Powered by Deep Web Technologies
Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Geneva, Switzerland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Switzerland: Energy Resources Switzerland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2660646 Coordinates 46.2038099°, 6.1399589° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2038099,"lon":6.1399589,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Daytime microclimatic impacts of the SOVALP project in summer: A case study in Geneva, Switzerland  

Science Journals Connector (OSTI)

The Socit Simple de Valorisation de Terrains Genève-La Praille (SOVALP) project was conceived as a means of providing adequate housing within redevelopment policies during the last decades in Geneva, Switzerland including, among other ... Keywords: ENVI-met, PET, SOVALP, UTCI, microclimate analysis

Flvia Osaku Minella, Eduardo Krger, Susan Honjo, Stphane Goyette, Alexandre Hedjazi



Composition of bacterial and archaeal communities in freshwater sediments with different contamination levels (Lake Geneva, Switzerland)  

Science Journals Connector (OSTI)

The aim of this study was to compare the composition of bacterial and archaeal communities in contaminated sediments (Vidy Bay) with uncontaminated sediments (Ouchy area) of Lake Geneva using 16S rRNA clone libraries. Sediments of both sites were analysed for physicochemical characteristics including porewater composition, organic carbon, and heavy metals. Results show high concentrations of contaminants in sediments from Vidy. Particularly, high contents of fresh organic matter and nutrients led to intense mineralisation, which was dominated by sulphate-reduction and methanogenesis. The bacterial diversity in Vidy sediments was significantly different from the communities in the uncontaminated sediments. Phylogenetic analysis revealed a large proportion of Betaproteobacteria clones in Vidy sediments related to Dechloromonas sp., a group of dechlorinating and contaminant degrading bacteria. Deltaproteobacteria, including clones related to sulphate-reducing bacteria and Fe(III)-reducing bacteria (Geobacter sp.) were also more abundant in the contaminated sediments. The archaeal communities consisted essentially of methanogenic Euryarchaeota, mainly found in the contaminated sediments rich in organic matter. Multiple factor analysis revealed that the microbial community composition and the environmental variables were correlated at the two sites, which suggests that in addition to environmental parameters, pollution may be one of the factors affecting microbial community structure.

Laurence Haller; Mauro Tonolla; Jakob Zopfi; Raffaele Peduzzi; Walter Wildi; John Pot



A Request for Planning Funds for a Research and Study Abroad Facility in Geneva, Switzerland in Affiliation with the European Laboratory for Particle Physics  

SciTech Connect (OSTI)

To create a research and study abroad program that would allow U.S. undergraduate students access to the world-leading research facilities at the European Organization for Nuclear Research (CERN), the World Health Organization, various operations of the United Nations and other international organizations based in Geneva.The proposal is based on the unique opportunities currently existing in Geneva. The Large Hadron Collider (LHC) is now operational at CERN, data are being collected, and research results are already beginning to emerge. At the same time, a related reduction of activity at U.S. facilities devoted to particle physics is expected. In addition, the U.S. higher-education community has an ever-increasing focus on international organizations dealing with world health pandemics, arms control and human rights, a nexus also centered in Geneva.

campbell, myron



SES Switzerland formerly Societe d Energie Solaire SA | Open Energy  

Open Energy Info (EERE)

Switzerland formerly Societe d Energie Solaire SA Switzerland formerly Societe d Energie Solaire SA Jump to: navigation, search Name SES Switzerland (formerly Societe dâ€(tm)Energie Solaire SA) Place Geneva, Switzerland Zip 1228 Product Swiss PV module and silicon cell roof tiles manufacturer, which completed a reverse takeover with OTCBB company Electric Networks.com in June 2006. Coordinates 46.208358°, 6.142701° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.208358,"lon":6.142701,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geneva, Switzerland July 19-23, 2010  

E-Print Network [OSTI]

of Glasgow Mark Sanderson, University of Sheffield Mark Smucker, University of Waterloo Siddharth Suri, Yahoo search relevance evaluation. John Le, Andy Edmonds, Vaughn Hester and Lukas Biewald

Murphy, Robert F.


ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.



Applied Materials Switzerland SA Formerly HCT Shaping Systems SA | Open  

Open Energy Info (EERE)

Switzerland SA Formerly HCT Shaping Systems SA Switzerland SA Formerly HCT Shaping Systems SA Jump to: navigation, search Name Applied Materials Switzerland SA (Formerly HCT Shaping Systems SA) Place Chezeaux, Switzerland Zip 1033 Product Manufacturer of wire saws for the semiconductor and photovoltaic wafer slicing industries. References Applied Materials Switzerland SA (Formerly HCT Shaping Systems SA)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Applied Materials Switzerland SA (Formerly HCT Shaping Systems SA) is a company located in Chezeaux, Switzerland . References ↑ "[ Applied Materials Switzerland SA (Formerly HCT Shaping Systems SA)]" Retrieved from "http://en.openei.org/w/index.php?title=Applied_Materials_Switzerland_SA_Formerly_HCT_Shaping_Systems_SA&oldid=342245"


UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



ECE/TIM/SP/23 Timber Section, Geneva, Switzerland  

E-Print Network [OSTI]

, timber, wood industry, pulp and paper industry, wood fuels, certification, wood products, tropical timber


Good Energies (Switzerland) | Open Energy Information  

Open Energy Info (EERE)

Switzerland) Switzerland) Name Good Energies (Switzerland) Address Grafenauweg 4 Place Zug, Switzerland Zip CH-6301 Product Global investor in renewable energy and energy efficiency industries Year founded 2001 Phone number +41 41 560 66 60 Website http://www.goodenergies.com/ Coordinates 47.1744777°, 8.5134127° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.1744777,"lon":8.5134127,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Switzerland PL Martin Beniston  

E-Print Network [OSTI]

the implications of climate change for important processes occurring in our oceans'depths, Deep- water Project deep-water currents remain relatively unexplored. Any disruption affecting zones of deep-waterDeepwater Project Switzerland PL Martin Beniston Partnership$ Climate change is now widely

Loewith, Robbie


*Corresponding author. Correspondence address: CERN, EP Division, CH-1211 Geneva 23, Switzerland. Tel.: #41-22-  

E-Print Network [OSTI]

of a laser-driven plasma wake"eld accelerator K.A. Assamagan *, W.W. Buck , S.-Y. Chen , R. Ent , R.N. Green , P. Gueye , C. Keppel , G. Mourou , D. Umstadter , R. Wagner Nuclear/High Energy Physics Research employed to produce a table-sized laser with a pulse duration of 400 fs and a maximum energy of 2 J [2

Umstadter, Donald


BroadBand Europe Geneva, Switzerland 11-14 December 2006  

E-Print Network [OSTI]

from countries worldwide that present high broadband penetration rate. The policies adopted broadband penetration rate (such as Greece) However, the high broadband penetration rate cannot alone stand for the emerging digital economy and competitiveness. The current situation concerning the broadband penetration

Bouras, Christos



E-Print Network [OSTI]

, Associate, or Assistant Professor in Energy Efficiency The Faculty of sciences invites applicants for a Full, Associate, or Assistant Professor position on multi-disciplinary aspects related to Energy Efficiency to his/her scientific expertise and at the same time he/she will be housed within the inter

Schibler, Ueli


The CKM matrix and the unitarity triangle. Proceedings, workshop, Geneva, Switzerland, February 13-16, 2002  

SciTech Connect (OSTI)

This report contains the results of the Workshop on the CKM Unitarity Triangle that was held at CERN on 13-16 February 2002. There had been several Workshops on B physics that concentrated on studies at e{sup +}e{sup -} machines, at the Tevatron, or at LHC separately. Here we brought together experts of different fields, both theorists and experimentalists, to study the determination of the CKM matrix from all the available data of K, D, and B physics. The analysis of LEP data for B physics is reaching its end, and one of the goals of the Workshop was to underline the results that have been achieved at LEP, SLC, and CESR. Another goal was to prepare for the transfer of responsibility for averaging B physics properties, that has developed within the LEP community, to the present main actors of these studies, from the B factory and the Tevatron experiments. The optimal way to combine the various experimental and theoretical inputs and to fit for the apex of the Unitarity Triangle has been a contentious issue. A further goal of the Workshop was to bring together the proponents of different fitting strategies, and to compare their approaches when applied to the same inputs. Since lattice QCD plays a very important role in the determination of the non-perturbative parameters needed to constrain the CKM unitarity triangle, the first Workshop was seen as an excellent opportunity to bring together lattice theorists with the aim of establishing a working group to compile averages for phenomenologically relevant quantities. Representatives from lattice collaborations around the world were invited to attend a meeting during the Workshop. A consensus was reached to set up three test working groups, collectively known as the ''CKM Lattice Working Group'', to review a number of well-studied quantities: quark masses, the kaon B-parameter, and the matrix elements relevant for neutral B-meson mixing. This report is organized as a coherent document with chapters covering the domains of activity of the working groups. It deals mainly with the present determination of the CKM matrix in the Standard Model with a brief outlook on the near future. The impact of future measurements and of physics beyond the Standard Model will be developed further in forthcoming Workshops with the same title. Indeed, the Workshop was conceived as the first of a series. The second one will take place on 5-9 April 2003 in Durham and will focus on the results from the B-factories.

M. Battaglia et al.



Switzerland exploration may resume  

SciTech Connect (OSTI)

Since 1912, 35 wells have been drilled for oil and gas, 19 of them in the last 38 years. Eighty percent of these 19 wells had oil and/or gas shows, but only one was placed on production. The only gas discovery, Entlebuch-1, produced about 2.6 bcf of a high quality gas in 10 years. It was abandoned in 1994. This paper discusses why exploration waned. A second look at the data suggests Switzerland has a high potential for gas production.

Lahusen, P.H. [SEAG, Geneva (Switzerland)



Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +


Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


University of Geneva, Institute for Environmental Sciences, Energy Group  

E-Print Network [OSTI]

environment. Project and job description: Given the intermittency of many renewable energy sources (e.g. solarUniversity of Geneva, Institute for Environmental Sciences, Energy Group At the Institute of energy storage technologies. The successful applicant will become member of the Energy Group within

Halazonetis, Thanos



E-Print Network [OSTI]

Matthews Mathai Session 3: Monday, 5 September 14:00-16:00 Mental Health and Substance Abuse M. Taghi: women's right to the highest attainable standard of health, and abortion RonniePage 1 of 3 BOSTON UNIVERSITY GENEVA PROGRAM PRINCIPLES OF INTERNATIONAL HEALTH (PH 506E) Fall

Guenther, Frank



E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick



EDITORIAL -BASED ON MIR INVESTIGATIONS IN LAKE GENEVA Into the abyss of Lake Geneva: the elemo interdisciplinary field  

E-Print Network [OSTI]

of the wastewater treatment plant of the City of Lausanne, which discharges into the Vidy Bay. The investigations and Oeschger Centre for Climate Change Research, University of Bern, Bern, Switzerland B. W. Ibelings Á J

Wehrli, Bernhard


Geneva County, Alabama: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Geneva County, Alabama: Energy Resources Geneva County, Alabama: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 31.0990456°, -85.684578° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.0990456,"lon":-85.684578,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Geneva, Illinois (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Geneva Geneva Place Illinois Utility Id 7096 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Commercial Large General Service Large Industrial Industrial Large Industrial Rate-Optional Time of day. Industrial Medium General Service Residential Residential Space Heat Residential Average Rates Residential: $0.0956/kWh


Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +


Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology




E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add


Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +


Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +


Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin


Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL


Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of


Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gland, Switzerland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Gland, Switzerland: Energy Resources Gland, Switzerland: Energy Resources Jump to: navigation, search Name Gland, Switzerland Equivalent URI DBpedia GeoNames ID 2660600 Coordinates 46.433333°, 6.266667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.433333,"lon":6.266667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Switzerland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Switzerland: Energy Resources Switzerland: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.000158375286,"lon":8.0142688751221,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


France, Switzerland 'must pay more' for LHC  

Science Journals Connector (OSTI)

... a spanner into negotiations over the construction of Europe ' s planned Large Hadron Collider (LHC) by unexpectedly demanding that France and Switzerland jointly provide an additional 10 per cent ... CERN council, which many had hoped would give formal approval to the construction of the LHC. In particular, negotiations on the contentious issue of inflation-linked rises in contributions seemed ...

Alison Abbott



Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are


Zug, Switzerland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Zug, Switzerland: Energy Resources Zug, Switzerland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2657908 Coordinates 47.166192°, 8.515414° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.166192,"lon":8.515414,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.


University of Geneva Date: March 14, 2003 Computer Science Number: 03.02  

E-Print Network [OSTI]

and Multimedia Laboratory Technical Report Vision MRML: Steps towards version 2 Stéphane Marchand-Maillet* marchand@cui.unige.ch http://viper.unige.ch/ Latest version at: http/22 MRML 2.0 Draft specification S. Marchand-Maillet 03/2003 © Viper group ­ CUI ­ University of Geneva

Wrigley, Stuart


Borer problems and their control in dwarf apple trees David Kain, Entomology, NYSAES, Geneva, NY  

E-Print Network [OSTI]

Borer problems and their control in dwarf apple trees David Kain, Entomology, NYSAES, Geneva, NY in western New York, were invading burrknots on dwarf apple trees. About the same time, Dick Straub seemed to be becoming more common in dwarf apple plantings, as well. Based on Deb's alert, we decided

Agnello, Arthur M.


ISCAS 2000 -IEEE InternationalSymposiumon Circuits and Systems, May 28-31,2000, Geneva, Switzerland AN ADAPTIVE OFFSET CANCELLATIONMIXER FOR  

E-Print Network [OSTI]

In the continuing effort to minimize wireless transceiver size and power consumption great hopes exist noise amplifier, and the RF port of the mixer. The coupled LO signals are amplified as they follow the signal path to the mixer where they 'self mix,' causing energy to be superimposed onto the down

Moon, Un-Ku


Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...



E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of


WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...


Spent Sealed Sources Management in Switzerland - 12011  

SciTech Connect (OSTI)

Information is provided about the international recommendations for the safe management of disused and spent sealed radioactive sources wherein the return to the supplier or manufacturer is encouraged for large radioactive sources. The legal situation in Switzerland is described mentioning the demand of minimization of radioactive waste as well as the situation with respect to the interim storage facility at the Paul Scherrer Institute (PSI). Based on this information and on the market situation with a shortage of some medical radionuclides the management of spent sealed sources is provided. The sources are sorted according to their activity in relation to the nuclide-specific A2-value and either recycled as in the case of high active sources or conditioned as in the case for sources with lower activity. The results are presented as comparison between recycled and conditioned activity for three selected nuclides, i.e. Cs-137, Co-60 and Am-241. (author)

Beer, H.F. [Paul Scherrer Institute, CH-5232 Villigen (Switzerland)



Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade


Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions


Decentralized customerlevel under frequency load shedding in Switzerland  

Open Energy Info (EERE)

customerlevel under frequency load shedding in Switzerland customerlevel under frequency load shedding in Switzerland (Smart Grid Project) Jump to: navigation, search Project Name Decentralized customerlevel under frequency load shedding in Switzerland Country Switzerland Coordinates 46.818188°, 8.227512° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.818188,"lon":8.227512,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nuclear waste disposal in Switzerland: science, politics and uncertainty  

Science Journals Connector (OSTI)

In Switzerland, radioactive waste arises from electricity produced by five nuclear power plants and from the use of ... fields of medicine, industry and research. The waste is grouped into three categories: High-...

Simon Loew



Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Demonstration of membrane aeration panels: City of Geneva Wastewater Treatment Plant. Final report  

SciTech Connect (OSTI)

This report describes the design, construction, and testing of membrane aeration panels at the Marsh Creek wastewater treatment plant (WWTP) in Geneva, NY. The operators at the Geneva plant have undertaken a long-term program to upgrade wastewater treatment processes and lower operating costs. The aging mechanical surface aerators at the Marsh Creek treatment plant were replaced by a state-of-the-art membrane panel system. This fine-bubble diffused air system offers higher oxygen transfer efficiency than surface aerators or other types of fine-bubble diffused-air systems. The project had four objectives: to decrease the amount of electricity used at the plant for aeration; to enable the plant`s existing aeration basins to accommodate higher organic loads and/or nitrify the wastewater should the need arise; to provide an even distribution of dissolved oxygen within the aeration basins to enhance biological wastewater treatment activity; and to provide technical data to assess the performance of the membrane panel system versus other forms of wastewater aeration.



Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL



E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi


Analysis Of Geothermal Resources In Northern Switzerland | Open Energy  

Open Energy Info (EERE)

In Northern Switzerland In Northern Switzerland Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Paper: Analysis Of Geothermal Resources In Northern Switzerland Details Activities (0) Areas (0) Regions (0) Abstract: In Europe, geothermal energy becomes an attractive alternative for many conventional fuel based energy scenarios. In a time when actual political discussion favors regenerative energies, geothermal energy is an essential option since it offers the advantage of providing band energy. Recent studies provide evidence for large economical competitiveness of low-enthalpy, direct-use systems for heating and high-enthalpy systems for cogeneration (combined heat and power, CHP) or pure power generation. The study presented herein develops a detailed subsurface model of possible


Eprice (Smart Grid Project) (Switzerland) | Open Energy Information  

Open Energy Info (EERE)

Switzerland) Switzerland) Jump to: navigation, search Project Name Eprice Country Switzerland Coordinates 46.818188°, 8.227512° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.818188,"lon":8.227512,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Building Energy Software Tools Directory: Tools by Country - Switzerland  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Switzerland Switzerland A E F L M P U Tool Applications Free Recently Updated ACOUSALLE acoustics, codes and standards ECO-BAT environmental performance, life cycle assessment, sustainable development Software has been updated. EnerCAD Building Energy Efficiency; Early Design Optimization; Architecture Oriented; Life Cycle Analysis Software has been updated. flixo 2D heat transfer, cold bridge, fenestration, frame U-value, thermal bridge Software has been updated. LESO-COMFORT thermal comfort, load calculation, energy LESO-SHADE shading factors, solar shading, building geometry LESOCOOL airflow, passive cooling, energy simulation, mechanical ventilation LESODIAL Daylighting, early design stage, user-friendliness LESOKAI thermal tranmission, water vapor, building envelope Software has been updated.


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California


Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http


International Cloud Workshop, Locarno, Switzerland, 3 Feb 2009  

E-Print Network [OSTI]

International Cloud Workshop, Locarno, Switzerland, 3 Feb 2009 Impact of broken and inhomogeneous clouds on satellite cloud-phase retrieval Erwin Wolters ­ KNMI Hartwig Deneke ­ KNMI/University of Bonn;Contents Introduction CM-SAF cloud-phase retrieval method The problem ­ research question Broken clouds

Haak, Hein


Stellar substructures in the solar neighbourhood IV. Kinematic Group 1 in the Geneva-Copenhagen survey  

E-Print Network [OSTI]

We determine detailed elemental abundances in stars belonging to the so-called Group 1 of the Geneva-Copenhagen survey (GCS) and compare the chemical composition with the Galactic thin- and thick-disc stars, with the GCS Group 2 and Group 3 stars, as well as with several kinematic streams of similar metallicities. The aim is to search for chemical signatures that might give information about the formation history of this kinematic group of stars. High-resolution spectra were obtained with the Fibre-fed Echelle Spectrograph (FIES) spectrograph at the Nordic Optical Telescope, La Palma, and were analysed with a differential model atmosphere method. Comparison stars were observed and analysed with the same method. The average value of [Fe/H] for the 37 stars of Group 1 is -0.20 +- 0.14 dex. Investigated Group 1 stars can be separated into three age subgroups. Along with the main 8- and 12-Gyr-old populations, a subgroup of stars younger than 5 Gyr can be separated as well. Abundances of oxygen, alpha-elements, a...

enovien?, R; Nordstrm, B; Stonkut?, E; Barisevi?ius, G



E-Print Network 3.0 - alpine region switzerland Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

excellent example of an Alpine area where... region. Switzerland Italy France France Germany Austria Italy 12;... conflicting interests have learned to live in good harmony. The...


How Climate Efficient Is Tourism in Switzerland? An Assessment of Tourism's Carbon Dioxide Emissions  

E-Print Network [OSTI]

How Climate Efficient Is Tourism in Switzerland? An Assessment of Tourism's Carbon Dioxide;#12;Summary The tourism sector is not only affected by climate change but also has an impact on the Earth of such measures, we calculated the climate efficiency of the tourism sector in the case of Switzerland.We defined

Fischlin, Andreas


Evolution of carbon fluxes during initial soil formation along the forefield of Damma glacier, Switzerland  

E-Print Network [OSTI]

. Guelland Á I. Hajdas Institute for Particle Physics, ETH Zurich, HPK/H27, Schafmattstrasse 20, 8093 Zurich Dynamics, ETH Zurich, Universita¨tstrasse 16, 8092 Zurich, Switzerland e-mail: kathi.guelland@wsl.ch F Institute, ETH Zurich, Sonneggstrasse 5, 8092 Zurich, Switzerland H. Go¨ransson School of the Environment

Gilli, Adrian


Towards a policy convergence in Europe? General approaches in the Netherlands, Switzerland and  

E-Print Network [OSTI]

- 1 - Towards a policy convergence in Europe? General approaches in the Netherlands, Switzerland Engineering Rm 305 PO Box 5048 DELFT 2600 GA The Netherlands 31 15 278 4672 31 15 278 3179 e - The policies of three European countries (France, the Netherlands and Switzerland) are compared at the level

Paris-Sud XI, Université de


2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.


Literaturlenz: Reading with Authors from Germany, Switzerland, and Austria Reading with Larissa Boehning, Monica Cantieni, and Linda Stift  

E-Print Network [OSTI]

Literaturlenz: Reading with Authors from Germany, Switzerland, and Austria Reading with Larissa.m. Each year Literaturlenz brings authors from Germany, Switzerland, and Austria to the UW Campus. Each Boehning from Germany, Monica Cantieni from Switzerland, and Linda Stift of Austria. The readings

Sheridan, Jennifer


Address (Smart Grid Project) (Switzerland) | Open Energy Information  

Open Energy Info (EERE)

Project Name Address Project Name Address Country Switzerland Coordinates 46.818188°, 8.227512° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.818188,"lon":8.227512,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Environmental inventories for future electricity supply systems for Switzerland  

Science Journals Connector (OSTI)

The Swiss Association of Producers and Distributors of Electricity (VSE) identified a number of possible supply mix options to meet the future electricity demand in Switzerland. In this context, PSI, in co-operation with ETHZ, analysed environmental inventories for the selected electricity supply systems. Life Cycle Analysis (LCA) was used to establish the inventories, covering the complete energy chains associated with fossil, nuclear and renewable systems. The assessment was performed on three levels: (1) individually for each system considered; (2) comparison of systems; (3) comparison of supply mix options. In absolute value, the emissions of the major pollutants considered are, in most cases, significantly reduced in comparison with the currently operating systems. Due to the considerable advancements in fossil power plant technologies, the relative importance of other activities increases in the fossil energy systems. Selected results for systems and supply options are given in the present paper.

