Sample records for getters tested bone

  1. Performance testing of aged hydrogen getters against criteria for interim safe storage of plutonium bearing materials.

    SciTech Connect (OSTI)

    Shepodd, Timothy J.; Nissen, April; Buffleben, George M.

    2006-01-01T23:59:59.000Z

    Hydrogen getters were tested for use in storage of plutonium-bearing materials in accordance with DOE's Criteria for Interim Safe Storage of Plutonium Bearing Materials. The hydrogen getter HITOP was aged for 3 months at 70 C and tested under both recombination and hydrogenation conditions at 20 and 70 C; partially saturated and irradiated aged getter samples were also tested. The recombination reaction was found to be very fast and well above the required rate of 45 std. cc H2h. The gettering reaction, which is planned as the backup reaction in this deployment, is slower and may not meet the requirements alone. Pressure drop measurements and {sup 1}H NMR analyses support these conclusions. Although the experimental conditions do not exactly replicate the deployment conditions, the results of our conservative experiments are clear: the aged getter shows sufficient reactivity to maintain hydrogen concentrations below the flammability limit, between the minimum and maximum deployment temperatures, for three months. The flammability risk is further reduced by the removal of oxygen through the recombination reaction. Neither radiation exposure nor thermal aging sufficiently degrades the getter to be a concern. Future testing to evaluate performance for longer aging periods is in progress.

  2. Combination moisture and hydrogen getter

    DOE Patents [OSTI]

    Not Available

    1982-04-29T23:59:59.000Z

    A combination moisture and hydrogen getter comprises (a) a moisture getter comprising a readily oxidizable metal; and (b) a hydrogen getter comprising (i) a solid acetylenic compound and (ii) a hydrogenation catalyst. A method of scavenging moisture from a closed container uses the combination moisture and hydrogen getter to irreversibly chemically reduce the moisture and chemically bind the reusltant hydrogen.

  3. Improved Hydrogen Gas Getters for TRU Waste -- Final Report

    SciTech Connect (OSTI)

    Mark Stone; Michael Benson; Christopher Orme; Thomas Luther; Eric Peterson

    2005-09-01T23:59:59.000Z

    Alpha radiolysis of hydrogenous waste and packaging materials generates hydrogen gas in radioactive storage containers. For that reason, the Nuclear Regulatory Commission limits the flammable gas (hydrogen) concentration in the Transuranic Package Transporter-II (TRUPACT-II) containers to 5 vol% of hydrogen in air, which is the lower explosion limit. Consequently, a method is needed to prevent the build up of hydrogen to 5 vol% during the storage and transport of the TRUPACT-II containers (up to 60 days). One promising option is the use of hydrogen getters. These materials scavenge hydrogen from the gas phase and irreversibly bind it in the solid phase. One proven getter is a material called 1,4-bis (phenylethynyl) benzene, or DEB, characterized by the presence of carbon-carbon triple bonds. Carbon may, in the presence of suitable precious metal catalysts such as palladium, irreversibly react with and bind hydrogen. In the presence of oxygen, the precious metal may also eliminate hydrogen by catalyzing the formation of water. This reaction is called catalytic recombination. DEB has the needed binding rate and capacity for hydrogen that potentially could be generated in the TRUPACT II. Phases 1 and 2 of this project showed that uncoated DEB performed satisfactorily in lab scale tests. Based upon these results, Phase 3, the final project phase, included larger scale testing. Test vessels were scaled to replicate the ratio between void space in the inner containment vessel of a TRUPACT-II container and a payload of seven 55-gallon drums. The tests were run with an atmosphere of air for 63.9 days at ambient temperature (15-27°C) and a scaled hydrogen generation rate of 2.60E-07 moles per second (0.35 cc/min). A second type of getter known as VEI, a proprietary polymer hydrogen getter characterized by carbon-carbon double bonds, was also tested in Phase 3. Hydrogen was successfully “gettered” by both getter systems. Hydrogen concentrations remained below 5 vol% (in air) for the duration of the tests. However, catalytic reaction of hydrogen with carbon triple or double bonds in the getter materials did not take place. Instead, catalytic recombination was the predominant gettering mechanism in both getter materials as evidenced by (1) consumption of oxygen in the belljars, (2) production of free water in the belljars, and (3) absence of chemical changes in both getter materials as shown by nuclear magnetic resonance spectra.

  4. Impurity gettering in semiconductors

    DOE Patents [OSTI]

    Sopori, B.L.

    1995-06-20T23:59:59.000Z

    A process for impurity gettering in a semiconductor substrate or device such as a silicon substrate or device is disclosed. The process comprises hydrogenating the substrate or device at the back side thereof with sufficient intensity and for a time period sufficient to produce a damaged back side. Thereafter, the substrate or device is illuminated with electromagnetic radiation at an intensity and for a time period sufficient to cause the impurities to diffuse to the back side and alloy with a metal there present to form a contact and capture the impurities. The impurity gettering process also can function to simultaneously passivate defects within the substrate or device, with the defects likewise diffusing to the back side for simultaneous passivation. Simultaneously, substantially all hydrogen-induced damage on the back side of the substrate or device is likewise annihilated. Also taught is an alternate process comprising thermal treatment after hydrogenation of the substrate or device at a temperature of from about 500 C to about 700 C for a time period sufficient to cause the impurities to diffuse to the damaged back side thereof for subsequent capture by an alloying metal. 1 fig.

  5. Impurity gettering in semiconductors

    DOE Patents [OSTI]

    Sopori, Bhushan L. (Denver, CO)

    1995-01-01T23:59:59.000Z

    A process for impurity gettering in a semiconductor substrate or device such as a silicon substrate or device. The process comprises hydrogenating the substrate or device at the back side thereof with sufficient intensity and for a time period sufficient to produce a damaged back side. Thereafter, the substrate or device is illuminated with electromagnetic radiation at an intensity and for a time period sufficient to cause the impurities to diffuse to the back side and alloy with a metal there present to form a contact and capture the impurities. The impurity gettering process also can function to simultaneously passivate defects within the substrate or device, with the defects likewise diffusing to the back side for simultaneous passivation. Simultaneously, substantially all hydrogen-induced damage on the back side of the substrate or device is likewise annihilated. Also taught is an alternate process comprising thermal treatment after hydrogenation of the substrate or device at a temperature of from about 500.degree. C. to about 700.degree. C. for a time period sufficient to cause the impurities to diffuse to the damaged back side thereof for subsequent capture by an alloying metal.

  6. Development of hydrogen gas getters for TRU waste

    SciTech Connect (OSTI)

    Kaszuba, J. P. (John P.); Mroz, E. J. (Eugene J.); Peterson, E. (Eric); Stone, M. (Mark); Haga, M. J. (Marc J.)

    2004-01-01T23:59:59.000Z

    Alpha radiolysis of hydrogenous waste and packaging materials generates hydrogen gas in radioactive storage containers. For this reason, the flammable gas (hydrogen) concentration in waste shipment containers (Transuranic Package Transporter-II or TP-II containers) is limited to the lower explosion limit of hydrogen in air (5 vol%). The use of hydrogen getters is being investigated to prevent the build up of hydrogen during storage and transport of the TP-II containers (up to 60 days). Preferred hydrogen getters are solid materials that scavenge hydrogen from the gas phase and chemically and irreversibly bind it in the solid state. One proven getter, 1,4-bis(phenylethynyl)benzene or DEB, belongs to a class of compounds called alkynes, which are characterized by the presence of carbon-carbon triple bonds. These carbon atoms will, in the presence of suitable catalysts such as palladium, irreversibly react with hydrogen to form the corresponding saturated alkane compounds. Because DEB contains two triple bonds, one mole of DEB reacts with 4 moles of hydrogen. The standard formulation for the 'DEB getter' is a mixture of 75% DEB and 25% carbon catalyst (5% palladium on carbon). Certain chemicals such as volatile organic compounds (VOCs) are known to 'poison' and reduce the activity of the catalyst. Therefore, in addition to the standard formulation, a semi-permeable barrier that encapsulates and protects the getter and its catalyst from poisons was also developed. The uncoated and polymer coated getter formulations were subjected to tests that determined the performance of the getters with regard to capacity, operating temperature range (with hydrogen in nitrogen and in air), hydrogen concentration, poisons, aging, pressure, reversibility, and radiation effects. This testing program was designed to address the following performance requirements: (1) Minimum rate for hydrogen removal of 1.2E-5 moles hydrogen per second for 60 days; (2) Sufficient getter material within the TP-II to ensure that no more than 50% of getter material is consumed during the 60 days; and (3) Adequate hydrogen removal rate from the getter reaction in the absence of the recombination reaction of hydrogen to produce water. This conservative approach provides a measure of safety for waste shipments by ensuring that sufficient getter material is present and by not taking credit for the recombination reaction. The rationale for measuring and reporting the hydrogen removal rate at 50% getter capacity is thus derived. All of the coated getters as well as the uncoated DEB performed well above the performance requirements. Coating the DEB with polymers did not significantly enhance getter performance in the presence of poisons relative to uncoated DEB. The next phase of the project is to evaluate a scaled-up getter package for performance under waste shipping conditions anticipated in the TP-II.

  7. Technetium and Iodine Getters to Improve Cast Stone Performance

    SciTech Connect (OSTI)

    Qafoku, Nikolla; Neeway, James J.; Lawter, Amanda R.; Levitskaia, Tatiana G.; Serne, R. Jeffrey; Westsik, Joseph H.; Snyder, Michelle MV

    2014-07-01T23:59:59.000Z

    To determine the effectiveness of the various getter materials prior to their solidification in Cast Stone, a series of batch sorption experiments was performed at Pacific Northwest National Laboratory. To quantify the effectiveness of the removal of Tc(VII) and I(I) from solution by getters, the distribution coefficient, Kd (mL/g), was calculated. Testing involved placing getter material in contact with spiked waste solutions at a 1:100 solid-to-solution ratio for periods up to 45 days with periodic solution sampling. One Tc getter was also tested at a 1:10 solid-to-solution ratio. Two different solution media, 18.2 M? deionized water (DI H2O) and a 7.8 M Na LAW simulant, were used in the batch sorption tests. Each test was conducted at room temperature in an anoxic chamber containing N2 with a small amount of H2 (0.7%) to maintain anoxic conditions. Each getter-solution combination was run in duplicate. Three Tc- and I-doping concentrations were used separately in aliquots of both the 18.2 M? DI H2O and a 7.8 M Na LAW waste simulant. The 1× concentration was developed based on Hanford Tank Waste Operations Simulator (HTWOS) model runs to support the River Protection Project System Plan Revision 6. The other two concentrations were 5× and 10× of the HTWOS values. The Tc and I tests were run separately (i.e., the solutions did not contain both solutes). Sampling of the solid-solution mixtures occurred nominally after 0.2, 1, 3, 6, 9, 12, 15 days and ~35 to 45 days. Seven getter materials were tested for Tc and five materials were tested for I. The seven Tc getters were blast furnace slag 1 (BFS1) (northwest source), BFS2 (southeast source), Sn(II)-treated apatite, Sn(II) chloride, nano tin phosphate, KMS (a potassium-metal-sulfide), and tin hydroxapatite. The five iodine getters were layered bismuth hydroxide (LBH), argentite mineral, synthetic argentite, silver-treated carbon, and silver-treated zeolite. The Tc Kd values measured from experiments conducted using the 7.8 M Na LAW simulant (the simulant selected to represent LAW) for the first 15 days for four Tc getters (BFS1, BFS2, Sn(II)-treated apatite, and Sn(II) chloride) show no, to a very small, capacity to remove Tc from the LAW simulant. For the Tc-getter experiments in the 7.8 M LAW simulant, the majority of the effluent samples show very small drops in Tc concentrations for the 35-day compared to the 15-day samplings. However, the Tc concentration in the simulant blanks also dropped slightly during this period, so the effect of the getter contacting LAW simulant at 35 days compared to 15 days is minimal; except that the BFS1 1:10 test shows a slow but steady decrease in Tc concentration in the LAW simulant supernatant from the beginning to the 35 day contact at which point about 20% of the original Tc has been removed from solution. Lastly, the KMS getter gives the highest Kd value for Tc at 35 days where Kd values have increased to 104 mL/g. When considering the different I getters reacting with the 7.8 M LAW simulant, two getters are much more effective than the others: Ag zeolite and Syn Arg. The other getters have calculated iodide distribution coefficients that show very limited effectiveness in the caustic conditions created by the LAW simulant. These are preliminary results that will need more detailed analyses including both pre- and post-batch sorption getter solid-phase characterization using state-of-the-art instrumentation such as synchrotron X ray absorption spectroscopy, which can delineate the oxidation state of the Tc and likely iodine species as well as some of the getters key major components, sulfur and iron in the BFS, and tin and sulfur in the tin-bearing and sulfur-bearing getters. This report also describes future experimental studies to be performed to better elucidate the mechanisms controlling the Tc and I sequestration processes in the various getters and leach tests of getter-bearing Cast Stone monoliths.

  8. Hydrogen capacity and absorption rate of the SAES St707 non-evaporable getter at various temperatures.

    SciTech Connect (OSTI)

    Hsu, Irving; Mills, Bernice E.

    2010-08-01T23:59:59.000Z

    A prototype of a tritium thermoelectric generator (TTG) is currently being developed at Sandia. In the TTG, a vacuum jacket reduces the amount of heat lost from the high temperature source via convection. However, outgassing presents challenges to maintaining a vacuum for many years. Getters are chemically active substances that scavenge residual gases in a vacuum system. In order to maintain the vacuum jacket at approximately 1.0 x 10{sup -4} torr for decades, nonevaporable getters that can operate from -55 C to 60 C are going to be used. This paper focuses on the hydrogen capacity and absorption rate of the St707{trademark} non-evaporable getter by SAES. Using a getter testing manifold, we have carried out experiments to test these characteristics of the getter over the temperature range of -77 C to 60 C. The results from this study can be used to size the getter appropriately.

  9. Method for charging a hydrogen getter

    DOE Patents [OSTI]

    Tracy, C.E.; Keyser, M.A.; Benson, D.K.

    1998-09-15T23:59:59.000Z

    A method for charging a sample of either a permanent or reversible getter material with a high concentration of hydrogen while maintaining a base pressure below 10{sup {minus}4} torr at room temperature involves placing the sample of hydrogen getter material in a chamber, activating the sample of hydrogen getter material, overcharging the sample of getter material through conventional charging techniques to a high concentration of hydrogen, and then subjecting the sample of getter material to a low temperature vacuum bake-out process. Application of the method results in a reversible hydrogen getter which is highly charged to maximum capacities of hydrogen and which concurrently exhibits minimum hydrogen vapor pressures at room temperatures. 9 figs.

  10. Oxidation resistant organic hydrogen getters

    DOE Patents [OSTI]

    Shepodd, Timothy J. (Livermore, CA); Buffleben, George M. (Tracy, CA)

    2008-09-09T23:59:59.000Z

    A composition for removing hydrogen from an atmosphere, comprising a mixture of a polyphenyl ether and a hydrogenation catalyst, preferably a precious metal catalyst, and most preferably Pt. This composition is stable in the presence of oxygen, will not polymerize or degrade upon exposure to temperatures in excess of 200.degree. C., or prolonged exposure to temperatures in the range of 100-300.degree. C. Moreover, these novel hydrogen getter materials can be used to efficiently removing hydrogen from mixtures of hydrogen/inert gas (e.g., He, Ar, N.sub.2), hydrogen/ammonia atmospheres, such as may be encountered in heat exchangers, and hydrogen/carbon dioxide atmospheres. Water vapor and common atmospheric gases have no adverse effect on the ability of these getter materials to absorb hydrogen.

  11. Polymer system for gettering hydrogen

    DOE Patents [OSTI]

    Shepodd, Timothy Jon (330 Thrasher Ave., Livermore, Alameda County, CA 94550); Whinnery, LeRoy L. (4929 Julie St., Livermore, Alameda County, CA 94550)

    2000-01-01T23:59:59.000Z

    A novel composition comprising organic polymer molecules having carbon-carbon double bonds, for removing hydrogen from the atmosphere within enclosed spaces. Organic polymers molecules containing carbon-carbon double bonds throughout their structures, preferably polybutadiene, polyisoprene and derivatives thereof, intimately mixed with an insoluble catalyst composition, comprising a hydrogenation catalyst and a catalyst support, preferably Pd supported on carbon, provide a hydrogen getter composition useful for removing hydrogen from enclosed spaces even in the presence of contaminants such as common atmospheric gases, water vapor, carbon dioxide, ammonia, oil mists, and water. The hydrogen getter composition disclosed herein is particularly useful for removing hydrogen from enclosed spaces containing potentially explosive mixtures of hydrogen and oxygen.

  12. Hydrogen isotope separation utilizing bulk getters

    DOE Patents [OSTI]

    Knize, Randall J. (Los Angeles, CA); Cecchi, Joseph L. (Lawrenceville, NJ)

    1990-01-01T23:59:59.000Z

    Tritium and deuterium are separated from a gaseous mixture thereof, derived from a nuclear fusion reactor or some other source, by providing a casing with a bulk getter therein for absorbing the gaseous mixture to produce an initial loading of the getter, partially desorbing the getter to produce a desorbed mixture which is tritium-enriched, pumping the desorbed mixture into a separate container, the remaining gaseous loading in the getter being deuterium-enriched, desorbing the getter to a substantially greater extent to produce a deuterium-enriched gaseous mixture, and removing the deuterium-enriched mixture into another container. The bulk getter may comprise a zirconium-aluminum alloy, or a zirconium-vanadium-iron alloy. The partial desorption may reduce the loading by approximately fifty percent. The basic procedure may be extended to produce a multistage isotope separator, including at least one additional bulk getter into which the tritium-enriched mixture is absorbed. The second getter is then partially desorbed to produce a desorbed mixture which is further tritium-enriched. The last-mentioned mixture is then removed from the container for the second getter, which is then desorbed to a substantially greater extent to produce a desorbed mixture which is deuterium-enriched. The last-mentioned mixture is then removed so that the cycle can be continued and repeated. The method of isotope separation is also applicable to other hydrogen isotopes, in that the method can be employed for separating either deuterium or tritium from normal hydrogen.

  13. Hydrogen isotope separation utilizing bulk getters

    DOE Patents [OSTI]

    Knize, Randall J. (Los Angeles, CA); Cecchi, Joseph L. (Lawrenceville, NJ)

    1991-01-01T23:59:59.000Z

    Tritium and deuterium are separated from a gaseous mixture thereof, derived from a nuclear fusion reactor or some other source, by providing a casing with a bulk getter therein for absorbing the gaseous mixture to produce an initial loading of the getter, partially desorbing the getter to produce a desorbed mixture which is tritium-enriched, pumping the desorbed mixture into a separate container, the remaining gaseous loading in the getter being deuterium-enriched, desorbing the getter to a substantially greater extent to produce a deuterium-enriched gaseous mixture, and removing the deuterium-enriched mixture into another container. The bulk getter may comprise a zirconium-aluminum alloy, or a zirconium-vanadium-iron alloy. The partial desorption may reduce the loading by approximately fifty percent. The basic procedure may be extended to produce a multistage isotope separator, including at least one additional bulk getter into which the tritium-enriched mixture is absorbed. The second getter is then partially desorbed to produce a desorbed mixture which is further tritium-enriched. The last-mentioned mixture is then removed from the container for the second getter, which is then desorbed to a substantially greater extent to produce a desorbed mixture which is deuterium-enriched. The last-mentioned mixture is then removed so that the cycle can be continued and repeated. The method of isotope separation is also applicable to other hydrogen isotopes, in that the method can be employed for separating either deuterium or tritium from normal hydrogen.

  14. Hydrogen isotope separation utilizing bulk getters

    DOE Patents [OSTI]

    Knize, R.J.; Cecchi, J.L.

    1991-08-20T23:59:59.000Z

    Tritium and deuterium are separated from a gaseous mixture thereof, derived from a nuclear fusion reactor or some other source, by providing a casing with a bulk getter therein for absorbing the gaseous mixture to produce an initial loading of the getter, partially desorbing the getter to produce a desorbed mixture which is tritium-enriched, pumping the desorbed mixture into a separate container, the remaining gaseous loading in the getter being deuterium-enriched, desorbing the getter to a substantially greater extent to produce a deuterium-enriched gaseous mixture, and removing the deuterium-enriched mixture into another container. The bulk getter may comprise a zirconium-aluminum alloy, or a zirconium-vanadium-iron alloy. The partial desorption may reduce the loading by approximately fifty percent. The basic procedure may be extended to produce a multistage isotope separator, including at least one additional bulk getter into which the tritium-enriched mixture is absorbed. The second getter is then partially desorbed to produce a desorbed mixture which is further tritium-enriched. The last-mentioned mixture is then removed from the container for the second getter, which is then desorbed to a substantially greater extent to produce a desorbed mixture which is deuterium-enriched. The last-mentioned mixture is then removed so that the cycle can be continued and repeated. The method of isotope separation is also applicable to other hydrogen isotopes, in that the method can be employed for separating either deuterium or tritium from normal hydrogen. 4 figures.

  15. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat 

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    In this study, two mechanical testing procedures were developed to test the strength of cancellous bone from the proximal tibia of the rat, the "punch method" and the "whole slice method". These were used to quantify the effect of ovariectomy on rat...

  16. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    of the effect of two testing methods, torsion and three-point bending, on the mechanical strength of the rat femur and the changes in strength due to ovariectomy. From these tests, little change in cortical bone properties for the OVX rats compared to the Sham...

  17. Internal gettering by metal alloy clusters

    DOE Patents [OSTI]

    Buonassisi, Anthony (San Diego, CA); Heuer, Matthias (Berkeley, CA); Istratov, Andrei A. (Albany, CA); Pickett, Matthew D. (Berkeley, CA); Marcus, Mathew A. (Berkeley, CA); Weber, Eicke R. (Piedmont, CA)

    2010-07-27T23:59:59.000Z

    The present invention relates to the internal gettering of impurities in semiconductors by metal alloy clusters. In particular, intermetallic clusters are formed within silicon, such clusters containing two or more transition metal species. Such clusters have melting temperatures below that of the host material and are shown to be particularly effective in gettering impurities within the silicon and collecting them into isolated, less harmful locations. Novel compositions for some of the metal alloy clusters are also described.

  18. Methods for identifying cancellous bone specimen location and size for the Reduced Platen Compression Test 

    E-Print Network [OSTI]

    Cowen, Kyle Ray

    2013-02-22T23:59:59.000Z

    , and stimuli on the skeleton and its ability to perform these everyday functions. The current state of bone testing is focused on understanding the mechanical properties of bone through use of traditional mechanical testing procedures such as three point...

  19. Hydrogen and moisture getter and absorber for sealed devices

    DOE Patents [OSTI]

    Smith, H.M.; Schicker, J.R.

    1999-03-30T23:59:59.000Z

    The present invention is a hydrogen getter and method for formulating and using the getter. This getter effectively removes hydrogen gas typically present in many hermetically-sealed electronic applications where the presence of such gas would otherwise be harmful to the electronics. The getter is a non-organic composition, usable in a wide range of temperatures as compared to organic getters. Moreover, the getter is formulated to be used without the need for the presence of oxygen. The getter is comprised of effective amounts of an oxide of a platinum group metal, a desiccant, and a gas permeable binder which preferably is cured after composition in an oxygen-bearing environment at about 150 to about 205 degrees centigrade.

  20. Engineering Report on the Fission Gas Getter Concept

    SciTech Connect (OSTI)

    Ecker, Lynne; Ghose, Sanjit; Gill, Simerjeet; Thallapally, Praveen K.; Strachan, Denis M.

    2012-11-01T23:59:59.000Z

    In 2010, the Department of Energy (DOE) requested that a Brookhaven National Laboratory (BNL)-led team research the possibility of using a getter material to reduce the pressure in the plenum region of a light water reactor fuel rod. During the first two years of the project, several candidate materials were identified and tested using a variety of experimental techniques, most with xenon as a simulant for fission products. Earlier promising results for candidate getter materials were found to be incorrect, caused by poor experimental techniques. In May 2012, it had become clear that none of the initial materials had demonstrated the ability to adsorb xenon in the quantities and under the conditions needed. Moreover, the proposed corrective action plan could not meet the schedule needed by the project manager. BNL initiated an internal project review which examined three questions: 1. Which materials, based on accepted materials models, might be capable of absorbing xenon? 2. Which experimental techniques are capable of not only detecting if xenon has been absorbed but also determine by what mechanism and the resulting molecular structure? 3. Are the results from the previous techniques useable now and in the future? As part of the second question, the project review team evaluated the previous experimental technique to determine why incorrect results were reported in early 2012. This engineering report is a summary of the current status of the project review, description of newly recommended experiments and results from feasibility studies at the National Synchrotron Light Source (NSLS).

  1. Getter pump for hydrogen and hydrocarbon gases

    DOE Patents [OSTI]

    Hsu, Wen Ling

    1987-10-14T23:59:59.000Z

    A gettering device for hydrogen isotopes and gaseous hydrocarbons based on the interaction of a plasma and graphite used as cathodic material. The plasma is maintained at a current density within the range of about 1 to about 1000 mA/cm/sup 2/. The graphite may be heated to a temperature greater than 1000/degree/C. The new device offers high capacity, low noise, and gas species selectivity. 2 figs.

  2. Longitudinal ultrasound measurement of the equine third metacarpal bone as a predictor of mechanical testing properties 

    E-Print Network [OSTI]

    Dyer, Stephanie Ann

    1999-01-01T23:59:59.000Z

    diagnostic technique to identify the onset of bucked shins. The purpose of this study was to determine if the longitudinal speed of sound as measured by Soundscan 2000[] was an appropriate predictor of bone strength characterized by mechanical testing...

  3. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck 

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ESTIMATING CANCELLOIJS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1998 Major Subject: Mechanical Engineering ESTIMATING CANCELLOUS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to Texas Ai8:M University...

  4. Hydrogen gettering packing material, and process for making same

    DOE Patents [OSTI]

    LeMay, James D. (Castro Valley, CA); Thompson, Lisa M. (Knoxville, TN); Smith, Henry Michael (Overland Park, KS); Schicker, James R. (Lee's Summit, MO)

    2001-01-01T23:59:59.000Z

    A hydrogen gettering system for a sealed container is disclosed comprising packing material for use within the sealed container, and a coating film containing hydrogen gettering material on at least a portion of the surface of such packing material. The coating film containing the hydrogen gettering material comprises a mixture of one or more organic materials capable of reacting with hydrogen and one or more catalysts capable of catalyzing the reaction of hydrogen with such one or more organic materials. The mixture of one or more organic materials capable of reacting with hydrogen and the one or more catalysts is dispersed in a suitable carrier which preferably is a curable film-forming material. In a preferred embodiment, the packing material comprises a foam material which is compatible with the coating film containing hydrogen gettering material thereon.

  5. Simulation of iron impurity gettering in crystalline silicon solar cells

    E-Print Network [OSTI]

    Powell, Douglas M. (Douglas Michael)

    2012-01-01T23:59:59.000Z

    This work discusses the Impurity-to-Efficiency (12E) simulation tool and applet. The 12E simulator models the physics of iron impurity gettering in silicon solar cells during high temperature processing. The tool also ...

  6. An issue paper on the use of hydrogen getters in transportation packaging

    SciTech Connect (OSTI)

    NIGREY,PAUL J.

    2000-02-01T23:59:59.000Z

    The accumulation of hydrogen is usually an undesirable occurrence because buildup in sealed systems pose explosion hazards under certain conditions. Hydrogen scavengers, or getters, can avert these problems by removing hydrogen from such environments. This paper provides a review of a number of reversible and irreversible getters that potentially could be used to reduce the buildup of hydrogen gas in containers for the transport of radioactive materials. In addition to describing getters that have already been used for such purposes, novel getters that might find application in future transport packages are also discussed. This paper also discusses getter material poisoning, the use of getters in packaging, the effects of radiation on getters, the compatibility of getters with packaging, design considerations, regulatory precedents, and makes general recommendations for the materials that have the greatest applicability in transport packaging. At this time, the Pacific Northwest National Laboratory composite getter, DEB [1,4-(phenylethylene)benzene] or similar polymer-based getters, and a manganese dioxide-based getter appear to be attractive candidates that should be further evaluated. These getters potentially can help prevent pressurization from radiolytic reactions in transportation packaging.

  7. EFFECT OF THERMAL PROCESSES ON COPPER-TIN ALLOYS FOR ZINC GETTERING

    SciTech Connect (OSTI)

    Korinko, P.; Golyski, M.

    2013-11-01T23:59:59.000Z

    A contamination mitigation plan was initiated to address the discovery of radioactive zinc‐65 in a glovebox. A near term solution was developed, installation of heated filters in the glovebox piping. This solution is effective at retaining the zinc in the currently contaminated area, but the gamma emitting contaminant is still present in a system designed for tritium beta. A project was initiated to develop a solution to contain the {sup 65}Zn in the furnace module. Copper and bronze (a Cu/Sn alloy) were found to be candidate materials to combine with zinc‐65 vapor, using thermodynamic calculations. A series of binary Cu/Sn alloys were developed (after determining that commercial alloys were unacceptable), that were found to be effective traps of zinc vapor. The task described in this report was undertaken to determine if the bronze substrates would retain their zinc gettering capability after being exposed to simulated extraction conditions with oxidizing and reducing gases. Pure copper and three bronze alloys were prepared, exposed to varying oxidation conditions from 250 to 450{degree}C, then exposed to varying reduction conditions in He-H{sub 2} from 250-450{degree}C, and finally exposed to zinc vapor at 350{degree}C for four hours. The samples were characterized using scanning electron microscopy, X-ray diffraction, differential thermal analysis, mass change, and visual observation. It was observed that the as fabricated samples and the reduced samples all retained their zinc gettering capacity while samples in the "as-oxidized" condition exhibited losses in zinc gettering capacity. Over the range of conditions tested, i.e., composition, oxidation temperature, and reduction temperature, no particular sample composition appeared better. Samples reduced at 350{degree}C exhibited the greatest zinc capacity, although there were some testing anomalies associated with these samples. This work clearly demonstrated that the zinc gettering was not adversely affected by exposure to simulated process conditions and a full scale lithium and zinc trap should be fabricated for testing in the Tritium Extraction Facility.

  8. Impurity gettering in silicon using cavities formed by helium implantation and annealing

    DOE Patents [OSTI]

    Myers, Jr., Samuel M. (Albuquerque, NM); Bishop, Dawn M. (Albuquerque, NM); Follstaedt, David M. (Albuquerque, NM)

    1998-01-01T23:59:59.000Z

    Impurity gettering in silicon wafers is achieved by a new process consisting of helium ion implantation followed by annealing. This treatment creates cavities whose internal surfaces are highly chemically reactive due to the presence of numerous silicon dangling bonds. For two representative transition-metal impurities, copper and nickel, the binding energies at cavities were demonstrated to be larger than the binding energies in precipitates of metal silicide, which constitutes the basis of most current impurity gettering. As a result the residual concentration of such impurities after cavity gettering is smaller by several orders of magnitude than after precipitation gettering. Additionally, cavity gettering is effective regardless of the starting impurity concentration in the wafer, whereas precipitation gettering ceases when the impurity concentration reaches a characteristic solubility determined by the equilibrium phase diagram of the silicon-metal system. The strong cavity gettering was shown to induce dissolution of metal-silicide particles from the opposite side of a wafer.

  9. Impurity gettering in silicon using cavities formed by helium implantation and annealing

    DOE Patents [OSTI]

    Myers, S.M. Jr.; Bishop, D.M.; Follstaedt, D.M.

    1998-11-24T23:59:59.000Z

    Impurity gettering in silicon wafers is achieved by a new process consisting of helium ion implantation followed by annealing. This treatment creates cavities whose internal surfaces are highly chemically reactive due to the presence of numerous silicon dangling bonds. For two representative transition-metal impurities, copper and nickel, the binding energies at cavities were demonstrated to be larger than the binding energies in precipitates of metal silicide, which constitutes the basis of most current impurity gettering. As a result the residual concentration of such impurities after cavity gettering is smaller by several orders of magnitude than after precipitation gettering. Additionally, cavity gettering is effective regardless of the starting impurity concentration in the wafer, whereas precipitation gettering ceases when the impurity concentration reaches a characteristic solubility determined by the equilibrium phase diagram of the silicon-metal system. The strong cavity gettering was shown to induce dissolution of metal-silicide particles from the opposite side of a wafer. 4 figs.

  10. Nuclear breeder reactor fuel element with silicon carbide getter

    DOE Patents [OSTI]

    Christiansen, David W. (Kennewick, WA); Karnesky, Richard A. (Richland, WA)

    1987-01-01T23:59:59.000Z

    An improved cesium getter 28 is provided in a breeder reactor fuel element or pin in the form of an extended surface area, low density element formed in one embodiment as a helically wound foil 30 located with silicon carbide, and located at the upper end of the fertile material upper blanket 20.

  11. Gettering of hydrogen and methane from a helium gas mixture

    SciTech Connect (OSTI)

    Cárdenas, Rosa Elia, E-mail: recarde1@uiwtx.edu [Department of Physics, The University of the Incarnate Word, 4301 Broadway, San Antonio, Texas 78209 (United States); Stewart, Kenneth D.; Cowgill, Donald F., E-mail: dfcowgi@sandia.gov [Sandia National Laboratories, Hydrogen and Metallurgical Sciences, 7011 East Avenue, Livermore, California 94550 (United States)

    2014-11-01T23:59:59.000Z

    In this study, the authors developed an approach for accurately quantifying the helium content in a gas mixture also containing hydrogen and methane using commercially available getters. The authors performed a systematic study to examine how both H{sub 2} and CH{sub 4} can be removed simultaneously from the mixture using two SAES St 172{sup ®} getters operating at different temperatures. The remaining He within the gas mixture can then be measured directly using a capacitance manometer. The optimum combination involved operating one getter at 650?°C to decompose the methane, and the second at 110?°C to remove the hydrogen. This approach eliminated the need to reactivate the getters between measurements, thereby enabling multiple measurements to be made within a short time interval, with accuracy better than 1%. The authors anticipate that such an approach will be particularly useful for quantifying the He-3 in mixtures that include tritium, tritiated methane, and helium-3. The presence of tritiated methane, generated by tritium activity, often complicates such measurements.

