 50m above ground and 1km resolution  

Open Energy Info (EERE)

7018 7018 Varnish cache server Wind: wind power density GIS data at 50m above ground and 1km resolution for Ghana from NREL Dataset Summary Description (Abstract): Raster GIS data, exported as BIL file, 50 m wind power density for Ghana. Note: BIL files can be converted to raster data in ArcInfo using the IMAGEGRID command. (Purpose): To provide information on the wind resource potential in Ghana. Values range from 0 to 620 meters. (Supplemental Information):***** Spatial Reference Information (Beg) *****Projection ParametersCoordinate System:Projection Transverse MercatorZunits W/m2Units MetersSpheroid: WGS84ParametersScale factor at central meridian: 1.0000Longitude of central meridian: -1 0 0.0Latitude of origin: 8 0 0.0False easting: 0False northing: 0Spatial InformationRaster:Number of Columns:


Forest Investment Program (FIP) | Open Energy Information  

Open Energy Info (EERE)

Program (FIP) Program (FIP) Jump to: navigation, search Name Forest Investment Program (FIP) Agency/Company /Organization World Bank Sector Land Topics Background analysis, Finance, Implementation, Low emission development planning, Market analysis Website http://www.climatefundsupdate. Program Start 2008 Country Brazil, Burkina Faso, Democratic Republic of Congo, Ghana, Indonesia, Laos, Mexico, Peru South America, Western Africa, Middle Africa, Western Africa, South-Eastern Asia, South-Eastern Asia, Central America, South America References Forest Investment Program (FIP)[1] Forest Investment Program[2] Brazil Specific Documents[3] Democratic Republic of Congo Specific Documents[4] Ghana Specific Documents[5] Indonesia Specific Documents[6] Laos Specific Documents[7]


All Price Tables.vp  

Gasoline and Diesel Fuel Update (EIA)

E8. Primary Energy, Electricity, and Total Energy Expenditure Estimates, 2011 (Million Dollars) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i...


Study of Free-Fluoride Mold Powder Based on Titanium-Bearing ...  

Science Conference Proceedings (OSTI)

Sep 1, 2004 ... Study of Free-Fluoride Mold Powder Based on Titanium-Bearing Blast Furnace Slag by G.H. Wen, P. Tang, L. Zhang, Y. Liu, and S. Miao...


Content-Based Video Copy Detection: PRISMA at TRECVID ...  

Science Conference Proceedings (OSTI)

... ?(Gi,Gj) = w1 ?1(Gi,Gj) + w2 ?2(Gi,Gj) We defined ? as L1 (Manhattan) distance for EHD, GH and CH vectors: L1(x, y) = d ? i=0 |xi ? yi| ...



Intermittency, quasiperiodicity and chaos in probe-induced ferroelectr...  

NLE Websites -- All DOE Office Websites (Extended Search)

doubling (f) and intermittent behaviours (g,h). i, Domain merging at U sw 50 V. j, Phase diagram of switching behaviour as a function of bias and domain spacing. Shown are...


Understanding the Relationships between Lightning, Cloud Microphysics, and Airborne Radar-Derived Storm Structure during Hurricane Karl (2010)  

Science Conference Proceedings (OSTI)

This study explores relationships between lightning, cloud microphysics, and tropical cyclone (TC) storm structure in Hurricane Karl (16 September 2010) using data collected by the NASA DC-8 and Global Hawk (GH) aircraft during NASAs Genesis and ...

Brad Reinhart; Henry Fuelberg; Richard Blakeslee; Douglas Mach; Andrew Heymsfield; Aaron Bansemer; Stephen L. Durden; Simone Tanelli; Gerald Heymsfield; Bjorn Lambrigtsen


JOM: The Member Journal of TMS - JOM Monthly  

Science Conference Proceedings (OSTI)

Jan 18, 2013 ... Y.C. Feng, G.J. Cao, G.H. Fan, L.P. Wang, and L. Geng In this article, the ZnWO4 coating was prepared successfully on the surfaces of WO3...


Taraco Archaeological Project Report on 2003 Excavations at Kala Uyuni  

E-Print Network (OSTI)

Jars..short-necked olla (e), jar (f), medium-necked ollas (g-h) Asolla forms (Fig 30e) and jars (Fig 30f) and jars (Fig 31f).



Hydrogen Delivery Infrastructure Option Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Delivery Infrastructure Hydrogen Delivery Infrastructure Option Analysis Option Analysis DOE and FreedomCAR & Fuel Partnership Hydrogen Delivery and On-Board Storage Analysis Workshop January 25, 2005 Washington DC This presentation does not contain any proprietary or confidential information Tan-Ping Chen Nexant Jim Campbell Bhadra Grover Air Liquide Stefan Unnasch TIAX Glyn Hazelden GTI Graham Moore Chevron Matt Ringer NREL Ray Hobbs Pinnacle West 2 Presentation Outline Project Background Knowledge Collected and Preliminary Results for Each Delivery Option Summary of Observations Next Step Project Background Project Background 4 Delivery Options Option 1* GH delivery by new pipelines Option 2 Converting NG/oil pipelines for GH delivery Option 3 Blending GH into NG pipelines Option 4* GH tube trailers


Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis  

Science Conference Proceedings (OSTI)

Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for CFA accumulation via heterologous expression in production plants.

Yu X. H.; Shanklin J.; Rawat, R.



ICT-enabled delivery of maternal health services  

Science Conference Proceedings (OSTI)

Fresh opportunities are being created daily for the deployment of Information and Communication Technologies (ICT) [42] particularly in the area of poverty alleviation and sustainable economic growth in developing countries in particular. Therefore, ... Keywords: Ghana, ICT4D, development, e-governance, maternal mortality, mobile phones, public policy

Johanna E. Awotwi



UNIVERSITY OKLAHOMA College of International Studies  

E-Print Network (OSTI)

Singapore 6 South Korea 2 Azerbaijan 1 Belgium 96 France 28 Germany 1 Greece Republic 2 The Netherlands 2 Azerbaijan 2 Belgium 1 Brazil 1 Burkina Faso 1 Egypt 1 Finland 1 Ghana 1 from Austria 7 Total from Azerbaijan 1 Total from Bahamas, The 2 Total

Oklahoma, University of

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CRC handbook of agricultural energy potential of developing countries. Volume I  

Science Conference Proceedings (OSTI)

The contents of this book are: Introduction, Argentina, Bangladesh, Benin, Bolivia, Botswana, Bourkina (Upper Volta), Brazil, Burma, Burundi, Cameroon, Chad, Chile, Columbia, Costa Rica, Djibouti, Dominican Republic, Ecuador, El Salvador, Ethiopia, French Guiana, Gambia, Ghana, Guatemala, Guinea, Guyana, Haiti, Honduras, India, Indonesia, Jamaica, Appendix I. Conventional and Energetic Yields, Appendix II, Phytomass Files, and References.

Duke, J.A.



Satellite-Based Actual Evapotranspiration over Drying Semiarid Terrain in West Africa  

Science Conference Proceedings (OSTI)

A simple satellite-based algorithm for estimating actual evaporation based on Makkinks equation is applied to a seasonal cycle in 2002 at three test sites in Ghana, West Africa: at a location in the humid tropical southern region and two in the ...

D. Schttemeyer; Ch Schillings; A. F. Moene; H. A. R. de Bruin



Biofuels War: The New Scramble for Africa by Western Big Money Profiteers : EcoWorldly Explore GO Media  

E-Print Network (OSTI)

Biofuels War: The New Scramble for Africa by Western Big Money Profiteers : EcoWorldly About Like this post? Subscribe to our RSS feed and stay up to date. Biofuels War: The New Scramble in Africa, Ethiopia, Europe, Ghana, Global, Tanzania, United States of America Biofuels war has broken out


Image from Wikimedia Commons  

E-Print Network (OSTI)

Photos by Amy Smith. Used with permission. Ghana ContextSafe water supply is not universal More than 1 billion people lack access to clean drinking water Half the hospital beds in the world are occupied by patients with easily prevented water-borne disease Half the people in the world do not have sanitation systems as good as those in Ancient Rome.

Mit Opencourseware



24 Germany 8 58 Pakistan 3 34 Israel 1 68 Saudi Arabia 30  

E-Print Network (OSTI)

24 Germany 8 58 Pakistan 3 34 Israel 1 68 Saudi Arabia 30 COLLEGES (STUDENTS) ACADEMIC LEVELS France 10 57 Oman 1 TOTAL 1283 24 Germany 8 58 Pakistan 3 25 Ghana 5 59 Palestine 1 26 Greece 2 60 Panama

Collins, Gary S.


TRIUMF 4004 Wesbrook Mall, Vancouver, B.C. V6T 2A3, Canada DESIGN NOTE S.R. Koscielniak June 2003 TRI-DN-97-12 v3.2  

E-Print Network (OSTI)

) = 0 0 xr rr -qhr + uxr + vrr -qer . In the previous relations P is the total gas pres- sure Te x , qer = -ke Te r , with kh equal to the thermal conductivity of the heavy particles and ke equal

Koscielniak, Shane


Surface Heat Flux Variations across the Kuroshio Extension as Observed by Surface Flux Buoys  

Science Conference Proceedings (OSTI)

Wintertime sea surface heat flux variability across the Kuroshio Extension (KE) front is analyzed using data from the Kuroshio Extension Observatory (KEO) buoy in the Kuroshio recirculation gyre south of the KE front and from the Japan Agency for ...

Masanori Konda; Hiroshi Ichikawa; Hiroyuki Tomita; Meghan F. Cronin



Mesoscale Energy Spectra of Mei-Yu Front System. Part I: Kinetic Energy Spectra  

Science Conference Proceedings (OSTI)

The mesoscale kinetic energy (KE) spectra of Mei-Yu front system are investigated through idealized numerical simulations. In the mature stage, the upper tropospheric KE spectrum resembles a -3 power law for wavelengths between 1000 and 400 km and ...

Jun Peng; Lifeng Zhang; Yu Luo; Yun Zhang


You are now leaving Energy.gov | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



NIST: Technical Bulletin on Airport Backscatter X-ray Systems  

Science Conference Proceedings (OSTI)

... The energy scale was calibrated using the 14.1 keV and 122.1 keV gamma energies from a ... measurements outside of the primary beam, due to ...



High-Resolution X-ray Spectroscopy  

Science Conference Proceedings (OSTI)

... In support of these efforts, we also maintain laboratory x-ray sources from 1 keV to 300 keV, energy and intensity calibration facilities, and a vacuum ...



A Quantizable Model of Massive Gauge Vector Bosons without Higgs  

E-Print Network (OSTI)

We incorporate the parameters of the gauge group G into the gauge theory of interactions through a non-linear partial-trace sigma-model Lagrangian on G/H. The minimal coupling of the new (Goldstone-like) scalar bosons provides mass terms to those intermediate vector bosons associated with the quotient G/H, without spoiling gauge invariance, remaining the H-vector potentials massless. The main virtue of a partial trace on G/H, rather than on the entire G, is that we can find an infinite-dimensional symmetry, with non-trivial Noether invariants, which ensures quantum integrability in a non-canonical quantization scheme. The present formalism is explicitly applied to the case G=SU(2)x U(1), as a Higgs-less alternative to the Standard Model of electroweak interactions, although it can also be used in low-energy phenomenological models for strong interactions.

V. Aldaya; M. Calixto; F. F. Lopez-Ruiz



Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENERGY lab ENERGY lab Methane Hydrate Federal Advisory Committee Gas Hydrate Program Activities in FY2013 Ray Boswell, DOE/NETL June 7, 2013 DOE Gas Hydrate R&D Program Spending Historical Results (through 2010) - Conducted three safe/successful Arctic/Deepwater field programs on time, on budget. - Resolved GH-drilling hazards facing GoM operations. - Identified the resource target (sands:10,000s Tcf); with international implications. - 2007 test with BP key input to USGS confirmation of technically- recoverable resources in AK: test earned industry buy-in for subsequent scientific testing in PBU. - 2009 GoM program proved GH exploration approach with field results, and further informed 2008 BOEM assessment. - Enabled the first modeling of GH response to climate change.


Results of Reference List Query  

Science Conference Proceedings (OSTI)

... 1991) (54-1333 keV: acetophenone, acetylacetone, bakelite, benzaldehyde, benzyl alcohol, cellulose-triacetate, ethanol, ether, ethylacetoacetate ...


Annotation and comparative analysis of the glycoside hydrolase genes in Brachypodium distachyon  

Science Conference Proceedings (OSTI)

Background Glycoside hydrolases cleave the bond between a carbohydrate and another carbohydrate, a protein, lipid or other moiety. Genes encoding glycoside hydrolases are found in a wide range of organisms, from archea to animals, and are relatively abundant in plant genomes. In plants, these enzymes are involved in diverse processes, including starch metabolism, defense, and cell-wall remodeling. Glycoside hydrolase genes have been previously cataloged for Oryza sativa (rice), the model dicotyledonous plant Arabidopsis thaliana, and the fast-growing tree Populus trichocarpa (poplar). To improve our understanding of glycoside hydrolases in plants generally and in grasses specifically, we annotated the glycoside hydrolase genes in the grasses Brachypodium distachyon (an emerging monocotyledonous model) and Sorghum bicolor (sorghum). We then compared the glycoside hydrolases across species, both at the whole-genome level and at the level of individual glycoside hydrolase families. Results We identified 356 glycoside hydrolase genes in Brachypodium and 404 in sorghum. The corresponding proteins fell into the same 34 families that are represented in rice, Arabidopsis, and poplar, helping to define a glycoside hydrolase family profile which may be common to flowering plants. Examination of individual glycoside hydrolase familes (GH5, GH13, GH18, GH19, GH28, and GH51) revealed both similarities and distinctions between monocots and dicots, as well as between species. Shared evolutionary histories appear to be modified by lineage-specific expansions or deletions. Within families, the Brachypodium and sorghum proteins generally cluster with those from other monocots. Conclusions This work provides the foundation for further comparative and functional analyses of plant glycoside hydrolases. Defining the Brachypodium glycoside hydrolases sets the stage for Brachypodium to be a monocot model for investigations of these enzymes and their diverse roles in planta. Insights gained from Brachypodium will inform translational research studies, with applications for the improvement of cereal crops and bioenergy grasses.

Tyler, Ludmila [USDA-ARS Western Regional Research Center; Bragg, Jennifer [USDA-ARS Western Regional Research Center; Wu, Jiajie [USDA-ARS Western Regional Research Center; Yang, Xiaohan [ORNL; Tuskan, Gerald A [ORNL; Vogel, John [USDA-ARS Western Regional Research Center



Free-wheeling hydraulic power mills  

DOE Green Energy (OSTI)

Free-wheeling power plants using free replenishable hydraulic forces of winds and water currents would consist of most or all of the following: fore and after cones to increase throughput; duplex impellers; rotors with dc/ac excitation, ac/dc inverters and dc field coils; stators with ac output of varying frequency, voltage and power; solid-state ac/dc inverters, dc electrolytic cell banks for GH/sub 2/ and GO/sub 2/ production; and neon refrigerators for reducing these to LOX and chilled GH/sub 2/ for ease in shipment or storage.