R. Dones; U.; Ganter; S. Hirschberg



Expert Paper for the UNECE, Timber Committee Market Discussions, Geneva, 7-8 October 2003 1 Trends and Market Effects of Wood Energy Policies  

E-Print Network [OSTI]

and Market Effects of Wood Energy Policies By Dr. Bengt Hillring1 Department of Bioenergy Swedish UniversityExpert Paper for the UNECE, Timber Committee Market Discussions, Geneva, 7-8 October 2003 1 Trends behind the increased interest for wood energy. · Bioenergy promotion policy in certain countries


330 West State Street, Suite 1, Geneva, IL 60134 (USA) Tel: +1.888.733.1ALA (252) Fax: +1.630.578.0172  

E-Print Network [OSTI]

330 West State Street, Suite 1, Geneva, IL 60134 (USA) Tel: +1.888.733.1ALA (252) Fax: +1 Convention Center, Palm Springs, CA, USA: Jason Haaheim, M.S., Skokie, IL, USA, NanoInk ­ Dip Pen, USA, Harvard-Massachusetts Institute of Technology ­ Microengineered Hydrogels for Tissue Engineering

Tang, William C

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


POSTER PRESENTATION Open Access Impact of obesity on global and regional systolic  

E-Print Network [OSTI]

Radiology department, Hopital Universitaire de Genève, Geneva, Switzerland. 2 Pediatric Cardiology Unit. Published: 2 February 2011 1 Radiology department, Hopital Universitaire de Genève, Geneva, Switzerland Full

Paris-Sud XI, Université de


SwiftLink: Serendipitous Navigation Strategy for Large-scale Document Collections  

E-Print Network [OSTI]

´ephane Marchand-Maillet Department of Computer Science University of Geneva Carouge, Switzerland Stephane.Marchand

Genève, Université de


Occurrence of Methyl Triclosan, a Transformation Product of the Bactericide Triclosan, in Fish from Various Lakes in Switzerland  

Science Journals Connector (OSTI)

Occurrence of Methyl Triclosan, a Transformation Product of the Bactericide Triclosan, in Fish from Various Lakes in Switzerland ... The bactericide triclosan and methyl triclosan, an environmental transformation product thereof, have been previously detected in lakes and a river in Switzerland. ... Both compounds are emitted via wastewater treatment plants (WWTPs), with methyl triclosan probably being formed by biological methylation. ...

Marianne E. Balmer; Thomas Poiger; Christian Droz; Kathrin Romanin; Per-Anders Bergqvist; Markus D. Mller; Hans-Rudolf Buser



On Physical-Layer Identification of Wireless Devices BORIS DANEV, DAVIDE ZANETTI, and SRDJAN CAPKUN, ETH Zurich, Switzerland  

E-Print Network [OSTI]

CAPKUN, ETH Zurich, Switzerland Physical-layer device identification aims at identifying wireless devices Science, ETH Zurich, Universit¨atstrasse 6, 8092 Zurich, Switzerland; email: {bdanev, zanettid, capkuns appear in the transmitted signals, which makes them This work was partially supported by the Zurich

Capkun, Srdjan


ISIT2002, Lausanne, Switzerland, June 30 -July 5,2002 The use of memory in  

E-Print Network [OSTI]

consider the following canonical load balancing problem: Drop n balls into n bins so as to minimize the following randomized load balancing policy, called the " ( d , m )policy": Suppose that d 2 m. At the beISIT2002, Lausanne, Switzerland, June 30 -July 5,2002 The use of memory in randomized load

Prabhakar, Balaji


Montreux, Switzerland, 01-03 June 2005 Design Automation Challenges for Microfluidics-Based Biochips*  

E-Print Network [OSTI]

Montreux, Switzerland, 01-03 June 2005 Design Automation Challenges for Microfluidics, Durham, NC 27708 E-mail: {krish, fs}@ee.duke.edu Abstract Microfluidics-based biochips are soon expected are expected to increase dramatically. Current techniques for full-custom design of digital microfluidic

Chakrabarty, Krishnendu


bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond



UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Etrion Corporation | Open Energy Information  

Open Energy Info (EERE)

Etrion Corporation Etrion Corporation Jump to: navigation, search Name Etrion Corporation Place Geneva, Switzerland Zip 1207 Sector Solar, Wind energy Product Geneva-based power producer, developing and building large scale solar PV, solar thermal and wind power plants. Coordinates 46.208358°, 6.142701° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.208358,"lon":6.142701,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solar cooking in Switzerland--Use of cookers in Africa and India  

SciTech Connect (OSTI)

This paper describes the development of activities in Switzerland, Africa and India to promote the use of solar cookers. The most successful programs are said to be in Senegal in Western Africa, and Kenya and Sudan in Eastern Africa. These activities include information dissemination and sales of ready-made products. Although some projects are for individual homes, some have been developed for hospitals, prisons, schools, boarding houses, etc. These larger units are usually systems using parabolic reflectors and fireplaces or propane as a source of fuel when there is no sunshine.

Pulfer, J. [Group ULOG, Basel (Switzerland)




E-Print Network [OSTI]



UNSUPERVISED DISCRIMINANT EMBEDDING IN CLUSTER Eniko Szekely, Eric Bruno and Stephane Marchand-Maillet  

E-Print Network [OSTI]

Marchand-Maillet University of Geneva, 7 Route de Drize, Geneva, Switzerland eniko.szekely@unige.ch, eric.bruno@unige.ch, stephane.marchand-maillet@unige.ch Keywords: Dimension reduction, Clustering, High dimensionality. Abstract

Genève, Université de



E-Print Network [OSTI]

´ephane Marchand-Maillet, Eric Bruno Computer Vision and Multimedia Laboratory University of Geneva Geneva, Switzerland {donn.morrison,marchand,eric.bruno}@cui.unige.ch ABSTRACT User-supplied data such as browsing logs

Genève, Université de


Forest plant community changes during 1989-2007 in response to climate warming in the Jura Mountains (France and Switzerland)  

E-Print Network [OSTI]

Mountains (France and Switzerland) J. Lenoir, J.C. Ge� gout, J.L. Dupouey, D. Bert & J.-C. Svenning Abstract, lenoir.john@gmail. com) & Ge� gout, J.C. (jcgegout@yahoo.fr): AgroParis- Tech, UMR 1092 Agro

Bert, Didier


International Workshop on Geomechanics and Energy The Ground as Energy Source and Storage Lausanne, Switzerland, 26-28 November 2013  

E-Print Network [OSTI]

International Workshop on Geomechanics and Energy ­ The Ground as Energy Source and Storage region of Switzerland. #12;International Workshop on Geomechanics and Energy ­ The Ground as Energy and the "Brown Dogger", from a deep geothermal well (depth of 766.67 and 778.30 m) near the village

Candea, George


February 16-18, 2011 / Biel (Bienne), Switzerland Comparison between accelerated thermo-hydro aged wood and naturally  

E-Print Network [OSTI]

Bois 3 DEISTAF ­ University of Florence, Italy Key words: accelerated aging, micro-mechanics, thermo-hydroFebruary 16-18, 2011 / Biel (Bienne), Switzerland Comparison between accelerated thermo-hydro aged]. It has been observed that similar degradation can be found in thermo-hydro (TH) treated wood [4]. The aim

Paris-Sud XI, Université de


Services Industriels de Geneve SIG | Open Energy Information  

Open Energy Info (EERE)

Industriels de Geneve SIG Industriels de Geneve SIG Jump to: navigation, search Name Services Industriels de Geneve (SIG) Place Geneva, Switzerland Zip 1204 Sector Solar Product Switzerland-based electric and gas utility. The company has interest in solar project development. Coordinates 46.208358°, 6.142701° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.208358,"lon":6.142701,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fermilab | Science | Questions for the Universe | Einstein's...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solve the mystery of dark energy: Large Hadron Collider, CERN, Switzerland, Geneva International Linear Collider (proposed) Joint Dark Energy Mission (proposed) Large Synoptic...


Search for the Higgs Boson in the Vector Boson Fusion Channel at the ATLAS Detector.  

E-Print Network [OSTI]

??The search for the Higgs boson has been a cornerstone of the physics program at the Large Hadron Collider in Geneva Switzerland. The ATLAS experiment (more)

Ouellette, Eric Alexandre



Fermilab at Work | Physics Links: HEP Labs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Linear Accelerator Center LNS at Cornell University CERN (Geneva, Switzerland) DESY (Hamburg, Germany) KEK (Tsukuba, Japan) JINR (Dubna, Russia) JLab ANL (High Energy Physics) LBL...

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High-Throughput and Combinatorial Screening of Hydrogen Storage...  

Broader source: Energy.gov (indexed) [DOE]

method The sintering technique is used by groups at: U. Geneva (Switzerland), MPI (Germany), Stockholm University (Sweden), IFE (Norway), SRNL (USA), U. Tohoku, AIST (Japan)...


Performance Evaluation of a Crystal-Enhanced Collimation System for the LHC.  

E-Print Network [OSTI]

??The Large Hadron Collider (LHC) has been constructed at CERN (Conseil Europen pour la Recherche Nuclaire, Geneva, Switzerland), and recently started up. The LHC beams, (more)

Previtali, Valentina



Curriculum vitae  

E-Print Network [OSTI]

Fellow of the Summer Student Programme at the European Organization. Jul 91 Oct 91 for Nuclear Research (CERN), Geneva, Switzerland. 7. Fellowship of...



White House backs US contribution to LHC  

Science Journals Connector (OSTI)

... back a US contribution of $530 million towards construction of the Large Hadron Collider (LHC) at CERN, the European particle physics laboratory in Geneva, Switzerland.

Colin Macilwain



Clients of sex workers in Switzerland: it makes sense to counsel and propose rapid test for HIV on the street, a preliminary report  

Science Journals Connector (OSTI)

The study took place over 5 nights in September 2008 (from 10 pm to 1 am) in the red light district of Lausanne, Switzerland. This well defined area consists of 4 parallel streets each less than 400 meters long r...

Esther-Amlie Diserens; Patrick Bodenmann; Chantal N'Garambe



14th Cambridge Workshop on Cool Stars, Stellar Systems, and the Sun ASP Conference Series, Vol. x, 2007  

E-Print Network [OSTI]

, 5232 Villigen PSI, Switzerland 2 Columbia Astrophysics Laboratory, 550 West 120th Street, New York, NY 10027 3 ISDC & Geneva Observatory, University of Geneva, Ch. d'Ecogia 16, 1290 Versoix, Switzerland 4 (near-infrared color prop- erties, LX, X-ray light curves and spectra) to identify a sample of 12 likely

Guedel, Manuel


LHC switches on  

Science Journals Connector (OSTI)

... successfully circulated the first protons around the 27-kilometre ring of the Large Hadron Collider (LHC), located at CERN outside of Geneva, Switzerland. "Merci, merci," a relieved ... at CERN outside of Geneva, Switzerland. "Merci, merci," a relieved Lyn Evans, LHC's project leader, thanked the applauding physicists and engineers. The ...

Geoff Brumfiel




E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS


Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter


Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter


ICSE Workshop on Green and Sustainable Software Engineering, Zurich, Switzerland, 3rd June 2012 An Energy Consumption Model and Analysis Tool for Cloud Computing  

E-Print Network [OSTI]

system-level optimisation. Keywords-green computing; Cloud computing; energy consumption; performanceIn 1st ICSE Workshop on Green and Sustainable Software Engineering, Zurich, Switzerland, 3rd June 2012 An Energy Consumption Model and Analysis Tool for Cloud Computing Environments FeiFei Chen, Jean

Schneider, Jean-Guy


FermiNews - November 10, 2000  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 | Friday, November 10, 2000 | Number 19 3 | Friday, November 10, 2000 | Number 19 In This Issue | FermiNews Main Page LHC Magnet: From Model to Prototype by Kurt Riesselmann Paul Mayer checks one of the leads to a coil prior to final assembly of the magnet Magnets are crucial components of every particle accelerator around the world. Like tracks guiding trains, they force charged particles to follow a path prescribed by magnetic forces. The higher the energy of the particles, the stronger the magnetic forces needed to steer them around a ring. The Large Hadron Collider, which will be the world's most powerful particle accelerator when finished in 2005, will feature the world's largest assembly of powerful magnets. Thousands of magnets will assure that protons, traveling at almost the speed of light, will stay on track as they zip around a 17-mile-long circular track at CERN, the European particle physics laboratory near Geneva, Switzerland.


Kender Energy Inc | Open Energy Information  

Open Energy Info (EERE)

Kender Energy Inc Kender Energy Inc Jump to: navigation, search Name Kender Energy Inc Place Geneva, Switzerland Zip 1207 Sector Solar Product Closed circuit gas heat exchanger-based solar power panel maker. Coordinates 46.208358°, 6.142701° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.208358,"lon":6.142701,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ASP AG | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: ASP AG Place: Laupen, Switzerland Zip: CH-8637 Product: Manufacturer of inverters for PV systems and other off- and on-grid applications. References:...


Determining the local acceptance of wind energy projects in Switzerland: The importance of general attitudes and project characteristics  

Science Journals Connector (OSTI)

Abstract This article explores the relationship between general attitudes toward wind energy, local acceptance of specific wind projects and respective intentions to act on those attitudes in Switzerland. Its primary instrument of data collection was a survey experiment with 919 citizens in five Swiss rural municipalities with potential wind sites. The survey presented descriptions of several potential wind projects. Participants rated their acceptance and intention to act for each wind project, as well as their general attitude toward wind energy. Results showed that general attitude is a strong predictor of local acceptance but is rated significantly higher than local acceptance. When matched with the effects of three procedural and distributive justice measures on local acceptance, the results of the study seem to support the concept of Qualified Support: local acceptance by participants with a moderate or positive general attitude is dependent on the associated local benefits, while local acceptance by participants with a negative attitude is not. Interestingly, the study also finds that general attitude and local acceptance both had only minimal effects on respective intentions to act. Thus, researchers should be aware of cognitive and behavioral aspects of local acceptance and seek to better distinguish between these two dimensions.

Gtz Walter



Astronomy & Astrophysics manuscript no. 6536 c ESO 2006 November 24, 2006  

E-Print Network [OSTI]

, Switzerland 4 Columbia Astrophysics Laboratory, Mail Code 5247, 550 West 120th Street, New York, NY 10027, USA. The light curves of the selected sources show different types of variability: flares, long-lasting decay, Switzerland & Geneva Observatory, Ch. des Maillettes 51, 1290 Sauverny, Switzerland Preibisch et al. 2005

Audard, Marc


An LCA model for waste incineration enhanced with new technologies for metal recovery and application to the case of Switzerland  

SciTech Connect (OSTI)

Highlights: An enhanced process-based LCA model for MSWI is featured and applied in case study. LCA modeling of recent technological developments for metal recovery from fly ash. Net release from Swiss MSWI 133 kg CO{sub 2}-eq/tonne waste from attributional LCA perspective. Net savings from a consequential LCA perspective reach up to 303 kg CO{sub 2}-eq/tonne waste. Impacts according to ReCiPe and CExD show similar pattern to climate change. - Abstract: A process model of municipal solid waste incinerators (MSWIs) and new technologies for metal recovery from combustion residues was developed. The environmental impact is modeled as a function of waste composition as well as waste treatment and material recovery technologies. The model includes combustion with a grate incinerator, several flue gas treatment technologies, electricity and steam production from waste heat recovery, metal recovery from slag and fly ash, and landfilling of residues and can be tailored to specific plants and sites (software tools can be downloaded free of charge). Application of the model to Switzerland shows that the treatment of one tonne of municipal solid waste results on average in 425 kg CO{sub 2}-eq. generated in the incineration process, and 54 kg CO{sub 2}-eq. accrue in upstream processes such as waste transport and the production of operating materials. Downstream processes, i.e. residue disposal, generates 5 kg CO{sub 2}-eq. Savings from energy recovery are in the range of 67 to 752 kg CO{sub 2}-eq. depending on the assumptions regarding the substituted energy production, while the recovery of metals from slag and fly ash currently results in a net saving of approximately 35 kg CO{sub 2}-eq. A similar impact pattern is observed when assessing the MSWI model for aggregated environmental impacts (ReCiPe) and for non-renewable resource consumption (cumulative exergy demand), except that direct emissions have less and no relevance, respectively, on the total score. The study illustrates that MSWI plants can be an important element of industrial ecology as they provide waste disposal services and can help to close material and energetic cycles.

Boesch, Michael E. [Aveny GmbH, Schwandenholzstr. 212, CH-8046 Zrich (Switzerland); Vadenbo, Carl, E-mail: vadenbo@ifu.baug.ethz.ch [ETH Zurich, Institute of Environmental Engineering, Schafmattstrasse 6, CH-8093 Zurich (Switzerland); Saner, Dominik [Swiss Post, Communications, Politics and Social Responsibility, Viktoriastrasse 21, P.O. Box, CH-3030 Berne (Switzerland); Huter, Christoph [City of Zrich, ERZ Entsorgung - Recycling Zrich, Hagenholzstrasse 110, P.O. Box, CH-8050 Zrich (Switzerland); Hellweg, Stefanie [ETH Zurich, Institute of Environmental Engineering, Schafmattstrasse 6, CH-8093 Zurich (Switzerland)



Electron reconstruction in simulated Pb+Pb events in CMS  

E-Print Network [OSTI]

Introduction: The Large Hadron Collider (LHC) located at Geneva, Switzerland, will be the biggest particle accelerator in the world. There are a number of detectors on the LHC ring. The LHCb detector is aimed to study ...

Chen, Yi, S.B. Massachusetts Institute of Technology



NOAA ARL Monthly Activity Report Bruce B. Hicks, Director  

E-Print Network [OSTI]

NOAA ARL Monthly Activity Report March 2003 Bruce B. Hicks, Director Air Resources Laboratory, held 24-27 March 2003 in Geneva, Switzerland, examined the underrepresentation of women in these fields


Reflections on the development of health economics in low- and middle-income countries  

Science Journals Connector (OSTI)

...Geneva, Switzerland: World Health Organization. 54 Mills...case-study from Thailand. Health Policy 51, 163-180...Creating markets in hospital care: the adoption of developed country health sector reforms by developing countries...


Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Spatially-consistent partial matching for intra-and inter-image prototype selection  

E-Print Network [OSTI]

. Bruno and S. Marchand-Maillet Viper Group - University of Geneva - Switzerland Abstract This paper following Corresponding author. Email address: marchand@cui.unige.ch (S. Marchand-Maillet). 1 This work

Genève, Université de


Exploiting Synergistic and Redundant Features for Multimedia Document Classification  

E-Print Network [OSTI]

, Eric Bruno and Stephane Marchand-Maillet University of Geneva, Switzerland kludas|bruno|marchand algorithm that #12;2 Jana Kludas, Eric Bruno and Stephane Marchand-Maillet finds an optimal subset (where

Genève, Université de


Health in financial crises: economic recession and tuberculosis in Central and Eastern Europe  

Science Journals Connector (OSTI)

...research-article Research articles 1004 24 Health in financial crises: economic recession...and Neglected Tropical Diseases, World Health Organization, , 1211 Geneva 27, Switzerland...declining economic conditions on public health. A quantitative analysis of previous...



Accounting for indirect land-use change in the life cycle assessment of biofuel supply chains  

Science Journals Connector (OSTI)

...re.jrc.ec.europa.eu/bf-tp/ 9 Fritsche, U. R. , R. Sims...and guidelines. Technical Report ISO 14044:2006(E). Geneva, Switzerland...Organization. See http://www.iso.org/iso/iso_catalogue/catalogue_ics...



Reducing abrupt climate change risk using the Montreal Protocol and other regulatory actions to complement cuts in CO2 emissions  

Science Journals Connector (OSTI)

...refrigerants such as hydrocarbons (GWP combustion of fossil fuels and biomass...solar radiation, which heats the surrounding air...2005 Supplement Report Data ( UNEP , Geneva, Switzerland...NOAA's Natl Climatic Data Center , Washington...

Mario Molina; Durwood Zaelke; K. Madhava Sarma; Stephen O. Andersen; Veerabhadran Ramanathan; Donald Kaniaru



Potential ecological footprints of active pharmaceutical ingredients: an examination of risk factors in low-, middle- and high-income countries  

Science Journals Connector (OSTI)

...country_files 68 AECOM International Development, Inc...the Philippines, Sri Lanka, Thailand, and Vietnam. US Agency for International Development. See http...Geneva, Switzerland: International Federation of Pharmaceutical...



Full-Genome Sequence Analysis of a Multirecombinant Echovirus 3 Strain Isolated from Sewage in Greece  

Science Journals Connector (OSTI)

...properties could be potentially dangerous for public health. Enteroviruses are among...poliovirus circulation. World Health Organization, Geneva, Switzerland...properties could be potentially dangerous for public health. | Department of Biochemistry...

Zaharoula Kyriakopoulou; Evaggelos Dedepsidis; Vaia Pliaka; Dimitris Tsakogiannis; Anastassia Pratti; Stamatina Levidiotou-Stefanou; Panayotis Markoulatos



Fermilab | Newsroom | Press Releases | March 19, 2014: International...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

05 March 19, 2014 FOR IMMEDIATE RELEASE International team of LHC and Tevatron scientists announces first joint result thumb Hi-res | Med-res CHICAGO, USA AND GENEVA, SWITZERLAND -...


Systems Testing of a Free Hg Jet System for Use in a High-Power Target Experiment  

E-Print Network [OSTI]

, USA A. Fabich, I. Efthymiopolous, CERN, Geneva, Switzerland P. Titus, MIT Plasma Science and Fusion Center, Cambridge, MA 02139, USA K. McDonald, Princeton University, Princeton, NJ 08544, USA The MERIT

McDonald, Kirk


Emerging and Reemerging Neglected Tropical Diseases: a Review of Key Characteristics, Risk Factors, and the Policy and Innovation Environment  

Science Journals Connector (OSTI)

...for deadly fever outbreak. BBC News. http://www.bbc.com/news/world-africa-26703960...WHO. 2013. Sustaining the drive to overcome the global impact...Geneva, Switzerland. 55. UN News Centre. 2014. Ebola: UN health...

