Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use


Category:Mason, IA | Open Energy Information  

Open Energy Info (EERE)

IA IA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Mason, IA" The following 16 files are in this category, out of 16 total. SVQuickServiceRestaurant Mason IA MidAmerican Energy Co (Iowa).png SVQuickServiceRestaura... 64 KB SVFullServiceRestaurant Mason IA MidAmerican Energy Co (Iowa).png SVFullServiceRestauran... 64 KB SVHospital Mason IA MidAmerican Energy Co (Iowa).png SVHospital Mason IA Mi... 73 KB SVLargeHotel Mason IA MidAmerican Energy Co (Iowa).png SVLargeHotel Mason IA ... 72 KB SVLargeOffice Mason IA MidAmerican Energy Co (Iowa).png SVLargeOffice Mason IA... 73 KB SVMediumOffice Mason IA MidAmerican Energy Co (Iowa).png SVMediumOffice Mason I... 69 KB SVMidriseApartment Mason IA MidAmerican Energy Co (Iowa).png


Type Ia Supernovae Project at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

Type Ia Supernovae Type Ia Supernovae Supernova-1.jpg Update: Recent Berkeley Lab Computing Sciences News about supernovae: read more... Key Challenges: Understanding Type Ia...


Prospective Type Ia supernova surveys from Dome A  

E-Print Network (OSTI)

Prospective Type Ia Supernova Surveys From Dome A A. Kim a ,are conducive toward Type Ia supernova surveys forheterogeneities within the Type Ia supernova class, reducing

Kim, A.



RECIPIENT:Gwinnett Co, GA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Gwinnett Co, GA Gwinnett Co, GA u.s DEPARUIENT OFENllRGY EERE PROJECT MANAGEMENT CENTER NllPA DETERl\JINATION PROJECr TITLE: Gwinnett Co, GA EEC8G Page I or2 STATE: GA Funding Opportunity Announcement Number Procu~ment Instrument Number N[PA Control Number CID Number DE-EEOOOOS05.005 0 Based on my review ortbe information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I bave made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Turbulent Combustion in Type Ia Supernova Models  

E-Print Network (OSTI)

We review the astrophysical modeling of type Ia supernova explosions and describe numerical methods to implement numerical simulations of these events. Some results of such simulations are discussed.

F. K. Roepke; W. Hillebrandt



New approaches for modeling type Ia supernovae  

SciTech Connect

Type Ia supernovae (SNe Ia) are the largest thermonuclearexplosions in the Universe. Their light output can be seen across greatstances and has led to the discovery that the expansion rate of theUniverse is accelerating. Despite the significance of SNe Ia, there arestill a large number of uncertainties in current theoretical models.Computational modeling offers the promise to help answer the outstandingquestions. However, even with today's supercomputers, such calculationsare extremely challenging because of the wide range of length and timescales. In this paper, we discuss several new algorithms for simulationsof SNe Ia and demonstrate some of their successes.

Zingale, Michael; Almgren, Ann S.; Bell, John B.; Day, Marcus S.; Rendleman, Charles A.; Woosley, Stan



Theoretical cosmic Type Ia supernova rates  

E-Print Network (OSTI)

The aim of this work is the computation of the cosmic Type Ia supernova rates at very high redshifts (z>2). We adopt various progenitor models in order to predict the number of explosions in different scenarios for galaxy formation and to check whether it is possible to select the best delay time distribution model, on the basis of the available observations of Type Ia supernovae. We also computed the Type Ia supernova rate in typical elliptical galaxies of different initial luminous masses and the total amount of iron produced by Type Ia supernovae in each case. It emerges that: it is not easy to select the best delay time distribution scenario from the observational data and this is because the cosmic star formation rate dominates over the distribution function of the delay times; the monolithic collapse scenario predicts an increasing trend of the SN Ia rate at high redshifts whereas the predicted rate in the hierarchical scheme drops dramatically at high redshift; for the elliptical galaxies we note that the predicted maximum of the Type Ia supernova rate depends on the initial galactic mass. The maximum occurs earlier (at about 0.3 Gyr) in the most massive ellipticals, as a consequence of downsizing in star formation. We find that different delay time distributions predict different relations between the Type Ia supernova rate per unit mass at the present time and the color of the parent galaxies and that bluer ellipticals present higher supernova Type Ia rates at the present time.

R. Valiante; F. Matteucci; S. Recchi; F. Calura



Ga Air Compressor, Ga Air Compressor Products, Ga Air ...  

U.S. Energy Information Administration (EIA)

Ga Air Compressor, You Can Buy Various High Quality Ga Air Compressor Products from Global Ga Air Compressor Suppliers and Ga Air Compressor ...


Steamboat IA Geothermal Facility | Open Energy Information  

Open Energy Info (EERE)

IA Geothermal Facility IA Geothermal Facility Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Steamboat IA Geothermal Facility General Information Name Steamboat IA Geothermal Facility Facility Steamboat IA Sector Geothermal energy Location Information Location Washoe, Nevada Coordinates 40.5608387°, -119.6035495° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.5608387,"lon":-119.6035495,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


The progenitors of subluminous type Ia supernovae  

DOE Green Energy (OSTI)

We find that spectroscopically peculiar subluminous SNe Ia come from an old population. Of the thirteen subluminous SNe Ia known, nine are found in E/S0 galaxies, and the remainder are found in early-type spirals. The probability that this is a chance occurrence is only 0.1%. The finding that subluminous SNe Ia are associated with an older stellar population indicates that for a sufficiently large lookback time (already accessible in current high redshift searches) they will not be found. Due to a scarcity in old populations, hydrogen and helium main sequence stars and He red giant stars that undergo Roche lobe overflow are unlikely to be the progenitors of subluminous SNe Ia. Earlier findings that overluminous SNe Ia (DELTA m{sub 15} (B) < 0.94) come from a young progenitor population are confirmed. The fact that subluminous SNe Ia and overluminous SNe Ia come from different progenitor populations and also have different properties is a prediction of the CO white dwarf merger progenitor scenario.

Howell, D. Andrew



Rates and progenitors of type Ia supernovae  

SciTech Connect

The remarkable uniformity of Type Ia supernovae has allowed astronomers to use them as distance indicators to measure the properties and expansion history of the Universe. However, Type Ia supernovae exhibit intrinsic variation in both their spectra and observed brightness. The brightness variations have been approximately corrected by various methods, but there remain intrinsic variations that limit the statistical power of current and future observations of distant supernovae for cosmological purposes. There may be systematic effects in this residual variation that evolve with redshift and thus limit the cosmological power of SN Ia luminosity-distance experiments. To reduce these systematic uncertainties, we need a deeper understanding of the observed variations in Type Ia supernovae. Toward this end, the Nearby Supernova Factory has been designed to discover hundreds of Type Ia supernovae in a systematic and automated fashion and study them in detail. This project will observe these supernovae spectrophotometrically to provide the homogeneous high-quality data set necessary to improve the understanding and calibration of these vital cosmological yardsticks. From 1998 to 2003, in collaboration with the Near-Earth Asteroid Tracking group at the Jet Propulsion Laboratory, a systematic and automated searching program was conceived and executed using the computing facilities at Lawrence Berkeley National Laboratory and the National Energy Research Supercomputing Center. An automated search had never been attempted on this scale. A number of planned future large supernovae projects are predicated on the ability to find supernovae quickly, reliably, and efficiently in large datasets. A prototype run of the SNfactory search pipeline conducted from 2002 to 2003 discovered 83 SNe at a final rate of 12 SNe/month. A large, homogeneous search of this scale offers an excellent opportunity to measure the rate of Type Ia supernovae. This thesis presents a new method for analyzing the true sensitivity of a multi-epoch supernova search and finds a Type Ia supernova rate from z {approx} 0.01-0.1 of r{sub V} = 4.26{sub -1.93 -0.10}{sup +1.39 +0.10} h{sup 3} x 10{sup -4} SNe Ia/yr/Mpc{sup 3} from a preliminary analysis of a subsample of the SNfactory prototype search. Several unusual supernovae were found in the course of the SNfactory prototype search. One in particular, SN 2002ic, was the first SN Ia to exhibit convincing evidence for a circumstellar medium and offers valuable insight into the progenitors of Type Ia supernovae.

Wood-Vasey, William Michael



Rolling Hills (IA) | Open Energy Information  

Open Energy Info (EERE)

Rolling Hills (IA) Rolling Hills (IA) Jump to: navigation, search Name Rolling Hills (IA) Facility Rolling Hills (IA) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner MidAmerican Energy Company Developer MidAmerican Energy Company Energy Purchaser MidAmerican Energy Company Location Massena IA Coordinates 41.230443°, -94.75459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.230443,"lon":-94.75459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


On the Brightness of Supernova Ia  

E-Print Network (OSTI)

Before 1998 the universe expansion was thought to be slowing down. After 1998 the universe expansion is thought to be accelerating up. The key evidence came from the observed brightness of high redshift supernovae Ia in 1998. Astronomers found that the observed brightness of high redshift supernovae Ia is fainter than expected. Astronomers believe this means that the universe expansion is accelerating up. In this paper it is argued that if the ionized gas in the universe space is taken into account, then the brightness of the high redshift supernova Ia should be fainter than expected. The universe expansion does not need to be accelerating up. The exotic form of energy (dark energy) does not need to be introduce

Yijia Zheng



Spectral diversity of Type Ia Supernovae  

E-Print Network (OSTI)

We use published spectroscopic and photometric data for 8 Type Ia supernovae to construct a dispersion spectrum for this class of object, showing their diversity over the wavelength range 3700A to 7100A. We find that the B and V bands are the spectral regions with the least dispersion, while the U band below 4100A is more diverse. Some spectral features such as the Si line at 6150A are also highly diverse. We then construct two objective measures of 'peculiarity' by (i) using the deviation of individual objects from the average SN Ia spectrum compared to the typical dispersion and (ii) applying principle component analysis. We demonstrate these methods on several SNe Ia that have previously been classified as peculiar.

J. Berian James; Tamara M. Davis; Brian P. Schmidt; Alex G. Kim


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Visualizing Buoyant Burning Bubbles in Type Ia Supernovae at...  

NLE Websites -- All DOE Office Websites (Extended Search)

Burning in Supernovae Buoyant Burning Bubbles in Type Ia Supernovae bubble-s.jpeg Flame ignition in type Ia supernovae leads to isolated bubbles of burning buoyant fluid. As a...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



Science Conference Proceedings (OSTI)

Comparing the ejecta velocities at maximum brightness and narrow circumstellar/interstellar Na D absorption line profiles of a sample of 23 Type Ia supernovae (SNe Ia), we determine that the properties of SN Ia progenitor systems and explosions are intimately connected. As demonstrated by Sternberg et al., half of all SNe Ia with detectable Na D absorption at the host-galaxy redshift in high-resolution spectroscopy have Na D line profiles with significant blueshifted absorption relative to the strongest absorption component, which indicates that a large fraction of SN Ia progenitor systems have strong outflows. In this study, we find that SNe Ia with blueshifted circumstellar/interstellar absorption systematically have higher ejecta velocities and redder colors at maximum brightness relative to the rest of the SN Ia population. This result is robust at a 98.9%-99.8% confidence level, providing the first link between the progenitor systems and properties of the explosion. This finding is further evidence that the outflow scenario is the correct interpretation of the blueshifted Na D absorption, adding additional confirmation that some SNe Ia are produced from a single-degenerate progenitor channel. An additional implication is that either SN Ia progenitor systems have highly asymmetric outflows that are also aligned with the SN explosion or SNe Ia come from a variety of progenitor systems where SNe Ia from systems with strong outflows tend to have more kinetic energy per unit mass than those from systems with weak or no outflows.

Foley, Ryan J.; Kirshner, Robert P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Simon, Joshua D.; Burns, Christopher R. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Gal-Yam, Avishay [Benoziyo Center for Astrophysics, Faculty of Physics, Weizmann Institute of Science, Rehovot 76100 (Israel); Hamuy, Mario [Departamento de Astronomia, Universidad de Chile, Casilla 36-D, Santiago (Chile); Morrell, Nidia I.; Phillips, Mark M. [Las Campanas Observatory, Carnegie Observatories, Casilla 601, La Serena (Chile); Shields, Gregory A. [Department of Astronomy, University of Texas, Austin, TX 78712 (United States); Sternberg, Assaf, E-mail: rfoley@cfa.harvard.edu [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Strasse 1, 85741 Garching (Germany)



Category:Des Moines, IA | Open Energy Information  

Open Energy Info (EERE)

IA IA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Des Moines, IA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Des Moines IA MidAmerican Energy Co (Iowa).png SVFullServiceRestauran... 64 KB SVQuickServiceRestaurant Des Moines IA MidAmerican Energy Co (Iowa).png SVQuickServiceRestaura... 64 KB SVHospital Des Moines IA MidAmerican Energy Co (Iowa).png SVHospital Des Moines ... 73 KB SVLargeHotel Des Moines IA MidAmerican Energy Co (Iowa).png SVLargeHotel Des Moine... 72 KB SVLargeOffice Des Moines IA MidAmerican Energy Co (Iowa).png SVLargeOffice Des Moin... 73 KB SVMediumOffice Des Moines IA MidAmerican Energy Co (Iowa).png SVMediumOffice Des Moi... 69 KB SVMidriseApartment Des Moines IA MidAmerican Energy Co (Iowa).png



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)



Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax



Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...


Turbulence-Flame Interactions in Type Ia Supernovae  

E-Print Network (OSTI)

Turbulence-Flame Interactions in Type Ia Supernovae A. J.Normalised time (e) Normalised flame speed Normalised time (length scale (cm) Laminar flame width Gibson scale Cell

Aspden, Andrew J; Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (Authors 1, 2 & 3); Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (Author 4); Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (Author 5)



DOE - Office of Legacy Management -- Titus Metals - IA 04  

Office of Legacy Management (LM)

from consideration under FUSRAP Also see Documents Related to TITUS METALS IA.04-1 - Argonne National Laboratory Memorandum; Lonergan to Novak; Subject: Extrusion of Billets,...


DOE - Office of Legacy Management -- Bendix Aviation Corp Pioneer Div - IA  

Office of Legacy Management (LM)

Bendix Aviation Corp Pioneer Div - Bendix Aviation Corp Pioneer Div - IA 05 FUSRAP Considered Sites Site: BENDIX AVIATION CORP., PIONEER DIV. (IA.05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Pioneer Division, Bendix Aviation Corporation Bendix Aviation Corporation Bendix Pioneer Division IA.05-1 IA.05-2 IA.05-3 Location: Davenport , Iowa IA.05-1 Evaluation Year: 1990 IA.05-2 IA.05-4 Site Operations: Conducted studies to investigate the feasibility of using sonic cleaning equipment to decontaminate uranium contaminated drums. IA.05-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited operations at the site IA.05-2 IA.05-4 IA.05-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IA.05-1


The Distant Type Ia Supernova Rate  

DOE R&D Accomplishments (OSTI)

We present a measurement of the rate of distant Type Ia supernovae derived using 4 large subsets of data from the Supernova Cosmology Project. Within this fiducial sample, which surveyed about 12 square degrees, thirty-eight supernovae were detected at redshifts 0.25--0.85. In a spatially flat cosmological model consistent with the results obtained by the Supernova Cosmology Project, we derive a rest-frame Type Ia supernova rate at a mean red shift z {approx_equal} 0.55 of 1.53 {sub -0.25}{sub -0.31}{sup 0.28}{sup 0.32} x 10{sup -4} h{sup 3} Mpc{sup -3} yr{sup -1} or 0.58{sub -0.09}{sub -0.09}{sup +0.10}{sup +0.10} h{sup 2} SNu(1 SNu = 1 supernova per century per 10{sup 10} L{sub B}sun), where the first uncertainty is statistical and the second includes systematic effects. The dependence of the rate on the assumed cosmological parameters is studied and the redshift dependence of the rate per unit comoving volume is contrasted with local estimates in the context of possible cosmic star formation histories and progenitor models.

Pain, R.; Fabbro, S.; Sullivan, M.; Ellis, R. S.; Aldering, G.; Astier, P.; Deustua, S. E.; Fruchter, A. S.; Goldhaber, G.; Goobar, A.; Groom, D. E.; Hardin, D.; Hook, I. M.; Howell, D. A.; Irwin, M. J.; Kim, A. G.; Kim, M. Y.; Knop, R. A.; Lee, J. C.; Perlmutter, S.; Ruiz-Lapuente, P.; Schahmaneche, K.; Schaefer, B.; Walton, N. A.



Conformal cosmological model and SNe Ia data  

SciTech Connect

Now there is a huge scientific activity in astrophysical studies and cosmological ones in particular. Cosmology transforms from a pure theoretical branch of science into an observational one. All the cosmological models have to pass observational tests. The supernovae type Ia (SNe Ia) test is among the most important ones. If one applies the test to determine parameters of the standard Friedmann-Robertson-Walker cosmological model one can conclude that observations lead to the discovery of the dominance of the {Lambda} term and as a result to an acceleration of the Universe. However, there are big mysteries connected with an origin and an essence of dark matter (DM) and the {Lambda} term or dark energy (DE). Alternative theories of gravitation are treated as a possible solution of DM and DE puzzles. The conformal cosmological approach is one of possible alternatives to the standard {Lambda}CDM model. As it was noted several years ago, in the framework of the conformal cosmological approach an introduction of a rigid matter can explain observational data without {Lambda} term (or dark energy). We confirm the claim with much larger set of observational data.

Zakharov, A. F., E-mail: zakharov@itep.ru [National Astronomical Observatories of Chinese Academy of Sciences (China); Pervushin, V. N. [Joint Institute for Nuclear Research, Bogoliubov Laboratory for Theoretical Physics (Russian Federation)



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Burning Thermals in Type Ia Supernovae A. J. Aspden1  

E-Print Network (OSTI)

Burning Thermals in Type Ia Supernovae A. J. Aspden1 , J. B. Bell1 , S. Dong2 , and S. E. Woosley2 ABSTRACT We develop a one-dimensional theoretical model for thermals burning in Type Ia supernovae based for the burning and for the expansion of the thermal due to changes in the background stratification found

Bell, John B.


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Visualizing Type Ia Supernova Explosions at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

Supernova Explosions Supernova Explosions Visualizing Type Ia Supernova Explosions Childs1a-Supernovasm.png Deep inside a dying star in a galaxy far, far away, a carbon fusion flame ignites. Ignition may happen in the middle or displaced slightly to one side, but this simulation explores the consequences of central ignition. In a localized hot spot, represented here by a deformed sphere with an average radius of 100 km, carbon is assumed to have already fused to iron, producing hot ash (~10 billion K) with a density about 20% less than its surroundings. As the burning progresses, this hot buoyant ash rises up and interacts with cold fuel. Rayleigh-Taylor fingers give rise to shear and turbulence, which interacts with the flame, causing it to move faster. In about 2 seconds, the energy released blows the entire white dwarf star up,


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Iowa Army Ammunition Plant - IA 02  

Office of Legacy Management (LM)

Army Ammunition Plant - IA 02 Army Ammunition Plant - IA 02 FUSRAP Considered Sites Iowa Army Ammunition Plant, IA Alternate Name(s): Burlington Ordnance Plant Iowa Ordnance Plant Silas Mason Company IA.02-3 Location: Located in Township 70 North, Range 3 West, Section 32, 5th Principal Meridian, Des Moines County, Burlington, Iowa IA.02-1 IA.02-5 Historical Operations: Assembled nuclear weapons, primarily high explosive components and conducted explosives testing using the high explosive components and depleted uranium. AEC and ERDA operations conducted under permit from the Department of the Army. IA.02-3 IA.02-4 Eligibility Determination: Eligible IA.02-5 Radiological Survey(s): Assessment Survey IA.02-2 Site Status: Cleanup pending by U.S. Army Corps of Engineers. IA.02-6


Late Light Curves of Normally-Luminous Type Ia Supernovae  

E-Print Network (OSTI)

The use of Type Ia supernovae as cosmological tools has reinforced the need to better understand these objects and their light curves. The light curves of Type Ia supernovae are powered by the nuclear decay of $^{56}Ni \\to ^{56}Co \\to ^{56}Fe$. The late time light curves can provide insight into the behavior of the decay products and their effect of the shape of the curves. We present the optical light curves of six "normal" Type Ia supernovae, obtained at late times with template image subtraction, and the fits of these light curves to supernova energy deposition models.