Hall, F.F.



Herwig++ 2.0 Release Note.  

E-Print Network (OSTI)

: The transverse momentum of the Z0 boson at the Tevatron calculated by HERWIG6.5 and Herwig++ compared with run I CDF data taken from [7] with and without matrix element corrections. Photon plus jet production, i.e. qq ? ?g, qg ? ?q; Higgs boson production, i... .e. qq/gg ? h0; Higgs boson plus jet production, i.e. gg ? gh0, qg ? qh0 and qq ? gh0; Heavy quark pair production, i.e. qq/gg ? QQ; QCD 2 ? 2 scattering processes, i.e. gg ? gg, gg ? qq, qq ? gg, qg ? qg, qq ? qq, qq ? qq; in addition the W...

Gieseke, Stefan; Grellscheid, D; Hamilton, K; Ribon, Alberto; Richardson, P; Seymour, Michael H; Stephens, Phil; Webber, Bryan R


Elastocapillarity: adhesion and large deformations of thin sheets  

E-Print Network (OSTI)

at the other end, with ?s(l) = 0 and ?(l) = 0. The gravitational energy is then written as G(w) = ?ghw, with ? being the density of the beam, h its thickness and g the acceleration due to gravity. In this case ?s = ?gh and ? = ?gh(s ? l). Equation (1... to gravity see Appendix 2.A.) We must minimize this combined energy subject to the constraint of an imposed end-to-end displacement ?l. Supplementing the energy (measured relative to the flat, fully adhered, state) with a Lagrange multiplier to enforce...

Wagner, Till Jakob Wenzel



ECOWAS Clean Energy Gateway-Help | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » ECOWAS Clean Energy Gateway-Help Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png


ECOWAS Clean Energy Gateway-Technology Data | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » ECOWAS Clean Energy Gateway-Technology Data Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ECOWAS Clean Energy Gateway-About | Open Energy Information  

Open Energy Info (EERE)

ECOWAS Clean Energy Gateway-About ECOWAS Clean Energy Gateway-About Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo The ECOWAS Centre for Renewable Energy and Energy Efficiency (ECREEE) is


Energy System and Scenario Analysis Toolkit | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo What analysis tools and methods can I use to study my country's energy system? Understanding approaches


ECOWAS Clean Energy Gateway-Organizations and Networks | Open Energy  

Open Energy Info (EERE)

ECOWAS Clean Energy Gateway-Organizations and Networks ECOWAS Clean Energy Gateway-Organizations and Networks Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo Registered Technical and Research Organizations


M38 | Open Energy Information  

Open Energy Info (EERE)

M38 M38 Jump to: navigation, search Name M38 Address Accra, Ghana Place Ghana Product Liquefied Petroleum Gas Website http://eandco.net/investments/ Coordinates 5.555717°, -0.196306° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":5.555717,"lon":-0.196306,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The REDD Opportunities Scoping Exercise (ROSE) | Open Energy Information  

Open Energy Info (EERE)

REDD Opportunities Scoping Exercise (ROSE) REDD Opportunities Scoping Exercise (ROSE) Jump to: navigation, search Name The REDD Opportunities Scoping Exercise (ROSE): A Tool for Prioritizing Sub-National REDD+ Activities - Case Studies from Ghana, Tanzania, and Uganda Agency/Company /Organization The Katoomba Group, Forest Trends, Nature Conservation Research Centre Sector Land Focus Area Forestry Topics Implementation, Policies/deployment programs, Pathways analysis, Background analysis Resource Type Guide/manual Website http://www.forest-trends.org/d Country Ghana, Tanzania, Uganda UN Region "Sub-Saharan Africa" is not in the list of possible values (Eastern Africa, Middle Africa, Northern Africa, Southern Africa, Western Africa, Caribbean, Central America, South America, Northern America, Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand, Melanesia, Micronesia, Polynesia, Latin America and the Caribbean) for this property.


ECOWAS Clean Energy Gateway-Links | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit History Facebook icon Twitter icon » ECOWAS Clean Energy Gateway-Links Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo


ECOWAS Clean Energy Gateway-Policy/ProgramDesign | Open Energy Information  

Open Energy Info (EERE)

ECOWAS Clean Energy Gateway-Policy/ProgramDesign ECOWAS Clean Energy Gateway-Policy/ProgramDesign Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo Background → Design → Implementation →


Kumasi Institute of Technology and Environment (KITE) | Open Energy  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Logo: Kumasi Institute of Technology Energy and Environment Name Kumasi Institute of Technology Energy and Environment Address P. O. Box AT 720, Achimota, Accra, Ghana. Place Ghana Number of employees 11-50 Year founded 1996 Phone number +233-302-256800-01 Coordinates 5.555717°, -0.196306° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":5.555717,"lon":-0.196306,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ECOWAS Clean Energy Gateway-News | Open Energy Information  

Open Energy Info (EERE)

News News Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo Regional News Renewable Energy News Today-West Africa Renewable Energy News Failed to load RSS feed from http://renewableenergy.einnews.com/xml/west-africa/: Error fetching URL: Operation timed out after 5000 milliseconds with 0 bytes received


Gateway:ECOWAS Clean Energy Gateway | Open Energy Information  

Open Energy Info (EERE)

ECOWAS Clean Energy Gateway ECOWAS Clean Energy Gateway Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo West Africa Organizations, Programs, and Tools Countries (15)


West African Clean Energy Gateway-Software Analysis Tools | Open Energy  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » West African Clean Energy Gateway-Software Analysis Tools Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png


ECOWAS Clean Energy Gateway-Transportation | Open Energy Information  

Open Energy Info (EERE)

ECOWAS Clean Energy Gateway-Transportation ECOWAS Clean Energy Gateway-Transportation Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo Introduction→ Step 1 Step 2 Step 3 Step 4


West African Clean Energy Gateway-Resource Assessment | Open Energy  

Open Energy Info (EERE)

African Clean Energy Gateway-Resource Assessment African Clean Energy Gateway-Resource Assessment Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png Ivory Coast Liberia Mali Niger Nigeria Senegal Sierra Leone Togo SWERA-thumb.jpg The SWERA landing page allows for the quick browsing of global data layers.


Solar: hourly solar (direct normal (DNI), global horizontal (GHI), and  

Open Energy Info (EERE)

Ghana from NREL Ghana from NREL Dataset Summary Description (Abstract): Each data file is a set of hourly values of solar radiation and meteorological elements for a 1-year period. Solar radiation is modeled using the NREL METSTAT model, with surface observed cloud cover being the principal model input. Each container file contains up to 30 yearly files for one station, plus the Typical Meteorological Year (TMY) file for the selected station, plus documentation files and a TMY data reader file for use with Microsoft Excel. (Purpose): Simulations (Supplemental Information): The intended use of these data files is for computer simulations of solar energy conversion systems and building systems. The yearly data may be suitable for designing systems and their components to meet the worst-case conditions occurring at a


Impact Assessment Toolkit | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Impact Assessment Toolkit Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png


ECOWAS Clean Energy Gateway-Finance | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » ECOWAS Clean Energy Gateway-Finance Jump to: navigation, search Economic Community of West African States (ECOWAS) Clean Energy Gateway Home | About | News | Links | Help | Countries Benin | Burkina Faso | Cape Verde | Gambia | Ghana | Guinea| Guinea-Bissau | Ivory Coast | Liberia | Mali | Niger | Nigeria | Senegal | Sierra Leone | Togo Countries ECREEE light.JPG FBenin.png FBurkinaFaso.png FCapeVerde.png FGambia.png FGhana.png FGuinea.png FGuinea-Bissau.png Benin Burkina Faso Cape Verde Gambia Ghana Guinea Guinea-Bissau FIvoryCoast.png FLiberia.png FMali.png FNiger.png FNigeria.png FSenegal.png FSierraLeone.png FTogo.png


File:Ghanametst 222.pdf | Open Energy Information  

Open Energy Info (EERE)

Ghanametst 222.pdf Ghanametst 222.pdf Jump to: navigation, search File File history File usage Meteorology: map of Ghana selected meteorological stations and elevation from NREL Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 5.51 MB, MIME type: application/pdf) Title Africa - select meteorological stations and elevation Description Meteorology: map of Ghana selected meteorological stations and elevation from NREL Sources NREL Authors Donna Heimiller Related Technologies Meteorology Extent International Countries Ghana UN Region Western Africa Coordinates 7.946527°, -1.023194° File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:31, 13 June 2011 Thumbnail for version as of 17:31, 13 June 2011 1,650 × 1,275 (5.51 MB) Nlangle (Talk | contribs) A map depicting elevation and location of selected meteorological stations.


Feasibility study on the modernization and expansion of the Tema Oil Refinery. Executive Summary. Export trade information  

Science Conference Proceedings (OSTI)

The Tema Oil Refinery (TOR), which was commissioned in 1963, is a simple hydro-skimming plant which processes crude oil into LPG, gasoline, kerosene, gasoil, and fuel oil. It is the only petroleum refinery in Ghana. Over the years some of the equipment in the refinery has deteriorated or become obsolete necessitating major rehabilitation. A study of the refinery expansion project takes into consideration earlier studies and, equally important, recognizes the extensive work done by TOR in rehabilitating the refinery. The program, carried out in phases because of funding limitations, has addressed the critical repairs and replacements in the process units and utilities necessary to prolong the life of the refinery and assure reliability and safe operation. It undertook the task of investigating the feasibility of modernizing and expanding the refinery at Tema, Ghana to meet projected market demands until the year 2005. A process planning study was conducted to select the optimal process and utility configuration which would result in economic benefits to Ghana.

Not Available




NLE Websites -- All DOE Office Websites (Extended Search)

CONTENTS CONTENTS Japan's R&D Program ..................1 Hydrate in Nature..........................7 HYFLUX Expedition ......................12 Sub Sampling for GH ................ 16 Gas Production Geomechanical Implications ................................. 18 Announcements ...................... 23 * Database Now Available * Global Assessment * NETL-NAS Fellowship * New Zealand Workshop * EGU 2010 Abstracts


The Position of Dalit Women in Caste System  

E-Print Network (OSTI)

~12053), Year 6, Issue 12. Kathmandu: JanaUthan Academy. Kamata Hemchuri (Ed.). Jijibisha, Quarterly (2056), Year 3, Issue 4. . Kathmandu: Ocr/it Sewa Sal1gh. LUltel, S. (1992). Women in Developmenl. Kathmandu: B.P. Luitel. Lllltel, S'. el. al (1997). Social...

Luintel, Samira


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Difference from Median in T11U per Topic Difference from ...  

Science Conference Proceedings (OSTI)

... &'(( )01&2)2342354 6'7 89@ )ABCCD E&p &'E2)4F E)25G 6H4I'05H4'4HP@ I2GH0Q 6RS TA23(3U HP VI0 QCCp QIA3521AH@ W44H44I0 ...



User Guide for the GREET Fleet Footprint Calculator 1.0 Beginning in 1998, the Department of Energy's (DOE's) Clean Cities Program enlisted expertise  

E-Print Network (OSTI)

Gas (LNG) Landfill Gas (LFG) Liquifed Petroleum Gas/ Propane (LPG) Electricity Gaseous Hydrogen (G.H2 in accordance with the desire to measure the petroleum displacement and greenhouse gas (GHG) emissions of medium represents the vehicle's operation activities. It is important to examine transportation fuels

Argonne National Laboratory



E-Print Network (OSTI)

LITTLEWOOD-TYPE PROBLEMS ON [0,1]. PEtER BoRwEin, TAm bAs eRD bElyi , AnD u bExA ? bos. ?R????? ' ??????d?f gh ???d kl mopRC ?s C?h?f?t.


Section 1: Interfacial Turbulence and AirWater Scalar Transfer Turbulence and wave dynamics across gasliquid interfaces 1  

E-Print Network (OSTI)

The calculation of the gas transfer between the ocean and atmosphere13 S.A. Kitaigorodskii The influence of wind relationship to airwater gas transfer rates51 D. Turney, S. Banerjee Turbulent gas flux measurements near the airwater interface in an oscillating-grid tank 65 J.G. Janzen, H.E. Schulz, G.H. Jirka Sensible and latent

Takada, Shoji



E-Print Network (OSTI)

3&F>7$7$Fahw$\\"1CxC=9Xy]F>Fjiw7$Fafw7$$\\"15d%fgN,* RF1$\\"1IQ4=yLLoF> 7$7$Fahw$\\"1'HSZRTN%oF>Fdjw7$7$F\\\\ewF\\\\gw7$$\\"1%e'Gh! =...



E-Print Network (OSTI)

of greenhouse gases CO2, CH4, and N2O VOC, CO, and NOx as optional GHGs GREET estimates emissions of five/Compression Are Key Steps for Gaseous H2 NA NG Recovery (97.5%) Compressed G.H2 at Refueling Stations LNG Gasification Critical for Evaluating Costs Define Pathways Estimate Fuel Demand Estimate Size of Facilities Capital


Exploring the hidden impacts of HomeSys: energy and emissions of home sensing and automation  

Science Conference Proceedings (OSTI)

Home sensing and automation systems are rarely discussed with reference to their direct energy demand, much less other environmental impacts such as greenhouse gas (GhG) emissions arising from their manufacture and transport. It is imperative that designers ... Keywords: embodied carbon, home energy, home systems

Oliver Bates, Mike Hazas



Methods of using thermal tolerant avicelase from Acidothermus cellulolyticus  

DOE Patents (OSTI)

The invention provides a thermal tolerant (thermostable) cellulase, AviIII, that is a member of the glycoside hydrolase (GH) family. AviIII was isolated and characterized from Acidothermus cellulolyticus, and, like many cellulases, the disclosed polypeptide and/or its derivatives may be useful for the conversion of biomass into biofuels and chemicals.

Adney, William S. (Golden, CO); Vinzant, Todd B. (Golden, CO); Ding, Shih-You (Golden, CO); Himmel, Michael E. (Golden, CO)



Thermal tolerant avicelase from Acidothermus cellulolyticus  

DOE Patents (OSTI)

The invention provides a thermal tolerant (thermostable) cellulase, AviIII, that is a member of the glycoside hydrolase (GH) family. AviIII was isolated and characterized from Acidothermus cellulolyticus and, like many cellulases, the disclosed polypeptide and/or its derivatives may be useful for the conversion of biomass into biofuels and chemicals.