Tim K. Mackey; Bryan A. Liang; Raphael Cuomo; Ryan Hafen; Kimberly C. Brouwer; Daniel E. Lee



Geneva, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

875281°, -88.3053525° 875281°, -88.3053525° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.8875281,"lon":-88.3053525,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geneva, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

3917165°, -85.7199794° 3917165°, -85.7199794° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.3917165,"lon":-85.7199794,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geneva, Florida: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

397163°, -81.1150616° 397163°, -81.1150616° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":28.7397163,"lon":-81.1150616,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



E-Print Network [OSTI]

Symbioses at the Spring Meeting of the Society for General Microbiology, Harrogate, UK. Cole Gilbert other entomologists from Cornell and was a party to remember. Linda Rayor and Cole Gilbert led another graduating in May 2012 with a B.S. degree in entomology and microbiology. He is currently in the process

Lazzaro, Brian


In Vivo Measurements of Light Emission Hazem M. Kalaji1  

E-Print Network [OSTI]

1 In Vivo Measurements of Light Emission in Plantsa Hazem M. Kalaji1 , Vasilij Goltsev2 , Mari of Sciences, Botanicheskaya Street 35, Moscow 127276, Russia; Institute of Basic Biological Problems, Russian Bioenergetics Laboratory, University of Geneva, CH-1254 Jussy/Geneva, Switzerland; Weed Research Laboratory



doi: 10.1098/rstb.2010.0268 , 863-8773662011Phil. Trans. R. Soc. B  

E-Print Network [OSTI]

Biology), University College London, Physics Building, Gower Street, London WC1E 6BT, UK 4 AHRC Centre of Anthropology and Ecology, University of Geneva, 12 rue Gustave-Revilliod, 1227 Geneva, Switzerland 6 and describe three simulation studies that have shed light on the evolution of this trait in Europe


Preliminary Interpretation of a Radionuclide and Colloid Tracer Test in a Granodiorite Shear Zone at the Grimsel Test Site, Switzerland  

SciTech Connect (OSTI)

In February and March 2012, a tracer test involving the injection of a radionuclide-colloid cocktail was conducted in the MI shear zone at the Grimsel Test Site, Switzerland, as part of the Colloids Formation and Migration (CFM) project. The colloids were derived from FEBEX bentonite, which is mined in Spain and is being considered as a potential waste package backfill in a Spanish nuclear waste repository. The tracer test, designated test 12-02 (second test in 2012), involved the injection of the tracer cocktail into borehole CFM 06.002i2 and extraction from the Pinkel surface packer at the main access tunnel wall approximately 6.1 m from the injection interval. The test configuration is depicted in Figure 1. This configuration has been used in several conservative tracer tests and two colloid-homologue tracer tests since 2007, and it is will be employed in an upcoming test involving the emplacement of a radionuclide-doped bentonite plug into CFM 06.002i2 to evaluate the swelling and erosion of the bentonite and the transport of bentonite colloids and radionuclides from the source to the extraction point at the tunnel wall. Interpretive analyses of several of the previous tracer tests, from 09-01 through 12-02 were provided in two previous Used Fuel Disposition Program milestone reports (Arnold et al., 2011; Kersting et al., 2012). However, only the data for the conservative tracer Amino-G Acid was previously analyzed from test 12-02 because the other tracer data from this test were not available at the time. This report documents the first attempt to quantitatively analyze the radionuclide and colloid breakthrough curves from CFM test 12-02. This report was originally intended to also include an experimental assessment of colloid-facilitated transport of uranium by bentonite colloids in the Grimsel system, but this assessment was not conducted because it was reported by German collaborators at the Karlsruhe Institute of Technology (KIT) that neither uranium nor neptunium adsorbed appreciably to FEBEX bentonite colloids in Grimsel groundwater (Huber et al., 2011). The Grimsel groundwater has a relatively high pH of {approx}9, so the lack of uranium and neptunium adsorption to clay is not surprising given the tendency for these actinides to form very stable negative or neutrally-charged uranyl- or calcium-uranyl-carbonate complexes at these pH, particularly in a water that is effectively saturated with respect to calcite. It was also observed in testing conducted at LANL earlier in 2012 that uranium did not adsorb measurably to Grimsel granodiorite in a synthetic Grimsel groundwater at pH {approx}8.5 (Kersting et al., 2012). Thus, the planned experimental work was not pursued because all the available information clearly pointed to an expected result that uranium transport would not be facilitated by clay colloids in the Grimsel system.

Reimus, Paul W. [Los Alamos National Laboratory



International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences, Vol. XXXVIII-1/C22 UAV-g 2011, Conference on Unmanned Aerial Vehicle in Geomatics, Zurich, Switzerland  

E-Print Network [OSTI]

. XXXVIII-1/C22 UAV-g 2011, Conference on Unmanned Aerial Vehicle in Geomatics, Zurich, Switzerland DIRECT GEOREFERENCING OF UAVS M. Bláha *, H. Eisenbeiss, D. Grimm, P. Limpach Institute of Geodesy and Photogrammetry.limpach)@geod.baug.ethz.ch and mblaha@student.ethz.ch Commission VI, WG VI/4 KEY WORDS: UAV, Falcon 8, direct georeferencing, GPS

Schindler, Konrad


ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...


Bobst Group SA | Open Energy Information  

Open Energy Info (EERE)

Bobst Group SA Jump to: navigation, search Name: Bobst Group SA Place: Susanne, Switzerland Zip: CH-1001 Sector: Services Product: A Swiss-based company that supplies equipment and...

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mi GmbH | Open Energy Information  

Open Energy Info (EERE)

Mi GmbH Jump to: navigation, search Name: Mi GmbH Place: Switzerland Zip: CH-6340 Sector: Solar Product: Baar-based manufacturer and distributor of fruit juices. The firm is also...


On Some Movements of the Ground in Geneva  

Science Journals Connector (OSTI)

......construction and alignment of the 25 GeV proton synchroton at CERN. On Some Movements of the Ground...and align- ment of the 25 GeV proton synchroton at CERN. The 25000 million electron volt synchroton (the Eurotron) that has been under construction......

A. Decae



Lake Geneva. - American Society of Limnology and Oceanography  

Science Journals Connector (OSTI)

and by smoothing them over depth intervals and over time. We applied these ..... exponential correlation between K, and N2 cannot be es- tablished by the flux...



The Peaceful Uses of Atomic Energy: The Geneva International Conference  

Science Journals Connector (OSTI)

... water, and in designs in which the water boils and is transmitted direct to a turbine or in which the water circulates through a heat exchanger to raise steam. Homogeneous ... will have to increase from 3 million kilowatts to 25 million kilowatts. The undeveloped hydroelectric capacity of 35 million kilowatts could provide most of this; but there are some ...




PC-Scheme/Geneva 4.02 log  

E-Print Network [OSTI]

Jun 1, 1999 ... You might play with them (I made them to show students computer architecture) but remember ... INI and the PCS DOSKEY environment will.



Transatlantic Native 10 Gigabit Ethernet Experiments: Connecting Geneva to Ottawa  

Science Journals Connector (OSTI)

Local area network technology has evolved rapidly in speed and distance coverage. In this paper, we report on the first transatlantic native local area network built using...

Bob Dobinson; Ren Hatem; Wade Hong



A Leviathan Takes Shape Beneath Geneva's Gentle Environs  

Science Journals Connector (OSTI)

...universe. The long view. A string of superconducting...electromagnetic fields oscillating at radio frequencies...universe. The long view. A string of superconducting...electromagnetic fields oscillating at radio frequencies...

Matin Durrani



EDITORIAL -BASED ON MIR INVESTIGATIONS IN LAKE GENEVA Into the abyss of Lake Geneva: the elemo interdisciplinary field  

E-Print Network [OSTI]

boundary. One focus site was the surrounding of the outlet of the wastewater treatment plant of the City F. S. Anselmetti Institute of Geological Sciences and Oeschger Centre for Climate Change Research

Gilli, Adrian


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean



Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds



Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...


Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...


Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member


Seven days: 1319 June 2014  

Science Journals Connector (OSTI)

... search The Hubble Space Telescope has begun searching for an icy world in the outer Solar System that NASAs New Horizons mission can visit after its fly-by of Pluto ... seizures were made in Africa than in Asia, 80% of which occurred in Kenya, Tanzania and Uganda. The results will be discussed at a CITES meeting in Geneva, Switzerland ...



Science prizes: The new Nobels  

Science Journals Connector (OSTI)

... Alexander Polyakov's words were less than gushing. It was the culmination of a glittering award ceremony in Geneva, Switzerland, in March, hosted by Hollywood actor Morgan Freeman and ... Mark Zuckerberg, Google co-founder Sergey Brin and property developer Samuel Yin, the new awards outstrip the $1.2-million Nobel prizes in monetary value. In addition to Milner ...

Zeeya Merali




E-Print Network [OSTI]


McDonald, Kirk


International Conference on Wood-based Bioenergy LIGNA+Hannover, Germany, 17-18 May 2007  

E-Print Network [OSTI]

International Conference on Wood-based Bioenergy LIGNA+Hannover, Germany, 17-18 May 2007 Photo: NTC Marketing Specialist and Sebastian Hetsch, Consultant Food and Agricultural Organization & UN Economic Commission for Europe Geneva, Switzerland #12;International Conference on Wood-based Bioenergy LIGNA


EUROGRAPHICS 2000 / M. Gross and F.R.A. Hopgood (Guest Editors)  

E-Print Network [OSTI]

-Thalmann MIRALab, CUI, University of Geneva, Switzerland Web: http://www.miralab.unige.ch E-mail: {wslee, gu to the reconstruction of a face either using a sculptor8, a laser scanner22, a stereoscopic camera21, an active light Publishers, 108 Cowley Road, Oxford OX4 1JF, UK and 350 Main Street, Malden, MA 02148, USA. #12;Lee, Gu

Lee, WonSook


Fusion history beyond the fiascos  

Science Journals Connector (OSTI)

... It is 50 years since the first international symposium on fusion energy research took place in Geneva, Switzerland, as part of the second United Nations ... the United Kingdom, the Soviet Union and the United States announced the declassification of controlled fusion research, raising the hope of clean and limitless energy for mankind.

Jean Jacquinot


Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sustainable Mobility, Future Fuels, and the Periodic Table  

Science Journals Connector (OSTI)

Sustainability has three pillars: economic, social, and environmental. ... We will concentrate on the environmental pillar as a discussion of economic and social factors is beyond the scope of the present work. ... World Business Council for Sustainable Development, Mobility 2030: Meeting the Challenges to Sustainability; Conches: Geneva, Switzerland, 2004 ...

Timothy J. Wallington; James E. Anderson; Donald J. Siegel; Michael A. Tamor; Sherry A. Mueller; Sandra L. Winkler; Ole J. Nielsen



Goldschmidt 2012 Conference Abstracts  

Science Journals Connector (OSTI)

...the chemical weathering rates and CO2 comsumption fluxes in the soil zones. The dissolution...Biomass Tars with Dolomites. Energy & Fuels, Volume 23, Issue 4, Pages 2264-2272...Geneva, Switzerland. 3 Swedish Nuclear Fuel and Waste Management Co, Blekholmstorget...


Macroeconomics and Health: Investing in Health for  

E-Print Network [OSTI]

Macroeconomics and Health: Investing in Health for Economic Development #12;Information concerning be obtained from: World Health Organization Marketing and Dissemination 1211 Geneva 27, Switzerland tel: (41 clear and strong on the central task of raising the health of the poor. I can be `realistic


Synergie entre le msocentre grenoblois CIMENT et la grille europenne EGI pour la recherche de nouvelles particules dans l'exprience ATLAS auprs du  

E-Print Network [OSTI]

nouvelles particules dans l'expérience ATLAS auprès du collisionneur LHC au CERN Catherine Biscarat(1 in Grenoble) and WLCG (the LHC computing grid) for the analysis of data recorded by the ATLAS experiment at the LHC collider. The LHC collider at CERN (Geneva, Switzerland) is the leading facility for research

Paris-Sud XI, Université de


27. R. Bessinger, P. Akwara, "Trends in Sexual and Fertility-Related Behavior: Cameroon, Kenya, Uganda, Zambia,  

E-Print Network [OSTI]

, Uganda, Zambia, and Thailand" (The Measure Evaluation Project, Unit- ed States Agency for International, 608 (2000). 31. UNAIDS, "A measure of success in Uganda" (UNAIDS, Geneva, Switzerland, 1998). 32., Lancet 361, 645 (2003). 38. R. Moodie et al., "An evaluation study of Uganda's AIDS control programmes


AACR Cancer Progress Report 2014  

Science Journals Connector (OSTI)

...and enforcement of social and economic policies aimed at promoting...tobacco, areca nut, alcohol, coal smoke, and salted fish. Lancet...Fathima S, et alThe global economic burden of non-communicable...Geneva, Switzerland: World Economic Forum; 2011. 16. Colditz...

Carlos L. Arteaga; Peter C. Adamson; Jeffrey A. Engelman; Margaret Foti; Richard B. Gaynor; Susan G. Hilsenbeck; Paul J. Limburg; Scott W. Lowe; Elaine R. Mardis; Scott Ramsey; Timothy R. Rebbeck; Andrea L. Richardson; Eric H. Rubin; and George J. Weiner



LHC further delayed  

Science Journals Connector (OSTI)

... on their newest toy. A report out today says that the Large Hadron Collider (LHC), the world's most powerful particle accelerator, located at CERN near Geneva, Switzerland ... are set to cost up to 35 million Swiss francs (US$29 million). The LHC will collide 7 TeV beams of protons together in the hopes of generating new particles ...

Geoff Brumfiel



LHC students face data drought  

Science Journals Connector (OSTI)

... That's because the Large Hadron Collider (LHC), the world's largest particle accelerator at CERN, outside Geneva in Switzerland, is ... in four giant detectors spread around its 27-kilometre circumference. Physicists once hoped that the LHC would start its collisions in late 2006, but last September, after a series of ...

Geoff Brumfiel



LHC prepares for data pile-up  

Science Journals Connector (OSTI)

... one of the greatest challenges this year for scientists working on the Large Hadron Collider (LHC) at CERN, Europes main high-energy physics laboratory near Geneva, Switzerland. If ... machine before decaying into lighter particles. Last year, the two biggest detectors at the LHC saw hints of a Higgs with a mass of about 125 gigaelectronvolts (energy and ...

Geoff Brumfiel



LHC plans extra year for Higgs hunt  

Science Journals Connector (OSTI)

... If the plan is implemented, the Large Hadron Collider (LHC), located at CERN, near Geneva, Switzerland, will run until the end of ... management and council in January. At stake is the particle many physicists see as the LHC's raison d'tre: the Higgs. Theorists believe that the Higgs particle, together ...

Geoff Brumfiel



LHC and space station get funding strings  

Science Journals Connector (OSTI)

... , authorizing US funding for both the International Space Station and the Large Hadron Collider (LHC) at the European Laboratory for Particle Physics (CERN) in Geneva, Switzerland, but ... both houses. But they do provide an indication of policy direction. In particular, the LHC vote represents defeat for a bid to cut funding completely, but still reflects congressional ...

Meredith Wadman



LHC sees particles circulate once more  

Science Journals Connector (OSTI)

... began circulating beams of protons around the 27-kilometre ring of the Large Hadron Collider (LHC) at CERN, Europe's particle-physics laboratory near Geneva, Switzerland. The tests bring ... at a press conference about the status of the machine. "We've shown the LHC is in superb condition." ...

Geoff Brumfiel



Did design flaws doom the LHC?  

Science Journals Connector (OSTI)

... some soul-searching. One senior scientist who helped to build the Large Hadron Collider (LHC) at CERN, Europe's particle-physics laboratory near Geneva, Switzerland, is claiming that ... 2008 could have been avoided. On 19 September 2008, just weeks before the LHC was first scheduled to start colliding protons, an electrical short caused massive damage. A ...

Geoff Brumfiel



Wood Resources International  

E-Print Network [OSTI]

Wood Resources International Wood Raw Material Consumption on the Rise Despite Weak Global Economy UNECE Timber Committee Meeting October 7-8, 2003 Geneva, Switzerland Håkan Ekström Wood Resources International #12;Wood Resources International Outline · Roundwood Removals · Roundwood Consumption · Raw


The rapid disintegration of Arctic sea ice, like the Ward Hunt Ice Shelf in Canada, is a cause for  

E-Print Network [OSTI]

Change (IPCC), after his speech at the third World Climate Conference in Geneva on Monday. The week-long event is being organized by the World Meteorological Organization (WMO), together with Switzerland technical tools for the crucial United Nations World Climate Conference in December in Copenhagen, Denmark

Stocker, Thomas


Energy Efficiency in Buildings in Switzerland  

E-Print Network [OSTI]

? Sensitivity to the decision procedure Based on experiences observed during these management seminars, the actual IEA annex 40 project of the Swiss shadow group is working to improve the com- petence of managers responsible for operation of the company.... SwissEnergy, Basic principles for optimum operation of complex installa- tions (OCI), EMDZ 805.220.1e, also published in the CD IEA Annex 40 2. SwissEnergy, Cost-efficiency arguments for optimum operation of com- plex installations...

Chuard, J.



Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait  

E-Print Network [OSTI]

and Evolution, University of Geneva, Quai Ernest-Ansermet 30, 1211 Geneva, Switzerland. 6Department of Zoology, Cambridge University, Downing Street, Cambridge CB2 3EJ, UK. 72 Boulevard Rougemont, F-13012 Marseille, France. Authors contributions LTS coordinated... , stained for all genes, were obtained from the Lagartagis Butter- fly House (Lisbon, Portugal) or field caught and kept as follows: D. plexippus (room temperature, and natural light (L) and dark (D) cycle, fed on milkweed), P. rapae (18/23C at 6D:18 L, fed...

Shirai, Leila T; Saenko, Suzanne V; Keller, Roberto A; Jeronimo, Maria A; Brakefield, Paul M; Descimon, Henri; Wahlberg, Niklas; Beldade, Patricia



Differential Cross-Section for N-P Elastic-Scattering in the Angular Range 60-Degrees Less-than Theta-Star Less-than 180-Degrees at 801.9 Mev  

E-Print Network [OSTI]

PHYSICAL REVIEW C VOLUME 30, NUMBER 2 AUGUST 1984 Differential cross section for n-p elastic scattering in the angular range 60' & 8' & 180' at 801.9 Mev Mahavir Jain, M. L. Evans, G. Glass, J. C. Hiebert, R. A. Kenefick, and L. C. Northcliffe.... Dieterle, C. P. Leavitt, and D. M. Wolfe University ofNew Mexico, Albuquerque, New Mexico 87131 D. W. %"erren~ University of Geneva, Geneva, Switzerland (Received 17 April 1984) The differential cross section for n-p elastic scattering at 801.9 MeV has...

Jain, M.; Evans, M. L.; Glass, G.; Hiebert, John C.; Kenefick, R. A.; Northcliffe, L. C.; Bonner, BE; Simmons, J. E.; Bjork, C. W.; Riley, P. J.; Bryant, H. C.; Cassapakis, C. G.; Dieterle, B.; Leavitt, C. P.; Wolfe, D. M.; Werren, D. W.



OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

CSTD Topic CSTD Topic WorldWideScience Opens International Doors by Dr. Walt Warnick 06 Jun, 2011 in Personal Perspectives On May 25, 2011, I made an invited presentation in Geneva, Switzerland at the 14th session of the United Nations' Commission on Science and Technology for Development (CSTD). I want to share with you the reception WorldWideScience.org received at this conference. palace Palace of Nations in Geneva, Switzerland CSTD and OSTI share similar goals. CSTD supports universal access for all to scientific knowledge. OSTI seeks to share DOE R&D results with as many people as possible and we partner with other organizations to create integrated products designed to attract users. Related Topics: Commission on Science and Technology for Development, CSTD, WorldWideScience.org (WWS)


OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Opens International Doors Opens International Doors by Dr. Walt Warnick on Mon, 6 Jun, 2011 On May 25, 2011, I made an invited presentation in Geneva, Switzerland at the 14th session of the United Nations' Commission on Science and Technology for Development (CSTD). I want to share with you the reception WorldWideScience.org received at this conference. palace Palace of Nations in Geneva, Switzerland CSTD and OSTI share similar goals. CSTD supports universal access for all to scientific knowledge. OSTI seeks to share DOE R&D results with as many people as possible and we partner with other organizations to create integrated products designed to attract users. Meeting attendees came from around the world and included Ministers and high-level representatives of governments, civil society representatives,

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


World Health Organization (WHO) | Open Energy Information  

Open Energy Info (EERE)

Organization (WHO) Organization (WHO) Jump to: navigation, search Logo: World Health Organization (WHO) Name World Health Organization (WHO) Address 20, avenue Appia 1211 Geneva, Switzerland Place Geneva, Switzerland Website http://www.who.int/en/ Coordinates 46.2327276°, 6.1343571° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2327276,"lon":6.1343571,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Commission on Science and Technology for Commission on Science and Technology for Development Topic WorldWideScience Opens International Doors by Dr. Walt Warnick 06 Jun, 2011 in Personal Perspectives On May 25, 2011, I made an invited presentation in Geneva, Switzerland at the 14th session of the United Nations' Commission on Science and Technology for Development (CSTD). I want to share with you the reception WorldWideScience.org received at this conference. palace Palace of Nations in Geneva, Switzerland CSTD and OSTI share similar goals. CSTD supports universal access for all to scientific knowledge. OSTI seeks to share DOE R&D results with as many people as possible and we partner with other organizations to create integrated products designed to attract users. Related Topics: Commission on Science and Technology for Development, CSTD, WorldWideScience.org (WWS)


Alan Turing's fundamental contributions to computing led to the development of modern computing technology, and his work conti-  

E-Print Network [OSTI]

work and legacy. New light is shed on the future of computing science by visionary Ray Kurzweil of Technology Lausanne (EPFL),Switzerland Easy access to the latest titles in your specific fields.Create your without notice. All errors and omissions excepted. Printed in Germany Name Street City/ZIP-Code Country E

Teuscher, Christof


A measurement of hadron production cross sections for the simulation of accelerator neutrino beams and a search for muon-neutrino to electron-neutrino oscillations in the delta m**2 about equals 1-eV**2 region  

SciTech Connect (OSTI)

A measurement of hadron production cross-sections for the simulation of accelerator neutrino beams and a search for muon neutrino to electron neutrino oscillations in the {Delta}m{sup 2} {approx} 1 eV{sup 2} region. This dissertation presents measurements from two different high energy physics experiments with a very strong connection: the Hadron Production (HARP) experiment located at CERN in Geneva, Switzerland, and the Mini Booster Neutrino Experiment (Mini-BooNE) located at Fermilab in Batavia, Illinois.

Schmitz, David W.; /Columbia U.



International Workshop on Linear Colliders 2010  

ScienceCinema (OSTI)

IWLC2010 International Workshop on Linear Colliders 2010ECFA-CLIC-ILC joint meeting: Monday 18 October - Friday 22 October 2010Venue: CERN and CICG (International Conference Centre Geneva, Switzerland)This year, the International Workshop on Linear Colliders organized by the European Committee for Future Accelerators (ECFA) will study the physics, detectors and accelerator complex of a linear collider covering both CLIC and ILC options.Contact Workshop SecretariatIWLC2010 is hostedby CERN




E-Print Network 3.0 - als geneva rationale Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technology Collection: Physics 94 IOP PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 50 (2010) 095005 (15pp) doi:10.10880029-5515509095005...


New solar twins and the metallicity and temperature scales of the GenevaCopenhagen Survey  

Science Journals Connector (OSTI)

......middle of the box. The solar twin candidates of the...the Sun. While this project was being undertaken...an average of 80 K at solar values and in decreased...been adopted to finding solar twins by groups active...range in the spectral energy distribution (SED......

Juliet Datson; Chris Flynn; Laura Portinari



Plant Pathology (Geneva) Seminars FALL 2013 All Seminars--3:30 PM (Coffee @ 3:00)  

E-Print Network [OSTI]

, fruit composition, and leaching of agrochemicals in a Finger Lakes vineyard December 4 12:20 PM Bruce Mc

Lazzaro, Brian


Annual report for the SEG Student Chapter Geneva September 2010 through September 2011  

E-Print Network [OSTI]

. In three conferences he talked about uranium fractionation during magmatic processes, a genetic classification of uranium deposits and about the parameters controlling the formation of high grade uranium research projects and trends in economic geology. Pictures from this weekend can be found here: http://www

Schibler, Ueli



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Fritz Coester Fritz Coester phone: 630/252-4089 FAX: 630/252-6008 e-mail: coester@theory.phy.anl.gov Biographical sketch 1944 Ph.D., University of Zurich, Switzerland 1944-46 Physicist, Sulzer Brothers, Ltd., Winterthur, Switzerland 1946-47 Research Associate, University of Geneva, Switzerland 1947-53 Assistant Professor, University of Iowa 1953-60 Associate Professor, University of Iowa 1960-63 Professor, University of Iowa 1963-97 Senior Physicist, Argonne National Laboratory 1997-present Post-retirement research participant, Argonne National Laborato ry 1953-54 Member, Institute for Advanced Study 1955-62 Consultant, Argonne National Laboratory 1962-63 Resident Research Associate, Argonne National Laboratory Member, Swiss Physical Society Member, European Physical Society


3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced


A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-



Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating



Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music


Switzerland County, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

County, Indiana: Energy Resources County, Indiana: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 38.8419394°, -85.0649071° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.8419394,"lon":-85.0649071,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A Stochastic Ground?Motion Model for Switzerland  

Science Journals Connector (OSTI)

...Rietbrock, 2009) stress parameters. Figure 9. Aerial view of fault and simulation directions. Note in...Irikura, H. K. Thio, P. G. Somerville, Y. Fukushima, and Y. Fukushima (2006). Attenuation relations of strong ground...