  12. Method of gettering hydrogen under conditions of low pressure

    DOE Patents [OSTI]

    Mendelsohn, Marshall H. (Woodridge, IL); Gruen, Dieter M. (Downers Grove, IL)

    1983-01-01T23:59:59.000Z

    A ternary intermetallic compound having the formula Zr(V.sub.1-x Cr.sub.x).sub.2 where x is in the range of 0.01 to 0.90 is capable of reversibly sorbing hydrogen at temperatures ranging from room temperature to 200.degree. C., at pressures down to 10.sup.-6 Torr. The compound is suitable for use as a hydrogen getter in low pressure, high temperature applications such as magnetic confinement fusion devices.

  13. Neutral beam dump with cathodic arc titanium gettering

    SciTech Connect (OSTI)

    Smirnov, A.; Korepanov, S. A.; Putvinski, S. [Tri Alpha Energy Inc., Rancho Santa Margarita, California 92688 (United States); Krivenko, A. S.; Murakhtin, S. V.; Savkin, V. Ya. [Budker Institute of Nuclear Physics, Novosibirsk 630090 (Russian Federation)

    2011-03-15T23:59:59.000Z

    An incomplete neutral beam capture can degrade the plasma performance in neutral beam driven plasma machines. The beam dumps mitigating the shine-through beam recycling must entrap and retain large particle loads while maintaining the beam-exposed surfaces clean of the residual impurities. The cathodic arc gettering, which provides high evaporation rate coupled with a fast time response, is a powerful and versatile technique for depositing clean getter films in vacuum. A compact neutral beam dump utilizing the titanium arc gettering was developed for a field-reversed configuration plasma sustained by 1 MW, 20-40 keV neutral hydrogen beams. The titanium evaporator features a new improved design. The beam dump is capable of handling large pulsed gas loads, has a high sorption capacity, and is robust and reliable. With the beam particle flux density of 5 x 10{sup 17} H/(cm{sup 2}s) sustained for 3-10 ms, the beam recycling coefficient, defined as twice the ratio of the hydrogen molecular flux leaving the beam dump to the incident flux of high-energy neutral atoms, is {approx}0.7. The use of the beam dump allows us to significantly reduce the recycling of the shine-through neutral beam as well as to improve the vacuum conditions in the machine.

  14. Nuclear breeder reactor fuel element with axial tandem stacking and getter

    DOE Patents [OSTI]

    Gibby, Ronald L. (Richland, WA); Lawrence, Leo A. (Kennewick, WA); Woodley, Robert E. (Richland, WA); Wilson, Charles N. (Richland, WA); Weber, Edward T. (Kennewick, WA); Johnson, Carl E. (Elk Grove, IL)

    1981-01-01T23:59:59.000Z

    A breeder reactor fuel element having a tandem arrangement of fissile and fertile fuel with a getter for fission product cesium disposed between the fissile and fertile sections. The getter is effective at reactor operating temperatures to isolate the cesium generated by the fissile material from reacting with the fertile fuel section.

  15. IEEE JOURNAL OF PHOTOVOLTAICS, VOL. 3, NO. 1, JANUARY 2013 261 Tradeoffs Between Impurity Gettering, Bulk

    E-Print Network [OSTI]

    layer for n-type sil- icon solar cells is investigated. We have studied the gettering ef- fectiveness PHOSPHORUS-DOPED n-type silicon for solar cells has received great interest in recent years, mainly due silicon solar cells is phosphorus diffusion. Phosphorus diffusion gettering is well studied [8

  16. Self assembled molecular monolayers on high surface area materials as molecular getters

    DOE Patents [OSTI]

    King, D.E.; Herdt, G.C.; Czanderna, A.W.

    1997-01-07T23:59:59.000Z

    The present invention relates to a gettering material that may be used as a filtration medium to remove pollutants from the environment. The gettering material comprises a high surface area material having a metal surface that chemically bonds n-alkanethiols in an organized manner thereby forming a molecular monolayer over the metal surface. The n-alkanethiols have a free functional group that interacts with the environment thereby binding specific pollutants that may be present. The gettering material may be exposed to streams of air in heating, ventilation, and air conditioning systems or streams of water to remove specific pollutants from either medium. 9 figs.

  17. Self assembled molecular monolayers on high surface area materials as molecular getters

    DOE Patents [OSTI]

    King, David E. (Lakewood, CO); Herdt, Gregory C. (Denver, CO); Czanderna, Alvin W. (Denver, CO)

    1997-01-01T23:59:59.000Z

    The present invention relates to a gettering material that may be used as a filtration medium to remove pollutants from the environment. The gettering material comprises a high surface area material having a metal surface that chemically bonds n-alkanethiols in an organized manner thereby forming a molecular monolayer over the metal surface. The n-alkanethiols have a free functional group that interacts with the environment thereby binding specific pollutants that may be present. The gettering material may be exposed to streams of air in heating, ventilation, and air conditioning systems or streams of water to remove specific pollutants from either medium.

  18. Transition metal gettering studies and simulation for the optimization of silicon photovoltaic device processing

    E-Print Network [OSTI]

    Smith, Aimée Louise, 1971-

    2002-01-01T23:59:59.000Z

    We use what is known about transition metal (TM) defect thermodynamic driving forces and kinetic responses to make predictive simulation of gettering during solar cell fabrication possible. We have developed a simulator ...

  19. Effective lifetimes exceeding 300 ?s in gettered p-type epitaxial kerfless silicon for photovoltaics

    E-Print Network [OSTI]

    Powell, D. M.

    We evaluate defect concentrations and investigate the lifetime potential of p-type single-crystal kerfless silicon produced via epitaxy for photovoltaics. In gettered material, low interstitial iron concentrations (as low ...

  20. Contact formation and gettering of precipitated impurities by multiple firing during semiconductor device fabrication

    DOE Patents [OSTI]

    Sopori, Bhushan

    2014-05-27T23:59:59.000Z

    Methods for contact formation and gettering of precipitated impurities by multiple firing during semiconductor device fabrication are provided. In one embodiment, a method for fabricating an electrical semiconductor device comprises: a first step that includes gettering of impurities from a semiconductor wafer and forming a backsurface field; and a second step that includes forming a front contact for the semiconductor wafer, wherein the second step is performed after completion of the first step.

  1. Analysis of tritium extraction from liquid lithium by permeation window and solid gettering processes

    SciTech Connect (OSTI)

    Takeda, T. [Japan Atomic Energy Research Inst., Ibaraki-ken (Japan); Ying, A.Y.; Abdou, M.A. [Univ. of California, Los Angeles, CA (United States)

    1994-12-31T23:59:59.000Z

    Tritium recovery from liquid lithium at low concentration is an important problem for liquid metal breeder-blanket in a fusion reactor. Previous studies have identified tritium recovery methods including molten salt extraction, gettering recovery, permeation window, and vacuum distillation. In this paper, the authors focus on the numerical studies on tritium extraction by permeation window and gettering processes. These studies include for example: dynamic tritium concentration variation along the flow direction, tritium inventory distributions in the permeator and getter bed, along with the effect of dispersion on extraction efficiency. Using a model description makes it possible to determine functional dependence and provide insight into the interrelationships of the various operating conditions and material properties which may affect the behavior of tritium in the material. Clearly, reliable material properties (such as diffusivity, solubility, etc.) are essential for realistic evaluations.

  2. Preparation of high purity niobium by electron beam melting and external gettering

    SciTech Connect (OSTI)

    Kim, Yong Hwan; Suzuki, Ryosuke O.; Ono, Katsutoshi [Kyoto Univ., Yoshida-Honmachi (Japan)

    1994-12-31T23:59:59.000Z

    Physical properties of niobium are deteriorated by interstitial impurities such as oxygen and nitrogen. The removal of these gaseous impurities was studied by electron beam (EB) melting and solid state external gettering with Ti, Y and Zr. The buttons and ingots were repeatedly remelted and refined by the EB furnace (max.; l4OkW). Subsequently, the external gettering for oxygen and nitrogen in niobium was carried out by wrapping samples with active metal foils and annealing in evacuated quartz ampoules over 1273K. The purity of refined niobium was characterized by its hardness, specific resistivity, internal friction and residual resistivity ratio (RRR={rho}{sub 273}/{rho}{sub 4.2}). The results of these measurements were compared with conventional gas analysis. Niobium was purified to the RRR of 100 through EB melting and 700 through external gettering.

  3. Combined gettering and molten salt process for tritium recovery from lithium

    SciTech Connect (OSTI)

    Sze, D.K.; Finn, P.A.; Bartlit, J.; Tanaka, S.; Teria, T.; Yamawaki, M.

    1988-02-01T23:59:59.000Z

    A new tritium recovery concept from lithium has been developed as part of the US/Japan collaboration on Reversed-Field Pinch Reactor Design Studies. This concept combines the ..gamma..-gettering process as the front end to recover tritium from the coolant, and a molten salt recovery process to extract tritium for fuel processing. A secondary lithium is used to regenerate the tritium from the gettering bed and, in the process, increases the tritium concentration by a factor of about 20. That way, the required size of the molten salt process becomes very small. A potential problem is the possible poisoning of the gettering bed by the salt dissolved in lithium. 16 refs., 6 figs.

  4. Non Evaporable Getter (NEG) Pumps: a Route to UHV-XHV

    SciTech Connect (OSTI)

    Manini, Paolo [SAES Getters SpA, Viale Italia 77, 20010 Lainate (Italy)

    2009-08-04T23:59:59.000Z

    Non Evaporable Getter (NEG) technology has been developed in the 1970's and since then adopted by industry, R and D labs, research centres and in large physics projects like accelerators, synchrotrons and fusion reactors. NEG pumps are very compact and vibration-free devices able to deliver very high pumping with minimal power requirement and electromagnetic interference. In the present paper, main features and performances of getter pumps are reviewed and discussed with a special focus to photocathode gun application, where UHV or XHV conditions are mandatory to ensure adequate gun life. NEG coating and future challenges for NEG technology are also discussed.

  5. Getter sputtering system for high-throughput fabrication of composition spreads

    SciTech Connect (OSTI)

    Gregoire, John M.; Dover, R. B. van; Jin Jing; Di Salvo, Francis J.; Abruna, Hector D. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States) and Cornell Fuel Cell Institute, Cornell University, Ithaca, New York 14853 (United States); Department of Materials Science and Engineering, Cornell University, Ithaca, New York 14853 (United States) and Cornell Fuel Cell Institute, Cornell University, Ithaca, New York 14853 (United States); Department of Chemistry and Chemical Biology, Cornell University, Ithaca, New York 14853 (United States) and Cornell Fuel Cell Institute, Cornell University, Ithaca, New York 14853 (United States)

    2007-07-15T23:59:59.000Z

    We describe a sputtering system that can deposit composition spreads in an effectively UHV environment but which does not require the high-throughput paradigm to be compromised by a long pump down each time a target is changed. The system deploys four magnetron sputter guns in a cryoshroud (getter sputtering) which allows elements such as Ti and Zr to be deposited with minimal contamination by oxygen or other reactive background gases. The system also relies on custom substrate heaters to give rapid heating and cool down. The effectiveness of the gettering technique is evaluated, and example results obtained for catalytic activity of a pseudoternary composition spread are presented.

  6. WORKSHOP ON DEVELOPMENT OF RADIONUCLIDE GETTERS FOR THE YUCCA MOUNTAIN WASTE REPOSITORY

    SciTech Connect (OSTI)

    K.C. Holt

    2006-03-13T23:59:59.000Z

    One of the important that the U.S. Department of Energy (DOE) is currently undertaking is the development of a high-level nuclear waste repository to be located at Yucca Mountain, Nevada. Concern is generated by the Yucca Mountain Project (YMP) is due to potential releases as groundwater contamination, as described in the Total System Performance Assessment (TSPA). The dose to an off-site individual using this groundwater for drinking and irrigation is dominated by four radionuclides: Tc-99, I-127, Np-237, and U-238. Ideally, this dose would be limited to a single radionuclide, U-238; in other words, YMP would resemble a uranium ore body, a common geologic feature in the Western U.S. For this reason and because of uncertainties in the behavior of Tc-99, I-127, and Np-237, it would be helpful to limit the amount of Tc, I, and Np leaving the repository, which would greatly increase the confidence in the long-term performance of YMP. An approach to limiting the migration of Tc, I, and Np that is complementary to the existing YMP repository design plans is to employ sequestering agents or ''getters'' for these radionuclides such that their migration is greatly hindered, thus decreasing the amount of radionuclide leaving the repository. Development of such getters presents a number of significant challenges. The getter must have a high affinity and high selectivity for the radionuclide in question since there is approximately a 20- to 50-fold excess of other fission products and a 1000-fold excess of uranium in addition to the ions present in the groundwater. An even greater challenge is that the getters must function over a period greater than the half-life of the radionuclide (greater than 5 half-lives would be ideal). Typically, materials with a high affinity for Tc, I, or Np are not sufficiently durable. For example, strong-base ion exchange resins have a very high affinity for TcO{sub 4}{sup -} but are not expected to be durable. On the other hand, durable materials, such as hydrotalcite, do not have sufficient affinity to be useful getters. Despite these problems, the great increase in the repository performance and corresponding decrease in uncertainty promised by a useful getter has generated significant interest in these materials. This report is the result a workshop sponsored by the Office of Civilian Radioactive Waste Management and Office of Science and Technology and International of the DOE to assess the state of research in this field.

  7. QED-1 device and measurements of gettering efficiency for a simulated divertor plasma

    SciTech Connect (OSTI)

    Owens, D.K.; Yamada, M.

    1980-03-01T23:59:59.000Z

    The QED-1 device at PPL has provided gettering efficiency data for neutralized hydrogen plasma on titanium. The hollow-anode arcjet produces a plasma column 1 cm in diameter with 10/sup 12/ < n/sub e/ < 10/sup 15/ cm/sup -3/ and T/sub i/ approx.< T/sub e/ = 3-10 eV, confined by an axial magnetic field of 1-6 kG. The gettering measurements are based on monitoring neutral gas density with respect to time in the divertor simulation chamber of QED-1. The present results indicate that the plasma particles lose their charge and most of their energy when they strike the neutralizer plate.

  8. Method for absorbing hydrogen using an oxidation resisant organic hydrogen getter

    DOE Patents [OSTI]

    Shepodd, Timothy J. (Livermore, CA); Buffleben, George M. (Tracy, CA)

    2009-02-03T23:59:59.000Z

    A composition for removing hydrogen from an atmosphere, comprising a mixture of a polyphenyl ether and a hydrogenation catalyst, preferably a precious metal catalyst, and most preferably platinum, is disclosed. This composition is stable in the presence of oxygen, will not polymerize or degrade upon exposure to temperatures in excess of 200.degree. C., or prolonged exposure to temperatures in the range of 100-300.degree. C. Moreover, these novel hydrogen getter materials can be used to efficiently remove hydrogen from mixtures of hydrogen/inert gas (e.g., He, Ar, N.sub.2), hydrogen/ammonia atmospheres, such as may be encountered in heat exchangers, and hydrogen/carbon dioxide atmospheres. Water vapor and common atmospheric gases have no adverse effect on the ability of these getter materials to absorb hydrogen.

  9. Method for gettering organic, inorganic and elemental iodine in aqueous solutions

    DOE Patents [OSTI]

    Beahm, Edward C. (Oak Ridge, TN); Shockley, William E. (Oak Ridge, TN)

    1990-01-01T23:59:59.000Z

    A process for the removal of iodine from aqueous solutions, particularly the trapping of radioactive iodine to mitigate damage resulting from accidents or spills associated with nuclear reactors, by exposing the solution to well dispersed silver carbonate which reacts with the iodine and iodides, thereby gettering iodine and iodine compounds from solution. The iodine is not only removed from solution but also from the contiguous vapor.

  10. Misfit dislocation gettering by substrate pit-patterning in SiGe films on Si(001)

    SciTech Connect (OSTI)

    Grydlik, Martyna; Groiss, Heiko; Brehm, Moritz; Schaeffler, Friedrich [Institute of Semiconductor and Solid State Physics, Johannes Kepler University Linz, Altenbergerstrasse 69, A-4040 Linz (Austria); Boioli, Francesca; Montalenti, Francesco; Miglio, Leo [L-NESS and Department of Material Science, University of Milano-Bicocca (Italy); Gatti, Riccardo; Devincre, Benoit [LEM, CNRS/ONERA, Chatillon Cedex (France)

    2012-07-02T23:59:59.000Z

    We show that suitable pit-patterning of a Si(001) substrate can strongly influence the nucleation and the propagation of dislocations during epitaxial deposition of Si-rich Si{sub 1-x}Ge{sub x} alloys, preferentially gettering misfit segments along pit rows. In particular, for a 250 nm layer deposited by molecular beam epitaxy at x{sub Ge} = 15%, extended film regions appear free of dislocations, by atomic force microscopy, as confirmed by transmission electron microscopy sampling. This result is quite general, as explained by dislocation dynamics simulations, which reveal the key role of the inhomogeneous distribution in stress produced by the pit-patterning.

  11. Use of non evaporable getter pumps to ensure long term performances of high quantum efficiency photocathodes

    SciTech Connect (OSTI)

    Sertore, Daniele, E-mail: daniele.sertore@mi.infn.it; Michelato, Paolo; Monaco, Laura [Istituto Nazionale di Fisica Nucleare Sez. Milano – LASA, Via Fratelli Cervi 201, I-20090 Segrate (Italy); Manini, Paolo; Siviero, Fabrizio [SAES Getters S.p.A., Viale Italia 77, 20020 Lainate (Italy)

    2014-05-15T23:59:59.000Z

    High quantum efficiency photocathodes are routinely used as laser triggered emitters in the advanced high brightness electron sources based on radio frequency guns. The sensitivity of “semiconductor” type photocathodes to vacuum levels and gas composition requires special care during preparation and handling. This paper will discuss the results obtained using a novel pumping approach based on coupling a 20?l s{sup ?1} sputter ion getter pump with a CapaciTorr® D100 non evaporable getter (NEG) pump. A pressure of 8?10{sup ?8}?Pa was achieved using only a sputter ion pump after a 6?day bake-out. With the addition of a NEG pump, a pressure of 2?10{sup ?9}?Pa was achieved after a 2?day bake-out. These pressure values were maintained without power due to the ability of the NEG to pump gases by chemical reaction. Long term monitoring of cathodes quantum efficiencies was also carried out at different photon wavelengths for more than two years, showing no degradation of the photoemissive film properties.

  12. Analysis of copper-rich precipitates in silicon: Chemical state, gettering, and impact on multicrystalline silicon solar cell material

    E-Print Network [OSTI]

    Analysis of copper-rich precipitates in silicon: Chemical state, gettering, and impact on multicrystalline silicon solar cell material Tonio Buonassisia Applied Science and Technology Group, University and Lawrence Berkeley National Laboratory, Berkeley, California 94720 Received 23 September 2004; accepted 13

  13. Characterization Of The Hydrogenation Products Of Bix (phenylethynyl) Benzene (DEB) Getter Using Combined GC/FTIR/MS, FT-Raman, and ATR Spectroscopies (U)

    SciTech Connect (OSTI)

    Smyrl, N. R.; Powell, G. L.

    2011-06-09T23:59:59.000Z

    Organic hydrogen getters are utilized to minimize hydrogen accumulation in sealed systems where such build up could produce either a safety problem from pressure build up or corrosion problem due the hydriding of metals contained in the sealed vessel. DEB (1,4 bis (phenyl ethynyl) benzene) is a hydrogen getter that is based on the palladium catalyzed hydrogenation of triple bonds to single bonds in aromatic aryl compound. DEB is a getter mixed with 25% carbon and 1% Pd and pressed into pellets with some porosity. The reaction mechanisms are complex involving solid state reactions with a heterogeneous catalyst leading to the many intermediates.

  14. Workshop on development of radionuclide getters for the Yucca Mountain waste repository: proceedings.

    SciTech Connect (OSTI)

    Moore, Robert Charles; Lukens, Wayne W. (Lawrence Berkeley National Laboratory)

    2006-03-01T23:59:59.000Z

    The proposed Yucca Mountain repository, located in southern Nevada, is to be the first facility for permanent disposal of spent reactor fuel and high-level radioactive waste in the United States. Total Systems Performance Assessment (TSPA) analysis has indicated that among the major radionuclides contributing to dose are technetium, iodine, and neptunium, all of which are highly mobile in the environment. Containment of these radionuclides within the repository is a priority for the Yucca Mountain Project (YMP). These proceedings review current research and technology efforts for sequestration of the radionuclides with a focus on technetium, iodine, and neptunium. This workshop also covered issues concerning the Yucca Mountain environment and getter characteristics required for potential placement into the repository.

  15. X-ray photoelectron spectroscopy of gallium nitride films grown by radical-beam gettering epitaxy

    SciTech Connect (OSTI)

    Rogozin, I. V. [Berdyansk State Pedagogical University (Ukraine)], E-mail: rogozin@bdpu.org; Kotlyarevsky, M. B. [Academy of Management and Information Technology (Ukraine)

    2007-05-15T23:59:59.000Z

    Thin GaN films were grown on GaAs(111) substrates by radical-beam gettering epitaxy. The structural quality of the films was studied by high-resolution x-ray diffraction. The chemical composition of the GaAs surface and GaN film was studied by x-ray photoelectron spectroscopy. It is shown that Ga-N and As-N bonds are formed on the GaAs surface at initial growth stages at low temperatures. The state of the film-substrate interface was studied. It was found that prolonged annealing of GaN films in nitrogen radicals shifts the composition to nitrogen excess.

  16. Improved Hydrogen Gas Getters for TRU Waste Transuranic and Mixed Waste Focus Area - Phase 2 Final Report

    SciTech Connect (OSTI)

    Stone, Mark Lee

    2002-04-01T23:59:59.000Z

    Alpha radiolysis of hydrogenous waste and packaging materials generates hydrogen gas in radioactive storage containers. For that reason, the Nuclear Regulatory Commission (NRC) limits the flammable gas (hydrogen) concentration in the Transuranic Package Transporter-II (TRUPACT-II) containers to 5 vol% of hydrogen in air, which is the lower explosion limit. Consequently, a method is needed to prevent the build up of hydrogen to 5 vol% during the storage and transport of the TRUPACT-II containers (up to 60 days). One promising option is the use of hydrogen getters. These materials scavenge hydrogen from the gas phase and irreversibly bind it in the solid phase. One proven getter is a material called 1,4-bis (phenylethynyl) benzene, or DEB. It has the needed binding rate and capacity, but some of the chemical species that might be present in the containers could interfere with its ability to remove hydrogen. This project is focused upon developing a protective polymeric membrane coating for the DEB getter material, which comes in the form of small, irregularly shaped particles. This report summarizes the experimental results of the second phase of the development of the materials.

  17. SCREENING TESTS FOR IMPROVED METHANE CRACKING MATERIALS

    SciTech Connect (OSTI)

    Klein, J; Jeffrey Holder, J

    2007-07-16T23:59:59.000Z

    Bench scale (1 to 6 gram) methane cracking tests have been performed on a variety of pure elements, some alloys, and SAES{reg_sign} commercial getters St 101, St 198, St 707, St 737, and St 909 to determine methane cracking performance (MCP) of 5% methane in a helium carrier at 700 C, 101.3 kPa (760 torr) with a 10 sccm feed. The MCP was almost absent from some materials tested while others showed varying degrees of MCP. Re, Cr, V, Gd, and Mo powders had good MCP, but limited capacities. Nickel supported on kieselguhr (Ni/k), a Zr-Ni alloy, and the SAES{reg_sign} getters had good MCP in a helium carrier. The MCP of these same materials was suppressed in a hydrogen carrier stream and the MCP of the Zr-based materials was reduced by nitride formation when tested with a nitrogen carrier gas.

  18. Screening tests for improved methane cracking materials

    SciTech Connect (OSTI)

    Klein, J. E.; Hoelder, J. S. [Savannah River National Laboratory, Aiken, SC 29808 (United States)

    2008-07-15T23:59:59.000Z

    Bench scale (1 to 6 gram) methane cracking tests have been performed on a variety of pure elements, some alloys, and SAES{sup R} commercial getters St 101, St 198, St 707, St 737, and St 909 to determine methane cracking performance (MCP) of 5% methane in a helium carrier at 700 deg.C, 101.3 kPa (760 torr) with a 10 seem feed. The MCP was almost absent from some materials tested while others showed varying degrees of MCP. Re, Cr, V, Gd, and Mo powders had good MCP, but limited capacities. Nickel supported on kieselguhr (Ni/k), a Zr-Ni alloy, and the SAESr getters had good MCP in a helium carrier. The MCP of these same materials was suppressed in a hydrogen carrier stream and the MCP of the Zr-based materials was reduced by nitride formation when tested with a nitrogen carrier gas. (authors)

  19. The 22nd International Photovoltaic Science and Engineering Conference, November 05-09, 2012, Hangzhou, China Gettering of n-type multicrystalline silicon solar cells by

    E-Print Network [OSTI]

    , Hangzhou, China Gettering of n-type multicrystalline silicon solar cells by phosphorus diffusion, boron in heavily dislocated regions. 1. INTRODUCTION N-type multicrystalline silicon has great potential as solar+ diffused region in n- type silicon solar cells with either aluminum annealing or boron diffusion are good

  20. Hydrogen gettering and strain-induced platelet nucleation in tensilely strained Si0.4Ge0.6/Ge for layer exfoliation applications

    E-Print Network [OSTI]

    for layer exfoliation applications Arthur J. Piteraa and E. A. Fitzgerald Department of Materials Science of these result in subsurface crack propagation leading to surface blistering and eventual exfoliation of a H the exfoliation kinetics of relaxed Ge/Si1-xGex/Si virtual substrates by gettering hydrogen and providing

  1. Relaxed graded SiGe donor substrates incorporating hydrogen-gettering and buried etch stop layers for strained silicon layer transfer

    E-Print Network [OSTI]

    Relaxed graded SiGe donor substrates incorporating hydrogen-gettering and buried etch stop layers lattice constants of SiGe on Si with low threading dislocation den- sities in the surface layer, the relaxed graded SiGe buffer i.e., x Si1-xGex /Si Refs. 6­8 has been utilized for both the SSOI as well

  2. Bone loss during energy restriction: mechanistic role of leptin 

    E-Print Network [OSTI]

    Baek, Kyunghwa

    2009-05-15T23:59:59.000Z

    ), dual energy X-ray absorptiometry (DEXA) and mechanical testing. As a whole body measure, biochemical markers of bone turnover can be used to quantify changes in bone formation (e.g., osteocalcin, OC) and bone resorption (e.g., deoxypyridonoline...

  3. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  4. attenuates bone cancer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    human bone were studied via the small scale mechanical loading test. Failure analysis was conducted... Jang, Eunhwa 2012-10-19 19 ORIGINAL ARTICLE JBMR Cancer Treatment...

  5. Bone Cancer Rates in Dinosaurs Compared with Modern Vertebrates

    E-Print Network [OSTI]

    L. C. Natarajan; A. L. Melott; B. M. Rothschild; L. D. Martin

    2007-10-16T23:59:59.000Z

    Data on the prevalence of bone cancer in dinosaurs is available from past radiological examination of preserved bones. We statistically test this data for consistency with rates extrapolated from information on bone cancer in modern vertebrates, and find that there is no evidence of a different rate. Thus, this test provides no support for a possible role of ionizing radiation in the K-T extinction event.

  6. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  7. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  8. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  9. A Graph-based Approach for Computational Model of Bone Microstructure

    E-Print Network [OSTI]

    Buffalo, State University of New York

    azhang@buffalo.edu ABSTRACT Osteoporosis, a condition in which bones become fragile and more likely bone due to osteoporosis. The diagnosis of osteoporosis is commonly done by tests that measure for the diagnosis of osteoporosis are limited due to the lack of good measurements of bone quality. In this paper

  10. Preparation of CaO as OLED getter material through control of crystal growth of CaCO{sub 3} by block copolymers in aqueous solution

    SciTech Connect (OSTI)

    Park, Jae-Hyung [Department of Chemical Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Oh, Seong-Geun [Department of Chemical Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of)], E-mail: seongoh@hanyang.ac.kr

    2009-01-08T23:59:59.000Z

    As the starting materials of organic light-emitting diode (OLED) getter, calcium carbonate (CaCO{sub 3}) particles with various shapes and crystal structures have been successfully prepared with additives (L64 or PEGPG), which contain blocks of poly(ethylene oxide) (PEO) and poly(propylene oxide) (PPO). These CaCO{sub 3} particles were calcinated into highly crystalline calcium oxide (CaO) nanoparticles with high capacity of water adsorption up to 14.23 wt.%. The CaCO{sub 3} and CaO particles prepared at various conditions were characterized using the field emission scanning electron microscopy (FE-SEM), Fourier transform infrared microscopy (FT-IR), X-ray powder diffraction (XRD), and dynamic vapor sorption (DVS) method.

  11. Application of Vacancy Injection Gettering to Improve Efficiency of Solar Cells Produced by Millinet Solar: Cooperative Research and Development Final Report, CRADA Number CRD-10-417

    SciTech Connect (OSTI)

    Sopori, B.

    2012-07-01T23:59:59.000Z

    NREL will apply vacancy injection gettering (VIG) to Millinet solar cells and evaluate the performance improvement produced by this process step. The VIG will be done in conjunction with the formation of a back, Al-alloyed, contact. Millinet Solar will provide NREL with cells having AR coating on the front side and screen-printed Al on the backside, which will be processed in the NREL's optical furnace to perform simultaneous VIG and back contact alloying with deep BSF. These cells will be sent back to Millinet solar for a screen-printed front/side contact mask, followed by a second firing at NREL. Detailed analyses will be performed to determine improvements due to BSF and VIG.

  12. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  13. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  14. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  15. Methods and modeling for the reduced platen compression of cancellous bone in the rodent proximal tibia 

    E-Print Network [OSTI]

    Rogers, William Elliott

    2002-01-01T23:59:59.000Z

    This study focused on the reduced platen compression (RPC) test of cancellous bone in the rodent proximal tibia. The objective was to improve methods for this mechanical test, specifically in the areas of specimen location, specimen preparation...

  16. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  17. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  18. Correlating mechanical properties of cancellous bone in the rat with various density measures 

    E-Print Network [OSTI]

    Ramaswamy, Ramya

    2004-09-30T23:59:59.000Z

    , and to correlate the mechanical properties of the rodent cancellous bone with the various density measures. Analytical studies were made to assess the effect of the size and shape of the platen based on the values from mechanical testing of the cancellous bone...

  19. HANFORD CONTAINERIZED CAST STONE FACILITY TASK 1 PROCESS TESTING & DEVELOPMENT FINAL TEST REPORT

    SciTech Connect (OSTI)

    LOCKREM, L L

    2005-07-13T23:59:59.000Z

    Laboratory testing and technical evaluation activities on Containerized Cast Stone (CCS) were conducted under the Scope of Work (SOW) contained in CH2M HILL Hanford Group, Inc. (CHG) Contract No. 18548 (CHG 2003a). This report presents the results of testing and demonstration activities discussed in SOW Section 3.1, Task I--''Process Development Testing'', and described in greater detail in the ''Containerized Grout--Phase I Testing and Demonstration Plan'' (CHG, 2003b). CHG (2003b) divided the CCS testing and evaluation activities into six categories, as follows: (1) A short set of tests with simulant to select a preferred dry reagent formulation (DRF), determine allowable liquid addition levels, and confirm the Part 2 test matrix. (2) Waste form performance testing on cast stone made from the preferred DRF and a backup DRF, as selected in Part I, and using low activity waste (LAW) simulant. (3) Waste form performance testing on cast stone made from the preferred DRF using radioactive LAW. (4) Waste form validation testing on a selected nominal cast stone formulation using the preferred DRF and LAW simulant. (5) Engineering evaluations of explosive/toxic gas evolution, including hydrogen, from the cast stone product. (6) Technetium ''getter'' testing with cast stone made with LAW simulant and with radioactive LAW. In addition, nitrate leaching observations were drawn from nitrate leachability data obtained in the course of the Parts 2 and 3 waste form performance testing. The nitrate leachability index results are presented along with other data from the applicable activity categories.

  20. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . · Mini-project on bone nodule formation. · Neutron scattering on whole bone. · Analysis of bone explants

  1. Mechanical bone strength in the proximal tibia 

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    KNEE REPLACEMENT 3 2. 1 Mechanics of the Knee 2. 1. 1 knee Structure. 2. 1. 2 Bone Strength of Proximal Tibia. 2. 2 Total Knee Replacement. '2. 3 Research Prospective III MECHANICS OF MATERIALS. . 3 3 5 7 8 10 3. 1 Normal Stress and Strain... Specimens. 4. 1. 2 Mechanical Test. . 4. 2 Statistical Analysis. . . . . . . . . . . . . 18 18 18 19 V RESULTS AND CONCLUSIONS. 20 5. 1 Results. . 20 5. 2 Discussion and Conclusions. Page 24 REFERENCES. 27 VITA. 29 LIST OF FIGURES FIGURE 2. 1...

  2. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  3. The effects of eccentric training on muscle-bone function 

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    , mechanical testing at this site showed greater tibiae stiffness in the exercised bone than that of the OVX group (+28.5%). No significant differences were found in tibial ultimate load to fracture, ultimate strength or modulus of elasticity. In summary...

  4. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity 

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    of the series was conducted at Brookhaven National Laboratory. To quantify the impact of the abovementioned countermeasures and space radiation on bone, mechanical testing, peripheral quantitative computed tomography, micro-computed tomography, histomorphometry...

  5. Self-assembling peptide hydrogels modulate in vitro chondrogenesis of bovine bone marrow stromal cells

    E-Print Network [OSTI]

    Kopesky, Paul Wayne

    Our objective was to test the hypothesis that self-assembling peptide hydrogel scaffolds provide cues that enhance the chondrogenic differentiation of bone marrow stromal cells (BMSCs). BMSCs were encapsulated within two ...

  6. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency 

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    mechanically loaded by a unique four-point loading machine three times per week. After six weeks of treatment, all animals were sacrificed, both tibia removed and tested for bone mineral density (BMD) by dual energy X-ray absorptiometry, stiffness and ultimate...