J. C. Lair; M. D. Leising; P. A. Milne; G. G. Williams



DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


UMore Ph IA CR Report 7-8-10.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PHASE IA ARCHAEOLOGICAL AND PHASE IA ARCHAEOLOGICAL AND ARCHITECTURAL HISTORY SURVEY FOR THE UMORE PARK RESEARCH WIND TURBINE PROJECT, DAKOTA COUNTY, MINNESOTA SHPO File No. Pending Client No. Pending The 106 Group Project No. 10-18 Submitted to: Barr Engineering Company 4700 West 77th Street Minneapolis, MN 55435-4803 Submitted by: The 106 Group Ltd. The Dacotah Building 370 Selby Avenue St. Paul, MN 55102 Principal Investigators: AnneKetz, M.A., RPA Greg Mathis, M.C.R.P. Report Authors: Mark Doperalski, B.S. Miranda Van Vleet, M.H.P July 2010 UMore Park Wind Turbine Project Phase IA Archaeological and Architectural History Survey Page i MANAGEMENT SUMMARY During May of 2010, The 106 Group Ltd. (106 Group) conducted a Phase IA archaeological and architectural history survey for the University of Minnesota Outreach, Research, and



SciTech Connect

Owing to their utility for measurements of cosmic acceleration, Type Ia supernovae (SNe Ia) are perhaps the best-studied class of SNe, yet the progenitor systems of these explosions largely remain a mystery. A rare subclass of SNe Ia shows evidence of strong interaction with their circumstellar medium (CSM), and in particular, a hydrogen-rich CSM; we refer to them as SNe Ia-CSM. In the first systematic search for such systems, we have identified 16 SNe Ia-CSM, and here we present new spectra of 13 of them. Six SNe Ia-CSM have been well studied previously, three were previously known but are analyzed in depth for the first time here, and seven are new discoveries from the Palomar Transient Factory. The spectra of all SNe Ia-CSM are dominated by H{alpha} emission (with widths of {approx}2000 km s{sup -1}) and exhibit large H{alpha}/H{beta} intensity ratios (perhaps due to collisional excitation of hydrogen via the SN ejecta overtaking slower-moving CSM shells); moreover, they have an almost complete lack of He I emission. They also show possible evidence of dust formation through a decrease in the red wing of H{alpha} 75-100 days past maximum brightness, and nearly all SNe Ia-CSM exhibit strong Na I D absorption from the host galaxy. The absolute magnitudes (uncorrected for host-galaxy extinction) of SNe Ia-CSM are found to be -21.3 mag {<=} M{sub R} {<=} -19 mag, and they also seem to show ultraviolet emission at early times and strong infrared emission at late times (but no detected radio or X-ray emission). Finally, the host galaxies of SNe Ia-CSM are all late-type spirals similar to the Milky Way, or dwarf irregulars like the Large Magellanic Cloud, which implies that these objects come from a relatively young stellar population. This work represents the most detailed analysis of the SN Ia-CSM class to date.

Silverman, Jeffrey M. [Department of Astronomy, University of Texas, Austin, TX 78712-0259 (United States); Nugent, Peter E. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gal-Yam, Avishay; Arcavi, Iair; Ben-Ami, Sagi [Benoziyo Center for Astrophysics, Weizmann Institute of Science, Rehovot 76100 (Israel); Sullivan, Mark [School of Physics and Astronomy, University of Southampton, Southampton SO17 1BJ (United Kingdom); Howell, D. Andrew; Graham, Melissa L. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Filippenko, Alexei V.; Bloom, Joshua S.; Cenko, S. Bradley; Clubb, Kelsey I. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Cao, Yi; Horesh, Assaf; Kulkarni, Shrinivas R. [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Chornock, Ryan; Foley, Ryan J. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Coil, Alison L. [Department of Physics, University of California, San Diego, La Jolla, CA 92093 (United States); Griffith, Christopher V. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Kasliwal, Mansi M., E-mail: jsilverman@astro.as.utexas.edu [Observatories of the Carnegie Institution of Science, Pasadena, CA 91101 (United States); and others



The Rate of Type Ia Supernovae at High Redshift  

E-Print Network (OSTI)

We derive the rates of Type Ia supernovae (SNIa) over a wide range of redshifts using a complete sample from the IfA Deep Survey. This sample of more than 100 SNIa is the largest set ever collected from a single survey, and therefore uniquely powerful for a detailed supernova rate (SNR) calculation. Measurements of the SNR as a function of cosmological time offer a glimpse into the relationship between the star formation rate (SFR) and Type Ia SNR, and may provide evidence for the progenitor pathway. We observe a progressively increasing Type Ia SNR between redshifts z~0.3-0.8. The Type Ia SNR measurements are consistent with a short time delay (t~1 Gyr) with respect to the SFR, indicating a fairly prompt evolution of SNIa progenitor systems. We derive a best-fit value of SFR/SNR 580 h_70^(-2) M_solar/SNIa for the conversion factor between star formation and SNIa rates, as determined for a delay time of t~1 Gyr between the SFR and the Type Ia SNR. More complete measurements of the Type Ia SNR at z>1 are necessary to conclusively determine the SFR--SNR relationship and constrain SNIa evolutionary pathways.

Brian J. Barris; John L. Tonry




SciTech Connect

To understand how best to use observations of Type Ia supernovae (SNe Ia) to obtain precise and accurate distances, we investigate the relations between spectra of SNe Ia and their intrinsic colors. Using a sample of 1630 optical spectra of 255 SNe, based primarily on data from the CfA Supernova Program, we examine how the velocity evolution and line strengths of Si II {lambda}6355 and Ca II H and K are related to the B - V color at peak brightness. We find that the maximum-light velocity of Si II {lambda}6355 and Ca II H and K and the maximum-light pseudo-equivalent width of Si II {lambda}6355 are correlated with intrinsic color, with intrinsic color having a linear relation with the Si II {lambda}6355 measurements. Ca II H and K does not have a linear relation with intrinsic color, but lower-velocity SNe tend to be intrinsically bluer. Combining the spectroscopic measurements does not improve intrinsic color inference. The intrinsic color scatter is larger for higher-velocity SNe Ia-even after removing a linear trend with velocity-indicating that lower-velocity SNe Ia are more 'standard crayons'. Employing information derived from SN Ia spectra has the potential to improve the measurements of extragalactic distances and the cosmological properties inferred from them.

Foley, Ryan J.; Sanders, Nathan E.; Kirshner, Robert P., E-mail: rfoley@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)



The diversity of Type Ia Supernovae: evidence for systematics?  

E-Print Network (OSTI)

The photometric and spectroscopic properties of 26 well observed Type Ia Supernovae (SNeIa) were analyzed with the aim to explore SNIa diversity. The sample includes (Branch-)normal SNe as well as extreme events like SNe 1991T and 1991bg, while the truly peculiar SNIa, SN2000cx and SN2002cx are not included in our sample . A statistical treatment reveals the existence of three different groups. The first group (FAINT) consists of faint SNeIa similar to SN1991bg, with low expansion velocities and rapid evolution of SiII velocity. A second group consists of ``normal'' SNeIa, also with high temporal velocity gradient (HVG), but with brighter mean absolute magnitude =-19.3 and higher expansion velocities than the FAINT SNe. The third group includes both ``normal'' and SN1991T-like SNeIa: these SNe populate a narrow strip in the SiII velocity evolution plot, with a small velocity gradient (SVG), but have absolute magnitudes similar to HVGs. While the FAINT and HVG SNeIa together seem to define a relation between RSi(II) and Dm15(B), the SVG ones either do not conform with that relation or define a new, looser one. The RSi(II) pre-maximum evolution of HVGs is strikingly different from that of SVGs. The impact of this evidence on the understanding of SNIa diversity, in terms of explosion mechanisms, degree of ejecta mixing, and ejecta-CSM interaction, is discussed.

S. Benetti; E. Cappellaro; P. A. Mazzali; M. Turatto; G. Altavilla; F. Bufano; N. Elias-Rosa; R. Kotak; G. Pignata; M. Salvo; V. Stanishev



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



China Ga Air Compressor, China Ga Air Compressor Products ...  

U.S. Energy Information Administration (EIA)

China Ga Air Compressor, China Ga Air Compressor Suppliers and Manufacturers Directory - Source a Large Selection of Ga Air Compressor Products at ...



Science Conference Proceedings (OSTI)

At a density near a few x10{sup 7} g cm{sup -3}, the subsonic burning in a Type Ia supernova (SN) enters the distributed regime (high Karlovitz number). In this regime, turbulence disrupts the internal structure of the flame, and so the idea of laminar burning propagated by conduction is no longer valid. The nature of the burning in this distributed regime depends on the turbulent Damkoehler number (Da{sub T}), which steadily declines from much greater than one to less than one as the density decreases to a few x10{sup 6} g cm{sup -3}. Classical scaling arguments predict that the turbulent flame speed s{sub T} , normalized by the turbulent intensity u-check, follows s{sub T}/u-check = Da{sub T}{sup 1/2} for Da{sub T} {approx}burns as a turbulently broadened effective unity Lewis number flame. This flame burns locally with speed s{sub l}ambda and width l{sub l}ambda, and we refer to this kind of flame as a lambda-flame. The burning becomes a collection of lambda-flames spread over a region approximately the size of the {integral} scale. While the total burning rate continues to have a well-defined average, s{sub T}{approx}u-check, the burning is unsteady. We present a theoretical framework, supported by both one-dimensional and three-dimensional numerical simulations, for the burning in these two regimes. Our results indicate that the average value of s{sub T} can actually be roughly twice u-check for Da{sub T} {approx}> 1, and that localized excursions to as much as 5 times u-check can occur. We also explore the properties of the individual flames, which could be sites for a transition to detonation when Da{sub T} {approx} 1. The lambda-flame speed and width can be predicted based on the turbulence in the star (specifically the energy dissipation rate epsilon*) and the turbulent nuclear burning timescale of the fuel tau {sup T}{sub nuc}. We propose a practical method for measuring s{sub l}ambda and l{sub l}ambda based on the scaling relations and small-scale computationally inexpensive simulations. This suggests that a simple turbulent flame model can be easily constructed suitable for large-scale distributed SNe flames. These results will be useful both for characterizing the deflagration speed in larger full-star simulations, where the flame cannot be resolved, and for predicting when detonation occurs.

Aspden, A. J.; Bell, J. B. [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (United States); Woosley, S. E. [Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (United States)



Redshift-Independent Distances to Type Ia Supernovae  

E-Print Network (OSTI)

We describe a procedure for accurately determining luminosity distances to Type Ia supernovae (SNe Ia) without knowledge of redshift. This procedure, which may be used as an extension of any of the various distance determination methods currently in use, is based on marginalizing over redshift, removing the requirement of knowing $z$ a priori. We demonstrate that the Hubble diagram scatter of distances measured with this technique is approximately equal to that of distances derived from conventional redshift-specific methods for a set of 60 nearby SNe Ia. This indicates that accurate distances for cosmological SNe Ia may be determined without the requirement of spectroscopic redshifts, which are typically the limiting factor for the number of SNe that modern surveys can collect. Removing this limitation would greatly increase the number of SNe for which current and future SN surveys will be able to accurately measure distance. The method may also be able to be used for high-$z$ SNe Ia to determine cosmological density parameters without redshift information.

Brian J. Barris; John L. Tonry



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



The type Ia supernova SNLS-03D3bb from a super-Chandrasekhar-mass white dwarf star  

E-Print Network (OSTI)

The absolute magnitudes of Type IA supernovae. Astrophys. J.in a Sublu- o minous Type Ia Supernova: SpectropolarimetryL. Could There Be a Hole in Type Ia Super- novae? Astrophys.


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Nucleosynthesis in type Ia supernovae driven by asymmetric thermonuclear ignition  

Science Conference Proceedings (OSTI)

Type Ia Supernovae (SNe Ia) are believed to be thermonuclear explosions of a white dwarf. They can be used as mature cosmological standardized candles, leading to the discovery of the accelerating expansion of the Universe. However, the explosion mechanism has not yet been fully clarified. In this paper, we first present nucleosynthetic features of a leading explosion scenario, namely a delayed-detonation scenario. Based on this, we propose a new and strong observational constraint on the explosion mechanism through emission lines from neutron-rich Fe-peaks. Especially, we show that an asymmetry in the explosion is likely a generic feature. We further argue that the diversity arising from various viewing angles can be an origin of observational diversities of SNe Ia seen in their spectral features (suspected possible biases in cosmology) and colors (related to the extinction estimate in cosmology). Using these new insights could open up a possibility of using SNe Ia as more precise distance indicators than currently employed.

Maeda, Keiichi [Institute for the Physics and Mathematics of the Universe (IPMU), Todai Institutes for Advanced Study (TODIAS), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan)



Optical Spectra of Type Ia Supernovae at z=0.46 and z=1.2  

E-Print Network (OSTI)

We present optical spectra, obtained with the Keck 10-m telescope, of two high-redshift type Ia supernovae (SNe Ia) discovered by the High-z Supernova Search Team: SN 1999ff at z=0.455 and SN 1999fv at z~1.2, the highest-redshift published SN Ia spectrum. Both SNe were at maximum light when the spectra were taken. We compare our high-z spectra with low-z normal and peculiar SNe Ia as well as with SNe Ic, Ib, and II. There are no significant differences between SN 1999ff and normal SNe Ia at low redshift. SN 1999fv appears to be a SN Ia and does not resemble the most peculiar nearby SNe Ia.

Coil, A L; Filippenko, A V; Leonard, D C; Tonry, J; Riess, A G; Challis, P M; Clocchiatti, A; Garnavich, P M; Hogan, C J; Jha, S; Kirshner, R P; Leibundgut, B; Phillips, M M; Schmidt, B P; Schommer, R A; Smith, R C; Soderberg, A M; Spyromilio, J; Stubbs, C; Suntzeff, N B; Woudt, P A; Coil, Alison L.; Matheson, Thomas; Filippenko, Alexei V.; Leonard, Douglas C.; Tonry, John; Riess, Adam G.; Challis, Peter; Clocchiatti, Alejandro; Garnavich, Peter M.; Hogan, Craig J.; Jha, Saurabh; Kirshner, Robert P.; Schmidt, Brian P.; Schommer, Robert A.; Soderberg, Alicia M.; Stubbs, Christopher; Suntzeff, Nicholas B.; Woudt, Patrick



Progenitors of type Ia supernovae in elliptical galaxies  

Science Conference Proceedings (OSTI)

Although there is a nearly universal agreement that type Ia supernovae are associated with the thermonuclear disruption of a CO white dwarf, the exact nature of their progenitors is still unknown. The single degenerate scenario envisages a white dwarf accreting matter from a non-degenerate companion in a binary system. Nuclear energy of the accreted matter is released in the form of electromagnetic radiation or gives rise to numerous classical nova explosions prior to the supernova event. We show that combined X-ray output of supernova progenitors and statistics of classical novae predicted in the single degenerate scenario are inconsistent with X-ray and optical observations of nearby early type galaxies and galaxy bulges. White dwarfs accreting from a donor star in a binary system and detonating at the Chandrasekhar mass limit can account for no more than {approx}5% of type Ia supernovae observed in old stellar populations.

Gilfanov, M.; Bogdan, A.



Type Ia Supernova Spectral Line Ratios as LuminosityIndicators  

SciTech Connect

Type Ia supernovae have played a crucial role in thediscovery of the dark energy, via the measurement of their light curvesand the determination of the peak brightness via fitting templates to theobserved lightcurve shape. Two spectroscopic indicators are also known tobe well correlated with peak luminosity. Since the spectroscopicluminosity indicators are obtained directly from observed spectra, theywill have different systematic errors than do measurements usingphotometry. Additionally, these spectroscopic indicators may be usefulfor studies of effects of evolution or age of the SNe~;Ia progenitorpopulation. We present several new variants of such spectroscopicindicators which are easy to automate and which minimize the effects ofnoise. We show that these spectroscopic indicators can be measured byproposed JDEM missions such as snap and JEDI.

Bongard, Sebastien; Baron, E.; Smadja, G.; Branch, David; Hauschildt, Peter H.



Learning from the scatter in type ia supernovae  

SciTech Connect

Type Ia Supernovae are standard candles so their mean apparent magnitude has been exploited to learn about the redshift-distance relationship. Besides intrinsic scatter in this standard candle, additional scatter is caused by gravitational magnification by large scale structure. Here they probe the dependence of this dispersion on cosmological parameters and show that information about the amplitude of clustering, {sigma}{sub s}, is contained in the scatter. In principle, it will be possible to constrain {sigma}{sub s} to within 5% with observations of 2000 Type Ia Supernovae. They identify three sources of systematic error--evolution of intrinsic scatter, baryon contributions to lensing, and non-Gaussianity of lensing--which will make this measurement difficult.

Dodelson, Scott; /Fermilab /Chicago U., Astron. Astrophys. Ctr.; Vallinotto, Alberto; /Fermilab /Chicago U.



Investigating the Flame Microstructure in Type Ia Supernovae  

E-Print Network (OSTI)

We present a numerical model to study the behavior of thermonuclear flames in the discontinuity approximation. This model is applied to investigate the Landau-Darrieus instability under conditions found in Type Ia supernova explosions of Chandrasekhar mass white dwarfs. This is a first step to explore the flame microstructure in these events. The model reproduces Landau's linearized stability analysis in early stages of the flame evolution and the stabilization in a cellular flame structure in the nonlinear stage.

F. K. Roepke; W. Hillebrandt; J. C. Niemeyer



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Reflections on Reflexions: I. Light Echoes in Type Ia Supernovae  

E-Print Network (OSTI)

In the last ten years, observational evidences about a possible connection between Type Ia Supernovae (SNe) properties and the environment where they explode have been steadily growing. In this paper I discuss, from a theoretical point of view but with an observer's perspective, the usage of light echoes (LEs) to probe the CSM around SNe of Type Ia since, in principle, they give us a unique opportunity of getting a three-dimensional description of the SN environment. In turn, this can be used to check the often suggested association of some Ia's with dusty/star forming regions, which would point to a young population for the progenitors. After giving a brief introduction to the LE phenomenon in single scattering approximation, I derive analytical and numerical solutions for the optical light and colour curves for a few simple dust geometries. A fully 3D multiple scattering treatment has also been implemented in a Monte Carlo code, which I have used to investigate the effects of multiple scattering. In particu...

Patat, F



Could There Be A Hole In Type Ia Supernovae?  

E-Print Network (OSTI)

In the favored progenitor scenario, Type Ia supernovae arise from a white dwarf accreting material from a non-degenerate companion star. Soon after the white dwarf explodes, the ejected supernova material engulfs the companion star; two-dimensional hydrodynamical simulations by Marietta et. al. show that, in the interaction, the companion star carves out a conical hole of opening angle 30-40 degrees in the supernova ejecta. In this paper we use multi-dimensional Monte Carlo radiative transfer calculations to explore the observable consequences of an ejecta-hole asymmetry. We calculate the variation of the spectrum, luminosity, and polarization with viewing angle for the aspherical supernova near maximum light. We find that the supernova looks normal from almost all viewing angles except when one looks almost directly down the hole. In the latter case, one sees into the deeper, hotter layers of ejecta. The supernova is relatively brighter and has a peculiar spectrum characterized by more highly ionized species, weaker absorption features, and lower absorption velocities. The spectrum viewed down the hole is comparable to the class of SN 1991T-like supernovae. We consider how the ejecta-hole asymmetry may explain the current spectropolarimetric observations of SNe Ia, and suggest a few observational signatures of the geometry. Finally, we discuss the variety currently seen in observed SNe Ia and how an ejecta-hole asymmetry may fit in as one of several possible sources of diversity.

Daniel Kasen; Peter Nugent; R. C. Thomas; Lifan Wang




Science Conference Proceedings (OSTI)

Using data from the Sloan Digital Sky Supernova Survey-II (SDSS-II SN Survey), we measure the rate of Type Ia supernovae (SNe Ia) as a function of galaxy properties at intermediate redshift. A sample of 342 SNe Ia with 0.05 0.15) SNe Ia in highly star-forming galaxies. We consider that the high levels of dust in these systems may be obscuring the reddest and faintest SNe Ia.

Smith, Mathew [Department of Physics, University of Western Cape, Bellville 7530, Cape Town (South Africa); Nichol, Robert C. [Institute of Cosmology and Gravitation, University of Portsmouth, Portsmouth PO1 3FX (United Kingdom); Dilday, Benjamin [Las Cumbres Observatory Global Telescope Network, 6740 Cortona Dr., Suite 102, Goleta, CA 93117 (United States); Marriner, John; Frieman, Joshua [Center for Particle Astrophysics, Fermilab, P.O. Box 500, Batavia, IL 60510 (United States); Kessler, Richard [Department of Astronomy and Astrophysics, University of Chicago, 5640 S. Ellis Ave, Chicago, IL 60637 (United States); Bassett, Bruce [African Institute for Mathematical Sciences, 6-8 Melrose Road, Muizenberg 7945 (South Africa); Cinabro, David [Department of Physics and Astronomy, Wayne State University, Detroit, MI 48201 (United States); Garnavich, Peter [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Jha, Saurabh W. [Department of Physics and Astronomy, Rutgers, State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Lampeitl, Hubert [Astrophysics, Cosmology and Gravity Centre (ACGC), Department of Mathematics and Applied Mathematics, University of Cape Town, Rondebosch 7701 (South Africa); Sako, Masao [Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Schneider, Donald P. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Sollerman, Jesper, E-mail: matsmith2@gmail.com [Oskar Klein Centre, Department of Astronomy, AlbaNova, Stockholm University, SE-106 91 Stockholm (Sweden)



Ba-Ga (Barium - Gallium)  

Science Conference Proceedings (OSTI)

Ba-Ga crystallographic data...Ba-Ga crystallographic data Phase Composition, wt% Ga Pearson symbol Space group (Ba) 0 cI 2 Im m Ba 10 Ga 4.8 cF 176 Fd m Ba 8 Ga 7 30.8 cP 60 P 2 1 3 BaGa 2 50.4 hP 3 P 6/ mmm BaGa 4 67 tI 10 I 4/ mmm (Ga) 100 hP 2 P 6 3 / mmc...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Turbulence-Flame Interactions in Type Ia Supernovae  

E-Print Network (OSTI)

The large range of time and length scales involved in type Ia supernovae (SN Ia) requires the use of flame models. As a prelude to exploring various options for flame models, we consider, in this paper, high-resolution three-dimensional simulations of the small-scale dynamics of nuclear flames in the supernova environment in which the details of the flame structure are fully resolved. The range of densities examined, 1 to $8 \\times 10^7$ g cm$^{-3}$, spans the transition from the laminar flamelet regime to the distributed burning regime where small scale turbulence disrupts the flame. The use of a low Mach number algorithm facilitates the accurate resolution of the thermal structure of the flame and the inviscid turbulent kinetic energy cascade, while implicitly incorporating kinetic energy dissipation at the grid-scale cutoff. For an assumed background of isotropic Kolmogorov turbulence with an energy characteristic of SN Ia, we find a transition density between 1 and $3 \\times 10^7$ g cm$^{-3}$ where the nature of the burning changes qualitatively. By $1 \\times 10^7$ g cm$^{-3}$, energy diffusion by conduction and radiation is exceeded, on the flame scale, by turbulent advection. As a result, the effective Lewis Number approaches unity. That is, the flame resembles a laminar flame, but is turbulently broadened with an effective diffusion coefficient, $D_T \\sim u' l$, where $u'$ is the turbulent intensity and $l$ is the integral scale. For the larger integral scales characteristic of a real supernova, the flame structure is predicted to become complex and unsteady. Implications for a possible transition to detonation are discussed.