Benjamin Edwards; Donat Fh



Open Energy Info (EERE)

Published in Solar Energy - Vol. 73, 5, pp. 307-317, (2002) Published in Solar Energy - Vol. 73, 5, pp. 307-317, (2002) 1 of 23 A NEW OPERATIONAL MODEL FOR SATELLITE-DERIVED IRRADIANCES DESCRIPTION AND VALIDATION Richard Perez * Pierre Ineichen ** Kathy Moore * Marek Kmiecik * Cyril Chain *** Ray George **** Frank Vignola ***** * ASRC - The University at Albany, Albany, NY, USA ** CUEPE - University of Geneva, Geneva, Switzerland *** Vaulx-en-Velin, France **** NREL, Golden, CO, USA ***** University of Oregon, Eugene, OR, USA Published in Solar Energy - Vol. 73, 5, pp. 307-317, (2002) 2 of 23 ABSTRACT We present a new simple model capable of exploiting geostationary satellite visible images for the production of site/time specific global and direct irradiances The new model features new clear sky global and direct irradiance functions, a new


LCC-0091 Tesla-2002-08 CLIC-513  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 Tesla-2002-08 CLIC-513 July 2002 Linear Collider Collaboration Technical Notes Tests of 3 Linear Collider Beam Dynamics Simulation Programs Daniel Schulte CERN Geneva, Switzerland Peter Tenenbaum, Mark Woodley Stanford Linear Accelerator Center Menlo Park, California Nicholas Walker Andrej Wolski Lawrence Berkeley National Laboratory Berkeley, California Abstract: We report on tests of 3 linear collider beam dynamics simulation programs: PLACET. MERLIN and LIAR. The programs are used to simulate the performance of the TESLA, NLC and CLIC beamlines from the main linac to the IP. In each case the beamlines have no errors or misalignments. Tests of 3 Linear Collider Beam Dynamics Simulation Programs D. Schulte, P. Tenenbaum,

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Discovering anomaly-mediated supersymmetry at the LHC  

E-Print Network [OSTI]

.G. Lester, M.A. Parker Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge, CB3 0HE, UK. B.C. Allanach Theory Division, CERN, 1211 Geneva 23, Switzerland. P. Richardson DAMTP, Silver Street, Cambridge CB3 9EW, UK, and Cavendish... of the mass difference ?M?1 . The mAMSB Point dAix, despite being ruled out, still has a number of features which are of qualitative interest (fig. 2). The light gluino means that the decays g ? tt and bb are no longer kinematically allowed. This means...

Barr, Alan; Lester, Christopher G; Parker, Michael A; Allanach, B C; Richardson, P


Hybrid Life-Cycle Assessment of Natural Gas Based Fuel Chains for Transportation  

Science Journals Connector (OSTI)

The end use is passenger transportation with a sub-compact car that has an internal combustion engine for the natural gas case and a fuel cell for the methanol and hydrogen cases. ... Then, trucks are used to transport the fuels to a fueling station in Geneva, Switzerland. ... In evaluating fuel/vehicle options with the potential to improve the greenness of cars [diesel (direct injection) and ethanol in internal combustion engines, battery-powered, gasoline hybrid elec., and hydrogen fuel cells], we find no option dominates the others on all dimensions. ...

Anders Hammer Strmman; Christian Solli; Edgar G. Hertwich



Early Standard Model Measurement and Determination of Standard Model Background for Searches  

E-Print Network [OSTI]

The Large Hadron Collider (LHC) at CERN in Geneva (Switzerland) will go in operation in the coming months and will soon enable us to analyze the highest energy collisions ever produced at an accelerator. Beyond Standard Model searches at LHC require a detailed understanding of the detector performance, reconstruction algorithms and triggering. Precision measurements of Standard Model processes are also mandatory to acquire the necessary knowledge of Standard Model background. Both ATLAS and CMS efforts are hence addressed to determine the best calibration candles and to design a realistic plan for the initial period of data taking.

S. Beauceron



Sunseeker Energy Holding AG | Open Energy Information  

Open Energy Info (EERE)

Sunseeker Energy Holding AG Sunseeker Energy Holding AG Jump to: navigation, search Name Sunseeker Energy Holding AG Place Schindellegi, Switzerland Zip 8834 Sector Solar Product Switzerland-based company seeking to developing new generation solar and hybrid power technologies for sustainable energy use. References Sunseeker Energy Holding AG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sunseeker Energy Holding AG is a company located in Schindellegi, Switzerland . References ↑ "Sunseeker Energy Holding AG" Retrieved from "http://en.openei.org/w/index.php?title=Sunseeker_Energy_Holding_AG&oldid=351842" Categories: Clean Energy Organizations Companies Organizations



E-Print Network [OSTI]

Atomic Energy, Geneva, 1958 (United Nations, New York 1958),Atomic Energy, Geneva, 1958 (United Nations, New York, VoLof Atomic Energy, Geneva, 1958 (United Nations, New York,

Gordon, Glen E.; Larsh, Almon E.; Sikkeland, Torbjorn; Seaborg, Glenn T.



World Economic Forum | Open Energy Information  

Open Energy Info (EERE)

World Economic Forum World Economic Forum Jump to: navigation, search Logo: The World Economic Forum (WEF) Name The World Economic Forum (WEF) Address World Economic Forum Switzerland 91-93 route de la Capite, CH-1223 Cologny/Geneva Switzerland Year founded 1971 Website http://www.weforum.org Coordinates 46.2169537°, 6.18583° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2169537,"lon":6.18583,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi



Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne



Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu



CAERO | Open Energy Information  

Open Energy Info (EERE)

CAERO CAERO Jump to: navigation, search Name CAERO Place Zurich, Switzerland Zip 6300 Sector Renewable Energy, Solar Product Switzerland-based company developing renewable energy projects that present sustainable investment opportunities. It is currently focused on developing solar energy projects in Europe. Coordinates 47.37706°, 8.53955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.37706,"lon":8.53955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Meeco AG | Open Energy Information  

Open Energy Info (EERE)

Meeco AG Meeco AG Jump to: navigation, search Name meeco AG Place Zug, Switzerland Zip 6304 Sector Renewable Energy Product Switzerland-based company that offers engineering and management solutions in the areas of renewable energy, reusable resources and aviation. Coordinates 47.171507°, 8.516215° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.171507,"lon":8.516215,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MES DEA SA | Open Energy Information  

Open Energy Info (EERE)

MES DEA SA MES DEA SA Jump to: navigation, search Name MES-DEA SA Place Stabio, Switzerland Zip 6855 Sector Vehicles Product String representation "A Switzerland-b ... uel Cell Stack." is too long. Coordinates 45.852351°, 8.939383° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.852351,"lon":8.939383,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo



E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.


IBM NANOTECHNOLOGY CENTER Location: Campus of IBM Research -Zurich in Rschlikon, Switzerland  

E-Print Network [OSTI]

; photonics; and simulation and theory. #12;SUSTAINABILITY IN THE USE OF NATURAL RESOURCES The new: · Photovoltaic power system · Geothermal heat exchange system · Heat recovery windows and cutting-edge HVAC, sand and earth which will provide a new habitat for a variety of native plants, lizards and insects


Individual monitoring of internal exposure for nuclear medicine workers in Switzerland  

Science Journals Connector (OSTI)

......monitoring intake of betaemitters. Since most radiopharmaceuticals labelled with betaemitters are non-volatile...half-lives (? 6 h), such as (99m)Tc and those used in positron emission tomography...low-intensity gamma rays, i.e. (153)Sm, (177)Lu, (186)Re and (188......

S. Baechler; N. Stritt; F. O. Bochud



Palaeoseismicity studies on end-Pleistocene and Holocene lake deposits around Basle, Switzerland  

Science Journals Connector (OSTI)

......margin a patch of clastic Permian deposits is preserved...of the lake, the lake basin had a length of only...is largest at distal basin sites (Sturm et al...slumps within the lake basin or its surroundings could...in Lake Seewen Pre-historic earthquakes can be detected......

Arnfried Becker; Colin A. Davenport; Domenico Giardini



European SOFC Forum 2012 26 29 June 2012, Lucerne Switzerland B0503 / Page 1-10  

E-Print Network [OSTI]

of an industrial NiO powder is performed under 1.3 mbar of H2 (2 mlN/min) in a differentially pumped FEI Titan 80 the data obtained at different heating rates and the Kissinger method, an activation energy for the Ni an oxygen vacancy (the presence of such vacancy leads to an increase in the adsorption energy of H2, which

Dunin-Borkowski, Rafal E.


DSM Generation and Interior Orientation Determination of IKONOS Images Using a Testfield in Switzerland*  

E-Print Network [OSTI]

DSM Generation and Interior Orientation Determination of IKONOS Images Using a Testfield-resolution satellite images, IKONOS, image matching, DSM generation, in-flight calibration, interior orientation- timal imaging conditions (snow, long shadows). A sophisticated matching algorithm for DSM generation

Giger, Christine


Elie Khoury | Ph.D. Rue Marconi 19 1921 Martigny Switzerland  

E-Print Network [OSTI]

) Visiting scholar at University of Eastern Finland (Joensuu, Finland) University of Maine Le Mans, France) and NIST i-vector challenge (2014). Visiting scholarship at University of Eastern Finland of Eastern Finland Joensuu, Finland Visiting teacher Feb. 2014 University of Maine Le Mans, France Temporary

Khoury, Elie

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Distribution of authigenic albites in a limestone succession of the Helvetic Domain, eastern Switzerland  

E-Print Network [OSTI]

exclusively in limestones with a carbonate content higher than 80 wt-%. A diagenetic or hydrothermal origin contenant plus de 80 %m de carbonate. La possibilité d'une origine diagéné- tique ou hydrothermale est to a thin section scale, and we discuss a possible diagenetic or hydrothermal origin of these albites. 2

Gilli, Adrian



E-Print Network [OSTI]

micro-electro- discharge machining (micro-EDM) to fabricate magnetoelastic micro-sensor arrays sensors was fabricated, using micro-electro- discharge machining (micro-EDM) [5], each of slightly

Mason, Andrew


Characterization and Monitoring of the Furggwanghorn Rock Glacier, Turtmann Valley, Switzerland: Results from 2010 to 2012  

Science Journals Connector (OSTI)

...Two separate multiphase cables were used per borehole to...shearing zone location. Foam spacers were slipped onto the thermistor chain cables to minimize convective heat...located on a steep, less-insulated slope. The occurrence of...

Thomas Buchli; Kaspar Merz; Xiaohai Zhou; Wolfgang Kinzelbach; Sarah M. Springman


E-Print Network 3.0 - air travelers switzerland Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Travel Reimbursement Policy UT-B Contracts Div Page 1 of 2 Summary: or the first U.S. airport at which the traveler's flight arrives. (iii) "International air transportation... )...


Patient doses in CT examinations in Switzerland: implementation of national diagnostic reference levels  

Science Journals Connector (OSTI)

......Obviously, a good communication between the medical staff and the auditors represents a necessary prerequisite. These audits had the...in 18 countries: initial results from International Atomic Energy Agency projects. Radiat. Prot. Dosim. (2009) 136:118-126......

R. Treier; A. Aroua; F. R. Verdun; E. Samara; A. Stuessi; Ph. R. Trueb



The Tobacco Industry's Successful Efforts to Control Tobacco Policy Making in Switzerland  

E-Print Network [OSTI]

Seckler Plaintiff, vs. Healthy Buildings International, Inc.USA, later renamed Healthy Buildings International, HBI,ACVA, later renamed Healthy Buildings International (HBI) is

Lee, Chung-Yol MD, MPH; Glantz, Stanton A. Ph.D.




E-Print Network [OSTI]

at ETH Zurich and installed permanently at the Gregory Coud´e Telescope at Istituto Ricerche Solari it is a function of declination only. Therefore it can easily Also affiliated with ETH Zurich, CH-8092 Zurich Sciences of Wiesbaden (Germany), and the Institute of Astronomy at ETH Zurich. The scientific collaboration


Switzerland, 22 to 24 October 2012; www.abim.ch/ fileadmin/documents-abim/Presentations_2012/  

E-Print Network [OSTI]

. Lamberth, J. Dinges, in Bioactive Heterocyclic Compound Classes - Agrochemicals, C. Lamberth, J. Dinges, 2012), pp. 73­128. 25. G. Theodoridis, in Fluorine and the Environment ­ Agrochemicals, Archaeology. Miyamoto, Eds., Chirality in Agrochemicals (Wiley, Chichester, UK, 1998). 27. G. M. Ramos Tambo, D. Bellus

Dangl, Jeff


LHC Magnet Program | Superconducting Magnet Division  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Magnet Program Magnet Program The Superconducting Magnet Division is building a number of dipole magnets for the Large Hadron Collider (LHC), which is now under construction at CERN in Geneva, Switzerland. Scheduled to begin operation in 2007, this machine will collide beams of protons with the unprecedented energy of 7 TeV per beam to explore the nature of matter at its most basic level (RHIC can collide beams of protons with energies of 0.25 TeV, but is mostly used to collide heavy ions with energies of 0.1 TeV per nucleon). The magnets are being built as part of the US program, recommended by the High Energy Physics Advisory Panel (HEPAP) and approved by Congress, to contribute to the construction and, later, use of that frontier machine by the US high energy physics community. Fermi National Accelerator Laboratory (FNAL) and


United Nations Economic Commission for Europe | Open Energy Information  

Open Energy Info (EERE)

Europe Europe Jump to: navigation, search Name United Nations Economic Commission for Europe Address UN Economic Commission for Europe Information Service Palais des Nations Place Geneva, Switzerland Year founded 1947 Phone number +41 (0) 22 917 44 44 Website http://www.unece.org/Welcome.h Coordinates 46.2266748°, 6.1404115° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2266748,"lon":6.1404115,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Design studies of superconducting cos? magnets for a fast-pulsed synchrotron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BNL-68235-AB BNL-68235-AB Abstract submitted to the 17 th International Conference on Magnet Technology (MT-17), Geneva, Switzerland, September 24-28, 2001 Design studies of superconducting cosθ θ θ θ magnets for a fast-pulsed synchrotron M. Wilson, G. Moritz, G. Ganetis, A. K. Ghosh, A. Jain, J. Muratore, R. Thomas, P. Wanderer, W. Hassenzahl Part of the GSI future project is an accelerator facility with two synchrotron rings in the same tunnel. The lower and upper rings have a rigidity of 100 and 200 Tm respectively. The upper ring will be equipped with superconducting cosθ magnets. The dipoles will be operated with fields up to 4 T and ramp rates up to 4 T/s and will be similar to the RHIC- dipoles. The challenge in building such magnets is the high ramp rate. Induced coupling and persistent


The Universe Adventure - The Search for Dark Matter  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search for Dark Matter Search for Dark Matter Large Hadron Collider Particle accelerators, such as the newly constructed LHC (Large Hadron Collider) at CERN in Geneva, Switzerland, use powerful magnets to accelerate particles to velocities near that of light and collide them into target beams. Physicists analyze the spray of particles created by the collisions which may contain clues about the properties of elusive dark matter particles. Today the search for dark matter is carried out in labs, observatories, and particle accelerators around the world. Scientists hope that the next generation of experiments will finally uncover the identity of dark matter. Alternatives to Dark Matter Some cosmologists are looking for alternative theories that explain these phenomena without relying on unobservable dark matter. Most of these


Common Coil Papers  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on the common coil magnet design with Ramesh Gupta as a major author on the common coil magnet design with Ramesh Gupta as a major author (unless noted). There are many other papers on common coil magnet by several other authors that are not listed here. R. Gupta, et. al, "React & Wind Nb3Sn Common Coil Dipole", Presented at ASC 2006, August 27- September 1, 2006 in Seattle, WA, USA. J. Cozzolino, et. al., "Magnet Engineering and Test Results of the High Field Magnet R&D Program at BNL", Presented at the Applied Superconductivity Conference at Houston, TX, USA (2002). R. Gupta, et al., “R & D for Accelerator Magnets with React and Wind High Temperature Superconductors,” International Conference on Magnet Technology (MT-17) at Geneva, Switzerland (2001)... (Click here for Talk) J. Escallier, et al., "Technology Development for React and Wind


Fermilab | Science at Fermilab | Questions for the Universe | Einstein's  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

extra dimensions of space exist: extra dimensions of space exist: Large Hadron Collider, CERN, Switzerland, Geneva International Linear Collider (proposed) Further reading courtesy of Symmetry magazine Explain it in 60 Seconds: Extra dimensions Explain it in 60 Seconds: String Theory The Search for Extra Dimensions The Great String Debate Joe Lykken Joe Lykken, Fermilab physicist, discusses the exciting possibility of discovering extra dimensions in experiments that are being conducted at particle physics labs right now. View the Video Are there extra dimensions of space? The revolutionary concept of string theory is a bold realization of Einstein's dream of an ultimate explanation for everything from the tiniest quanta of particle physics to the cosmos itself. String theory unifies physics by producing all known forces and particles as different vibrations


University of Puerto Rico (Universidad de Puerto Rico) | .EDUconnections  

Office of Scientific and Technical Information (OSTI)

Portico of the Mayaguez Campus Portico of the Mayaguez Campus Research Office of Research & Technology Research Centers & Facilities UPR Research Statistics Researchers PDF DOE UPR Research Grants DOE UPR Research Records UPR Directory of Inventors Renewable Energy Projects Carribean Affordable Solar House, ScienceCinema UPR Mayagüez High Energy Physics Group The High Energy Physics Group is currently working in the experiment Compact Muon Solenoid at the Large Hadron Collider at CERN near Geneva, Switzerland. The group is funded by the U.S. DOE Office of Science. Search this site: Search The University of Puerto Rico has the largest and most diverse academic offerings in Puerto Rico and the Caribbean Resources About UPR Campuses Administration Academic Offerings International Programs


First Beam for Large Hadron Collider | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Beam for Large Hadron Collider Beam for Large Hadron Collider First Beam for Large Hadron Collider September 10, 2008 - 3:20pm Addthis WASHINGTON, DC - An international collaboration of scientists today sent the first beam of protons zooming at nearly the speed of light around the world's most powerful particle accelerator-the Large Hadron Collider (LHC)-located at the CERN laboratory near Geneva, Switzerland. The U.S. Department of Energy (DOE) and the National Science Foundation (NSF) invested a total $531 million in the construction of the accelerator and its detectors, which scientists believe could help unlock extraordinary discoveries about the nature of the physical universe. Celebrations across the U.S. and around the world mark the LHC's first circulating beam, an occasion more than 15 years in the making. An


The Omega Group, Brookhaven National Laboratory, BNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Site Details Site Details Homepage Current Experiments Past Projects Publications (pdf) Group Links Foreign & Domestic Travel Calendars (Omega\PAS) Staff Members Other Information PAS Group Brookhaven Links BNL Site Index Can't View PDFs? Omega Group Brookhaven National Laboratory Brookhaven National Laboratory Physics Department Building 510A Upton, Long Island, NY 11973 U.S.A. Current Experiments Omega Group members are collaborators on the following experiments. ATLAS Experiment (CERN: Geneva, Switzerland) - US ATLAS Collaboration - ATLAS Upgrade D0 (Fermilab: Batavia, Illinois) Proton and Deuteron EDM Experiments at the Deep Underground Science and Engineering Laboratory MicroBooNE - an experiment at Fermilab with a large Liquid Argon Time Projection Chamber (LArTPC) to be exposed to the Booster neutrino beam


World Business Council for Sustainable Development (WBCSD) | Open Energy  

Open Energy Info (EERE)

Sustainable Development (WBCSD) Sustainable Development (WBCSD) Jump to: navigation, search Logo: World Business Council for Sustainable Development Name World Business Council for Sustainable Development Address 4, chemin de Conches 1231 Conches Place Geneva, Switzerland Number of employees 201-500 Year founded 1992 Phone number +41 (0)22 839 3100 Coordinates 46.1834063°, 6.1729986° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.1834063,"lon":6.1729986,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Multilingual WorldWideScience.org: International Collaboration Speeds Multilingual WorldWideScience.org: International Collaboration Speeds Advances in E-Science Slide01 Slide01 Multilingual WorldWideScience.org: International Collaboration Speeds Advances in E-Science United Nations Commission on Science and Technology for Development Geneva, Switzerland 25 May 2011 Walter L. Warnick, Ph.D. Director, Office of Scientific and Technical Information U.S. Department of Energy Slide02 Slide02 What Is WorldWideScience.org? * A search engine covering national scientific databases and R&D results from the governments of 71 countries * A tool that integrates these results and makes them searchable by a single query, then returns them in relevance order * A virtual collection that is enormous and mostly non-Googleable * A portal that offers translations between a number of


OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Slide24 Slide25 Multilingual WorldWideScience.org: International Collaboration Speeds Advances in E-Science Slide01 Multilingual WorldWideScience.org: International Collaboration Speeds Advances in E-Science United Nations Commission on Science and Technology for Development Geneva, Switzerland 25 May 2011 Walter L. Warnick, Ph.D. Director, Office of Scientific and Technical Information U.S. Department of Energy Multilingual WorldWideScience.org: International Collaboration Speeds Advances in E-Science Slide02 What Is WorldWideScience.org? * A search engine covering national scientific databases and R&D results from the governments of 71 countries * A tool that integrates these results and makes them searchable by a single query, then returns them in

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Science Showcase - Exciting Higgs Boson Research | OSTI, US Dept of  

Office of Scientific and Technical Information (OSTI)

Exciting Higgs Boson Research Exciting Higgs Boson Research Credit: Claudia Marcelloni, CERN Some of the most exciting research happening in recent decades has been the observation and tentative confirmation of the elusive subatomic particle known as the Higgs boson at the Large Hadron Collider at CERN, Geneva, Switzerland. These findings, produced from one of the largest scientific experiments ever conducted, have provided a direction for the exploration and stringent testing of the Standard Model of physics and if it should be changed as well as new research on models of physics beyond the Standard Model. Read in detail about the Higgs boson experiments, new accelerator designs, and further explorations in Dr. William Watson's latest white paper In the OSTI Collections: the Higgs Boson.