  7. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Mun˜oz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  8. Development of high strength hydroxyapatite for bone tissue regeneration using nanobioactive glass composites

    SciTech Connect (OSTI)

    Shrivastava, Pragya; Dalai, Sridhar; Vijayalakshmi, S. [Centre for Research in Nanotechnology and Science, IIT Bombay (India); Sudera, Prerna; Sivam, Santosh Param [Amity Institute of Nanotechnology, Amity University, Noida, Uttar Pradesh-201303 (India); Sharma, Pratibha [Dept of Energy Science and Engineering, IIT Bombay (India)

    2013-02-05T23:59:59.000Z

    With an increasing demand of biocompatible bone substitutes for the treatment of bone diseases and bone tissue regeneration, bioactive glass composites are being tested to improvise the osteoconductive as well as osteoinductive properties. Nanobioactive glass (nBG) composites, having composition of SiO{sub 2} 70 mol%, CaO 26 mol % and P{sub 2}O{sub 5} 4 mol% were prepared by Freeze drying method using PEG-PPG-PEG co-polymer. Polymer addition improves the mechanical strength and porosity of the scaffold of nBG. Nano Bioactive glass composites upon implantation undergo specific reactions leading to the formation of crystalline hydroxyapatite (HA). This is tested in vitro using Simulated Body Fluid (SBF). This high strength hydroxyapatite (HA) layer acts as osteoconductive in cellular environment, by acting as mineral base of bones, onto which new bone cells proliferate leading to new bone formation. Strength of the nBG composites as well as HA is in the range of cortical and cancellous bone, thus proving significant for bone tissue regeneration substitutes.

  9. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M.  2002.  “Bone  Diagenesis:  An  Overview  of  2000.  “Patterns  of  Diagenesis  in  Bone  I:  The  element  Studies  of  Diagenesis  in  Prehistoric  Bone. ”  

  10. Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone D. Farlay, G. Panczer, C. Rey, P. D. Delmas

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone Mineral D. Farlay, G in "Journal of Bone and Mineral Metabolism 2010;28(4):433-45" DOI : 10.1007/s00774-009-0146-7 #12;Abstract The purpose of this study was to test the hypothesis that mineral maturity and crystallinity index are two

  11. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  12. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  13. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ­ this is why it is often called

  14. Changing the Mechanical Properties of PMMA Bone Cement with Nano and Micro Particles Ricardo F. Pinto, Brandon J. Johnson, L. D. Timmie Topoleski

    E-Print Network [OSTI]

    Alonso, Juan J.

    in the vacuum mixer. During the exothermic polymerization of the bone cement, the liquid rubber should testing. Specimens were then retrieved and tested individually in three point bending quasi-static loading

  15. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  16. Sex Differences in Long Bone Fatigue Using a Rat Model Luisa D. Moreno,1

    E-Print Network [OSTI]

    Waldman, Stephen D.

    response to fatigue, we also determined the creep that occurred during the fatigue test. From the creep progress (Fig. 1). Caler and Carter32 studied cortical bone creep behavior during fatigue testing. When adaptation. From these results, we hypothesized that creep was the underlying mechanism that accounted

  17. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  18. Test Automation Test Automation

    E-Print Network [OSTI]

    Mousavi, Mohammad

    Test Automation Test Automation Mohammad Mousavi Eindhoven University of Technology, The Netherlands Software Testing 2013 Mousavi: Test Automation #12;Test Automation Outline Test Automation Mousavi: Test Automation #12;Test Automation Why? Challenges of Manual Testing Test-case design: Choosing inputs

  19. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  20. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  1. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  2. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fränzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bäuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  3. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur 

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    .................................................................................................................. 35 3.7.1 Analysis of Mechanical Testing Data .............................................................. 35 3.7.2 Material Properties ........................................................................................... 37 3.7.3 Core....2 Osteoporosis and the Ovariectomized Rat Model .................................................... 5 2.3 Mechanical Testing of Cancellous Bone in Rats ..................................................... 5 2.3.1 Femoral Neck Testing...

  4. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santé et de la Recherche Médicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  5. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  6. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  7. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  8. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  9. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  10. 1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling of Bones

    E-Print Network [OSTI]

    Gefen, Amit

    1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling*, Member, IEEE Abstract--This paper presents a feasibility study of drilling in fresh wet bone tissue in vitro using the microwave drill method [Jerby et al., 2002], toward testing its applicability

  11. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  12. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  13. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  14. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  15. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  16. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  17. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  18. Bisphosphonates and Bone diseases: past, present and future Bisphosphonates are stable analogues of the naturally-occuring inorganic

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget's disease of bone

  19. Engineered nanomedicine for myeloma and bone microenvironment targeting

    E-Print Network [OSTI]

    Swami, Archana

    Bone is a favorable microenvironment for tumor growth and a frequent destination for metastatic cancer cells. Targeting cancers within the bone marrow remains a crucial oncologic challenge due to issues of drug availability ...

  20. Cellular and molecular immunotherapeutics derived from the bone marrow stroma

    E-Print Network [OSTI]

    Parekkadan, Biju

    2008-01-01T23:59:59.000Z

    The bone marrow contains a multipotent stromal cell, commonly referred to as a mesenchymal stem cell (MSC). There has been recent interest in the clinical use of MSCs for cell-based therapy because: (1) bone marrow aspiration ...

  1. Original article Analysis of muscle and bone weight variation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . The commonalities ranged from 0.76 (drumstick muscle) to 0.92 (neck bone) and the uniqueness (special size factors and drumstick bone factors. The correlation coefficient between the first factor score and carcass muscle was 0

  2. Two-dimensional ultrasonic computed tomography of growing bones.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Two-dimensional ultrasonic computed tomography of growing bones. P. Lasaygues, E. Franceschini, R: Ultrasonic Computed Tomography, Bone imaging, Born approximation, iterative distorted method I. INTRODUCTION imaging process, using ultrasonic computed tomography. Although this method is known to provide

  3. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  4. Three-dimensional terahertz computed tomography of human bones

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    spectroscopy cannot rival with dual energy x-ray absorptiometry (DEXA) to identify the bone mineral density

  5. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  6. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  7. INVEST IN YOUR BONES Daily Activities

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Daily Activities Leaflet 3 Another osteoporosis prevention step to decrease lifestyle. Let's see how you can do that. If you have osteoporosis, follow carefully the activity program. Remember the following about osteoporosis: is largely preventable and treatable is a serious

  8. Nanoscale Surface Topography to Guide Bone Growth

    E-Print Network [OSTI]

    Nanoscale Surface Topography to Guide Bone Growth P R O J E C T L E A D E R : Jirun Sun (American T S Designed and fabricated devices with nanoscale surface topography. Controlled cell alignment by varying the height and aspect ratio of the surface features. R E F E R E N C E Exploring cellular contact guidance

  9. Self regulating formulations for safe hydrogen gettering

    DOE Patents [OSTI]

    Shepodd, Timothy Jon

    2004-03-16T23:59:59.000Z

    A method and composition are disclosed for preventing uncontrolled exothermic reaction in the presence of a catalyst. A catalyst deployed as a finely divided powder which is attached to the surface of a low melting point wax or wax-like material which is utilized as a carrier for the catalyst. During operation should the catalyst overheat due to uncontrolled conditions brought about by a run-away reaction the heat of reaction melts the low melting point wax which would itself wet the surface of the catalyst and prevent further catalysis.

  10. Self regulating formulations for safe hydrogen gettering

    DOE Patents [OSTI]

    Shepodd, Timothy Jon (Livermore, CA)

    2002-01-01T23:59:59.000Z

    A method and composition are disclosed for preventing uncontrolled exothermic reaction in the presence of a catalyst. A catalyst deployed as a finely divided powder which is attached to the surface of a low melting point wax or wax-like material which is utilized as a carrier for the catalyst. During operation should the catalyst overheat due to uncontrolled conditions brought about by a run-away reaction the heat of reaction melts the low melting point wax which would itself wet the surface of the catalyst and prevent further catalysis.

  11. Interactions between microenvironment and cancer cells in two animal models of bone metastasis

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Interactions between microenvironment and cancer cells in two animal models of bone metastasis of characteristics leading to osteoclastogenesis only in the bone microenvironment. Key words: Bone metastasis;3 INTRODUCTION Bone is a preferential site for metastasis in different types of cancer. Bone metastases induce

  12. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimer’s Disease and Bone Loss Bone health is an important issue in aging and AD. Osteoporosis–related fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  13. allowing normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    assays. Correlations of fluoride levels between normal bone near the Nancy Medina; Chester W. Douglass; Gary M. Whitford; Robert N. Hoover; Thomas R. Fears 6 Differential...

  14. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    their results, the researchers recommended that vitamin D levels be checked and kept on well--balanced levels to maintain the structural integrity of bones and avoid...

  15. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

  16. ancient human bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reich, David 159 OsteoConduct: Wireless Body-Area Communication based on Bone Conduction Energy Storage, Conversion and Utilization Websites Summary: , Measurement, Human Factors....

  17. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    present and that diagenesis (chemical exchange between therisk assessment. Diagenesis, or the chemical exchangeto assess the level of diagenesis in a bone without chemical

  18. arm bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone Engineering Websites Summary: , and robot and human velocities. The impact experiments are performed with an apparatus...

  19. Treatment of Extraspinal Painful Bone Metastases with Percutaneous Cementoplasty: A Prospective Study of 50 Patients

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment, Interventional Radiology Unit (Italy); Ortega, Cinzia; Grignani, Giovanni [Institute for Cancer Research and Treatment, Oncology Unit (Italy); DeBernardi, Felicino [Institute for Cancer Research and Treatment, Anesthesiology Unit (Italy); Regge, Daniele [Institute for Cancer Research and Treatment, Radiology Unit (Italy)

    2008-11-15T23:59:59.000Z

    The aim of this study was to assess the efficacy of percutaneous cementoplasty (PC) with polymethylmethacrylate (PMMA) in painful extravertebral lytic bone metastases not responding to conventional therapy. Fifty patients (25 females), mean age 64.7 {+-} 11.2 years, underwent PC after giving informed consent. Procedures were performed under fluoroscopy (1/50) or combined fluoroscopy-CT (49/50) guidance in local anesthesia or under deep sedation in 7 patients with large metastases who underwent radiofrequency thermoablation (RFA) in the same session. Seventy lesions were treated (1-6 per patient; average, 1.4 {+-} 0.9), arranging in size from 1 to 10 cm (average, 3.6 {+-} 2.1 cm). Mean volume of PMMA per lesion was 5.9 {+-} 3.2 ml (range, 1.5-15.0 ml). Pain was prospectively evaluated on an 11-point visual analog scale (VAS) before and after the procedure (follow-up, 15 to 36 months). Mean VAS score dropped from 9.1 {+-} 1.2 (range: 6-10) to 2.1 {+-} 2.5 (range: 0-9). Mean VAS difference was 7.0 {+-} 2.3 (range, 1-10; p < 0.0001, Wilcoxon signed rank test). Forty-seven of the 50 patients (94%) suspended narcotic drugs, in 22 (44%) pain was controlled with a nonsteroidal anti-inflammatory drug, in 25 (50%) analgesic therapy was suspended, and 13 of 50 (26%) had complete pain regression. In 3 of the 50 patients (6%) pain was not improved. No statistical difference between osteoplasty and osteoplasty plus RFA was found (p = 0.8338, Mann-Whitney test). No complications arose during the procedure. Two patients with metastases in the femoral diaphysis reported a fracture 1 month after treatment. PC is effective to obtain pain regression in painful bone metastases not responding to conventional analgesic therapy; bone consolidation cannot be obtained in the diaphysis of long weight-bearing bones.

  20. Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Bala Krishnamoorthy, Department of Mathematics, Washington State University

    E-Print Network [OSTI]

    Krishnamoorthy, Bala

    1 Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Strength Bala to failure in axial compression. Predictive variables included age, gender, bone mineral density (BMD mineral density, spine surgery. #12;3 Introduction The allograft bone industry is guided by practices

  1. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  2. Quantity and Quality of Trabecular Bone in the Femur Are Enhanced by a Strongly Anabolic, Noninvasive

    E-Print Network [OSTI]

    serve as the basis for a biomechanically based intervention for osteoporosis. To evaluate intervention for osteoporosis. (J Bone Miner Res 2002;17:349­357) Key words: osteoporosis, osteogenic, anabolic, bone formation, bone quality, osteogenic INTRODUCTION OSTEOPOROSIS, A disease characterized

  3. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials 

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  4. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    Bone marrow production of lung cells: the impact of G-CSF,bone marrow to reconstitute lung epithelium. Am. J. Respirof Bone Marrow Cells into Lung Cells Mark S. Dooner 1 *,

  5. Role of middle-ear inertial component of bone conduction in chinchilla

    E-Print Network [OSTI]

    Chhan, David

    2013-01-01T23:59:59.000Z

    Bone conduction describes the mechanisms that produce a hearing sensation when the skull bones are subjected to vibration. Multiple components and pathways have been suggested to contribute to total bone-conducted sound. ...

  6. WOMEN'S GLOBAL HEALTH INSTITUTE NUTR59000/BMS59800: WOMEN'SHEALTH:BONE

    E-Print Network [OSTI]

    /remodeling, mechanics;Tools of assessment Epidemiology of osteoporosis Development of peak bone mass ­ nutrition/exercise Adult Bone: Women's reproductive choices ­ oral contraceptives, pregnancy, lactation Menopause: Biology

  7. Novel Techniques for High-Resolution Functional Imaging of Trabecular Bone

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    associated with osteoporosis (1, 2). Osteoporosis results in bone loss and deterioration in trabecular a primary endpoint in osteoporosis diagnosis and monitoring. Where strong correlations between bone density

  8. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Interpreting Bone Loss and Osteoporosis in Past Populations.2005. How many women have osteoporosis? Journal of Bone and1987. Postmenopausal osteoporosis: single screening method

  9. In Vivo Evaluation of the Presence of Bone Marrow in Cortical Porosity in Postmenopausal Osteopenic Women

    E-Print Network [OSTI]

    Goldenstein, Janet; Kazakia, Galateia; Majumdar, Sharmila

    2010-01-01T23:59:59.000Z

    bone resorption in osteoporosis. Calcif. Tissue Int. Augat,Porosity in Women with Osteoporosis. Vienna, Austria:porosity in women with osteoporosis. J. Bone Miner. Res.

  10. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  11. Controlling the Bone Marrow Dynamics in Cancer Chemotherapy

    E-Print Network [OSTI]

    Ledzewicz, Urszula

    Professor Award 1 #12;find optimal strategies for chemotherapy treatments of the cancer, where Controlling the Bone Marrow Dynamics in Cancer Chemotherapy Urszula Ledzewicz1 and Heinz Sch In the paper a mathematical model for the growth of the bone marrow under cell-cycle specific cancer

  12. Microcapsule-Induced Toughening of Bone Cement Gina M. Miller

    E-Print Network [OSTI]

    Sottos, Nancy R.

    27 Microcapsule-Induced Toughening of Bone Cement Gina M. Miller Senior in Aerospace Engineering R. White, and TAM Prof. Nancy R. Sottos Acrylic bone cement is the primary material used cement, it may be possible to extend the lifetime of the implant, thus reducing the occurrence

  13. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages · Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  14. Bone motion analysis from dynamic MRI: acquisition and tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    overload, impingement or femoral head instability. For both the diagnosis and the surgical planningBone motion analysis from dynamic MRI: acquisition and tracking Benjamin Gilles1 , Rosalind Perrin2 methods in order to auto- matically extract active bone kinematics from multi-slice real-time dy- namic

  15. Biomechanics in bone tissue engineering Dominique P. Pioletti*

    E-Print Network [OSTI]

    Guerraoui, Rachid

    such a procedure truly is, we report, in Figure 1(a), the particular case of a posterior surgical approachBiomechanics in bone tissue engineering Dominique P. Pioletti* Laboratory of Biomechanical 18 January 2010) Biomechanics may be considered as central in the development of bone tissue

  16. Protocadherin-7 induces bone metastasis of breast cancer

    SciTech Connect (OSTI)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China)] [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China)] [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05T23:59:59.000Z

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  17. On the Estimation of Bone Status Rasmus Paulsen

    E-Print Network [OSTI]

    Osteoporosis Diagnostics. The subject of this thesis is medical image analysis with special attention to X Reinhold Paulsen Keywords Osteoporosis, bone status, radius, contact radiographs, cortical geometry, en algorithm developed by Torsana Osteoporosis Diagnostics. A simulated bone is made by simulated x

  18. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly; Zimmermann, Elizabeth; Schaible, Eric; Tang, Simon; Alliston, Tamara; Ritchie, Robert

    2011-08-19T23:59:59.000Z

    Bone comprises a complex structure of primarily collagen, hydroxyapatite and water, where each hierarchical structural level contributes to its strength, ductility and toughness. These properties, however, are degraded by irradiation, arising from medical therapy or bone-allograft sterilization. We provide here a mechanistic framework for how irradiation affects the nature and properties of human cortical bone over a range of characteristic (nano to macro) length-scales, following x-­ray exposures up to 630 kGy. Macroscopically, bone strength, ductility and fracture resistance are seen to be progressively degraded with increasing irradiation levels. At the micron-­scale, fracture properties, evaluated using in-situ scanning electron microscopy and synchrotron x-ray computed micro-tomography, provide mechanistic information on how cracks interact with the bone-matrix structure. At sub-micron scales, strength properties are evaluated with in-situ tensile tests in the synchrotron using small-/wide-angle x-ray scattering/diffraction, where strains are simultaneously measured in the macroscopic tissue, collagen fibrils and mineral. Compared to healthy bone, results show that the fibrillar strain is decreased by ~40% following 70 kGy exposures, consistent with significant stiffening and degradation of the collagen. We attribute the irradiation-­induced deterioration in mechanical properties to mechanisms at multiple length-scales, including changes in crack paths at micron-­scales, loss of plasticity from suppressed fibrillar sliding at sub-­micron scales, and the loss and damage of collagen at the nano-­scales, the latter being assessed using Raman and Fourier-Transform-Infrared spectroscopy and a fluorometric assay.

  19. RMOTC - Testing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sale of Equipment and Materials DOE to Sell NPR-3 Testing Tomorrow's Technology Today RMOTC - Testing - From Lab to Industry, Moving Your Ideas Forward RMOTC provides a neutral,...

  20. Essential requirement of I-A region-identical host bone marrow or bone marrow-derived cells for tumor neutralization by primed L3T4+ T cells

    SciTech Connect (OSTI)

    Ozawa, H.; Iwaguchi, T.; Kataoka, T.

    1987-12-01T23:59:59.000Z

    The antitumor activity of Meth A-hyperimmunized BALB/c mouse spleen cells (Meth A-Im-SPL) was assayed by the Winn test in H-2 incompatible bone marrow chimeras in closed colony CD-1 (nu/nu), inbred DDD/1(nu/nu) (H-2s), or inbred BALB/c(nu/nu) (H-2d) mice as recipients. We found that Meth A-Im-SPL suppressed Meth A growth in the chimera nude mice which were reconstituted with bone marrow cells of the H-2d haplotype (i.e., BALB/c, DBA/2 and B10.D2), but not in the chimeras which were reconstituted with bone marrow cells of the H-2a, H-2b, or H-2k haplotype (i.e., B10.A, B10, and B10.BR). These results suggested that H-2 restriction occurred between Meth A-Im-SPL and bone marrow or bone marrow-derived cells in tumor neutralization. Furthermore, Meth A-Im-SPL did not suppress Meth 1 tumors (antigenically distinct from Meth A tumors) in the presence or absence of mitomycin C-treated Meth A in a Winn assay. These results suggested that there is tumor specificity in the effector phase as well as in the induction phase. The phenotype of the effectors in the Meth A-Im-SPL was Thy-1.2+ and L3T4+, because Meth A-Im-SPL lost their antitumor activity with pretreatment with anti-Thy-1.2 monoclonal antibody (mAb) and complement or anti-L3T4 mAb and complement, but not with anti-Lyt-2.2 mAb and complement or complement alone. Positively purified L3T4+ T cells from Meth A-Im-SPL (Meth A-Im-L3T4), obtained by the panning method, suppressed the tumor growth in the chimera nude mice which were reconstituted with bone marrow cells of B10.KEA2 mice (that were I-A region-identical with Meth A-Im-L3T4 cells but not others in H-2) as well as B10.D2 cells (that were fully identical with Meth A-Im-L3T4 cells in H-2). We conclude that Meth A-Im-SPL (L3T4+) neutralized the tumors in collaboration with I-A region-identical host bone marrow or bone marrow-derived cells, and the neutralization was not accompanied by the bystander effect.

  1. Relation between hydrogen isotopic ratios of bone collagen and rain

    SciTech Connect (OSTI)

    Cormie, A.B.; Schwarcz, H.P. (McMaster Univ., Hamilton, Ontario (Canada)); Gray, J. (Univ. of Alberta, Edmonton (Canada))

    1994-01-01T23:59:59.000Z

    The hydrogen isotopic value ([delta]D) of deer bone collagen is related to both [delta]D of rain during the growing season and growing season relative humidity (RH). With correction for the effects of RH, bone [delta]D is related to growing season rain [delta]D in a simple manner with a slope of 1.0. This indicates that, with RH correction, there are no additional sources of bias in the [delta]D of bone due to unaccounted for biologic or climatic effects. Due to a low sensitivity of bone [delta]D to RH effects, both yearly and growing season rain [delta]D can be estimated with considerable accuracy (R = 0.97 and R = 0.96) from bone collagen [delta]D and [delta][sup 15]N. Here, [delta][sup 15]N is used to correct bone [delta]D for the effects of RH. From these estimates of rain [delta]D, it may then be possible to evaluate temperature since the [delta]D of rain primarily reflects local temperature. Therefore, the measurement of bone collagen [delta]D has good potential for evaluating paleoclimates.

  2. The effects of low environmental cadmium exposure on bone density

    SciTech Connect (OSTI)

    Trzcinka-Ochocka, M., E-mail: ochocka@imp.lodz.pl [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Jakubowski, M. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Szymczak, W. [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland) [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland); Insitute of Psychology, University of Lodz (Poland); Janasik, B.; Brodzka, R. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)

    2010-04-15T23:59:59.000Z

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction ({beta}{sub 2}M-U RBP, NAG), glomerular dysfunction (Alb-U and {beta}{sub 2}M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  3. Processing of hydroxylapatite coatings on titanium alloy bone prostheses

    DOE Patents [OSTI]

    Nastasi, Michael A. (Espanola, NM); Levine, Timothy E. (Santa Clara, CA); Mayer, James W. (Phoenix, AZ); Pizziconi, Vincent B. (Phoenix, AZ)

    1998-01-01T23:59:59.000Z

    Processing of hydroxylapatite sol-gel films on titanium alloy bone prostheses. A method utilizing non-line-of-sight ion beam implantation and/or rapid thermal processing to provide improved bonding of layers of hydroxylapatite to titanium alloy substrates while encouraging bone ingrowth into the hydroxylapatite layers located away from the substrate, is described for the fabrication of prostheses. The first layer of hydroxylapatite is mixed into the substrate by the ions or rapidly thermally annealed, while subsequent layers are heat treated or densified using ion implantation to form layers of decreasing density and larger crystallization, with the outermost layers being suitable for bone ingrowth.

  4. ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone

    E-Print Network [OSTI]

    Price, Paul A.

    ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone Po-Yu Chen · Damon the hierarchical structure of mineral in mature bone. A method to completely deproteinize bone without altering of mineral and protein constituents. SEM revealed that bone minerals are fused together and form a sheet

  5. Interactive Separation of Segmented Bones in CT Volumes Using Graph Cut

    E-Print Network [OSTI]

    Ju, Tao

    mask customized to the shape of the bone, such as the femoral head. However, creat- ing masks for bones of different methodology have been reported for bone segmen- tation (see a recent survey in [1]). DueInteractive Separation of Segmented Bones in CT Volumes Using Graph Cut Lu Liu, David Raber, David

  6. Bone density and geometry in juvenile racehorses fed differing amounts of minerals

    E-Print Network [OSTI]

    Nolan, Meghan Muire

    2002-01-01T23:59:59.000Z

    designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

  7. Computer modeling approach for microsphere-packed bone scaffold Pallavi Lal, Wei Sun*

    E-Print Network [OSTI]

    Sun, Wei

    bone graft [5,6], for structural and human cellular assessment of scaffolds for bone repair [7 modeling approach for constructing a three-dimensional microsphere-packed bone graft structure is presented packing model to determine the number of microspheres packed in a synthesized bone graft. The pore size

  8. Prediction of the elastic modulus of the trabecular bone based on X-ray computed tomography

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . INTRODUCTION The investigation of the mechanical properties of trabe- cular bone presents a major challenge

  9. Test quality

    SciTech Connect (OSTI)

    Hartley, R.S. [EG and G Idaho, Inc., Idaho Falls, ID (United States); Keller, A.E. [Nuclear Regulatory Commission, Washington, DC (United States)

    1992-09-01T23:59:59.000Z

    This document discusses inservice testing of safety-related components at nuclear power plants which is performed under the American Society of Mechanical Engineers Boiler and Pressure Vessel Code (the Code). Subsections IWP and IWV of Section XI of the Code state test method and frequency requirements for pumps and valves respectively. Tests vary greatly in quality and frequency. This paper explores the concept of test quality and its relationship with operational readiness and preventive maintenance. This paper also considers the frequencies of component testing. Test quality is related to a test`s ability to detect degradation that can cause component failure. The quality of the test depends on several factors, including specific parameters measured, system or component conditions, and instrument accuracy. The quality of some currently required tests for check valves, motor-operated valves, and pumps is also discussed. Suggestions are made to improve test quality by measuring different parameters, testing valves under load, and testing positive displacement pumps at high pressure and centrifugal pumps at high flow rate conditions. These suggestions can help to improve the level of assurance of component operational readiness gained from testing.

  10. Evaluation of radionuclide bone-imaging for the early detection of sepsis in a model of equine neonatal osteomyelitis

    E-Print Network [OSTI]

    Taylor, James Rutledge

    1986-01-01T23:59:59.000Z

    method of detecting bone abnormalities. The two main factors determining the degree of radiopharmaceutical uptake in bones, and thereby assessing the functional integrity of bone, have been identified as bone blood flow and bone turnover rates.... The resultant infection and induced metabolic changes should produce a positive Technetium-99m MDP ( Tc-MDP) 99m bone scan, a positive scan using Indium-111-oxine labeled leukocytes and radiographic changes characterized by decreased bone density . Seven...

  11. autotaxin controls bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 3 Akt1 in Osteoblasts and Osteoclasts Controls Bone Remodeling University of Kansas -...

  12. On the Mechanistic Origins of Toughness in Bone

    E-Print Network [OSTI]

    Launey, Maximilien E.

    One of the most intriguing protein materials found in nature is bone, a material composed of assemblies of tropocollagen molecules and tiny hydroxyapatite mineral crystals that form an extremely tough, yet lightweight, ...

  13. Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics E.M.van Aken 1107895 of the joint and to relieve the pain, a prosthesis to replace the glenoid of the shoulder joint is an option

  14. affects bone tissue: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  15. acute bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  16. abnormal bone growth: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  17. abnormally high bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  18. acute bone crises: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  19. anorganic bone clinical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  20. abnormal bone development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  1. absorptiometry bone densitometer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  2. alveolar bone cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  3. acute bone infarcts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  4. acellular bone explants: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  5. adverse events bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    marrow disease Daldrup-Link, H E; Henning, T; Link, T M 2007-01-01 316 Bone loss during energy restriction: mechanistic role of leptin Texas A&M University - TxSpace Summary:...

  6. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  7. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  8. ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone

    E-Print Network [OSTI]

    Ritchie, Robert

    ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone in adult rats /Accepted: 3 September 2013 /Published online: 11 April 2014 # International Osteoporosis Foundation and National Osteoporosis Foundation 2014 Abstract Summary We used an osteopenic adult ovariectomized (OVX) rat

  9. areal bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2.2.4 Risk factors 22 2.2.5 Morbidity and mortality 23 2.3 Units Laughlin, Robert B. 103 Rare earth element systematics of fossil bone revealed by LA-ICPMS analysis Environmental...

  10. Modular ‘Click-in-Emulsion’ Bone-Targeted Nanogels

    E-Print Network [OSTI]

    Heller, Daniel A.

    A new class of nanogel demonstrates modular biodistribution and affinity for bone. Nanogels, ~70 nm in diameter and synthesized via an astoichiometric click-chemistry in-emulsion method, controllably display residual, free ...

  11. Children cortical bone characterisation: the ultrasonic J.-P. Berteaua

    E-Print Network [OSTI]

    Boyer, Edmond

    infantile osteo-pathologies. That is why there is a strong interest in the characterisation of the growing specific location (close to cancerous cells) or cadaveric bone. They indicate a lower Young's modulus

  12. Test quality

    SciTech Connect (OSTI)

    Hartley, R.S. (EG and G Idaho, Inc., Idaho Falls, ID (United States)); Keller, A.E. (Nuclear Regulatory Commission, Washington, DC (United States))

    1992-01-01T23:59:59.000Z

    This document discusses inservice testing of safety-related components at nuclear power plants which is performed under the American Society of Mechanical Engineers Boiler and Pressure Vessel Code (the Code). Subsections IWP and IWV of Section XI of the Code state test method and frequency requirements for pumps and valves respectively. Tests vary greatly in quality and frequency. This paper explores the concept of test quality and its relationship with operational readiness and preventive maintenance. This paper also considers the frequencies of component testing. Test quality is related to a test's ability to detect degradation that can cause component failure. The quality of the test depends on several factors, including specific parameters measured, system or component conditions, and instrument accuracy. The quality of some currently required tests for check valves, motor-operated valves, and pumps is also discussed. Suggestions are made to improve test quality by measuring different parameters, testing valves under load, and testing positive displacement pumps at high pressure and centrifugal pumps at high flow rate conditions. These suggestions can help to improve the level of assurance of component operational readiness gained from testing.

  13. Trabecular bone dosimetry using a Monte Carlo code

    E-Print Network [OSTI]

    Zuzarte de Mendonca, Anne

    1993-01-01T23:59:59.000Z

    The nuclear medicine community needs radiation ~ dose estimates to patients who are administered radiopharmaceuticals for therapy or diagnosis. These estimates should be as accurate as possible for any organ, and especially for the bone since the bone... of Nuclear Medicine formed a committee to fulfill the needs of the nuclear medicine community to determine the radiation absorbed dose to patients who are athninistered radiopharmaceuticals. The objectives of the Medical Internal Radiation Dose Committee...

  14. Test Images

    E-Print Network [OSTI]

    Test Images. I hope to have a set of test images for the course soon. Some images are available now; some will have to wait until I can find another 100-200

  15. On the effect of x-ray irradiation on the deformation and fracture behavior of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly D.; Launey, Maximilien E.; McDowell, Alastair A.; Ager III, Joel W.; Ritchie, Robert O.

    2010-01-10T23:59:59.000Z

    In situ mechanical testing coupled with imaging using high-energy synchrotron x-ray diffraction or tomography imaging is gaining in popularity as a technique to investigate micrometer and even sub-micrometer deformation and fracture mechanisms in mineralized tissues, such as bone and teeth. However, the role of the irradiation in affecting the nature and properties of the tissue is not always taken into account. Accordingly, we examine here the effect of x-ray synchrotron-source irradiation on the mechanistic aspects of deformation and fracture in human cortical bone. Specifically, the strength, ductility and fracture resistance (both work-of-fracture and resistance-curve fracture toughness) of human femoral bone in the transverse (breaking) orientation were evaluated following exposures to 0.05, 70, 210 and 630 kGy irradiation. Our results show that the radiation typically used in tomography imaging can have a major and deleterious impact on the strength, post-yield behavior and fracture toughness of cortical bone, with the severity of the effect progressively increasing with higher doses of radiation. Plasticity was essentially suppressed after as little as 70 kGy of radiation; the fracture toughness was decreased by a factor of five after 210 kGy of radiation. Mechanistically, the irradiation was found to alter the salient toughening mechanisms, manifest by the progressive elimination of the bone's capacity for plastic deformation which restricts the intrinsic toughening from the formation 'plastic zones' around crack-like defects. Deep-ultraviolet Raman spectroscopy indicated that this behavior could be related to degradation in the collagen integrity.

  16. Temperature Measurement During Polymerization of Bone Cement in Percutaneous Vertebroplasty: An In Vivo Study in Humans

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment (IRCC), Interventional Radiology Unit (Italy); Kanika, Khanna; Murphy, Kieran [Johns Hopkins Hospital, Radiology and Radiological Science (United States); Eminefendic, Haris [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy); Masala, Salvatore ['Tor Vergata' University General Hospital, Department of Diagnostic Imaging, Molecular Imaging, Interventional Radiology and Radiotherapy (Italy); Regge, Daniele [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy)

    2009-05-15T23:59:59.000Z

    Aim of the study was to 'in vivo' measure temperature, during percutaneous vertebroplasty (PV), within a vertebral body injected with different bone cements. According to the declaration of Helsinki, 22 women (60-80 years; mean, 75 years) with painful osteoporotic vertebral collapse underwent bilateral transpedicular PV on 22 lumbar vertebrae. Two 10-G vertebroplasty needles were introduced into the vertebra under digital fluoroscopy; a 16-G radiofrequency thermoablation needle (Starburst XL; RITA Medical System Inc., USA), carrying five thermocouples, was than coaxially inserted. Eleven different bone cements were injected and temperatures were measured every 30 s until temperatures dropped under 45{sup o}C. After the thermocouple needle was withdrawn, bilateral PV was completed with cement injection through the vertebroplasty needle. Unpaired Student's t-tests, Kruskal-Wallis test, and Wilcoxon signed rank test were used to evaluate significant differences (p < 0.05) in peak temperatures, variations between cements, and clinical outcome. All procedures were completed without complications, achieving good clinical outcomes (p < 0.0001). Regarding average peak temperature, cements were divided into three groups: A (over 60{sup o}C), B (from 50{sup o} to 60{sup o}C), and C (below 50{sup o}C). Peak temperature in Group A (86.7 {+-} 10.7{sup o}C) was significantly higher (p = 0.0172) than that in Groups B (60.5 {+-} 3.7{sup o}C) and C (44.8 {+-} 2.6{sup o}C). The average of all thermocouples showed an extremely significant difference (p = 0.0002) between groups. None of the tested cements maintained a temperature {>=}45{sup o}C for more than 30 min. These data suggest that back-pain improvement is obtained not by thermal necrosis but by mechanical consolidation only. The relative necrotic thermal effect in vertebral metastases seems to confirm that analgesia must be considered the main intent of PV.

  17. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  18. Common variants in the region around Osterix are associated with bone mineral density and growth in childhood

    E-Print Network [OSTI]

    Peltonen, Leena

    Peak bone mass achieved in adolescence is a determinant of bone mass in later life. In order to identify genetic variants affecting bone mineral density (BMD), we performed a genome-wide association study of BMD and related ...