A. J. Aspden; J. B. Bell; M. S. Day; S. E. Woosley; M. Zingale



Reflections on Reflexions: I. Light Echoes in Type Ia Supernovae  

E-Print Network (OSTI)

In the last ten years, observational evidences about a possible connection between Type Ia Supernovae (SNe) properties and the environment where they explode have been steadily growing. In this paper I discuss, from a theoretical point of view but with an observer's perspective, the usage of light echoes (LEs) to probe the CSM around SNe of Type Ia since, in principle, they give us a unique opportunity of getting a three-dimensional description of the SN environment. In turn, this can be used to check the often suggested association of some Ia's with dusty/star forming regions, which would point to a young population for the progenitors. After giving a brief introduction to the LE phenomenon in single scattering approximation, I derive analytical and numerical solutions for the optical light and colour curves for a few simple dust geometries. A fully 3D multiple scattering treatment has also been implemented in a Monte Carlo code, which I have used to investigate the effects of multiple scattering. In particular, I have explored in detail the LE colour dependency from time and dust distribution, since this is a promising tool to determine the dust density and derive the effective presence of multiple scattering from the observed properties. Finally, again by means of Monte Carlo simulations, I have studied the effects of multiple scattering on the LE linear polarization, analyzing the dependencies from the dust parameters and geometry. Both the analytical formalism and MC codes described in this paper can be used for any LE for which the light curve of the central source is known.

F. Patat




SciTech Connect

The origin of the diffuse extragalactic gamma-ray background (EGB) has been intensively studied but remains unsettled. Current popular source candidates include unresolved star-forming galaxies, starburst galaxies, and blazars. In this paper, we calculate the EGB contribution from the interactions of cosmic rays accelerated by Type Ia supernovae (SNe), extending earlier work that only included core-collapse SNe. We consider Type Ia events not only in star-forming galaxies, but also in quiescent galaxies that lack star formation. In the case of star-forming galaxies, consistently including Type Ia events makes little change to the star-forming EGB prediction, so long as both SN types have the same cosmic-ray acceleration efficiencies in star-forming galaxies. Thus, our updated EGB estimate continues to show that star-forming galaxies can represent a substantial portion of the signal measured by Fermi. In the case of quiescent galaxies, conversely, we find a wide range of possibilities for the EGB contribution. The dominant uncertainty we investigated comes from the mass in hot gas in these objects, which provides targets for cosmic rays; total gas masses are as yet poorly known, particularly at larger radii. Additionally, the EGB estimation is very sensitive to the cosmic-ray acceleration efficiency and confinement, especially in quiescent galaxies. In the most optimistic allowed scenarios, quiescent galaxies can be an important source of the EGB. In this case, star-forming galaxies and quiescent galaxies together will dominate the EGB and leave little room for other contributions. If other sources, such as blazars, are found to have important contributions to the EGB, then either the gas mass or cosmic-ray content of quiescent galaxies must be significantly lower than in their star-forming counterparts. In any case, improved Fermi EGB measurements will provide important constraints on hot gas and cosmic rays in quiescent galaxies.

Lien, Amy; Fields, Brian D. [Department of Physics, University of Illinois, Urbana, IL 61801 (United States)



Turbulence-Flame Interactions in Type Ia Supernovae  

SciTech Connect

The large range of time and length scales involved in type Ia supernovae (SN Ia) requires the use of flame models. As a prelude to exploring various options for flame models, we consider, in this paper, high-resolution three-dimensional simulations of the small-scale dynamics of nuclear flames in the supernova environment in which the details of the flame structure are fully resolved. The range of densities examined, 1 to 8 x 107 g cm-3, spans the transition from the laminar flamelet regime to the distributed burning regime where small scale turbulence disrupts the flame. The use of a low Mach number algorithm facilitates the accurate resolution of the thermal structure of the flame and the inviscid turbulent kinetic energy cascade, while implicitly incorporating kinetic energy dissipation at the grid-scale cutoff. For an assumed background of isotropic Kolmogorov turbulence with an energy characteristic of SN Ia, we find a transition density between 1 and 3 x 107 g cm-3 where the nature of the burning changes ualitatively. By 1 x 107 g cm-3, energy diffusion by conduction and radiation is exceeded, on the flame scale, by turbulent advection. As a result, the effective Lewis Number approaches unity. That is, the flame resembles a laminar flame, but is turbulently broadened with an effective diffusion coefficient, D_T \\sim u' l, where u' is the turbulent intensity and l is the integral scale. For the larger integral scales characteristic of a real supernova, the flame structure is predicted to become complex and unsteady. Implications for a possible transition to detonation are discussed.

Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (Authors 1, 2& 3); Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (Author 4); Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (Author 5); Aspden, Andrew J; Aspden, Andrew J.; Bell, John B.; Day, Marc S.; Woosley, Stan E.; Zingale, Mike



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


Ga-Zr (Gallium - Zirconium)  

Science Conference Proceedings (OSTI)

Ga-Zr crystallographic data...Ga 5 Zr 3 44.0 oC 32 Cmcm Ga 3 Zr 2 47 oF 40 Fdd 2 βGaZr 56.7 ? ? αGaZr 56.7 tI 16 I 4 1 / amd Ga 4 Zr 5 62.1 hP 18 P 6 3 / mcm Ga 2 Zr 3 66 tP 10 P 4/ mbm Ga 3 Zr 5 68.6 hP 16 P 6 3 / mcm GaZr 2 72.4 tI 12 I 4/ mcm (βZr) ~94 to 100 cI 2 Im m (αZr) 99.4 to 100 hP 2 P 6 3 / mmc...


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Microsoft PowerPoint - IEEE IAS PES 102313.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE's ARRA DOE's ARRA Smart Grid Program Steve Bossart, Senior Energy Analyst IEEE IAS/PES Pittsburgh Section October 23, 2013 ‹#› Topics * OE ARRA Smart Grid Program * OE ARRA Smart Grid Progress * Results and Case Studies * Life After ARRA Smart Grid ‹#› DOE OE ARRA Smart Grid Program ‹#› American Recovery and Reinvestment Act ($4.5B) * Smart Grid Investment Grants (99 projects) - $3.4 billion Federal; $4.7 billion private sector - > 800 PMUs covering almost 100% of transmission - ~ 8000 distribution automation circuits - > 15 million smart meters * Smart Grid Demonstration Projects (32 projects) - $685 million Federal; $1 billion private sector - 16 storage projects - 16 regional demonstrations Smart Grid ARRA Activities ‹#› Smart Grid investment from ARRA field projects


Type Ia Supernova: Burning and Detonation in the Distributed Regime  

E-Print Network (OSTI)

A simple, semi-analytic representation is developed for nuclear burning in Type Ia supernovae in the special case where turbulent eddies completely disrupt the flame. The speed and width of the ``distributed'' flame front are derived. For the conditions considered, the burning front can be considered as a turbulent flame brush composed of corrugated sheets of well-mixed flames. These flames are assumed to have a quasi-steady-state structure similar to the laminar flame structure, but controlled by turbulent diffusion. Detonations cannot appear in the system as long as distributed flames are still quasi-steady-state, but this condition is violated when the distributed flame width becomes comparable to the size of largest turbulent eddies. When this happens, a transition to detonation may occur. For current best estimates of the turbulent energy, the most likely density for the transition to detonation is in the range 0.5 - 1.5 x 10^7 g cm^{-3}.

S. E. Woosley



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


AlGaN/GaN-based power semiconductor switches  

E-Print Network (OSTI)

AlGaN/GaN-based high-electron-mobility transistors (HEMTs) have great potential for their use as high efficiency and high speed power semiconductor switches, thanks to their high breakdown electric field, mobility and ...

Lu, Bin, Ph. D. Massachusetts Institute of Technology



Type Ia Supernovae Rates and Galaxy Clustering from the CFHT Supernova Legacy Survey  

E-Print Network (OSTI)

The Canada-France-Hawaii Telescope Supernova Legacy Survey (SNLS) has created a large homogeneous database of intermediate redshift (0.2 rates, properties, and host galaxy star formation rates. The SNLS SN Ia database has now been combined with a photometric redshift galaxy catalog and an optical galaxy cluster catalog to investigate the possible influence of galaxy clustering on the SN Ia rate, over and above the expected effect due to the dependence of SFR on clustering through the morphology-density relation. We identify three cluster SNe Ia, plus three additional possible cluster SNe Ia, and find the SN Ia rate per unit mass in clusters at intermediate redshifts is consistent with the rate per unit mass in field early-type galaxies and the SN Ia cluster rate from low redshift cluster targeted surveys. We also find the number of SNe Ia in cluster environments to be within a factor of two of expectations from the two component SNIa rate model.

M. L. Graham; C. J. Pritchet; M. Sullivan; S. D. J. Gwyn; J. D. Neill; E. Y. Hsiao; P. Astier; D. Balam; C. Balland; S. Basa; R. G. Carlberg; A. Conley; D. Fouchez; J. Guy; D. Hardin; I. M. Hook; D. A. Howell; R. Pain; K. Perrett; N. Regnault; S. Baumont; J. Le Du; C. Lidman; S. Perlmutter; P. Ripoche; N. Suzuki; E. S. Walker; T. Zhang



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Fitting Type Ia supernovae with coupled dark energy  

E-Print Network (OSTI)

We discuss the possible consistency of the recently discovered Type Ia supernovae at z>1 with models in which dark energy is strongly coupled to a significant fraction of dark matter, and in which an (asymptotic) accelerated phase exists where dark matter and dark energy scale in the same way. Such a coupling has been suggested for a possible solution of the coincidence problem, and is also motivated by string cosmology models of "late time" dilaton interactions. Our analysis shows that, for coupled dark energy models, the recent data are still consistent with acceleration starting as early as at $z=3$ (to within 90% c.l.), although at the price of a large "non-universality" of the dark energy coupling to different matter fields. Also, as opposed to uncoupled models which seem to prefer a ``phantom'' dark energy, we find that a large amount of coupled dark matter is compatible with present data only if the dark energy field has a conventional equation of state w>-1.

Amendola, L; Piazza, F; Amendola, Luca; Gasperini, Maurizio; Piazza, Federico



50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mtrologie des supernovae de type Ia pour la cosmologie : instrumentation et analyse calorimtrique.  

E-Print Network (OSTI)

??L'utilisation des supernovae de type Ia comme indicateurs de distance est un pilier du modle de concordance actuel en cosmologie. Le travail d'instrumentation prsent dans (more)

Juramy, Claire



Toward Exascale Computing of Type Ia and Ib,c Supernovae: V&V...  

NLE Websites -- All DOE Office Websites (Extended Search)

Toward Exascale Computing of Type Ia and Ib,c Supernovae: V&V of Current Models PI Name: Don Lamb PI Email: lamb@oddjob.uchicago.edu Institution: University Of Chicago Allocation...


Diversity of supernovae Ia determined using equivalent widths of Si II 4000  

E-Print Network (OSTI)

Spectroscopic and photometric properties of low and high-z supernovae Ia (SNe Ia) have been analyzed in order to achieve a better understanding of their diversity and to identify possible SN Ia sub-types. We use wavelet transformed spectra in which one can easily measure spectral features. We investigate the \\ion{Si}{II} 4000 equivalent width ($EW_w\\lbrace\\ion{Si}{II}\\rbrace$). The ability and, especially, the ease in extending the method to SNe at high-$z$ is demonstrated. We applied the method to 110 SNe Ia and found correlations between $EW_w\\lbrace\\ion{Si}{II}\\rbrace$ and parameters related to the light-curve shape for 88 supernovae with available photometry. No evidence for evolution of $EW_w\\lbrace\\ion{Si}{II}\\rbrace$ with redshift is seen. Three sub-classes of SNe Ia were confirmed using an independent cluster analysis with only light-curve shape, colour, and $EW_w\\lbrace\\ion{Si}{II}\\rbrace$. SNe from high-$z$ samples seem to follow a similar grouping to nearby objects. The $EW_w\\lbrace\\ion{Si}{II}\\rbrace$ value measured on a single spectrum may point towards SN Ia sub-classification, avoiding the need for expansion velocity gradient calculations.

V. Arsenijevic; S. Fabbro; A. M. Mourao; A. J. Rica da Silva



Polarization-engineered GaN/InGaN/GaN tunnel diodes  

E-Print Network (OSTI)

We report on the design and demonstration of polarization-engineered GaN/InGaN/GaN tunnel junction diodes with high current density and low tunneling turn-on voltage. Wentzel-Kramers-Brillouin (WKB) calculations were used to model and design tunnel junctions with narrow bandgap InGaN-based barrier layers. N-polar p-GaN/In0.33Ga0.67N/n-GaN heterostructure tunnel diodes were grown using molecular beam epitaxy. Efficient zero bias tunneling turn-on with a high current density of 118 A/cm2 at a reverse bias of 1V, reaching a maximum current density up to 9.2 kA/cm2 were obtained. These results represent the highest current density reported in III-nitride tunnel junctions, and demonstrate the potential of III-nitride tunnel devices for a broad range of optoelectronic and electronic applications.

Sriram Krishnamoorthy; Digbijoy N. Nath; Fatih Akyol; Pil Sung Park; Michele Esposto; Siddharth Rajan



GaN High Power Devices  

SciTech Connect

A brief review is given of recent progress in fabrication of high voltage GaN and AlGaN rectifiers, GaN/AlGaN heterojunction bipolar transistors, GaN heterostructure and metal-oxide semiconductor field effect transistors. Improvements in epitaxial layer quality and in fabrication techniques have led to significant advances in device performance.




Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Verifying the Cosmological Utility of Type Ia Supernovae: Implications of a Dispersion in the Ultraviolet Spectra  

SciTech Connect

We analyze the mean rest-frame ultraviolet (UV) spectrum of Type Ia Supernovae (SNe) and its dispersion using high signal-to-noise ratio Keck-I/LRIS-B spectroscopy for a sample of 36 events at intermediate redshift (z=0.5) discovered by the Canada-France-Hawaii Telescope Supernova Legacy Survey (SNLS). We introduce a new method for removing host galaxy contamination in our spectra, exploiting the comprehensive photometric coverage of the SNLS SNe and their host galaxies, thereby providing the first quantitative view of the UV spectral properties of a large sample of distant SNe Ia. Although the mean SN Ia spectrum has not evolved significantly over the past 40percent of cosmic history, precise evolutionary constraints are limited by the absence of a comparable sample of high-quality local spectra. The mean UV spectrum of our z~;;=0.5 SNe Ia and its dispersion is tabulated for use in future applications. Within the high-redshift sample, we discover significant UV spectral variations and exclude dust extinction as the primary cause by examining trends with the optical SN color. Although progenitor metallicity may drive some of these trends, the variations we see are much larger than predicted in recent models and do not follow expected patterns. An interesting new result is a variation seen in the wavelength of selected UV features with phase. We also demonstrate systematic differences in the SN Ia spectral features with SN light curve width in both the UV and the optical. We show that these intrinsic variations could represent a statistical limitation in the future use of high-redshift SNe Ia for precision cosmology. We conclude that further detailed studies are needed, both locally and at moderate redshift where the rest-frame UV can be studied precisely, in order that future missions can confidently be planned to fully exploit SNe Ia as cosmological probes.

Nugent, Peter E; Ellis, R.S.; Sullivan, M.; Nugent, P.E.; Howell, D.A.; Gal-Yam, A.; Astier, P.; Balam, D.; Balland, C.; Basa, S.; Carlberg, R.; Conley, A.; Fouchez, D.; Guy, J.; Hardin, D.; Hook, I.; Pain, R.; Perrett, K.; Pritchet, C.J.; Regnault, N.



GA SNC Solar | Open Energy Information  

Open Energy Info (EERE)

GA SNC Solar Jump to: navigation, search Name GA-SNC Solar Place Nevada Sector Solar Product Nevada-based PV project developer and joint venture of GA-Solar North America and...


Category:Savannah, GA | Open Energy Information  

Open Energy Info (EERE)

Savannah, GA Savannah, GA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Savannah, GA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Savannah GA Georgia Power Co.png SVFullServiceRestauran... 80 KB SVHospital Savannah GA Georgia Power Co.png SVHospital Savannah GA... 80 KB SVLargeHotel Savannah GA Georgia Power Co.png SVLargeHotel Savannah ... 75 KB SVLargeOffice Savannah GA Georgia Power Co.png SVLargeOffice Savannah... 82 KB SVMediumOffice Savannah GA Georgia Power Co.png SVMediumOffice Savanna... 85 KB SVMidriseApartment Savannah GA Georgia Power Co.png SVMidriseApartment Sav... 80 KB SVOutPatient Savannah GA Georgia Power Co.png SVOutPatient Savannah ... 84 KB SVPrimarySchool Savannah GA Georgia Power Co.png


Category:Atlanta, GA | Open Energy Information  

Open Energy Info (EERE)

GA GA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Atlanta, GA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Atlanta GA Georgia Power Co.png SVFullServiceRestauran... 81 KB SVHospital Atlanta GA Georgia Power Co.png SVHospital Atlanta GA ... 81 KB SVLargeHotel Atlanta GA Georgia Power Co.png SVLargeHotel Atlanta G... 74 KB SVLargeOffice Atlanta GA Georgia Power Co.png SVLargeOffice Atlanta ... 82 KB SVMediumOffice Atlanta GA Georgia Power Co.png SVMediumOffice Atlanta... 84 KB SVMidriseApartment Atlanta GA Georgia Power Co.png SVMidriseApartment Atl... 82 KB SVOutPatient Atlanta GA Georgia Power Co.png SVOutPatient Atlanta G... 83 KB SVPrimarySchool Atlanta GA Georgia Power Co.png SVPrimarySchool Atlant...



Science Conference Proceedings (OSTI)

We present the first maximum-light ultraviolet (UV) through near-infrared (NIR) Type Ia supernova (SN Ia) spectrum. This spectrum of SN 2011iv was obtained nearly simultaneously by the Hubble Space Telescope at UV/optical wavelengths and the Magellan Baade telescope at NIR wavelengths. These data provide the opportunity to examine the entire maximum-light SN Ia spectral energy distribution. Since the UV region of an SN Ia spectrum is extremely sensitive to the composition of the outer layers of the explosion, which are transparent at longer wavelengths, this unprecedented spectrum can provide strong constraints on the composition of the SN ejecta, and similarly the SN explosion and progenitor system. SN 2011iv is spectroscopically normal, but has a relatively fast decline ({Delta}m{sub 15}(B) = 1.69 {+-} 0.05 mag). We compare SN 2011iv to other SNe Ia with UV spectra near maximum light and examine trends between UV spectral properties, light-curve shape, and ejecta velocity. We tentatively find that SNe with similar light-curve shapes but different ejecta velocities have similar UV spectra, while those with similar ejecta velocities but different light-curve shapes have very different UV spectra. Through a comparison with explosion models, we find that both a solar-metallicity W7 and a zero-metallicity delayed-detonation model provide a reasonable fit to the spectrum of SN 2011iv from the UV to the NIR.

Foley, Ryan J.; Marion, G. Howie; Challis, Peter; Kirshner, Robert P.; Berta, Zachory K. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Kromer, Markus; Taubenberger, Stefan; Hillebrandt, Wolfgang; Roepke, Friedrich K.; Ciaraldi-Schoolmann, Franco; Seitenzahl, Ivo R. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Strasse 1, D-85748 Garching bei Muenchen (Germany); Pignata, Giuliano [Departamento de Ciencias Fisicas, Universidad Andres Bello, Avda. Republica 252, Santiago (Chile); Stritzinger, Maximilian D. [Department of Physics and Astronomy, Aarhus University, Ny Munkegade, DK-8000 Aarhus C (Denmark); Filippenko, Alexei V.; Li Weidong; Silverman, Jeffrey M. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Folatelli, Gaston [Kavli Institute for the Physics and Mathematics of the Universe (Kavli IPMU, WPI), Todai Institutes for Advanced Study, University of Tokyo, Kashiwa 277-8583 (Japan); Hsiao, Eric Y.; Morrell, Nidia I. [Carnegie Observatories, Las Campanas Observatory, La Serena (Chile); Simcoe, Robert A., E-mail: rfoley@cfa.harvard.edu [MIT-Kavli Institute for Astrophysics and Space Research, 77 Massachusetts Avenue, 37-664D Cambridge, MA 02139 (United States); and others



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Spectral Modeling of SNe Ia Near Maximum Light: Probing the Characteristics of Hydro Models  

E-Print Network (OSTI)

We have performed detailed NLTE spectral synthesis modeling of 2 types of 1-D hydro models: the very highly parameterized deflagration model W7, and two delayed detonation models. We find that overall both models do about equally well at fitting well observed SNe Ia near to maximum light. However, the Si II 6150 feature of W7 is systematically too fast, whereas for the delayed detonation models it is also somewhat too fast, but significantly better than that of W7. We find that a parameterized mixed model does the best job of reproducing the Si II 6150 line near maximum light and we study the differences in the models that lead to better fits to normal SNe Ia. We discuss what is required of a hydro model to fit the spectra of observed SNe Ia near maximum light.