NEWTON, Ask a Scientist at Argonne National Labs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nathan A. Unterman M.S. Nathan A. Unterman M.S. Email: nunterman@newton.dep.anl.gov FORMAL EDUCATION M.S. Science Teaching, 1988, DePaul University. Concentration in Secondary Science Curriculum Design. Courses included science content as well as curriculum design. B.S. Astronomy, 1975, University of Michigan. Minor in Physics and Mathematics, with courses including geology, meteorology, and chemistry. CONTINUING EDUCATION Illinois Oil and Natural Gas Education Conference 2012 Illinois Crude Oil and Natural Gas Core Energy Science and Math Curriculum Workshop 2012 Illinois Association of Aggregate Producers Rocks, Minerals, and Mining in Today's Society 2012 Illinois Coal Education Conference 2012 CERN High School Teachers International Program in high energy physics and physics education. Geneva, Switzerland 2011 Purdue University, Calumet ASM International Materials Science Camp 2011


LCC-0026 cover.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

6 20/09/99 6 20/09/99 CLIC Note 415 Simulations of an Intrapulse Interaction Point Feedback for the NLC September 20, 1999 Daniel Schulte CERN Geneva, Switzerland Abstract: Position and angle jitter of the beams at the interaction point are important sources of luminosity degradation in future linear colliders. In order to reduce their effect, intrapulse feedback can be used. Some simulations are presented to evaluate a position feedback at the interaction point. The influences of angle jitter onto this feedback are investigated and possible fixes are discussed. A feedback is proposed that also allows the effect of angle jitter to be reduced. Simulations of an Intra-Pulse Interaction Point Feedback for NLC D. Schulte September 27, 1999 Abstract Position and angle jitter of the beams at the


U.S. Completes Contribution to World's Most Powerful Particle Accelerator |  

Broader source: Energy.gov (indexed) [DOE]

Completes Contribution to World's Most Powerful Particle Completes Contribution to World's Most Powerful Particle Accelerator U.S. Completes Contribution to World's Most Powerful Particle Accelerator June 30, 2008 - 2:15pm Addthis WASHINGTON, DC - The U.S. contribution to the Large Hadron Collider (LHC) has been completed on budget and ahead of schedule, the U.S. Department of Energy (DOE) and the National Science Foundation (NSF) said today. The LHC, located near Geneva, Switzerland at the CERN laboratory, is the largest international scientific facility ever built. The U.S. contribution, a $531 million investment, consists of several key components of the particle accelerator and the ATLAS and CMS particle detectors. "The success of the U.S. LHC project is based on the quality of the U.S. teams, and national and international collaboration," DOE Under Secretary


Particle Physics at Discovery's Horizon  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

uslhc.us uslhc.us Particle Physics at Discovery's Horizon September 2012 Discoveries from the Compact Muon Solenoid experiment at the Large Hadron Collider at CERN in Geneva, Switzerland, promise to rev- olutionize our understanding of the universe. With more than 1000 participants from 49 institutions across the country, US CMS is the largest national group in the 3,600-member international CMS collaboration. Supported by the US Department of Energy's Office of Science and the National Science Foundation, the US CMS collaboration consists of more than 430 physicists, nearly 200 graduate students and more than 300 engineers, tech- nicians and computer scientists. The US CMS collaboration plays a vital role in the operation of the CMS detector and analysis of data from LHC collisions. US groups


LCC-0009 cover.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

09 07/1009/99 09 07/1009/99 CLIC Note 418 Using Octupoles for Background Control in Linear Colliders - an Exploratory Conceptual Study October 7, 1999 Rainer Pitthan Stanford Linear Accelerator Center Stanford, CA, USA CERN Geneva, Switzerland Abstract: If one adds a suited Octupole (or an even higher multipole) lattice to linear collider Quadrupole FODO lattices, the amplifying properties of the combined lattice drives particles in the tails, but not those in the core, into resonant losses. This nontraditional scheme for background control has the added advantage that most, or maybe all, of the Halo collimation can be done using the lever arm of the real estate of the main accelerators, thus reducing the costly length of a separate dedicated collimation section and also unifying machine protection and


Andreas Krassnigg  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Current address: Institute for Theoretical Physics Current address: Institute for Theoretical Physics University of Zagreb Bijenicka c. 32, P.P. 331 HR-10002 Zagreb, Croatia phone: +385 (1) 4605586 fax: +385 (1) 4680336 e-mail: akrassnigg@oberon.phy.hr more detailed web page: http://physik.uni-graz.at/~ank/ Biographical sketch 1998 Mag.rer.nat., Karl-Franzens-Universität Graz, Austria 1998 Participant of CERN Summer Student Programme, Geneva, Switzerland 2002 Dr. rer. nat. (Ph.D.) sub auspiciis praesidentis rei publicae, Karl-Franzens-Universität Graz, Austria 2002 Awarded the Prize in appreciation of excellent studies for the best graduates of the academic year 2001/2002 of the Austrian federal ministry of education. 2002 Postdoc, Institut für Theoretische Physik, Karl-Franzens-Universität Graz, Austria



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 CERN-AB-Report-2003-006 CLIC Note 555, CERN Fermilab-TM-2200 TESLA Report 2003-02 March 2003 Comparison of the TESLA, NLC and CLIC Beam Collimation System Performance A. Drozhdin 4 , G. Blair 6 , L. Keller 5 , W. Kozanecki 2 , T. Markiewicz 5 , T. Murayama 5 , N. Mokhov 4 , O. Napoly 2 , T. Raubenheimer 5 , D. Schulte 3 , A. Seryi 5 , P. Tenenbaum 5 , N. Walker 1 , M. Woodley 5 , F. Zimmermann 3 1. DESY, Hamburg, Germany 2. CEA-Saclay, Paris, France 3. CERN, Geneva, Switzerland 4. Fermilab, Batavia, Illinois, USA 5. SLAC, Menlo Park, CA, USA 6. University of London, London, United Kingdom March 2003 Abstract: This note describes studies performed in the framework of the Collimation Task Force organized to support the work of the


The particle world - many particles | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Why are there so many kinds of particles? Why are there so many kinds of particles? ATLAS .jpg file (381KB) More than 500 scientists from 42 US institutions participate in the ATLAS collaboration at the Large Hadron Collider at CERN in Geneva, Switzerland. (Credit: CERN) We have discovered three families of quarks and leptons, families of fundamental particles that differ only in their masses, which range from less than a millionth of the mass of an electron to the mass of an atom of gold. Just as quantum mechanics led to an understanding of the organization of the periodic table, we look to new theories to explain the patterns of elementary particles. Why do three families of particles exist, and why do their masses differ so dramatically? Current investigations focus on developing a detailed picture of the


U.S. CMS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Welcome Welcome Discoveries from the Compact Muon Solenoid (CMS) experiment at the Large Hadron Collider (LHC) at CERN in Geneva, Switzerland, promise to revolutionize our understanding of the universe. More than 900 scientists from 48 institutions in the U.S. participate in the U.S. CMS collaboration, supported by the Department of Energy and National Science Foundation. (show more) U.S. CMS View from the CMS collision hall. (Courtesy Michael Hoch, Adventure Art) U.S. CMS consists of more than 400 physicists, 200 graduate students and 200 engineers, technicians and computer scientists, making it the largest national group in the international collaboration. The U.S. collaboration is making significant contributions to nearly every aspect of the detector throughout all phases, including construction, installation and preparation


Brookhaven and ATLAS | Brookhaven and the LHC  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Brookhaven and ATLAS Brookhaven and ATLAS BNL scientists install cathode strip chambers BNL scientists install cathode strip chambers - designed and built at the Laboratory - and monitored drift tubes into the ATLAS small wheel. Image credit: CERN. Brookhaven physicists and engineers are participating in one of the most ambitious scientific projects in the world - constructing, operating, doing physics analysis of the data, and upgrading a machine the size of a seven-story building that will open up new frontiers in the human pursuit of knowledge about elementary particles and their interactions. The machine, dubbed ATLAS, is one of four facilities located at the LHC near Geneva, in Switzerland. The LHC consists of two circular vacuum pipes in which protons travel in opposite directions and collide at nearly the


Fermilab | Science at Fermilab | Questions for the Universe | The Birth of  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Tevatron, Fermilab, Batavia, IL Tevatron, Fermilab, Batavia, IL Large Hadron Collider, CERN, Geneva, Switzerland BaBar, SLAC, Menlo Park, CA Further reading courtesy of Symmetry magazine Explain it in 60 Seconds: Antimatter Explain it in 60 Seconds: CP violation BaBar's Window on the Weak Force Persis Drell Where has all the antimatter gone? Persis Drell, director of SLAC National Accelerator Laboratory, explains how answering questions about antimatter may shed light on what happened in the early universe. View the Video What happened to the antimatter? Experiments teach us that for every fundamental particle there exists an antiparticle. The big bang and its aftermath almost certainly produced particles and antiparticles in equal numbers. However, for as far out in the universe as we can probe, our observations indicate that we live in a


The Standards Forum, April 1995  

Broader source: Energy.gov (indexed) [DOE]

4 - March 1996 4 - March 1996 The Standards Volume 3. Number 4 - March 1996 ANSI Workshop Aims to Seek U.S. Viewpoint on Occupational Health and Safety Management Standards Reproduced with permission from the ANSI Reporter, February 1996. A two-day workshop that will address issues related to the development of international occupational health and safety management systems standards will be sponsored by ANSI on May 7 and 8, 1996. The information that is gath- ered at the workshop will be used by ANSI's International Advisory Commit- tee to develop a U.S. position that will be presented by an ANSI delegation on behalf of the U.S. at an International Organization for Standardization workshop scheduled to take place on September 5-6, 1996, in Geneva, Switzerland, on this issue. The ANSI workshop, which will be held


United Nations Institute for Training and Research (UNITAR) | Open Energy  

Open Energy Info (EERE)

Institute for Training and Research (UNITAR) Institute for Training and Research (UNITAR) Jump to: navigation, search Logo: United Nations Institute for Training and Research (UNITAR) Name United Nations Institute for Training and Research (UNITAR) Address International Environment House Chemin des Anémones 11-13 CH-1219 Châtelaine Place Geneva, Switzerland Phone number +41 22 917 8400 Website http://www.unitar.org/ References http://www.unitar.org/ No information has been entered for this organization. Add Organization "The United Nations Institute for Training and Research (UNITAR) is making concrete contributions to developing the capacities of tens of thousands of people around the world. Since its inception in 1965, UNITAR has built sustainable partnerships acquiring unique expertise and accumulating


World Meteorological Organization | Open Energy Information  

Open Energy Info (EERE)

World Meteorological Organization World Meteorological Organization Jump to: navigation, search Logo: World Meteorological Organization Name World Meteorological Organization Address 7bis, avenue de la Paix, Case postale 2300, CH-211 Place Geneva, Switzerland Coordinates 46.2038099°, 6.1399589° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2038099,"lon":6.1399589,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

61 - 61 - EVOLUTION OF SOME PARTICLE DETECTORS BASED ON THE DISCHARGE IN GASES G. Charpak CERN, Geneva, Switzerland. INTRODUCTION In this year 1969, if we look into the experimental techniques used around high-energy accelerators we observe the following situation: the bubble chamber is still an important tool, absorbing a large fraction of the activity of the community of experimentalists. Its evolution is directed towards a greater efficiency and rapidity in the automatic evalu- ation of pictures, and towards the building of giant chambers. What is it that keeps the bubble chamber surviving in the hostile surroundings of fast-growing counter techniques? Let us quote, for dis- cussion, some qualities and defects of a typical large hydrogen bubble chamber, 2 metres long:


Radiation damage induced by GeV electrons in W-Re and Cu targets  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 3 UCRL-JC-148049 July 2002 Linear Collider Collaboration Tech Notes Radiation Damage Induced by GeV Electrons in W-Re Targets for Next Generation Linear Colliders M.-J. Caturla 1* , S. Roesler 2 , V. K. Bharadwaj 3 , D. C. Schultz 3 , J. C. Sheppard 3 , J. Marian 1 , B. D. Wirth 1 , W. Stein 1 and A. Sunwoo 1 1 Lawrence Livermore National Laboratory Livermore, CA 2 CERN, CH-1211 Geneva 23, Switzerland 3 Stanford Linear Accelerator Center Menlo Park, California s: We have studied the structural damage of W-Re targets produced by electrons with energies of several GeV and under different conditions of total number of electrons, beam shape and target depth. We report the differences in damage levels for different designs considered in the construction of the next generation of linear accelerators, and discuss the possible effects in the lifetime


Dual-Readout Calorimetry for High-Quality Energy Measurements. Final Report  

SciTech Connect (OSTI)

This document constitutes the final report on the project Dual-Readout Calorimetry for High-Quality Energy Measurements. The project was carried out by a consortium of US and Italian physicists, led by Dr. Richard Wigmans (Texas tech University). This consortium built several particle detectors and tested these at the European Center for Nuclear Research (CERN) in Geneva, Switzerland. The idea arose to use scintillating crystals as dual-readout calorimeters. Such crystals were of course already known to provide excellent energy resolution for the detection of particles developing electromagnetic (em) showers. The efforts to separate the signals from scintillating crystals into scintillation and Cerenkov components led to four different methods by which this could be accomplished. These methods are based on a) the directionality, b) spectral differences, c) the time structure, and d) the polarization of the signals.

Wigmans, Richard; Nural, Akchurin



Superfluid helium as a technical coolant  

E-Print Network [OSTI]

The characteristics of superfluid helium as a technical coolant, which derive from its specific transport properties, are presented with particular reference to the working area in the phase diagram (saturated or pressurised helium II). We then review the principles and scaling laws of heat transport by equivalent conduction and by forced convection in pressurised helium II, thus revealing intrinsic limitations as well as technological shortcomings of these cooling methods. Once properly implemented, two-phase flow of saturated helium II presents overwhelming advantages over the previous solutions, which dictated its choice for cooling below 1.9 K the long strings of superconducting magnets in the Large Hadron Collider (LHC), a 26.7 km circumference particle collider now under construction at CERN, the European Laboratory for Particle Physics near Geneva (Switzerland). We report on recent results from the ongoing research and development programme conducted on thermohydraulics of two-phase saturated helium II...

Lebrun, P



Final Report: High Energy Physics Program (HEP), Physics Department, Princeton University  

SciTech Connect (OSTI)

The activities of the Princeton Elementary particles group funded through Department of Energy Grant# DEFG02-91 ER40671 during the period October 1, 1991 through January 31, 2013 are summarized. These activities include experiments performed at Brookhaven National Lab; the CERN Lab in Geneva, Switzerland; Fermilab; KEK in Tsukuba City, Japan; the Stanford Linear Accelerator Center; as well as extensive experimental and the- oretical studies conducted on the campus of Princeton University. Funded senior personnel include: Curtis Callan, Stephen Gubser, Valerie Halyo, Daniel Marlow, Kirk McDonald, Pe- ter Meyers, James Olsen, Pierre Pirou#19;e, Eric Prebys, A.J. Stewart Smith, Frank Shoemaker (deceased), Paul Steinhardt, David Stickland, Christopher Tully, and Liantao Wang.

Callan, Curtis G. [Princeton University; Gubser, Steven S. [Princeton University; Marlow, Daniel R. [Princeton University; McDonald, Kirk T. [Princeton University; Meyers, Peter D. [Princeton University; Olsen, James D. [Princeton University; Smith, Arthur J.S. [Princeton University; Steinhardt, Paul J. [Princeton University; Tully, Christopher G. [Princeton University; Stickland, David P. [Princeton University


Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Determination of the minimum value of the safety factor from geodesic Alfven eigenmodes in Joint European Torus  

SciTech Connect (OSTI)

An analysis of the experimental conditions under which low-frequency (70-150 kHz) Alfven eigenmodes (AE) are excited during the monster sawtooth in Joint European Torus [F. Romanelli et al., Proceedings of the 22nd IAEA Fusion Energy Conference, Geneva, Switzerland, 2008] is presented for the specific case of a discharge with ion cyclotron heating (5 MW). Using a simplified AE model for modes excited at the Alfven wave continuum maximum with geodesic corrections taken into account, the temporal evolution of the value of the safety factor q{sub 0} at the magnetic axis is determined. We describe a new scheme to determine the time variation of q{sub 0} that works under conditions in which other standard diagnostics, such as the motional Stark effect do not give reliable results such as during a monster sawtooth.

Elfimov, A. G. [Institute of Physics, University of Sao Paulo, 05508-090 Sao Paulo (Brazil); Galvao, R. M. O. [Institute of Physics, University of Sao Paulo, 05508-090 Sao Paulo (Brazil); Centro Brasileiro de Pesquisas em Fisica, Rua Xavier Sigaud 150, BR-22290180 Rio de Janeiro (Brazil); Sharapov, S. E. [Euratom/CCFE Fusion Association, Culham Science Centre, Abingdon OX14 3DB (United Kingdom)



Final Scientific EFNUDAT Workshop  

ScienceCinema (OSTI)

The Final Scientific EFNUDAT Workshop - organized by the CERN/EN-STI group on behalf of n_TOF Collaboration - will be held at CERN, Geneva (Switzerland) from 30 August to 2 September 2010 inclusive.EFNUDAT website: http://www.efnudat.euTopics of interest include: Data evaluationCross section measurementsExperimental techniquesUncertainties and covariancesFission propertiesCurrent and future facilitiesInternational Advisory Committee: C. Barreau (CENBG, France)T. Belgya (IKI KFKI, Hungary)E. Gonzalez (CIEMAT, Spain)F. Gunsing (CEA, France)F.-J. Hambsch (IRMM, Belgium)A. Junghans (FZD, Germany)R. Nolte (PTB, Germany)S. Pomp (TSL UU, Sweden)Workshop Organizing Committee: Enrico Chiaveri (Chairman)Marco CalvianiSamuel AndriamonjeEric BerthoumieuxCarlos GuerreroRoberto LositoVasilis VlachoudisWorkshop Assistant: Graldine Jean




World Trade Organization | Open Energy Information  

Open Energy Info (EERE)

Logo: World Trade Organization Name World Trade Organization Address Rue de Lausanne 154, CH-1211 Place Geneva, Switzerland Number of employees 501-1000 Phone number +41 (0)22 739 51 11 Website http://www.wto.org/index.htm Coordinates 46.2238973°, 6.1496442° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2238973,"lon":6.1496442,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE's Office of Science Launches Website for U.S. Role at Large Hadron  

Broader source: Energy.gov (indexed) [DOE]

Launches Website for U.S. Role at Large Launches Website for U.S. Role at Large Hadron Collider DOE's Office of Science Launches Website for U.S. Role at Large Hadron Collider September 12, 2007 - 2:32pm Addthis U.S. scientists join international colleagues to explore universe's mysteries at world's largest scientific experiments WASHINGTON, DC - The U.S. Department of Energy's Office of Science today launched a new website to tell the story of the U.S. role in the Large Hadron Collider (LHC), a particle accelerator that will begin operating in Europe, near Geneva, Switzerland, next year. Hundreds of physicists, engineers and students from the United States are joining with colleagues from around the globe in the largest and most complex scientific experiments ever built. The LHC experiments will address some of the most



Open Energy Info (EERE)

ASES 2003, Austin TX and submitted for publication in Solar Energy ASES 2003, Austin TX and submitted for publication in Solar Energy PRODUCING SATELLITE-DERIVED IRRADIANCES IN COMPLEX ARID TERRAIN Richard Perez & Marek Kmiecik ASRC, the University at Albany 251 Fuller Rd. Albany, NY 12203 perez@asrc.cestm.albany.edu Pierre Ineichen, CUEPE, University of Geneva 7 Route de Drize 1227 Carouge, Switzerland Pierre.Ineichen@cuepe.unige.ch Marek Kmiecik, ASRC Kathleen Moore, IED 251 Fuller Rd. Albany, NY 12203 moore@iedat.com David Renne & Ray George NREL 1617 Cole Blvd. Golden, CO 80401 drenne / ray_george@nrel.nrel.gov ABSTRACT This paper describes a methodology to correct satellite- derived irradiances over complex terrain. The correction applies to satellite models using visible images from geostationary satellites. 1. DESCRIPTION OF CURRENT MODEL


The Centre Universitaire d'Informatique, located in the Uni-Dufour building at the University of Geneva, is one of the  

E-Print Network [OSTI]

. Current research activities focus on machine learning and data mining, natural language processing Prados, P. A. Binz (2004). Data mining for mass spectra-based cancer diagnosis and biomarker discovery and Multimodal Interactions. As you will discover in reading this activity report, the range and depth of our

Genève, Université de


nature methods | VOL.7 NO.9 | SEPTEMBER 2010 | 681 1The Research Institute of the McGill University  

E-Print Network [OSTI]

of Technology (ETH) Zurich, Zurich, Switzerland. 5Faculty of Science, University of Zurich, Zurich, Switzerland

Cai, Long


The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]



Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce


The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert


UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.



Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.


E-Print Network 3.0 - acute mercury inhalation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)



E-Print Network 3.0 - acute mercury poisoning Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)



E-Print Network 3.0 - abandoned halkoy mercury Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)



2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter


2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Constitutional Environment and Entrepreneurship: An Empirical Study  

E-Print Network [OSTI]

Singapore Slovenia Spain Suriname Switzerland Tanzania TongaSingapore Slovenia Spain Suriname Switzerland Tanzania TongaSingapore Slovenia Spain Suriname Switzerland Tanzania Tonga

Zhang, Wei


Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Past, Current and Future Trends in Tobacco Use  

E-Print Network [OSTI]

Spain Sri Lanka Sudan Suriname Swaziland Sweden SwitzerlandSpain Sri Lanka Sudan Suriname Swaziland Sweden SwitzerlandSpain Sri Lanka Sudan Suriname Swaziland Sweden Switzerland

Guindon, G. Emmanuel; Boisclair, David



ISIT 2002, Lausanne, Switzerland, June 30 -July 5,2002 Iterative Decoding Algorithmsfor I-Q Space-TimeCodes  

E-Print Network [OSTI]

encoders are trellis codes employing a 1-D constellation such as M-PAM. The 2-D signal sfto be transmitted is assumed. The received signal is nt Yl = asCcxlsf+171, (1) i=l where E, is the average energy at each independent stages: the encoding using the I and Q codes, and the I-Q mapping to the 2-D signal constellation

Zummo, Salam Adel


Numerical Modeling of Gas Migration at a Proposed Repository for Low and Intermediate Level Nuclear Wastes at Oberbauenstock, Switzerland  

E-Print Network [OSTI]

repository rate, based on average cavern length of 466m.total length of the storage caverns is approximately 4660 m.With 10 caverns in parallel, average cavern length is 466 m,

Pruess editor, K.



C. Stephanidis (Ed.): HCII 2014 Posters, Part I, CCIS 434, pp. 368372, 2014. Springer International Publishing Switzerland 2014  

E-Print Network [OSTI]

recognition where higher accuracy is required than is currently achievable by automated systems, but where to accomplish. Performing the task automatically by machine usually can be done rapidly but the accuracy level automated tool, another way of improving automated tools is by employing human assistance in tasks where

Tappert, Charles


J. Blanc-Talon et al. (Eds.): ACIVS 2013, LNCS 8192, pp. 389401, 2013. Springer International Publishing Switzerland 2013  

E-Print Network [OSTI]

is a complex task, which contributes to what is known as the 'Big Data Challenge' [1]. Reducing the complexity: An Experimental Evaluation Pierre Payeur1 , Phillip Curtis1 , and Ana-Maria Cretu2 1 School of Electrical of the large amount of data generated, which often preempts full usage of the information available

Payeur, Pierre


In Proceedings of the Symposium on Virtual Reality Software and Technology (VRST-97), Lausanne, Switzerland, September 1517, 1997, pp. 8794  

E-Print Network [OSTI]

), 81925 Munich, Germany EE Dept., California Inst. of Technology, MC 136-93, Pasadena, CA 91125 Autodesk-2100 Dept of Comp & Info Science, IUPUI, 723 W. Michigan St, Indianapolis, IN 46202-5132 Email: dieter.koller@autodesk

Barr, Al


45th Discussion forum on LCAenvironmentally extended inputoutput analysis and LCA, September 15, 2011, Berne, Switzerland  

Science Journals Connector (OSTI)

The discussion forum on life cycle assessment (LCA) on September 15, 2011, aimed at ... analysis (EE-IOA) and the combination with LCA for the computation of environmental impact of ... regions. The combination w...