  19. FFTF (Fast Flux Test Facility) cobalt test assembly results

    SciTech Connect (OSTI)

    Rawlins, J.A.; Wootan, D.W.; Carter, L.L.; Brager, H.R.; Schenter, R.E.

    1987-10-01T23:59:59.000Z

    A cobalt test assembly containing yttrium hydride pins for neutron moderation was irradiated in the Fast Flux Test Facility during Cycle 9A for 137.7 equivalent full power days at a power level of 291 MW. The 36 test pins consisted of a batch of 32 pins containing cobalt metal to produce Co-60, and a set of 4 pins with europium oxide to produce Gd-153, a radioisotope used in detection of the bone disease Osteoporosis. Post-irradiation examination of the cobalt pins determined the Co-60 produced with an accuracy of about 5%. The measured Co-60 spatially distributed concentrations were within 20% of the calculated concentrations. The assembly average Co-60 measured activity was 4% less than the calculated value. The europium oxide pins were gamma scanned for the europium isotopes Eu-152 and Eu-154 to an absolute accuracy of about 10%. The measured europium radioisotope and Gd-153 concentrations were within 20% of calculated values. In conclusion, the hydride assembly performed well and is an excellent vehicle for many Fast Flux Test Facility isotope production applications. The results also demonstrate that the calculational methods developed by the Westinghouse Hanford Company are very accurate. 4 refs., 3 figs., 1 tab.

  20. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  1. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    properties of proximal tibia were measured using in vivo peripheral quantitative CT. Bone formation rate was quantified on the periosteal the surface by standard bone histomorphometry after intraperitoneal injections of calcein. There was a significant main...

  2. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces 

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to bone surfaces. Although only plutonium was used in the evaluation of this model, any bone surface-seeking, alpha-emitting nuclide, and any class compound, can be used with this model....

  3. Apatite-polymer composites for the controlled delivery of bone morphogenetic proteins

    E-Print Network [OSTI]

    Yong, Tseh-Hwan

    2005-01-01T23:59:59.000Z

    Current treatment of bone defects due to trauma, cancer, or degenerative spine diseases involves the implantation of a bone graft. Autografts, which are harvested from the patient's own body, are associated with problems ...

  4. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    translates into molecular osteogenic signals in bone cells is unknown. Radiation exposure is another potent inducer of bone loss, namely observed on Earth in the clinical setting following radiotherapy procedures. It is expected that long duration space...

  5. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training 

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    Young and ovariectomized animals eating diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs) exhibit enhanced bone formation and decrease bone loss, respectively. Eicosapentaenoic acid, an n-3 PUFA found in fish ...

  6. Detection of bone disease in dogs by radioisotope scanning

    E-Print Network [OSTI]

    Morris, Earl Louis

    1971-01-01T23:59:59.000Z

    f = fractional abundance 6 = cross section thermal neutron f1~ &t (1-e ) = decay factor The usual method of administration of radio- isotopes is intravenously but some have been given orally. 4 high bone to tissue ratio must be achieved... is limited by their availability because they must be produced close to where they will be used. MATERIALS AND METHODS The use of 2 radioactive isotopes for bone scanning in dogs was studied. Sr and Sr were 85 87m selected as the isotopes to be studied...

  7. Measurement of bone mineral content in caged and active cats 

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    errors but these can be reduced by using two different x-ray energies. Dual energy CT operates on a basis similar to dual photon absorptiometry (explained below). The difference in attenuation between tissue and bone is greater for a lower energy... to act as a soft tissue equivalent (35). Effects of fat and soft tissue are decreased when dual energy CT is used (33). Data from each of the two different photon energies are combined and result in images of soft tissue and bone mineral regions. Beam...

  8. The effects of eccentric training on muscle-bone function

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 1999 Major Subject: Kinesiology THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Subinitted to the Office of Graduate Studies of Texas A8iM University in partial fulfillment of the requirements...

  9. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    . While we cannot measure bone stress in vivo, we can visualize bone metabolic activity using 18 F NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate whether subjects. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: patellofemoral pain; 18 F NaF PET/CT; bone

  10. Is decreased bone mineral density associated with development of scoliosis? A bipedal osteopenic rat model

    E-Print Network [OSTI]

    Dede, Ozgur; Akel, Ibrahim; Demirkiran, Gokhan; Yalcin, Nadir; Marcucio, Ralph; Acaroglu, Emre

    2011-01-01T23:59:59.000Z

    more time standing erect. Dual energy X-ray absorbtiometry (acid; DEXA: Dual energy X-ray absorptiometry; BMD: Bone

  11. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  12. Test Comparability

    E-Print Network [OSTI]

    Keller, Christine; Shulenburger, David E.

    2010-01-01T23:59:59.000Z

    KU ScholarWorks | http://kuscholarworks.ku.edu Test Comparability 2010 by Christine Keller and David Shulenburger This work has been made available by the University of Kansas Libraries’ Office of Scholarly Communication and Copyright. Please... and Shulenburger, David. “Test comparability,” with Christine Keller in the Letters section of Change, September/October 2010, p. 6. Published version: http://www.changemag.org/Archives/Back%20 Issues/September-October%202010/letters-to-editor.html Terms of Use...

  13. Test Automation Ant JUnit Test Automation

    E-Print Network [OSTI]

    Mousavi, Mohammad

    Test Automation Ant JUnit Test Automation Mohammad Mousavi Eindhoven University of Technology, The Netherlands Software Testing 2012 Mousavi: Test Automation #12;Test Automation Ant JUnit Outline Test Automation Ant JUnit Mousavi: Test Automation #12;Test Automation Ant JUnit Why? Challenges of Manual Testing

  14. Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence of cortical fixation

    E-Print Network [OSTI]

    Guerraoui, Rachid

    Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence Keywords: Screw fixation Pullout force Calcium phosphate cement Osteoporotic bone a b s t r a c with cement. Previous studies have shown that bone augmentation with Calcium Phosphate (CaP) cement

  15. Augmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep

    E-Print Network [OSTI]

    Guerraoui, Rachid

    replacement, where significant bone loss can be found either under the tibial tray or in the femoral partAugmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep U March 2010 Keywords: Biocomposite Bone substitute In vivo Poly(L-lactic acid) b-Tricalcium phosphate a b

  16. Design and validation of automated femoral bone morphology measurements in cerebral palsy

    E-Print Network [OSTI]

    Lee, Jehee

    Design and validation of automated femoral bone morphology measurements in cerebral palsy Noyeol, Seoul, South Korea #12;Abstract Accurate quantification of bone morphology is important for monitoring an automatic bone morphology measurement method using one or two radiographs. The study focused on 4

  17. A method for calibration of bone driver transducers to measure the mastoid impedance Reggie Weecea

    E-Print Network [OSTI]

    Allen, Jont

    bone vibrator transducers for clinical measurements, the transfer of energy from the bone driver by known masses. This absolute calibration is based upon a circuit model of the driver, describing specialized equipment not available in the clinic, and a refined bone driver circuit model is proposed

  18. Modelling by percolation theory of the behaviour of natural coral used as bone substitute.

    E-Print Network [OSTI]

    Boyer, Edmond

    Modelling by percolation theory of the behaviour of natural coral used as bone substitute. Y the resorption and ossification of natural coral implanted in bones. The first step of the process.barbotteau@qse.tohoku.ac.jp) #12;Modelling by percolation theory of the behaviour of natural coral used as bone substitute.2 1

  19. Histologic Comparison of Regenerate Bone Produced from Dentate Versus Edentulous Transport Discs in Bone Transport Distraction Osteogenesis

    E-Print Network [OSTI]

    Sevilla Gaitan, Carlos

    2013-12-10T23:59:59.000Z

    and the recipient bone segment (Nagashima, Rondon-Newby et al. 2012). Histologic examination of the midline tissues was performed in the present study to establish whether or not bony union has occurred. Main Goal The main goal of this study was to analyze... emphasis on characteristics related to the quality and quantity of the new regenerate bone formed (Zapata, Halvachs et al. 2011; Zapata, Opperman et al. 2011; Nagashima, Rondon-Newby et al. 2012). Nagashima et al. concluded that after four weeks...

  20. Evolution of Matrix and Bone -Carboxyglutamic Acid Proteins in Vertebrates*

    E-Print Network [OSTI]

    Price, Paul A.

    or reconstructed through the use of comparative genomics and data mining. These sequences were compared with available annotated sequences (a total of 48 complete or nearly complete sequences, 28 BGPs and 20 MGPs of biological functions such as skeletogenesis and bone maintenance (BGP and MGP), hemostasis (prothrombin, clot

  1. FSH Directly Regulates Bone Mass Yuanzhen Peng,1

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    .01.051 SUMMARY Postmenopausal osteoporosis, a global public health problem, has for decades been attributed and function. We suggest that high circulating FSH causes hypogonadal bone loss. INTRODUCTION Osteoporosis., 1993; Manolagas and Jilka, 1995). After menopause, resorption significantly exceeds formation

  2. Invest in Your Bones Osteoporosis--The Silent Disease

    E-Print Network [OSTI]

    Invest in Your Bones Osteoporosis--The Silent Disease Leaflet 2 Osteoporosis, a painful of State Health Services, 2008). Osteoporosis is preventable and/or treatable. Accordingly, osteoporosis of height, and chronic back pain. Hip fracture, the most serious consequence of osteoporosis, threatens one

  3. Spectral Analysis and Connectivity of Porous Microstructures in Bone

    E-Print Network [OSTI]

    Golden, Kenneth M.

    that quantifies brine connectivity and its thermal evolution can also help assess the impact of osteoporosis on trabecular structure. Central to our approach is the spectral measure of a composite material, which contains, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  4. Splenic concentration of bone imaging agents in functional asplenia

    SciTech Connect (OSTI)

    Dhekne, R.D.

    1981-07-01T23:59:59.000Z

    Three cases of sickle cell disease associated with functional asplenia are described. The spleen was not visualized on routine Tc-99m-sulfur colloid scan. The bone scan performed with Tc-99m-phosphate compounds revealed abnormal splenic activity in all three cases. The previous case reports and the literature on this subject are reviewed.

  5. Metastatic calcification of the stomach imaged on a bone scan

    SciTech Connect (OSTI)

    Goldstein, R.; Ryo, U.Y.; Pinsky, S.M.

    1984-10-01T23:59:59.000Z

    A whole body bone scan obtained on a 21-year-old woman with sickle cell disease and chronic renal failure showed localization of the radionuclide diffusely in the stomach. The localization of the radionuclide represented metastatic calcification of the stomach caused by secondary hyperparathyroidism.

  6. Random lasing in bone tissue Qinghai Song,1

    E-Print Network [OSTI]

    Kim, Young L.

    of Biomedical Engineering, Purdue University, West Lafayette, Indiana 47907, USA 2 School of Electrical, 2010; posted March 26, 2010 (Doc. ID 122271); published April 28, 2010 Owing to the low-loss and high and deformation mecha- nisms in bone still remain relatively unexplored, in part, due to current technical

  7. A Signal-Inducing Bone Cement for Magnetic Resonance Imaging-Guided Spinal Surgery Based on Hydroxyapatite and Polymethylmethacrylate

    SciTech Connect (OSTI)

    Wichlas, Florian, E-mail: florian.wichlas@charite.de; Seebauer, Christian J.; Schilling, Rene [University Charite, Center for Musculoskeletal Surgery (Germany); Rump, Jens [University Charite, Department of Radiology (Germany); Chopra, Sascha S. [University Charite, Center for Musculoskeletal Surgery (Germany); Walter, Thula; Teichgraeber, Ulf K. M. [University Charite, Department of Radiology (Germany); Bail, Hermann J. [University Charite, Center for Musculoskeletal Surgery (Germany)

    2012-06-15T23:59:59.000Z

    The aim of this study was to develop a signal-inducing bone cement for magnetic resonance imaging (MRI)-guided cementoplasty of the spine. This MRI cement would allow precise and controlled injection of cement into pathologic lesions of the bone. We mixed conventional polymethylmethacrylate bone cement (PMMA; 5 ml methylmethacrylate and 12 g polymethylmethacrylate) with hydroxyapatite (HA) bone substitute (2-4 ml) and a gadolinium-based contrast agent (CA; 0-60 {mu}l). The contrast-to-noise ratio (CNR) of different CA doses was measured in an open 1.0-Tesla scanner for fast T1W Turbo-Spin-Echo (TSE) and T1W TSE pulse sequences to determine the highest signal. We simulated MRI-guided cementoplasty in cadaveric spines. Compressive strength of the cements was tested. The highest CNR was (1) 87.3 (SD 2.9) in fast T1W TSE for cements with 4 {mu}l CA/ml HA (4 ml) and (2) 60.8 (SD 2.4) in T1W TSE for cements with 1 {mu}l CA/ml HA (4 ml). MRI-guided cementoplasty in cadaveric spine was feasible. Compressive strength decreased with increasing amounts of HA from 46.7 MPa (2 ml HA) to 28.0 MPa (4 ml HA). An MRI-compatible cement based on PMMA, HA, and CA is feasible and clearly visible on MRI images. MRI-guided spinal cementoplasty using this cement would permit direct visualization of the cement, the pathologic process, and the anatomical surroundings.

  8. A multiscale mechanobiological model of bone remodelling predicts site-specific bone loss in the femur during osteoporosis and mechanical disuse

    E-Print Network [OSTI]

    Lerebours, C; Scheiner, S; Pivonka, P

    2015-01-01T23:59:59.000Z

    We propose a multiscale mechanobiological model of bone remodelling to investigate the site-specific evolution of bone volume fraction across the midshaft of a femur. The model includes hormonal regulation and biochemical coupling of bone cell populations, the influence of the microstructure on bone turnover rate, and mechanical adaptation of the tissue. Both microscopic and tissue-scale stress/strain states of the tissue are calculated from macroscopic loads by a combination of beam theory and micromechanical homogenisation. This model is applied to simulate the spatio-temporal evolution of a human midshaft femur scan subjected to two deregulating circumstances: (i) osteoporosis and (ii) mechanical disuse. Both simulated deregulations led to endocortical bone loss, cortical wall thinning and expansion of the medullary cavity, in accordance with experimental findings. Our model suggests that these observations are attributable to a large extent to the influence of the microstructure on bone turnover rate. Mec...

  9. Liquid-Solid Phase Transition Alloy as Reversible and Rapid Molding Bone Cement

    E-Print Network [OSTI]

    Yi, Liting; Liu, Jing

    2013-01-01T23:59:59.000Z

    Bone cement has been demonstrated as an essential restorative material in the orthopedic surgery. However current materials often imply unavoidable drawbacks, such as tissue-cement reaction induced thermal injuries and troublesome revision procedure. Here we proposed an injectable alloy cement to address such problems through its liquid-solid phase transition mechanism. The cement is made of a unique alloy BiInSnZn with a specifically designed low melting point 57.5{\\deg}C. This property enables its rapid molding into various shapes with high plasticity. Some fundamental characteristics including mechanical strength behaviors and phase transition-induced thermal features have been measured to demonstrate the competence of alloy as unconventional cement with favorable merits. Further biocompatible tests showed that this material could be safely employed in vivo. In addition, experiments also found the alloy cement capability as an excellent contrast agent for radiation imaging. Particularly, the proposed alloy...

  10. Verification Testing Test Driven Development Testing with JUnit Verification

    E-Print Network [OSTI]

    Peters, Dennis

    Verification Testing Test Driven Development Testing with JUnit Verification Any activity should be verified. #12;Verification Testing Test Driven Development Testing with JUnit Approaches to verification 1 Testing 2 Static Analysis · Peer review · Insepction/Walk-through/Structured review · Formal

  11. Peri-prosthetic fracture vibration testing

    SciTech Connect (OSTI)

    Cruce, Jesse R [Los Alamos National Laboratory; Erwin, Jenny R [Los Alamos National Laboratory; Remick, Kevin R [Los Alamos National Laboratory; Cornwell, Phillip J [Los Alamos National Laboratory; Menegini, R. Michael [INDIANA UNIV.; Racanelli, Joe [STRYKER ORTHOPAEDICS

    2011-01-28T23:59:59.000Z

    The purpose of this study is to establish a test setup and vibration analysis method to predict femoral stem seating and prevent bone fracture using accelerometer or force response data from an instrument stem and impactor. This study builds upon earlier studies to identify a means to supplement a surgeon's tactile and auditory senses by using damage identification techniques normally used for civil and mechanical structures. Testing will be conducted using foam cortical shell sawbones prepared for stems of different geometries. Each stem will be instrumented with an accelerometer. Two impactor designs will be compared: a monolithic impactor with an integrated load cell and accelerometer and a two piece impactor. Acceleration and force measurements will be taken in the direction of impaction. Signal processing techniques will be applied to the acceleration time histories to determine features that can be used to assess device seating and potential fracture. A consistent energy input will be applied using a drop tower. The effect of introducing compliance under the bone support vise will also be investigated. The ultimate goal of this study is to design an integrated portable data acquisition system capable of being used in future cadaveric testing. This paper will discuss the experimental set-up, the signal processing techniques used and the subsequent results.

  12. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ), moment can be related to stress by; (2-23) M =f cr?ydA 24 eutral surface Y Figure 2. 10. a. ) Stress distribution through the cross section of an elastic-perfectly plastic material in bending (Crandall et al. 1978). b. ) Stress-strain curvefor... and strain are still linearly related by s = ay/E and by substitution: (2-27) a, K= ? = Also, the yield curvature, Ky call be found from equatloll (2 5) wllel'e M: My so: (2-28) M?2cr, El Eh 26 Combining (2-27) and (2-28) gives: (2-29) h k, 2e Using...

  13. Verifying Test Hypotheses -HOL/TestGen Verifying Test Hypotheses -HOL/TestGen

    E-Print Network [OSTI]

    Verifying Test Hypotheses - HOL/TestGen Verifying Test Hypotheses - HOL/TestGen An Experiment in Test and Proof Thomas Malcher January 20, 2014 1 / 20 #12;Verifying Test Hypotheses - HOL/TestGen HOL/TestGen Outline Introduction Test Hypotheses HOL/TestGen - Demo Verifying Test Hypotheses Conclusion 2 / 20 #12

  14. Measuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT imaging.

    E-Print Network [OSTI]

    Piana, Michele

    ; 7 CNR-SPIN. Genova. Italy Running Head: PET/CT measurement of bone marrow volume AddressMeasuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT to chemotherapy. Keywords: PET/CT; bone marrow imaging; image processing. #12;2 Introduction Bone marrow (BM

  15. Microgrid Testing

    SciTech Connect (OSTI)

    Shirazi, M.; Kroposki, B.

    2012-01-01T23:59:59.000Z

    With the publication of IEEE 1574.4 Guide for Design, Operation, and Integration of Distributed Resource Island Systems with Electric Power Systems, there is an increasing amount of attention on not only the design and operations of microgrids, but also on the proper operation and testing of these systems. This standard provides alternative approaches and good practices for the design, operation, and integration of microgrids. This includes the ability to separate from and reconnect to part of the utility grid while providing power to the islanded power system. This presentation addresses the industry need to develop standardized testing and evaluation procedures for microgrids in order to assure quality operation in the grid connected and islanded modes of operation.

  16. Standardization of test methodology: a comparison between three suture anchors

    E-Print Network [OSTI]

    Jonnalagadda, Silpa P.

    2005-08-29T23:59:59.000Z

    was not the weakest link in the system. Meyer et al.12, however, reported that absorbable suture anchors are made of mechanically weak material and could be the weakest links in the soft tissue-anchor-bone complex. Investigators have also developed various modified... STANDARDIZATION OF TEST METHODOLOGY: A COMPARISON BETWEEN THREE SUTURE ANCHORS A Thesis by SILPA P. JONNALAGADDA Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements...

  17. Identification of a hypoxic population of bone marrow cells

    SciTech Connect (OSTI)

    Allalunis, M.J.; Chapman, J.D.; Turner, A.R.

    1983-02-01T23:59:59.000Z

    A technique using collagenase has been devised to release and separate, with reproducibility, hematopoietic cells (HC) from various microenvironments of mouse femurs. HC were assayed by an in vitro gel culture technique used traditionally to score granulocyte-macrophage precursor cells (CFU-C). CFU-C which resided in the medullary cavity and endosteal regions were sensitive to ionizing radiation and resistant to misonidazole (MISO) cytotoxicity. CFU-C which resided within the compact bone were resistant to ionizing radiation and sensitive to the cytotoxic action of MISO. These results suggest that HC which reside in the bone are hypoxic and retain clonogenic potential. When animals were exposed to various treatments with MISO followed by myelotoxic doses of cyclophosphamide (CTX) or total body irradiation (TBI), the LD/sub 50/ of both agents was significantly reduced. This result suggests that a hypoxic component of HC could be important in the regenerative process within the marrow after such myelotoxic trauma.

  18. Exposure to cadmium and persistent organochlorine pollutants and its association with bone mineral density and markers of bone metabolism on postmenopausal women

    SciTech Connect (OSTI)

    Rignell-Hydbom, A., E-mail: anna.rignell-hydbom@med.lu.se [Department of Occupational and Environmental Medicine, Lund University (Sweden); Skerfving, S.; Lundh, T.; Lindh, C.H. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Elmstahl, S. [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden)] [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden); Bjellerup, P. [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden)] [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden); Juensson, B.A.G.; Struemberg, U. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Akesson, A. [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)] [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)

    2009-11-15T23:59:59.000Z

    Environmental contaminants such as cadmium and persistent organochlorine pollutants have been proposed as risk factors of osteoporosis, and women may be at an increased risk. To assess associations between exposure to cadmium and two different POPs (2,2',4,4',5,5'-hexachlorobiphenyl CB-153, 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene p,p'-DDE), on one hand, and bone effects, on the other, in a population-based study among postmenopausal (60-70 years) Swedish women with biobanked blood samples. The study included 908 women and was designed to have a large contrast of bone mineral densities, measured with a single photon absorptiometry technique in the non-dominant forearm. Biochemical markers related to bone metabolism were analyzed in serum. Exposure assessment was based on cadmium concentrations in erythrocytes and serum concentrations of CB-153 and p,p'-DDE. Cadmium was negatively associated with bone mineral density and parathyroid hormone, positively with the marker of bone resorption. However, this association disappeared after adjustment for smoking. The major DDT metabolite (p,p'-DDE) was positively associated with bone mineral density, an association which remained after adjustment for confounders, but the effect was weak. There was no evidence that the estrogenic congener (CB-153) was associated with any of the bone markers. In conclusion, no convincing associations were observed between cadmium and POPs, on one hand, and bone metabolism markers and BMD, on the other.

  19. A comparative histological study of fossil and recent bone tissues

    E-Print Network [OSTI]

    Enlow, Donald H.

    1955-01-01T23:59:59.000Z

    ? scopic inspection. A wet section, as viewed during trial grinding examinations, will appear more transparent than the dried, finished mount. Any of the standard laboratory abrasives, such as finely powdered carborundum, polishing alumina, or powdered... by hand with the bone section in direct contact with the revolving surface of a power-driven lap wheel. Finely powdered abrasive, such as carborundum or cleansing pov/der, is applied in the form of water paste to the wheel. Periodic inspection under a...

  20. Effects of hyperparathyroidism and calcium on bone healing

    E-Print Network [OSTI]

    Hubbard, Gene Borden

    1975-01-01T23:59:59.000Z

    lesions, blood chemistry data and microscopic examination of bone, The citations on the following pages follow the style of the Sutrnaf. 0$ She. Amuck'. can Vetenanacq Medx. caf. Ass acL aX&0n. CHAPTER II LITERATURE REVIEW Trauma has traditionally...- parathyroidism; however, lameness disappeared in horses fed a standard ration containing 0. 52; calcium and 0. 45+ phosphorus. The case history of a man with hyperparathyroidism in which the main clinical feature was multiple nonuniting 7 fractures has been...

  1. Porous coatings from wire mesh for bone implants

    DOE Patents [OSTI]

    Sump, Kenneth R. (Richland, WA)

    1986-01-01T23:59:59.000Z

    A method of coating areas of bone implant elements and the resulting implant having a porous coating are described. Preselected surface areas are covered by a preform made from continuous woven lengths of wire. The preform is compressed and heated to assure that diffusion bonding occurs between the wire surfaces and between the surface boundaries of the implant element and the wire surfaces in contact with it. Porosity is achieved by control of the resulting voids between the bonded wire portions.

  2. Aging and Fracture of Human Cortical Bone and Tooth Dentin

    SciTech Connect (OSTI)

    Ager, Joel; Koester, Kurt J.; Ager III, Joel W.; Ritchie, Robert O.

    2008-05-07T23:59:59.000Z

    Mineralized tissues, such as bone and tooth dentin, serve as structural materials in the human body and, as such, have evolved to resist fracture. In assessing their quantitative fracture resistance or toughness, it is important to distinguish between intrinsic toughening mechanisms which function ahead of the crack tip, such as plasticity in metals, and extrinsic mechanisms which function primarily behind the tip, such as crack bridging in ceramics. Bone and dentin derive their resistance to fracture principally from extrinsic toughening mechanisms which have their origins in the hierarchical microstructure of these mineralized tissues. Experimentally, quantification of these toughening mechanisms requires a crack-growth resistance approach, which can be achieved by measuring the crack-driving force, e.g., the stress intensity, as a function of crack extension ("R-curve approach"). Here this methodology is used to study of the effect of aging on the fracture properties of human cortical bone and human dentin in order to discern the microstructural origins of toughness in these materials.

  3. Prototype to Test WHY prototype to test

    E-Print Network [OSTI]

    Prinz, Friedrich B.

    Prototype to Test METHOD WHY prototype to test HOW to prototype to test Prototyping to test or design space. The fundamental way you test your prototypes is by letting users experience them and react to them. In creating prototypes to test with users you have the opportunity to examine your solution

  4. Adaptive differentiation of H-2- and Igh-restricted B lymphocyte in tetraparental bone marrow chimera

    SciTech Connect (OSTI)

    Yamamoto, H.; Bitoh, S.; Fujimoto, S.

    1987-01-15T23:59:59.000Z

    Immunization of BALB/c mice with MOPC-104E myeloma protein induced idiotype-specific enhancing B cells that acted on anti-dextran antibody producing B cells. The enhancing cells have the surface phenotype of B cells. With the use of several H-2 or Igh congenic mice, it was found that the cooperation among B cells was controlled by both the major histocompatibility complex (MHC) and Igh. The capability to generate enhancing B cell activity was analyzed by using tetraparental bone marrow chimeras. (C57BL/6 X BALB/c)F1 mice, for example, were lethally irradiated and were reconstituted with C57BL/6 and BALB/c bone marrow cells. Nine to 12 wk after the reconstitution, the chimeras were immunized with the myeloma protein and were tested for their enhancing B cell activity. After the removal of C57BL/6 origin cells by treatment with anti-H-2b + complement, residual cells exhibited enhancing B cell activity on BALB.B, as well as BALB/c antidextran antibody response. This indicates that the generation of H-2-restricted, idiotype-specific enhancing B cell activity differentiated adaptively so as to recognize foreign MHC as self under chimeric conditions. On the other hand, splenic B cells treated with anti-H-2d + complement did not enhance the responses of BALB/c or BALB.B. Even in a chimeric environment, the B cells of C57BL/6 origin could not obtain the ability to generate enhancing B cell activity upon immunization of the idiotype. The results described here, taken in conjunction with our previous studies, suggest that the Ig heavy chain gene(s) predominantly control the Igh restriction properties of enhancing B cells, and the capability of MHC recognition by B cells is selected under chimeric conditions.

  5. Retrograde Melting and Internal Liquid Gettering in Silicon

    SciTech Connect (OSTI)

    Hudelson, Steve; Newman, Bonna K.; Bernardis, Sarah; Fenning, David P.; Bertoni, Mariana I.; Marcus, Matthew A.; Fakra, Sirine C.; Lai, Barry; Buonassisi, Tonio

    2011-07-01T23:59:59.000Z

    Retrograde melting (melting upon cooling) is observed in silicon doped with 3d transition metals, via synchrotron-based temperature-dependent X-ray microprobe measurements. Liquid metal-silicon droplets formed via retrograde melting act as efficient sinks for metal impurities dissolved within the silicon matrix. Cooling results in decomposition of the homogeneous liquid phase into solid multiple-metal alloy precipitates. These phenomena represent a novel pathway for engineering impurities in semiconductor-based systems.

  6. Retrograde Melting and Internal Liquid Gettering in Silicon

    E-Print Network [OSTI]

    Hudelson, Steve

    2012-01-01T23:59:59.000Z

    of high-performance integrated circuit, photovoltaic, andperformance and widening the range of acceptable feedstock qualities for low-cost photovoltaic

  7. Retrograde Melting and Internal Liquid Gettering in Silicon

    E-Print Network [OSTI]

    Hudelson, Steve

    2012-01-01T23:59:59.000Z

    X-ray ?uorescence microscopy ( ? -XRF) mapping was used toimpurities detected by ? -XRF was determined by X-raymetal-silicon mixture. ? -XRF mapping of the standard at

  8. A Lithium Getter Pump System ---- nventors Richard Majeski, Eugene Kearns,

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del(ANL-IN-03-032) -Less isNFebruaryOctober 2, AlgeriaQ1 Q2youKINETIC S'FUDY OFAAand

  9. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate: patellofemoral pain; 18 F NaF PET/CT; bone metabolic activity Patellofemoral pain syndrome is often characterized the specific regions of tracer uptake. 18 F NaF PET/CT is an alter- native to Tc-99m MDP bone scintigraphy

  10. Frontal and orbital bone infarctions causing periorbital swelling in patients with sickle cell anemia

    SciTech Connect (OSTI)

    Garty, I.; Koren, A.; Garzozi, H.

    1984-10-01T23:59:59.000Z

    Two cases of unilateral and bilateral periorbital hematomas occurred in patients with sickle cell anemia. The cause of periorbital swelling in these cases was found to be orbital and frontal bone infarctions, respectively, diagnosed by technetium Tc 99m medronate bone scintigraphy. To our knowledge, periorbital bone infarction, as a part of the differential diagnosis of periorbital hematoma and as part of the possible ocular manifestations in patients with sickle cell anemia, has not previously been described.

  11. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    on Bone During Extended Bed Rest (Human) Only a few long-term bed rest investigations have successfully mitigated bone loss with exercise paradigms. Combined supine flywheel resistive and treadmill exercise during 90-day bed rest in young men... novel rodent resistance exercise device using flywheel technology was used by Fluckey et al (57) to demonstrate the effects of maximal voluntary squats, performed during suspension, on changes in metaphyseal bone mass. The flywheel exercise protocol...

  12. Journal of Biomechanics 41 (2008) 10621068 Nonlinear ultrasound can detect accumulated damage in human bone

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    due to the fact that osteoporosis and bone fragility are increasingly widespread diseases. Fracture increases exponentially with age, with a significant increase corresponding to the beginning of menopause

  13. Preparation and characterization of calcium phosphate ceramics and Composites as bone substitutes

    E-Print Network [OSTI]

    Zhang, Xing

    2007-01-01T23:59:59.000Z

    bone. Natural porous calcium carbonate skeletons, coral andconversion of calcium carbonate marine skeletons in (NH 4 )conversions of calcium carbonate skeletons (e.g. coral,

  14. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    risk of vertebral osteoporosis compared to men with noto identify patients with osteoporosis. Keywords Bone loss .associated with COPD, osteoporosis is believed to affect 36%

  15. MECHANICAL TEST LAB CAPABILITIES

    E-Print Network [OSTI]

    MECHANICAL TEST LAB CAPABILITIES · Static and cyclic testing (ASTM and non-standard) · Impact drop testing · Slow-cycle fatigue testing · High temperature testing to 2500°F · ASTM/ Boeing/ SACMA standard testing · Ability to design and fabricate non-standard test fixtures and perform non-standard tests

  16. Orion Flight Test Exploration Flight Test-1

    E-Print Network [OSTI]

    Waliser, Duane E.

    Orion Flight Test Exploration Flight Test-1 PRESS KIT/December 2014 www.nasa.gov NP-2014-11-020-JSC National Aeronautics and Space Administration #12;#12;Orion Flight Test December 2014 Contents Section Page ........................................................................................... 28 i #12;Orion Flight Test ii December 2014 #12;Orion Flight Test December 2014 Flight Overview

  17. Test Preparation Options Free Test Prep Websites

    E-Print Network [OSTI]

    Stowell, Michael

    Test Preparation Options Free Test Prep Websites ACT: http: http://www.collegeboard.com/student/testing/sat/prep_one/test.html http://www.number2.com://testprep.princetonreview.com/CourseSearch/Search.aspx?itemCode=17&productType=F&rid=1&zip=803 02 Test Prep Classes Front Range Community College: Classes

  18. Test and Test Equipment Joshua Lottich

    E-Print Network [OSTI]

    Patel, Chintan

    Test and Test Equipment Joshua Lottich CMPE 640 11/23/05 #12;Testing Verifies that manufactured chip meets design specifications. Cannot test for every potential defect. Modeling defects as faults allows for passing and failing of chips. Ideal test would capture all defects and pass only chips

  19. SU-E-J-162: Quality Assurance Procedures for MR Guided Focused Ultrasound Treatment of Bone Metastasis

    SciTech Connect (OSTI)

    Chen, L; Chen, X; Wang, B; Gupta, R; Ma, C [Fox Chase Cancer Center, Philadelphia, PA (United States)

    2014-06-01T23:59:59.000Z

    Purpose: The purpose of this work is to develop and verify our quality assurance (QA) procedures to ensure the safety and efficacy of MR-guided focused ultrasound (MRgFUS) treatment of bone metastases. Methods: A practical QA program was developed. Monthly and daily QA (DQA) procedures were performed. The major QA items included the checks of the machine hardware, software and patient safety features. Briefly, these checks/tests include: 1) the cooling system reservoir and treatment table; 2) power to the treatment table; 3) the MR coil; 4) the transducer position with MRI; 5) image display on the treatment work station; 6) the effective focal spot in 3 directions using MR thermometry; and 7) all the safety devices including a sonication lamp, and the emergency stop-sonication switches. In order to avoid patient skin burn, it is important to remove gas bubbles in the interfaces between the treatment table and the gel pad, and the gel pad and patients skin during the patient setup. Our QA procedures have been verified and evaluated through patient treatments. Seven patients with scapula, humeral head, sacrum, ilium, pubic ramus and acetabular bone metastases were treated using MRgFUS. Results: Our study showed that all seven patients tolerated the MRgFUS treatment well. No skin toxicity or other complications were observed. The pain score (0–10) using the visual analog scale (VAS) was significantly reduced from 8.0 ± 1.1 before treatment to 4.7 ± 3.0, 3.0 ± 1.5, 3.2 ± 2.8 and 3.4 ± 1.5 at one day, one month, two months and three months after the MRgFUS treatment, respectively. Conclusion: We demonstrated that with the appropriate QA procedures, MRgFUS is a safe, effective and noninvasive treatment modality for palliation of bone metastases.