E. Baron; S. Bongard; David Branch; Peter H. Hauschildt




Science Conference Proceedings (OSTI)

We present early phase observations in optical and near-infrared wavelengths for the extremely luminous Type Ia supernova (SN Ia) 2009dc. The decline rate of the light curve is DELTAm{sub 15}(B) = 0.65 +- 0.03, which is one of the slowest among SNe Ia. The peak V-band absolute magnitude is estimated to be M{sub V} = -19.90 +- 0.15 mag if no host extinction is assumed. It reaches M{sub V} = -20.19 +- 0.19 mag if we assume the host extinction of A{sub V} = 0.29 mag. SN 2009dc belongs to the most luminous class of SNe Ia, like SNe 2003fg and 2006gz. Our JHK{sub s} -band photometry shows that this SN is also one of the most luminous SNe Ia in near-infrared wavelengths. We estimate the ejected {sup 56}Ni mass of 1.2 +- 0.3 M{sub sun} for the no host extinction case (and of 1.6 +- 0.4 M{sub sun} for the host extinction of A{sub V} = 0.29 mag). The C II lambda6580 absorption line remains visible until a week after the maximum brightness, in contrast to its early disappearance in SN 2006gz. The line velocity of Si II lambda6355 is about 8000 km s{sup -1} around the maximum, being considerably slower than that of SN 2006gz. The velocity of the C II line is similar to or slightly less than that of the Si II line around the maximum. The presence of the carbon line suggests that the thick unburned C+O layer remains after the explosion. Spectropolarimetric observations by Tanaka et al. indicate that the explosion is nearly spherical. These observational facts suggest that SN 2009dc is a super-Chandrasekhar mass SN Ia.

Yamanaka, M.; Arai, A.; Chiyonobu, S.; Fukazawa, Y.; Ikejiri, Y.; Itoh, R.; Komatsu, T.; Miyamoto, H. [Department of Physical Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan); Kawabata, K. S. [Hiroshima Astrophysical Science Center, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Kinugasa, K.; Hashimoto, O.; Honda, S. [Gunma Astronomical Observatory, Takayama, Gunma 377-0702 (Japan); Tanaka, M. [Department of Astronomy, School of Science, University of Tokyo, Bunkyo-ku, Tokyo 113-0033 (Japan); Imada, A.; Kuroda, D. [Okayama Astrophysical Observatory, National Astronomical Observatory of Japan, Kamogata, Asakuchi-shi, Okayama 719-0232 (Japan); Maeda, K.; Nomoto, K. [Institute for the Physics and Mathematics of the Universe, University of Tokyo, Kashiwa (Japan); Kamata, Y. [National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kawai, N. [Department of Physics, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo 152-8551 (Japan); Konishi, K., E-mail: myamanaka@hiroshima-u.ac.j [Institute for Cosmic Ray Research, University of Tokyo, 5-1-5, Kashiwanoha, Kashiwa, Chiba, 277-8582 (Japan)




SciTech Connect

SN 2002es is a peculiar subluminous Type Ia supernova (SN Ia) with a combination of observed characteristics never before seen in an SN Ia. At maximum light, SN 2002es shares spectroscopic properties with the underluminous SN 1991bg subclass of SNe Ia, but with substantially lower expansion velocities ({approx}6000 km s{sup -1}) more typical of the peculiar SN 2002cx subclass. Photometrically, SN 2002es differs from both SN 1991bg-like and SN 2002cx-like supernovae. Although at maximum light it is subluminous (M{sub B} = -17.78 mag), SN 2002es has a relatively broad light curve ({Delta}m{sub 15}(B) = 1.28 {+-} 0.04 mag), making it a significant outlier in the light-curve width versus luminosity relationship. We estimate a {sup 56}Ni mass of 0.17 {+-} 0.05 M{sub Sun} synthesized in the explosion, relatively low for an SN Ia. One month after maximum light, we find an unexpected plummet in the bolometric luminosity. The late-time decay of the light curves is inconsistent with our estimated {sup 56}Ni mass, indicating that either the light curve was not completely powered by {sup 56}Ni decay or the ejecta became optically thin to {gamma}-rays within a month after maximum light. The host galaxy is classified as an S0 galaxy with little to no star formation, indicating that the progenitor of SN 2002es is likely from an old stellar population. We also present a less extensive data set for SN 1999bh, an object which shares similar photometric and spectroscopic properties. Both objects were found as part of the Lick Observatory Supernova Search, allowing us to estimate that these objects should account for 2.5% of SNe Ia within a fixed volume. Current theoretical models are unable to explain the observed characteristics of SN 2002es.

Ganeshalingam, Mohan; Li Weidong; Filippenko, Alexei V.; Silverman, Jeffrey M.; Shen, Ken J. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Chornock, Ryan; Foley, Ryan J.; Kirshner, Robert P.; Calkins, Mike [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Matheson, Thomas [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Milne, Peter, E-mail: mganesh@astro.berkeley.edu [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States)



Atomic structure and energy spectrum of Ga(As,P)/GaP heterostructures  

Science Conference Proceedings (OSTI)

The atomic structure and energy spectrum of Ga(As,P)/GaP heterostructures were studied. It was shown that the deposition of GaAs of the same nominal thickness leads to the formation of pseudomorphic GaAs/GaP quantum wells (QW), fully relaxed GaAs/GaP self-assembled quantum dots (SAQDs), or pseudomorphic GaAsP/GaP SAQDs depending on the growth temperature. We demonstrate that the atomic structure of Ga(As,P)/GaP heterostructures is ruled by the temperature dependence of adatom diffusion rate and GaAs-GaP intermixing. The band alignment of pseudomorphic GaAs/GaP QW and GaAsP/GaP SAQDs is shown to be of type II, in contrast to that of fully relaxed GaAs/GaP SAQDs, which have the band alignment of type I with the lowest electronic states at the indirect L valley of the GaAs conduction band.

Abramkin, D. S.; Putyato, M. A.; Budennyy, S. A.; Gutakovskii, A. K.; Semyagin, B. R.; Preobrazhenskii, V. V.; Shamirzaev, T. S. [A. V. Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences, Pr. Lavrentyeva 13, 630090 Novosibirsk (Russian Federation); Kolomys, O. F.; Strelchuk, V. V. [V. E. Lashkarev Institute of Semiconductor Physics NAS of Ukraine, Pr. Nauki 41, 03028 Kiev (Ukraine)



General Atomics (GA) Fusion News: A New Spin on Understanding...  

NLE Websites -- All DOE Office Websites (Extended Search)

General Atomics (GA) Fusion News: A New Spin on Understanding Plasma Confinement American Fusion News Category: General Atomics (GA) Link: General Atomics (GA) Fusion News: A New...

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Rodefeld Landfill Ga Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Rodefeld Landfill Ga Biomass Facility Jump to: navigation, search Name Rodefeld Landfill Ga Biomass Facility Facility Rodefeld Landfill Ga Sector Biomass Facility Type Landfill Gas...


Symbiotic stars as possible progenitors of SNe Ia: binary parameters and overall outlook  

E-Print Network (OSTI)

Symbiotic stars are interacting binaries in which the first-formed white dwarf accretes and burns material from a red giant companion. This paper aims at presenting physical characteristics of these objects and discussing their possible link with progenitors of type Ia supernovae.

Miko?ajewska, J



Final Technical Report: Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae  

Science Conference Proceedings (OSTI)

The final technical report from the project "Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae" led at Rutgers the State University of New Jersey by Prof. Saurabh W. Jha is presented, including all publications resulting from this award.

Saurabh W. Jha




SciTech Connect

Prior to the explosive burning of a white dwarf (WD) that makes a Type Ia supernova (SN Ia), the star 'simmers' for {approx}10{sup 3} yr in a convecting, carbon-burning region. I estimate the excitation of g-modes by convection during this phase and explore their possible effect on the WD. As these modes propagate from the core of the WD toward its surface, their amplitudes grow with decreasing density. Once the modes reach nonlinear amplitudes, they break and deposit their energy into a shell of mass {approx}10{sup -4} M{sub sun}. This raises the surface temperature by {approx}4 x 10{sup 8} K, which is sufficient to ignite a layer of helium, as is expected to exist for some SN Ia scenarios. This predominantly synthesizes {sup 40}Ca, but some amount of {sup 28}Si, {sup 32}S, and {sup 44}Ti may also be present. These ashes are expanded out with the subsequent explosion up to velocities of {approx}20, 000 km s{sup -1}, which may explain the high velocity features (HVFs) seen in many SNe Ia. The appearance of HVFs would therefore be a useful discriminant for determining between progenitors, since a flammable helium-rich layer will not be present for accretion from a C/O WD as in a merger scenario. I also discuss the implications of {sup 44}Ti production.

Piro, Anthony L., E-mail: piro@caltech.edu [Theoretical Astrophysics, California Institute of Technology, 1200 E California Blvd., M/C 350-17, Pasadena, CA 91125 (United States)



Flames in Type Ia Supernova: Deflagration-Detonation Transition in the Oxygen Burning Flame  

E-Print Network (OSTI)

Flames in Type Ia Supernova: Deflagration-Detonation Transition in the Oxygen Burning Flame S. E structure which, de- pending on density, may involve separate regions of carbon, oxygen and silicon burning, all propagating in a self-similar, subsonic front. The separation between these three burning regions


A Test for the Nature of the Type Ia Supernova Explosion Mechanism  

E-Print Network (OSTI)

Currently popular models for Type Ia supernovae (SNe Ia) fall into two general classes. The first comprises explosions of nearly pure carbon/oxygen (C/O) white dwarfs at the Chandrasekhar limit which ignite near their centers. The second consists of lower-mass C/O cores which are ignited by the detonation of an accreted surface helium layer. Explosions of the latter type produce copious Fe, Co and Ni K-alpha emission from 56Ni and 56Co decay in the detonated surface layers, emission which is much weaker from Chandrasekhar-mass models. The presence of this emission provides a simple and unambiguous discriminant between these two models for SNe Ia. Both mechanisms may produce 0.1-0.6 solar masses of 56Ni, making them bright gamma-ray line emitters. The time to maximum brightness of 56Ni decay lines is distinctly shorter in the sub-Chandrasekhar mass class of model (approximately 15 days) than in the Chandrasekhar mass model (approximately 30 days), making gamma-ray line evolution another direct test of the explosion mechanism. It should just be possible to detect K-shell emission from a sub-Chandrasekhar explosion from SNe Ia as far away as the Virgo cluster with the XMM Observatory. A 1 to 2 square meter X-ray telescope such as the proposed Con-X Observatory could observe K-alpha emission from sub-Chandrasekhar mass SNe Ia in the Virgo cluster, providing not just a detection, but high-accuracy flux and kinematic information.

Philip A. Pinto; Ronald G. Eastman; Tamara Rogers




SciTech Connect

Limits on the companions of white dwarfs in the single-degenerate scenario for the origin of Type Ia supernovae (SNe Ia) have gotten increasingly tight, yet igniting a nearly Chandrasekhar mass C/O white dwarf from a condition of near hydrostatic equilibrium provides compelling agreement with observed spectral evolution. The only type of non-degenerate stars that survive the tight limits, M{sub V} {approx}> 8.4 on the SN Ia in SNR 0509-67.5 and M{sub V} {approx}> 9.5 in the remnant of SN 1572, are M dwarfs. While M dwarfs are observed in cataclysmic variables, they have special properties that have not been considered in most work on the progenitors of SNe Ia: they have small but finite magnetic fields and they flare frequently. These properties are explored in the context of SN Ia progenitors. White dwarf/M dwarf pairs may be sufficiently plentiful to provide, in principle, an adequate rate of explosions even with slow orbital evolution due to magnetic braking or gravitational radiation. Even modest magnetic fields on the white dwarf and M dwarf will yield adequate torques to lock the two stars together, resulting in a slowly rotating white dwarf, with the magnetic poles pointing at one another in the orbital plane. The mass loss will be channeled by a 'magnetic bottle' connecting the two stars, landing on a concentrated polar area on the white dwarf. This enhances the effective rate of accretion compared to spherical accretion. Luminosity from accretion and hydrogen burning on the surface of the white dwarf may induce self-excited mass transfer. The combined effects of self-excited mass loss, polar accretion, and magnetic inhibition of mixing of accretion layers give possible means to beat the 'nova limit' and grow the white dwarf to the Chandrasekhar mass even at rather moderate mass accretion rates.

Wheeler, J. Craig, E-mail: wheel@astro.as.utexas.edu [Department of Astronomy, University of Texas at Austin, Austin, TX 78712 (United States)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Intense terahertz emission from molecular beam epitaxy-grown GaAs/GaSb(001)  

SciTech Connect

Intense terahertz (THz) electromagnetic wave emission was observed in undoped GaAs thin films deposited on (100) n-GaSb substrates via molecular beam epitaxy. GaAs/n-GaSb heterostructures were found to be viable THz sources having signal amplitude 75% that of bulk p-InAs. The GaAs films were grown by interruption method during the growth initiation and using various metamorphic buffer layers. Reciprocal space maps revealed that the GaAs epilayers are tensile relaxed. Defects at the i-GaAs/n-GaSb interface were confirmed by scanning electron microscope images. Band calculations were performed to infer the depletion region and electric field at the i-GaAs/n-GaSb and the air-GaAs interfaces. However, the resulting band calculations were found to be insufficient to explain the THz emission. The enhanced THz emission is currently attributed to a piezoelectric field induced by incoherent strain and defects.

Sadia, Cyril P.; Laganapan, Aleena Maria; Agatha Tumanguil, Mae; Estacio, Elmer; Somintac, Armando; Salvador, Arnel [National Institute of Physics, University of the Philippines Diliman, Quezon City 1101 (Philippines); Que, Christopher T. [Physics Department, De La Salle University, 2401 Taft Avenue, Manila 1004 (Philippines); Yamamoto, Kohji; Tani, Masahiko [Research Center for Development of Far-Infrared Region, University of Fukui, Fukui 910-8507 (Japan)



Molecular beam epitaxy growth of GaAsBi/GaAs/AlGaAs separate confinement heterostructures  

Science Conference Proceedings (OSTI)

GaAsBi/GaAs/AlGaAs separate confinement heterostructures are grown using an asymmetric temperature profile due to the low optimal growth temperature of GaAsBi; the bottom AlGaAs barrier is grown at 610 Degree-Sign C, while the GaAsBi quantum well and the top AlGaAs barrier are grown at 320 Degree-Sign C. Cross-sectional transmission electron microscopy and room temperature photoluminescence measurements indicate that this approach results in samples with excellent structural and optical properties. The high quality of the low temperature AlGaAs barrier is attributed to the presence of Bi on the surface as indicated by a (1 Multiplication-Sign 3) surface reconstruction persisting throughout the low temperature growth.

Fan Dongsheng; Yu Shuiqing [Department of Electrical Engineering, University of Arkansas, Fayetteville, Arkansas 72701 (United States); Institute for Nanoscience and Engineering, University of Arkansas, Fayetteville, Arkansas 72701 (United States); Zeng Zhaoquan; Hu Xian; Dorogan, Vitaliy G.; Li Chen; Benamara, Mourad; Hawkridge, Michael E.; Mazur, Yuriy I.; Salamo, Gregory J. [Institute for Nanoscience and Engineering, University of Arkansas, Fayetteville, Arkansas 72701 (United States); Johnson, Shane R. [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, Arizona 85287-6206 (United States); Wang, Zhiming M. [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, Sichuan 610054 (China)



New GaInP/GaAs/GaInAs, Triple-Bandgap, Tandem Solar Cell for High-Efficiency Terrestrial Concentrator Systems  

DOE Green Energy (OSTI)

GaInP/GaAs/GaInAs three-junction cells are grown in an inverted configuration on GaAs, allowing high quality growth of the lattice matched GaInP and GaAs layers before a grade is used for the 1-eV GaInAs layer. Using this approach an efficiency of 37.9% was demonstrated.

Kurtz, S.; Wanlass, M.; Kramer, C.; Young, M.; Geisz, J.; Ward, S.; Duda, A.; Moriarty, T.; Carapella, J.; Ahrenkiel, P.; Emery. K.; Jones, K.; Romero, M.; Kibbler, A.; Olson, J.; Friedman, D.; McMahon, W.; Ptak, A.



Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Ultraviolet electroabsorption modulator based on AlGaN/GaN multiple quantum wells  

E-Print Network (OSTI)

Ultraviolet electroabsorption modulator based on AlGaN/GaN multiple quantum wells I. Friel, C online 20 June 2005 An ultraviolet electroabsorption modulator based on AlGaN/GaN quantum wells is demonstrated. Enhanced excitonic absorption in the quantum wells at around 3.48 eV was achieved using

Moustakas, Theodore


Self-aligned AlGaN/GaN transistors for sub-mm wave applications  

E-Print Network (OSTI)

This thesis describes work done towards realizing self-aligned AlGaN/GaN high electron mobility transistors (HEMTs). Self-aligned transistors are important for improving the frequency of AlGaN/GaN HEMTs by reducing source ...

Saadat, Omair I



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


IA REP0 SAND85-2809 Unlimited Release UC-92A  

Office of Scientific and Technical Information (OSTI)

IA REP0 SAND85-2809 Unlimited Release UC-92A IA REP0 SAND85-2809 Unlimited Release UC-92A Printed July 1986 High Energy Gas Fracture Experiments in Fluid-Filled Boreholes-Potential Geothermal Application J. F. Cuderman, T. Y. Chu, J. Jung, R. D. Jacobson Prepared by Sandia National Laboratories Albuquerque, New Mexico 87 185 and Livermore, California 94550 for the United States Department of Energy under Contract DE-AC04-76DP00789 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency Thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process


File:USDA-CE-Production-GIFmaps-IA.pdf | Open Energy Information  

Open Energy Info (EERE)

IA.pdf IA.pdf Jump to: navigation, search File File history File usage Iowa Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 303 KB, MIME type: application/pdf) Description Iowa Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Iowa External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:13, 27 December 2010 Thumbnail for version as of 16:13, 27 December 2010 1,650 × 1,275 (303 KB) MapBot (Talk | contribs) Automated bot upload


Constraining the spin-down timescale of the white-dwarf progenitors of Type Ia supernovae  

E-Print Network (OSTI)

Justham (2011) and DiStefano et al.\\ (2011) proposed that the white-dwarf progenitor of a Type Ia supernova (SN Ia) may have to spin down before it can explode. As the white dwarf spin-down timescale is not well known theoretically, we here try to constrain it empirically (within the framework of this spin-down model) for progenitor systems that contain a giant donor and for which circumbinary material has been detected after the explosion: we obtain an upper limit of a few $10^{\\rm 7} {\\rm yr}$. Based on the study of Di Stefano & Kilic (2012) this means that it is too early to rule out the existence of a surviving companion in SNR 0509-67.5.

Meng, Xiangcun


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Generation of a stable, aminotyrosyl radical-induced ?2?2 complex of Escherichia coli class Ia ribonucleotide reductase  

E-Print Network (OSTI)

Ribonucleotide reductase (RNR) catalyzes the conversion of nucleoside diphosphates to deoxynucleoside diphosphates (dNDPs). The Escherichia coli class Ia RNR uses a mechanism of radical propagation by which a cysteine in ...

Minnihan, Ellen Catherine


In vivo cofactor biosynthesis and maintenance in the class Ia ribonucleotide reductase small subunit of Escherichia coli  

E-Print Network (OSTI)

The small subunit ([beta]2) of Escherichia coli class Ia ribonucleotide reductases (RNRs) contains a diferric tyrosyl radical (Y*) cofactor essential for the conversion of nucleotides to deoxynucleotides that are needed ...

Wu, Chia-Hung, Ph. D. Massachusetts Institute of Technology



Integral Airframe Structures (IAS)---Validated Feasibility Study of Integrally Stiffened Metallic Fuselage Panels for Reducing Manufacturing Costs  

Science Conference Proceedings (OSTI)

The Integral Airframe Structures (IAS) program investigated the feasibility of using "integrally stiffened" construction for commercial transport fuselage structure. The objective of the program was to demonstrate structural performance and weight equal ...

Munroe J.; Wilkins K.; Gruber M.



The Cellular Burning Regime in Type Ia Supernova Explosions - I. Flame Propagation into Quiescent Fuel  

E-Print Network (OSTI)

We present a numerical investigation of the cellular burning regime in Type Ia supernova explosions. This regime holds at small scales (i.e. below the Gibson scale), which are unresolved in large-scale Type Ia supernova simulations. The fundamental effects that dominate the flame evolution here are the Landau-Darrieus instability and its nonlinear stabilization, leading to a stabilization of the flame in a cellular shape. The flame propagation into quiescent fuel is investigated addressing the dependence of the simulation results on the specific parameters of the numerical setup. Furthermore, we investigate the flame stability at a range of fuel densities. This is directly connected to the questions of active turbulent combustion (a mechanism of flame destabilization and subsequent self-turbulization) and a deflagration-to-detonation transition of the flame. In our simulations we find no substantial destabilization of the flame when propagating into quiescent fuels of densities down to ~10^7 g/cm^3, corroborating fundamental assumptions of large-scale SN Ia explosion models. For these models, however, we suggest an increased lower cutoff for the flame propagation velocity to take the cellular burning regime into account.