Ding, Shi-You (Golden, CO); Adney, William S. (Golden, CO); Vinzant, Todd B. (Golden, CO); Himmel, Michael E. (Littleton, CO)



Thermal tolerant avicelase from Acidothermus cellulolyticus  

DOE Patents (OSTI)

The invention provides a thermal tolerant (thermostable) cellulase, AviIII, that is a member of the glycoside hydrolase (GH) family. AviIII was isolated and characterized from Acidothermus cellulolyticus and, like many cellulases, the disclosed polypeptide and/or its derivatives may be useful for the conversion of biomass into biofuels and chemicals.

Ding, Shi-You (Golden, CO); Adney, William S. (Golden, CO); Vinzant, Todd B. (Golden, CO); Himmel, Michael E. (Littleton, CO)



Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community  

Science Conference Proceedings (OSTI)

Development of cellulosic biofuels from non-food crops is currently an area of intense research interest. Tailoring depolymerizing enzymes to particular feedstocks and pretreatment conditions is one promising avenue of research in this area. Here we added a green-waste compost inoculum to switchgrass (Panicum virgatum) and simulated thermophilic composting in a bioreactor to select for a switchgrass-adapted community and to facilitate targeted discovery of glycoside hydrolases. Smallsubunit (SSU) rRNA-based community profiles revealed that the microbial community changed dramatically between the initial and switchgrass-adapted compost (SAC) with some bacterial populations being enriched over 20-fold. We obtained 225 Mbp of 454-titanium pyrosequence data from the SAC community and conservatively identified 800 genes encoding glycoside hydrolase domains that were biased toward depolymerizing grass cell wall components. Of these, ,10percent were putative cellulasesmostly belonging to families GH5 and GH9. We synthesized two SAC GH9 genes with codon optimization for heterologous expression in Escherichia coli and observed activity for one on carboxymethyl cellulose. The active GH9 enzyme has a temperature optimum of 50uC and pH range of 5.5 to 8 consistent with the composting conditions applied. We demonstrate that microbial communities adapt to switchgrass decomposition using simulated composting condition and that full-length genes can be identified from complex metagenomic sequence data, synthesized and expressed resulting in active enzyme.

Reddy, Amitha; Allgaier, Martin; Park, Joshua I.; Ivanoval, Natalia; Dhaeseleer, Patrik; Lowry, Steve; Sapra, Rajat; Hazen, Terry C.; Simmons, Blake A.; VanderGheynst, Jean S.; Hugenholtz, Philip



Benefits and Costs of Hydrogen Fuels  

E-Print Network (OSTI)

Processor Herbaceous Biomass Woody Biomass Petroleum Natural Gas Flared Gas Natural Gas #12;Production/Compression Pathways Gaseous H2 Liquid H2 Centralized Decentralized Electricity Methanol Flared Gas Landfill Gas Are Key Steps for Gaseous H2 NA NG Recovery (97.5%) Compressed G.H2 at Refueling Stations LNG Gasification

Argonne National Laboratory


Well-to-Wheels Energy and Emission Impacts of Vehicle/Fuel Systems  

E-Print Network (OSTI)

Biodiesel Corn Cellulosic Biomass Soybean Various Sources Electricity Flared Gas Landfill Gas Crude Naphtha Petroleum Conv. & Reform. Gasoline Conv. & Reform. Diesel Liquefied Petroleum Gas Compressed Natural Gas vs. MTBE #12;Production and Compression Are Key Steps for Centralized G.H2 Pathways NA NG Recovery

Argonne National Laboratory


ANL/ESD/TM-163 Development and Use of GREET 1.6  

E-Print Network (OSTI)

-fuel vehicle FG flared gas FRFG federal reformulated gasoline FT Fischer-Tropsch FTD Fischer-Tropsch diesel GC Soybeans Various Sources Electricity Flared Gas Landfill Gas Crude Naphtha Liquefied Petroleum Gas and from NNA flared gas (FG). In the latter two cases, for production of CNG, G.H2, and station-produced L

Argonne National Laboratory


Experimental Lung Research, 27:121 141, 2001 Copyright 2001 Taylor & Francis  

E-Print Network (OSTI)

Zhang Department of An atomy and Cell Biology, The University of Iowa, School of Medicine, Iowa City, The University of Iowa, School of Medicine, Iowa City, Iowa, USA Althou gh lymphoid enhancer binding factor-1 is not an adequate signal for initiating gland morphogenesis. Because Lef-1 forms a bipartite transcription factor

Engelhardt, John F.


Well-to-Wheels Energy Use, Greenhouse Gas Emissions, and Criteria Pollutant Emissions  

E-Print Network (OSTI)

for a given facility were divided by its throughput to develop emissions factors Distribution curves were and Storage (99%) Transportation, Storage, and Distribution of Gasoline (99.5%) MTBE or EtOH for Gasoline.5%) Steam or Electricity Export NA: North American nNA: non-North American NG: natural gas G.H2 Compression

Argonne National Laboratory


Abyssal Channel Flow in Ocean General Circulation Models with Application to the Vema Channel  

Science Conference Proceedings (OSTI)

An idealized Cox model is shown to pass a flux given by g?H2/2f though a deep channel, single grid-box wide, consistent with analytical models. This flux can, however, be significantly increased or decreased by the presence of density gradients ...

Martin R. Wadley; Grant R. Bigg



Workplace Violence Prevention Employee Awareness Class | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Workplace Violence Prevention Employee Awareness Class Workplace Violence Prevention Employee Awareness Class Workplace Violence Prevention Employee Awareness Class November 22, 2013 9:30AM to 1:00PM EST Course Title: Workplace Violence Prevention Employee Awareness Classes Course Start/End Date: November 5 -22, 2013 (see list of course sessions below) Forrestal Location (each class is 2.5 Hrs) Friday, November 8 1E-245 9:30 am Tuesday, November 12 6A-092 10:30 am Tuesday, November 12 6E-069 1:30 pm Thursday, November 14 GH-019 9:00 am Thursday, November 14 GH-019 1:00 pm Tuesday, November 19 GH-035 10:30 am Tuesday, November 19 GH-035 2:00 pm Wednesday, November 20 1E-245 9:00 am Wednesday, November 20 1E-245 1:00 am Friday, November 22 1E-245 9:00am Germantown Location (each class is 2.5 Hrs) Thursday, November 7 Large Auditorium 9:00 am


Ovine placental lactogen binds specifically to endometrial glands of the ovine uterus  

E-Print Network (OSTI)

A hormonal servomechanism has been proposed to regulate differentiation and function of the endometrial glandular epithelium (GE) in the ovine uterus during pregnancy that involves sequential actions of estrogen, progesterone, ovine interferon tau (IFN[T]), placental lactogen (oPL), and placental growth hormone (oGH). The biological actions of oPL in vitro are mediated by homodimerization of the PRL receptor (oPRLR) as well as heterodimerization of the oPRLR and oGH receptor (oGHR). The objectives of this study were to: (1) determine effects of intrauterine oPL, oGH and their combination on endometrial histoarchitecture and gene expression; (2) localize and characterize binding sites for oPL in the ovine uterus in vivo using an in situ ligand binding assay; and (3) determine temporal and spatial alterations in STAT 1, 3 and 5 expression in the pregnant ovine uterus. Intrauterine infusion of oPL and/or oGH following IFN[T] into ovariectomized ewes treated daily with progesterone differentially affected endometrial gland number and expression of uterine milk proteins and osteopontin. However, neither hormone affected PRLR, IGF-I or IGF-II mRNA levels in the endometrium. A chimeric protein of placental secretory alkaline phosphatase (SEAP) and oPL (SEAP-oPL) was used to identify and characterize binding sites for oPL in frozen sections of interplacentomal endometrium from pregnant ewes. Specific binding of SEAP-oPL was detected in the endometrial GE on Days 30, 60, 90, and 120 of pregnancy. In Day 90 endometrium, SEAP-oPL binding to the endometrial GE was displaced completely by oPL and oPRL, but only partially by oGH. Binding experiments using the extracellular domain of the oPRLR also showed that iodinated oPL binding could be competed by oPRL and oPL, but not by oGH. Collectively, results indicate that oPL binds to receptors in the endometrial glands and that PRL is more effective than GH for competing these binding sites. Thus, effects of oPL on the endometrial glands may be mediated by both PRLR and GHR.

Noel, Sekoni Daouda



Performance Evaluation of a Bedside Cardiac SPECT System  

Science Conference Proceedings (OSTI)

This paper reports on the initial performance evaluation of a bedside cardiac PET/SPECT system. The system was designed to move within a hospital to image critically-ill patients, for example, those in intensive care unit (ICU) or emergency room settings, who cannot easily be transported to a conventional SPECT or PET facility. The system uses two compact (25 cm times 25 cm) detectors with pixilated NaI crystals and position sensitive PMTs. The performance is evaluated for both 140 keV (Tc-99m) and 511 keV (F-18) emitters with the system operating in single photon counting (SPECT) mode. The imaging performance metrics for both 140 keV and 511 keV included intrinsic energy resolution, spatial resolution (intrinsic, system, and reconstructed SPECT), detection sensitivity, count rate capability, and uniformity. Results demonstrated an intrinsic energy resolution of 31% at 140 keV and 23% at 511 keV, a planar intrinsic spatial resolution of 5.6 mm full width half-maximum (FWHM) at 140 keV and 6.3 mm FWHM at 511 keV, and a sensitivity of 4.15 countsmiddotmuCi-1 ldr s-1 at 140 keV and 0.67 counts ldr muCi-1 ldr s-1 at 511 keV. To further the study, a SPECT acquisition using a dynamic cardiac phantom was performed, and the resulting reconstructed images are presented.

M.T. Studenski, D.R. Gilland, J.G. Parker, B. Hammond, S. Majewski, A.G. Weisenberger, V. Popov


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Scintillation time dependence and pulse shape discrimination in liquid argon  

SciTech Connect

Using a single-phase liquid argon detector with a signal yield of 4.85 photoelectrons per keV of electronic-equivalent recoil energy (keVee), we measure the scintillation time dependence of both electronic and nuclear recoils in liquid argon down to 5 keVee. We develop two methods of pulse shape discrimination to distinguish between electronic and nuclear recoils. Using one of these methods, we measure a background- and statistics-limited level of electronic recoil contamination to be 7.6x10{sup -7} between 52 and 110 keV of nuclear recoil energy (keVr) for a nuclear recoil acceptance of 50% with no nuclear recoil-like events above 62 keVr. Finally, we develop a maximum likelihood method of pulse shape discrimination based on the measured scintillation time dependence.

Lippincott, W. H.; McKinsey, D. N.; Nikkel, J. A. [Department of Physics, Yale University, New Haven, Connecticut 06511 (United States); Coakley, K. J. [National Institute of Standards and Technology, Boulder, Colorado 80305 (United States); Gastler, D.; Kearns, E. [Department of Physics, Boston University, Boston, Massachusetts 02215 (United States); Hime, A.; Stonehill, L. C. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)



Monitoring the Solidification of Single-Crystal Castings Using High ...  

Science Conference Proceedings (OSTI)

Work by Green11 extended XRD investigations to energies exceeding 150 keV. His flash XRD system also provided the facility for studying structural changes...


The High Temperature Stability of IN718 Derivative Alloys  

Science Conference Proceedings (OSTI)

standard specimens due to the limited availability of material. ... characterized using a transmission electron microscope (TEM) operated at 120 KeV and.


Aqueous Processing  

Science Conference Proceedings (OSTI)

"Cold-Weather Gold Heap-Leaching Operational Methods" (Overview), K.E. ..... " Tools for Optimizing Cu Electrodeposition: Modeling and Reagent Addition...


Recipient: 1999 Mehl Award  

Science Conference Proceedings (OSTI)

Dr. Ke has received several honors and awards, including citations for his participation in the Manhattan Project and the Long-Range Radar Project. He has...


Open Data Sites | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Kentucky - Open Door Kentucky: http:opendoor.ky.govtransparencyPagesdefault.aspx Kenya - Kenya: http:opendata.go.ke Louisiana - Louisiana: http:wwwprd.doa.louisiana.gov...


Research Highlights | ORNL Neutron Sciences  

NLE Websites -- All DOE Office Websites (Extended Search)

superconducting cable for the central solenoid (CS) magnetic system for US ITER begins next Tuesday, says Ke An, lead instrument scientist for the VULCAN Engineering...


Occupational Radiation Protection Program Inspection Criteria...  

NLE Websites -- All DOE Office Websites (Extended Search)

Inspection Criteria, Approach, and Lines of Inqu v Acting Di ector, Off'ke.-of Safety and Emergency Management Evaluations Date: '; 4 I &.- WJ Criteria Lead,...



NLE Websites -- All DOE Office Websites (Extended Search)

U.S.. Lawrence Berkeley National Laboratory; Iron & Steel Research Institute, Iron and Steel Industry, 2011. Zhou, Nan, Lynn K. Price, Nina Zheng, Jing Ke, and Ali Hasanbeigi....


3D Micron-resolution Laue Diffraction  

NLE Websites -- All DOE Office Websites (Extended Search)

by single rotation - Time resolution (4D) Grain outline determined - Ray tracing - conical slit - Back-projection tomography E>50 keV allows deep measurements Tensile...


Session II  

Science Conference Proceedings (OSTI)

Mar 13, 2012 ... Program Organizers: Qizhen Li, University of Nevada, Reno; Fuqian Yang, Univ. of Kentucky; Ke An, Oak Ridge National Laboratory Tuesday...


Pollutant transport and dispersion in large indoor spaces: A status report for the large space effort of the Interiors Project  

E-Print Network (OSTI)

k-e EVM, ASM, and DSM." ASHRAE Trans. 100(2), pp. 697-704.configurations." ASHRAE Trans. 100(l), pp. 1679- Todd, L.




NLE Websites -- All DOE Office Websites (Extended Search)

tunable x-ray energy from 5 to 25 keV. * Powder crystallography, including solving and refining crystal structures, quantitative analysis of phase fraction and sizestrain...


A synchrotron study of residual stresses in a Al6022 deep ...  

Science Conference Proceedings (OSTI)

... to reduce scrap and tooling costs, the modeling ... are within 3% of their average, thus justifying ... Despite the relatively low photon energy of 20keV the ...



Beamline 7.2  

NLE Websites -- All DOE Office Websites (Extended Search)

beamline GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range Port 1: 17 keV transmission though Mo...


Extinguishment of methane diffusion flames by carbon dioxide ...  

Science Conference Proceedings (OSTI)

... These were determined from a flammability map presented by Coward and Jones for methane in air diluted with CO2 [41]. ... [15] KE Lange, AT Perka ...