  20. Bone mineral density and blood metals in premenopausal women

    SciTech Connect (OSTI)

    Pollack, A.Z., E-mail: pollacka@mail.nih.gov [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Mumford, S.L. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Wactawski-Wende, J. [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States)] [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States); Yeung, E.; Mendola, P.; Mattison, D.R.; Schisterman, E.F. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)

    2013-01-15T23:59:59.000Z

    Exposure to metals, specifically cadmium, lead, and mercury, is widespread and is associated with reduced bone mineral density (BMD) in older populations, but the associations among premenopausal women are unclear. Therefore, we evaluated the relationship between these metals in blood and BMD (whole body, total hip, lumbar spine, and non-dominant wrist) quantified by dual energy X-ray absorptiometry in 248 premenopausal women, aged 18-44. Participants were of normal body mass index (mean BMI 24.1), young (mean age 27.4), 60% were white, 20% non-Hispanic black, 15% Asian, and 6% other race group, and were from the Buffalo, New York region. The median (interquartile range) level of cadmium was 0.30 {mu}g/l (0.19-0.43), of lead was 0.86 {mu}g/dl (0.68-1.20), and of mercury was 1.10 {mu}g/l (0.58-2.00). BMD was treated both as a continuous variable in linear regression and dichotomized at the 10th percentile for logistic regression analyses. Mercury was associated with reduced odds of decreased lumbar spine BMD (0.66, 95% confidence interval: 0.44, 0.99), but overall, metals at environmentally relevant levels of exposure were not associated with reduced BMD in this population of healthy, reproductive-aged women. Further research is needed to determine if the blood levels of cadmium, lead, and mercury in this population are sufficiently low that there is no substantive impact on bone, or if effects on bone can be expected only at older ages.

  1. Hydroxyapatite-binding peptides for bone growth and inhibition

    DOE Patents [OSTI]

    Bertozzi, Carolyn R. (Berkeley, CA); Song, Jie (Shrewsbury, MA); Lee, Seung-Wuk (Walnut Creek, CA)

    2011-09-20T23:59:59.000Z

    Hydroxyapatite (HA)-binding peptides are selected using combinatorial phage library display. Pseudo-repetitive consensus amino acid sequences possessing periodic hydroxyl side chains in every two or three amino acid sequences are obtained. These sequences resemble the (Gly-Pro-Hyp).sub.x repeat of human type I collagen, a major component of extracellular matrices of natural bone. A consistent presence of basic amino acid residues is also observed. The peptides are synthesized by the solid-phase synthetic method and then used for template-driven HA-mineralization. Microscopy reveal that the peptides template the growth of polycrystalline HA crystals .about.40 nm in size.

  2. Zhejiang Bone New Material Technology Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit withTianlinPapers HomeXuanenYongzhouYunnanZhangye LonghuiZhejiang Bone New

  3. Bone status in high levels cyclists J Clin Densitom. 2012 Jan-Mar;15(1):103-7. Evaluation of the Bone Status in High-Level Cyclists

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    health Organization has defined osteoporosis in post-menopausal women as a T-score value less than -2) defines a "low bone density". In post-menopausal women as well as in elderly in general, results are more

  4. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    Alcohol consumption is occurring in the younger generation. It has been found that the sooner people started drinking the shorter they are. Alcohol has also been shown to reduce peak bone mass. Alcohol inhibits osteoblastic proliferation which...

  5. The bending and dynamic mechanical properties of cortical bone: the effects of sodium fluoride and the relationship to physical properties 

    E-Print Network [OSTI]

    McCurdy-Rahn, Megan Calista

    1998-01-01T23:59:59.000Z

    Bone is a complex organic composite material. The graphics. interface between the mineral and organic phases of bone is significant both to medicine and to the biokinetics, a field which seeks to create advanced synthetic materials by copying...

  6. The effect of alcohol on the bone growth spurt of rats at a time equivalent to adolescent females

    E-Print Network [OSTI]

    Chaffin, Catherine Lee

    1997-01-01T23:59:59.000Z

    . The trabecular bone that remained was widely separated and reduced in thickness. These changes are similar to those observed in osteoporosis. The cause and mechanism of the reduced bone volume after alcohol abuse remains unclear. Alcohol consumption at an early...

  7. High-speed photography of compressed human trabecular bone correlates whitening to microscopic damage

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of trabecular bone is mainly motivated by the huge impact of osteoporosis in post-menopausal women and the aged is mainly motivated by the reduction of bone strength due to osteoporosis, a systemic skeletal disease [10.elsevier.com/locate/engfracmech #12;comes with a concomitant increase of fracture risk. Post-menopausal women and the elderly

  8. High-Speed Photography of Human Trabecular Bone during Compression Philipp J. Thurner1

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of this research is motivated by the immense costs of health care and social impacts due to osteoporosis in post-menopausal women and the aged. Osteoporosis results in bone loss and change of trabecular architecture, causing of osteoporosis, a systemic, skeletal disease2 , which comes with a reduction of bone strength and a concomitant

  9. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival

    E-Print Network [OSTI]

    Brown, Myles

    for post-menopausal osteoporosis (Sambrook and Cooper, 2006). Estrogen and ERs are important for bone and Musculoskeletal Biology, Wyeth Research, Collegeville, PA, USA Estrogen deficiency in menopause is a major cause of osteoporosis in women. Estrogen acts to maintain the appropriate ratio between bone-forming osteoblasts

  10. Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum But Not Cells

    E-Print Network [OSTI]

    Price, Paul A.

    Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum mineralization in the absence of cells. For this model, we utilized EDTA- decalcified new-born rat tibias with the cartilaginous ends intact, allowing us to visually determine the spec- ificity of mineralization within the bone

  11. Calcium balance and bone density in immature horses fed a high protein diet

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    . Blood samples, feces, and urine were collected during the 116-day study to determine any diet effect on pH and mineral balance. Radiographs were made of the left third metacarpal (MCIII) to determine bone density via radiographic bone aluminum...

  12. Targeting bone-microenvironment-tumour cell interactions : IGF-1 receptor kinase inhibitors. 

    E-Print Network [OSTI]

    Logan, John Gordon

    2012-11-30T23:59:59.000Z

    Bone metastases are a frequent clinical complication associated with cancer. The aim of this PhD thesis was to set up a model system for the study of tumour cell – bone cell interactions in vitro, ex vivo and in vivo and ...

  13. Bone Motion Analysis From Dynamic MRI: Ac-quisition and Tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    of mechanical overload, impingement or femoral head instability. For both diagnosis and surgical planning, an acBone Motion Analysis From Dynamic MRI: Ac- quisition and Tracking INTRODUCTION Periacetabular- curate estimate of hip joint bone motion is required. Orthopedists can use animated 3D models, prior

  14. Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1)

    E-Print Network [OSTI]

    Chetverikov, Dmitry

    Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1) Istv surfaces reconstructed from MR volumes are shown. 1 Outline of the project One of our current projects steps of bone surface reconstruction from CT/MR slice images. 2 Main steps of reconstruction 2.1

  15. Research Paper A method for calibration of bone driver transducers to measure the mastoid

    E-Print Network [OSTI]

    Allen, Jont

    vibrator transducers for clinical measurements, the transfer of energy from the bone driver depends. This absolute calibration is based upon a circuit model of the driver, describing it with three frequency in the clinic, and a refined bone driver circuit model is proposed to better capture the observed behaviors. Ã?

  16. Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent

    E-Print Network [OSTI]

    Butler, Samantha

    Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent Regulates, Toronto, Ontario, Canada M5G 1X8 Commissural spinal axons extend away from the roof plate (RP) in response to the dorsal midline and are generated by the bone morphogenetic proteins (BMPs) in the roof plate (RP) (Liem

  17. Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis

    E-Print Network [OSTI]

    Toledo, University of

    Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis Beata secondary osteoporosis. Risk factors for development of TZD-induced secondary osteoporosis are gender (women healing in T2DM patients on TZD therapy. Keywords Diabetes . Thiazolidinediones . Bone . Osteoporosis

  18. A multi-scale bone study to estimate the risk of fracture related to osteoporosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A multi-scale bone study to estimate the risk of fracture related to osteoporosis Abdelwahed' Orléans, 8, Rue Léonard de Vinci 45072 Orléans, France Objective: Osteoporosis is a disease marked. Bone fractures caused by the osteoporosis become increasingly important goal for both clinicians

  19. Classification and volumetric analysis of temporal bone pneumatization using cone beam computed tomography

    E-Print Network [OSTI]

    Terasaki, Mark

    bone pneumatization in adults using cone beam computed tomography (CBCT) scans. Study Design. A total Oral Pathol Oral Radiol 2014;117:376-384) The advances in cone beam computed tomography (CBCT) overClassification and volumetric analysis of temporal bone pneumatization using cone beam computed

  20. Finite-Element Analysis of Biting Behavior and Bone Stress in the

    E-Print Network [OSTI]

    Dumont, Elizabeth R.

    Finite-Element Analysis of Biting Behavior and Bone Stress in the Facial Skeletons of Bats biting behavior and bite force data gathered in the field with finite-element (FE) analysis. Our FE words: biting behavior; bone stress; adaptation; finite-ele- ment analysis; Chiroptera Mammal evolution

  1. Bone marrow transplantation after the Chernobyl nuclear accident

    SciTech Connect (OSTI)

    Baranov, A.; Gale, R.P.; Guskova, A.; Piatkin, E.; Selidovkin, G.; Muravyova, L.; Champlin, R.E.; Danilova, N.; Yevseeva, L.; Petrosyan, L. (Institute of Biophysics of the Ministry of Health and Clinical Hospital, Moscow (USSR))

    1989-07-27T23:59:59.000Z

    On April 26, 1986, an accident at the Chernobyl nuclear power station in the Soviet Union exposed about 200 people to large doses of total-body radiation. Thirteen persons exposed to estimated total-body doses of 5.6 to 13.4 Gy received bone marrow transplants. Two transplant recipients, who received estimated doses of radiation of 5.6 and 8.7 Gy, are alive more than three years after the accident. The others died of various causes, including burns (the cause of death in five), interstitial pneumonitis (three), graft-versus-host disease (two), and acute renal failure and adult respiratory distress syndrome (one). There was hematopoietic (granulocytic) recovery in nine transplant recipients who could be evaluated, six of whom had transient partial engraftment before the recovery of their own marrow. Graft-versus-host disease was diagnosed clinically in four persons and suspected in two others. Although the recovery of endogenous hematopoiesis may occur after exposure to radiation doses of 5.6 to 13.4 Gy, we do not know whether it is more likely after the transient engraftment of transplanted stem cells. Because large doses of radiation affect multiple systems, bone marrow recovery does not necessarily ensure survival. Furthermore, the risk of graft-versus-host disease must be considered when the benefits of this treatment are being weighed.

  2. Past Test One

    E-Print Network [OSTI]

    MA 366: Introduction to Di?'erential Equations. Fall 2001, Test One. Instructor: Yip o This test booklet has FIVE QUESTIONS, totaling 50 points for the whole test.

  3. Advanced Vehicle Testing & Evaluation

    Broader source: Energy.gov (indexed) [DOE]

    Vehicle Accelerated Reliability Test Battery Electric Vehicle Fast Charge Test Battery Energy Storage Performance Test For DC Fast Charge Demand Reduction...

  4. Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a

    E-Print Network [OSTI]

    Ariza Moreno, Pilar

    Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a , H descubrimientos s/n 41092 Seville (Spain) a jsanz@us.es, b helgaem@gmail.com, c mpariza@us.es Keywords: Bone-cement of the last XX century. Normally, implant is fixed to bone by means of a polymer material known as bone cement

  5. Estimation of the 3D self-similarity parameter of trabecular bone from its 2D projection

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of osteoporosis is mainly based on dual energy X-ray absorptiometry which amounts to measuring bone mass

  6. TEST STATION SALE OF PERFORMANCE TESTED BULLS

    E-Print Network [OSTI]

    Tennessee, University of

    in the test had to meet minimum performance requirements. Those were: CREEP NON-CREEP Adj 205 day wt. 560 520AS-B428 U T BULL TEST STATION SALE OF PERFORMANCE TESTED BULLS THURSDAY, MARCH 8, 2012 12:00 NOON IN GREENEVILLE AND KNOXVILLE LIVESTOCK CENTER http://animalscience.ag.utk.edu/ (For video) #12;UT BULL TEST

  7. Advanced Vehicle Testing - Beginning-of-Test Battery Testing...

    Broader source: Energy.gov (indexed) [DOE]

    2.5 V Thermal Mgmt.: Passive, Vacuum-Sealed Unit Pack Weight: 294 kg BATTERY LABORATORY TEST RESULTS SUMMARY Vehicle Mileage and Testing Date Vehicle Odometer: 6,696 mi Date of...

  8. EARLY PREVENTIVE EFFECTS OF RISEDRONATE IN A RAT MODEL WITH MASSIVE BONE LOSS DUE TO ORCHIDECTOMY AND

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and disuse induced osteoporosis. ORX and BTX models were combined to see if their effects were cumulative on trabecular bone mass and bone architecture. KEY WORDS: Osteoporosis Orchidectomy Disuse Risedronate Bone-remodeling rate is observed in women after menopause or surgica

  9. Computational analysis of whole body CT documents a bone structure alteration in adult advanced chronic lymphocytic leukemia

    E-Print Network [OSTI]

    Piana, Michele

    progression. PET/CT images were analyzed using dedicated software, able to recognize an external 2-pixel bone ring whose Hounsfield coefficient served as cut off to recognize trabecular and compact bone. PET/CT of the disease. Keywords: Image Analysis, Bone Marrow, Skeletal Structure, ACLL, PET/CT #12;3 Introduction

  10. Bull Test ID 1118 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1118 2013 Florida Bull Test #12;Bull Test ID 1119 2013 Florida Bull Test #12;Bull Test ID 1120 2013 Florida Bull Test #12;Bull Test ID 1121 2013 Florida Bull Test #12;Bull Test ID 1122 2013 Florida Bull Test #12;Bull Test ID 1123 2013 Florida Bull Test #12;Bull Test ID 1124 2013 Florida

  11. Bull Test ID 1181 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1181 2013 Florida Bull Test #12;Bull Test ID 1182 2013 Florida Bull Test #12;Bull Test ID 1183 2013 Florida Bull Test #12;Bull Test ID 1184 2013 Florida Bull Test #12;Bull Test ID 1185 2013 Florida Bull Test #12;Bull Test ID 1186 2013 Florida Bull Test #12;Bull Test ID 1187 2013 Florida

  12. Bull Test ID 1098 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1098 2013 Florida Bull Test #12;Bull Test ID 1099 2013 Florida Bull Test #12;Bull Test ID 1100 2013 Florida Bull Test #12;Bull Test ID 1101 2013 Florida Bull Test #12;Bull Test ID 1102 2013 Florida Bull Test #12;Bull Test ID 1103 2013 Florida Bull Test #12;Bull Test ID 1104 2013 Florida

  13. Bull Test ID 1160 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1160 2013 Florida Bull Test #12;Bull Test ID 1161 2013 Florida Bull Test #12;Bull Test ID 1162 2013 Florida Bull Test #12;Bull Test ID 1163 2013 Florida Bull Test #12;Bull Test ID 1164 2013 Florida Bull Test #12;Bull Test ID 1165 2013 Florida Bull Test #12;Bull Test ID 1166 2013 Florida

  14. Bull Test ID 1077 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    14th Annual Florida Bull Test #12;Bull Test ID 1077 2013 Florida Bull Test #12;Bull Test ID 1078 2013 Florida Bull Test #12;Bull Test ID 1079 2013 Florida Bull Test #12;Bull Test ID 1080 2013 Florida Bull Test #12;Bull Test ID 1081 2013 Florida Bull Test #12;Bull Test ID 1082 2013 Florida Bull Test #12

  15. Bull Test ID 1140 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1140 2013 Florida Bull Test #12;Bull Test ID 1141 2013 Florida Bull Test #12;Bull Test ID 1142 2013 Florida Bull Test #12;Bull Test ID 1143 2013 Florida Bull Test #12;Bull Test ID 1144 2013 Florida Bull Test #12;Bull Test ID 1145 2013 Florida Bull Test #12;Bull Test ID 1146 2013 Florida

  16. Peri-prosthetic fracture vibration testing

    SciTech Connect (OSTI)

    Cruce, Jesse R [Los Alamos National Laboratory; Erwin, Jenny R [Los Alamos National Laboratory; Remick, Kevin R [Los Alamos National Laboratory; Cornwell, Phillip J [Los Alamos National Laboratory; Menegini, R. Michael [INDIANA UNIV.; Racanelli, Joe [STRYKER ORTHOPARDICS

    2010-11-08T23:59:59.000Z

    The purpose of this study was to establish a test setup and vibration analysis method to predict femoral stem seating and prevent bone fracture using accelerometer and force response data from an instrumented stem and impactor. This study builds upon earlier studies to identify a means to supplement a surgeon's tactile and auditory senses by using damage identification techniques normally used for civil and mechanical structures. Testing was conducted using foam cortical shell sawbones prepared for stems of different geometries. Each stem was instrumented with an accelerometer. Two impactor designs were compared: a monolithic impactor and a two-piece impactor, each with an integrated load cell and accelerometer. Acceleration and force measurements were taken in the direction of impaction. Comparisons between different methods of applying an impacting force were made, including a drop tower and a surgical hammer. The effect of varying compliance on the data was also investigated. The ultimate goal of this study was to assist in the design of an integrated portable data acquisition system capable of being used in future cadaveric testing. This paper will discuss the experimental setup and the subsequent results of the comparisons made between impactors, prosthetic geometries, compliances, and impact methods. The results of this study can be used for both future replicate testing as well as in a cadaveric environment.

  17. Innovative Composites Through Reinforcement Morphology Design - a Bone-Shaped-Short-Fiber Composite

    SciTech Connect (OSTI)

    Zhu, Y.T.; Valdez, J.A.; Beyerlain, I.J.; Stout, M.G.; Zhou, S.; Shi, N.; Lowe, T.C.

    1999-06-29T23:59:59.000Z

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at Los Alamos National Laboratory (LANL). The objective of this project is to improve the strength and toughness of conventional short-fiber composites by using innovative bone-shaped-short (BSS) fibers as reinforcement. We fabricated a model polyethylene BSS fiber-reinforced polyester-matrix composite to prove that fiber morphology, instead of interfacial strength, solves the problem. Experimental tensile and fracture toughness test results show that BSS fibers can bridge matrix cracks more effectively, and consume many times more energy when pulled out, than conventional-straight-short (CSS) fibers. This leads to both higher strength and fracture toughness for the BSS-fiber composites. A computational model was developed to simulate crack propagation in both BSS- and CSS-fiber composites, accounting for stress concentrations, interface debonding, and fiber pullout. Model predictions were validated by experimental results and will be useful in optimizing BSS-fiber morphology and other material system parameters.

  18. Concolic Testing Koushik Sen

    E-Print Network [OSTI]

    Sen, Koushik

    Concolic testing automates test input generation by com­ bining the concrete and symbolic (concolic) execution of the code under test. Traditional test input generation tech­ niques use either (1) concrete test inputs from these constraints. In contrast, concolic testing tightly couples both concrete

  19. Concolic Testing Koushik Sen

    E-Print Network [OSTI]

    Sen, Koushik

    Concolic testing automates test input generation by com- bining the concrete and symbolic (concolic) execution of the code under test. Traditional test input generation tech- niques use either (1) concrete test inputs from these constraints. In contrast, concolic testing tightly couples both concrete

  20. Effect of cryo-induced microcracks on microindentation of hydrated cortical bone tissue

    SciTech Connect (OSTI)

    Yin Ling, E-mail: ling.yin@jcu.edu.au [School of Engineering, James Cook University, Townsville, QLD 4811 (Australia); Venkatesan, Sudharshan [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia); Webb, Daryl [Electron Microscopy Unit, Australian National University, Canberra, ACT 0200 (Australia); Kalyanasundaram, Shankar; Qin Qinghua [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia)

    2009-08-15T23:59:59.000Z

    Microcracks accumulate in cortical bone tissue as a consequence of everyday cyclic loading. However, it remains unclear to what extent microdamage accumulation contributes to an increase in fracture risk. A cryo-preparation technique was applied to induce microcracks in cortical bone tissue. Microcracks with lengths up to approximately 20 {mu}m, which were initiated mainly on the boundaries of haversian canals, were observed with cryo-scanning electron microscopy. A microindentation technique was applied to study the mechanical loading effect on the microcracked hydrated bone tissue. The microindentation patterns were section-scanned using confocal laser scanning microscopy to understand the deformation and bone damage mechanisms made by mechanical loading. The results show that there was no significant difference with respect to microhardness between the original and microcracked hydrated cortical bone tissues (ANOVA, p > 0.05). The cryo-induced microcracks in the bone tissue were not propagated further under the mechanical loads applied. The deformation mechanism of the microcracked cortical bone tissue was plastic deformation, not brittle fracture.

  1. Test Series 2. 3 detailed test plan

    SciTech Connect (OSTI)

    Not Available

    1983-12-01T23:59:59.000Z

    Test Series 2.3 is chronologically the second of the five sub-series of tests which comprise Test Series 2, the second major Test Series as part of the combustion research phase to be carried out at the Grimethorpe Experimental Pressurised Fluidised Bed Combustion Facility. Test Series 2.3 will consist of 700 data gathering hours which is expected to require some 1035 coal burning hours. The tests will be performed using US supplied coal and dolomite. This will be the first major series of tests on the Facility with other than the UK datum coal and dolomite. The document summarises the background to the facility and the experimental program. Described are modifications which have been made to the facility following Test Series 2.1 and a series of Screening Tests. Detailed test objectives are specified as are the test conditions for the experiments which comprise the test series. The test results will provide information on the effects of the bed temperature, excess air level, Ca/S ratio, number of coal feed lines, and combustion efficiency and sulphur retention. A significant aspect of the test series will be part load tests which will investigate the performance of the facility under conditions of turn down which simulate load following concepts specified for two combined cycle concepts, i.e., their CFCC combined cycle and a turbo charged combined cycle. The material test plan is also presented. The principal feature of the materials programme is the planned exposure of a set of static turbine blade specimens in a cascade test loop to the high temperature, high pressure flue gas. A schedule for the programme is presented as are contingency plans.

  2. Accelerated Stress Testing, Qualification Testing, HAST, Field...

    Office of Environmental Management (EM)

    stress tests beyond the qualification test levels, which are necessary to predict PV module wear-out. The commercial success of PVs is ultimately based on the long-term...

  3. Jefferson Lab Man Donates Bone Marrow to Save 12-Year-Old Boy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to MCV where he was admitted for the overnight procedure. He received a general anesthesia; then the doctors extracted two liters of bone marrow from his body. The life-saving...

  4. Discovery of novel anti-inflammatory proteins inspired by bone marrow mesenchymal stem cell secretions

    E-Print Network [OSTI]

    Milwid, Jack Miles

    2011-01-01T23:59:59.000Z

    Bone marrow mesenchymal stem cells (MSCs) may soon become the first FDA-approved stem cell therapy for autoimmune and inflammatory disease. Our lab originally hypothesized that much of the therapeutic activity of MSCs may ...

  5. Investigation of bone response to implant materials by electron microscopy and computer simulation

    E-Print Network [OSTI]

    Wang, Hao, 1974-

    2004-01-01T23:59:59.000Z

    (cont.) implementation of this scintigraphic method for quantitative studies of osteoblast-mediated mineralization in vitro. A 2-D truss finite element model is used to study the remodeling of trabecular bone. Using strain ...

  6. Immobilized sonic hedgehog N-terminal signaling domain enhances differentiation of bone marrow-derived

    E-Print Network [OSTI]

    Schaffer, David V.

    , and immobilized onto interpenetrating polymer network (IPN) surfaces also grafted with a bone sialoprotein presented to cells using an intrinsically nonfouling interpenetrating polymer network (IPN).12,13 In spite

  7. The effects of alcohol consumption after menopause on bone regulating hormones

    E-Print Network [OSTI]

    Blaschke, Dawn Lewis

    1999-01-01T23:59:59.000Z

    The goal of this project was to determine if the alcohol-associated increase in osteopenia as observed in ovariectomized rats, which simulated human females after menopause, was due to the elect of alcohol on hormones that regulate bone metabolism...

  8. attenuates bone cancer-induced: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2007-01-01 300 MR imaging of therapy-induced changes of bone marrow University of California eScholarship Repository Summary: Treatment effects due to irradiation, chemotherapy...

  9. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, S.C.; Meinken, G.E.; Mausner, L.F.; Atkins, H.L.

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients. 5 figs.

  10. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, Suresh C. (Setauket, NY); Meinken, George E. (Middle Island, NY); Mausner, Leonard F. (Stony Brook, NY); Atkins, Harold L. (Setauket, NY)

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients.

  11. Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone

    E-Print Network [OSTI]

    Yuen, Evelyn P

    2013-04-19T23:59:59.000Z

    (induced by feeding a high iron diet) and gamma radiation exposure would independently increase markers of oxidative stress and markers of oxidative damage and result in loss of bone mass, with the combined treatment having additive or synergistic effects...

  12. Pretreatment levels of bone turnover and the antifracture efficacy of alendronate: The fracture intervention trial

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in postmenopausal osteoporosis. Cal- cif Tissue Int 65:359–in postmeno- pausal osteoporosis. J Bone Miner Res 12:624–among women without osteoporosis at baseline. Although they

  13. Race/ethnic differences in bone mineral densities in older men

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    the Baltimore men’s osteoporosis study. J Bone Miner Res 13.center genetic study of osteoporosis. Osteoporos Int 17:125–Leung Jockey Club Centre for Osteoporosis Care and Control,

  14. The harmful effects of late-onset alcohol consumption on cortical bone in aged rats 

    E-Print Network [OSTI]

    Bowlin, Julie Lee

    2001-01-01T23:59:59.000Z

    to determine bone chemistry and morphological parameters. The effects of alcohol consumption, the aging process and caloric restriction were examined after obtaining results from this experiment. From the results found, it is evident that alcohol does have a...

  15. Factors Affecting the Mechanical Behavior of Bone Subrata Saha, Ph.D.

    E-Print Network [OSTI]

    Gilbert, Robert P.

    Factors Affecting the Mechanical Behavior of Bone by Subrata Saha, Ph.D. Research Professor-mail: subrata.saha@downstate.edu ABSTRACT The load carrying capacity of our skeletal system depends

  16. Non-invasive shock wave stimulated periosteum for bone tissue engineering

    E-Print Network [OSTI]

    Kearney, Cathal (Cathal John)

    2011-01-01T23:59:59.000Z

    The cambium cells of the periosteum, which are known osteoprogenitor cells, have limited suitability for clinical applications of bone tissue engineering due to their low cell number (2-5 cells thick). Extracorporeal shock ...

  17. RMOTC - Testing - Geothermal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Geothermal Testing Notice: As of July 1st, 2014, Testing at RMOTC has officially completed. We would like to thank all of our testing partners and everyone who helped make the...

  18. Test Herrera Report Template

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    development are described in detail in the following section. The model was run in six test sites: Test Site 1 is along the Cowlitz River (Segment 3); Test Site 2 includes the...

  19. ZiaTest

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ZiaTest ZiaTest Description This test executes a new proposed standard benchmark method for MPI startup that is intended to provide a realistic assessment of both launch and wireup...

  20. Directed random testing

    E-Print Network [OSTI]

    Pacheco, Carlos, Ph.D. Massachusetts Institute of Technology

    2009-01-01T23:59:59.000Z

    Random testing can quickly generate many tests, is easy to implement, scales to large software applications, and reveals software errors. But it tends to generate many tests that are illegal or that exercise the same parts ...

  1. Analysis of a Fossil Bone from the Archaeological Settlement Malu Rosu, Romania by Accelerator Mass Spectrometry

    E-Print Network [OSTI]

    Agata Olariu; Ion V. Popescu; Ragnar Hellborg; Kristina Stenström; Mikko Faarinen; Per Persson; Bengt Erlandsson; Göran Skog; Emilian Alexandrescu

    2001-03-13T23:59:59.000Z

    A fossil bone from the archaeological site Malu Rosu Giurgiu, in Romania has been analyzed by accelerator mass spectrometry to estimate its age by determining its $^{14}$C content. The radiocarbon age of the bone is in agreement with the date obtained by the method for age determination, based on fluorine content. This is the first radiocarbon dating for the final Neolithic period, for this archaeological settlement in the Romanian region.

  2. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone 

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    (Member) John E. Bauer (Chair of Nutrition) Bryan H. Johnson (Department Head) August 2001 Major: Nutrition ABSTRACT Analyzing the Effects of Alcohol on IGF-I in Bone and Plasma and on IGF-I mRNA in the Liver and Bone. (August 2001) Christina... different effector pathways to increase proliferation at the growth plate (Klaus et al. , 1998). Therefore Vitamin D may not have an effect on IGF-I. Alcoholics have decreased plasma 25-hydroxyvitamin D which is an indicator of Vitamin D status (Peris et...

  3. LANSCE | Materials Test Station

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research Facility Training Office Contact Administrative nav background Materials Test Station dotline Testing New Reactor Fuels that Reduce Radioactive Waste Mission Used...

  4. Vendor System Vulnerability Testing Test Plan

    SciTech Connect (OSTI)

    James R. Davidson

    2005-01-01T23:59:59.000Z

    The Idaho National Laboratory (INL) prepared this generic test plan to provide clients (vendors, end users, program sponsors, etc.) with a sense of the scope and depth of vulnerability testing performed at the INL’s Supervisory Control and Data Acquisition (SCADA) Test Bed and to serve as an example of such a plan. Although this test plan specifically addresses vulnerability testing of systems applied to the energy sector (electric/power transmission and distribution and oil and gas systems), it is generic enough to be applied to control systems used in other critical infrastructures such as the transportation sector, water/waste water sector, or hazardous chemical production facilities. The SCADA Test Bed is established at the INL as a testing environment to evaluate the security vulnerabilities of SCADA systems, energy management systems (EMS), and distributed control systems. It now supports multiple programs sponsored by the U.S. Department of Energy, the U.S. Department of Homeland Security, other government agencies, and private sector clients. This particular test plan applies to testing conducted on a SCADA/EMS provided by a vendor. Before performing detailed vulnerability testing of a SCADA/EMS, an as delivered baseline examination of the system is conducted, to establish a starting point for all-subsequent testing. The series of baseline tests document factory delivered defaults, system configuration, and potential configuration changes to aid in the development of a security plan for in depth vulnerability testing. The baseline test document is provided to the System Provider,a who evaluates the baseline report and provides recommendations to the system configuration to enhance the security profile of the baseline system. Vulnerability testing is then conducted at the SCADA Test Bed, which provides an in-depth security analysis of the Vendor’s system.b a. The term System Provider replaces the name of the company/organization providing the system being evaluated. This can be the system manufacturer, a system user, or a third party organization such as a government agency. b. The term Vendor (or Vendor’s) System replaces the name of the specific SCADA/EMS being tested.

  5. Dynamometer Testing (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2010-11-01T23:59:59.000Z

    This fact sheet describes the dynamometer and its testing capabilities at the National Wind Technology Center.

  6. Solderability test system

    DOE Patents [OSTI]

    Yost, F.; Hosking, F.M.; Jellison, J.L.; Short, B.; Giversen, T.; Reed, J.R.

    1998-10-27T23:59:59.000Z

    A new test method to quantify capillary flow solderability on a printed wiring board surface finish. The test is based on solder flow from a pad onto narrow strips or lines. A test procedure and video image analysis technique were developed for conducting the test and evaluating the data. Feasibility tests revealed that the wetted distance was sensitive to the ratio of pad radius to line width (l/r), solder volume, and flux predry time. 11 figs.

  7. Solderability test system

    DOE Patents [OSTI]

    Yost, Fred (Cedar Crest, NM); Hosking, Floyd M. (Albuquerque, NM); Jellison, James L. (Albuquerque, NM); Short, Bruce (Beverly, MA); Giversen, Terri (Beverly, MA); Reed, Jimmy R. (Austin, TX)

    1998-01-01T23:59:59.000Z

    A new test method to quantify capillary flow solderability on a printed wiring board surface finish. The test is based on solder flow from a pad onto narrow strips or lines. A test procedure and video image analysis technique were developed for conducting the test and evaluating the data. Feasibility tests revealed that the wetted distance was sensitive to the ratio of pad radius to line width (l/r), solder volume, and flux predry time.

  8. Check for peroxides every 6 months. opened test 1 test 2 test 3

    E-Print Network [OSTI]

    Pawlowski, Wojtek

    Check for peroxides every 6 months. opened test 1 test 2 test 3 date initials Check for peroxides every 6 months. opened test 1 test 2 test 3 date initials Check for peroxides every 6 months. Test strips can be obtained from EH&S, 5-8200 opened test 1 test 2 test 3 date initials Check for peroxides

  9. Automatic Test Factoring for Java

    E-Print Network [OSTI]

    Saff, David

    2005-06-08T23:59:59.000Z

    Test factoring creates fast, focused unit tests from slow system-widetests; each new unit test exercises only a subset of the functionalityexercised by the system test. Augmenting a test suite with factoredunit tests ...

  10. Entry/Exit Port testing, test report

    SciTech Connect (OSTI)

    Winkelman, R.H.