Romina Schuerch; Josef Kaenzig




E-Print Network [OSTI]

of the Intergovernmental Panel on Climate Change (IPCC). He knows why it is important to be up to speed at all times. Why by the fact that we can use climate models to understand climate change and even gauge how it will develop as the biggest challenge in terms of climate change? "First of all, we urgently need to define a global climate

Stocker, Thomas


Mass movement-induced fold-and-thrust belt structures in unconsolidated sediments in Lake Lucerne (Switzerland)  

E-Print Network [OSTI]

Mass movement-induced fold-and-thrust belt structures in unconsolidated sediments in Lake Lucerne-lying, unconsolidated sediment at the foot of subaqueous slopes. These deformation structures appear beneath wedges

Gilli, Adrian


4th International Workshop on Equation-Based Object-Oriented Modeling Languages and Tools, September, 2011, ETH Zrich, Switzerland.  

E-Print Network [OSTI]

4th International Workshop on Equation-Based Object-Oriented Modeling Languages and Tools is an equation-based, object- oriented mathematical modeling language suited to modeling complex physical systems in Modelica Toby Myers1 Wladimir Schamai2 Peter Fritzson3 1 Institute of Intelligent and Integrated Systems

Zhao, Yuxiao


International Workshop on Geomechanics and Energy The Ground as Energy Source and Storage Lausanne, Switzerland, 26-28 November 2013  

E-Print Network [OSTI]

in the ground from other technologies, such as solar panels, will lead to higher temperature variations. Soils and downwards when it contracts. The entity of this effect on the behaviour of the foundation depends that the material contracts upon heating in NC conditions and a significant part of this deformation is irreversible

Candea, George


Grubbing by wild boars (Sus scrofa L.) and its impact on hardwood forest soil carbon dioxide emissions in Switzerland  

Science Journals Connector (OSTI)

Interest in soil C storage and release has increased in recent years. In addition to factors such as climate/land-use change, vertebrate animals can have a considerable impact on soil CO2 emissions. To date, most...

Anita C. Risch; Sven Wirthner; Matt D. Busse; Deborah S. Page-Dumroese



International Micro Electro Mechanical Systems Conference, MEMS 2001, Interlaken, Switzerland, January 2001 1 AN ELECTROSTATIC INDUCTION MICROMOTOR  

E-Print Network [OSTI]

for such micromachines include dime- sized gas-turbine generators powering mobile electronic devices, motor-driven pumps-lubricated bearings - A pair of hydrostatic thrust bearings floats the rotor in the axial direction, while

Frechette, Luc G.


Meyer Burger AG | Open Energy Information  

Open Energy Info (EERE)

Meyer Burger AG Meyer Burger AG Jump to: navigation, search Name Meyer Burger AG Place Steffisburg, Switzerland Zip 3613 Sector Solar Product Manufactures wire saws for cutting and processing hard, brittle materials - such as silicon solar feedstock. Coordinates 46.77862°, 7.633955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.77862,"lon":7.633955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Edisun Power AG | Open Energy Information  

Open Energy Info (EERE)

Edisun Power AG Edisun Power AG Jump to: navigation, search Name Edisun Power AG Place Zurich, Switzerland Zip 8006 Sector Solar Product Edisun Power Europe AG finances, acquires and operates solar power installations, and markets solar power. Coordinates 47.37706°, 8.53955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.37706,"lon":8.53955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GEE Energy GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

GEE Energy GmbH Co KG GEE Energy GmbH Co KG Jump to: navigation, search Name GEE Energy GmbH & Co. KG Place Hamburg, Germany Zip 20459 Sector Biomass Product Biomass trader delivering wood pellets, wood and bark briquettes to Germany, Scandinavia, Austria, Italy and Switzerland. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alteno AG | Open Energy Information  

Open Energy Info (EERE)

Alteno AG Alteno AG Jump to: navigation, search Name Alteno AG Place Basel, Switzerland Zip 4057 Sector Solar Product Installer of solar PV and passive plants in Basel and Zurich. Coordinates 47.548807°, 7.58782° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.548807,"lon":7.58782,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Jura Energie | Open Energy Information  

Open Energy Info (EERE)

Jura Energie Jura Energie Place Cerneux-Veusil, Belgium Zip 2345 Sector Solar, Wind energy Product Wind and solar project developer and system integrator. Active in Belgium, France and Switzerland. Coordinates 48.692879°, 3.34533° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.692879,"lon":3.34533,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Huber and Suhner AG | Open Energy Information  

Open Energy Info (EERE)

and Suhner AG and Suhner AG Jump to: navigation, search Name Huber and Suhner AG Place Pfaeffikon, Switzerland Zip 8330 Sector Solar Product Huber and Suhner specialises in electrical and optical connectivity solutions and makes solar module components. Coordinates 47.367448°, 8.781544° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.367448,"lon":8.781544,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Open Energy Info (EERE)

SOMASED - RENEWABLE ENERGY SUSTAINABLE DEVELOPMENT SOMASED - RENEWABLE ENERGY SUSTAINABLE DEVELOPMENT Jump to: navigation, search Name SOMASED - RENEWABLE ENERGY SUSTAINABLE DEVELOPMENT Address RUE DE PLACE D'ARMES 6 Place FLEURIER, SWITZERLAND Zip 2114 Sector Wind energy Coordinates 46.9025879°, 6.5786091° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.9025879,"lon":6.5786091,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Voegelin GmbH | Open Energy Information  

Open Energy Info (EERE)

Voegelin GmbH Voegelin GmbH Jump to: navigation, search Name Voegelin GmbH Place Flurlingen, Switzerland Zip CH-8247 Sector Solar Product Swiss-based PV and solar thermal system installer. Coordinates 47.68414°, 8.628247° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.68414,"lon":8.628247,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Industriellen Werke Basel IWB | Open Energy Information  

Open Energy Info (EERE)

Industriellen Werke Basel IWB Industriellen Werke Basel IWB Jump to: navigation, search Name Industriellen Werke Basel (IWB) Place Basel, Switzerland Zip 4002 Sector Solar Product Swiss utility with a possible interest in investment in solar plants in other geographies. Coordinates 47.548807°, 7.58782° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.548807,"lon":7.58782,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


nature methods | VOL.9 NO.6 | JUNE2012 | 555 The ability to detect and quantify proteins or sets of  

E-Print Network [OSTI]

of Biochemistry, ETH Zurich, Zurich, Switzerland. 2Department of Biology, Institute of Molecular Systems Biology, ETH Zurich, Zurich, Switzerland. 3Competence Center for Systems Physiology and Metabolic Diseases, Zurich, Switzerland. 4Faculty of Science, University of Zurich, Zurich, Switzerland. Correspondence

Cai, Long


Cross Capital AG | Open Energy Information  

Open Energy Info (EERE)

Cross Capital AG Cross Capital AG Jump to: navigation, search Name Cross Capital AG Place Zug, Switzerland Zip 6300 Sector Solar Product Switzerland-based company that participates in enterprises of all kinds at home and abroad. The company Shares a 50% stake in the Ibersol STEG project with German solar developer Solar Millennium. Coordinates 47.171507°, 8.516215° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.171507,"lon":8.516215,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)


Press Pass - Press Release - U.S. LHC first beam  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8-15 8-15 Aug. 8, 2008 For immediate release Media Contacts: Brookhaven National Laboratory - Kendra Snyder, ksnyder@bnl.gov, 631-344-8191 Fermilab - Judy Jackson, 630-840-3351, jjackson@fnal.gov Lawrence Berkeley National Laboratory - Dan Krotz, dakrotz@lbl.gov, (510) 486-4019 and Paul Preuss, paul_preuss@lbl.gov, 510-486-6249 CERN - James Gillies, james.gillies@cern.ch, +41 22 767 4101 Photos and graphics of the Large Hadron Collider are available at: http://multimedia-gallery.web.cern.ch/multimedia-gallery/PhotoGallery_Main.aspx and http://www.uslhc.us/Images. U.S. scientists count down to LHC startup Batavia, IL, Berkeley, CA and Upton, NY - On September 10, scientists at the Large Hadron Collider will attempt for the first time to send a proton beam zooming around the 27-kilometer-long accelerator. The LHC, the world's most powerful particle accelerator, is located at CERN in Geneva, Switzerland. Journalists are invited to attend LHC first beam events at CERN and several locations within the United States. Information about the CERN event and accreditation procedures is available at . A list of LHC startup events in the U.S. and contact information for each is available at http://www.uslhc.us/first_beam.


Fermi 3/29/02  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

31, 2003 31, 2003 Number 2 f Photo by Reidar Hahn I N S I D E : 2 C E R N R e c e i v e s F i r s t U . S . - B u i l t C o m p o n e n t f o r L a r g e H a d r o n C o l l i d e r 4 D Z e r o G o e s G l o b a l 8 N e w H e a d o f P r o g r a m P l a n n i n g 1 0 R e a c h i n g O u t : L e d e r m a n F e l l o w s B r i n g S c i e n c e t o t h e P u b l i c Professor Prairie 12 2 FERMINEWS Friday, January 31, 2003 GENEVA, Switzerland-In a milestone for global science collaboration, the European Organization for Nuclear Research (CERN) took delivery on Tuesday, January 21, of the first U.S.-built contribution to what will be the world's highest-energy particle accelerator. The superconducting magnet, built at the U.S. Brookhaven National Laboratory, will become a key component of the Large Hadron Collider (LHC). It is the first of several advanced accelerator elements the U.S. will provide


International Centre for Trade and Sustainable Development | Open Energy  

Open Energy Info (EERE)

Trade and Sustainable Development Trade and Sustainable Development Jump to: navigation, search Name International Centre for Trade and Sustainable Development Address International Environment House 2 Chemin de Balexert 7-9 1219 Châtelaine Place Geneva, Switzerland Year founded 1996 Phone number + 41 22 917 84 92 Website http://ictsd.org/ Coordinates 46.2151128°, 6.1084892° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.2151128,"lon":6.1084892,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

For copies of this Booklet and of the full Review to be sent to addresses in the Americas, Australasia, or the Far East, visit http://pdg.lbl.gov/pdgmail or write to Particle Data Group MS 50R6008 Lawrence Berkeley National Laboratory Berkeley, CA 94720-8166, USA From all other areas, visit http://www.cern.ch/library or write to CERN Scientific Information Service CH-1211 Geneva 23 Switzerland To make comments or corrections, send e-mail to PDG@LBL.GOV. We acknowledge all e-mail via e-mail. No reply indicates nonreceipt. Please try again. Visit our WWW site: http://pdg.lbl.gov/ The publication of the Review of Particle Physics is supported by the Director, Office of Science, Office of High Energy and Nuclear Physics, the Division of High Energy Physics of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231; by the U.S. National Science Foundation under Agreement


Press Pass - Press Release - U.S. scientists join in "cosmic challenge" at  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 7 July 26, 2006 Media Contact: Judy Jackson, Fermilab, 630-840-4112, jjackson@fnal.gov For immediate release U.S. scientists join in "cosmic challenge" at CERN's Large Hadron Collider Batavia, Ill.--Scientists at the Department of Energy's Fermi National Accelerator Laboratory joined collaborators from around the world in announcing today (July 26) that the giant CMS detector at CERN, the European Organization for Nuclear Research, in Geneva, Switzerland, has been sealed and switched on to collect data for an important series of tests using cosmic ray particles. Cosmic rays from space provide a source of high-energy particles like those from accelerator-generated particle collisions. U.S. physicists are among the CMS scientists taking and analyzing data from cosmic rays to calibrate and align the CMS particle detector in preparation for the start-up of the Large Hadron Collider accelerator at CERN next year. DOE's Fermilab, near Chicago, Illinois, serves as the host laboratory for the U.S. CMS collaboration, and the U.S. helped to fund the design and construction of the detector.


Thermal conductivity of diamond-loaded glues for the ATLAS particle physics detector  

E-Print Network [OSTI]

The ATLAS experiment is one of two large general-purpose particle detectors at the Large Hadron Collider (LHC) at the CERN laboratory in Geneva, Switzerland. ATLAS has been collecting data from the collisions of protons since December 2009, in order to investigate the conditions that existed during the early Universe and the origins of mass, and other topics in fundamental particle physics. The innermost layers of the ATLAS detector will be exposed to the most radiation over the first few years of operation at the LHC. In particular, the layer closest to the beam pipe, the B-layer, will degrade over time due to the added radiation. To compensate for its degradation, it will be replaced with an Insertable B-Layer (IBL) around 2016. The design of and R&D for the IBL is ongoing, as the hope is to use the most current technologies in the building of this new sub-detector layer. One topic of interest is the use of more thermally conductive glues in the construction of the IBL, in order to facilitate in the dissipation of heat from the detector. In this paper the measurement and use of highly thermally conductive glues, in particular those that are diamond-loaded, will be discussed. The modified transient plane source technique for thermal conductivity is applied in characterizing the glues across a wide temperature range.

E. A. Ouellette; A. Harris



Determination of effective axion masses in the helium-3 buffer of CAST  

SciTech Connect (OSTI)

The CERN Axion Solar Telescope (CAST) is a ground based experiment located in Geneva (Switzerland) searching for axions coming from the Sun. Axions, hypothetical particles that not only could solve the strong CP problem but also be one of the favored candidates for dark matter, can be produced in the core of the Sun via the Primakoff effect. They can be reconverted into X-ray photons on Earth in the presence of strong electromagnetic fields. In order to look for axions, CAST points a decommissioned LHC prototype dipole magnet with different X-ray detectors installed in both ends of the magnet towards the Sun. The analysis of the data acquired during the first phase of the experiment yielded the most restrictive experimental upper limit on the axion-to-photon coupling constant for axion masses up to about 0.02 eV/c{sup 2}. During the second phase, CAST extends its mass sensitivity by tuning the electron density present in the magnetic field region. Injecting precise amounts of helium gas has enabled CAST to look for axion masses up to 1.2 eV/c{sup 2}. This paper studies the determination of the effective axion masses scanned at CAST during its second phase. The use of a helium gas buffer at temperatures of 1.8 K has required a detailed knowledge of the gas density distribution. Complete sets of computational fluid dynamic simulations validated with experimental data have been crucial to obtain accurate results.

Ruz, J



The heart of ATLAS Commissioning and performance of the ATLAS silicon tracker  

E-Print Network [OSTI]

The Large Hadron Collider (LHC) has been built under the french-swiss border near Geneva, Switzerland. Two opposing beams of protons will collide with a centre of mass energy of 14 TeV, an energy seven million times that of the first accelerator. The LHC takes particle physics research to a new frontier. On September 10th 2008, the first single pilot beam of $2 x 10^9$ protons was circulated successfully through the entire LHC, with an injection energy of 0.45 TeV. The first collisions are expected in Summer 2009. One of the experiments designed to search for new particle phenomena is the ATLAS experiment. This is a general purpose detector capable of detecting and measuring the broadest range of particle signals. At the heart of the ATLAS detector lies the SemiConductor Tracker (SCT). It is a central part of the inner detector providing precision measurements of particle trajectories over a large $\\eta$ range. The work presented in this thesis focuses on the performance and commissioning of the SCT detector....

Magrath, Caroline Alexandra



Minimizing the background radiation in the new neutron time-of-flight facility at CERN FLUKA Monte Carlo simulations for the optimization of the n_TOF second experimental line  

E-Print Network [OSTI]

At the particle physics laboratory CERN in Geneva, Switzerland, the Neutron Time-of-Flight facility has recently started the construction of a second experimental line. The new neutron beam line will unavoidably induce radiation in both the experimental area and in nearby accessible areas. Computer simulations for the minimization of the background were carried out using the FLUKA Monte Carlo simulation package. The background radiation in the new experimental area needs to be kept to a minimum during measurements. This was studied with focus on the contributions from backscattering in the beam dump. The beam dump was originally designed for shielding the outside area using a block of iron covered in concrete. However, the backscattering was never studied in detail. In this thesis, the fluences (i.e. the flux integrated over time) of neutrons and photons were studied in the experimental area while the beam dump design was modified. An optimized design was obtained by stopping the fast neutrons in a high Z mat...

Bergstrm, Ida; Elfgren, Erik



Rough set approach to the evaluation of stormwater pollution  

Science Journals Connector (OSTI)

This paper addresses the problem of urban stormwater quality and its impacts on the receiving water. In order to describe this phenomenon, research aimed at creating a mathematical model of pollution has been conducted. Although various deterministic and stochastic models exist already, the quality of stormwater phenomenon deserves a very careful and thoughtful validation. In order to take advantage of some empirical observations available, we introduce an inductive learning method to discover some regularities in form of ''if...then...'' rules. We suggest the use of the rough set theory for this purpose. This approach is able to process both quantitative and qualitative data and also accepts inconsistency in the dataset. The rules generated from the data explain the phenomenon in terms of relevant attributes, and can be used to predict the level of pollution from future events. We present the results of the rough set analysis of a dataset concerning five catchments in the urban area of Lausanne and Geneva, Switzerland. The application of the rules to events from other catchments, particularly in France, proves the good prediction ability of our model.

Luca Rossi; Roman Slowinski; Robert Susmaga



Microsoft Word - SCReportMarch05.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DOE/NSF U.S. LHC PROGRAM OFFICE DOE/NSF U.S. LHC PROGRAM OFFICE JUNE 6, 2005 REPORT ON THE JOINT DOE/NSF REVIEW OF U.S. LHC SOFTWARE AND COMPUTING BNL, 1-4 MARCH 2005 REPORT TO THE U.S. DEPARTMENT OF ENERGY AND THE NATIONAL SCIENCE FOUNDATION 2 TABLE OF CONTENTS EXECUTIVE SUMMARY 3 1. INTRODUCTION 9 2. MANAGEMENT 11 3. FACILITIES AND GRIDS 18 4. CORE SOFTWARE 30 5. APPENDICES A. Charge to Committee 36 B. Committee membership 39 C. Agenda for the meeting 40 3 EXECUTIVE SUMMARY ATLAS and CMS will be general-purpose detectors at the LHC, a high-luminosity proton-on-proton collider located at CERN in Geneva, Switzerland. The collider will operate at 7 TeV per beam and is expected to turn on in mid-2007. The U.S., recognizing the great physics opportunities at the energy frontier, has invested substantially in the


World Business Council for Sustainable Development (WBCSD) | Open Energy  

Open Energy Info (EERE)

World Business Council for Sustainable Development (WBCSD) World Business Council for Sustainable Development (WBCSD) (Redirected from World Business Council for Sustainable Development) Jump to: navigation, search Logo: World Business Council for Sustainable Development Name World Business Council for Sustainable Development Address 4, chemin de Conches 1231 Conches Place Geneva, Switzerland Number of employees 201-500 Year founded 1992 Phone number +41 (0)22 839 3100 Coordinates 46.1834063°, 6.1729986° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.1834063,"lon":6.1729986,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wind Energy Resource Atlas of Armenia (CD-ROM)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...


Appears in 11th Int. Conf. on Information Visualization (IV 2007), Zurich, Switzerland, July 3-6, 2007 Visual Mashup of Text and Media Search Results  

E-Print Network [OSTI]

would be difficult to show in a series of mini-displays arranged in a grid layout. 1. Introduction visualization: a) multiple mini-displays for each data source can be created that are then shown and "combined. On the one hand, the former solution is simple to create by placing the mini-displays next to each other

Spoerri, Anselm


In Proceedings of 1st International Conference on Dextrous Autonomous Robots and Humanoids (darh2005) Yverdon-les-Bains -Switzerland, paper nr. 3.2, May 2005.  

E-Print Network [OSTI]

of Computer Science Georges-K¨ohler-Allee 52, 79110 Freiburg, Germany {behnke, jmuller, schreibe}@informatik.uni-freiburg.de Abstract Small humanoid robots available today often lack computing power and vision sensors. They fre have ample computing power to run image processing, self-localization, behavior control

Behnke, Sven

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


6th International Workshop on Parallel Matrix Algorithms and Applications (PMAA'10) June 30 July 2, 2010, University of Basel, Switzerland  

E-Print Network [OSTI]

. of Computer Science, Univ. of Haifa, Haifa 31905, Israel. Email: gordon@cs.haifa.ac.il 2 Dept. of Aerospace of the Helmholtz equation is a challenging computational task, par- ticularly when the wave number is large. Recent enhancements of the shifted Laplacian pre- conditioner, originally introduced in [1]. For a recent survey

Gordon, Dan


Detrital thermochronology of the Alpine foreland basin in Central Switzerland: Insights into tectonic and erosion history of the North Central Alps  

E-Print Network [OSTI]

This study systematically integrates zircon U-Pb geochronology and (U-Th)/He low-temperature thermochronology to correlate the Northern Alpine Foreland Basin (NAFB) sediment provenance and the tectonic and thermal evolution of the thrust stack...

Miller, Joseph Christopher



Seismic wave attenuation from borehole and surface records in the top 2.5km beneath the city of Basel, Switzerland  

Science Journals Connector (OSTI)

......Figure 2 Overview of the borehole profile in the injection...from surface (top of drilling basement). 3 Seismic...separate institutions. Borehole sensors of Geothermal...also seen for other borehole stations. The number...stacking and the generally large number of spectra......

Falko Bethmann; Nicholas Deichmann; P. Martin Mai




E-Print Network [OSTI]

noises, coughing of nearby passengers or other sounds which are ubiquitously available. Based on the TDOA

Schindelhauer, Christian


Conclusions of the International RILEM TC 186-ISA Workshop on Internal Sulfate Attack and Delayed Ettringite Formation (46 September 2002, Villars, Switzerland)  

Science Journals Connector (OSTI)

A RILEM technical committee on Internal Sulfate Attack (TC 186-ISA) was established in 1996. In the ensuing years considerable research was carried out, which helped to clarify the scientific knowledge surroundin...