F. K. Roepke; W. Hillebrandt; J. C. Niemeyer




SciTech Connect

There are insufficient super-soft ({approx}0.1 keV) X-ray sources in either spiral or elliptical galaxies to account for the rate of explosion of Type Ia supernovae (SNe Ia) in either the single-degenerate or the double-degenerate scenarios. We quantify the amount of circumstellar matter that would be required to suppress the soft X-ray flux by yielding a column density in excess of 10{sup 23} cm{sup -2}. We summarize evidence that appropriate quantities of matter are extant in SNe Ia and in recurrent novae that may be supernova precursors. The obscuring matter is likely to have a large, but not complete, covering factor and to be substantially non-spherically symmetric. Assuming that much of the absorbed X-ray flux is re-radiated as blackbody radiation in the UV, we estimate that {approx}<100 sources might be detectable in the Galaxy Evolution Explorer All-sky Survey.

Wheeler, J. Craig [Department of Astronomy, University of Texas at Austin, Austin, TX (United States)] [Department of Astronomy, University of Texas at Austin, Austin, TX (United States); Pooley, D., E-mail: wheel@astro.as.utexas.edu [Department of Physics, Sam Houston State University, Huntsville, TX (United States)



Restframe I-band Hubble diagram for type Ia supernovae up toredshift z ~; 0.5  

SciTech Connect

We present a novel technique for fitting rest frame I-bandlight curves on a data set of 42 type Ia supernovae (SNe Ia). Using the result of the fit, we construct a Hubble diagram with 26 SNe from the subset at 0.01 < z < 0.1. Adding two SNe at z {approx} 0.5 yields results consistent with a flat Lambda-dominated ''concordance universe'' (OmegaM,Omega Lambda) = (0.25, 0.75). For one of these, SN 2000fr, new near infrared data are presented. The high redshift supernova NIR data are also used to test for systematic effects in the use of SNe Ia as distance estimators. A flat, Lambda = 0, universe where the faintness of supernovae at z {approx} 0.5 is due to grey dust homogeneously distributed in the intergalactic medium is disfavored based on the high-z Hubble diagram using this small data-set. However, the uncertainties are large and no firm conclusion may be drawn. We explore the possibility of setting limits on intergalactic dust based on B - I and B - V color measurements, and conclude that about 20 well measured SNe are needed to give statistically significant results. We also show that the high redshift restframe I-band data points are better fit by light curve templates that show a prominent second peak, suggesting that they are not intrinsically underluminous.

Nobili, S.; Amanullah, R.; Garavini, G.; Goobar, A.; Lidman, C.; Stanishev, V.; Aldering, G.; Antilogus, P.; Astier, P.; Burns, M.S.; Conley, A.; Deustua, S.E.; Ellis, R.; Fabbro, S.; Fadeyev, V.; Folatelli,G.; Gibbons, R.; Goldhaber, G.; Groom, D.E.; Hook, I.; Howell, D.A.; Kim,A.G.; Knop, R.A.; Nugent, P.E.; Pain, R.; Perlmutter, S.; Quimby, R.; Raux, J.; Regnault, N.; Ruiz-Lapuente, P.; Sainton, G.; Schahmaneche, K.; Smith, E.; Spadafora, A.L.; Thomas, R.C.; Wang, L.



Observational constraints from SNe Ia and Gamma-Ray Bursts on a clumpy universe  

E-Print Network (OSTI)

The luminosity distance describing the effect of local inhomogeneities in the propagation of light proposed by Zeldovich-Kantowski-Dyer-Roeder (ZKDR) is tested with two probes for two distinct ranges of redshifts: supernovae Ia (SNe Ia) in 0.015 gamma-ray bursts (GRBs) in 1.547 < z < 3.57. Our analysis is performed by a Markov Chain Monte Carlo (MCMC) code that allows us to constrain the matter density parameter \\Omega_m as well as the smoothness parameter $\\alpha$ that measures the inhomogeneous-homogeneous rate of the cosmic fluid in a flat \\LambdaCDM model. The obtained best fits are (\\Omega_m=0.285^{+0.019}_{-0.018}, \\alpha= 0.856^{+0.106}_{-0.176}) from SNe Ia and (\\Omega_m=0.259^{+0.028}_{-0.028}, \\alpha=0.587^{+0.201}_{-0.202}) from GRBs, while from the joint analysis the best fits are (\\Omega_m=0.284^{+0.021}_{-0.020}, \\alpha= 0.685^{+0.164}_{-0.171}) with a \\chi^2_{\\rm red}=0.975. The value of the smoothness parameter $\\alpha$ indicates a clumped universe however it does not have an impact on the amount of dark energy (cosmological constant) needed to fit observations. This result may be an indication that the Dyer-Roeder approximation does not describe in a precise form the effects of clumpiness in the expansion of the universe.

Nora Bretn; Ariadna Montiel



Effect of buffer structures on AlGaN/GaN high electron mobility transistor reliability  

Science Conference Proceedings (OSTI)

AlGaN/GaN high electron mobility transistors (HEMTs) with three different types of buffer layers, including a GaN/AlGaN composite layer, or 1 or 2 lm GaN thick layers, were fabricated and their reliability compared. The HEMTs with the thick GaN buffer layer showed the lowest critical voltage (Vcri) during off-state drain step-stress, but this was increased by around 50% and 100% for devices with the composite AlGaN/GaN buffer layers or thinner GaN buffers, respectively. The Voff - state for HEMTs with thin GaN and composite buffers were 100 V, however, this degraded to 50 60V for devices with thick GaN buffers due to the difference in peak electric field near the gate edge. A similar trend was observed in the isolation breakdown voltage measurements, with the highest Viso achieved based on thin GaN or composite buffer designs (600 700 V), while a much smaller Viso of 200V was measured on HEMTs with the thick GaN buffer layers. These results demonstrate the strong influence of buffer structure and defect density on AlGaN/GaN HEMT performance and reliability.

Liu, L. [University of Florida, Gainesville; Xi, Y. Y. [University of Florida, Gainesville; Ren, F. [University of Florida; Pearton, S. J. [University of Florida; Laboutin, O. [Kopin Corporation, Taunton, MA; Cao, Yu [Kopin Corporation, Taunton, MA; Johnson, Wayne J. [Kopin Corporation, Taunton, MA; Kravchenko, Ivan I [ORNL



Measurements of the Rate of Type Ia Supernovae at Redshift z < ~0.3 from the SDSS-II Supernova Survey  

E-Print Network (OSTI)

We present a measurement of the volumetric Type Ia supernova (SN Ia) rate based on data from the Sloan Digital Sky Survey II (SDSS-II) Supernova Survey. The adopted sample of supernovae (SNe) includes 516 SNe Ia at redshift z \\lesssim 0.3, of which 270 (52%) are spectroscopically identified as SNe Ia. The remaining 246 SNe Ia were identified through their light curves; 113 of these objects have spectroscopic redshifts from spectra of their host galaxy, and 133 have photometric redshifts estimated from the SN light curves. Based on consideration of 87 spectroscopically confirmed non-Ia SNe discovered by the SDSS-II SN Survey, we estimate that 2.04+1.61-0.95 % of the photometric SNe Ia may be misidentified. The sample of SNe Ia used in this measurement represents an order of magnitude increase in the statistics for SN Ia rate measurements in the redshift range covered by the SDSS-II Supernova Survey. If we assume a SN Ia rate that is constant at low redshift (z < 0.15), then the SN observations can be used t...

Dilday, Benjamin; Bassett, Bruce; Becker, Andrew; Bender, Ralf; Castander, Francisco; Cinabro, David; Filippenko, Alexei V; Frieman, Joshua A; Galbany, Lluis; Garnavich, Peter M; Goobar, Ariel; Hopp, Ulrich; Ihara, Yutaka; Jha, Saurabh W; Kessler, Richard; Lampeitl, Hubert; Marriner, John; Miquel, Ramon; Molla, Mercedes; Nichol, Robert C; Nordin, Jakob; Riess, Adam G; Sako, Masao; Schneider, Donald P; Sollerman, Jesper; Wheeler, J Craig; Ostman, Linda; Bizyaev, Dmitry; Brewington, Howard; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Dan; Pan, Kaike; Simmons, Audrey; Snedden, Stephanie



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...


Effect of dislocations on electron mobility in AlGaN/GaN and AlGaN/AlN/GaN heterostructures  

Science Conference Proceedings (OSTI)

Al{sub x}Ga{sub 1-x}N/GaN (x = 0.06, 0.12, 0.24) and AlGaN/AlN/GaN heterostructures were grown on 6 H-SiC, GaN-on-sapphire, and free-standing GaN, resulting in heterostructures with threading dislocation densities of {approx}2 Multiplication-Sign 10{sup 10}, {approx}5 Multiplication-Sign 10{sup 8}, and {approx}5 Multiplication-Sign 10{sup 7} cm{sup -2}, respectively. All growths were performed under Ga-rich conditions by plasma-assisted molecular beam epitaxy. Dominant scattering mechanisms with variations in threading dislocation density and sheet concentration were indicated through temperature-dependent Hall measurements. The inclusion of an AlN interlayer was also considered. Dislocation scattering contributed to reduced mobility in these heterostructures, especially when sheet concentration was low or when an AlN interlayer was present.

Kaun, Stephen W.; Burke, Peter G.; Kyle, Erin C. H.; Speck, James S. [Materials Department, University of California, Santa Barbara, California 93106 (United States); Wong, Man Hoi; Mishra, Umesh K. [Electrical and Computer Engineering Department, University of California, Santa Barbara, California 93106 (United States)



InGaAsN/GaAs heterojunction for multi-junction solar cells  

DOE Patents (OSTI)

An InGaAsN/GaAs semiconductor p-n heterojunction is disclosed for use in forming a 0.95-1.2 eV bandgap photodetector with application for use in high-efficiency multi-junction solar cells. The InGaAsN/GaAs p-n heterojunction is formed by epitaxially growing on a gallium arsenide (GaAs) or germanium (Ge) substrate an n-type indium gallium arsenide nitride (InGaAsN) layer having a semiconductor alloy composition In.sub.x Ga.sub.1-x As.sub.1-y N.sub.y with 0GaAs layer, with the InGaAsN and GaAs layers being lattice-matched to the substrate. The InGaAsN/GaAs p-n heterojunction can be epitaxially grown by either molecular beam epitaxy (MBE) or metalorganic chemical vapor deposition (MOCVD). The InGaAsN/GaAs p-n heterojunction provides a high open-circuit voltage of up to 0.62 volts and an internal quantum efficiency of >70%.

Kurtz, Steven R. (Albuquerque, NM); Allerman, Andrew A. (Albuquerque, NM); Klem, John F. (Albuquerque, NM); Jones, Eric D. (Edgewood, NM)



Magnetism and transport properties of epitaxial Fe-Ga thin films on GaAs(001)  

SciTech Connect

Epitaxial Fe-Ga thin films in disordered bcc {alpha}-Fe crystal structure (A2) have been grown on GaAs(001) by molecular beam epitaxy. The saturated magnetization (M{sub S}) decreased from 1371 to 1105 kA/m with increasing Ga concentration from 10.5 to 24.3 % at room temperature. The lattice parameter increased with the increase in Ga content because of the larger atomic radius of Ga atom than that of Fe. The increase in carrier density with Ga content caused in lower resistivity.

Duong Anh Tuan; Shin, Yooleemi; Cho, Sunglae [Department of Physics, University of Ulsan, Ulsan 680-749 (Korea, Republic of); Dang Duc Dung [Department of Physics, University of Ulsan, Ulsan 680-749 (Korea, Republic of); Department of General Physics, School of Engineering Physics, Ha Noi University of Science and Technology, 1 Dai Co Viet road, Ha Noi (Viet Nam); Vo Thanh Son [Centers for Nanobioenineering and Spintronics, Chungnam National University, Daejon 350-746 (Korea, Republic of)



Notes on the compatibility of type Ia supernovae data and varying--$G$ cosmology  

E-Print Network (OSTI)

Observational data for type Ia supernovae, shows that the expansion of the universe is accelerated. This accelerated expansion can be described by a cosmological constant or by dark energy models like quintessence. An interesting question may be raised here. Is it possible to describe the accelerated expansion of universe using varying--$G$ cosmological models? Here we shall show that the price for having accelerated expansion in slow--varying--$G$ models (in which the dynamical terms of $G$ are ignored) is to have highly non--conserved matter and also that it is in contradiction with other data.

Shojai, F



On the hydrogen emission from the type Ia supernova 2002ic  

DOE Green Energy (OSTI)

The discovery of SN 2002ic by the Supernova Factory and the subsequent spectroscopic studies have led to the surprising finding that SN 2002ic is a type Ia supernova with strong ejecta-circumstellar interaction. Here we show that nearly 1 year after the explosion the supernova has become fainter overall, but the H-alpha emission has brightened and broadened dramatically compared to earlier observations. We have obtained spectropolarimetry data which show that the hydrogen-rich matter is highly aspherically distributed. These observations suggest that the supernova exploded inside a dense, clumpy, disk-like circumstellar environment.

Wang, Lifan; Baade, Dietrich; Hoflich, Peter; Wheeler, J. Craig; Kawabata, Koji; Nomoto, Ken'ichi



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Room temperature green light emission from nonpolar cubic InGaN/GaN multi-quantum-wells  

E-Print Network (OSTI)

Room temperature green light emission from nonpolar cubic InGaN/GaN multi-quantum-wells Shunfeng Li Cubic InGaN/GaN multi-quantum-wells MQWs with high structural and optical quality are achieved by utilizing freestanding 3C-SiC 001 substrates and optimizing InGaN quantum well growth. Superlattice peaks up

As, Donat Josef

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


passivation of InGaN/GaN nanopillar light emitting diodes.  

E-Print Network (OSTI)

??Recently, InGaN/GaN based blue light emitting diodes (LEDs) have become widely available commercially, but their efficiency is reduced due to the quantum confined Stark effect (more)

Choi, Won



Detailed Analysis of Temperature Characteristics of InGaP/InGaAs ...  

Science Conference Proceedings (OSTI)

The current-voltage (I-V) characteristics of single-junction solar cells (InGaP, InGaAs, Ge solar cells) were measured at various temperatures. The structures of ...


AlGaAsSb/GaSb Distributed Bragg Reflectors Grown by Organometallic Vapor Phase Epitaxy  

SciTech Connect

The first AlGaAsSb/GaSb quarter-wave distributed Bragg reflectors grown by metallic vapor phase epitaxy are reported. The peak reflectance is 96% for a 10-period structure.

C.A. Wang; C.J. Vineis; D.R. Calawa



GA 30+-90 / GA 37-90 VSD: Oil-injected rotary screw ...  

U.S. Energy Information Administration (EIA)

GA 30+-90 / GA 37-90 VSD: Oil-injected rotary screw compressors, 30-90 kW / 40-125 hp,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading air ...


GA 11+-30/GA 15-30 VSD: Oil-injected rotary screw compressors ...  

U.S. Energy Information Administration (EIA)

GA 11+-30/GA 15-30 VSD: Oil-injected rotary screw compressors, 11-30 kW / 15-40 hp,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading air ...


GA 90+-160+ / GA 110-160 VSD: Oil-injected rotary screw ...  

U.S. Energy Information Administration (EIA)

GA 90+-160+ / GA 110-160 VSD: Oil-injected rotary screw compressors, 90-160 kW / 125-200 hp.,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading ...


Characteristics study of 2DEG transport properties of AlGaN/GaN and AlGaAs/GaAs-based HEMT  

Science Conference Proceedings (OSTI)

Growth of wide bandgap material over narrow bandgap material, results into a two dimensional electron gas (2DEG) at the heterointerface due to the conduction band discontinuity. In this paper the 2DEG transport properties of AlGaN/GaN-based high electron mobility transistor (HEMT) is discussed and its effect on various characteristics such as 2DEG density, C-V characteristics and Sheet resistances for different mole fractions are presented. The obtained results are also compared with AlGaAs/GaAs-based HEMT for the same structural parameter as like AlGaN/GaN-based HEMT. The calculated results of electron sheet concentration as a function of the Al mole fraction are in excellent agreement with some experimental data available in the literature.

Lenka, T. R., E-mail: trlenka@gmail.com; Panda, A. K., E-mail: akpanda62@hotmail.com [National Institute of Science and Technology, Palur Hills (India)



The Cellular Burning Regime in Type Ia Supernova Explosions - II. Flame Propagation into Vortical Fuel  

E-Print Network (OSTI)

We investigate the interaction of thermonuclear flames in Type Ia supernova explosions with vortical flows by means of numerical simulations. In our study, we focus on small scales, where the flame propagation is no longer dominated by the turbulent cascade originating from large-scale effects. Here, the flame propagation proceeds in the cellular burning regime, resulting from a balance between the Landau-Darrieus instability and its nonlinear stabilization. The interaction of a cellularly stabilized flame front with a vortical fuel flow is explored applying a variety of fuel densities and strengths of the velocity fluctuations. We find that the vortical flow can break up the cellular flame structure if it is sufficiently strong. In this case the flame structure adapts to the imprinted flow field. The transition from the cellularly stabilized front to the flame structure dominated by vortices of the flow proceeds in a smooth way. The implications of the results of our simulations for Type Ia Supernova explosion models are discussed.

F. K. Roepke; W. Hillebrandt; J. C. Niemeyer



Flame Evolution During Type Ia Supernovae and the Deflagration Phase in the Gravitationally Confined Detonation Scenario  

E-Print Network (OSTI)

We develop an improved method for tracking the nuclear flame during the deflagration phase of a Type Ia supernova, and apply it to study the variation in outcomes expected from the gravitationally confined detonation (GCD) paradigm. A simplified 3-stage burning model and a non-static ash state are integrated with an artificially thickened advection-diffusion-reaction (ADR) flame front in order to provide an accurate but highly efficient representation of the energy release and electron capture in and after the unresolvable flame. We demonstrate that both our ADR and energy release methods do not generate significant acoustic noise, as has been a problem with previous ADR-based schemes. We proceed to model aspects of the deflagration, particularly the role of buoyancy of the hot ash, and find that our methods are reasonably well-behaved with respect to numerical resolution. We show that if a detonation occurs in material swept up by the material ejected by the first rising bubble but gravitationally confined to the white dwarf (WD) surface (the GCD paradigm), the density structure of the WD at detonation is systematically correlated with the distance of the deflagration ignition point from the center of the star. Coupled to a suitably stochastic ignition process, this correlation may provide a plausible explanation for the variety of nickel masses seen in Type Ia Supernovae.

D. M. Townsley; A. C. Calder; S. M. Asida; I. R. Seitenzahl; F. Peng; N. Vladimirova; D. Q. Lamb; J. W. Truran



Flame-driven deflagration-to-detonation transitions in Type Ia supernovae?  

E-Print Network (OSTI)

Although delayed detonation models of thermonuclear explosions of white dwarfs seem promising for reproducing Type Ia supernovae, the transition of the flame propagation mode from subsonic deflagration to supersonic detonation remains hypothetical. A potential instant for this transition to occur is the onset of the distributed burning regime, i.e. the moment when turbulence first affects the internal flame structure. Some studies of the burning microphysics indicate that a deflagration-to-detonation transition may be possible here, provided the turbulent intensities are strong enough. Consequently, the magnitude of turbulent velocity fluctuations generated by the deflagration flame is analyzed at the onset of the distributed burning regime in several three-dimensional simulations of deflagrations in thermonuclear supernovae. It is shown that the corresponding probability density functions fall off towards high turbulent velocity fluctuations much more slowly than a Gaussian distribution. Thus, values claimed to be necessary for triggering a detonation are likely to be found in sufficiently large patches of the flame. Although the microphysical evolution of the burning is not followed and a successful deflagration-to-detonation transition cannot be guaranteed from simulations presented here, the results still indicate that such events may be possible in Type Ia supernova explosions.

F. K. Roepke



Photometric Observations of the Type Ia SN 2002er in UGC 10743  

E-Print Network (OSTI)

Extensive light and colour curves for the Type Ia supernova SN 2002er are presented as part of the European Supernova Collaboration. We have collected UBVRI photometry from ten different telescopes covering the phases from 7 days before until 619 days after maximum light. Corrections for the different instrumental systems and the non-thermal spectrum of the supernova (S-corrections) have been applied. With the densely sampled light curves we can make detailed comparisons to other well-observed objects. SN 2002er most closely resembles SN 1996X after maximum, but clearly shows a different colour evolution before peak light and a stronger shoulder in V and R bands compared to other well-observed SNe Ia. In particular, the rise time appears to be longer than what is expected from rise-time vs.decline-rate relation. We use several methods to determine the reddening towards SN 2002er based on the colour evolution at near peak and at late phases. The uvoir (bolometric) light curve shows great similarity with SN 199...

Pignata, G; Benetti, S; Blinnikov, S; Hillebrandt, W; Kotak, R; Leibundgut, B; Mazzali, P A; Meikle, P; Qiu, Y; Ruiz-Lapuente, P; Smartt, S; Sorokina, E; Stritzinger, M; Stehle, M; Turatto, M; Marsh, T; Martin-Luis, F; McBride, N; Mndez, J; Morales-Rueda, L; Narbutis, D; Street, R



Y2, Threading Defect Elimination in GaN Nanostructures  

Science Conference Proceedings (OSTI)

DD3, A New Approach to Make ZnO-Cu2O Heterojunctions for Solar Cells ... E2, AlGaAs/GaAs/GaN Wafer Fused HBTs with Ar Implanted Extrinsic Collectors.


Quantized states in homogenous polarized GaInN GaN quantum wells  

E-Print Network (OSTI)

Quantized states in homogenous polarized GaInN GaN quantum wells C. Wetzel1, S. Kamiyama1, H. Amano wells is calculated in a single particle model. The act- ing electric eld in the wells and the band gap-dimensional well layers our approach is based on induction from results obtained at the binary GaN barri- ers

Wetzel, Christian M.