    1993-05-01T23:59:59.000Z

    The Waste Receiving and Processing Module I (WRAP-1) facility must have the ability to allow 55-gallon drums to enter and exit glovebox enclosures. An Entry/Exit Port (Appendix 1, Figure 1), designed by United Engineers and Constructors (UE&C), is one method chosen for drum transfer. The Entry/Exit Port is to be used for entry of 55-gallon drums into both process entry gloveboxes, exit of 55-gallon drum waste pucks from the low-level waste (LLW) glovebox, and loadout of waste from the restricted waste management glovebox. The Entry/Exit Port relies on capture velocity air flow and a neoprene seal to provide alpha confinement when the Port is in the open and closed positions, respectively. Since the glovebox is in a slight vacuum, air flow is directed into the glovebox through the space between the overpack drum and glovebox floor. The air flow is to direct any airborne contamination into the glovebox. A neoprene seal is used to seal the Port door to the glovebox floor, thus maintaining confinement in the closed position. Entry/Exit Port testing took place February 17, 1993, through April 14, 1993, in the 305 building of Westinghouse Hanford Company. Testing was performed in accordance with the Entry/Exit Port Testing Test Plan, document number WHC-SD-WO26-TP-005. A prototype Entry/Exit Port built at the Hanford Site was tested using fluorescent paint pigment and smoke candles as simulant contaminants. This test report is an interim test report. Further developmental testing is required to test modifications made to the Port as the original design of the Port did not provide complete confinement during all stages of operation.

  11. Automated simulation of areal bone mineral density assessment in the distal radius from high-resolution peripheral quantitative computed tomography

    E-Print Network [OSTI]

    Burghardt, A. J.; Kazakia, G. J.; Link, T. M.; Majumdar, S.

    2009-01-01T23:59:59.000Z

    Bone mineral density . DXA . HR-pQCT . Osteoporosis .Simulation Introduction Osteoporosis is a conditionclinical assessment of osteoporosis status were identified

  12. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    E-Print Network [OSTI]

    Barth, Holly

    2012-01-01T23:59:59.000Z

    in   bone   strength.   Osteoporosis  Int    2006;17:319-­??fragility   in   aging,   osteoporosis,   and   diabetes  mellitus.  Osteoporosis  Int    2010;21:195-­??214.  

  13. Electron Microscopy and Analytical X-ray Characterization of Compositional and Nanoscale Structural Changes in Fossil Bone

    E-Print Network [OSTI]

    Boatman, Elizabeth

    2012-01-01T23:59:59.000Z

    of questions surrounding the diagenesis and fossilization ofthe consequences of diagenesis for that particular feature (on the concept of bone diagenesis and how it relates to

  14. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    SciTech Connect (OSTI)

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States)] [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)] [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15T23:59:59.000Z

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (?17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results for external calibrations exhibited much larger RMS errors than size matched internal calibration. Use of an average body size external-to-internal calibration correction factor reduced the errors to closer to those for internal calibration. RMS errors of less than 30% or about 0.01 for the bone and 0.1 for the red marrow volume fractions would likely be satisfactory for human studies. Such accuracies were achieved for 3 × 3 segmentation of 5 mm slice images for: (a) internal calibration with 4 times dose for all size body phantoms, (b) internal calibration with 2 times dose for the small and medium size body phantoms, and (c) corrected external calibration with 4 times dose and all size body phantoms. Conclusions: Phantom studies are promising and demonstrate the potential to use dual energy quantitative CT to estimate the spatial distributions of red marrow and bone within the vertebral spongiosa.

  15. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecânica e Gestão Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  16. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    SciTech Connect (OSTI)

    Anne, Jennifer [Univ. of Manchester (United Kingdom); Edwards, Nicholas P. [Univ. of Manchester (United Kingdom); Wogelius, Roy A. [Univ. of Manchester (United Kingdom); Tumarkin-Deratzian, Allison R. [Temple Univ., Philadelphia, PA (United States); Sellers, William I. [Univ. of Manchester (United Kingdom); van Veelen, Arjen [Univ. of Manchester (United Kingdom); Bergmann, Uwe [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Sokaras, Dimosthenis [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Alonso-Mori, Roberto [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Ignatyev, Konstantin [Diamond Light Source (United Kingdom); Egerton, Victoria M. [Univ. of Manchester (United Kingdom); Manning, Phillip L. [Univ. of Manchester (United Kingdom)

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimens (decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.

  17. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Anne, Jennifer; Edwards, Nicholas P.; Wogelius, Roy A.; Tumarkin-Deratzian, Allison R.; Sellers, William I.; van Veelen, Arjen; Bergmann, Uwe; Sokaras, Dimosthenis; Alonso-Mori, Roberto; Ignatyev, Konstantin; et al

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimensmore »(decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.« less

  18. I/O Test

    E-Print Network [OSTI]

    Beeler, Michael

    1967-10-01T23:59:59.000Z

    IO TEST is intended as a hardware testing and debugging aid for use with the PDP-6 and its associated input multiplexer (analog to digital converter) and output multiplexer (digital to analog converter). While all characters ...

  19. MA 266 Practice Test

    E-Print Network [OSTI]

    2015-02-26T23:59:59.000Z

    Test 1: March 4, 2015. INSTRUCTIONS in the Test. 1. Do not open this exam booklet until told to do so. 2. There are 6 or 7 problems - one per page. 3. Show all ...

  20. Practice test 2

    E-Print Network [OSTI]

    2015-04-12T23:59:59.000Z

    Spring 2015. Test 2: April 15, 2015. INSTRUCTIONS in the Test. 1. Do not open this exam booklet until told to do so. 2. There are 6 or 7 problems - one per page.

  1. Coaxial test fixture

    DOE Patents [OSTI]

    Praeg, W.F.

    1984-03-30T23:59:59.000Z

    This invention pertains to arrangements for performing electrical tests on contact material samples, and in particular for testing contact material test samples in an evacuated environment under high current loads. Frequently, it is desirable in developing high-current separable contact material, to have at least a preliminary analysis of selected candidate conductor materials. Testing of material samples will hopefully identify materials unsuitable for high current electrical contact without requiring incorporation of the materials into a completed and oftentimes complex structure.

  2. Blade Testing Trends (Presentation)

    SciTech Connect (OSTI)

    Desmond, M.

    2014-08-01T23:59:59.000Z

    As an invited guest speaker, Michael Desmond presented on NREL's NWTC structural testing methods and capabilities at the 2014 Sandia Blade Workshop held on August 26-28, 2014 in Albuquerque, NM. Although dynamometer and field testing capabilities were mentioned, the presentation focused primarily on wind turbine blade testing, including descriptions and capabilities for accredited certification testing, historical methodology and technology deployment, and current research and development activities.

  3. Articles about Testing

    Broader source: Energy.gov [DOE]

    Stories about testing facilities, capabilities, and certification featured by the U.S. Department of Energy (DOE) Wind Program.

  4. Soil Testing and Research

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Soil Testing and Research Analytical Laboratory Copyright © 2014 University of Minnesota Soil Testing and Research Analytical Laboratory Department of Soil, Water and Climate College of Food payable to the University of Minnesota We also accept the following credit cards: Soil Testing

  5. Gas Test Loop Booster Fuel Hydraulic Testing

    SciTech Connect (OSTI)

    Gas Test Loop Hydraulic Testing Staff

    2006-09-01T23:59:59.000Z

    The Gas Test Loop (GTL) project is for the design of an adaptation to the Advanced Test Reactor (ATR) to create a fast-flux test space where fuels and materials for advanced reactor concepts can undergo irradiation testing. Incident to that design, it was found necessary to make use of special booster fuel to enhance the neutron flux in the reactor lobe in which the Gas Test Loop will be installed. Because the booster fuel is of a different composition and configuration from standard ATR fuel, it is necessary to qualify the booster fuel for use in the ATR. Part of that qualification is the determination that required thermal hydraulic criteria will be met under routine operation and under selected accident scenarios. The Hydraulic Testing task in the GTL project facilitates that determination by measuring flow coefficients (pressure drops) over various regions of the booster fuel over a range of primary coolant flow rates. A high-fidelity model of the NW lobe of the ATR with associated flow baffle, in-pile-tube, and below-core flow channels was designed, constructed and located in the Idaho State University Thermal Fluids Laboratory. A circulation loop was designed and constructed by the university to provide reactor-relevant water flow rates to the test system. Models of the four booster fuel elements required for GTL operation were fabricated from aluminum (no uranium or means of heating) and placed in the flow channel. One of these was instrumented with Pitot tubes to measure flow velocities in the channels between the three booster fuel plates and between the innermost and outermost plates and the side walls of the flow annulus. Flow coefficients in the range of 4 to 6.5 were determined from the measurements made for the upper and middle parts of the booster fuel elements. The flow coefficient for the lower end of the booster fuel and the sub-core flow channel was lower at 2.3.

  6. Human Cementum Protein 1 induces expression of bone and cementum proteins by human gingival fibroblasts

    SciTech Connect (OSTI)

    Carmona-Rodriguez, Bruno [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Alvarez-Perez, Marco Antonio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Narayanan, A. Sampath [Department of Pathology, School of Medicine, UW, Seattle (United States); Zeichner-David, Margarita [Center for Craniofacial Molecular Biology, School of Dentistry, USC, Los Angeles (United States); Reyes-Gasga, Jose [Instituto de Fisica, UNAM (Mexico); Molina-Guarneros, Juan [Facultad de Medicina, UNAM (Mexico); Garcia-Hernandez, Ana Lilia [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Suarez-Franco, Jose Luis [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Chavarria, Ivet Gil [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Villarreal-Ramirez, Eduardo [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Arzate, Higinio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico)]. E-mail: harzate@servidor.unam.mx

    2007-07-06T23:59:59.000Z

    We recently presented evidence showing that a human cementoblastoma-derived protein, named Cementum Protein 1 (CEMP1) may play a role as a local regulator of cementoblast differentiation and cementum-matrix mineralization. This protein was shown to be expressed by cementoblasts and progenitor cells localized in the periodontal ligament. In this study we demonstrate that transfection of CEMP1 into human gingival fibroblasts (HGF) induces mineralization and expression of bone and cementum-matrix proteins. The transfected HGF cells had higher alkaline phosphatase activity and proliferation rate and they expressed genes for alkaline phosphatase, bone sialoprotein, osteocalcin, osteopontin, the transcription factor Runx2/Cbfa1, and cementum attachment protein (CAP). They also produced biological-type hydroxyapatite. These findings indicate that the CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and that it might have a potential function in cementum and bone formation.

  7. Clinical Assessment of Percutaneous Radiofrequency Ablation for Painful Metastatic Bone Tumors

    SciTech Connect (OSTI)

    Kojima, Hiroyuki, E-mail: kojimah@takii.kmu.ac.jp; Tanigawa, Noboru; Kariya, Shuji; Komemushi, Atsushi; Shomura, Yuzo; Sawada, Satoshi [Kansai Medical University Takii Hospital, Department of Radiology (Japan)

    2006-12-15T23:59:59.000Z

    Purpose. To investigate the pain-alleviating effects of radiofrequency ablation (RFA) on metastatic bone tumors in relation to tumor size, combined therapy, and percent tumor necrosis rate following RFA. Methods. Subjects comprised 24 patients with 28 painful metastatic bone tumors. A 17G internally cooled electrode was inserted into the tumor for CT guidance and ablation was performed. Bone cement was injected following RFA for 4 tumors involving a weight-bearing bone, while 5 tumors were treated using combined RFA and external irradiation. Percent necrosis rate of the tumor was measured using contrast-enhanced computed tomography 1 week after RFA. Results. Improvement in the visual analog scale (VAS) score was 4.6 {+-} 2.2 for large tumors (>5 cm, n = 12), 3.7 {+-} 1.8 for medium-sized tumors (3.1-5.0 cm, n = 11), and 3.5 {+-} 1.7 for small tumors ({<=}3 cm, n = 4), with no significant differences noted among tumor sizes. Improvement in the VAS score was 3.5 {+-} 1.3 for the 4 tumors in the RFA + bone cement group, 3.2 {+-} 1.9 for the 5 tumors in the RFA + radiation therapy group, and 4.8 {+-} 2.2 for the 18 tumors in the RFA group. No significant differences were identified between groups. The improvement in the VAS score was 3.8 {+-} 2.3, 4.0 {+-} 1.9, and 4.7 {+-} 2.6 in patients with tumor necrosis rates of 0-49%, 50-74%, and 75-100%, respectively. No significant association was observed among these three groups. Conclusion. Percutaneous RFA therapy was effective in relieving pain due to metastatic bone tumors. No relationships appear to exist between initial response and tumor size, combined therapy, and percent tumor necrosis.

  8. Pendulum detector testing device

    DOE Patents [OSTI]

    Gonsalves, John M. (Modesto, CA)

    1997-01-01T23:59:59.000Z

    A detector testing device which provides consistent, cost-effective, repeatable results. The testing device is primarily constructed of PVC plastic and other non-metallic materials. Sensitivity of a walk-through detector system can be checked by: 1) providing a standard test object simulating the mass, size and material content of a weapon or other contraband, 2) suspending the test object in successive positions, such as head, waist and ankle levels, simulating where the contraband might be concealed on a person walking through the detector system; and 3) swinging the suspended object through each of the positions, while operating the detector system and observing its response. The test object is retained in a holder in which the orientation of the test device or target can be readily changed, to properly complete the testing requirements.

  9. Pendulum detector testing device

    DOE Patents [OSTI]

    Gonsalves, J.M.

    1997-09-30T23:59:59.000Z

    A detector testing device is described which provides consistent, cost-effective, repeatable results. The testing device is primarily constructed of PVC plastic and other non-metallic materials. Sensitivity of a walk-through detector system can be checked by: (1) providing a standard test object simulating the mass, size and material content of a weapon or other contraband, (2) suspending the test object in successive positions, such as head, waist and ankle levels, simulating where the contraband might be concealed on a person walking through the detector system; and (3) swinging the suspended object through each of the positions, while operating the detector system and observing its response. The test object is retained in a holder in which the orientation of the test device or target can be readily changed, to properly complete the testing requirements. 5 figs.

  10. Development of a three-dimensional in vitro model to study the effect of vitamin D on bone metastatic breast cancer

    E-Print Network [OSTI]

    Li, Danda

    2011-08-31T23:59:59.000Z

    Breast cancer has a high prevalence among women and most patients suffer from metastasis to bone. The mechanisms involved in breast cancer bone metastasis are poorly understood. Three-dimensional (3D) tissue culture systems are becoming a focus...

  11. J Bone Miner Res . Author manuscript Fracture risk prediction using BMD and clinical risk factors in early

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,651 peri- and early post-menopausal women (mean age (± SD): 54 4 yr) with a mean follow-up period of 13 Density ; Female ; Fractures, Bone ; etiology ; Humans ; Middle Aged ; Osteoporosis, Postmenopausal definition of osteoporosis ( ), i.e. a bone mineral density (BMD) value less than 2.5 standard deviations

  12. Wavelet based characterization of ex vivo vertebral trabecular bone structure with 3T MRI compared to microCT

    SciTech Connect (OSTI)

    Krug, R; Carballido-Gamio, J; Burghardt, A; Haase, S; Sedat, J W; Moss, W C; Majumdar, S

    2005-04-11T23:59:59.000Z

    Trabecular bone structure and bone density contribute to the strength of bone and are important in the study of osteoporosis. Wavelets are a powerful tool to characterize and quantify texture in an image. In this study the thickness of trabecular bone was analyzed in 8 cylindrical cores of the vertebral spine. Images were obtained from 3 Tesla (T) magnetic resonance imaging (MRI) and micro-computed tomography ({micro}CT). Results from the wavelet based analysis of trabecular bone were compared with standard two-dimensional structural parameters (analogous to bone histomorphometry) obtained using mean intercept length (MR images) and direct 3D distance transformation methods ({micro}CT images). Additionally, the bone volume fraction was determined from MR images. We conclude that the wavelet based analyses delivers comparable results to the established MR histomorphometric measurements. The average deviation in trabecular thickness was less than one pixel size between the wavelet and the standard approach for both MR and {micro}CT analysis. Since the wavelet based method is less sensitive to image noise, we see an advantage of wavelet analysis of trabecular bone for MR imaging when going to higher resolution.

  13. Revised estimates of electron absorbed fractions and radionuclide S-values in trabecular bone

    E-Print Network [OSTI]

    Parry, Robert Alan

    1995-01-01T23:59:59.000Z

    of trabecular bone in the skeleton. (Adapted from ICRP 1975). 45 Table 5. 3. Relative weights of dry bones as percentages of total skeleton. (Adapted from ICRP 1975), 45 Table 5. 4. Fractional distribution of red marrow in the skeleton. (Adapted from ICRP... Table 6. 3. Average and maximum beta-particle energy for selected radionuclides. 69 Table 6. 4. S-values for sources in the marrow (in mGy'A4Bq 's '). Target: Marrow 7l Table 6. 5. S-values for sources in the marrow (in mGyMBq 's ') Target...

  14. STRUCTURES AND MATERIALS TEST LABORATORY

    E-Print Network [OSTI]

    Russell, Jeffrey S.

    of the test program described here was to measure the shrinkage and creep characteristics of SCC mixes used. Creep tests ................................................. 4 3. Other tests ........................... 13 Shrinkage Test Results ................................... 16 Creep test Results

  15. Dynamic T{sub 2}-mapping during magnetic resonance guided high intensity focused ultrasound ablation of bone marrow

    SciTech Connect (OSTI)

    Waspe, Adam C.; Looi, Thomas; Mougenot, Charles; Amaral, Joao; Temple, Michael; Sivaloganathan, Siv; Drake, James M. [Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Philips Healthcare Canada, Markham, ON, L6C 2S3 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Department of Applied Mathematics, University of Waterloo, Waterloo, ON, N2L 3G1 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada)

    2012-11-28T23:59:59.000Z

    Focal bone tumor treatments include amputation, limb-sparing surgical excision with bone reconstruction, and high-dose external-beam radiation therapy. Magnetic resonance guided high intensity focused ultrasound (MR-HIFU) is an effective non-invasive thermotherapy for palliative management of bone metastases pain. MR thermometry (MRT) measures the proton resonance frequency shift (PRFS) of water molecules and produces accurate (<1 Degree-Sign C) and dynamic (<5s) thermal maps in soft tissues. PRFS-MRT is ineffective in fatty tissues such as yellow bone marrow and, since accurate temperature measurements are required in the bone to ensure adequate thermal dose, MR-HIFU is not indicated for primary bone tumor treatments. Magnetic relaxation times are sensitive to lipid temperature and we hypothesize that bone marrow temperature can be determined accurately by measuring changes in T{sub 2}, since T{sub 2} increases linearly in fat during heating. T{sub 2}-mapping using dual echo times during a dynamic turbo spin-echo pulse sequence enabled rapid measurement of T{sub 2}. Calibration of T{sub 2}-based thermal maps involved heating the marrow in a bovine femur and simultaneously measuring T{sub 2} and temperature with a thermocouple. A positive T{sub 2} temperature dependence in bone marrow of 20 ms/ Degree-Sign C was observed. Dynamic T{sub 2}-mapping should enable accurate temperature monitoring during MR-HIFU treatment of bone marrow and shows promise for improving the safety and reducing the invasiveness of pediatric bone tumor treatments.

  16. DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process.

    E-Print Network [OSTI]

    Boyer, Edmond

    in the prostate cancer bone metastasis process. Mori K.1, 2, * , Le Goff B. 1, 2 , Charrier C. 1, 2 , Battaglia S cells, thus facilitating prostate cancer metastasis development in bone. We confirm that RANKL is a factor that facilitates metastasis to bone by acting as an activator of both osteoclasts and RANK

  17. IBMS BoneKEy. 2009 April;6(4):132-149 http://www.bonekey-ibms.org/cgi/content/full/ibmske;6/4/132

    E-Print Network [OSTI]

    and osteoporosis, yet uniquely ­ without targeting the resident fat or bone cell. IBMS BoneKEy. 2009 April;6(4):132-149. ©2009 International Bone & Mineral Society Introduction Osteoporosis and obesity, two of the most billion dollars in annual health service costs. (1) Osteoporosis, a disease characterized by diminished

  18. APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO-MECHANICS ON THE IBM SP

    E-Print Network [OSTI]

    California at Berkeley, University of

    APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO,5 Abstract. Accurate micro-finite element analyses of whole bones require the solution of large sets architectures. Key words. multigrid, trabecular bone, human vertebral body, finite element method, massively

  19. Summary of Test Results for the Interagency Field Test &Evaluation...

    Broader source: Energy.gov (indexed) [DOE]

    Summary of Test Results for the Interagency Field Test &Evaluation of Wind Turbine - Radar Interference Mitigation Technologies Summary of Test Results for the Interagency Field...

  20. MITG Test Plan

    SciTech Connect (OSTI)

    Eck, Marshall B.

    1981-08-01T23:59:59.000Z

    The plan presented is for the testing of a prototypical slice of the Modular Isotopic Thermoelectric Generator (MITG). Cross Reference T48-1.

  1. RMOTC - Testing - Carbon Management

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    several years of site characterization and baseline studies necessary to advance CO2 injection tests that could yield important EOR and storage findings. Numerous...

  2. Optimum Statistical Test Procedure

    E-Print Network [OSTI]

    Rajesh Singh; Jayant Singh; Florentin Smarandache

    2009-04-10T23:59:59.000Z

    In this paper we obtain a test which minimizes the sum of the two error probabilities irrespective of whether $\\sigma^2$ is known or unknown.

  3. OMB MPI Tests

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI Tests Description The Ohio MicroBenchmark suite is a collection of independent MPI message passing performance microbenchmarks developed and written at The Ohio State...

  4. Test 1 Solutions

    E-Print Network [OSTI]

    Microsoft account

    2015-03-03T23:59:59.000Z

    Mar 1, 2015 ... Test 1. Spring 2015. February 18, 2015. 1. (30 points) Christian has started to work today at Spears Corporation. Today is Christian's 42nd.

  5. RMOTC - Testing - Environmental

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    oilfield activities and facilities offers opportunities for testing new technologies for environmental protection and restoration in a real-world environment. Examples include pit...

  6. Solutions to Test 1

    E-Print Network [OSTI]

    Owner

    2014-03-06T23:59:59.000Z

    Math 373. Spring 2013. Test 1. February 12, 2013. 1. Tracy is receiving an annuity immediate with quarterly payments of 250 for 10 years. Tracy invests each ...

  7. Solutions to Test 1

    E-Print Network [OSTI]

    Microsoft account

    2015-01-14T23:59:59.000Z

    Jan 14, 2015 ... TEST 1. MATH 373. Fall 2014. October 7, 2014. 1. Ralph's Retail Stores have borrowed 100,000. Ralph's will repay the loan with annual ...

  8. Battery Safety Testing

    Broader source: Energy.gov (indexed) [DOE]

    Battery Safety Testing Christopher J. Orendorff, Leigh Anna M. Steele, Josh Lamb, and Scott Spangler Sandia National Laboratories 2014 Energy Storage Annual Merit Review...

  9. RMOTC - Testing - Alternative Energies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    click here. RMOTC provides the opportunity for its partners to field test the latest alternative energy and environmental management technologies which have specific and...

  10. Accelerator Test Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Test Facility Vitaly Yakimenko October 6-7, 2010 ATF User meeting DOE HE, S. Vigdor, ALD - (Contact) T. Ludlam Chair, Physics Department V. Yakimenko Director ATF, Accelerator...

  11. ACCELERATOR TEST FACILITY

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    LABORATORY PHYSICS DEPARTMENT Effective: 04012004 Page 1 of 2 Subject: Accelerator Test Facility - Linear Accelerator General Systems Guide Prepared by: Michael Zarcone...

  12. RMOTC - Library - Test Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Test Reports All non-proprietary project reports that are approved for release are posted here. Many of RMOTC's projects have protection extended through a Cooperative Research and...

  13. Leak test fitting

    DOE Patents [OSTI]

    Pickett, Patrick T. (Kettering, OH)

    1981-01-01T23:59:59.000Z

    A hollow fitting for use in gas spectrometry leak testing of conduit joints is divided into two generally symmetrical halves along the axis of the conduit. A clip may quickly and easily fasten and unfasten the halves around the conduit joint under test. Each end of the fitting is sealable with a yieldable material, such as a piece of foam rubber. An orifice is provided in a wall of the fitting for the insertion or detection of helium during testing. One half of the fitting also may be employed to test joints mounted against a surface.

  14. Flexibility in Testing Configurations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technologies Laboratory and the National Solar Thermal Test Facility to advance the reliability, interconnectivity, and availability of solar technologies in the nation's...

  15. Solutions to Test 1

    E-Print Network [OSTI]

    jeffb_000

    2014-03-04T23:59:59.000Z

    STAT 479. Spring 2014. Test 1. February 18, 2014. 1. You are given the following empirical distribution of losses: 300 500 700 800 1000 1400. An insurance ...

  16. Animal Health Diagnostic Center Test and Fee Schedule Test Name Test Fee Discipline Test Days Lag** Samples Container Coolant Comments

    E-Print Network [OSTI]

    Keinan, Alon

    Animal Health Diagnostic Center Test and Fee Schedule Test Name Test Fee Discipline Test Days Lag** Samples Container Coolant Comments Equine Tests Equine Tests Acid Fast Stain (for bacteria) M-F 1-2 days 1 4 hours for equine. For more information, see Equine Cushing's Tests or AppendixC. For Equine only

  17. School of Architecture, Design and the Built Environment Project Title: Artificial bone for prosthetic hip joints

    E-Print Network [OSTI]

    Evans, Paul

    formation by the Additive Manufacturing (AM) direct printing process. The artificial bone must and the development of new additive manufacturing techniques for medical devices. The group has active links and structural gradients into the prosthesis. It is envisioned this could involve the use of additively

  18. Nonlinear resonant ultrasound spectroscopy (NRUS) applied to damage assessment in bone

    E-Print Network [OSTI]

    Alamos National Laboratory of the University of California, Los Alamos, New Mexico 87545 Received 25 May NRUS is a resonance-based technique exploiting the significant nonlinear behavior of damaged materials obtained through the measurement of bone mineral density BMD obtained from x-ray densitometric techniques.1

  19. In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone

    E-Print Network [OSTI]

    Weiss, Lee E.

    In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone tissue engineering Kacey G. Marra,1 Jeffrey W. Szem,2 Prashant N. Kumta,3 Paul A. DiMilla,4 Lee E. Weiss5 1 14 April 1999 Abstract: Blends of biodegradable polymers, poly(capro- lactone) and poly

  20. Estimated number of women likely to benefit from bone mineral density measurement in France

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ; Menopause Introduction The prevalence of osteoporosis is rising, most notably in postmenopausal women years of age with risk factors for osteoporosis likely to lead to bone mineral density measurement, an investigation reimbursed by the French national health insurance system in patients at risk for osteoporosis

  1. Differential Maintenance of Cortical and Cancellous Bone Strength Following Discontinuation of

    E-Print Network [OSTI]

    Ritchie, Robert

    and with combination of osteoporosis medications are needed to improve our treatment of osteoporosis. ß 2011 American; RALOXIFENE Introduction A number of drugs offer some protection against post- menopausal bone loss and nonvertebral fractures in postmenopausal osteoporosis.(3) While bisphosphonates such as ALN may accumulate

  2. Feeding Bone Meal to Range Cattle on the Coastal Plains of Texas : Preliminary Report.

    E-Print Network [OSTI]

    Schmidt, H.

    1926-01-01T23:59:59.000Z

    TO RANGE CATTLE 15 Ullllt deca espc T : (Figure 4), or a piece of old hide that has not yet completely yed. Occasionally an animal may be seen licking on the partially ~sed bones of a foul-smelling carcass. he facts related above have probably been...

  3. 3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views

    E-Print Network [OSTI]

    3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views B. Nikkhahe of the femur and 97 % of the model femur shaft less than 2 mm from the CT scan. Also the femoral head visualization of the femur including the femoral collumn and condyles is important for the clinician in a number

  4. Changes in bone morphology and composition following long-term alcohol consumption

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 months. The rats were...

  5. Bone ingrowth in a shoulder prosthesis E.M.van Aken

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis E.M.van Aken 1107895 emvanaken@hotmail.com Delft, 2006 and to relief the pain, a prosthesis to replace the glenoid of the shoulder joint is an option. The shoulder. The prosthesis, often made of stainless steal combined with polyethylene, re- #12;4 places this glenoid cavity

  6. A method for calibration of bone driver transducers to measure the mastoid Reggie Weece a

    E-Print Network [OSTI]

    Allen, Jont

    2010 Available online xxxx a b s t r a c t When using bone vibrator transducers for clinical a circuit model of the driver, describing it with three frequency-dependent parameters. Once these three circuit model is proposed to better capture the observed behaviors. Ã? 2010 Published by Elsevier B.V. 1

  7. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    The objective of this experiment was to examine the effect of late-onset alcohol abuse on aged bone using the rat model. Thirty female Fischer 344 rats were separated by weights into one of four groups: baseline, alcohol-fed, pair-fed, and pellet...

  8. Calcium balance and bone density in immature horses fed a high protein diet 

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    is easy and non-invasive, the variability among horses is quite high, and thus it is best used for observations of changes in bone density over time for a specific animal. Computer assisted tomography (CAT scan) and dual energy x-ray 7...

  9. From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia

    E-Print Network [OSTI]

    From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia MARINA FAERMAN,1* ALMUT identification; Y chromosome polymorphic markers; sickle cell anemia ABSTRACT The potential and reliability sample, which represented a documented case of sickle cell anemia. -globin gene sequences obtained from

  10. Correlation of mechanical viscoelastic properties to microstructure of equine cortical bone tissue

    E-Print Network [OSTI]

    Ayers, Andrew Kerr

    1995-01-01T23:59:59.000Z

    , there is a fair amount of subjectivity that is involved when deciding borderline grid points The current investigation used a diff'erent method in which an image analysis program, Optimas 4 2, is used to threshold the image of the bone In this procedure...

  11. Microfluidic purification and analysis of hematopoietic stem cells from bone Romana Schirhagl,a

    E-Print Network [OSTI]

    Zare, Richard N.

    Microfluidic purification and analysis of hematopoietic stem cells from bone marrow Romana to separate them from a whole-marrow sample. A microfluidic device was fabricated using an integrated membrane are restricted by the limited availability of stem cell sources.2,3 We believe that microfluidics can be used

  12. BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA AND CT

    E-Print Network [OSTI]

    Valero-Cuevas, Francisco

    BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA, osteoporosis is frequently overdiagnosed in children when using dual-energy x-ray absorptiometry (DXA osteoporosis in pediatric populations. (J Pediatr 2005;146:776-9) D ual-energy x-ray absorptiometry (DXA

  13. On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone

    E-Print Network [OSTI]

    Frey, Pascal

    On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone Peter Arbenz on complicated domains composed of often hundreds of millions of voxel elements. The finite element analysis finite element (FE) analysis. The approach based on the FE analysis leads to linear systems of equations

  14. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to recalculate integrated activity over fifty years, U, values, as a function of intake for use in dose calculations for plutonium deposit on bone surfaces. These values were compared with those in ICRP-30 and showed a substantial decrease in the estimated dose...

  15. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling 

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    . Recent data gathered from crew members on the International Space Station (ISS) illustrates the significant losses of bone mineral density (BMD) and geometry of the femoral neck (15). Dual-energy x-ray absorptiometry (DXA) and QCT scans were taken...

  16. Changes in bone morphology and composition following long-term alcohol consumption 

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 ...

  17. A 3D Statistical Shape Model Of The Pelvic Bone For Segmentation

    E-Print Network [OSTI]

    Andrzejak, Artur

    patient models from 3D image data. Within the setting of a hybrid system (applicator plus MR tomograph. Left: hybrid system (MRT plus applicator), Right: MRT slice image from the abdomen with pelvic bone. 1 on heating up affected tissue compartments to temperatures above 42 degree Celsius without damaging

  18. Randomized, Double-Blinded, Placebo-Controlled, Trial of Risedronate for the Prevention of Bone Mineral Density Loss in Nonmetastatic Prostate Cancer Patients Receiving Radiation Therapy Plus Androgen Deprivation Therapy

    SciTech Connect (OSTI)

    Choo, Richard [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)] [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Lukka, Himu [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada)] [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada); Cheung, Patrick [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)] [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada); Corbett, Tom [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada)] [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada); Briones-Urbina, Rosario [Department of Medicine, Women's College Hospital, University of Toronto, Toronto (Canada)] [Department of Medicine, Women's College Hospital, University of Toronto, Toronto (Canada); Vieth, Reinhold [Departments of Nutritional Sciences and Laboratory Medicine and Pathology, Mount Sinai Hospital, University of Toronto, Toronto (Canada)] [Departments of Nutritional Sciences and Laboratory Medicine and Pathology, Mount Sinai Hospital, University of Toronto, Toronto (Canada); Ehrlich, Lisa [Department of Radiology, Sunnybrook Health Sciences Center, University of Toronto (Canada)] [Department of Radiology, Sunnybrook Health Sciences Center, University of Toronto (Canada); Kiss, Alex [Department of Health Policy, Management, and Evaluation, Sunnybrook Health Sciences Center, University of Toronto, Toronto (Canada)] [Department of Health Policy, Management, and Evaluation, Sunnybrook Health Sciences Center, University of Toronto, Toronto (Canada); Danjoux, Cyril, E-mail: Cyril.danjoux@sunnybrook.ca [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)] [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)

    2013-04-01T23:59:59.000Z

    Purpose: Androgen deprivation therapy (ADT) has been used as an adjuvant treatment to radiation therapy (RT) for the management of locally advanced prostate carcinoma. Long-term ADT decreases bone mineral density (BMD) and increases the risk of osteoporosis. The objective of this clinical trial was to evaluate the efficacy of risedronate for the prevention of BMD loss in nonmetastatic prostate cancer patients undergoing RT plus 2 to 3 years of ADT. Methods and Materials: A double-blinded, placebo-controlled, randomized trial was conducted for nonmetastatic prostate cancer patients receiving RT plus 2 to 3 years of ADT. All had T scores > ?2.5 on dual energy x-ray absorptiometry at baseline. Patients were randomized 1:1 between risedronate and placebo for 2 years. The primary endpoints were the percent changes in the BMD of the lumbar spine at 1 and 2 years from baseline, measured by dual energy x-ray absorptiometry. Analyses of the changes in BMD and bone turnover biomarkers were carried out by comparing mean values of the intrapatient changes between the 2 arms, using standard t tests. Results: One hundred four patients were accrued between 2004 and 2007, with 52 in each arm. Mean age was 66.8 and 67.5 years for the placebo and risedronate, respectively. At 1 and 2 years, mean (±SE) BMD of the lumbar spine decreased by 5.77% ± 4.66% and 13.55% ± 6.33%, respectively, in the placebo, compared with 0.12% ± 1.29% at 1 year (P=.2485) and 0.85% ± 1.56% (P=.0583) at 2 years in the risedronate. The placebo had a significant increase in serum bone turnover biomarkers compared with the risedronate. Conclusions: Weekly oral risedronate prevented BMD loss at 2 years and resulted in significant suppression of bone turnover biomarkers for 24 months for patients receiving RT plus 2 to 3 years of ADT.