K. Scrivener; J. P. Skalny



Summary of a two-page feature article in the Berner Zeitung newspaper of Switzerland Sat/Sun 8/9 September 2012  

E-Print Network [OSTI]

/9 September 2012 Reinventing the toilet for the poor One of the sessions at the recently held 3rd International Conference on Research for Development 2012 was devoted to the topic of improving sanitation sanitation hasn't been able to keep pace with the rapid growth," says Dr. Koottatep, an environmental

Richner, Heinz


1 | P a g e A lymphotoxin-driven pathway to hepatocellular carcinoma  

E-Print Network [OSTI]

(ETH), Zurich, Schlieren, CH 8952 Schlieren, Switzerland. 6 Swiss HPB (Hepato Hospital Zurich, CH 8091 Zurich, Switzerland. 3 Functional Genomics Center Zurich, University Zurich, CH 8057 Zurich, Switzerland. 4 Department of Pathology, Cantonal Hospital Aarau, CH 5001 Aarau

Paris-Sud XI, Université de


Ocular motor disorders Dominik Straumanna  

E-Print Network [OSTI]

Department, ETH Zurich, Zurich, Switzerland Correspondence to Dominik Straumann, Neurology Department, Zurich Williams & Wilkins. a Neurology Department, Zurich University Hospital, Zurich, Switzerland and b Physics University Hospital, Zurich, Switzerland Tel: +41 1 255 5564; fax: +41 1 255 4507; e

Haslwanter, Thomas


Quantifying the impact of mechanical layering and underthrusting on the dynamics  

E-Print Network [OSTI]

. Hetényi4,5 , D. A. May5 , and B. J. P. Kaus6 1 Geological Institute, ETH Zurich, Zurich, Switzerland, 2, ETH Zurich, Zurich, Switzerland, 5 Institute of Geophysics, ETH Zurich, Zurich, Switzerland, 6

Kaus, Boris


TECHNICAL ADVANCE EVE (external variance estimation) increases statistical power  

E-Print Network [OSTI]

for Statistics, ETH Zurich, CH-8092, Zurich, Switzerland, 2 Colab, ETH Zurich, CH-8092 Zurich, Switzerland, and 3 Institute of Plant Sciences & Zurich­Basel Plant Science Center, ETH Zurich, CH-8092 Zurich, Switzerland

Buehlmann, Peter


Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren


Effects of Orthographic Depth on Literacy Performance: Reading Comprehension Difficulties Across Languages  

E-Print Network [OSTI]

Simple Shallow Finnish (Finland) Italian (Switzerland)Dutch (Belgium) Swedish (Finland) Deep French (Canada/Assessment in Finland and Switzerland 46

McClung, Nicola Ann



Finite Lattice-Size Effects in MIMO Detection C. Studer, D. Seethaler, and H. Blcskei  

E-Print Network [OSTI]

Systems Laboratory ETH Zurich, 8092 Zurich, Switzerland e-mail: studer@iis.ee.ethz.ch Communication Technology Laboratory ETH Zurich, 8092 Zurich, Switzerland e-mail: {seethal


Stem cell plasticity, osteogenic differentiation and the third Markus Rottmar Maria Hakanson  

E-Print Network [OSTI]

, ETH Zurich, 8093 Zurich, Switzerland M. Smith Laboratory for Biologically Oriented Materials, Department of Materials, Swiss Federal Institute of Technology, ETH Zurich, 8093 Zurich, Switzerland M. Smith


Extended metabolite profile of the human spinal cord Andreas Hock1  

E-Print Network [OSTI]

for Biomedical Engineering, University and ETH Zurich, Zurich, Switzerland, 2 Dept. of Clinical Research Institute of Neuroradiology, University Hospital of Zurich, Zurich, Switzerland, 4 Max Planck Institute


Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant


Existing Commercial Reference Buildings Constructed In or After 1980 -  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)


3S Industries AG Formerly 3S Swiss Solar Systems AG | Open Energy  

Open Energy Info (EERE)

AG Formerly 3S Swiss Solar Systems AG AG Formerly 3S Swiss Solar Systems AG Jump to: navigation, search Name 3S Industries AG (Formerly 3S Swiss Solar Systems AG) Place Bern, Switzerland Zip CH-3006 Product Swiss-based manufacturer of manual and semi-automatic PV module production lines; provides turnkey integration service for PV and BIPV. Coordinates 46.948432°, 7.440461° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.948432,"lon":7.440461,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Flisom AG | Open Energy Information  

Open Energy Info (EERE)

Flisom AG Flisom AG Jump to: navigation, search Name Flisom AG Place Zurich, Switzerland Zip 8005 Sector Efficiency, Solar Product Flisom has a high-efficiency copper-indium-gallium-selenide technology that it plans to put on plastic foilâ€"not glassâ€"potentially opening up new applications like solar for cell phones. Coordinates 47.37706°, 8.53955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.37706,"lon":8.53955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nuclear spectroscopic studies  

SciTech Connect (OSTI)

The Nuclear Physics group at the University of Tennessee, Knoxville is involved in several aspects of heavy-ion physics including both nuclear structure and reaction mechanisms. While our main emphasis is on experimental problems involving heavy-ion accelerators, we have maintained a strong collaboration with several theorists in order to best pursue the physics of our measurements. During the last year we have led several experiments at the Holifield Heavy Ion Research Facility and participated in others at Argonne National Laboratory. Also, we continue to be very active in the collaboration to study ultra-relativistic heavy ion physics utilizing the SPS accelerator at CERN in Geneva, Switzerland and in a RHIC detector R D project. Our experimental work is in four broad areas: (1) the structure of nuclei at high angular momentum, (2) heavy-ion induced transfer reactions, (3) the structure of nuclei far from stability, and (4) ultra-relativistic heavy-ion physics. The results of studies in these particular areas will be described in this document in sections IIA, IIB, IIC, and IID, respectively. Areas (1), (3), and (4) concentrate on the structure of nuclear matter in extreme conditions of rotational motion, imbalance of neutrons and protons, or very high temperature and density. Area (2) pursues the transfer of nucleons to states with high angular momentum, both to learn about their structure and to understand the transfer of particles, energy, and angular momentum in collisions between heavy ions. An important component of our program is the strong emphasis on the theoretical aspects of nuclear structure and reactions.

Bingham, C.R.; Guidry, M.W.; Riedinger, L.L.; Sorensen, S.P.


Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear spectroscopic studies. Progress report  

SciTech Connect (OSTI)

The Nuclear Physics group at the University of Tennessee, Knoxville is involved in several aspects of heavy-ion physics including both nuclear structure and reaction mechanisms. While our main emphasis is on experimental problems involving heavy-ion accelerators, we have maintained a strong collaboration with several theorists in order to best pursue the physics of our measurements. During the last year we have led several experiments at the Holifield Heavy Ion Research Facility and participated in others at Argonne National Laboratory. Also, we continue to be very active in the collaboration to study ultra-relativistic heavy ion physics utilizing the SPS accelerator at CERN in Geneva, Switzerland and in a RHIC detector R&D project. Our experimental work is in four broad areas: (1) the structure of nuclei at high angular momentum, (2) heavy-ion induced transfer reactions, (3) the structure of nuclei far from stability, and (4) ultra-relativistic heavy-ion physics. The results of studies in these particular areas will be described in this document in sections IIA, IIB, IIC, and IID, respectively. Areas (1), (3), and (4) concentrate on the structure of nuclear matter in extreme conditions of rotational motion, imbalance of neutrons and protons, or very high temperature and density. Area (2) pursues the transfer of nucleons to states with high angular momentum, both to learn about their structure and to understand the transfer of particles, energy, and angular momentum in collisions between heavy ions. An important component of our program is the strong emphasis on the theoretical aspects of nuclear structure and reactions.

Bingham, C.R.; Guidry, M.W.; Riedinger, L.L.; Sorensen, S.P.



Department of Energy assessment of the Large Hadron Collider  

SciTech Connect (OSTI)

This report summarizes the conclusions of the committee that assessed the cost estimate for the Large Hadron Collider (LHC). This proton-proton collider will be built at CERN, the European Laboratory for Particle Physics near Geneva, Switzerland. The committee found the accelerator-project cost estimate of 2.3 billion in 1995 Swiss francs, or about $2 billion US, to be adequate and reasonable. The planned project completion date of 2005 also appears achievable, assuming the resources are available when needed. The cost estimate was made using established European accounting procedures. In particular, the cost estimate does not include R and D, prototyping and testing, spare parts, and most of the engineering labor. Also excluded are costs for decommissioning the Large Electron-Positron collider (LEP) that now occupies the tunnel, modifications to the injector system, the experimental areas, preoperations costs, and CERN manpower. All these items are assumed by CERN to be included in the normal annual operations budget rather than the construction budget. Finally, contingency is built into the base estimate, in contrast to Department of Energy (DOE) estimates that explicitly identify contingency. The committee`s charge, given by Dr. James F. Decker, Deputy Directory of the DOE Office of Energy Research, was to understand the basis for the LHC cost estimate, identify uncertainties, and judge the overall validity of the estimate, proposed schedule, and related issues. The committee met at CERN April 22--26, 1996. The assessment was based on the October 1995 LHC Conceptual Design Report or ``Yellow Book,`` cost estimates and formal presentations made by the CERN staff, site inspection, detailed discussions with LHC technical experts, and the committee members` considerable experience.




Controlled Nuclear Fusion Reactions  

Science Journals Connector (OSTI)

... THE presentation of full and authoritative accounts of research on controlled nuclear fusion reactions was a major feature of the second Geneva Conference on the Peaceful Uses of ...




Societies and Academies  

Science Journals Connector (OSTI)

... of the reply to Dr. Reye, and observations concerning an article from the Bibliotheque universelleof Geneva, and a reclamation by M. Norman Lockyer, by M. Faye. ...



Scientific Serials  

Science Journals Connector (OSTI)

... History Society of Geneva, in September last, has just been published in the Bibliotheque Universelle et Revue Suisse. The conclusions arrived at are as follows: -(1), The ...



E-Print Network 3.0 - adoptive transfer model Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Modelling Guest Editors: Alain Haurie, HEC-Management Studies, University of Geneva David... abatement, R&D in technology development, emissions reduction, and subsidization...


E-Print Network 3.0 - accelerated electron bunches Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

. The symmetries of the vertical osets between the electron and positron bunch trains have a profound eect. Geneva... with the only assumption that the closed orbit of all...


E-Print Network 3.0 - antiomega particles Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Applied Chemistry, University of Geneva Collection: Chemistry 34 Particle resuspension from indoor flooring materials James H. Lohaus, Atila Novoselac and Jeffrey A....


E-Print Network 3.0 - activity advanced science Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

advanced science Search Powered by Explorit Topic List Advanced Search Sample search results for: activity advanced science Page: << < 1 2 3 4 5 > >> 1 UNIVERSITY OF GENEVA...


Improving Surgical Care in Low- and Middle-Income Countries: A Pivotal Role for the World Health Organization  

E-Print Network [OSTI]

Care (GIEESC) (2007) Dar Es Salaam, United World J Surg (held in Geneva [13], Dar es Salaam, United Republic of Tan-

Bickler, Stephen W.; Spiegel, David



What are social media? Making use of social media in research Other uses of social media Use of Social Media in Mathematical Research  

E-Print Network [OSTI]

Public outreach Places where social media can help [Adapted from Ren´e Schneider and Jasmin H¨ugi, Geneva

Stockie, John


Effect of Market Price Uncertainties on the Design of Optimal Biorefinery SystemsA Systematic Approach  

Science Journals Connector (OSTI)

King, D., Hagan, A., Lffler, K., Gillman, N., Weihe, U., and Oertel, S. The Future of Industrial Biorefineries; World Economic Forum: Geneva, 2010; REF: 210610. ...

Peam Cheali; Alberto Quaglia; Krist V. Gernaey; Grkan Sin



Toward a Computer-Aided Synthesis and Design of Biorefinery Networks: Data Collection and Management Using a Generic Modeling Approach  

Science Journals Connector (OSTI)

King, D.; Hagan, A.; Lffler, K.; Gillman, N.; Weihe, U.; Oertel, S. The Future of Industrial Biorefineries; REF: 210610; World Economic Forum: Geneva, 2010. ...

Peam Cheali; Krist V. Gernaey; Grkan Sin



Attributing climate variations: Part of an information system for the future  

E-Print Network [OSTI]

: on environment, human activities and sectors such as agriculture, energy, fisheries, water resources, etc Climate Conference 3, Geneva, Sept 2009 · Ocean Obs 09, Venice, Sept 2009 #12;

Hurrell, James


List of International Authors, Contributors, and Reviewers Major Acronyms and Abbreviations  

E-Print Network [OSTI]

) Switzerland Timothy J. Wallington Ford Motor Company USA Hsiang J. (Ray) Wang Georgia Institute of Technology

Jánosi, Imre M.


Part I: International and Regional Management Arrangements Global International Whaling Commission (IWC)  

E-Print Network [OSTI]

, Slovenia, Solomon Islands, South Africa, Spain, Suriname, Sweden, Switzerland, Tanzania, Togo, Tuvalu


License Exceptions Supplement No. 1 to Part 740 page 1 Export Administration Regulations September 28, 2001  

E-Print Network [OSTI]

Islands Somalia South Africa Spain Sri Lanka Surinam Swaziland Sweden Switzerland Taiwan Tanzania Thailand

Bernstein, Daniel


Last update / Dernire mise jour: 7/07/2005 EU Member States Other countries (continued)  

E-Print Network [OSTI]

Zambia 127 Suriname 122 Zimbabwe 133 Swaziland 129 Switzerland 215 Syrian Arab Republic 141 Tajikistan

De Cindio, Fiorella


Visa Requirements With the exception of nationals from the countries listed below, a visa will be required to visit Brazil for tourism or  

E-Print Network [OSTI]

Slovenia South Africa South Korea Sovereign Military Order of Malta Spain Suriname Sweden Switzerland

Cai, Long


Evaluation of a Swiss carbon tax with the Computable General Equilibrium Model  

E-Print Network [OSTI]

of the Kyoto protocol in Switzerland with and without international emissions trading [7], or assess

Lausanne, Ecole Polytechnique Fédérale de

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Introduction The IRD around the world p. 2  

E-Print Network [OSTI]

indonesia thailand laos vietnam new caledonia madagascar costa-rica togo switzerland ethiopia gabon bolivia


Global Report International Assessment of Agricultural Knowledge,  

E-Print Network [OSTI]

- lic of Palau, Romania, Saudi Arabia, Senegal, Solomon Islands, Swaziland, Sweden, Switzerland, United

Richner, Heinz


Soil Control on Runoff Response to Climate Change in Regional Climate Model Simulations  

E-Print Network [OSTI]

, Switzerland #GKSS Forschungszentrum, Geesthacht, Germany @Max Planck Institute for Meteorology, Hamburg

Haak, Hein


Geophysical Research Abstracts, Vol. 9, 11521, 2007 SRef-ID: 1607-7962/gra/EGU2007-A-11521  

E-Print Network [OSTI]

and Avalanche Research SLF, Davos, Switzerland (schweizer@slf.ch), (2) Department of Civil Engineering

Jamieson, Bruce


ORIGINAL PAPER Fingerprints of extreme climate events in Pinus sylvestris tree  

E-Print Network [OSTI]

and Avalanche Research SLF, Davos, Switzerland N. Zafirov Department of Plant Pathology and Chemistry


PHYSICAL REVIEW B 83, 195427 (2011) Evolution of the Rashba spin-orbit-split Shockley state on Ag/Pt(111)  

E-Print Network [OSTI]

, Switzerland 5 Department Chemie und Biochemie, Physikalische Chemie, Ludwig-Maximilians Universit¨at M

Brune, Harald


94 Thursday, March 15 Optical absorption and photoluminescence excitation spectroscopy of SWNTs in UV-VisPTH  

E-Print Network [OSTI]

Physics Laboratory, ETH Zurich, 8093 Zurich, Switzerland 2 Micro and Nanosystems, ETH Zurich, 8092 Zurich

Maruyama, Shigeo


Reports and other Publications  

Science Journals Connector (OSTI)

... 13. (Geneva : Universita di Geneva, Istituto Geofisico e Geodetico, 1960.) [202Norsk Polarinstituut. Meddelelser. Nr. 83 : Reinen pa Svalbard. Av Odd L0n0. Pp. ... Anders Rapp. Pp. vii+96+20 plates. Kr. 25.00. (Oslo : Norsk Polarinstituut, 1960. Distributed by the Oslo University Press.) [202




E-Print Network [OSTI]

LESSONS LEARNED FROM A LANDFILL SLOPE FAILURE INVOLVING GEOSYTNTHETICS Virginia L. Wilson.L. Soderman and G.P. Raymond November 12, 1998 #12;LESSONS LEARNED FROM A LANDFILL SLOPE FAILURE INVOLVING slopes at waste containment facilities. The Geneva Landfill is located near Geneva, Ohio which


Physicists want 1996 link-up with LHC  

Science Journals Connector (OSTI)

... lay the groundwork for a substantial US involvement from 1996 in the Large Hadron Collider (LHC) being planned by the European Laboratory for Particle Physics (CERN) in Geneva." ... Geneva."It is perfectly possible for us to provide an intellectual contribution [to the LHC] now, with the expectation of money to follow later," says George Trilling of ...

Colin Macilwain



Cornell University, Office of Sponsored Programs Awards Received in August 2008  

E-Print Network [OSTI]


Danforth, Bryan Nicholas


Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan


E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...


Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)



Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)



Nuclear Material Transaction Report NRC 741_1  

National Nuclear Security Administration (NNSA)



NRC Form 741  

National Nuclear Security Administration (NNSA)



Nuclear Material Transaction Report NRC 741_1  

National Nuclear Security Administration (NNSA)



Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)


Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)



The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone


Klimaschutzberatung | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Klimaschutzberatung Place: Mnchen, Germany Zip: 80469 Sector: Carbon Product: Look at Carbon Markets References:...


Celgard LLC | Open Energy Information  

Open Energy Info (EERE)

Carolina Zip: 28273 Product: Celgard battery separators are polypropylene andor polyethylene electrolytic membranes used in high performance battery applications. References:...


Eco Fuel Global | Open Energy Information  

Open Energy Info (EERE)

California Zip: 94596 Sector: Services Product: California-based environmental engineering and consulting firm. It's services include alternative fuel production,...


Fermilab | Press Room | Fact Sheets & Brochures | Archives |...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Economic Impacts Economic Impact FY2010 FY2009 FY2008 FY2007 Procurement Distribution Payroll by Zip Code...



Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip


Reprintedfrom GreenhouseGasControl Technologies.B. Eliasson,P. Riemer,andA. Wokaun,eds.,Pergamon,Amsterdam,1999. Proceedingsofthe~ International ConferenceonGHG Control Technologies.mterlaken,Switzerland,30Aug.-2 Sept.1998  

E-Print Network [OSTI]

.- 2 Sept.1998 '" HYDROGEN PRODUCTION FROM COAL AND COAL BED METHANE, USING BYPRODUCT CO2 FOR ENHANCED METHANE RECOVERY AND SEQUESTERING THE CO2 IN mE COAL BED RH Williams, Center for Energy and Environmental that are poorly endowed with conventional hydrocarbon resources but coal- and coal-bed-methane-rich would


5 June 2003 : Proceedings paper for the ESA Symposium on European Rocket and Balloon Programmes and Related Research, St. Gallen, Switzerland, 2-5 June 2003, ESA-SP530, 357-362, 2003  

E-Print Network [OSTI]

. Schmidlin (3) , R.A. Goldberg (4) (1) Swedish Institute of Space Physics, Box 812, 98128 Kiruna, Sweden20771, USA ABSTRACT During the MaCWAVE winter campaign in January 2003, layers of enhanced echo power in the winter mesosphere is strong turbulence due to wave-breaking or windshear [4] [5]. The need to propose

Kirkwood, Sheila


UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship


CSC420--Introduction to Image Understanding, Fall 2011 Assignment 1: Calibration Checkerboards  

E-Print Network [OSTI]

plane that projects to p. (c) In the Matlab code checkerShow.m, implement the above computation to hand in. Both a short written report and the completed Matlab handout code will be submitted a zip file of your Matlab solution code. The zip file must be called A1Matlab.zip, and should consist

Jepson, Allan D.


COSMO 09  

SciTech Connect (OSTI)

This year's edition of the annual Cosmo International Conference on Particle Physics and Cosmology -- Cosmo09 -- will be hosted by the CERN Theory Group from Monday September 7 till Friday September 11, 2009. The conference will take place at CERN, Geneva (Switzerland). The Cosmo series is one of the major venues of interaction between cosmologists and particle physicists. In the exciting LHC era, the Conference will be devoted to the modern interfaces between Fundamental and Phenomenological Particle Physics and Physical Cosmology and Astronomy. The Conference will be followed by the CERN TH Institute "Particle Cosmology" which will take place from Monday September 14 till Friday September 18, 2009. The CERN-TH Institutes are visitor programs intended to bring together scientists with similar interests and to promote scientific collaborations. If you wish to participate, please register on the Institute web page. Link to last editions: COSMO 07 (U. of Sussex), COSMO 08 (U. of Wisconsin) List of plenary speakers: Gianfranco Bertone, Pierre Binetruy, Francois Bouchet, Juerg Diemand, Jonathan Feng, Gregory Gabadadze, Francis Halzen, Steen Hannestad, Will Kinney, Johannes Knapp, Hiranya Peiris, Will Percival, Syksy Rasanen, Alexandre Refregier, Pierre Salati, Roman Scoccimarro, Michael Schubnell, Christian Spiering, Neil Spooner, Andrew Tolley, Matteo Viel. The plenary program is available on-line. Select "Preliminary programme" in the left menu and click on each plenary session to see details. Parallel sessions: Inflation, convenor: Andrew Liddle Dark matter, convenor: Marco Cirelli Dark energy and modified gravity, convenor: Kazuya Koyama CMB, LSS and cosmological parameters/models, convenor: Licia Verde String cosmology, convenor: Jim Cline Baryogenesis and leptogenesis, convenor: Mariano Quiros The submission of talk proposals is closed by now. The parallel session program is available on-line. Select "Preliminary programme" in the left menu and click on each parallel session title to see details. Posters. Participants willing to present a poster will be offered the opportunity to hang it in the hall, next to the main auditorium. The poster application is closed by now. The poster list is available on-line. Registration. On-line registration is open from January 16 till August 31 (click on the link in the left menu). There will be no registration fees. [Thanks to the generosity of EU's network "UniverseNet", we have some limited funds available for supporting the visit of a few young scientists who could not attend otherwise. The application for funding is closed by now. All applicants have already been informed of the success of their application.] Accomodation. Participants are expected to arrange their accomodation by themselves: some rooms with shower, wc and washbasin have been blocked in the CERN hostel for the conference (price: 58CHF/night). Unfortunately, all these rooms have already been booked. You can book a hotel in Geneva or in the area surrounding CERN using this list. If you book a hotel on the French side, be sure to have a passport or a visa valid also in France. All participants are expected to be in possession of a passport or a visa valid in Swizerland (if relevant), and to be covered by their own health insurance during their visit. Sponsors. This conference is receiving support from the European Community's Marie Curie Research and Training Network UniverseNet.