December 2011: JOM Article  

Science Conference Proceedings (OSTI)

Kinetic energy (KE) penetrators truly push materials to the extreme. ..... Equal channel angular extrusion has been investigated as an alternative processing...



NLE Websites -- All DOE Office Websites (Extended Search)

(Desc) Filters: Author is Hongyou Lu Clear All Filters 2013 Hasanbeigi, Ali, Lynn Price, Cecilia Fino-Chen, Hongyou Lu, and Jing Ke. "Retrospective and prospective...


Document (0k)  

NLE Websites -- All DOE Office Websites (Extended Search)

Lynn Price, Cecilia Fino-Chen, Hongyou Lu, and Jing Ke. "Retrospective and prospective decomposition analysis of Chinese manufacturing energy use and policy implications." Energy...


Current Sheet Permeability in Electromagnetic Pulsed Plasma Thrusters  

E-Print Network (OSTI)

in Pulsed Electromagnetic Accelerators. PhD thesis, Princeton University, 2002. [6] R.G. Jahn and K.E. Clark

Choueiri, Edgar

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Performance of steel-polymer and ceramic-polymer layered composites and concrete under high strain rate loadings  

E-Print Network (OSTI)

Results. SP: steel plate, PU: polyurea, KE: Kineticsample configurations: (a) SP-PU-SP (steel - polyurea -steel) (b) SP-PU-SP-PU (steel - polyurea - steel -

Samiee, Ahsan



NIST X-Ray Form Factor, Atten. Scatt. Tables Database ...  

Science Conference Proceedings (OSTI)

... Database Holdings. Elements: from Z = 1 (hydrogen) to Z = 92 (uranium). Energy range: threshold to 433 keV. Graphical Output with Table. ...


DANE TECHNICAL NOTE INFN -LNF, Accelerator Division  

E-Print Network (OSTI)

synchrotron power/beam (KW) 49 VRF (KV) @ Z/n = 2 254 @ Z/n = 1 127 Parasitic losses @ z = 3 cm (KeV/)** 7

Istituto Nazionale di Fisica Nucleare (INFN)


Agriculture Rural Energy Enterprise Development (AREED) | Open Energy  

Open Energy Info (EERE)

Enterprise Development (AREED) Enterprise Development (AREED) Jump to: navigation, search Name Agriculture Rural Energy Enterprise Development (AREED) Agency/Company /Organization United Nations Environment Programme Sector Climate, Energy Focus Area Agriculture, Biomass, Economic Development, Energy Efficiency Topics Co-benefits assessment, - Energy Access, - Environmental and Biodiversity, - Health, Finance Website http://www.areed.org/ Country Ghana, Mali, Tanzania, Senegal, Zambia Western Africa, Western Africa, Eastern Africa, Western Africa, Eastern Africa References AREED[1] Agriculture Rural Energy Enterprise Development (AREED) Screenshot "The United Nations Environment Programme's Rural Energy Enterprise Development (REED) initiative operates in Africa as AREED to develop new


Oilfields of the World. Third edition  

SciTech Connect

This third edition (updated to 1984) covers all of the world's major producing areas (both onshore and offshore) on six continents. It offers essential geologic, reserves, and production data on 13 nations that have become commercial oil producers in the last five years: Benin, Cameroon, Congo Republic, Ghana, Ivory Coast, Sudan, Zaire, Greece, The Phillippines, Sharjah, Thailand, Guatemala, and Surinam. Numerous maps display the geologic details of each area. This book also contains full-color maps of the oil and gas fields of the North Sea, Persian Gulf, Mexico, Venezuela, and Brazil.

Tiratsoo, E.N.



Market survey on products from the Tema Oil Refinery carried out as part of the feasibility study on the Tema Oil Refinery expansion project. Export trade information  

SciTech Connect

The Tema Oil Refinery (TOR), which was commissioned in 1963, is a simple hydroskimming plant which processes crude oil into LPG, gasoline, kerosene, gasoil, and fuel oil. It is the only petroleum refinery in Ghana. Over the years some of the equipment in the refinery has deteriorated or become obsolete necessitating major rehabilitation. A feasibility study is investigating the modernization and expansion of the refinery to meet projected market demands until the year 2005. The report presents the results of a market survey done on products from TOR.

Not Available



Forest Carbon Partnership Facility | Open Energy Information  

Open Energy Info (EERE)

Forest Carbon Partnership Facility Forest Carbon Partnership Facility Jump to: navigation, search Logo: Forest Carbon Partnership Facility Name Forest Carbon Partnership Facility Agency/Company /Organization World Bank Sector Land Focus Area Forestry Topics Co-benefits assessment, Finance Resource Type Lessons learned/best practices, Training materials Website http://www.forestcarbonpartner Country Argentina, Bolivia, Cambodia, Cameroon, Central African Republic, Chile, Colombia, Costa Rica, Democratic Republic of Congo, El Salvador, Equatorial Guinea, Ethiopia, Gabon, Ghana, Guatemala, Guyana, Honduras, Indonesia, Kenya, Laos, Laos, Liberia, Madagascar, Mexico, Moldova, Mozambique, Nepal, Nicaragua, Panama, Papua New Guinea, Paraguay, Peru, Republic of the Congo, Suriname, Tanzania, Thailand, Uganda, Vanuatu, Vietnam


GNEP Ministerial Attendees  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Senior Delegation Officials From All GNEP Participants Senior Delegation Officials From All GNEP Participants GNEP PARTNERS Australia John Carlson, Director General, Australian Safeguards and Non-Proliferation Office Bulgaria Chavdar Zhechev, Ambassador Extraordinary and Plenipotentiary of the Republic of Bulgaria to the United Nations China Chen Deming, Vice Chairman, National Development and Reform Commission France Alain Bugat, Chairman, French Atomic Energy Commission Ghana Joseph Adda, Minister for Energy Hungary József Rónaky, Director General, Hungarian Atomic Energy Authority Japan Yukiya Amano, Ambassador, Permanent Mission of Japan to the International Organizations in Vienna Jordan Khaled Toukan, Minister of Higher Education and Scientific Research Kazakhstan Kayrat Abdrakhmanov, Ambassador Extraordinary


UNEP Green Economy Advisory Services | Open Energy Information  

Open Energy Info (EERE)

Logo: UNEP Green Economy Advisory Services Name UNEP Green Economy Advisory Services Agency/Company /Organization United Nations Environment Programme (UNEP) Partner German Agency for International Cooperation (GIZ), Global Green Growth Knowledge Platform (GGKP), Green Jobs Initiative, United Nations Development Programme (UNDP), United Nations Department of Economic and Social Affairs (UNDESA) Sector Climate, Energy, Land, Water Focus Area People and Policy Topics Low emission development planning Country Armenia, Azerbaijan, Barbados, Burkina Faso, China, Egypt, Ghana, Indonesia, Jordan, Kenya, Korea, Mali, Mexico, Moldova, Mongolia, Montenegro, Morocco, Namibia, Nepal, Peru, Philippines, Russia, Rwanda, Senegal, Serbia, South Africa, Ukraine


African Biofuel & Renewable Energy Fund (ABREF) | Open Energy Information  

Open Energy Info (EERE)

Biofuel & Renewable Energy Fund (ABREF) Biofuel & Renewable Energy Fund (ABREF) Jump to: navigation, search Name African Biofuel & Renewable Energy Fund (ABREF) Agency/Company /Organization African Biofuel & Renewable Energy Compnay (ABREC) Sector Energy Focus Area Renewable Energy, Biomass, - Biofuels Website http://www.bidc-ebid.com/en/fo Country Benin, Burkina Faso, Cape Verde, Ivory Coast, Gambia, Ghana, Guinea, Guinea-Bissau, Liberia, Mali, Niger, Nigeria, Senegal, Sierra Leone, Togo Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa, Western Africa References African Biofuel & Renewable Energy Fund (ABREF)[1]


National Action Programmes on Desertification | Open Energy Information  

Open Energy Info (EERE)

Programmes on Desertification Programmes on Desertification Jump to: navigation, search Name National Action Programmes on Desertification Agency/Company /Organization United Nations Convention to Combat Desertification Sector Land Focus Area Forestry, Agriculture Topics Co-benefits assessment, GHG inventory, Policies/deployment programs, Background analysis Resource Type Publications Website http://www.unccd.int/actionpro Country Algeria, Benin, Botswana, Burkina Faso, Burundi, Cameroon, Cape Verde, Chad, Democratic Republic of Congo, Djibouti, Egypt, Equatorial Guinea, Eritrea, Ethiopia, Gabon, Gambia, Ghana, Guinea, Kenya, Lesotho, Madagascar, Malawi, Mali, Mauritania, Morocco, Mozambique, Namibia, Niger, Nigeria, Senegal, South Africa, Sudan, Swaziland, Tanzania, Togo, Tunisia, Uganda, Zambia, Zimbabwe


Facilitating Implementation and Readiness for Mitigation (FIRM) | Open  

Open Energy Info (EERE)

Facilitating Implementation and Readiness for Mitigation (FIRM) Facilitating Implementation and Readiness for Mitigation (FIRM) Jump to: navigation, search Logo: UNEP-Facilitating Implementation and Readiness for Mitigation (FIRM) Name UNEP-Facilitating Implementation and Readiness for Mitigation (FIRM) Agency/Company /Organization United Nations Environment Programme (UNEP) Partner Global Environment Facility (GEF), Government of Denmark Sector Climate, Energy, Land Topics Adaptation, Co-benefits assessment, - Environmental and Biodiversity, Finance, Implementation, Low emission development planning Website http://www.unep.org/climatecha Program Start 2011 Program End 2013 Country Costa Rica, Ethiopia, Ghana, Indonesia, Mexico, Morocco, Senegal, South Africa, Vietnam UN Region Central America References Facilitating Implementation and Readiness for Mitigation (FIRM)[1]


Geospatial Toolkit | Open Energy Information  

Open Energy Info (EERE)

Geospatial Toolkit Geospatial Toolkit Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Geospatial Toolkit (GsT) Agency/Company /Organization: National Renewable Energy Laboratory Sector: Energy Focus Area: Solar, Wind Phase: Determine Baseline Topics: Resource assessment Resource Type: Guide/manual, Software/modeling tools User Interface: Desktop Application Website: www.nrel.gov/applying_technologies/geospatial_toolkits.html Country: Afghanistan, Bangladesh, Bhutan, Brazil, China, El Salvador, Ghana, Guatemala, Honduras, India, Nepal, Nicaragua, Oaxaca, Pakistan, Sri Lanka, Turkey Cost: Free Southern Asia, Southern Asia, Southern Asia, South America, Eastern Asia, Central America, Western Africa, Central America, Central America, Southern Asia, Southern Asia, Central America, , Southern Asia, Southern Asia, Western Asia


Study of Thick CZT Detectors for X-ray and Gamma-ray Astronomy  

Science Conference Proceedings (OSTI)

CdZnTe (CZT) is a wide bandgap II-VI semiconductor developed for the spectroscopic detection of X-rays and {gamma}-rays at room temperature. The Swift Burst Alert Telescope is using an 5240 cm{sup 2} array of 2 mm thick CZT detectors for the detection of 15-150 keV X-rays from Gamma-ray Bursts. We report on the systematic tests of thicker (0.5 cm) CZT detectors with volumes between 2 cm{sup 3} and 4 cm{sup 3} which are potential detector choices for a number of future X-ray telescopes that operate in the 10 keV to a few MeV energy range. The detectors contacted in our laboratory achieve Full Width Half Maximum energy resolutions of 2.7 keV (4.5%) at 59 keV, 3 keV (2.5%) at 122 keV and 4 keV (0.6%) at 662 keV. The 59 keV and 122 keV energy resolutions are among the world-best results for 0.5 cm thick CZT detectors. We use the data set to study trends of how the energy resolution depends on the detector thickness and on the pixel pitch. Unfortunately, we do not find clear trends, indicating that even for the extremely good energy resolutions reported here, the achievable energy resolutions are largely determined by the properties of individual crystals. Somewhat surprisingly, we achieve the reported results without applying a correction of the anode signals for the depth of the interaction. Measuring the interaction depths thus does not seem to be a pre-requisite for achieving sub-1% energy resolutions at 662 keV.

Li Q.; De Geronimo G.; Beilicke, M.; Lee, K.; Garson III, A.; Guo, Q.; Martin, J.; Yin, Y.; Dowkontt, P.; Jung, I.; Krawczynski, H.



Gain-assisted control of the Goos-Haenchen shift  

SciTech Connect

A gain-assisted model is considered to study the Goos-Haenchen (GH) shift behavior in the reflected and transmitted light. In this model, a probe light is incident on a cavity containing three-level dilute gaseous atomic medium. The atom-field interaction follows two-photon Raman transitions, and the dielectric susceptibility of the medium exhibits dispersion and gain properties [L. J. Wang, A. Kuzmich, and A. Dogariu, Nature (London) 406, 227 (2000)]. Under appropriate conditions, two gain peaks are observed with anomalous dispersion between the peaks, whereas normal dispersion can be observed at and around the gain maxima. The manipulation of the detuning associated with the probe light field which interacts with the intracavity medium during its propagation through the cavity can lead to a control over negative and positive GH shift in the reflected and transmitted light beam via the anomalous and normal dispersion of the medium.