E-Print Network (OSTI)

PIEZOELECTRIC LEVEL SPLITTING IN GaInN/GaN QUANTUM WELLS C. Wetzel, T. Takeuchi, H. Amano, and IInN/GaN multiple quantum well samples in a large set of variable composition a clear correspondence of transitions in photo- and electroreflection, as well as photoluminescence is found. The effective band offset across

Wetzel, Christian M.


Pulsed optically detected NMR of single GaAs/AlGaAs quantum wells  

E-Print Network (OSTI)

Pulsed optically detected NMR of single GaAs/AlGaAs quantum wells Marcus Eickhoff* and Dieter Suter, nanometer-sized quantum wells possible with excellent sensitivity and selectivity while avoiding.60.-k; 78.55.Cr; 78.67.De Keywords: ODNMR; Pulsed excitation; Quantum well; GaAs 1. Introduction Nuclear

Suter, Dieter


Spontaneous emission in GaN/InGaN photonic crystal nanopillars  

E-Print Network (OSTI)

. Sigalas, "InGaN/GaN quantum-well heterostructure light-emitting diodes employing photonic crystal, "III-nitride blue and ultraviolet photonic crystal light emitting diodes," Appl. Phys. Lett. 84, 466, and H. Benisty, "Photonic-crystal GaN light-emitting diodes with tailored guided modes distribution

Recanati, Catherine


Princeton Plasma Physics Lab - General Atomics (GA)  

NLE Websites -- All DOE Office Websites (Extended Search)

general-atomics-ga General general-atomics-ga General Atomics en The Scorpion's Strategy: "Catch and Subdue" http://www.pppl.gov/node/1132

American Fusion News Category: 
ga">General Atomics (GA)

TMS P&GA Wired to Washington  

Science Conference Proceedings (OSTI)

P & GA COMMITTEE HOME ... the connection between MSE and such key U.S. initiatives as national security, energy independence, and economic growth.


Verifying the Cosmological Utility of Type Ia Supernovae:Implications of a Dispersion in the Ultraviolet Spectra  

SciTech Connect

We analyze the mean rest-frame ultraviolet (UV) spectrum ofType Ia Supernovae(SNe) and its dispersion using high signal-to-noiseKeck-I/LRIS-B spectroscopyfor a sample of 36 events at intermediateredshift (z=0.5) discoveredby the Canada-France-Hawaii TelescopeSupernova Legacy Survey (SNLS). Weintroduce a new method for removinghost galaxy contamination in our spectra,exploiting the comprehensivephotometric coverage of the SNLS SNe and theirhost galaxies, therebyproviding the first quantitative view of the UV spectralproperties of alarge sample of distant SNe Ia. Although the mean SN Ia spectrumhas notevolved significantly over the past 40 percent of cosmic history,preciseevolutionary constraints are limited by the absence of acomparable sample ofhigh quality local spectra. The mean UV spectrum ofour z 0.5 SNe Ia and itsdispersion is tabulated for use in futureapplications. Within the high-redshiftsample, we discover significant UVspectral variations and exclude dust extinctionas the primary cause byexamining trends with the optical SN color. Although progenitormetallicity may drive some of these trends, the variations we see aremuchlarger than predicted in recent models and do not follow expectedpatterns.An interesting new result is a variation seen in the wavelengthof selected UVfeatures with phase. We also demonstrate systematicdifferences in the SN Iaspectral features with SN lightcurve width inboth the UV and the optical. Weshow that these intrinsic variations couldrepresent a statistical limitation in thefuture use of high-redshift SNeIa for precision cosmology. We conclude thatfurther detailed studies areneeded, both locally and at moderate redshift wherethe rest-frame UV canbe studied precisely, in order that future missions canconfidently beplanned to fully exploit SNe Ia as cosmological probes.

Ellis, R.S.; Sullivan, M.; Nugent, P.E.; Howell, D.A.; Gal-Yam,A.; Astier, P.; Balam, D.; Balland, C.; Basa, S.; Carlberg, R.G.; Conley,A.; Fouchez, D.; Guy, J.; Hardin, D.; Hook, I.; Pain, R.; Perrett, K.; Pritchet, C.J.; Regnault, N.



Price of Elba Island, GA Liquefied Natural Gas Total Imports...  

Annual Energy Outlook 2012 (EIA)

Elba Island, GA Liquefied Natural Gas Total Imports (Dollars per Thousand Cubic Feet) Price of Elba Island, GA Liquefied Natural Gas Total Imports (Dollars per Thousand Cubic Feet)...

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GaInP/GaAs/GaInAs Monolithic Tandem Cells for High-Performance Solar Concentrators  

DOE Green Energy (OSTI)

We present a new approach for ultra-high-performance tandem solar cells that involves inverted epitaxial growth and ultra-thin device processing. The additional degree of freedom afforded by the inverted design allows the monolithic integration of high-, and medium-bandgap, lattice-matched (LM) subcell materials with lower-bandgap, lattice-mismatched (LMM) materials in a tandem structure through the use of transparent compositionally graded layers. The current work concerns an inverted, series-connected, triple-bandgap, GaInP (LM, 1.87 eV)/GaAs (LM, 1.42 eV)/GaInAs (LMM, {approx}1 eV) device structure grown on a GaAs substrate. Ultra-thin tandem devices are fabricated by mounting the epiwafers to pre-metallized Si wafer handles and selectively removing the parent GaAs substrate. The resulting handle-mounted, ultra-thin tandem cells have a number of important advantages, including improved performance and potential reclamation/reuse of the parent substrate for epitaxial growth. Additionally, realistic performance modeling calculations suggest that terrestrial concentrator efficiencies in the range of 40-45% are possible with this new tandem cell approach. A laboratory-scale (0.24 cm2), prototype GaInP/GaAs/GaInAs tandem cell with a terrestrial concentrator efficiency of 37.9% at a low concentration ratio (10.1 suns) is described, which surpasses the previous world efficiency record of 37.3%.

Wanlass, M. W.; Ahrenkiel, S. P.; Albin, D. S.; Carapella, J. J.; Duda, A.; Emery, K.; Geisz, J. F.; Jones, K.; Kurtz, S.; Moriarty, T.; Romero, M. J.




SciTech Connect

PTF11kx was a Type Ia supernova (SN Ia) that showed time-variable absorption features, including saturated Ca II H and K lines that weakened and eventually went into emission. The strength of the emission component of H{alpha} gradually increased, implying that the SN was undergoing significant interaction with its circumstellar medium (CSM). These features, and many others, were blueshifted slightly and showed a P-Cygni profile, likely indicating that the CSM was directly related to, and probably previously ejected by, the progenitor system itself. These and other observations led Dilday et al. to conclude that PTF11kx came from a symbiotic nova progenitor like RS Oph. In this work we extend the spectral coverage of PTF11kx to 124-680 rest-frame days past maximum brightness. The late-time spectra of PTF11kx are dominated by H{alpha} emission (with widths of full width at half-maximum intensity Almost-Equal-To 2000 km s{sup -1}), strong Ca II emission features ({approx}10,000 km s{sup -1} wide), and a blue 'quasi-continuum' due to many overlapping narrow lines of Fe II. Emission from oxygen, He I, and Balmer lines higher than H{alpha} is weak or completely absent at all epochs, leading to large observed H{alpha}/H{beta} intensity ratios. The H{alpha} emission appears to increase in strength with time for {approx}1 yr, but it subsequently decreases significantly along with the Ca II emission. Our latest spectrum also indicates the possibility of newly formed dust in the system as evidenced by a slight decrease in the red wing of H{alpha}. During the same epochs, multiple narrow emission features from the CSM temporally vary in strength. The weakening of the H{alpha} and Ca II emission at late times is possible evidence that the SN ejecta have overtaken the majority of the CSM and agrees with models of other strongly interacting SNe Ia. The varying narrow emission features, on the other hand, may indicate that the CSM is clumpy or consists of multiple thin shells.

Silverman, Jeffrey M. [Department of Astronomy, University of Texas, Austin, TX 78712-0259 (United States); Nugent, Peter E.; Filippenko, Alexei V.; Cenko, S. Bradley [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Gal-Yam, Avishay [Benoziyo Center for Astrophysics, The Weizmann Institute of Science, Rehovot 76100 (Israel); Sullivan, Mark [School of Physics and Astronomy, University of Southampton, Southampton SO17 1BJ (United Kingdom); Howell, D. Andrew [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Pan, Yen-Chen; Hook, Isobel M., E-mail: jsilverman@astro.as.utexas.edu [Department of Physics (Astrophysics), University of Oxford, Keble Road, Oxford OX1 3RH (United Kingdom)



US SoAtl GA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

GA GA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl GA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl GA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl GA Expenditures dollars ELECTRICITY ONLY average per household * Site energy consumption (89.5 million Btu) and energy expenditures per household ($2,067) in Georgia are similar to the U.S. household averages. * Per household electricity consumption in Georgia is among the highest in the country, but similar to other states in the South. * Forty-five percent of homes in Georgia were built since 1990, a characteristic typically associated with lower per household consumption. Georgia homes,


US SoAtl GA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

GA GA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl GA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl GA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl GA Expenditures dollars ELECTRICITY ONLY average per household * Site energy consumption (89.5 million Btu) and energy expenditures per household ($2,067) in Georgia are similar to the U.S. household averages. * Per household electricity consumption in Georgia is among the highest in the country, but similar to other states in the South. * Forty-five percent of homes in Georgia were built since 1990, a characteristic typically associated with lower per household consumption. Georgia homes,


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


A Precision Photometric Comparison between SDSS-II and CSP Type Ia Supernova Data  

Science Conference Proceedings (OSTI)

Consistency between Carnegie Supernova Project (CSP) and SDSS-II Supernova Survey ugri measurements has been evaluated by comparing Sloan Digital Sky Survey (SDSS) and CSP photometry for nine spectroscopically confirmed Type Ia supernova observed contemporaneously by both programs. The CSP data were transformed into the SDSS photometric system. Sources of systematic uncertainty have been identified, quantified, and shown to be at or below the 0.023 mag level in all bands. When all photometry for a given band is combined, we find average magnitude differences of equal to or less than 0.011 mag in ugri, with rms scatter ranging from 0.043 to 0.077 mag. The u-band agreement is promising, with the caveat that only four of the nine supernovae are well observed in u and these four exhibit an 0.038 mag supernova-to-supernova scatter in this filter.

Mosher, J.; /Pennsylvania U.; Sako, M.; /Pennsylvania U.; Corlies, L.; /Pennsylvania U. /Columbia U.; Folatelli, G.; /Tokyo U. /Carnegie Inst. Observ.; Frieman, J.; /Chicago U., KICP /Chicago U., Astron. Astrophys. Ctr.; Holtzman, J.; /New Mexico State U.; Jha, S.W.; /Rutgers U., Piscataway; Kessler, R.; /Chicago U., Astron. Astrophys. Ctr. /Chicago U., KICP; Marriner, J.; /Fermilab; Phillips, M.M.; /Carnegie Inst. Observ.; Stritzinger, M.; /Aarhus U. /Stockholm U., OKC /Bohr Inst. /Carnegie Inst. Observ.




SciTech Connect

Consistency between Carnegie Supernova Project (CSP) and SDSS-II Supernova Survey ugri measurements has been evaluated by comparing Sloan Digital Sky Survey (SDSS) and CSP photometry for nine spectroscopically confirmed Type Ia supernova observed contemporaneously by both programs. The CSP data were transformed into the SDSS photometric system. Sources of systematic uncertainty have been identified, quantified, and shown to be at or below the 0.023 mag level in all bands. When all photometry for a given band is combined, we find average magnitude differences of equal to or less than 0.011 mag in ugri, with rms scatter ranging from 0.043 to 0.077 mag. The u-band agreement is promising, with the caveat that only four of the nine supernovae are well observed in u and these four exhibit an 0.038 mag supernova-to-supernova scatter in this filter.

Mosher, J.; Sako, M.; Corlies, L. [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Folatelli, G. [Institute for the Physics and Mathematics of the Universe (IPMU), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Frieman, J.; Kessler, R. [Department of Astronomy and Astrophysics, University of Chicago, 5640 South Ellis Avenue, Chicago, IL 60637 (United States); Holtzman, J. [Department of Astronomy, MSC 4500, New Mexico State University, P.O. Box 30001, Las Cruces, NM 88003 (United States); Jha, S. W. [Department of Physics and Astronomy, Rutgers, the State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Marriner, J. [Center for Particle Astrophysics, Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Phillips, M. M.; Morrell, N. [Las Campanas Observatory, Carnegie Observatories, Casilla 601, La Serena (Chile); Stritzinger, M. [Oskar Klein Centre for Cosmo Particle Physics, AlbaNova University Center, 106 91 Stockholm (Sweden); Schneider, D. P., E-mail: jmosher@sas.upenn.edu [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States)



A Precision Photometric Comparison between SDSS-II and CSP Type Ia Supernova Data  

E-Print Network (OSTI)

Consistency between Carnegie Supernova Project (CSP) and SDSS-II supernova (SN) survey ugri measurements has been evaluated by comparing SDSS and CSP photometry for nine spectroscopically confirmed Type Ia supernova observed contemporaneously by both programs. The CSP data were transformed into the SDSS photometric system. Sources of systematic uncertainty have been identified, quantified, and shown to be at or below the 0.023 magnitude level in all bands. When all photometry for a given band is combined, we find average magnitude differences of equal to or less than 0.011 magnitudes in ugri, with rms scatter ranging from 0.043 to 0.077 magnitudes. The u band agreement is promising, with the caveat that only four of the nine supernovae are well-observed in u and these four exhibit an 0.038 magnitude supernova-to-supernova scatter in this filter.

Mosher, J; Corlies, L; Folatelli, G; Frieman, J; Holtzman, J; Jha, S W; Kessler, R; Marriner, J; Phillips, M M; Stritzinger, M; Morrell, N; Schneider, D P



Analysis of Reaction-Diffusion Systems for Flame Capturing in Type Ia Supernova Simulations  

E-Print Network (OSTI)

We present a study of numerical behavior of a thickened flame used in Flame Capturing (FC, Khokhlov (1995)) for tracking thin unresolved physical flames in deflagration simulations. We develop a steady-state procedure for calibrating the flame model used, and test it against analytical results. We observe numerical noises generated by original realization of the technique. Alternative artificial burning rates are discussed, which produce acceptably quiet flames. Two new quiet models are calibrated to yield required "flame" speed and width, and further studied in 2D and 3D setting. Landau-Darrieus type instabilities of the flames are observed. One model also shows significantly anisotropic propagation speed on the grid, both effects increasingly pronounced at larger matter expansion as a result of burning; this makes the model unacceptable for use in type Ia supernova simulations. Another model looks promising for use in flame capturing at fuel to ash density ratio of order 3 and below. That "Model B" yields f...

Zhiglo, Andrey V



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



ASD(NII)/DoD CIO SUBJECT: Defense Industrial Base (DIB) Cyber Security/Information Assurance (CS/IA) Activities  

E-Print Network (OSTI)

directing the conduct of DIB CS/IA activities to protect unclassified DoD information, as defined in the Glossary, that transits or resides on unclassified DIB information systems and networks. 2. APPLICABILITY. This Instruction applies to OSD, the Military Departments, the Office of

unknown authors




SciTech Connect

On 2011 August 24 (UT) the Palomar Transient Factory (PTF) discovered PTF11kly (SN 2011fe), the youngest and most nearby Type Ia supernova (SN Ia) in decades. We followed this event up in the radio (centimeter and millimeter bands) and X-ray bands, starting about a day after the estimated explosion time. We present our analysis of the radio and X-ray observations, yielding the tightest constraints yet placed on the pre-explosion mass-loss rate from the progenitor system of this supernova. We find a robust limit of M-dot {approx}<10{sup -8}(w/100 km s{sup -1}) M{sub sun} yr{sup -1} from sensitive X-ray non-detections, as well as a similar limit from radio data, which depends, however, on assumptions about microphysical parameters. We discuss our results in the context of single-degenerate models for SNe Ia and find that our observations modestly disfavor symbiotic progenitor models involving a red giant donor, but cannot constrain systems accreting from main-sequence or sub-giant stars, including the popular supersoft channel. In view of the proximity of PTF11kly and the sensitivity of our prompt observations, we would have to wait for a long time (a decade or longer) in order to more meaningfully probe the circumstellar matter of SNe Ia.

Horesh, Assaf; Kulkarni, S. R.; Carpenter, John; Kasliwal, Mansi M.; Ofek, Eran O. [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Fox, Derek B. [Astronomy and Astrophysics, Eberly College of Science, Pennsylvania State University, University Park, PA 16802 (United States); Quimby, Robert [IPMU, University of Tokyo, Kashiwanoha 5-1-5, Kashiwa-shi, Chiba (Japan); Gal-Yam, Avishay [Benoziyo Center for Astrophysics, Faculty of Physics, Weizmann Institute of Science, Rehovot 76100 (Israel); Cenko, S. Bradley [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); De Bruyn, A. G. [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, NL-7990 AA Dwingeloo (Netherlands); Kamble, Atish; Wijers, Ralph A. M. J. [Center for Gravitation and Cosmology, University of Wisconsin, Milwaukee, WI 53211 (United States); Van der Horst, Alexander J. [Universities Space Research Association, NSSTC, Huntsville, AL 35805 (United States); Kouveliotou, Chryssa [Space Science Office, VP-62, NASA-Marshall Space Flight Center, Huntsville, AL 35805 (United States); Podsiadlowski, Philipp; Sullivan, Mark; Maguire, Kate [Department of Physics (Astrophysics), University of Oxford, Keble Road, Oxford OX1 3RH (United Kingdom); Howell, D. Andrew [Las Cumbres Observatory Global Telescope Network, Santa Barbara, CA 93117 (United States); Nugent, Peter E. [Computational Cosmology Center, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Gehrels, Neil [NASA-Goddard Space Flight Center, Greenbelt, MD 20771 (United States); and others



Photometric Observations of the Type Ia SN 2002er in UGC 10743  

E-Print Network (OSTI)

Extensive light and colour curves for the Type Ia supernova SN 2002er are presented as part of the European Supernova Collaboration. We have collected UBVRI photometry from ten different telescopes covering the phases from 7 days before until 619 days after maximum light. Corrections for the different instrumental systems and the non-thermal spectrum of the supernova (S-corrections) have been applied. With the densely sampled light curves we can make detailed comparisons to other well-observed objects. SN 2002er most closely resembles SN 1996X after maximum, but clearly shows a different colour evolution before peak light and a stronger shoulder in V and R bands compared to other well-observed SNe Ia. In particular, the rise time appears to be longer than what is expected from rise-time vs.decline-rate relation. We use several methods to determine the reddening towards SN 2002er based on the colour evolution at near peak and at late phases. The uvoir (bolometric) light curve shows great similarity with SN 1996X, but also indications of a higher luminosity, longer rise time and a more pronounced shoulder 25 days past maximum. The interpretation of the light curves was done with two independent light curve codes. Both find that given the luminosity of SN 2002er the 56Ni mass exceeds 0.6 Msun with prefered values near 0.7 Msun. Uncertainties in the exact distance to SN 2002er are the most serious limitation of this measurement. The light curve modelling also indicates a high level of mixing of the nickel in the explosion of SN 2002er.

G. Pignata; F. Patat; S. Benetti; S. Blinnikov; W. Hillebrandt; R. Kotak; B. Leibundgut; P. A. Mazzali; P. Meikle; Y. Qiu; P. Ruiz-Lapuente; S. Smartt; E. Sorokina; M. Stritzinger; M. Stehle; M. Turatto; T. Marsh; F. Martin-Luis; N. McBride; J. Mendez; L. Morales-Rueda; D. Narbutis; R. Street



Direct Analysis of Spectra of the Peculiar Type Ia Supernova 2000cx  

E-Print Network (OSTI)

The Type Ia SN 2000cx exhibited multiple peculiarities, including a lopsided B-band light-curve peak that does not conform to current methods for using shapes of light curves to standardize SN Ia luminosities. We use the parameterized supernova synthetic-spectrum code SYNOW to study line identifications in the photospheric-phase spectra of SN 2000cx. Previous work established the presence of Ca II infrared-triplet features forming above velocity about 20,000 km/s, much higher than the photospheric velocity of about 10,000 km/s. We find Ti II features forming at the same high velocity. High-velocity line formation is partly responsible for the photometric peculiarities of SN 2000cx: for example, B-band flux blocking by Ti II absorption features that decreases with time causes the B light curve to rise more rapidly and decline more slowly than it otherwise would. SN 2000cx contains an absorption feature near 4530 A that may be H-beta, forming at the same high velocity. The lack of conspicuous H-alpha and P-alpha signatures does not necessarily invalidate the H-beta identification if the high-velocity line formation is confined to a clump that partly covers the photosphere and the H-alpha and P-alpha source functions are elevated relative to that of resonance scattering. The H-beta identification is tentative. If it is correct, the high-velocity matter must have come from a nondegenerate companion star.