  19. Standard Test Method for Sandwich Corrosion Test

    E-Print Network [OSTI]

    American Society for Testing and Materials. Philadelphia

    2009-01-01T23:59:59.000Z

    1.1 This test method defines the procedure for evaluating the corrosivity of aircraft maintenance chemicals, when present between faying surfaces (sandwich) of aluminum alloys commonly used for aircraft structures. This test method is intended to be used in the qualification and approval of compounds employed in aircraft maintenance operations. 1.2 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information. 1.3 This standard may involve hazardous materials, operations, and equipment. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. Specific hazard statements appear in Section 9.

  20. Testing of the structural evaluation test unit

    SciTech Connect (OSTI)

    Ammerman, D.J.; Bobbe, J.G.

    1995-12-31T23:59:59.000Z

    In the evaluation of the safety of radioactive material transportation it is important to consider the response of Type B packages to environments more severe than that prescribed by the hypothetical accident sequence in Title 10 Part 71 of the Code of Federal Regulations (NRC 1995). The impact event in this sequence is a 9-meter drop onto an essentially unyielding target, resulting in an impact velocity of 13.4 m/s. The behavior of 9 packages when subjected to impacts more severe than this is not well known. It is the purpose of this program to evaluate the structural response of a test package to these environments. Several types of structural response are considered. Of primary importance is the behavior of the package containment boundary, including the bolted closure and 0-rings. Other areas of concern are loss of shielding capability due to lead slump and the deceleration loading of package contents, that may cause damage to them. This type of information is essential for conducting accurate risk assessments on the transportation of radioactive materials. Currently very conservative estimates of the loss of package protection are used in these assessments. This paper will summarize the results of a regulatory impact test and three extra-regulatory impact tests on a sample package.

  1. RESULTS OF FIELD TESTING DOE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    FIELD TESTING AT THE DEPARTMENT OF ENERGY, ROCKY MOUNTAIN OILFIELD TESTING CENTER May through September of 2011 RMOTC is an energy testing center that partners with industry to...

  2. A dual model HU conversion from MRI intensity values within and outside of bone segment for MRI-based radiotherapy treatment planning of prostate cancer

    SciTech Connect (OSTI)

    Korhonen, Juha, E-mail: juha.p.korhonen@hus.fi [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland) [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland); Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland); Kapanen, Mika [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland) [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland); Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland); Department of Medical Physics, Tampere University Hospital, POB-2000, 33521 Tampere (Finland); Keyriläinen, Jani; Seppälä, Tiina; Tenhunen, Mikko [Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland)] [Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland)

    2014-01-15T23:59:59.000Z

    Purpose: The lack of electron density information in magnetic resonance images (MRI) poses a major challenge for MRI-based radiotherapy treatment planning (RTP). In this study the authors convert MRI intensity values into Hounsfield units (HUs) in the male pelvis and thus enable accurate MRI-based RTP for prostate cancer patients with varying tissue anatomy and body fat contents. Methods: T{sub 1}/T{sub 2}*-weighted MRI intensity values and standard computed tomography (CT) image HUs in the male pelvis were analyzed using image data of 10 prostate cancer patients. The collected data were utilized to generate a dual model HU conversion technique from MRI intensity values of the single image set separately within and outside of contoured pelvic bones. Within the bone segment local MRI intensity values were converted to HUs by applying a second-order polynomial model. This model was tuned for each patient by two patient-specific adjustments: MR signal normalization to correct shifts in absolute intensity level and application of a cutoff value to accurately represent low density bony tissue HUs. For soft tissues, such as fat and muscle, located outside of the bone contours, a threshold-based segmentation method without requirements for any patient-specific adjustments was introduced to convert MRI intensity values into HUs. The dual model HU conversion technique was implemented by constructing pseudo-CT images for 10 other prostate cancer patients. The feasibility of these images for RTP was evaluated by comparing HUs in the generated pseudo-CT images with those in standard CT images, and by determining deviations in MRI-based dose distributions compared to those in CT images with 7-field intensity modulated radiation therapy (IMRT) with the anisotropic analytical algorithm and 360° volumetric-modulated arc therapy (VMAT) with the Voxel Monte Carlo algorithm. Results: The average HU differences between the constructed pseudo-CT images and standard CT images of each test patient ranged from ?2 to 5 HUs and from 22 to 78 HUs in soft and bony tissues, respectively. The average local absolute value differences were 11 HUs in soft tissues and 99 HUs in bones. The planning target volume doses (volumes 95%, 50%, 5%) in the pseudo-CT images were within 0.8% compared to those in CT images in all of the 20 treatment plans. The average deviation was 0.3%. With all the test patients over 94% (IMRT) and 92% (VMAT) of dose points within body (lower than 10% of maximum dose suppressed) passed the 1 mm and 1% 2D gamma index criterion. The statistical tests (t- and F-tests) showed significantly improved (p ? 0.05) HU and dose calculation accuracies with the soft tissue conversion method instead of homogeneous representation of these tissues in MRI-based RTP images. Conclusions: This study indicates that it is possible to construct high quality pseudo-CT images by converting the intensity values of a single MRI series into HUs in the male pelvis, and to use these images for accurate MRI-based prostate RTP dose calculations.

  3. Advanced Test Reactor Tour

    SciTech Connect (OSTI)

    Miley, Don

    2011-01-01T23:59:59.000Z

    The Advanced Test Reactor at Idaho National Laboratory is the foremost nuclear materials test reactor in the world. This virtual tour describes the reactor, how experiments are conducted, and how spent nuclear fuel is handled and stored. For more information about INL research, visit http://www.facebook.com/idahonationallaboratory.

  4. Advanced Test Reactor Tour

    ScienceCinema (OSTI)

    Miley, Don

    2013-05-28T23:59:59.000Z

    The Advanced Test Reactor at Idaho National Laboratory is the foremost nuclear materials test reactor in the world. This virtual tour describes the reactor, how experiments are conducted, and how spent nuclear fuel is handled and stored. For more information about INL research, visit http://www.facebook.com/idahonationallaboratory.

  5. Cooperative Testing and Analysis

    E-Print Network [OSTI]

    Xie, Tao

    Cooperative Testing and Analysis: Tao Xie Peking University, China (2011-2012) North Carolina State Account for even half the total cost of software development [Beizer 90] Automated testing reduces manual to the user to get her help? Tool Human How does the user help the tool based on the info? Iterations

  6. Tests for Convergence Clubs

    E-Print Network [OSTI]

    Corrado, Luisa; Weeks, Melvyn

    2011-01-26T23:59:59.000Z

    In many applications common in testing for convergence the number of cross-sectional units is large and the number of time periods are few. In these situations tests which are founded upon an omnibus null hypothesis are characterised by a number...

  7. Nanomechanical testing system

    DOE Patents [OSTI]

    Vodnick, David James; Dwivedi, Arpit; Keranen, Lucas Paul; Okerlund, Michael David; Schmitz, Roger William; Warren, Oden Lee; Young, Christopher David

    2014-07-08T23:59:59.000Z

    An automated testing system includes systems and methods to facilitate inline production testing of samples at a micro (multiple microns) or less scale with a mechanical testing instrument. In an example, the system includes a probe changing assembly for coupling and decoupling a probe of the instrument. The probe changing assembly includes a probe change unit configured to grasp one of a plurality of probes in a probe magazine and couple one of the probes with an instrument probe receptacle. An actuator is coupled with the probe change unit, and the actuator is configured to move and align the probe change unit with the probe magazine and the instrument probe receptacle. In another example, the automated testing system includes a multiple degree of freedom stage for aligning a sample testing location with the instrument. The stage includes a sample stage and a stage actuator assembly including translational and rotational actuators.

  8. Air gun test evaluation

    SciTech Connect (OSTI)

    Carleton, J.J. II; Fox, L.; Rudy, C.R.

    1992-01-15T23:59:59.000Z

    A mechanical shock testing apparatus is used for testing the response of components subject to large accelerations in hostile environments. The test acceleration is provided by the impact of a bullet against a plate on which the component to be tested is mounted. This report describes a series of experiments that were performed to determine the dependence of the air gun test apparatus performance on incremental changes in the hardware configurations, changes in the pressure used to drive the bullet, and different accelerometers. The effect of variation of these experimental factors on the measured acceleration was determined using a Taguchi screening experimental design. Experimental settings were determined that can be used to operate the tester with a measured output within acceleration specifications.

  9. Cylinder Test Specification

    SciTech Connect (OSTI)

    Richard Catanach; Larry Hill; Herbert Harry; Ernest Aragon; Don Murk

    1999-10-01T23:59:59.000Z

    The purpose of the cylinder testis two-fold: (1) to characterize the metal-pushing ability of an explosive relative to that of other explosives as evaluated by the E{sub 19} cylinder energy and the G{sub 19} Gurney energy and (2) to help establish the explosive product equation-of-state (historically, the Jones-Wilkins-Lee (JWL) equation). This specification details the material requirements and procedures necessary to assemble and fire a typical Los Alamos National Laboratory (LANL) cylinder test. Strict adherence to the cylinder. material properties, machining tolerances, material heat-treatment and etching processes, and high explosive machining tolerances is essential for test-to-test consistency and to maximize radial wall expansions. Assembly and setup of the cylinder test require precise attention to detail, especially when placing intricate pin wires on the cylinder wall. The cylinder test is typically fired outdoors and at ambient temperature.

  10. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    SciTech Connect (OSTI)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17T23:59:59.000Z

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates ?-catenin and RUNX2. -- Abstract: Wnt/?-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of ?-catenin and RUNX2, as well as inhibiting the nuclear translocation of ?-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  11. Edit Test Options Page 1 Edit Test Options

    E-Print Network [OSTI]

    Xu, Shouhuai

    Edit Test Options Page 1 Edit Test Options Format Test Information 1. Enter a Name for the Test. 2. Choose a color for the title text of the Test. (Optional) 3. Enter a Description in the Text Box. The description is visible to Students before they click on the link to take the Test. (Optional) 4. If you want

  12. Advancing Toward Test Automation through Effective Manual Testing

    E-Print Network [OSTI]

    . This paper will walk through a best practice scenario for using Manual Tester to more naturally organize test Automation through Effective Manual Testing Bob Levy, Lead Product Manager ­ Functional Test Dennis ElenburgAdvancing Toward Test Automation through Effective Manual Testing May 2005 Advancing Toward Test

  13. Thermal test options

    SciTech Connect (OSTI)

    Koski, J.A.; Keltner, N.R.; Sobolik, K.B.

    1993-02-01T23:59:59.000Z

    Shipping containers for radioactive materials must be qualified to meet a thermal accident environment specified in regulations, such at Title 10, Code of Federal Regulations, Part 71. Aimed primarily at the shipping container design, this report discusses the thermal testing options available for meeting the regulatory requirements, and states the advantages and disadvantages of each approach. The principal options considered are testing with radiant heat, furnaces, and open pool fires. The report also identifies some of the facilities available and current contacts. Finally, the report makes some recommendations on the appropriate use of these different testing methods.

  14. Solutions to Test 2

    E-Print Network [OSTI]

    Test 2. Spring 2013. March 5, 2013. 1. Jana purchased a 20 year zero coupon bond for 20,000. The bond matures for 70,000. Christian borrowed 50,000 to be ...

  15. Solutions to Test 3

    E-Print Network [OSTI]

    Microsoft account

    2015-04-02T23:59:59.000Z

    Apr 2, 2015 ... Test 3. Fall 2014. November 18, 2014. 1. The preferred stock of Oldham Company pays a quarterly dividend of 8. The next dividend is due in 1 ...

  16. Solutions to Test 2

    E-Print Network [OSTI]

    Microsoft account

    2015-01-14T23:59:59.000Z

    Jan 14, 2015 ... Test 2. Fall 2014. October 28, 2014. 1. Joon is going to buy a 10 year callable bond. The bond matures for 15,000 and pays semi-annual.

  17. Solutions to Test 3

    E-Print Network [OSTI]

    jeffb_000

    2014-08-16T23:59:59.000Z

    Math 373. Test 3. Spring 2014. April 8, 2014. 1. Yujin can buy each of the following bonds for a price of P . The bonds are: a. A 10 year zero coupon bond ...

  18. Solutions to Test 1

    E-Print Network [OSTI]

    jeffb_000

    2014-08-16T23:59:59.000Z

    MATH 373. Spring 2014. Test 1. February 18, 2013. 1. Amar wants to accumulate 1 million (1,000,000) by the time that he is 50 years old. Amar is currently 20 ...

  19. Solutions to Test 2

    E-Print Network [OSTI]

    jeffb_000

    2014-04-14T23:59:59.000Z

    STAT 479. Test 2. Spring 2014. April 1, 2014. 1. (5 points) You are given the following grouped data: Amount of claims. Number of Claims. 0 to 1000. 8. 1000 to ...

  20. Final focus test beam

    SciTech Connect (OSTI)

    Not Available

    1991-03-01T23:59:59.000Z

    This report discusses the following: the Final Focus Test Beam Project; optical design; magnets; instrumentation; magnetic measurement and BPM calibration; mechanical alignment and stabilization; vacuum system; power supplies; control system; radiation shielding and personnel protection; infrastructure; and administration.

  1. Solutions to Test 1

    E-Print Network [OSTI]

    Microsoft account

    2014-10-24T23:59:59.000Z

    Test 1. STAT 47201. Fall 2014. October 7, 2014. 1. You are given: i. Mortality follows the illustrative life table ii. 6% i = Calculate: a. The actuarial present value

  2. RMOTC TEST REPORT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    896PT15 RMOTC TEST REPORT Bull Dog Auger Bull Dog Tool, Inc 243 W. County Road P.O. Box 5961 Hobbs, New Mexico 88241-5961 Leo Gianfiacomo, Project Manager Rocky Mountain Oilfield...

  3. Accelerated Testing Validation

    E-Print Network [OSTI]

    Mukundan, Rangachary

    2013-01-01T23:59:59.000Z

    used in the HD6 MEA. Failure analysis of these MEAs has beenpotential hold test. The failure analysis from these stacksbe validated with the failure analysis from both the AST and

  4. RMOTC TEST REPORT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    conducted a field test on the MUD DEVIL - Deaerator Mixer (MDDM), at the Naval Oil Shale Reserve No. 3 (NOSR-3) located west of Rifle, Colorado. Industrial Screen and...

  5. Duct Tape Durability Testing

    SciTech Connect (OSTI)

    Sherman, Max H.; Walker, Iain S.

    2004-04-01T23:59:59.000Z

    Duct leakage is a major source of energy loss in residential buildings. Most duct leakage occurs at the connections to registers, plenums, or branches in the duct system. At each of these connections, a method of sealing the duct system is required. Typical sealing methods include tapes or mastics applied around the joints in the system. Field examinations of duct systems have shown that taped seals tend to fail over extended periods of time. The Lawrence Berkeley National Laboratory (LBNL) has been testing sealant durability for several years using accelerated test methods and found that typical duct tape (i.e., cloth-backed tapes with natural rubber adhesives) fails more rapidly than other duct sealants. This report summarizes the results of duct sealant durability testing over two years for four UL 181B-FX listed duct tapes (two cloth tapes, a foil tape and an Oriented Polypropylene (OPP) tape). One of the cloth tapes was specifically developed in collaboration with a tape manufacturer to perform better in our durability testing. The tests involved the aging of common ''core-to-collar joints'' of flexible duct to sheet metal collars. Periodic air leakage tests and visual inspection were used to document changes in sealant performance. After two years of testing, the flex-to-collar connections showed little change in air leakage, but substantial visual degradation from some products. A surprising experimental result was failure of most of the clamps used to mechanically fasten the connections. This indicates that the durability of clamps also need to be addressed ensure longevity of the duct connection. An accelerated test method developed during this study has been used as the basis for an ASTM standard (E2342-03).

  6. Diesel Engine Idling Test

    SciTech Connect (OSTI)

    Larry Zirker; James Francfort; Jordon Fielding

    2006-02-01T23:59:59.000Z

    In support of the Department of Energy’s FreedomCAR and Vehicle Technology Program Office goal to minimize diesel engine idling and reduce the consumption of millions of gallons of diesel fuel consumed during heavy vehicle idling periods, the Idaho National Laboratory (INL) conducted tests to characterize diesel engine wear rates caused by extended periods of idling. INL idled two fleet buses equipped with Detroit Diesel Series 50 engines, each for 1,000 hours. Engine wear metals were characterized from weekly oil analysis samples and destructive filter analyses. Full-flow and the bypass filter cartridges were removed at four stages of the testing and sent to an oil analysis laboratory for destructive analysis to ascertain the metals captured in the filters and to establish wear rate trends. Weekly samples were sent to two independent oil analysis laboratories. Concurrent with the filter analysis, a comprehensive array of other laboratory tests ascertained the condition of the oil, wear particle types, and ferrous particles. Extensive ferrogram testing physically showed the concentration of iron particles and associated debris in the oil. The tests results did not show the dramatic results anticipated but did show wear trends. New West Technologies, LLC, a DOE support company, supplied technical support and data analysis throughout the idle test.

  7. Architectures of Test Automation 1 High Volume Test AutomationHigh Volume Test Automation

    E-Print Network [OSTI]

    Architectures of Test Automation 1 High Volume Test AutomationHigh Volume Test Automation Cem Kaner Institute of Technology October 2003 #12;Architectures of Test Automation 2 Acknowledgements developed a course on test automation architecture, and in the Los Altos Workshops on Software Testing

  8. Jim Duckworth, WPI Verilog for Testing -Module 61 Test Benches (Test Fixtures)

    E-Print Network [OSTI]

    Huang, Xinming

    Jim Duckworth, WPI Verilog for Testing - Module 61 Test Benches (Test Fixtures) Verilog for Testing #12;Jim Duckworth, WPI Verilog for Testing - Module 62 Overview · We have concentrated on Verilog for synthesis · Can also use Verilog as a test language · Very important to conduct comprehensive verification

  9. The Modified Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions

    E-Print Network [OSTI]

    The Modified Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions Francis for Nondestructive Evaluation Iowa State University Ames, IA 50011 ABSTRACT: We present modified sudden death test (MSDT) plans to address the problem of limited testing positions in life tests. A single MSDT involves

  10. The Modi ed Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions

    E-Print Network [OSTI]

    The Modi ed Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions Francis for Nondestructive Evaluation Iowa State University Ames, IA 50011 ABSTRACT: We present modi ed sudden death test (MSDT) plans to address the problem of limited testing positions in life tests. A single MSDT involves

  11. Adult equine bone-marrow stromal cells produce a cartilage-like ECM superior to animal-matched adult chondrocytes

    E-Print Network [OSTI]

    Kisiday, John D.

    Our objective was to evaluate the age-dependent mechanical phenotype of bone marrow stromal cell- (BMSC-) and chondrocyte-produced cartilage-like neo-tissue and to elucidate the matrix-associated mechanisms which generate ...

  12. Rational design to control multipotent stromal cell migration for applications in bone tissue engineering and injury repair

    E-Print Network [OSTI]

    Wu, Shan, Ph. D. Massachusetts Institute of Technology

    2011-01-01T23:59:59.000Z

    Multipotent stromal cells derived from bone marrow hold great potential for tissue engineering applications because of their ability to home to injury sites and to differentiate along mesodermal lineages to become osteocytes, ...

  13. Regional geologic characterization of the Second Bone Spring Sandstone, Delaware basin, Lea and Eddy Counties, New Mexico

    E-Print Network [OSTI]

    Downing, Amanda Beth

    2001-01-01T23:59:59.000Z

    The Bone Spring Formation is a series of interbedded siliciclastics and carbonates that were deposited in the Delaware basin during the Leonardian (Early Permian). It consists of the First, Second and Third Carbonate and the First, Second and Third...

  14. Adaptations of Trabecular Bone to Low Magnitude Vibrations Result in More Uniform Stress and Strain Under Load

    E-Print Network [OSTI]

    magnitude mechanical stimuli 10 microstrain induced at high frequencies are anabolic to trabe- cular bone strain or stress , the resultant stresses and strains within trabe- culae were more uniformly distributed

  15. Gary M. Bone, Andrew Lambert and Mark Edwards Abstract This paper describes the development of a novel

    E-Print Network [OSTI]

    Bone, Gary

    Gary M. Bone, Andrew Lambert and Mark Edwards Abstract ­ This paper describes the development from the top of a pile was described by Taylor, Blake and Cox [3]. They used a wrist-mounted camera

  16. Effect of dietary calcium and phosphorus levels on performance and bone development of large-framed developing boars

    E-Print Network [OSTI]

    Robinson, Robert Glen

    1975-01-01T23:59:59.000Z

    in determining bone strength. His expertise and willingness to help on short notice many times under adverse conditions will always be remembered. Special recognition is also due and gratefully given to personal friends Darrell Knabe and Edward Gregg...

  17. Potential commercial application of a bi-layer bone-ligament regeneration scaffold to anterior cruciate ligament replacement

    E-Print Network [OSTI]

    Li, Jessica C. (Jessica Ching-Yi)

    2006-01-01T23:59:59.000Z

    A business model was created in order to explore the commercial application of a bi-layer bone-ligament scaffold to the treatment of torn anterior cruciate ligaments (ACL) requiring replacement. The two main keys in producing ...

  18. Office of Evaluation and Testing Test Day Tips

    E-Print Network [OSTI]

    Brinkmann, Peter

    Office of Evaluation and Testing Test Day Tips Get plenty of rest the night before the test. The best thing to do the evening before the test is to get a good night's sleep. You've covered the content and you've perfected the skills. Now it's time to get in test mode -- calm, rested, confident, and ready

  19. Sparkr Blade Test Centre Fatigue tests of wind turbine blades

    E-Print Network [OSTI]

    Sparkær Blade Test Centre Fatigue tests of wind turbine blades Flapwise fatigue tests of 3 blades wind load. By turning and oscillating the blade in the horzontal direction, an R-ratio of ­1 running at the Sparkær Centre Blade Test Facilities. Fatigue blade tests are performed in order

  20. Software Verification and Testing Lecture Notes: Testing I

    E-Print Network [OSTI]

    Struth, Georg

    of Testing Methods dynamic testing: software component is executed with concrete input values (in a realSoftware Verification and Testing Lecture Notes: Testing I #12;Motivation verification: · powerful · automated techniques rather limited testing: (as "poor man's verification") · can only detect presence

  1. Test Anxiety Tips to Ease Your Test Anxiety

    E-Print Network [OSTI]

    Kasman, Alex

    Test Anxiety Tips to Ease Your Test Anxiety Adapted from: Study Guides and Strategies website, Overcoming test anxiety Test taking can be overwhelming and can cause a lot of anxiety. Try these tips to ease your anxiety through the testing process! Before Approach the exam with confidence Be prepared

  2. Intra-arterial Autologous Bone Marrow Cell Transplantation in a Patient with Upper-extremity Critical Limb Ischemia

    SciTech Connect (OSTI)

    Madaric, Juraj, E-mail: jurmad@hotmail.com [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia)] [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia); Klepanec, Andrej [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia); Mistrik, Martin [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia)] [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia); Altaner, Cestmir [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia)] [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia); Vulev, Ivan [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)

    2013-04-15T23:59:59.000Z

    Induction of therapeutic angiogenesis by autologous bone marrow mononuclear cell transplantation has been identified as a potential new option in patients with advanced lower-limb ischemia. There is little evidence of the benefit of intra-arterial cell application in upper-limb critical ischemia. We describe a patient with upper-extremity critical limb ischemia with digital gangrene resulting from hypothenar hammer syndrome successfully treated by intra-arterial autologous bone marrow mononuclear cell transplantation.

  3. Characterization of host lymphoid cells in antibody-facilitated bone marrow chimeras

    SciTech Connect (OSTI)

    McCarthy, S.A.; Griffith, I.J.; Gambel, P.; Francescutti, L.H.; Wegmann, T.G.

    1985-07-01T23:59:59.000Z

    The authors have produced stable murine antibody-facilitated (AF) chimeras by the simultaneous injection of P1 bone marrow cells and anti-P2 monoclonal antibody into normal (unirradiated) adult (P1 X P2)F1 recipients. These AF chimeras are healthy, long-lived, and exhibit no overt signs of graft-versus-host disease. They are immunocompetent and tolerant of host, P2-encoded alloantigens. Donor cell engraftment and takeover, monitored by glucosephosphate isomerase isozyme patterns, is usually complete (greater than 95%) in the peripheral blood, bone marrow, and hemopoietic stem cell compartments of long-term (greater than 3 months posttransplantation) AF chimeras. The authors report here, however, that splenic, lymph node, and thymic leukocytes of AF chimeras represent donor/host chimeric populations. Spleen cell populations of AF chimeras exhibit substantial chimera-to-chimera variation in the preponderant residual host cell type(s) present. Interpretations of the implications of these findings are discussed.

  4. Evaluation of Radiation Dose Effects on Rat Bones Using Synchrotron Radiation Computed Microtomography

    SciTech Connect (OSTI)

    Nogueira, Liebert Parreiras; Braz, Delson [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Barroso, Regina Cely [Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Almeida, Carlos Eduardo de; Andrade, Cherley Borba [Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Tromba, Giuliana [Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2011-12-13T23:59:59.000Z

    In this work, we investigated the consequences of irradiation in the femora and ribs of rats submitted to radiation doses of 5 Gy. Three different sites in femur specimens (head, distal metaphysis and distal epiphysis) and one in ribs (ventral) were imaged using synchrotron radiation microcomputed tomography to assess trabecular bone microarchitecture. Histomorphometric quantification was calculated directly from the 3D microtomographic images using synchrotron radiation. The 3D microtomographic images were obtained at the SYRMEP (SYnchrotron Radiation for MEdical Physics) beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. A better understanding of the biological interactions that occur after exposure to photon radiation is needed in order to optimize therapeutic regimens and facilitate development and strategies that decrease radiation-induced side effects in humans. Results showed significant differences between irradiated and non-irradiated specimens, mostly in head and distal metaphysis bone sites.

  5. Corrosion testing using isotopes

    DOE Patents [OSTI]

    Hohorst, F.A.

    1995-12-05T23:59:59.000Z

    A method is described for determining the corrosion behavior of a material with respect to a medium in contact with the material by: implanting a substantially chemically inert gas in a matrix so that corrosion experienced by the material causes the inert gas to enter the medium; placing the medium in contact with the material; and measuring the amount of inert gas which enters the medium. A test sample of a material whose resistance to corrosion by a medium is to be tested is described composed of: a body of the material, which body has a surface to be contacted by the medium; and a substantially chemically inert gas implanted into the body to a depth below the surface. A test sample of a material whose resistance to corrosion by a medium is to be tested is described composed of: a substrate of material which is easily corroded by the medium, the substrate having a surface; a substantially chemically inert gas implanted into the substrate; and a sheet of the material whose resistance to corrosion is to be tested, the sheet being disposed against the surface of the substrate and having a defined thickness. 3 figs.

  6. Corrosion testing using isotopes

    DOE Patents [OSTI]

    Hohorst, Frederick A. (Idaho Falls, ID)

    1995-12-05T23:59:59.000Z

    A method for determining the corrosion behavior of a material with respect to a medium in contact with the material by: implanting a substantially chemically inert gas in a matrix so that corrosion experienced by the material causes the inert gas to enter the medium; placing the medium in contact with the material; and measuring the amount of inert gas which enters the medium. A test sample of a material whose resistance to corrosion by a medium is to be tested, composed of: a body of the material, which body has a surface to be contacted by the medium; and a substantially chemically inert gas implanted into the body to a depth below the surface. A test sample of a material whose resistance to corrosion by a medium is to be tested, composed of: a substrate of material which is easily corroded by the medium, the substrate having a surface; a substantially chemically inert gas implanted into the substrate; and a sheet of the material whose resistance to corrosion is to be tested, the sheet being disposed against the surface of the substrate and having a defined thickness.

  7. Mining Test Cases To Improve Software Maintenance

    E-Print Network [OSTI]

    Ziftci, Celal

    Finding TestTracing Features to Test Cases . . . . . . . . . . . . . . .5.4.2 Finding Test Intents Using

  8. Bone Implant Interface Investigation by Synchrotron Radiation X-Ray Microfluorescence

    SciTech Connect (OSTI)

    Calasans-Maia, M. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Sales, E.; Lopes, R. T. [Nuclear Instrumentation Laboratory-PEN/COPPE, Federal Univeristy of Rio de Janeiro, Rio de Janeiro 21941-914, RJ (Brazil); Granjeiro, J. M. [Department of Cell and Molecular Biology, Fluminense Federal University, Niteroi 24030-900, RJ (Brazil); Lima, I. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Department of Mechanical Engineering and Energy, Rio de Janeiro State University, Regional Campus-Polytechnic Institute-Alberto Rangel, s/n, Vila Nova, room 308, 28630-050, Nova Friburgo, RJ (Brazil)

    2010-04-06T23:59:59.000Z

    Zinc is known to play a relevant role in growth and development; it has stimulatory effects on in vitro and in vivo bone formation and an inhibitory effect on in vitro osteoclastic bone resorption. The inorganic component of the bone tissue is nonstoichiometric apatite; changes in the composition of hidroxyapatite are subject of studies in order to improve the tissue response after implantation. The objective of this study was to investigate the effect of 0.5% zinc-containing hydroxyapatite in comparison to hydroxyapatite on osseous repair of rabbit's tibia. Cylinders (2x6 mm) of both materials were produced according to the specification of the International Organization for Standardization. Ethics Commission on Teaching and Research in Animals approved this project (HUAP-195/06). Fifteen White New Zealand rabbits were submitted to general anesthesia and two perforations (2 mm) were made in each tibia for implantation of zinc-containing hydroxyapatite cylinders (left tibia) and hydroxyapatite cylinders (right tibia). After 1, 2 and 4 weeks, the animals were killed and one fragment of each tibia with the cylinder was collected and embedded in a methacrylate-based resin and cut into slices (approx200 {mu}m thickness), parallel to the implant's long axis with a precision diamond saw for Synchrotron Radiation X-ray Microfluorescence investigation. The accomplishment of the standard procedures helped the planning, execution and the comparative analysis of the results. The chemical and physical properties of the biomaterials were modified after its implantation and the incorporation of zinc. Both materials are biocompatible and promote osteoconduction and favored bone repair.

  9. The Relation of Lime and Phosphoric Acid to the Growth and Bone Development of White Rats.

    E-Print Network [OSTI]

    Blum, J. K. (Joseph Kelly)

    1931-01-01T23:59:59.000Z

    LIBRARY, A & M COLLEGE. CAMPUS. TEXAS AGRICULTURAL EXPERIMENT STATION A. B. CONNER, DIRECTOR College Station, Brazos County, Texas BULLETIN NO. 441 DECEMBER, 1931 DIVISION OF CHEMISTRY The Relation of Lime and Phosphoric Acid to the Growth... and Bone Development of White Rats 2 ., .t .I* .-. /.' AGRICULTURAL AND MECHANICAL COLLEGE OF TEXAS--. .. T. 0. WALTON, President ..- STATION STAFF+ ADMINISTRATION: VETERINARY SCIENCE: A B. CONNER M S. Director *M. FRANCIS, D. V. M., Chief. R: E...

  10. Automatic detection of bone fragments in poultry using multi-energy x-rays

    DOE Patents [OSTI]

    Gleason, Shaun S. (Knoxville, TN); Paulus, Michael J. (Knoxville, TN); Mullens, James A. (Knoxville, TN)

    2002-04-09T23:59:59.000Z

    At least two linear arrays of x-ray detectors are placed below a conveyor belt in a poultry processing plant. Multiple-energy x-ray sources illuminate the poultry and are detected by the detectors. Laser profilometry is used to measure the poultry thickness as the x-ray data is acquired. The detector readout is processed in real time to detect the presence of small highly attenuating fragments in the poultry, i.e., bone, metal, and cartilage.

  11. Functional Interference Clusters in Cancer Patients With Bone Metastases: A Secondary Analysis of RTOG 9714

    SciTech Connect (OSTI)

    Chow, Edward, E-mail: Edward.Chow@sunnybrook.c [Odette Cancer Centre, Toronto, ON (Canada); James, Jennifer [RTOG Statistical Center, Philadelphia, PA (United States); Barsevick, Andrea [Fox Chase Cancer Center, Cheltenham, PA (United States); Hartsell, William [Good Samaritan Cancer Center, Downers Grove, IL (United States); Ratcliffe, Sarah [University of Pennsylvania School of Medicine, Philadelphia, PA (United States); Scarantino, Charles [Rex Healthcare Cancer Center, Raleigh, NC (United States); Ivker, Robert [Newark Beth Israel Medical Center, Newark, NJ (Israel); Roach, Mack [UCSF Comprehensive Cancer Center, San Francisco, CA (United States); Suh, John [Cleveland Clinic Foundation, Cleveland, OH (United States); Petersen, Ivy [Mayo Clinic, Rochester, MN (United States); Konski, Andre [Fox Chase Cancer Center, Cheltenham, PA (United States); Demas, William [Akron City Hospital Cancer Care Center, Inc., Akron, OH (United States); Bruner, Deborah [Abramson Cancer Center, Philadelphia, PA (United States)

    2010-04-15T23:59:59.000Z

    Purpose: To explore the relationships (clusters) among the functional interference items in the Brief Pain Inventory (BPI) in patients with bone metastases. Methods: Patients enrolled in the Radiation Therapy Oncology Group (RTOG) 9714 bone metastases study were eligible. Patients were assessed at baseline and 4, 8, and 12 weeks after randomization for the palliative radiotherapy with the BPI, which consists of seven functional items: general activity, mood, walking ability, normal work, relations with others, sleep, and enjoyment of life. Principal component analysis with varimax rotation was used to determine the clusters between the functional items at baseline and the follow-up. Cronbach's alpha was used to determine the consistency and reliability of each cluster at baseline and follow-up. Results: There were 448 male and 461 female patients, with a median age of 67 years. There were two functional interference clusters at baseline, which accounted for 71% of the total variance. The first cluster (physical interference) included normal work and walking ability, which accounted for 58% of the total variance. The second cluster (psychosocial interference) included relations with others and sleep, which accounted for 13% of the total variance. The Cronbach's alpha statistics were 0.83 and 0.80, respectively. The functional clusters changed at week 12 in responders but persisted through week 12 in nonresponders. Conclusion: Palliative radiotherapy is effective in reducing bone pain. Functional interference component clusters exist in patients treated for bone metastases. These clusters changed over time in this study, possibly attributable to treatment. Further research is needed to examine these effects.