Ziauddin,; Qamar, Sajid [Centre for Quantum Physics, COMSATS Institute of Information Technology, Islamabad (Pakistan); Department of Physics, COMSATS Institute of Information Technology, Islamabad (Pakistan)



Workplace Violence Prevention: Employee Awareness Class | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Workplace Violence Prevention: Employee Awareness Class Workplace Violence Prevention: Employee Awareness Class Workplace Violence Prevention: Employee Awareness Class December 13, 2013 9:00AM to 3:30PM EST Registration: Federal employees should sign up directly in CHRIS ("NTC Workplace Violence" Course #002647) for one of the sessions below. Approved contractor employees should email Steven Martinez with name, organization and requested session. Walk-ins are welcome on a space available basis. Forrestal Location: Course #002647 (each class is 2.5 Hrs) #0024 Friday, December 13, GH-027 9:00-11:30 am #0025 Friday, December 13, GH-027 1:00-3:30 pm Germantown Location: Course #002647 (each class is 2.5 Hrs) #0026 Tuesday, December 10, E-114 9:00-11:30 am #0027 Tuesday, December 10, E-114 1:00-3:30 pm



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

These courses have immediate open registraton These courses have immediate open registraton PLEASE LOOK FOR US AT http://energy.gov/dvu/professional-skills-and-technical-training OFFICE OF LEARNING & WORKFORCE DEVELOPMENT Professional Skills & Technical Training Program FY 2014 Corporate Schedule Points of Contact: If you have any logistical/registration questions please contact: Shira Kimble at 202-586-8449 or 301-903-5116. Course Title: Course Date: Time: CHRIS Code: Session: Location: Trustworthy Customer Services NEW January 15-16, 2014 8:30am-4:00pm 002452 0001 Forrestal RM GH- 043 CSRS Retirement Seminar January 28-30, 2014 8:30am-4:00pm 000033 0091 Forrestal RM GH- 043 Managing Up Down & Across February 11-12, 2014


Hydrogen Delivery Options and Issues  

NLE Websites -- All DOE Office Websites (Extended Search)

Options and Issues Options and Issues Mark Paster DOE August, 2006 Scope * From the end point of central or distributed production (300 psi H2) to and including the dispenser at a refueling station or stationary power site - GH2 Pipelines and Trucks, LH2 Trucks, Carriers <$1.00/kg of Hydrogen by 2017 Hydrogen Delivery H2 Delivery Current Status * Technology - GH2 Tube Trailers: ~340 kg, ~2600 psi - LH2 Trucks: ~3900 kg - Pipelines: up to 1500 psi (~630 miles in the U.S.) - Refueling Site Operations (compression, storage dispensing): Demonstration projects * Cost (Does NOT include refueling Site Operations) - Trucks: $4-$12/kg - Pipeline: <$2/kg H2A Analysis * Consistent, comparable, transparent approach to hydrogen production and delivery cost analysis * Excel spreadsheet tools with common economic


Nonlinear Grassmann Sigma Models in Any Dimension and An Infinite Number of Conserved Currents  

E-Print Network (OSTI)

We first consider nonlinear Grassmann sigma models in any dimension and next construct their submodels. For these models we construct an infinite number of nontrivial conserved currents. Our result is independent of time-space dimensions and, therfore, is a full generalization of that of authors (Alvarez, Ferreira and Guillen). Our result also suggests that our method may be applied to other nonlinear sigma models such as chiral models, $G/H$ sigma models in any dimension.

Kazuyuki Fujii; Yasushi Homma; Tatsuo Suzuki



TransporTaTionresearch Group newsletter reporT 2010  

E-Print Network (OSTI)

for the future. The Transportation Research Group participated in the Transportation Research Board ConferenceTliGhT on TransiT research 6 selecTed publicaTions by The 7 miTsl research Group TransporTaTion research board 9 TransporTaTion sTudenT 13 inTernships sTudenT profiles 14 recenT alumni 14 special noTes 14 Transportation

Fernandez, Eduardo

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The conformal group, point particles and twistors  

Science Conference Proceedings (OSTI)

The massless particle action is interpreted as mechanics with a vanishing Hamiltonian on a phase space which is a coset space of the form G/H, where G is the conformal group and H is a certain subgroup. In dimensions 3, 4 and 6, twistor variables emerge naturally. In these same dimensions, the formalism cam be extended straightforwardly to superparticles. In this paper the [kappa] symmetry of the superparticle is interpreted as a part of the H gauge invariance of the action.

Howe, P.S.; West, P.C. (King's Coll., London (United Kingdom). Dept. of Mathematics)



230 JOURNAL OF DISPLAY TECHNOLOGY, VOL. 1, NO. 2, DECEMBER 2005 Reflective Direct-View Displays Using a Dye-Doped  

E-Print Network (OSTI)

such as Cole-Kashnow cell [3], White-Taylor cell [4] or double orthogonal cells [5]­[7] have been proposed are added and a 10:1 contrast ratio is demonstrated using a PDLC in a twisted cell [10]. The response time viewing angle. In this paper, we demonstrate a new GH LCD using a dye-doped DFLC gel to realize polarizer

Wu, Shin-Tson


Effects of zeranol on serum concentrations of growth hormone, IGF-I and metabolites and on carcass composition of lambs fed at two levels of intake  

E-Print Network (OSTI)

Forty crossbred wether lambs (average initial weight = 30 kg) were used to determine the effects of zeranol on carcass composition and metabolite concentrations in blood when fed at two levels of feeding: Lambs were implanted with zeranol (12 mg) at 30-d intervals and fed at two levels of feed intake (restricted and ad libitum) in a 2 x 2 factorial arrangement of treatments. Restricted fed lambs were fed to gain 50% of body weight gained by lambs allowed ad libitum access to feed. Lambs with ad libitum and restricted access to feed were slaughtered after 98 and 154 d, respectively. Zeranol increased average daily gains (ADG) and gain to feed by 20 (P <.05) and 17% (P < .03), respectively. Carcass fat percentage tended to be reduced by 7.4% in implanted lambs, however, there was no difference in daily fat gain (g/d) in implanted vs non implanted lambs. Yet zeranol increased carcass protein by 33%(P<.10). Restricted feeding reduced (P <.05) daily fat gain (40%) and CP gain (32%) but increased (P < .06) feed to gain (45%), percentage carcass ash (12%), and dressing percentage (9%). Zeranol increased pituitary weight (P <.001), plasma glucose (P <.05), mean serum growth hormone (GH; P < .05), baseline GH (P < .05), GH pulse amplitude (P < .05), and insulin-like growth factor-I (IGF-1; P < .00 1) levels by 40%, 13 %, 42%, 7 1 %, 33%, and 53%, respectively. Restricted feeding reduced(P<.10)serum IGF-I by 16%. These results indicate that continuous administration of zeranol alters the GH-IGF-I axis regulation of growth and carcass composition in lambs.

Scott, Patricia Lynn



A multiple filter test for change point detection in renewal processes with varying variance  

E-Print Network (OSTI)

, the algorithm successively searches for extreme values of the filtered derivative, similar to the techniques of in the interval (a, b] (0, T]. For each point t h we compare the number of events Nle := N(t-h,t]() and Nri := N(t,t+h]() in the left and right window (Figure 4 A). 0 h t-h t t+h T - h T h ( ] Nle ( ] Nri A T = 700 h = 75 -2 0 Gh

Neininger, Ralph


Fourth DOE Natural Phenomena Hazards Mitigation Conference: Proceedings. Volume 1  

SciTech Connect

This conference allowed an interchange in the natural phenomena area among designers, safety professionals, and managers. The papers presented in Volume I of the proceedings are from sessions I - VIII which cover the general topics of: DOE standards, lessons learned and walkdowns, wind, waste tanks, ground motion, testing and materials, probabilistic seismic hazards, risk assessment, base isolation and energy dissipation, and lifelines and floods. Individual papers are indexed separately. (GH)

Not Available




Gasoline and Diesel Fuel Update (EIA)

8) 8) June 2010 State Energy Price and Expenditure Estimates 1970 Through 2008 2008 Price and Expenditure Summary Tables Table S1a. Energy Price Estimates by Source, 2008 (Dollars per Million Btu) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i Coal Natural Gas a Petroleum Nuclear Fuel Biomass Total g,h,i Distillate Fuel Oil Jet Fuel b LPG c Motor Gasoline d Residual Fuel Oil Other e Total Wood and


.:-he submittfld Planu-scripr LJS been authored )y a contractor of the U. S. Government  

E-Print Network (OSTI)

- ::-..~~'- x-..-~ 4..co ~ ~ .,.. ~~ ~,... 4.2 6.4 I Sourc¡1 l¡ttl ~ .1 .1 0-20 0-30 9.6 13.2 ke~1 . ke~1

Kemner, Ken


Nuclear Instruments and Methods in Physics Research A 562 (2006) 401406 Generating a multi-line neutron beam using an electron  

E-Print Network (OSTI)

. Glasstone, Nuclear Reactor Theory, Robert E. Krieger Publishing Company (1970). [17] W.E. Lamb, Phys. Rev with the steady-state filtered neutron beams obtained using nuclear reactors [1­4]. The filter materials used in conjuc- tion with nuclear reactors are scandium (producing 2.03 keV neutron beams with a width DE$1:3 ke

Danon, Yaron


Improving the stability of a discrete least-squares method for membrane eigenvalue problems  

E-Print Network (OSTI)

-low background experiment since these sensors are made from germa- nium exposed in a nuclear reactor to fast to the missing mass. Generically predicted by supersym- metric (SUSY) theories, Weakly Interacting Massive detection experiment. A WIMP scat- tering induces a low energy (a few keV to a few tens of keV) nuclear

Vianello, Marco



NLE Websites -- All DOE Office Websites (Extended Search)

energiefreisetzender Reaktionen n 4 He Fusion Endprodukte Brennstoffe T D 20 keV 3,5 MeV 14,1 MeV 20 keV D + T 4 He + 1 n 1 eV 1,6022 x 10 -19 J. Die mittlere kinetische...



NLE Websites -- All DOE Office Websites (Extended Search)

physiques de ractions exothermiques n 4 He Fusion Produits Ractifs T D 20 keV 3,5 MeV 14,1 MeV 20 keV D + T 4 H e + 1 n 1 eV 1,6022 x 10 -19 J. L'nergie cintique...


Spectral unfolds of PITHON Flash X-ray source.  

SciTech Connect

Using a differential absorption spectrometer we obtained experimental spectral information for the PITHON Flash X-ray Machine located in San Leandro, California at L-3 Communications. Spectral information we obtained pertained to the 200 keV to 800 keV endpoint operation of PITHON. We also obtained data on the temporal behavior of high energy and low energy spectral content.

Zarick, Thomas Andrew; Sheridan, Timothy J.; Hartman, E. Frederick; Riordan, John C. (L-3 Pulse Sciences)



Requirements for anthrax toxin entry into cells  

E-Print Network (OSTI)

Med 163, 2527-2531. Beauregard, K.E. , Collier, R.J. , andU S A 100: 51705174. 7. Beauregard KE, Collier RJ, Swansonmedium (Fig. 1.2 and 1.3) (Beauregard et al. , 2000). PA 63

Ryan, Patricia Lynn



Mesoscale Energy Spectra of the Mei-Yu Front System. Part I: Kinetic Energy Spectra  

Science Conference Proceedings (OSTI)

The mesoscale kinetic energy (KE) spectra of the mei-yu front system are investigated through idealized numerical simulations. In the mature stage, the upper-tropospheric KE spectrum resembles a ?3 power law for wavelengths between 1000 and 400 km ...

Jun Peng; Lifeng Zhang; Yu Luo; Yun Zhang




E-Print Network (OSTI)

Si,5 Xl01}cm2 120 KeV,RTi E I I I I I LA,0.9JA::m2 ENE XBLSi, 7.5 x1o 1 o/ cm 2 120 KeV,RTi RANDOM '-- . J C2

Sadana, D.K.



Department of Energy Bonneville Power Administration  

E-Print Network (OSTI)

Department of Energy Bonneville Power Administration P.O. Box 3621 Portland, Oregon 97208. Delwiche ­ KE-4 J. Stier ­ KE-4 R. Austin ­ KEW-4 G. Dondlinger ­ KEWB-4 P. Lofy ­ KEWL-4 P. Krueger ­ KEWR


TRUPACT-II Hydrogen G-Valve Program Test Plan  

DOE Green Energy (OSTI)

This test plan describes the objectives, scope, participants, and components of the Transuranic Package Transporter-II (TRUPACT-II) Hydrogen G-Value Program (GH2P). The GH2P builds on the experience, results, and experimental setup of the TRUPACT-II Matrix Depletion Program (MDP) to establish effective hydrogen G-values (G-values) for additional waste matrices. This plan details the experimental design and test matrices for experiments to measure the G-value for additional waste matrices, including first- and second-stage sludges at the Idaho National Engineering and Environmental Laboratory, and molten salt extraction residues with varying amounts of residual moisture (i.e., unbound water). Data collected from the GH2P will be used to support an application to the US Nuclear Regulatory Commission for G-values and corresponding wattage limits for the TRUPACT-II payloads containing these waste matrices. The testing will also evaluate the ability to determine G-values on a waste stream basis.

Mroz, Eugene J.



Microwave proton source development for a high-current linac injector  

Science Conference Proceedings (OSTI)

Powerful CW proton linear accelerators (100-mA at 0.5--1.0 GeV) are being proposed for spallation neutron-source applications. A 75-keV, 110-mA dc proton injector using a microwave ion source is being tested for these applications. It has achieved 80-keV, 110-mA hydrogen-ion-beam operation. Video and dc beam-current toroid diagnostics are operational, and an EPICS control system is also operational on the 75-keV injector. A technical base development program has also been carried out on a 50-keV injector obtained from Chalk River Laboratories, and it includes low-energy beam transport studies, ion source lifetime tests, and proton-fraction enhancement studies. Technical base results and the present status of the 75-keV injector will be presented.

Sherman, J.; Bolme, G.; Geisik, C. [Los Alamos National Lab., NM (United States). Accelerator Operations and Technology Div.] [and others




NLE Websites -- All DOE Office Websites (Extended Search)

I mpact o n Developing C ountries 2012 INTERNATIONAL OPEN G OVERNMENT D ATA CONFERENCE Moderator: F ernando P erini, I DRC(Canada ) Jose M . A lonso, W orld W ide W eb F oundaCon Tim D avies, P racCcal P arCcipaCon; ( U.K.) Bjorn---Soren G igler, W orld B ank I nsCtute ( World B ank) Dorothy G ordon, K ofi A nnan C enter o f E xcellency i n I CT ( Ghana) William T evie, N aConal I nformaCon T echnology A gency ( Ghana) Organized b y t he W orld B ank a nd D ata.gov 2012 INTERNATIONAL O PEN G OVERNMENT D ATA C ONFERENCE Exploring t he I mpacts O f Open D ata i n t he S outh "EXPLORING T HE E MERGING I MPACTS O F O PEN D ATA I N T HE SOUTH" Call f or C oncept N otes --- O pen u nCl 1 0 September 2 012 * InsCtuCons i n d eveloping c ountries ( UniversiCes, N GOs, t hink--- tanks) * Research g rants b etween U SD25k


Kumasi Institute of Technology and Environment (KITE) | Open Energy  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Kumasi Institute of Technology and Environment (KITE) (Redirected from Kumasi Institute of Technology and Environment) Jump to: navigation, search Logo: Kumasi Institute of Technology Energy and Environment Name Kumasi Institute of Technology Energy and Environment Address P. O. Box AT 720, Achimota, Accra, Ghana. Place Ghana Number of employees 11-50 Year founded 1996 Phone number +233-302-256800-01 Coordinates 5.555717°, -0.196306° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":5.555717,"lon":-0.196306,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Endocrine manipulation of growth and tissue development of broiler chickens  

E-Print Network (OSTI)

This study evaluated the potential use of in ovo administration of exogenous endocrine compounds to enhance growth and reduce fat content of posthatch broiler chickens. Effects of in ovo administration of growth hormone (GH) plus triiodothyronine (T3)on growth and adiposity of broiler chickens were investigated in experiment 1. Vehicle or vehicle containing .1 ng T3 plus .25 mg GH, . 1 ng T, plus 2.5 mg GH or .1 ng T3 plus 25 mg GH were injected into the albumen of fertile eggs on day 11 of incubation. Female broilers from eggs injected with .1 ng T3 plus 25 mg GH had significantly greater body weights as compared to controls from 5 weeks to 7 weeks of age. Administration of .1 ng T3 plus 2.5 mg G H resulted in a significant (P <. 05) 20.5 % reduction in fat pad weight in males. The effect of manipulating estrogen status in ovo on posthatch growth rate and skeletal development was examined by two trials in experiment 2. Effects of in ovo administration of tamoxifen citrate (T) or 17f3-estradiol (E) on growth and fattening of broiler chickens were assessed in trial 1. At day one of incubation, either vehicle, vehicle containing 20 Mg of E or 200 Mg of T was injected into the albumen of fertile eggs. Neither sex ratios, body weight, fat pad weight nor adipose cellularity parameters were altered by the concentrations of T or E administered in trial 1. In trial 2, eggs from a commercially selected broiler line and from a population of Athens-Canadian Randombreds (AC) were injected with either vehicle or vehicle containing 500 mg of T. At three weeks of age, chicks were sampled for fat pad weight and gonadal sex. The higher concentrations of T administered in trial 2 resulted in significant modifications in phenotypic sex ratios at hatch in both genotypes. However, these phenotypic changes in sex ratios did not yield significant alterations in body weight, fat pad weight or skeletal development. In conclusion, in ovo endocrine administration resulted in modifications of growth and tissue development in broilers. However, the alterations were dependent on the type and concentration of hormone.