D. Branch; R. C. Thomas; E. Baron; D. Kasen; K. Hatano; K. Nomoto; A. V. Filippenko; W. Li; R. J. Rudy




SciTech Connect

For the explosion mechanism of Type Ia supernovae (SNe Ia), different scenarios have been suggested. In these, the propagation of the burning front through the exploding white dwarf (WD) star proceeds in different modes, and consequently imprints of the explosion model on the nucleosynthetic yields can be expected. The nucleosynthetic characteristics of various explosion mechanisms are explored based on three two-dimensional explosion simulations representing extreme cases: a pure turbulent deflagration, a delayed detonation following an approximately spherical ignition of the initial deflagration, and a delayed detonation arising from a highly asymmetric deflagration ignition. Apart from this initial condition, the deflagration stage is treated in a parameter-free approach. The detonation is initiated when the turbulent burning enters the distributed burning regime. This occurs at densities around 10{sup 7} g cm{sup -3}-relatively low as compared to existing nucleosynthesis studies for one-dimensional spherically symmetric models. The burning in these multidimensional models is different from that in one-dimensional simulations as the detonation wave propagates both into unburned material in the high-density region near the center of a WD and into the low-density region near the surface. Thus, the resulting yield is a mixture of different explosive burning products, from carbon-burning products at low densities to complete silicon-burning products at the highest densities, as well as electron-capture products synthesized at the deflagration stage. Detailed calculations of the nucleosynthesis in all three models are presented. In contrast to the deflagration model, the delayed detonations produce a characteristic layered structure and the yields largely satisfy constraints from Galactic chemical evolution. In the asymmetric delayed detonation model, the region filled with electron capture species (e.g., {sup 58}Ni, {sup 54}Fe) is within a shell, showing a large off-set, above the bulk of {sup 56}Ni distribution, while species produced by the detonation are distributed more spherically.

Maeda, K. [Institute for the Physics and Mathematics of the Universe (IPMU), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Roepke, F.K.; Fink, M.; Hillebrandt, W.; Travaglio, C. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Strasse 1, 85741 Garching (Germany); Thielemann, F.-K., E-mail: keiichi.maeda@ipmu.j [Department Physik, Universitaet Basel, CH-4056 Basel (Switzerland)



Measurements of the Rate of Type Ia Supernovae at Redshift z < ~0.3 from the SDSS-II Supernova Survey  

Science Conference Proceedings (OSTI)

We present a measurement of the volumetric Type Ia supernova (SN Ia) rate based on data from the Sloan Digital Sky Survey II (SDSS-II) Supernova Survey. The adopted sample of supernovae (SNe) includes 516 SNe Ia at redshift z {approx}< 0.3, of which 270 (52%) are spectroscopically identified as SNe Ia. The remaining 246 SNe Ia were identified through their light curves; 113 of these objects have spectroscopic redshifts from spectra of their host galaxy, and 133 have photometric redshifts estimated from the SN light curves. Based on consideration of 87 spectroscopically confirmed non-Ia SNe discovered by the SDSS-II SN Survey, we estimate that 2.04{sub -0.95}{sup +1.61}% of the photometric SNe Ia may be misidentified. The sample of SNe Ia used in this measurement represents an order of magnitude increase in the statistics for SN Ia rate measurements in the redshift range covered by the SDSS-II Supernova Survey. If we assume a SN Ia rate that is constant at low redshift (z < 0.15), then the SN observations can be used to infer a value of the SN rate of r{sub V} = (2.69{sub -0.30-0.01}{sup +0.34+0.21}) x 10{sup -5} SNe yr{sup -1} Mpc{sup -3} (H{sub 0}/(70 km s{sup -1} Mpc{sup -1})){sup 3} at a mean redshift of {approx} 0.12, based on 79 SNe Ia of which 72 are spectroscopically confirmed. However, the large sample of SNe Ia included in this study allows us to place constraints on the redshift dependence of the SN Ia rate based on the SDSS-II Supernova Survey data alone. Fitting a power-law model of the SN rate evolution, r{sub V} (z) = A{sub p} x ((1+z)/(1+z{sub 0})){sup {nu}}, over the redshift range 0.0 < z < 0.3 with z{sub 0} = 0.21, results in A{sub p} = (3.43{sub -0.15}{sup +0.15}) x 10{sup -5} SNe yr{sup -1} Mpc{sup -3} (H{sub 0}/(70 km s{sup -1} Mpc{sup -1})){sup 3} and {nu} = 2.04{sub -0.89}{sup +0.90}.

Dilday, Benjamin; /Rutgers U., Piscataway /Chicago U. /KICP, Chicago; Smith, Mathew; /Cape Town U., Dept. Math. /Portsmouth U.; Bassett, Bruce; /Cape Town U., Dept. Math. /South African Astron. Observ.; Becker, Andrew; /Washington U., Seattle, Astron. Dept.; Bender, Ralf; /Munich, Tech. U. /Munich U. Observ.; Castander, Francisco; /Barcelona, IEEC; Cinabro, David; /Wayne State U.; Filippenko, Alexei V.; /UC, Berkeley; Frieman, Joshua A.; /Chicago U. /Fermilab; Galbany, Lluis; /Barcelona, IFAE; Garnavich, Peter M.; /Notre Dame U. /Stockholm U., OKC /Stockholm U.



AlGaAs/GaAs nano-hetero-epitaxy on a patterned GaAs substrate by MBE  

SciTech Connect

An AlGaAs/GaAs resonant tunneling diode (RTD) with submicron size was fabricated on {l_brace}111{r_brace} oblique facets of GaAs with selective MBE. The method is based on the fact that a certain facet structure is formed on a patterned substrate in selective MBE because the growth rate depends strongly on the facet structure. The fabrication of a double-barrier structure was attempted on a {l_brace}111{r_brace}B facet. The current-voltage characteristics of the sample showed negative differential resistance at 77K demonstrating that we have achieved an RTD on a submicron facet.

Nishiwaki, T.; Yamaguchi, M.; Sawaki, N. [Department of Electronics, Nagoya University, Chikusa-ku, Nagoya, 464-8603 (Japan)



Accelerated aging of GaAs concentrator solar cells  

DOE Green Energy (OSTI)

An accelerated aging study of AlGaAs/GaAs solar cells has been completed. The purpose of the study was to identify the possible degradation mechanisms of AlGaAs/GaAs solar cells in terrestrial applications. Thermal storage tests and accelerated AlGaAs corrosion studies were performed to provide an experimental basis for a statistical analysis of the estimated lifetime. Results of this study suggest that a properly designed and fabricated AlGaAs/GaAs solar cell can be mechanically rugged and environmentally stable with projected lifetimes exceeding 100 years.

Gregory, P.E.



Characterization of high-quality InGaN/GaN multiquantum wells with time-resolved photoluminescence  

E-Print Network (OSTI)

Characterization of high-quality InGaN/GaN multiquantum wells with time-resolved photoluminescence October 1997; accepted for publication 5 January 1998 Recombination in single quantum well and multiquantum well InGaN/GaN structures is studied using time-resolved photoluminescence and pulsed

Bowers, John


Optical injection and coherent control of a ballistic charge current in GaAsAlGaAs quantum wells  

E-Print Network (OSTI)

Optical injection and coherent control of a ballistic charge current in GaAs?AlGaAs quantum wells of Hache´ et al.,2,3 but in this article we report injection into the plane of GaAs/AlGaAs quantum wells specific to quantum wells. Although we expect the underlying physics of injection and control of currents

Sipe,J. E.

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analysis of Schottky gate electron tunneling in polarization induced AlGaN/GaN high electron mobility transistors  

Science Conference Proceedings (OSTI)

( gate=nickel)/(barrier=GaN/Al (y) Ga (1?y) N)/(buffer=GaN)/(substrate=SiC ) polarizationinduced high electron mobility transistors (PI-HEMTs) show promise for ultrahigh power microwave amplification. The polarization fields in these Ga-face

Lester F. Eastman



Journal of Crystal Growth 298 (2007) 272275 Dislocation analysis in homoepitaxial GaInN/GaN light emitting  

E-Print Network (OSTI)

of GaInN/GaN-based light emitting diodes (LED) on quasi-bulk GaN with an atomically flat polished were much improved. The optical output power of the light emitting diode increased by more than one. Cathodoluminescence; A1. Threading dislocation density; A2. Homoepitaxial growth; B1. GaInN; B3. Light emitting diode

Wetzel, Christian M.


Discrete Steps in the Capacitance-Voltage Characteristics of GaInN/GaN Light Emitting Diode Structures  

E-Print Network (OSTI)

Discrete Steps in the Capacitance-Voltage Characteristics of GaInN/GaN Light Emitting Diode and GaInN/GaN heterostructures typically used for high efficiency light emitting diodes is of high materials for green, blue, and UV light emitting diodes (LED) [1-2]. It is known that huge piezoelectric

Wetzel, Christian M.


AlGaN/GaN high electron mobility transistors based on InGaN/GaN multi-quantum-well structures with photo-chemical vapor deposition of SiO2 dielectrics  

Science Conference Proceedings (OSTI)

AlGaN/GaN metal-oxide-semiconductor high electron mobility transistor (MOS-HEMT) based on InGaN/GaN multi-quantum-well (MQW) structure has been fabricated with SiO"2 dielectric deposited via photo-chemical vapor deposition (PHCVD) using a deuterium lamp ... Keywords: GaN, HEMT, MQW, Photo-chemical vapor deposition, SiO 2

Kai-Hsuan Lee; Ping-Chuan Chang; Shoou-Jinn Chang



J1, MBE Growth of Metamorphic InGaP on GaAs and GaP for Wide ...  

Science Conference Proceedings (OSTI)

I4, Electrical Spin Injection in a Hybrid Organic/Inorganic Spin-Polarized Light Emitting Diode (Spin-LED) I5, Properties of MnAs/GaMnAs/MnAs Magnetic...


GA Solar | Open Energy Information  

Open Energy Info (EERE)

Solar Solar Jump to: navigation, search Name GA-Solar Place Madrid, Spain Zip 28045 Sector Solar Product Madrid based solar project developer, owned by Spanish industrial group Corporacion Gestamp. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Free carrier accumulation at cubic AlGaN/GaN heterojunctions  

Science Conference Proceedings (OSTI)

Cubic Al{sub 0.3}Ga{sub 0.7}N/GaN heterostructures were grown by plasma-assisted molecular beam epitaxy on 3C-SiC (001) substrates. A profile of the electrostatic potential across the cubic-AlGaN/GaN heterojunction was obtained using electron holography in the transmission electron microscope. The experimental potential profile indicates that the unintentionally doped layers show n-type behavior and accumulation of free electrons at the interface with a density of 5.1 x 10{sup 11}/cm{sup 2}, about one order of magnitude less than in wurtzite AlGaN/GaN junctions. A combination of electron holography and cathodoluminescence measurements yields a conduction-to-valence band offset ratio of 5:1 for the cubic AlGaN/GaN interface, which also promotes the electron accumulation. Band diagram simulations show that the donor states in the AlGaN layer provide the positive charges that to a great extent balance the two-dimensional electron gas.

Wei, Q. Y.; Li, T.; Huang, J. Y.; Ponce, F. A. [Department of Physics, Arizona State University, Tempe, Arizona 85287-1504 (United States); Tschumak, E.; Zado, A.; As, D. J. [Department of Physics, Universitaet Paderborn, D-33098 Paderborn (Germany)



L1, Formation of Structural Defects in AlGaN/GaN High Electron ...  

Science Conference Proceedings (OSTI)

Transmission electron microscope (TEM) cross sectional image has shown that electrical degradation is closely related to structural damage in the GaN cap and ...


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Plasma Damage in p-GaN  

SciTech Connect

The effect of Inductively Coupled Plasma H{sub 2} or Ar discharges on the breakdown voltage of p-GaN diodes was measured over a range of ion energies and fluxes. The main effect of plasma exposure is a decrease in net acceptor concentration to depths of 400-550{angstrom}. At high ion fluxes or energies there can be type conversion of the initially p-GaN surface. Post etch annealing at 900 C restores the initial conductivity.

Cao, X.A.; Dang, G.T.; Hickman, R.A.; Pearton, S.J.; Ren, F.; Shul, R.J.; Van Hove, J.M.; Zhang, A.P.; Zhang, L.



GaTe semiconductor for radiation detection  

SciTech Connect

GaTe semiconductor is used as a room-temperature radiation detector. GaTe has useful properties for radiation detectors: ideal bandgap, favorable mobilities, low melting point (no evaporation), non-hygroscopic nature, and availability of high-purity starting materials. The detector can be used, e.g., for detection of illicit nuclear weapons and radiological dispersed devices at ports of entry, in cities, and off shore and for determination of medical isotopes present in a patient.

Payne, Stephen A. (Castro Valley, CA); Burger, Arnold (Nashville, TN); Mandal, Krishna C. (Ashland, MA)



Constraints on SN Ia progenitor time delays from high-z SNe and the star formation history  

E-Print Network (OSTI)

We re-assess the question of a systematic time delay between the formation of the progenitor and its explosion in a type Ia supernova (SN Ia) using the Hubble Higher-z Supernova Search sample (Strolger et al. 2004). While the previous analysis indicated a significant time delay, with a most likely value of 3.4 Gyr, effectively ruling out all previously proposed progenitor models, our analysis shows that the time-delay estimate is dominated by systematic errors, in particular due to uncertainties in the star-formation history. We find that none of the popular progenitor models under consideration can be ruled out with any significant degree of confidence. The inferred time delay is mainly determined by the peak in the assumed star-formation history. We show that, even with a much larger Supernova sample, the time delay distribution cannot be reliably reconstructed without better constraints on the star-formation history.

F. Frster; C. Wolf; Ph. Podsiadlowski; Z. Han



A Measurement of the Rate of Type Ia Supernovae in Galaxy Clusters from the SDSS-II Supernova Survey  

Science Conference Proceedings (OSTI)

We present measurements of the Type Ia supernova (SN) rate in galaxy clusters based on data from the Sloan Digital Sky Survey-II (SDSS-II) Supernova Survey. The cluster SN Ia rate is determined from 9 SN events in a set of 71 C4 clusters at z {le} 0.17 and 27 SN events in 492 maxBCG clusters at 0.1 {le} z {le} 0.3. We find values for the cluster SN Ia rate of (0.37{sub -0.12-0.01}{sup +0.17+0.01}) SNur h{sup 2} and (0.55{sub -0.11-0.01}{sup +0.13+0.02}) SNur h{sup 2} (SNux = 10{sup -12}L{sub x{circle_dot}}{sup -1} yr{sup -1}) in C4 and maxBCG clusters, respectively, where the quoted errors are statistical and systematic, respectively. The SN rate for early-type galaxies is found to be (0.31{sub -0.12-0.01}{sup +0.18+0.01}) SNur h{sup 2} and (0.49{sub -0.11-0.01}{sup +0.15+0.02}) SNur h{sup 2} in C4 and maxBCG clusters, respectively. The SN rate for the brightest cluster galaxies (BCG) is found to be (2.04{sub -1.11-0.04}{sup +1.99+0.07}) SNur h{sup 2} and (0.36{sub -0.30-0.01}{sup +0.84+0.01}) SNur h{sup 2} in C4 and maxBCG clusters, respectively. The ratio of the SN Ia rate in cluster early-type galaxies to that of the SN Ia rate in field early-type galaxies is 1.94{sub -0.91-0.015}{sup +1.31+0.043} and 3.02{sub -1.03-0.048}{sup +1.31+0.062}, for C4 and maxBCG clusters, respectively. The SN rate in galaxy clusters as a function of redshift, which probes the late time SN Ia delay distribution, shows only weak dependence on redshift. Combining our current measurements with previous measurements, we fit the cluster SN Ia rate data to a linear function of redshift, and find r{sub L} = [(0.49{sub -0.14}{sup +0.15}) + (0.91{sub -0.81}{sup +0.85}) x z] SNuB h{sup 2}. A comparison of the radial distribution of SNe in cluster to field early-type galaxies shows possible evidence for an enhancement of the SN rate in the cores of cluster early-type galaxies. With an observation of at most 3 hostless, intra-cluster SNe Ia, we estimate the fraction of cluster SNe that are hostless to be (9.4{sub -5.1}{sup +8.3})%.

Dilday, Benjamin; /Rutgers U., Piscataway /Chicago U. /KICP, Chicago; Bassett, Bruce; /Cape Town U., Dept. Math. /South African Astron. Observ.; Becker, Andrew; /Washington U., Seattle, Astron. Dept.; Bender, Ralf; /Munich, Tech. U. /Munich U. Observ.; Castander, Francisco; /Barcelona, IEEC; Cinabro, David; /Wayne State U.; Frieman, Joshua A.; /Chicago U. /Fermilab; Galbany, Lluis; /Barcelona, IFAE; Garnavich, Peter; /Notre Dame U.; Goobar, Ariel; /Stockholm U., OKC /Stockholm U.; Hopp, Ulrich; /Munich, Tech. U. /Munich U. Observ. /Tokyo U.



LAX XXlCfl jX?iK, Idd+?KYLViG?IA  

Office of Legacy Management (LM)

f f , : I~&l, samtier cipwati8Aa CffUm - . Jiux.lCJ d,# 1754 - - _- - .- t :; . Jesse e. ahizmn*~*ter -2.' -------- - _ &tV' hi@A l f izau Bkteriala ;' . . 1 -7 I _' i' . Fpr&G& r&Q Q,&& fu &fI& L;&& -l&d 2;,i' iI,;/Qi' rIGN CQ&GgJy p;E& p;~p>gyf LAX XXlCfl jX?iK, Idd+?KYLViG?IA i-icfer~~o is &o ta yaw rwarandu3;: l P iimwmbec L?, 1953, reque&in~ a d&q.&ti of khority tA A&sister prog= for th+zz developmrrrl, Ii-&k& & acyui8itti ef c;uYletit*type and reswitlitc-type urtim bi:aPing eres and far t3-u jx*uctim and acquisitian 6f W ;aniU CCm- csa:ratc~ fhzi awes wit2n Lhe Six&e of Pemlsyzvania. 1 da not b&i- the projscrt fmr the pkcch2670 +S eroa from i&d.&


Capturing the Fire: Flame Energetics and Neutronizaton for Type Ia Supernova Simulations  

E-Print Network (OSTI)

We develop and calibrate a realistic model flame for hydrodynamical simulations of deflagrations in white dwarf (Type Ia) supernovae. Our flame model builds on the advection-diffusion-reaction model of Khokhlov and includes electron screening and Coulomb corrections to the equation of state in a self-consistent way. We calibrate this model flame--its energetics and timescales for energy release and neutronization--with self-heating reaction network calculations that include both these Coulomb effects and up-to-date weak interactions. The burned material evolves post-flame due to both weak interactions and hydrodynamic changes in density and temperature. We develop a scheme to follow the evolution, including neutronization, of the NSE state subsequent to the passage of the flame front. As a result, our model flame is suitable for deflagration simulations over a wide range of initial central densities and can track the temperature and electron fraction of the burned material through the explosion and into the expansion of the ejecta.

A. C. Calder; D. M. Townsley; I. R. Seitenzahl; F. Peng; O. E. B. Messer; N. Vladimirova; E. F. Brown; J. W. Truran; D. Q. Lamb




E-Print Network (OSTI)

We extend our previous three-dimensional, full-star simulations of the final hours of convection preceding ignition in Type Ia supernovae to higher resolution using the adaptive mesh refinement capability of our low Mach number code, MAESTRO. We report the statistics of the ignition of the first flame at an effective 4.34 km resolution and general flow field properties at an effective 2.17 km resolution. We find that off-center ignition is likely, with radius of 50 km most favored and a likely range of 4075 km. This is consistent with our previous coarser (8.68 km resolution) simulations, implying that we have achieved sufficient resolution in our determination of likely ignition radii. The dynamics of the last few hot spots preceding ignition suggest that a multiple ignition scenario is not likely. With improved resolution, we can more clearly see the general flow pattern in the convective region, characterized by a strong outward plume with a lower speed recirculation. We show that the convective core is turbulent with a Kolmogorov spectrum and has a lower turbulent intensity and larger integral length scale than previously thought (on the order of 16 km s?1 and 200 km, respectively), and we discuss the potential consequences for the first flames. Key words: convection hydrodynamics methods: numerical nuclear reactions, nucleosynthesis, abundances supernovae: general white dwarfs Online-only material: color figures 1.

A. Nonaka; A. J. Aspden; M. Zingale; A. S. Almgren; J. B. Bell; S. E. Woosley



Phenomenology for Supernova Ia Data Based on a New Cosmic Time  

E-Print Network (OSTI)

A new phenomenological theory for the expansion of our universe is presented. Because fundamental supporting theory is still in development, its discussion is not presented in this paper. The theory is based on a new algebraic expression for cosmic time G Rho t^2=3/32Pi, which correctly predicts the WMAP measured cosmological constants and the fundamental Hubble parameter H(t) for the expansion of the universe. A replacement for dark matter, called here "dark mass", is proposed which scales as with the expansion and incorporated. It does not react with ordinary matter, except gravitationally, and produces flat rotational curves for spiral galaxies. Also a new expression for the approaching velocity of radiation in a closed 3-sphere expanding universe is given that accounts for the early degrading negative approach of radiation for z > 1.7. The expression is v = Hr-c. Combining these three elements produces a luminosity distance dL that successfully predicts the apparent magnitude of exploding supernova Ia stars and even the new gamma ray bursts with no need for dark energy or acceleration of the expansion of the universe.

Charles B. Leffert



Prospects for Type Ia Supernova explosion mechanism identification with gamma rays  

E-Print Network (OSTI)

The explosion mechanism associated with thermonuclear supernovae (SNIa) is still a matter of debate. There is a wide agreement that high amounts of of radioactive nuclei are produced during these events and they are expected to be strong gamma-ray emitters. In the past, several authors have investigated the use of this gamma-ray emission as a diagnostic tool. In this paper we have done a complete study of the gamma-ray spectra associated with all the different scenarios currently proposed. This includes detonation, delayed detonation, deflagration and the off-center detonation. We have performed accurate simulations for this complete set of models in order to determine the most promising spectral features that could be used to discriminate among the different models. Our study is not limited to qualitative arguments. Instead, we have quantified the differences among the spectra and established distance limits for their detection. The calculations have been performed considering the best current response estimations of the SPI and IBIS instruments aboard INTEGRAL in such a way that our results can be used as a guideline to evaluate the capabilities of INTEGRAL in the study of type Ia supernovae. For the purpose of completeness we have also investigated the nuclear excitation and spallation reactions as a possible secondary source of gamma-rays present in some supernova scenarios. We conclude that this mechanism can be neglected due to its small contribution.