  12. An experimental study of diffusional properties of small ions and nonelectrolytes in compact bone 

    E-Print Network [OSTI]

    Bilge, Huseyin Fertac

    1978-01-01T23:59:59.000Z

    in mineralized tissue is lacking, and no direct measurement of the diffusion coefficient in bone has been reported. RESEARCH OBJECTIVES The overall objective of this investigation was to experimentally determine selected passive mass transport properties... The objective of the research reported was tn determine the diffu- sion coefficients of Na , urea, and glucose and permeability of water through compact hone. The methodology used involved construction of diffusion cells for controlled diffusion...

  13. Growth and bone development in weanling quarter horses fed diets supplemented with sodium zeolite-A

    E-Print Network [OSTI]

    Frey, Kimberly Suzanne

    1991-01-01T23:59:59.000Z

    ) possibly due to SZA's high ion-exchange capabilities (Roland, 1985; Miles, 1986); however, natural zeolites have not been shown to improve egg shell quality especially in diets low in calcium (Nakaue and Koelliker, 1981). This could be due...GROWTH AND BONE DEVELOPMENT IN WEANLING QUARTER HORSES FED DIETS SUPPLEMENTED WITH SODIUM ZEOLITE-A A Thesis by KIMBERLY SUZANNE FREY Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

  14. Impact Tensile Testing of Stainless Steels at Various Temperatures

    SciTech Connect (OSTI)

    D. K. Morton

    2008-03-01T23:59:59.000Z

    Stainless steels are used for the construction of numerous spent nuclear fuel or radioactive material containers that may be subjected to high strains and moderate strain rates during accidental drop events. Mechanical characteristics of these base materials and their welds under dynamic loads in the strain rate range of concern (1 to 300 per second) are not well documented. However, research is being performed at the Idaho National Laboratory to quantify these characteristics. The work presented herein discusses tensile impact testing of dual-marked 304/304L and 316/316L stainless steel material specimens. Both base material and welded material specimens were tested at -20 oF, room temperature, 300 oF, and 600 oF conditions. Utilizing a drop weight impact test machine and 1/4-inch and 1/2-inch thick dog bone-shaped test specimens, a strain rate range of approximately 4 to 40 per second (depending on initial temperature conditions) was achieved. Factors were determined that reflect the amount of increased strain energy the material can absorb due to strain rate effects. Using the factors, elevated true stress-strain curves for these materials at various strain rates and temperatures were generated. By incorporating the strain rate elevated true stress-strain material curves into an inelastic finite element computer program as the defined material input, significant improvement in the accuracy of the computer analyses was attained. However, additional impact testing is necessary to achieve higher strain rates (up to 300 per second) before complete definition of strain rate effects can be made for accidental drop events and other similar energy-limited impulsive loads. This research approach, using impact testing and a total energy analysis methodology to quantify strain rate effects, can be applied to many other materials used in government and industry.

  15. Immunization with FSH? fusion protein antigen prevents bone loss in a rat ovariectomy-induced osteoporosis model

    SciTech Connect (OSTI)

    Geng, Wenxin; Yan, Xingrong; Du, Huicong; Cui, Jihong; Li, Liwen, E-mail: liven@nwu.edu.cn; Chen, Fulin, E-mail: chenfl@nwu.edu.cn

    2013-05-03T23:59:59.000Z

    Highlights: •A GST-FSH fusion protein was successfully expressed in E. coli. •Immunization with GST-FSH antigen can raise high-titer anti-FSH polyclonal sera. •Anti-FSH polyclonal sera can neutralize osteoclastogenic effect of FSH in vitro. •FSH immunization can prevent bone loss in a rat osteoporosis model. -- Abstract: Osteoporosis, a metabolic bone disease, threatens postmenopausal women globally. Hormone replacement therapy (HTR), especially estrogen replacement therapy (ERT), is used widely in the clinic because it has been generally accepted that postmenopausal osteoporosis is caused by estrogen deficiency. However, hypogonadal ? and ? estrogen receptor null mice were only mildly osteopenic, and mice with either receptor deleted had normal bone mass, indicating that estrogen may not be the only mediator that induces osteoporosis. Recently, follicle-stimulating hormone (FSH), the serum concentration of which increases from the very beginning of menopause, has been found to play a key role in postmenopausal osteoporosis by promoting osteoclastogenesis. In this article, we confirmed that exogenous FSH can enhance osteoclast differentiation in vitro and that this effect can be neutralized by either an anti-FSH monoclonal antibody or anti-FSH polyclonal sera raised by immunizing animals with a recombinant GST-FSH? fusion protein antigen. Moreover, immunizing ovariectomized rats with the GST-FSH? antigen does significantly prevent trabecular bone loss and thereby enhance the bone strength, indicating that a FSH-based vaccine may be a promising therapeutic strategy to slow down bone loss in postmenopausal women.

  16. ONTOLOGY OF TEST Larisa Soldatova

    E-Print Network [OSTI]

    Mizoguchi, Riichiro

    ONTOLOGY OF TEST Larisa Soldatova Post doctoral researcher Riichiro Mizoguchi Professor ISIR, Osaka In the present paper design of test generation systems (TGS) based on test ontology and student's knowledge model parts: domain independent- and domain-dependant knowledge. Suggested test ontology allows analyzing test

  17. RF test bench automation Description

    E-Print Network [OSTI]

    Dobigeon, Nicolas

    RF test bench automation Description: Callisto would like to implement automated RF test bench. Three RF test benches have to be studied and automated: LNA noise temperature test bench LNA gain phase of the test benches and an implementation of the automation phase. Tasks: Noise temperature

  18. Advanced Vehicle Testing Activity (AVTA) - Vehicle Testing and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Vehicle Testing Activity (AVTA) Non-PHEV Evaluations and Data Collection AVTA HEV, NEV, BEV and HICEV Demonstrations and Testing Benchmarking of Advanced HEVs and...

  19. ROCKY MOUNTAIN OILFIELD TESTING CENTER PROJECT TEST RESULTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MOUNTAIN OILFIELD TESTING CENTER MAG-WELL DOWNHOLE MAGNETIC FLUID CONDITIONERS PROJECT TEST RESULTES Prepared for: Industry Publication Prepared by: MICHAEL R. TYLER RMOTC Field...

  20. Test Facility Daniil Stolyarov, Accelerator Test Facility User...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Development of the Solid-State Laser System for the Accelerator Test Facility Daniil Stolyarov, Accelerator Test Facility User's Meeting April 3, 2009 Outline Motivation for...

  1. ROCKY MOUNTAIN OILFIELD TESTING CENTER PROJECT TEST RESULTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    JANUARY 27, 1998 Report No. RMOTC97PT22 ROCKY MOUNTAIN OILFIELD TESTING CENTER PROJECT TEST RESULTS PETRO-PLUG BENTONITE PLUGGING Prepared for: INDUSTRY PUBLICATION Prepared by:...

  2. ROCKY MOUNTAIN OILFIELD TESTING CENTER PROJECT TEST RESULTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    FEBRUARY 19, 1997 FC9532 95EC1 ROCKY MOUNTAIN OILFIELD TESTING CENTER AJUST A PUMP TEST Rosemond Manufacturing, Inc. (RMI) Prepared for: INDUSTRY PUBLICATION Prepared by:...

  3. Soil Remediation Test

    SciTech Connect (OSTI)

    Manlapig, D. M.; Williamsws

    2002-04-01T23:59:59.000Z

    Soils contaminated with petroleum by-products can now be effectively remediated using a variety of technologies. Among these are in-situ bioremediation, land farming, and landfill/replacing of soil. The range of efficiencies and cost effectiveness of these technologies has been well documented. Exsorbet Plus is showing promise as an in-situ bioremediation agent. It is made of naturally grown Spaghnum Peat Moss which has been activated for encapsulation and blended with nitrogen-rich fertilizer. In its initial field test in Caracas, Venezuela, it was able to remediate crude oil-contaminated soil in 90 days at less than half of the cost of competing technologies. Waste Solutions, Corp and the US Department of Energy signed a Cooperative Research and Development Agreement to test Exsorbet Plus at the Rocky Mountain Oilfield Testing Center near Casper, Wyoming. As part of the test, soil contaminated with crude oil was treated with Exsorbet Plus to aid the in-situ bioremediation process. Quantitative total petroleum hydrocarbon (TPH) measurements were acquired comparing the performance of Exsorbet Plus with an adjacent plot undergoing unaided in-situ bioremediation.

  4. Audiometry (hearing test)

    Broader source: Energy.gov [DOE]

    The audiogram is an evaluation of how well an individual can hear. Sounds are presented to the individual through earphones during the test. These sounds are presented at different levels of frequency and intensity. The human ear responds to the frequency or pitch of a sound and the intensity or loudness of the sound.

  5. Solutions to Test 3

    E-Print Network [OSTI]

    jeffb_000

    2014-04-05T23:59:59.000Z

    April 5, 2014. Math 373. Test 3. Fall 2013. November 7, 2013. 1. You are given the following spot interest rate curve: Time t. Spot Rate tr. 0.5. 3.2%. 1.0. 3.5%. 1.5.

  6. Micromachine friction test apparatus

    DOE Patents [OSTI]

    deBoer, Maarten P. (Albuquerque, NM); Redmond, James M. (Albuquerque, NM); Michalske, Terry A. (Cedar Crest, NM)

    2002-01-01T23:59:59.000Z

    A microelectromechanical (MEM) friction test apparatus is disclosed for determining static or dynamic friction in MEM devices. The friction test apparatus, formed by surface micromachining, is based on a friction pad supported at one end of a cantilevered beam, with the friction pad overlying a contact pad formed on the substrate. A first electrostatic actuator can be used to bring a lower surface of the friction pad into contact with an upper surface of the contact pad with a controlled and adjustable force of contact. A second electrostatic actuator can then be used to bend the cantilevered beam, thereby shortening its length and generating a relative motion between the two contacting surfaces. The displacement of the cantilevered beam can be measured optically and used to determine the static or dynamic friction, including frictional losses and the coefficient of friction between the surfaces. The test apparatus can also be used to assess the reliability of rubbing surfaces in MEM devices by producing and measuring wear of those surfaces. Finally, the friction test apparatus, which is small in size, can be used as an in situ process quality tool for improving the fabrication of MEM devices.

  7. Testing the AVNG

    SciTech Connect (OSTI)

    Thron, Jonathan Louis [Los Alamos National Laboratory; Mac Arthur, Duncan W [Los Alamos National Laboratory; Kondratov, Sergey [VNIIEF; Livke, Alexander [VNIIEF; Razinkov, Sergey [VNIIEF

    2010-01-01T23:59:59.000Z

    An attribute measurement system (AMS) measures a number of unclassified attributes of potentially classified material. By only displaying these unclassified results as red or green lights, the AMS protects potentially classified information while still generating confidence in the measurement result. The A VNG implementation that we describe is an AMS built by RFNC - VNIIEF in Sarov, Russia. The AVNG detects neutron and gamma radiation signatures and displays the three unclassified attributes of 'plutonium presence,' 'plutonium mass > 2 kg,' and 'plutonium isotopic ratio ({sup 240}Pu to {sup 239}Pu) < 0.1.' Prior to demonstration to a joint US/Russian audience, the overall operation and thresholds of the AVNG were tested using a number of multi-kg plutonium reference material (RM) sources manufactured for this purpose. As the AVNG was designed to incorporate an open mode (where all radiation data was displayed) as well as a secure mode (where only the red/green attribute lights were visible), the AVNG was tested in both modes. We will present data from these tests using unclassified plutonium RM sources as well as detector test results obtained using smaller calibration sources.

  8. Transition-fault test generation

    E-Print Network [OSTI]

    Cobb, Bradley Douglas

    2013-02-22T23:59:59.000Z

    . One way to detect these timing defects is to apply test patterns to the integrated circuit that are generated using the transition-fault model. Unfortunately, industry's current transition-fault test generation schemes produce test sets that are too...

  9. Copyright (c) Cem Kaner, Automated Testing. 1 Software Test Automation:Software Test Automation

    E-Print Network [OSTI]

    Copyright (c) Cem Kaner, Automated Testing. 1 Software Test Automation:Software Test Automation: A RealA Real--World ProblemWorld Problem Cem Kaner, Ph.D., J.D. #12;Copyright (c) Cem Kaner, Automated Testing. 2 This TalkThis Talk The most widely used class of automated testing tools leads senior software

  10. GAP TESTS; COMPARISON BETWEEN UN GAP TEST AND CARD GAP TEST

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    98-36 GAP TESTS; COMPARISON BETWEEN UN GAP TEST AND CARD GAP TEST by R. BRANKA and C. MICHOT, FRANCE (tel.: 33 3 44 55 65 19, fax: 33 3 44 55 65 10) ABSTRACT: UN gap test, type 1(a) or 2(a), is the recommended test in the acceptance procedure for transport of explosives in class 1. Up to the revision

  11. ADVANCED COATINGS LAB EQUIPMENT & TESTING

    E-Print Network [OSTI]

    ­ Exposure Testing, Filiform Corrosion · Ovens · Low Temperature Freezer · Thermal Cyclic Chamber · Solar and conical · Adhesion Test Kits · Water Immersion Bath · Dry Film Thickness ­ Magnetic Induction, Eddy

  12. SPECTR System Operational Test Report

    SciTech Connect (OSTI)

    W.H. Landman Jr.

    2011-08-01T23:59:59.000Z

    This report overviews installation of the Small Pressure Cycling Test Rig (SPECTR) and documents the system operational testing performed to demonstrate that it meets the requirements for operations. The system operational testing involved operation of the furnace system to the design conditions and demonstration of the test article gas supply system using a simulated test article. The furnace and test article systems were demonstrated to meet the design requirements for the Next Generation Nuclear Plant. Therefore, the system is deemed acceptable and is ready for actual test article testing.

  13. Turing test: an historical perspective

    SciTech Connect (OSTI)

    Ahl, D.H.

    1983-08-01T23:59:59.000Z

    This article explains the turing test of machine intelligence. This test has become the accepted criteria for defining a computer as truly intelligent.

  14. Age-related changes in the plasticity and toughness of human cortical bone at multiple length-scales

    SciTech Connect (OSTI)

    Zimmermann, Elizabeth A.; Schaible, Eric; Bale, Hrishikesh; Barth, Holly D.; Tang, Simon Y.; Reichert, Peter; Busse, Bjoern; Alliston, Tamara; Ager III, Joel W.; Ritchie, Robert O.

    2011-08-10T23:59:59.000Z

    The structure of human cortical bone evolves over multiple length-scales from its basic constituents of collagen and hydroxyapatite at the nanoscale to osteonal structures at nearmillimeter dimensions, which all provide the basis for its mechanical properties. To resist fracture, bone’s toughness is derived intrinsically through plasticity (e.g., fibrillar sliding) at structural-scales typically below a micron and extrinsically (i.e., during crack growth) through mechanisms (e.g., crack deflection/bridging) generated at larger structural-scales. Biological factors such as aging lead to a markedly increased fracture risk, which is often associated with an age-related loss in bone mass (bone quantity). However, we find that age-related structural changes can significantly degrade the fracture resistance (bone quality) over multiple lengthscales. Using in situ small-/wide-angle x-ray scattering/diffraction to characterize sub-micron structural changes and synchrotron x-ray computed tomography and in situ fracture-toughness measurements in the scanning electron microscope to characterize effects at micron-scales, we show how these age-related structural changes at differing size-scales degrade both the intrinsic and extrinsic toughness of bone. Specifically, we attribute the loss in toughness to increased non-enzymatic collagen cross-linking which suppresses plasticity at nanoscale dimensions and to an increased osteonal density which limits the potency of crack-bridging mechanisms at micron-scales. The link between these processes is that the increased stiffness of the cross-linked collagen requires energy to be absorbed by “plastic” deformation at higher structural levels, which occurs by the process of microcracking.

  15. Test fire environmental testing operations at Mound Applied Technologies

    SciTech Connect (OSTI)

    NONE

    1992-03-01T23:59:59.000Z

    This paper describes Mound Laboratory`s environmental testing operations. The function of environmental testing is to perform quality environmental (thermal, mechanical, spin, resistance, visual) testing/conditioning of inert/explosive products to assure their compliance with specified customer acceptance criteria. Capabilities, organization, equipment specifications, and test facilities are summarized.

  16. Test Access Mechanism Optimization, Test Scheduling, and Tester Data Volume

    E-Print Network [OSTI]

    Chakrabarty, Krishnendu

    Test Access Mechanism Optimization, Test Scheduling, and Tester Data Volume Reduction for System Marinissen, Senior Member, IEEE Abstract--We describe an integrated framework for system-on-chip (SOC) test automation. Our framework is based on a new test access mechanism (TAM) architecture consisting of flexible

  17. INVERSE-SQUARE LAW TESTS 1 TESTS OF THE GRAVITATIONAL

    E-Print Network [OSTI]

    Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group

    INVERSE-SQUARE LAW TESTS 1 TESTS OF THE GRAVITATIONAL INVERSE-SQUARE LAW E.G.Adelberger, B-1560 KEYWORDS: gravitation, experimental tests of inverse-square law, quantum gravity, extra dimensions ABSTRACT: We review recent experimental tests of the gravitational inverse-square law, and the wide variety

  18. Sparkr Blade Test Centre Static tests of wind turbine blades

    E-Print Network [OSTI]

    Sparkær Blade Test Centre Static tests of wind turbine blades Static blade tests are performed down- and up-wind direction, and in the rotor thrust direction and opposite to that, respectively-4000 Roskilde Denmark www.risoe.dk Wind Energy Department Sparkær Blade test Centre vea@risoe.dk Tel

  19. Test factoring with amock: generating readable unit tests from system tests

    E-Print Network [OSTI]

    Glasser, David Samuel

    2007-01-01T23:59:59.000Z

    Automated unit tests are essential for the construction of reliable software, but writing them can be tedious. If the goal of test generation is to create a lasting unit test suite (and not just to optimize execution of ...

  20. Semiconductor Bridge Cable Test

    SciTech Connect (OSTI)

    KING, TONY L.

    2002-01-01T23:59:59.000Z

    The semiconductor bridge (SCB) is an electroexplosive device used to initiate detonators. A C cable is commonly used to connect the SCB to a firing set. A series of tests were performed to identify smaller, lighter cables for firing single and multiple SCBs. This report provides a description of these tests and their results. It was demonstrated that lower threshold voltages and faster firing times can be achieved by increasing the wire size, which reduces ohmic losses. The RF 100 appears to be a reasonable substitute for C cable when firing single SCBs. This would reduce the cable volume by 68% and the weight by 67% while increasing the threshold voltage by only 22%. In general, RG 58 outperforms twisted pair when firing multiple SCBs in parallel. The RG 58's superior performance is attributed to its larger conductor size.

  1. Assessment of trabecular bone structure using MDCT: comparison of 64- and 320-slice CT using HR-pQCT as the reference standard

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    slice MDCT . HR-pQCT . Osteoporosis . Structure analysis .bone Introduction Osteoporosis is defined as a systemicmethod in current osteoporosis diagnosis is the assessment

  2. Testing Bulls for Fertility.

    E-Print Network [OSTI]

    Berry, R. O.; Thompson, U. D.; Sorensen, A. M.; Maddox, L. A. Jr.

    1958-01-01T23:59:59.000Z

    , but this seasonal dif- ference is not shown by the survey. However, there is a trend toward lower fertility in late summer if the questionable bulls are included with the cull bulls. funnel which reduces breakage and hjui The reproductive organs should... OF THE TESTS --------_-_ 6 Sa~isfactor~ ............................ 6 Questionable ........................... 6 Cull ................................... 6 WHEN TO CHECK FOR FERTILITY -_-_-_----_-- 6 Just Before the Breeding Season ----_--_-_- 6 Soon...

  3. Photomultiplier Tube Testing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for RenewableSpeedingBiomassPPPOPetroleum Reserves Vision,4 Photomultiplier Tube Testing

  4. LCLS Undulator Test Plan

    SciTech Connect (OSTI)

    Wolf, Zachary

    2010-11-24T23:59:59.000Z

    This note presents the test plan for the LCLS undulators. The undulators will be measured and tuned in the Magnetic Measurement Facility at SLAC. The requirements for tuning are well established and are summarized. A brief discussion of the measurement equipment is presented. This is followed by the detailed test plan in which each step is enumerated. Finally, the measurement results and storage format are presented. The LCLS consists of 33 undulator segments, hereafter referred to as undulators, plus 6 spares and one reference undulator. The undulators must be tuned to meet strict requirements. They must also be fiducialized to allow alignment with other components. This note details the plan for tuning and fiducializing the LCLS undulators. The note begins with the list of tuning and fiducialization requirements. The laboratory in which the work will be performed and the relevant equipment is then briefly described. This is followed by a detailed test plan in which all the steps of tuning and fiducialization are enumerated.

  5. Simultaneous high-temperature removal of alkali and particulates in a pressurized gasification system. Final technical progress report, April 1981-July 1983

    SciTech Connect (OSTI)

    Mulik, P.R.; Alvin, M.A.; Bachovchin, D.M.

    1983-09-01T23:59:59.000Z

    This program is directed at performing experimental and analytical investigations, deriving system designs, and estimating costs to ascertain the feasibility of using aluminosilicate-based getters for controlling alkali in pressurized gasification systems. Its overall objective is to develop a plan for evaluating a scaled-up version of the gettering process as a unit operation or as an integral part of a particulate removal device. This report describes work completed on the four technical program tasks: Thermodynamic projections; Getter Selection and Qualification; System Performance Projections; and Program Definition for Concept Scale-up during the 27-month contract performance period. Work completed on the thermodynamic projections includes a data base update, development of alkali phase diagrams, and system performance projections. Getter selection and qualification efforts involved over 70 kinetic studies in which a leading candidate getter - emathlite - was selected and characterized. System performance projections identified a packed-bed configuration containing relatively large getter pellets as the preferred contacting device for a full-scale unit. For emathlite, we concluded that full-scale unit bed heights of 2 m or less would be required if we assume annual replacement on the basis of bed saturation capacity. Concept scale-up work involved defining the hardware and test program requirements for further development of the emathlite packed-bed system. 56 references, 80 figures, 74 tables.

  6. Developing the Right Test Documentation

    E-Print Network [OSTI]

    and managing testing and test documentation. Over the past 17 years, we have criticized IEEE standard 829 (onDeveloping the Right Test Documentation Cem Kaner, J.D., Ph.D. Department of Computer Sciences Quality Conference #12;2Test Documentation Copyright © 2001 Cem Kaner and James Bach. All rights reserved

  7. Advanced Vehicle Testing and Evaluation

    SciTech Connect (OSTI)

    Garetson, Thomas

    2013-03-31T23:59:59.000Z

    The objective of the United States (U.S.) Department of Energy?s (DOEs) Advanced Vehicle Testing and Evaluation (AVTE) project was to provide test and evaluation services for advanced technology vehicles, to establish a performance baseline, to determine vehicle reliability, and to evaluate vehicle operating costs in fleet operations. Vehicles tested include light and medium-duty vehicles in conventional, hybrid, and all-electric configurations using conventional and alternative fuels, including hydrogen in internal combustion engines. Vehicles were tested on closed tracks and chassis dynamometers, as well as operated on public roads, in fleet operations, and over prescribed routes. All testing was controlled by procedures developed specifically to support such testing. Testing and evaluations were conducted in the following phases: ? Development of test procedures, which established testing procedures; ? Baseline performance testing, which established a performance baseline; ? Accelerated reliability testing, which determined vehicle reliability; ? Fleet testing, used to evaluate vehicle economics in fleet operation, and ? End of test performance evaluation. Test results are reported by two means and posted by Idaho National Laboratory (INL) to their website: quarterly progress reports, used to document work in progress; and final test reports. This final report documents work conducted for the entirety of the contract by the Clarity Group, Inc., doing business as ECOtality North America (ECOtality). The contract was performed from 1 October 2005 through 31 March 2013. There were 113 light-duty on-road (95), off-road (3) and low speed (15) vehicles tested.

  8. Hydroshear Simulation Lab Test 2

    SciTech Connect (OSTI)

    Bauer, Steve

    2014-08-01T23:59:59.000Z

    This data file is for test 2. In this test a sample of granite with a pre cut (man made fracture) is confined, heated and differential stress is applied. max temperature in this this system development test is 95C. test details on the spreadsheets--note thta there are 2 spreadsheets

  9. Hydroshear Simulation Lab Test 2

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Bauer, Steve

    This data file is for test 2. In this test a sample of granite with a pre cut (man made fracture) is confined, heated and differential stress is applied. max temperature in this this system development test is 95C. test details on the spreadsheets--note thta there are 2 spreadsheets

  10. Fusion Test Facilities John Sheffield

    E-Print Network [OSTI]

    Fusion Test Facilities John Sheffield ISSE - University of Tennessee FPA meeting Livermore December Stambaugh, and their colleagues #12;Destructive Testing · It is common practice to test engineered components to destruction prior to deployment of a system e.g., - Automobile crash tests - Airplane wing

  11. Micro-tensile testing system

    DOE Patents [OSTI]

    Wenski, Edward G.

    2006-01-10T23:59:59.000Z

    A micro-tensile testing system providing a stand-alone test platform for testing and reporting physical or engineering properties of test samples of materials having thicknesses of approximately between 0.002 inch and 0.030 inch, including, for example, LiGA engineered materials. The testing system is able to perform a variety of static, dynamic, and cyclic tests. The testing system includes a rigid frame and adjustable gripping supports to minimize measurement errors due to deflection or bending under load; serrated grips for securing the extremely small test sample; high-speed laser scan micrometers for obtaining accurate results; and test software for controlling the testing procedure and reporting results.

  12. Micro-tensile testing system

    DOE Patents [OSTI]

    Wenski, Edward G. (Lenexa, KS)

    2007-07-17T23:59:59.000Z

    A micro-tensile testing system providing a stand-alone test platform for testing and reporting physical or engineering properties of test samples of materials having thicknesses of approximately between 0.002 inch and 0.030 inch, including, for example, LiGA engineered materials. The testing system is able to perform a variety of static, dynamic, and cyclic tests. The testing system includes a rigid frame and adjustable gripping supports to minimize measurement errors due to deflection or bending under load; serrated grips for securing the extremely small test sample; high-speed laser scan micrometers for obtaining accurate results; and test software for controlling the testing procedure and reporting results.

  13. Micro-tensile testing system

    DOE Patents [OSTI]

    Wenski, Edward G. (Lenexa, KS)

    2007-08-21T23:59:59.000Z

    A micro-tensile testing system providing a stand-alone test platform for testing and reporting physical or engineering properties of test samples of materials having thicknesses of approximately between 0.002 inch and 0.030 inch, including, for example, LiGA engineered materials. The testing system is able to perform a variety of static, dynamic, and cyclic tests. The testing system includes a rigid frame and adjustable gripping supports to minimize measurement errors due to deflection or bending under load; serrated grips for securing the extremely small test sample; high-speed laser scan micrometers for obtaining accurate results; and test software for controlling the testing procedure and reporting results.

  14. Expression of T cell antigen receptor genes in the thymus of irradiated mice after bone marrow transplantation

    SciTech Connect (OSTI)

    Matsuzaki, G.; Yoshikai, Y.; Kishihara, K.; Nomoto, K.

    1988-01-15T23:59:59.000Z

    Sequential appearance of the expression of T cell antigen receptor genes was investigated in the thymus of irradiated mice at the early stage after transplantation of Thy-1 congeneic H-2 compatible allogeneic bone marrow cells. The first cells to repopulate the thymus on day 7 after bone marrow transplantation were intrathymic radioresistant T cell precursors, which expanded mainly to CD4+CD8+ host-type thymocytes by day 14. A high level of gamma gene expression but a much reduced level of alpha and beta gene expression were detected in the host-type thymocytes on day 7. During regeneration of these cells, gamma-chain messages fell to low level and alpha and beta mRNA levels increased. The thymus of the recipients began to be repopulated by donor-derived T cells about 2 wk after bone marrow transplantation and was almost completely replaced by the third week. An ordered expression of gamma then beta and alpha-chain gene transcript was also observed in the donor-type thymocytes at the early stage after bone marrow transplantation. The use of thymocytes at early stage in whole-body irradiated bone marrow chimera provides a pertinent source for investigating the molecular mechanism of T cell differentiation in adult thymus.

  15. Pressure tube testing test plan document production assurance program

    SciTech Connect (OSTI)

    Zaloudek, F.R. [Pacific Northwest Lab., Richland, WA (United States); Ruff, E.S. [UNC Nuclear Industries, Richland, WA (United States)

    1986-04-01T23:59:59.000Z

    UNC Nuclear Industries (UNC) has initiated a plan for the manufacture of zirconium alloy pressure tubes required for the future operation of N-Reactor. As part of this plan, UNC is establishing a program to qualify and develop a manufacturing process capable of fabricating these pressure tubes to the requirements of UNC specification HWS 6502, REV 4, Amendment 1. The objective of the task described in this test plan is to support the UNC program by performing physical/chemical testing on prototype tubes sections produced or procured during FY-1986, 1987 and 1988 and to test samples from production runs after 1988 as may be required. The types of tests included in this pressure tube testing task will be as follows: (1) Tensile tests; (2) Burst testing; (3) Tests to evaluate fracture properties; (4) Corrosion tests; (5) Spectrographic analysis of chemical composition; (6) Metallographic evaluation of grain size and oxide layer thickness.

  16. X-band EPR imaging as a tool for gradient dose reconstruction in irradiated bones

    SciTech Connect (OSTI)

    Leveque, Philippe; Godechal, Quentin; Bol, Anne; Trompier, Francois; Gallez, Bernard [Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Molecular Imaging and Experimental Radiotherapy Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Institut de Surete Nucleaire et de Radioprotection, F-92262 Fontenay-aux-Roses (France); Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium)

    2009-09-15T23:59:59.000Z

    Purpose: Various tools are currently available for dose reconstruction in individuals after accidental exposure to ionizing radiation. Among the available biological analyses, Monte Carlo simulations, and biophysical methods, such as electron paramagnetic resonance (EPR), the latter has proved its usefulness for retrospective dosimetry. Although EPR spectroscopy is probably the most sensitive technique, it does not provide spatial dosimetric data. This information is, however, highly desirable when steep dose gradient irradiations are involved. The purpose of this work was to explore the possibilities of EPR imaging (EPRI) for spatial dose reconstruction in irradiated biological material. Methods: X-band EPRI was used to reconstruct ex vivo the relative dose distribution in human bone samples and hydroxyapatite phantoms after irradiation with brachytherapy seeds or x rays. Three situations were investigated: Homogeneous, stepwise gradient, and continuous gradient irradiation. Results: EPRI gave a faithful relative spin density distribution in bone samples and in hydroxyapatite phantoms. Measured dose ratios were in close agreement with the actual delivered dose ratios. EPRI was able to distinguish the dose gradients induced by two different sources ({sup 125}I and {sup 192}Ir). However, the measured spatial resolution of the system was 1.9 mm and this appeared to be a limiting factor. The method could be improved by using new signal postprocessing strategies. Conclusions: This study demonstrates that EPRI can be used to assess the regional relative dose distribution in irradiated bone samples. The method is currently applicable to ex vivo measurements of small size samples with low variation in tissue density but is likely to be adapted for in vivo application using L-band EPRI.

  17. Long-term testing

    SciTech Connect (OSTI)

    Ferber, M.; Graves, G.A. Jr.

    1994-12-31T23:59:59.000Z

    Land-based gas turbines are significantly different from automotive gas turbines in that they are designed to operate for 50,000 h or greater (compared to 5,000--10,000 h). The primary goal of this research is to determine the long-term survivability of ceramic materials for industrial gas turbine applications. Research activities in this program focus on the evaluation of the static tensile creep and stress rupture (SR) behavior of three commercially available structural ceramics which have been identified by the gas turbine manufacturers as leading candidates for use in industrial gas turbines. For each material investigated, a minimum of three temperatures and four stresses will be used to establish the stress and temperature sensitivities of the creep and SR behavior. Because existing data for many candidate structural ceramics are limited to testing times less than 2,000 h, this program will focus on extending these data to times on the order of 10,000 h, which represents the lower limit of operating time anticipated for ceramic blades and vanes in gas turbine engines. A secondary goal of the program will be to investigate the possibility of enhancing life prediction estimates by combining interrupted tensile SR tests and tensile dynamic fatigue tests in which tensile strength is measured as a function of stressing rate. The third goal of this program will be to investigate the effects of water vapor upon the SR behavior of the three structural ceramics chosen for the static tensile studies by measuring the flexural strength as a function of stressing rate at three temperatures.

  18. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis 

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: . Wayn ampson (Co-Chair of Committee) Joanne R. Lupton (Co-Chair of Committee) kfa A. Hog (Member) John E. Bauer ( air of Faculty of Nutrition) Brya . hn (Head... dehydrated within a vacuum by an ethanol gradient of 70 10 to 100'/o over four days, followed by two-24-hour acetone steps, and then embedded in methyl methacrylate. " Using a Jung Polycut E microtome (Leica, Germany), the plastic-embedded bones were...

  19. A parametric analysis of bone fixation plates on fractured equine third metacarpal

    E-Print Network [OSTI]

    Ray, Donald Reagan

    1970-01-01T23:59:59.000Z

    of metallic materials, were also being investigated and tried clinically. The earliesr types of metal plates to be used were made of nickel-steel, iron, or silver (1). These early plates were generally attached to the fractured Numbers in parentheses...A P~TRIC ANALYSIS OI' BONE FIXATION PLATES ON FRACTURED EQUINE THIRD lKTACARPAL A Thesis by Donald Reagan Ray Submitted to tnk Graduate College of Texas A&N University in partial fulfillment of the requirement for the degree of MASTER...

  20. Biochemical markers of bone modeling and remodeling in juvenile racehorses at varying mineral intakes

    E-Print Network [OSTI]

    Eller, Elena Maria

    2007-09-17T23:59:59.000Z

    . Resorption begins with recruitment of preosteoclasts, followed by differentiation into mature osteoclasts that then attach to the skeletal surface (Kleerekoper, 1996). During resorption (or demineralization) mineral is removed from the skeleton creating a... levels in the diet not be allowed to exceed Ca levels as ratios of Ca:P less than 1:1 appear to inhibit Ca absorption (NRC, 1989). Although Mg does not comprise as great a percentage of bone as do both Ca and P, 60% of the Mg in the body 8...