Borbolla Sosa, Arturo German



Genetic Variation in DNA of Coho Salmon from the Lower Columbia River : Final Report 1993.  

DOE Green Energy (OSTI)

The goal of this project was to develop techniques to provide the information needed to determine if Lower Columbia River coho salmon represent a 'species' under the Endangered Species Act. Our report features two new nuclear DNA approaches to the improved detection of genetic variation: (1) Studies of DNA-level genetic variation for two nuclear growth hormone genes; (2) Use of arbitrary DNA primers (randomly amplified polymorphic DNA, or 'RAPD' primers) to detect variation at large numbers of nuclear genes. We used the polymerase chain reaction (PCR) to amplify variable sections (introns) of two growth hormone genes (GH-I and G/f-Z) in several salmonid species. Coho salmon had three DNA length variants for G/-I intron C. Restriction analysis and sequencing provided valuable information about the mode of evolution of these DNA sequences. We tested segregation of the variants in captive broods of coho salmon, and demonstrated that they are alleles at a single Mendelian locus. Population studies using the GH-1 alleles showed highly significant frequency differences between Lower Columbia River and Oregon Coast coho salmon, and marginal differences among stocks within these regions. These new markers are adequately defined and tested to use in coho salmon population studies of any size. The nature of the variation at GH-1 (Variable Number Tandem Repeats, or 'VNTRs') suggests that more genetic variants will be found in coho salmon from other areas. GH-2 intron C also showed length variation in coho salmon, and this variation was found to be sex-linked. Because PCR methods require minute amounts of tissue, this discovery provides a technique to determine the gender of immature coho salmon without killing them. Chinook salmon had restriction patterns and sequence divergences similar to coho salmon. Thus, we expect that sex linkage of GH-2 alleles predates the evolutionary divergence of Pacific salmon species, and that gender testing with this system will work on the entire group. Rainbow trout do not show this sex-linked variation. Genetic markers detected by DNA amplification using arbitrary 10-basepair primers (Randomly Amplified Polymorphic DNA, or 'RAPD' markers), are the newest and most promising method of assessing variation at large numbers of genetic loci. We have demonstrated the inheritance of these markers in rainbow trout, and we have found multiple variable genetic markers in coho salmon. Feasibility studies on the use of RAPDs on large salmon collections are described.

Fobes, Stephen; Knudsen, Kathy; Allendorf, Fred



Gazette d'Amsterdam  

E-Print Network (OSTI)

Flandres[3 FLANDERS] complimenter Mons. le Con?table de Castille[2 CC], de la part du Roy[2 KE], sur sa venu? au pa?s bas, & sur la civilit? qu'il avoit d?ja faite ? Sa Majest?[2 KE]. *b Le Sieur Houard de Nortfolc[2 HOWARD OF NORFOLK], que le Roy[2 KE... ] est retourn? aux environs de c?te ville, ce qui fait fort murmurer les habitans du dehors, tant contre les troupes que contre leurs propres Magistrats. Et que les troupes qui sont dans le Pa?s-bas[3 PA?S-BAS] vivent avec tant de licence qu'elles volent...

Ries, Paul



Internal conversion coefficients in (134)Cs, (137)Ba, and (139)La: A precise test of theory  

E-Print Network (OSTI)

Recently we measured the ratio of K-shell internal conversion coefficients, alpha(K), for the 127.5-keV E3 transition in (134)Cs and the 661.7-keV M4 transition in (137)Ba. We here report a measurement of the 165.9-keV M1 transition in (139)La, based on which we convert our earlier ratio measurement into individual aK values for the transitions in (134)Cs and (137)Ba. These results continue to confirm the Dirac-Fock calculations of internal conversion coefficients that incorporate the atomic K-shell vacancy.

Nica, N.; Hardy, John C.; Iacob, V. E.; Balonek, C.; Trzhaskovskaya, M. B.



Biomarkers of Exposure to Foodborne and Environmental Carcinogens: Enterosorbent Intervention in a High Risk Population  

E-Print Network (OSTI)

The need to assess human exposures to foodborne and environmental carcinogens, particularly in populations at high risk for cancer and disease, has led to the development of chemical-specific biomarkers. Sensitive biomarkers for aflatoxin and polycyclic aromatic hydrocarbons (PAHs) have been useful in providing information on population exposure and reducing associated public health impacts. Aflatoxins are fungal metabolites found in a variety of foods. Among these toxins, aflatoxin B1 (AFB1) is the most predominant and hepatocarcinogenic. Acutely, AFB1 can cause disease and death, necessitating safe and effective intervention strategies. Inclusion of NovaSil (NS) clay in the diet represents a practical, sustainable approach. NS has been shown to prevent aflatoxicosis in multiple animal species by binding aflatoxins in the gastrointestinal tract, reducing toxin bioavailability. Co-exposure to PAHs, hazardous environmental contaminants, has been shown to increase the risk for hepatocellular carcinoma (HCC). Therefore, objectives of this research were to utilize biomarkers to assess aflatoxin and PAH exposures in susceptible populations in Ghana and the U.S. and to evaluate the safety and efficacy of NS intervention in Ghana (a population at risk for aflatoxicosis). After 3-month intervention with 3.0g NS/day, median aflatoxin M1 (an AFB1 metabolite) was significantly reduced (up to 58 percent) compared to the placebo group. Furthermore, no significant differences were found in levels of nutrient minerals between NS and placebo groups at baseline and 3-months suggesting NS can be used to effectively sorb AFB1 without affecting serum concentrations of important minerals. PAH biomarker results showed participants in Ghana were significantly exposed to high levels of PAHs based on the presence of 1-hydroxypyrene (1-OHP) in the majority of urines (98.9 percent). NS treatment had no effect on 1-OHP levels, further confirming the preferential binding of aflatoxins by NS. U.S. population data from a Hispanic community in Texas with an elevated incidence of HCC demonstrated a lower percentage and level of aflatoxin and PAH biomarkers. Aflatoxin M1 excretion, however, was associated with increased consumption of certain foods prone to aflatoxin contamination; thus, some individuals may be more vulnerable to exposure and associated interactions that increase the risk for HCC (e.g., PAHs or hepatitis infection).

Johnson, Natalie Malek



Gas Generation from K East Basin Sludges - Series II Testing  

Science Conference Proceedings (OSTI)

This report describes work to examine the gas generation behavior of actual K East (KE) Basin floor, pit and canister sludge. Mixed and unmixed and fractionated KE canister sludge were tested, along with floor and pit sludges from areas in the KE Basin not previously sampled. The first report in this series focused on gas generation from KE floor and canister sludge collected using a consolidated sampling technique. The third report will present results of gas generation testing of irradiated uranium fuel fragments with and without sludge addition. The path forward for management of the K Basin Sludge is to retrieve, ship, and store the sludge at T Plant until final processing at some future date. Gas generation will impact the designs and costs of systems associated with retrieval, transportation and storage of sludge.

Bryan, Samuel A.; Delegard, Calvin H.; Schmidt, Andrew J.; Sell, Rachel L.; Silvers, Kurt L.; Gano, Susan R.; Thornton, Brenda M.




E-Print Network (OSTI)

how it will phase into fusion reactor fueling experiments.of the application will be fusion reactor fueling, The workf or the Tokamak Fusion Tes t Reactor (TFTR), l20-keV D

Berkner, K.H.



Real-time RBS analysis of plasma erosion in DIONISOS  

E-Print Network (OSTI)

One of the primary scientific challenges still facing the development of commercial nuclear fusion reactors lies at the plasma-material boundary. Plasma temperatures greater than 10 million degrees Celsius (10 keV) require ...

Peterson, Ethan E. (Ethan Eric)



DOE-NABIR Pi Workshop: Abstracts  

E-Print Network (OSTI)

and synchrotron-based FTIR at the NSLS. Ke- togluconic acidand by XANES and EXAFS at the NSLS. Studies on the effect ofspectroscopy performed at the NSLS revealed changes in the




Ferromagnetism in Mn-Implanted Epitaxially Grown Ge on Si(100)  

E-Print Network (OSTI)

Radiation Lightsource (SSRL) beamline 2-1 at 10 keV x-rayRadiation Lightsource (SSRL). Both beamlines provideand Welch Foundation F-1191. SSRL and ALS are national user

Guchhait, S.



A Beamline for High-Pressure Studies at the Advanced Light Source with a Superconducting Bending Magnet as the Source  

E-Print Network (OSTI)

The Advanced Light Source (ALS) is a relatively low-energy (keV. The beam size in the ALS is small, due to the smallCompared to the prototype ALS superconducting bend magnet



High-Energy Synchrotron X-Ray Diffraction for In-Situ Study of ...  

Science Conference Proceedings (OSTI)

At the APS high-energy x-ray beamline 11-ID-C, we have employed 115 keV ... ( Use of the Advanced Photon Source was supported by the U. S. Department of...


Ionization Yield from Nuclear Recoils in Liquid-Xenon Dark Matter Detection  

E-Print Network (OSTI)

The ionization yield in the two-phase liquid xenon dark-matter detector has been studied in keV nuclear-recoil energy region. The newly-obtained nuclear quenching as well as the recently-measured average energy required to produce an electron-ion pair are used to calculate the total electric charges produced. To estimate the fraction of the electron charges collected, the Thomas-Imel model is generalized to describing the field dependence for nuclear recoils in liquid xenon. With free parameters fitted to experiment measured 56.5 keV nuclear recoils, the energy dependence of ionization yield for nuclear recoils is predicted, which increases with the decreasing of the recoiling energy and reaches the maximum value at 2~3 keV. This prediction agrees well with existing data and may help to lower the energy detection threshold for nuclear recoils to ~1 keV.

Mu, Wei




E-Print Network (OSTI)

. For exampl-e, if n z = 5 , p/POrn= I, Tec = 1 keV, R 5 0 . 5 m , assuming x L x andT N #12;L/H - 1, i t i

Karney, Charles


China Energy and Emissions  

NLE Websites -- All DOE Office Websites (Extended Search)

China Energy and Emissions Paths to 2030 (2 nd Edition) David Fridley, Nina Zheng, Nan Zhou, Jing Ke, Ali Hasanbeigi, Bill Morrow, and Lynn Price China Energy Group, Energy...


APS 7-BM Beamline: Information for Prospective Users  

NLE Websites -- All DOE Office Websites (Extended Search)

(1.5% bandpass, 5.5-11 keV energy range), a P6 shutter fixed in monochromatic mode, and a flat Pd-coated mirror deflecting upwards (rarely used). The 7-BM-B experimental station...


Beamline 6.0.2  

NLE Websites -- All DOE Office Websites (Extended Search)

(6-month cycle) Source characteristics 3.5-cm period undulator (U3) Energy range 250 eV- 1.5 keV Monochromator White light and VLS-PGM, with two gratings (250 and 1000 linesmm)...


Comparison of Fast Amplifiers for Diamond Detectors  

E-Print Network (OSTI)

The development of Chemical Vapour Deposition (CVD) diamond detectors requests for novel signal amplifiers, capable to match the superb signal-to-noise ratio and timing response of these detectors. Existing amplifiers are still far away from this goal and are the dominant contributors to the overall system noise and the main source of degradation of the energy and timing resolution. We tested a number of commercial amplifiers designed for diamond detector readout to identify the best solution for a particular application. This application required a deposited energy threshold below 100 keV and timing resolution of the order of 200 ps at 200 keV. None of tested amplifiers satisfies these requirements. The best solution to such application found to be the Cividec C6 amplifier, which allows 100 keV minimal threshold, but its coincidence timing resolution at 200 keV is as large as 1.2 ns.

M. Osipenko; S. Minutoli; P. Musico; M. Ripani; B. Caiffi; A. Balbi; G. Ottonello; S. Argir; S. Beol; N. Amapane; M. Masera; G. Mila



Electron beam diagnostic for space charge measurement of an ion beam  

E-Print Network (OSTI)

of approximately 1.2 keV. D. Geomagnetic field cancellationThe earth's geomagnetic field (primarily the verticalThe average vertical geomagnetic field is nominally 0.44 G



Dieselzymes: development of a stable and methanol tolerant lipase for biodiesel production by directed evolution  

E-Print Network (OSTI)

of desirable biodiesel production properties. Keywords:time to improve properties of a lipase for biodiesel produc-biodiesel production. J Biotechnol 2009, Arpigny JL, Jaeger KE: Bacterial lipolytic enzymes: classification and properties.

Korman, Tyler P; Sahachartsiri, Bobby; Charbonneau, David M; Huang, Grace L; Beauregard, Marc; Bowie, James U


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Employment Bulletin Board  

NLE Websites -- All DOE Office Websites (Extended Search)

user support in the area of tender (1- 5 keV) x-ray spectroscopy Excellent written and oral communications skills and be able to interact effectively in a team environment with...



E-Print Network (OSTI)

) continued studies using 125 keV/m 4 He ions from the Track Segment Facility to evalu- ate depleted uranium in depleted uranium-induced cellular effects 0.5 133 S. Ghandhi S. Amundson CRR Biology Bystander effects


Inverse Modeling of Intra-annual Variability in the Subtropical North Pacific  

Science Conference Proceedings (OSTI)

Climatological data on the oceanic and atmospheric variability are inverted to study seasonal variation of the Kuroshio Extension (KE) and the recirculation gyre to the south. The processed datasets include climatological fluxes of heat, salt, ...