COSMO 09  

ScienceCinema (OSTI)

This year's edition of the annual Cosmo International Conference on Particle Physics and Cosmology -- Cosmo09 -- will be hosted by the CERN Theory Group from Monday September 7 till Friday September 11, 2009. The conference will take place at CERN, Geneva (Switzerland). The Cosmo series is one of the major venues of interaction between cosmologists and particle physicists. In the exciting LHC era, the Conference will be devoted to the modern interfaces between Fundamental and Phenomenological Particle Physics and Physical Cosmology and Astronomy. The Conference will be followed by the CERN TH Institute "Particle Cosmology" which will take place from Monday September 14 till Friday September 18, 2009. The CERN-TH Institutes are visitor programs intended to bring together scientists with similar interests and to promote scientific collaborations. If you wish to participate, please register on the Institute web page. Link to last editions: COSMO 07 (U. of Sussex), COSMO 08 (U. of Wisconsin) List of plenary speakers: Gianfranco Bertone, Pierre Binetruy, Francois Bouchet, Juerg Diemand, Jonathan Feng, Gregory Gabadadze, Francis Halzen, Steen Hannestad, Will Kinney, Johannes Knapp, Hiranya Peiris, Will Percival, Syksy Rasanen, Alexandre Refregier, Pierre Salati, Roman Scoccimarro, Michael Schubnell, Christian Spiering, Neil Spooner, Andrew Tolley, Matteo Viel. The plenary program is available on-line. Select "Preliminary programme" in the left menu and click on each plenary session to see details. Parallel sessions: Inflation, convenor: Andrew Liddle Dark matter, convenor: Marco Cirelli Dark energy and modified gravity, convenor: Kazuya Koyama CMB, LSS and cosmological parameters/models, convenor: Licia Verde String cosmology, convenor: Jim Cline Baryogenesis and leptogenesis, convenor: Mariano Quiros The submission of talk proposals is closed by now. The parallel session program is available on-line. Select "Preliminary programme" in the left menu and click on each parallel session title to see details. Posters. Participants willing to present a poster will be offered the opportunity to hang it in the hall, next to the main auditorium. The poster application is closed by now. The poster list is available on-line. Registration. On-line registration is open from January 16 till August 31 (click on the link in the left menu). There will be no registration fees. [Thanks to the generosity of EU's network "UniverseNet", we have some limited funds available for supporting the visit of a few young scientists who could not attend otherwise. The application for funding is closed by now. All applicants have already been informed of the success of their application.] Accomodation. Participants are expected to arrange their accomodation by themselves: some rooms with shower, wc and washbasin have been blocked in the CERN hostel for the conference (price: 58CHF/night). Unfortunately, all these rooms have already been booked. You can book a hotel in Geneva or in the area surrounding CERN using this list. If you book a hotel on the French side, be sure to have a passport or a visa valid also in France. All participants are expected to be in possession of a passport or a visa valid in Swizerland (if relevant), and to be covered by their own health insurance during their visit. Sponsors. This conference is receiving support from the European Community's Marie Curie Research and Training Network UniverseNet.




1st Circular Time-Resolved Vibrational  

E-Print Network [OSTI]

, Germany) Giulio Cerullo (Politec. Milano, Italy) Majed Chergui (EPFL, Switzerland) Dana Dlott (University of Illinois, USA) Thomas Elssser (Max Born Institute, Germany) Nikolaus Ernsting (Humbolt Univ. Germany Gerwert (Ruhr University, Germany) Peter Hamm (Univ. Zurich, Switzerland) Joachim Heberle (Free Univ

Gerwert, Klaus


http://www.tuchemnitz.de/cluster2000 OFFICIAL ADDRESS AND ORGANISATION  

E-Print Network [OSTI]

Chemnitz, Germany Thomas Sterling JPL and Caltech, USA Thomas Stricker ETH Zürich, Switzerland Barry Wilkinson UNCC, USA Thomas Stricker ETH Zürich, Switzerland VICE CHAIR STEERING COMMITTEE successful

Chemnitz, Technische Universität


Performance Characterization of a Molecular Dynamics Code on PC Clusters Is there any easy parallelism in CHARMM?  

E-Print Network [OSTI]

parallelism in CHARMM? Michela Taufer1, Egon Perathoner1 3, Andrea Cavalli2, Amedeo Caflisch2, Thomas Stricker of Zurich CH-8092 Zurich, Switzerland CH-8057 Zurich, Switzerland stricker,taufer@inf.ethz.ch caflisch

Caflisch, Amedeo


7, 1028710322, 2007 SSA measurement  

E-Print Network [OSTI]

and Avalanche Research SLF, Davos, Switzerland 2 Paul Scherrer Institute, 5232 Villigen PSI, Switzerland 3 July 2007 Correspondence to: M. Schneebeli (schneebeli@slf.ch) 10287 #12;ACPD 7, 10287­10322, 2007 SSA

Boyer, Edmond


MIMO Transmission with Residual Transmit-RF Impairments  

E-Print Network [OSTI]

Laboratory ETH Zurich, CH-8092 Zurich, Switzerland Email: studerc@nari.ee.ethz.ch Markus Wenk and Andreas Burg Integrated Systems Laboratory ETH Zurich, CH-8092 Zurich, Switzerland Email: {mawenk


The Uncertainty Principle in the Presence of Quantum Memory Mario Berta,1, 2  

E-Print Network [OSTI]

, ETH Zurich, 8093 Zurich, Switzerland. 2 Faculty of Physics, Ludwig-Maximilians-Universit¨at M, ON N2L 2Y5, Canada. 4 Institute of Theoretical Computer Science, ETH Zurich, 8092 Zurich, Switzerland

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Received 3 April 2002 Accepted 5 June 2002  

E-Print Network [OSTI]

Boer3 1 Ecology and Evolution, ETH Zurich, ETH Zentrum NW, CH-8092 Zurich, Switzerland 2 Institute of Mathematics, University of Zurich, CH-8057 Zurich, Switzerland 3 Theoretical Biology, Utrecht University, 3584

Utrecht, Universiteit


31 December 1999 Z .Chemical Physics Letters 315 1999 327334  

E-Print Network [OSTI]

a Laboratory of Physical Chemistry, ETH Zurich, CH-8092 Zurich, Switzerland b Geochemistry Group, Institute of Mineralogy and Petrography, ETH Zurich, CH-8092 Zurich, Switzerland c Department of Chemistry, Uni

Nguyen, Minh Tho


Area-and Throughput-Optimized VLSI Architecture of Sphere Decoding  

E-Print Network [OSTI]

, Andreas Burg Integrated Systems Laboratory ETH Zurich, CH-8092 Zurich, Switzerland E-mail: {mawenk,bruderer,apburg}@iis.ee.ethz.ch Christoph Studer Communication Technology Laboratory ETH Zurich, CH-8092 Zurich, Switzerland E-mail: studerc


IEEE TRANSACTIONS ON INFORMATION THEORY, VOL. 56, NO. 3, MARCH 2010 1085 Performance and Complexity Analysis of  

E-Print Network [OSTI]

with the Department of Information Technology and Electrical Engineering, ETH Zurich, 8092 Zurich, Switzerland. He is with the Department of Information Technology and Electrical Engineering, ETH Zurich, 8092 Zurich, Switzerland (e

Bölcskei, Helmut


Figure 2: Pulse sequence: Navigators are applied before inner-volume saturation (IVS), up-/downfield  

E-Print Network [OSTI]

, and Anke Henning1,3 1 Institute for Biomedical Engineering, University and ETH Zurich, Zurich, Switzerland, 2 Institute of Neuroradiology, University Hospital of Zurich, Zurich, Switzerland, 3 Max Planck


Vector and Scalar Bosons at D and ATLAS  

SciTech Connect (OSTI)

Vector Boson Fusion (VBF) has never been measured in hadron collisions, but it is one of the most sensitive modes for low mass Standard Model Higgs production at ATLAS. The objective of this proposal is to measure VBF production of W and Z bosons at the D Experiment taking place at the Tevatron Collider near Chicago, Illinois, and at the ATLAS Experiment, running at the Large Hadron Collider in Geneva, Switzerland. The framework developed in these measurements will be used to discover and study the Higgs Boson produced through the same mechanism (VBF) at ATLAS. The 10 f b?1 dataset recently collected by the D experiment provides a unique opportunity to observe evidence of VBF production of W Bosons, which will provide the required theoretical knowledge - VBF cross sections - and experimental knowledge - tuning of measurement techniques - on which to base the VBF measurements at the LHC. At the time of this writing, the ATLAS experiment has recorded 5 fb?1 of data at ?s = 7 TeV, and expects to collect at least another 5 in 2012. Assuming Standard Model cross sections, this dataset will allow for the observation of VBF production of W, Z and Higgs bosons. The major challenges for the first observation of VBF interactions are: developing highly optimized forward jet identification algorithms, and accurately modeling both rates and kinematics of background processes. With the research program outlined in this grant proposal, I plan to address each of these areas, paving the way for VBF observation. The concentration on VBF production for the duration of this grant will be at ATLAS where the anticipated high pileup rates necessitates a cleaner signal. My past experience with forward jet identification at the ZEUS experiment, and with W+(n)Jets measurements at D , puts me in a unique position to lead this effort. The proposed program will have a dual focus: on D where the VBF analysis effort is mature and efforts of a postdoc will be required to bring the VBF W analysis to a paper, and at ATLAS where a graduate student will begin the effort. I therefore request funding for a student and a postdoc, as well as summer support for myself, for the four year duration of the grant proposal. I also request travel funds to facilitate interactions with my group, presentation at conferences, and a modest amount of money to purchase computing resources.

Lammers, Sabine Sabine [Indiana University



Microsoft PowerPoint - 7_James Warden_2013-05-06 123 agreements...  

National Nuclear Security Administration (NNSA)

Norway - Canada - Russian Federation - China - South Africa - Colombia - Switzerland - Egypt - Thailand - EURATOM (27 countries) - Turkey - India - Ukraine - Indonesia - United...


Summary of Evaluated Data for Atmospheric Heterogeneous Processes IUPAC Subcommittee on Gas Kinetic Data Evaluation for Atmospheric Chemistry  

E-Print Network [OSTI]

, Switzerland Prof. J. Troe Institute of Physical Chemistry, University of Göttingen, Germany Dr Tim Wallington

Cambridge, University of


U.S. Department of the Interior November 2013 U.S. Geological Survey  

E-Print Network [OSTI]

-- -- Nicaragua -- 215 10 225 80 -- -- Peru -- 8,130 1 8,130 -- -- -- Suriname -- -- -- -- 1,730 -- -- Switzerland


Empowering Women: The Role of Economic Development, Political Culture and Institutional Design in the Worlds Societies  

E-Print Network [OSTI]

Paraguay, Sri Lanka, Suriname, Thailand, Turkey, Ukraine,South Africa, Spain, Suriname, Sweden, Switzerland 25 th -75

Alexander, Amy C.



International Student and Scholar Enrollment & Statistical Report  

E-Print Network [OSTI]

Suriname 1 Ghana 18 Swaziland 1 Greece 19 Sweden 8 Grenada 1 Switzerland 8 Guatemala 21 Syria 4 Guyana 2

Ginzel, Matthew


Symposium Registration  

E-Print Network [OSTI]

... Sierra Leone, Singapore, Slovakia, Slovenia, Solomon Islands, Somalia, South Africa, Spain, Sri Lanka, Sudan, Suriname, Swaziland, Sweden, Switzerland...


Kharisma Jaya Gemilang (KJG), an Indonesian company part-  

E-Print Network [OSTI]

The Forest Trust (TFT) Crassier - Switzerland Phone: + 41 (0) 22 367 94 40 Partner Countries GABON DECIDES


Climate signal age effects--Evidence from young and old trees in the Swiss Engadin  

E-Print Network [OSTI]

, 3012 Bern, Switzerland c WSL Institute for Snow and Avalanche Research SLF, Flu¨elastrasse 11, 7260


InfoTraffic Teaching Important Concepts of Computer Science and Math through Real-World Examples  

E-Print Network [OSTI]

Ruedi Arnold Inst. for Pervasive Computing ETH Zurich 8092 Zurich, Switzerland rarnold@inf.ethz.ch Marc Langheinrich Inst. for Pervasive Computing ETH Zurich 8092 Zurich, Switzerland langhein@inf.ethz.ch Werner Hartmann Center for Comp. Education PH Bern 3012 Bern, Switzerland werner.hartmann@phbern.ch ABSTRACT


Procedures for Reliable Estimation of Viral Fitness from Time Series Data  

E-Print Network [OSTI]

, , Andrew D. Barbour2 and Rob J. De Boer3 Ecology & Evolution, ETH Zurich, ETH Zentrum, CH-8092 Zurich, ETH Zurich, ETH Zen- trum NW, CH-8092 Zurich, Switzerland. Phone:41 1 6326033, Fax:41 1 6321271. E, Switzerland1 , Institute of Mathematics, University of Zurich, CH-8057 Zurich, Switzerland2 , and Theoretical

Barbour, Andrew


Anomaly Extraction in Backbone Networks using Association Rules  

E-Print Network [OSTI]

Anomaly Extraction in Backbone Networks using Association Rules Daniela Brauckhoff ETH Zurich Zurich, Switzerland brauckhoff@tik.ee.ethz.ch Xenofontas Dimitropoulos ETH Zurich Zurich, Switzerland fontas@tik.ee.ethz.ch Arno Wagner ETH Zurich Zurich, Switzerland wagner@tik.ee.ethz.ch Kavè Salamatian

Paris-Sud XI, Université de



E-Print Network [OSTI]

), ETH Zurich, 8092 Zurich, Switzerland, (e-mail: studerc@nari.ee.ethz.ch). S. Fateh is with the Integrated Systems Laboratory (IIS), ETH Zurich, 8092 Zurich, Switzerland (e-mail: fateh@iis.ee.ethz.ch). D. Seethaler was with the Communication Technology Laboratory (CTL), ETH Zurich, 8092 Zurich, Switzerland


Eidgenossische Technische Hochschule  

E-Print Network [OSTI]

Switzerland Seminar f¨ur Angewandte Mathematik, ETH Zurich and Electromagnetic Fields and Microwave Electronics Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich, Switzerland #12;Linearization techniques) and transverse 1 Seminar for Applied Mathematics, ETH Zurich, R¨amistrasse 101, 8092 Zurich, Switzerland 2

Lang, Annika


Attacks on Physical-layer Identification Boris Danev  

E-Print Network [OSTI]

Attacks on Physical-layer Identification Boris Danev Dept. of Comp. Science ETH Zurich 8092 Zurich, Switzerland bdanev@inf.ethz.ch Heinrich Luecken Comm. Tech. Laboratory ETH Zurich 8092 Zurich, Switzerland lueckenh@nari.ee.ethz.ch Srdjan Capkun Dept. of Comp. Science ETH Zurich 8092 Zurich, Switzerland capkuns

Capkun, Srdjan

Note: This page contains sample records for the topic "geneva switzerland zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Genome Biology 2004, 5:R92 commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation  

E-Print Network [OSTI]

Federal Institute of Technology (ETH), Zurich. Colab, ETH, Zurich 8092, Switzerland. Seminar for Statistics, ETH, Zurich 8092, Switzerland. §Institute for Plant Sciences and Functional Genomics Center Zurich, ETH, Zurich 8092, Switzerland. ¶Computer Engineering and Networks Laboratory, ETH, Zurich 8092

Zitzler, Eckart


Supporting Information Direct Monitoring of Protein-Protein Inhibition Using Nano Electrospray  

E-Print Network [OSTI]

and Applied Biosciences, ETH Zurich, 8093 Zurich, Switzerland 2 Department of Molecular Biology and Biophysics, ETH Zurich, 8093 Zurich, Switzerland 3 Institute of Organic Chemistry, University of Leipzig, 04103 of Chemistry and Applied Biosciences, ETH Zurich, 8093 Zurich, Switzerland. E-mail: zenobi

Wider, Gerhard


Hybrid-Secure MPC: Trading Information-Theoretic Robustness for Computational Privacy  

E-Print Network [OSTI]

Lucas Department of Computer Science, ETH Zurich 8092 Zurich, Switzerland clucas@inf.ethz.ch Dominik Maurer Department of Computer Science, ETH Zurich 8092 Zurich, Switzerland maurer@inf.ethz.ch ABSTRACT controls Supported by the Zurich Information Security Center. Work done while at ETH Zurich, Switzerland

Maurer, Ueli


9th International Conference on Construction Applications of Virtual Reality November 5-6, 2009 A NOVEL CAMERA-BASED SYSTEM FOR COLLABORATIVE  

E-Print Network [OSTI]

Bergh, Computer Vision Laboratory, ETH Zurich, Zurich, Switzerland; vamichae@vision.ee.ethz.ch J. Halatsch, Chair of Information Architecture, ETH Zurich, Zurich, Switzerland; halatsch@arch.ethz.ch A. Kunze, Chair of Information Architecture, ETH Zurich, Zurich, Switzerland; kunze@arch.ethz.ch F. Bosché

Bosché, Frédéric


Constraint Differentiation: A New Reduction Technique for ConstraintBased Analysis of Security Protocols  

E-Print Network [OSTI]

Protocols #3; David Basin Dep. of Computer Science ETH Zurich CH­8092 Zurich, Switzerland basin@inf.ethz.ch Sebastian M ? odersheim Dep. of Computer Science ETH Zurich CH­8092 Zurich, Switzerland moedersheim@inf.ethz.ch Luca Vigan ?? o Dep. of Computer Science ETH Zurich CH­8092 Zurich, Switzerland vigano

Basin, David


GEOCHEMISTRY, GEOPHYSICS, GEOSYSTEMS, VOL. ???, XXXX, DOI:10.1029/, The influence of non-uniform ambient noise on1  

E-Print Network [OSTI]

, Institute of Geophysics, ETH Zurich, Sonneggstrasse 5, Zurich, Switzerland. T. Nissen-Meyer, Institute of Geophysics, ETH Zurich, Sonneggstrasse 5, Zurich, Switzerland. Olaf Schenk, Institute of Computational of Geophysics, ETH Zurich, Sonneggstrasse 5, Zurich, Switzerland. 3 ISTEP, UMR 7193, UPMC Universite Paris 6

Paris-Sud XI, Université de


Tight Bounds for Clock Synchronization [Extended Abstract  

E-Print Network [OSTI]

and Networks Laboratory (TIK) ETH Zurich, 8092 Zurich, Switzerland lenzen@tik.ee.ethz.ch Thomas Locher Computer Engineering and Networks Laboratory (TIK) ETH Zurich, 8092 Zurich, Switzerland lochert@tik.ee.ethz.ch Roger Wattenhofer Computer Engineering and Networks Laboratory (TIK) ETH Zurich, 8092 Zurich, Switzerland

O'Donnell, Ryan


Remote Sketching on Paper Bachelor thesis  

E-Print Network [OSTI]

Zurich--Switzerland), Elke Reuss (ETH Zurich--Switzerland), Beat Signer (ETH Zurich Collaboration professor: Prof. Dr. M. C. Norrie (ETH Zurich--Switzerland) Global Information Systems Group. Reiterer, as the Global Information Systems Group (GlobIS) at the ETH Zurich, that gave me the opportunity

Reiterer, Harald


When Selfish Meets Evil: Byzantine Players in a Virus Inoculation Game  

E-Print Network [OSTI]

Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland moscitho@tik.ee.ethz.ch Stefan Schmid Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland schmiste@tik.ee.ethz.ch Roger Wattenhofer Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland

Schmid, Stefan


Incorporating self-consistently calculated mineral physics into thermochemical mantle convection simulations  

E-Print Network [OSTI]

of Geophysics, ETH Zurich, CH-8092 Zurich, Switzerland (ntakashi@ethz.ch) Paul J. Tackley and Frederic Deschamps Institute of Geophysics, ETH Zurich, CH-8092 Zurich, Switzerland James A. D. Connolly Institute of Petrology and Mineralogy, ETH Zurich, CH-8092 Zurich, Switzerland [1] Phase assemblages of mantle rocks calculated from

Deschamps, Frédéric


Efficiency of monolaurin in mitigating ruminal methanogenesis and modifying C-isotope fractionation when incubating diets composed of either C3 or C4  

E-Print Network [OSTI]

1 and Carla R. Soliva1 * 1 ETH Zurich, Department of Agricultural and Food Science, 8092 Zurich, Switzerland 2 ETH Zurich, Geological Institute, 8092 Zurich, Switzerland 3 ETH Zurich, Institute of Biogeochemistry and Pollutant Dynamics, 8092 Zurich, Switzerland (Received 17 November 2008 ­ Revised 23 April

Gilli, Adrian


On the Topologies Formed by Selfish Peers # [Extended Abstract] +  

E-Print Network [OSTI]

Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland moscitho@tik.ee.ethz.ch Stefan Schmid Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland schmiste@tik.ee.ethz.ch Roger Wattenhofer Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland

Schmid, Stefan


Dozer: Ultra-Low Power Data Gathering in Sensor Networks Nicolas Burri  

E-Print Network [OSTI]

and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland nburri@tik.ee.ethz.ch Pascal von Rickenbach Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland pascalv@tik.ee.ethz.ch Roger Wattenhofer Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland

Gummadi, Ramakrishna



E-Print Network [OSTI]

and Electrical Engineering, ETH Zurich, Switzerland, and is now with the Dept. of Electrical and Computer. of Information Technology and Electri- cal Engineering, ETH Zurich, Switzerland, and is now with UBS, Zurich Tech- nology and Electrical Engineering, ETH Zurich, Switzerland (e-mail: gpope


An Idealized Cloud-Resolving Framework for the Study of Midlatitude Diurnal Convection over Land  

E-Print Network [OSTI]

LINDA SCHLEMMER Institute for Atmospheric and Climate Science, ETH Zurich, Zurich, Switzerland CATHY Institute for Atmospheric and Climate Science, ETH Zurich, Zurich, Switzerland CHRISTOPHER S. BRETHERTON for Atmospheric and Climate Science, ETH Zurich, Zurich, Switzerland (Manuscript received 11 August 2010, in final

Bretherton, Chris


www.sciencesignaling.org/cgi/content/full/2/81/ra39/DC1 Supplementary Materials for  

E-Print Network [OSTI]

and Metabolic Diseases, ETH Zurich, 8093 Zurich, Switzerland 7 Faculty of Science, University of Zurich, 8057 of Molecular Genetics, University of Toronto, Toronto, Canada 3 Institute of Molecular Systems Biology, ETH, Zurich, Switzerland 4 Institute of Molecular Biology, University of Zurich, 8057 Zurich, Switzerland 5


TRANS. INF. THEORY, VOL. XX, NO. YY, THEMONTH YEAR 1 Information-Theoretic Analysis  

E-Print Network [OSTI]

by the Swiss National Science Foundation (SNF) under grant No. 200021-100025/1. D. S. Baum was with ETH Zurich.baum@ieee.org). H. B¨olcskei is with ETH Zurich, 8092 Zurich, Switzerland (e-mail: boelcskei, 8092 Zurich, Switzerland. He is now with Baum Consulting GmbH, 8003 Zurich, Switzerland (e-mail: daniel

Bölcskei, Helmut


On the Topologies Formed by Selfish Peers [Extended Abstract  

E-Print Network [OSTI]

Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland moscitho@tik.ee.ethz.ch Stefan Schmid Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland schmiste@tik.ee.ethz.ch Roger Wattenhofer Computer Engineering and Networks Laboratory ETH Zurich 8092 Zurich, Switzerland

Schmid, Stefan


The effect of phosphomonoesterases on the oxygen isotope composition of phosphate  

E-Print Network [OSTI]

a a Institute of Agricultural Sciences, ETH Zurich, Eschikon 33, CH-8315 Lindau, Switzerland b Laboratory of Organic Chemistry, ETH Zurich, ETH Ho¨nggerberg, CH-8093 Zurich, Switzerland c Geological Institute, ETH Zurich, Sonneggstrasse 5, CH-8092 Zurich, Switzerland Received 2 May 2013; accepted in revised form 6

Gilli, Adrian


10.1101/gr.133330.111Access the most recent version at doi: published online March 27, 2012Genome Res.  

E-Print Network [OSTI]

Kingdom; 5 Department of Biology, Institute of Molecular Systems Biology, ETH Zurich, 8093 Zurich, Switzerland; 6 Functional Genomics Center, ETH and University of Zurich, 8057 Zurich, Switzerland; 7 Laval of Science, University of Zurich, 8057 Zurich, Switzerland; 10 Institute of Pharmaceutical Sciences, ETH

Miska, Eric