Max Yaremchuk; Konstantin Lebedev



Liquid-tin-jet laser-plasma extreme ultraviolet generation P. A. C. Jansson,a)  

E-Print Network (OSTI)

liquid nitrogen,8 and argon9 for 1 keV, micros- copy and reflectometry , and hard x rays copper solutions of liquefied inert gases such as xenon. Finally, the new range of target materials allows improved flexibility


Instantaneous Wavelet Energetic Transfers between Atmospheric Blocking and Local Eddies  

Science Conference Proceedings (OSTI)

A new wavelet energetics technique, based on best-shift orthonormal wavelet analysis (OWA) of an instantaneous synoptic map, is constructed for diagnosing nonlinear kinetic energy (KE) transfers in five observed blocking cases. At least 90% of ...

Aim Fournier



A Nonlinear Theory of the Kuroshio Extension Bimodality  

Science Conference Proceedings (OSTI)

The Kuroshio Extension (KE) flow in the North Pacific Ocean displays a very distinctive decadal variability of bimodal character involving two completely different states (a large-meander elongated state and a small-meander contracted state) ...

Stefano Pierini; Henk A. Dijkstra; Angelo Riccio



High Aspect Ratio Semiconductor Heterojunction Solar Cells  

E-Print Network (OSTI)

High Aspect Ratio Semiconductor Heterojunction Solar Cells Haoting Shen Prof. Redwing's Research and in-situ dopant for Si nanowires Y. Ke, X.J. Weng, J.M. Redwing, C.M. Eichfeld, T.R. Swisher, S

Yener, Aylin


Estimation of Atmospheric Energetics in the Frequency Domain during the FGGE Year  

Science Conference Proceedings (OSTI)

The energetics of atmospheric motions are studied in the frequency domain using the two versions of the FGGE IIIb dataset, processed at GFDL and ECMWF. It is demonstrated that the frequency spectra of kinetic energy (KE) and available potential ...

Jian Sheng; Yoshikazu Hayashi



Proceedings Post-Accelerator Issues at IsoSpin Laboratory  

E-Print Network (OSTI)

to 1 keY/A, the voltage requirement is reduced to 140 kV,stability requirement of the preinjector voltage increaseseliminate the requirement of having high-voltage columns on

Chattopadhyay, S.



Vehicle Specifications  

NLE Websites -- All DOE Office Websites (Extended Search)

4WD VIN 1FMCU96H15KE18237 Vehicle Specifications Engine: 2.4 L 4-cylinder Electric Motor: 70 kW Battery: NiMH Seatbelt Positions: Five Features: Four wheel drive Regenerative...



NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Improvement and CO2 Emission Reduction Potentials in the Chinese Iron and Steel Industry." Energy 50 (2013): 315-325. 2012 Xu, Tengfang T., Joris Flapper, Jing Ke,...



NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Improvement and CO2 Emission Reduction Potentials in the Chinese Iron and Steel Industry." Energy 50 (2013): 315-325. Fridley, David, Nina Zheng, Nan Zhou, Jing Ke,...


Photon Sciences | Beamlines | CHX: Coherent Hard X-ray Scattering...  

NLE Websites -- All DOE Office Websites (Extended Search)

exceeding, for a photon energy near E8 keV, 1021 phsmrad2mm20.1 % bw (more than one order of magnitude higher than that of the Advanced Photon Source), the CHX beamline will...


A gamma- and X-ray detector for cryogenic, high magnetic field applications  

E-Print Network (OSTI)

As part of an experiment to measure the spectrum of photons emitted in beta-decay of the free neutron, we developed and operated a detector consisting of 12 bismuth germanate (BGO) crystals coupled to avalanche photodiodes (APDs). The detector was operated near liquid nitrogen temperature in the bore of a superconducting magnet and registered photons with energies from 5 keV to 1000 keV. To enlarge the detection range, we also directly detected soft X-rays with energies between 0.2 keV and 20 keV with three large area APDs. The construction and operation of the detector is presented, as well as information on operation of APDs at cryogenic temperatures.

Cooper, R L; Bales, M J; Bass, C D; Beise, E J; Breuer, H; Byrne, J; Chupp, T E; Coakley, K J; Dewey, M S; Fu, C; Gentile, T R; Mumm, H P; Nico, J S; O'Neill, B; Pulliam, K; Thompson, A K; Wietfeldt, F E



Retrospective and Prospective Decomposition Analysis of Chinese...  

NLE Websites -- All DOE Office Websites (Extended Search)

Use, 1995-2020 Publication Type Report LBNL Report Number LBNL-6028E Year of Publication 2013 Authors Hasanbeigi, Ali, Lynn K. Price, Cecilia Fino-Chen, Hongyou Lu, and Jing Ke...



NLE Websites -- All DOE Office Websites (Extended Search)

energy use and policy implications." Energy Policy (2013). Ke, Jing, Lynn K. Price, Michael A. McNeil, Nina Zheng Khanna, and Nan Zhou. Analysis and Practices of Energy...



NLE Websites -- All DOE Office Websites (Extended Search)

programs for appliances and equipment." Energy Policy (2013). Ke, Jing, Lynn K. Price, Michael A. McNeil, Nina Zheng Khanna, and Nan Zhou. Analysis and Practices of Energy...



U.S. Energy Information Administration (EIA)

PU Kenya KE Lesotho LT Liberia LI Libya LY Madagascar MA Malawi MI Mali ML Mauritania MR Mauritius MP Morocco MO Mozambique MZ Namibia WA Niger NG Nigeria NI Reunion ...


Discovering New Talents for Diamond | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

at normal incidence to the reflecting atomic planes for hard x-rays with a photon energy of E 24 keV. The reflectivity is significantly higher than that of Si crystals under...


Probing the Interface between Biological Systems and the Environment  

NLE Websites -- All DOE Office Websites (Extended Search)

sector 2BM of the APS, biofilms of Shewanella grown on multiple substrates were imaged at energies ranging from 13---18 keV and spatial scales of 0.7 and 1.4 mpixel. Improved...

Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Beamline 3.1  

NLE Websites -- All DOE Office Websites (Extended Search)

beamline GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 1-2 keV transmission through thin-film carbon...


Beamline 6.0.1  

NLE Websites -- All DOE Office Websites (Extended Search)

Yes Proposal cycle Proposals for General Sciences Beamlines (6-month cycle) Source characteristics 3-cm period undulator (U3) Energy range 2.3-9 keV Monochromator Double...


Stretching and twisting chromatin  

E-Print Network (OSTI)

16. Van Holde, K.E. (1989). Chromatin. Springer-Verlag, Newand C. Lange (1994). The 30 nm chromatin fiber as a felxible2003). The physics of chromatin. J. Phys. : Condens. Matter.

Dobrovolskaia, Irina V.; Dobrovolskaia, Irina V.




NLE Websites -- All DOE Office Websites (Extended Search)

All Filters 2012 Letschert, Virginie E., Nicholas Bojda, Jing Ke, and Michael A. McNeil. Estimate of Cost-Effective Potential for Minimum Efficiency Performance Standards in 13...


Biology Department - Brookhaven National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Operation and Methods Probe The STEM is operated at 40 keV with a probe focused to 0.25 nm. The sample is maintained at -150C to eliminate contamination and to reduce mass loss....


Experimental and numerical characterization of ion-cyclotron heated protons on the Alcator C-Mod tokamak  

E-Print Network (OSTI)

Energetic minority protons with -100 keV effective temperature are routinely created in Alcator C-Mod plasmas with the application of ICRF. A new multi-channel Compact Neutral Particle Analyzer is used to make measurements ...

Tang, Vincent, 1978-



Northern Hemisphere Winter Atmospheric Transient Eddy Heat Fluxes and the Gulf Stream and KuroshioOyashio Extension Variability  

Science Conference Proceedings (OSTI)

Spatial and temporal covariability between the atmospheric transient eddy heat fluxes (i.e., ??T? and ??q?) in the Northern Hemisphere winter (JanuaryMarch) and the paths of the Gulf Stream (GS), Kuroshio Extension (KE), and Oyashio Extension ...

Young-Oh Kwon; Terrence M. Joyce



Microprocessor Field Impactometer Calibration: Do We Measure Drops Momentum or Their Kinetic Energy?  

Science Conference Proceedings (OSTI)

This study presents the construction and calibration of a low-cost piezoelectric microprocessor impactometer designed for the field measurements of the rainfall kinetic energy (KE) flux. Its precise calibration was performed in laboratory ...

Pawe? Licznar; Janusz ?omotowski; S?awomir B?o?ski; Grzegorz J. Ciach




NLE Websites -- All DOE Office Websites (Extended Search)

David, Nina Zheng, Nan Zhou, Jing Ke, Ali Hasanbeigi, William R. Morrow, and Lynn K. Price. China Energy and Emissions Path to 2030., 2013. 2012 Zhou, Nan, John Romankiewicz,...


The Mesoscale Forcing of a Midlatitude Upper-Tropospheric Jet Streak by a Simulated Convective System. Part II: Kinetic Energy and Resolution Analysis  

Science Conference Proceedings (OSTI)

A kinetic energy (KE) analysis of the forcing of a mesoscale upper-tropospheric jet streak by organized diabaaic processes within the simulated convective system (SCS) that was discussed in Part I is presented in this study. The relative ...

Bart J. Wolf; Donald R. Johnson



Northern Hemisphere Winter Atmospheric Transient Eddy Heat Fluxes and the Gulf Stream and Kuroshio-Oyashio Extension Variability  

Science Conference Proceedings (OSTI)

Spatial and temporal co-variability between the atmospheric transient eddy heat fluxes (i.e. and ) in the Northern Hemisphere winter (January-March) and the paths of the Gulf Stream (GS), Kuroshio Extension (KE), and Oyashio Extension ...

Young-Oh Kwon; Terrence M. Joyce


Operator Manual  

Science Conference Proceedings (OSTI)

... Pressing the 'Defaults' button will restore the default choice of X-ray lines ... These defaults are based on an accelerating voltage of 20kV and a 20keV ...




Science Conference Proceedings (OSTI)

7zXZ*??F*!**t/????]9**P*?*?8=??*Ke??*???u?** ?BK??N,*iG?*?"t?,??w?v)%9?j?*>I?`??. ...



The KACST Heavy?Ion Electrostatic Storage Ring  

Science Conference Proceedings (OSTI)

A novel Electrostatic Storage Ring (ESR) for beams at energies up to 30keV/q is now being constructed at the National Centre for Mathematics and Physics (NCMP)

A. A. Almuqhim; S. M. Alshammari; M. O. A. El Ghazaly; A. I. Papash; C. P. Welsch



Analysis of 3D Elemental Mapping Artifacts in Biological ...  

Science Conference Proceedings (OSTI)

... studied the effects of different beam energies for generating ... the FIB-EDS technique for this type of sample. ... in this study, 5 keV beam energy is likely ...




NLE Websites -- All DOE Office Websites (Extended Search)

please contact, preferably via e-mail, Committee Members: Mailing Address: Ke Han KHan@lbl.gov Eric Linder Evlinder@lbl.gov Lawrence Berkeley National Laboratory 1 Cyclotron...


Identification of the slow E3 transition 136mCs -> 136Cs with conversion electrons  

E-Print Network (OSTI)

We performed at ISOLDE the spectroscopy of the decay of the 8- isomer in 136Cs by and conversion-electron detection. For the first time the excitation energy of the isomer and the multipolarity of its decay have been measured. The half-life of the isomeric state was remeasured to T1/2 = 17.5(2) s. This isomer decays via a very slow 518 keV E3 transition to the ground state. In addition to this, a much weaker decay branch via a 413 keV M4 and a subsequent 105 keV E2 transition has been found. Thus we have found a new level at 105 keV with spin 4+ between the isomeric and the ground state. The results are discussed in comparison to shell model calculations.

K. Wimmer; U. Koester; P. Hoff; Th. Kroell; R. Kruecken; R. Lutter; H. Mach; Th. Morgan; S. Sarkar; M. Saha Sarkar; W. Schwerdtfeger; P. C. Srivastava; P. G. Thirolf; P. Van Isacker



PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and K.E. Waldrip Sandia National Laboratories PO Box 5800 Albuquerque, NM 87185-0614 High Voltage Electrochemical Capacitor presented at EESAT 2007 September 23-27, 2007 PEER...


Sea Level Pressure Minimum along the Kuroshio and Its Extension  

Science Conference Proceedings (OSTI)

Atmospheric effects of sea surface temperature (SST) fronts along the Kuroshio and Kuroshio Extension (K-KE) are investigated by examining spatial characteristics of the climatological sea level pressure (SLP), surface winds and surface heat flux (...

Youichi Tanimoto; Tomohisa Kanenari; Hiroki Tokinaga; Shang-Ping Xie



Password based key exchange with mutual authentication  

Science Conference Proceedings (OSTI)

A reasonably efficient password based key exchange (KE) protocol with provable security without random oracle was recently proposed by Katz, et al. [17] and later by Gennaro and Lindell [13]. However, these protocols do not support mutual authentication ...

Shaoquan Jiang; Guang Gong


Note: This page contains sample records for the topic "gh ghana ke" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Available Technologies: Novel High-Performance Scintillators ...  

Oil exploration ; X-ray detection; ADVANTAGES: Extremely high light yield (80,000+ photons/MeV) ... (full width half maximum of the 662 keV absorption ...


A Search for Muon Neutrinos from Gamma-Ray Bursts wih the IceCube 22-String Detector.  

E-Print Network (OSTI)

??Two searches are conducted for muon neutrinos from Gamma-Ray Bursts (GRBs) using the IceCube detector. Gamma-Ray Bursts are brief and transient emissions of keV/MeV radiation (more)

Roth, A Philip




E-Print Network (OSTI)

.0 cm Synchr. radiation loss U0 9.3 keV/turn Damping time / x 17.8/36.0 ms RF voltage Vrf 100 ÷ 250 k

Istituto Nazionale di Fisica Nucleare (INFN)


Publications Portal  

Science Conference Proceedings (OSTI)

... Hui Chen, Albert Henins Abstract: Photon spectra in the energy range 60 keV to 1 MeV were recorded from targets irradiated by the LLNL Titan and ...



SciTech Connect: "smart grid"  

Office of Scientific and Technical Information (OSTI)

Observations of GRB 090510: a Short Hard Gamma-Ray Burst with an Additional, Hard Power-Law Component from 10 KeV to GeV Energies Citation Details In-Document Search Title: Fermi...


Direct Imaging of Lattice Atoms and Topological Defects in ...  

of the thin regions, thereby pinning them down by hydro- ... maximum energy that can be transferred from an 80 keV electron to a carbon atom is 15.6 eV, ...


The Pattern of Correlated X-ray Timing and Spectral Behavior in GRS 1915+105  

E-Print Network (OSTI)

From data obtained from the PCA in the 2-11 keV and 11-30.5 keV energy range, GRS 1915+105 is seen during RXTE observations between 1996 May and October on two separate branches in a hardness intensity diagram. On the hard branch, GRS 1915+105 exhibits narrow quasi-periodic oscillations ranging from 0.5 to 6 Hz with ${\\Delta \

Xingming Chen; Jean H. Swank; Ronald E. Taam



Iron K line Variability in the Low-Luminosity AGN NGC 4579  

E-Print Network (OSTI)

We present results of new ASCA observations of the low-luminosity AGN (LLAGN) NGC 4579 obtained on 1998 December 18 and 28, and we report on detection of variability of an iron K emission line. The X-ray luminosities in the 2--10 keV band for the two observations are nearly identical (LX $\\approx$ 2$\\times10^{41}$ ergs/s), but they are $\\sim$35% larger than that measured in 1995 July by Terashima et al. An Fe K emission line is detected at $6.39\\pm0.09$ keV (source rest frame) which is lower than the line energy $6.73^{+0.13}_{-0.12}$ keV in the 1995 observation. If we fit the Fe lines with a blend of two Gaussians centered at 6.39 keV and 6.73 keV, the intensity of the 6.7 keV line decreases, while the intensity of the 6.4 keV line increases, within an interval of 3.5 yr. This variability rules out thermal plasmas in the host galaxy as the origin of the ionized Fe line in this LLAGN. The detection and variability of the 6.4 keV line indicates that cold matter subtends a large solid angle viewed from the nucleus and that it is located within $\\sim1$ pc from the nucleus. It could be identified with an optically thick standard accretion disk. If this is the case, a standard accretion disk is present at the Eddington ratio of $L_{\\rm Bol}/L_{\\rm Eddington} \\sim 2\\times10^{-3}$. A broad disk-line profile is not clearly seen and the structure of the innermost part of accretion disk remains unclear.

Y. Terashima; L. C. Ho; A. F. Ptak; T. Yaqoob; H. Kunieda; K. Misaki; P. J. Serlemitsos



Low energy tracking and particles identification in the MUNU Time Projection Chamber at 1 bar. Possible application in low energy solar neutrino spectroscopy  

E-Print Network (OSTI)

In this paper we present the results from the measurements made with the MUNU TPC at 1bar pressure of CF4 in the energy region below 1 MeV. Electron events down to 80 keV are successfully measured. The electron energy and direction are reconstructed for every contained single electron above 200 keV. As test the 137Cs photopeak is reconstructed by measuring both the energy and direction of the Compton electrons in the TPC.

Z. Daraktchieva; C. Amsler; M. Avenier; C. Broggini; J. Busto; C. Cerna; F. Juget; D. H. Koang; J. Lamblin; D. Lebrun; O. Link; G. Puglierin; A. Stutz; A. Tadsen; J. -L. Vuilleumier; J. -M. Vuilleumier; V. Zacek




SciTech Connect

We present a Chandra observation of IRAS 19254-7245, a nearby ultraluminous infrared galaxy also known as the Superantennae. The high spatial resolution of Chandra allows us to disentangle for the first time the diffuse starburst (SB) emission from the embedded Compton-thick active galactic nucleus (AGN) in the southern nucleus. No AGN activity is detected in the northern nucleus. The 2-10 keV spectrum of the AGN emission is fitted by a flat power law ({Gamma} = 1.3) and an He-like Fe K{alpha} line with equivalent width {approx}1.5 keV, consistent with previous observations. The Fe K{alpha} line profile could be resolved as a blend of a neutral 6.4 keV line and an ionized 6.7 keV (He-like) or 6.9 keV (H-like) line. Variability of the neutral line is detected compared with the previous XMM-Newton and Suzaku observations, demonstrating the compact size of the iron line emission. The spectrum of the galaxy-scale extended emission excluding the AGN and other bright point sources is fitted with a thermal component with a best-fit kT of {approx}0.8 keV. The 2-10 keV luminosity of the extended emission is about one order of magnitude lower than that of the AGN. The basic physical and structural properties of the extended emission are fully consistent with a galactic wind being driven by the SB. A candidate ultraluminous X-ray source is detected 8'' south of the southern nucleus. The 0.3-10 keV luminosity of this off-nuclear point source is {approx}6 Multiplication-Sign 10{sup 40} erg s{sup -1} if the emission is isotropic and the source is associated with the Superantennae.

Jia Jianjun; Heckman, Timothy M. [Department of Physics and Astronomy, Johns Hopkins University, Baltimore, MD 21218 (United States); Ptak, Andrew [Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Braito, Valentina [INAF-Osservatorio Astronomico di Brera, via Brera 28, I-20121 Milano (Italy); Reeves, James [Astrophysics Group, School of Physical and Geographical Sciences, Keele University, Keele, Staffordshire ST5 5BG (United Kingdom)



Plasma measurements with surface barrier detectors  

DOE Green Energy (OSTI)

A surface barrier detector system for measuring the loss rate of protons from a hydrogen plasma and their energy spectrum is described. A full width at half maximum (FWHM) resolution of 1.4 keV for 15-keV hydrogen atoms was obtained using a selected detector having a sensitive area of 3 mm/sup 2/ and a depletion depth of 700 microns.

Futch, A.H. Jr.; Bradley, A.E.



HAPO Plant and capital equipment budget for FY 1966 and revision of budget for FY 1965 equipment not related to construction projects  

SciTech Connect

This document is divided into: byproduct horizontal control rod system (5 reactors); high-speed scanning-effluent temperature monitoring system (KE reactor); improved reactor gas system (100-KE & KW); safety circuit system modifications (5 reactors); alternate process hot die sizing, 313 Building 300 Area; button line equipment (234-5 Building); in-tank waste solidification (3rd unit); and misc. minor equipment projects.

McDonald, J.E.




E-Print Network (OSTI)

to the light curve for long-duration gamma-ray bursts (GRBs), i.e., a broken power law with a late time slope -- gamma rays: bursts -- supernovae: general -- X-rays: individual (XRF 030723) 1. INTRODUCTION X-ray (covering 2­25 keV) that did not trigger the Gamma Ray Burst Monitor (covering 40­700 keV). Beppo

Greiner, Jochen


Evaluation and Recommendation of Waste Form and Packaging for Disposition of the K East Basin North Loadout Pit Sludge  

SciTech Connect

This report discusses the recommendation from the Pacific Northwest National Laboratory (PNNL) to Fluor Hanford regarding the treatment of the Hanford K East Basin North Loadout Pit (KE NLOP) sludge to produce contact handled transuranic waste (CH-TRU) for disposal at the Waste Isolation Pilot Plant (WIPP). The recommendation was supported in part by chemical and radiochemical characterization analyses (provided in this report) performed on a sample of KE NLOP sludge.

Mellinger, George B.; Delegard, Calvin H.; Schmidt, Andrew J.; Sevigny, Gary J.



Astrophysical S factors of radiative {sup 3}He{sup 4}He, {sup 3}H{sup 4}He, and {sup 2}H{sup 4}He capture  

Science Conference Proceedings (OSTI)

The possibility of describing the astrophysical S factors for radiative {sup 3}He{sup 4}He capture at energies of up to 15 keV and radiative {sup 3}H{sup 4}He and {sup 2}H{sup 4}He capture at energies of up 5 keV is considered on the basis of the potential cluster model involving forbidden states.

Dubovichenko, S. B., E-mail: sergey@dubovichenko.r [National Academy of Sciences of the Republic of Kazakstan, Fesenkov Astrophysical Institute (Kazakhstan)



Structure Determination and Functional Analysis of a Chromate Reductase from Gluconacetobacter hansenii  

Science Conference Proceedings (OSTI)

Environmental protection through biological mechanisms that aid in the reductive immobilization of toxic metals (e.g.,chromate and uranyl) has been identified to involve specific NADH-dependent flavoproteins that promote cell viability. To understand the enzyme mechanisms responsible for metal reduction, the enzyme kinetics of a putative chromate reductasefrom Gluconacetobacter hansenii (Gh-ChrR) was measured and the crystal structure of the protein determined at 2.25 Aresolution. Gh-ChrR catalyzes the NADH-dependent reduction of chromate, ferricyanide, and uranyl anions under aerobic conditions. Kinetic measurements indicate that NADH acts as a substrate inhibitor; catalysis requires chromate binding prior to NADH association. The crystal structure of Gh-ChrR shows the protein is a homotetramer with one bound flavin mononucleotide (FMN) per subunit. A bound anion is visualized proximal to the FMN at the interface between adjacentsubunits within a cationic pocket, which is positioned at an optimal distance for hydride transfer. Site-directed substitutions of residues proposed to involve in both NADH and metal anion binding (N85A or R101A) result in 9095% reductions in enzyme efficiencies for NADH-dependent chromate reduction. In comparison site-directed substitution of a residue (S118A) participating in the coordination of FMN in the active site results in only modest (50%) reductions in catalytic efficiencies, consistent with the presence of a multitude of side chains that position the FMN in the active site. The proposed proximity relationships between metal anion binding site and enzyme cofactors is discussed in terms of rational design principles for the use of enzymes in chromate and uranyl bioremediation.

Jin, Hongjun; Zhang, Yanfeng; Buchko, Garry W.; Varnum, Susan M.; Robinson, Howard; Squier, Thomas C.; Long, Philip E.



Nickel-iron battery system safety. Final report  

DOE Green Energy (OSTI)

Eagle-Picher Industries conducted a literature search and experimental tests to characterize the generated flow rates of gaseous hydrogen (GH/sub 2/) and gaseous oxygen (GO/sub 2/) from an electrical vehicle (EV) nickel-iron battery system. The resulting gassing rates were used to experimentally evaluate the flame quenching capabilities of several candidate devices to prevent the propagation of flame within batteries having central watering/venting systems. The battery generated hydrogen (GH/sub 2/) and oxygen (GO/sub 2/) gasses were measured for a complete charge and discharge cycle. The data correlates well with accepted theory during strong overcharge conditions indicating that the measurements are valid for other portions of the cycle. Tests have confirmed that the gas mixture in the cells is always flammable regardless of the battery status. Research of flame arrestor literature yielded little information regarding their operation with hydrogen-oxygen mixtures. It was indicated that a conventional flame arrestor would not be effective over the broad spectrum of gassing conditions presented by a nickel-iron battery. Four different types of protective devices were evaluated. A foam-metal arrestor design was successful in quenching GH/sub 2/-GO/sub 2/ flames, however; the application of this flame arrestor to individual cell or module protection in a battery is problematic. A possible rearrangement of the watering/venting system to accept the partial protection of simple one-way valves is presented. This in combination with the successful foam-metal arrestor as main vent protection, could result in a significant improvement in battery protection. This concept was not tested.

Saltat, R.



Earth Occultation Imaging of the Low Energy Gamma-Ray Sky with GBM  

E-Print Network (OSTI)

The Earth Occultation Technique (EOT) has been applied to Fermi's Gamma-ray Burst Monitor (GBM) to perform all-sky monitoring for a predetermined catalog of hard X-ray/soft gamma-ray sources. Imaging with a Differential filter using the Earth Occultation Method (IDEOM) has been developed to search for sources not in the catalog, thus completing the catalog and reducing a source of systematic error in EOT. IDEOM is a tomographic imaging method that takes advantage of the orbital precession of the Fermi satellite. Using IDEOM, all-sky images have been generated for ~4 years of GBM data in the 12-50 keV, 50-100 keV and 100-300 keV energy bands in search of sources otherwise unmodeled by the GBM occultation analysis. Analysis resulted in the detection of 43 sources in the 12-50 keV energy band, 23 sources in the 50-100 keV energy band, and 7 sources in the 100-300 keV energy band. IDEOM analysis has resulted in the addition of 16 sources to the GBM-EOT catalog. We also present the first joined averaged spectra fo...

Rodi, J; Case, G L; Camero-Arranz, A; Chaplin, C; Finger, M H; Jenke, P; Wilson-Hodge, C A



Determination of the displacement energy of O, Si and Zr under electron beam irradiation  

Science Conference Proceedings (OSTI)

The response of nanocrystalline, stabilizer-free cubic zirconia thin films on a Si substrate to electron beam irradiation with energies of 4, 110 and 200 keV and fluences up to {approx}1.5 x 10{sup 22} e m{sup -2} has been studied to determine the displacement energies. The 110 and 200 keV irradiations were performed in situ using a transmission electron microscope; the 4 keV irradiations were performed ex situ using an electron gun. In all three irradiations, no structural modification of the zirconia was observed, despite the high fluxes and fluences. However the Si substrate on which the zirconia film was deposited was amorphized under the 200 keV electron irradiation. Examination of the electron-solid interactions reveals that the kinetic energy transfer from the 200 keV electrons to the silicon lattice is sufficient to cause atomic displacements, resulting in amorphization. The kinetic energy transfer from the 200 keV electrons to the oxygen sub-lattice of the zirconia may be sufficient to induce defect production, however, no evidence of defect production was observed. The displacement cross-section value of Zr was found to be {approx}400 times greater than that of O indicating that the O atoms are effectively screened from the electrons by the Zr atoms, and, therefore, the displacement of O is inefficient.

Edmondson, Philip D [ORNL; Weber, William J [ORNL; Namavar, Fereydoon [University of Nebraska Medical Center; Zhang, Yanwen [ORNL



Determination of the 242Pu Branching Ratio via Alpha-Gamma Coincidence  

Science Conference Proceedings (OSTI)

When the burn-up is high, the {sup 242}Pu isotopic content becomes more important. The traditional correlation method will fail. The {sup 242}Pu isotopic content in the sample plays an essential role if the neutron coincidence method is used to quantify the total amount of plutonium. In one of the earlier measurements we had a chance to measure an isotopic pure (> 99.95 %) {sup 242}Pu thick sample and realized that the difference in the branching ratio (BR) value among current nuclear data3) for the two important gamma-rays at 103.5-keV and 158.8-keV. In this study, the thick sample was counted on a 15% ORTEC safeguards type HPGe to further improve BR determination of the 159-keV gamma-ray. Furthermore, we have made a thin {sup 242}Pu sample from the thick sample and performed alpha-gamma coincidence measurements. Our preliminary gamma-ray BR results are 4.37(6) E-4, 2.79(8) E-5, and 2.25(8) E-6 for 44.9-keV, 103.5-keV, and 158.9-keV, respectively.

Wang, T F