Jordi Gomez-Gomar; Jordi Isern; Pierre Jean


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect

We present a study exploring a systematic effect on the brightness of Type Ia supernovae using numerical models that assume the single-degenerate paradigm. Our investigation varied the central density of the progenitor white dwarf at flame ignition, and considered its impact on the explosion yield, particularly the production and distribution of radioactive {sup 56}Ni, which powers the light curve. We performed a suite of two-dimensional simulations with randomized initial conditions, allowing us to characterize the statistical trends that we present. The simulations indicate that the production of Fe-group material is statistically independent of progenitor central density, but the mass of stable Fe-group isotopes is tightly correlated with central density, with a decrease in the production of {sup 56}Ni at higher central densities. These results imply that progenitors with higher central densities produce dimmer events. We provide details of the post-explosion distribution of {sup 56}Ni in the models, including the lack of a consistent centrally located deficit of {sup 56}Ni, which may be compared to observed remnants. By performing a self-consistent extrapolation of our model yields and considering the main-sequence lifetime of the progenitor star and the elapsed time between the formation of the white dwarf and the onset of accretion, we develop a brightness-age relation that improves our prediction of the expected trend for single degenerates and we compare this relation with observations.

Krueger, Brendan K.; Jackson, Aaron P.; Calder, Alan C. [Department of Physics and Astronomy, State University of New York-Stony Brook, Stony Brook, NY (United States); Townsley, Dean M. [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL (United States); Brown, Edward F. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI (United States); Timmes, Francis X., E-mail: brendan.krueger@stonybrook.edu [Joint Institute for Nuclear Astrophysics, Notre Dame, IN (United States)



Direct numerical simulations of type Ia supernovae flames II: The Rayleigh-Taylor instability  

Science Conference Proceedings (OSTI)

A Type Ia supernova explosion likely begins as a nuclear runaway near the center of a carbon-oxygen white dwarf. The outward propagating flame is unstable to the Landau-Darrieus, Rayleigh-Taylor, and Kelvin-Helmholtz instabilities, which serve to accelerate it to a large fraction of the speed of sound. We investigate the Rayleigh-Taylor unstable flame at the transition from the flamelet regime to the distributed-burning regime, around densities of 10e7 gm/cc, through detailed, fully resolved simulations. A low Mach number, adaptive mesh hydrodynamics code is used to achieve the necessary resolution and long time scales. As the density is varied, we see a fundamental change in the character of the burning--at the low end of the density range the Rayleigh-Taylor instability dominates the burning, whereas at the high end the burning suppresses the instability. In all cases, significant acceleration of the flame is observed, limited only by the size of the domain we are able to study. We discuss the implications of these results on the potential for a deflagration to detonation transition.

Bell, J.B.; Day, M.S.; Rendleman, C.A.; Woosley, S.E.; Zingale, M.



Constraining deflagration models of Type Ia supernovae through intermediate-mass elements  

E-Print Network (OSTI)

The physical structure of a nuclear flame is a basic ingredient of the theory of Type Ia supernovae (SNIa). Assuming an exponential density reduction with several characteristic times we have followed the evolution of a planar nuclear flame in an expanding background from an initial density 6.6 10^7 g/cm3 down to 2 10^6 g/cm3. The total amount of synthesized intermediate-mass elements (IME), from silicon to calcium, was monitored during the calculation. We have made use of the computed mass fractions, X_IME, of these elements to give an estimation of the total amount of IME synthesized during the deflagration of a massive white dwarf. Using X_IME and adopting the usual hypothesis that turbulence decouples the effective burning velocity from the laminar flame speed, so that the relevant flame speed is actually the turbulent speed on the integral length-scale, we have built a simple geometrical approach to model the region where IME are thought to be produced. It turns out that a healthy production of IME invol...

Garca-Senz, D; Cabezon, R M; Woosley, S E



Direct numerical simulations of type Ia supernovae flames I: The landau-darrieus instability  

SciTech Connect

Planar flames are intrinsically unstable in open domains due to the thermal expansion across the burning front--the Landau-Darrieus instability. This instability leads to wrinkling and growth of the flame surface, and corresponding acceleration of the flame, until it is stabilized by cusp formation. We look at the Landau-Darrieus in stability for C/O thermonuclear flames at conditions relevant to the late stages of a Type Ia supernova explosion. Two-dimensional direct numerical simulations of both single-mode and multi-mode perturbations using a low Mach number hydrodynamics code are presented. We show the effect of the instability on the flame speed as a function of both the density and domain size, demonstrate the existence of the small scale cutoff to the growth of the instability, and look for the proposed breakdown of the non-linear stabilization at low densities. The effects of curvature on the flame as quantified through measurements of the growth rate and computation of the corresponding Markstein number. While accelerations of a few percent are observed, they are too small to have any direct outcome on the supernova explosion.

Bell, J.B.; Day, M.S.; Rendleman, C.A.; Woosley, S.E.; Zingale, M.




Science Conference Proceedings (OSTI)

The flame in a Type Ia supernova is a conglomerate structure that, depending on density, may involve separate regions of carbon, oxygen, and silicon burning, all propagating in a self-similar, subsonic front. The separation between these three burning regions increases as the density declines until eventually, below about 2 x 10{sup 7} g cm{sup -3}, only carbon burning remains active, the other two burning phases having 'frozen out' on stellar scales. Between 2 and 3 x 10{sup 7} g cm{sup -3}, however, there remains an energetic oxygen-burning region that trails the carbon burning by an amount that is sensitive to the turbulence intensity. As the carbon flame makes a transition to the distributed regime (Karlovitz number {approx}> 10), the characteristic separation between the carbon- and oxygen-burning regions increases dramatically, from a fraction of a meter to many kilometers. The oxygen-rich mixture between the two flames is created at a nearly constant temperature, and turbulence helps to maintain islands of well-mixed isothermal fuel as the temperature increases. The delayed burning of these regions can be supersonic and could initiate a detonation.

Woosley, S. E. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Kerstein, A. R. [Combustion Research Facility, Sandia National Laboratories, Livermore, CA 94551 (United States); Aspden, A. J., E-mail: woosley@ucolick.org, E-mail: arkerst@sandia.gov, E-mail: ajaspden@lbl.gov [Center for Computational Sciences and Engineering, Lawrence Berkeley National Laboratory, CA 94720 (United States)




SciTech Connect

The nature of carbon burning flames in Type Ia supernovae is explored as they interact with Kolmogorov turbulence. One-dimensional calculations using the Linear Eddy Model of Kerstein elucidate three regimes of turbulent burning. In the simplest case, large-scale turbulence folds and deforms thin laminar flamelets to produce a flame brush with a total burning rate given approximately by the speed of turbulent fluctuations on the integral scale, U{sub L} , This is the regime where the supernova explosion begins and where most of its pre-detonation burning occurs. As the density declines, turbulence starts to tear the individual flamelets, making broader structures that move faster. For a brief time, these turbulent flamelets are still narrow compared to their spacing and the concept of a flame brush moving with an overall speed of U{sub L} remains valid. However, the typical width of the individual flamelets, which is given by the condition that their turnover time equals their burning time, continues to increase as the density declines. Eventually, mixed regions almost as large as the integral scale itself are transiently formed. At that point, a transition to detonation can occur. The conditions for such a transition are explored numerically and it is estimated that the transition will occur for densities near 1 x 10{sup 7} g cm{sup -3}, provided the turbulent speed on the integral scale exceeds about 20% sonic. An example calculation shows the details of a detonation actually developing.

Woosley, S. E. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Kerstein, A. R.; Sankaran, V. [Combustion Research Facility, Sandia National Laboratory, Livermore, CA 94551 (United States); Aspden, A. J. [Center for Computational Science and Engineering, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Roepke, F. K., E-mail: woosley@ucolick.or, E-mail: arkerst@sandia.go, E-mail: AJAspden@lbl.go, E-mail: fritz@mpa-Garching.mpg.d [Max Planck Institut fuer Astrophysik, Garching (Germany)




SciTech Connect

The explosion of a Type Ia supernova, SN2011fe, in the nearby Pinwheel galaxy (M101 at 6.4 Mpc) provides an opportunity to study pre-explosion images and search for the progenitor, which should consist of a white dwarf (WD), possibly surrounded by an accretion disk, in orbit with another star. We report on our use of deep Chandra observations and Hubble Space Telescope observations to limit the luminosity and temperature of the pre-explosion WD. It is found that if the spectrum was a blackbody, then pre-SN WDs with steady nuclear burning of the highest possible temperatures and luminosities are excluded assuming moderate n{sub H} values, but values of kT between roughly 10 eV and 60 eV are permitted even if the WD was emitting at the Eddington luminosity. This allows the progenitor to be an accreting nuclear-burning WD with an expanded photosphere 4-100 times the WD itself, or a super-critically accreting WD blowing off an optically thick strong wind, or possibly a recurrent nova with luminosities an order of magnitude lower than Eddington. The observations are also consistent with a double degenerate scenario, or a spinning down WD that has been spun up by accretion from the donor.

Liu Jifeng [National Astronomical Observatory of China, Beijing 100012 (China); Di Stefano, Rosanne; Wang Tao; Moe, Maxwell [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)



The Joint Efficient Dark-energy Investigation (JEDI): Measuring the cosmic expansion history from type Ia supernovae  

E-Print Network (OSTI)

JEDI (Joint Efficient Dark-energy Investigation) is a candidate implementation of the NASA-DOE Joint Dark Energy Mission (JDEM). JEDI will probe dark energy in three independent methods: (1) type Ia supernovae, (2) baryon acoustic oscillations, and (3) weak gravitational lensing. In an accompanying paper, an overall summary of the JEDI mission is given. In this paper, we present further details of the supernova component of JEDI. To derive model-independent constraints on dark energy, it is important to precisely measure the cosmic expansion history, H(z), in continuous redshift bins from z \\~ 0-2 (the redshift range in which dark energy is important). SNe Ia at z > 1 are not readily accessible from the ground because the bulk of their light has shifted into the near-infrared where the sky background is overwhelming; hence a space mission is required to probe dark energy using SNe. Because of its unique near-infrared wavelength coverage (0.8-4.2 microns), JEDI has the advantage of observing SNe Ia in the rest frame J band for the entire redshift range of 0 energy are discussed, with special emphasis on the improved precision afforded by the rest frame near-infrared data.

M. M. Phillips; Peter Garnavich; Yun Wang; David Branch; Edward Baron; Arlin Crotts; J. Craig Wheeler; Edward Cheng; Mario Hamuy; for the JEDI Team



A Measurement of the Rate of Type Ia Supernovae in Galaxy Clusters from the SDSS-II Supernova Survey  

E-Print Network (OSTI)

ABRIDGED We present measurements of the Type Ia supernova (SN) rate in galaxy clusters based on data from the Sloan Digital Sky Survey-II (SDSS-II) Supernova Survey. The cluster SN Ia rate is determined from 9 SN events in a set of 71 C4 clusters at z <0.17 and 27 SN events in 492 maxBCG clusters at 0.1 < z < 0.3$. We find values for the cluster SN Ia rate of $({0.37}^{+0.17+0.01}_{-0.12-0.01}) \\mathrm{SNu}r h^{2}$ and $({0.55}^{+0.13+0.02}_{-0.11-0.01}) \\mathrm{SNu}r h^{2}$ ($\\mathrm{SNu}x = 10^{-12} L_{x\\sun}^{-1} \\mathrm{yr}^{-1}$) in C4 and maxBCG clusters, respectively, where the quoted errors are statistical and systematic, respectively. The SN rate for early-type galaxies is found to be $({0.31}^{+0.18+0.01}_{-0.12-0.01}) \\mathrm{SNu}r h^{2}$ and $({0.49}^{+0.15+0.02}_{-0.11-0.01})$ $\\mathrm{SNu}r h^{2}$ in C4 and maxBCG clusters, respectively. The SN rate for the brightest cluster galaxies (BCG) is found to be $({2.04}^{+1.99+0.07}_{-1.11-0.04}) \\mathrm{SNu}r h^{2}$ and $({0.36}^{+0.84+0.01}_...

Dilday, Benjamin; Becker, Andrew; Bender, Ralf; Castander, Francisco; Cinabro, David; Frieman, Joshua A; Galbany, Llus; Garnavich, Peter; Goobar, Ariel; Hopp, Ulrich; Ihara, Yutaka; Jha, Saurabh W; Kessler, Richard; Lampeitl, Hubert; Marriner, John; Miquel, Ramon; Moll, Mercedes; Nichol, Robert C; Nordin, Jakob; Riess, Adam G; Sako, Masao; Schneider, Donald P; Smith, Mathew; Sollerman, Jesper; Wheeler, J Craig; stman, Linda; Bizyaev, Dmitry; Brewington, Howard; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Dan; Pan, Kaike; Simmons, Audrey; Snedden, Stephanie



Simulation and Design Analysis of (A1Ga)As/GaAs MODFET Integrated Circuits  

Science Conference Proceedings (OSTI)

A new (AlGa)As/GaAs MODFET integrated circuit simulator is described. Our simulator is a customized version of SPICE incorporating the extended charge control model for MODFET's and the velocity saturation model for ungated FET's used as the load devices. ...

Choong H. Hyun; M. S. Shur; N. C. Cirillo



Schottky-Drain Technology for AlGaN/GaN High-Electron Mobility Transistors  

E-Print Network (OSTI)

In this letter, we demonstrate 27% improvement in the buffer breakdown voltage of AlGaN/GaN high-electron mobility transistors (HEMTs) grown on Si substrate by using a new Schottky-drain contact technology. Schottky-drain ...

Lu, Bin


Nanocrystals cylindrical microcavities exploiting thin-walled InGaAs/GaAs microtubes  

Science Conference Proceedings (OSTI)

This paper relies on the design and fabrication of CdSe/ZnS core/shell colloidal nanocrystals (NCs) cylindrical microcavities for microphotonics applications. The fabrication technology relies on the release of the strain in strained heterostructures, ... Keywords: Colloidal nanocrystals, InGaAs/GaAs microtubes, Strained multilayer

C. Giordano; M. T. Todaro; A. Salhi; L. Martiradonna; I. Viola; A. Passab; L. Carbone; G. Gigli; A. Passaseo; M. De Vittorio



Two-dimensional electron gas in AlGaN/GaN heterostructures  

Science Conference Proceedings (OSTI)

The formation of a two-dimensional electron gas (2DEG) system by an AlGaN/GaN heterostructure has been further confirmed by measuring its electrical properties. The effect of persistent photoconductivity (PPC) has been observed and its unique features have been utilized to study the properties of 2DEG formed by the AlGaN/GaN heterointerface. Sharp electronic transitions from the first to the second subbands in the 2DEG channel have been observed by monitoring the 2DEG carrier mobility as a function of carrier concentration through the use of PPC. These results are expected to have significant implications on field-effect transistor and high electron mobility transistor applications based on the GaN system. {copyright} {ital 1997 American Vacuum Society.}

Li, J.Z.; Lin, J.Y.; Jiang, H.X. [Department of Physics, Kansas State University, Manhattan, Kansas 66506-2601 (United States)] [Department of Physics, Kansas State University, Manhattan, Kansas 66506-2601 (United States); Khan, M.A.; Chen, Q. [APA Optics, Inc., Blaine, Minnesota 55449 (United States)] [APA Optics, Inc., Blaine, Minnesota 55449 (United States)



Lattice-matched epitaxial GaInAsSb/GaSb thermophotovoltaic devices  

DOE Green Energy (OSTI)

The materials development of Ga{sub 1{minus}x}In{sub x}As{sub y}Sb{sub 1{minus}y} alloys for lattice-matched thermophotovoltaic (TPV) devices is reported. Epilayers with cutoff wavelength 2--2.4 {micro}m at room temperature and lattice-matched to GaSb substrates were grown by both low-pressure organometallic vapor phase epitaxy and molecular beam epitaxy. These layers exhibit high optical and structural quality. For demonstrating lattice-matched thermophotovoltaic devices, p- and n-type doping studies were performed. Several TPV device structures were investigated, with variations in the base/emitter thicknesses and the incorporation of a high bandgap GaSb or AlGaAsSb window layer. Significant improvement in the external quantum efficiency is observed for devices with an AlGaAsSb window layer compared to those without one.

Wang, C.A.; Choi, H.K.; Turner, G.W.; Spears, D.L.; Manfra, M.J. [Massachusetts Inst. of Tech., Lexington, MA (United States). Lincoln Lab.; Charache, G.W. [Lockheed Martin, Inc., Schenectady, NY (United States)



The Rise and Fall of Type Ia Supernova Light Curves in the SDSS-II Supernova Survey  

Science Conference Proceedings (OSTI)

We analyze the rise and fall times of Type Ia supernova (SN Ia) light curves discovered by the Sloan Digital Sky Survey-II (SDSS-II) Supernova Survey. From a set of 391 light curves k-corrected to the rest-frame B and V bands, we find a smaller dispersion in the rising portion of the light curve compared to the decline. This is in qualitative agreement with computer models which predict that variations in radioactive nickel yield have less impact on the rise than on the spread of the decline rates. The differences we find in the rise and fall properties suggest that a single 'stretch' correction to the light curve phase does not properly model the range of SN Ia light curve shapes. We select a subset of 105 light curves well observed in both rise and fall portions of the light curves and develop a '2-stretch' fit algorithm which estimates the rise and fall times independently. We find the average time from explosion to B-band peak brightness is 17.38 {+-} 0.17 days, but with a spread of rise times which range from 13 days to 23 days. Our average rise time is shorter than the 19.5 days found in previous studies; this reflects both the different light curve template used and the application of the 2-stretch algorithm. The SDSS-II supernova set and the local SNe Ia with well-observed early light curves show no significant differences in their average rise-time properties. We find that slow-declining events tend to have fast rise times, but that the distribution of rise minus fall time is broad and single peaked. This distribution is in contrast to the bimodality in this parameter that was first suggested by Strovink (2007) from an analysis of a small set of local SNe Ia. We divide the SDSS-II sample in half based on the rise minus fall value, t{sub r} - t{sub f} {approx} 2 days, to search for differences in their host galaxy properties and Hubble residuals; we find no difference in host galaxy properties or Hubble residuals in our sample.

Hayden, Brian T.; /Notre Dame U.; Garnavich, Peter M.; /Notre Dame U.; Kessler, Richard; /KICP, Chicago /Chicago U., EFI; Frieman, Joshua A.; /KICP, Chicago /Chicago U. /Fermilab; Jha, Saurabh W.; /Stanford U., Phys. Dept. /Rutgers U., Piscataway; Bassett, Bruce; /Cape Town U., Dept. Math. /South African Astron. Observ.; Cinabro, David; /Wayne State U.; Dilday, Benjamin; /Rutgers U., Piscataway; Kasen, Daniel; /UC, Santa Cruz; Marriner, John; /Fermilab; Nichol, Robert C.; /Portsmouth U., ICG /Baltimore, Space Telescope Sci. /Johns Hopkins U.



MBE growth of high electron mobility 2DEGs in AlGaN/GaN heterostructures controlled by RHEED  

Science Conference Proceedings (OSTI)

We have grown 2DEG AlGaN/GaN heterostructures by molecular beam epitaxy (MBE) with electron mobilities up to 21500 cm{sup 2}V{sup -1}s{sup -1} at 2 K. In-situ RHEED was applied to optimize different aspects of Ga-rich growth. This paper gives a compact overview of the experimental key aspects that significantly affect the low temperature electron mobility in AlGaN/GaN heterostructures. Growth at the transition towards Ga droplet formation produced the best results. A quantitative analysis of the magnetoresistance confirmes scattering at dislocations as the dominant scattering process at low temperature.

Broxtermann, D.; Sivis, M.; Malindretos, J.; Rizzi, A. [IV. physikalisches Institut, Georg-August-Universitaet Goettingen (Germany)



Double pulse doped InGaAs/AlGaAs/GaAs pseudomorphic high-electron-mobility transistor heterostructures  

Science Conference Proceedings (OSTI)

Double pulse doped ({delta}-doped) InGaAs/AlGaAs/GaAs pseudomorphic high-electron-mobility transistor (HEMT) heterostructures were grown by molecular-beam epitaxy using a multiwafer technological system. The room-temperature electron mobility was determined by the Hall method as 6550 and 6000 cm{sup 2}/(V s) at sheet electron densities of 3.00 x 10{sup 12} and 3.36 x 10{sup 12} cm{sup -2}, respectively. HEMT heterostructures fabricated in a single process feature high uniformity of structural and electrical characteristics over the entire area of wafers 76.2 mm in diameter and high reproducibility of characteristics from process to process.

Egorov, A. Yu., E-mail: anton@beam.ioffe.ru; Gladyshev, A. G.; Nikitina, E. V.; Denisov, D. V.; Polyakov, N. K.; Pirogov, E. V.; Gorbazevich, A. A. [Russian Academy of Sciences, St. Petersburg Physics and Technology Center for Research and Education (Russian Federation)



Revealing Type Ia supernova physics with cosmic rates and nuclear gamma rays  

E-Print Network (OSTI)

Type Ia supernovae (SNIa) remain mysterious despite their central importance in cosmology and their rapidly increasing discovery rate. The progenitors of SNIa can be probed by the delay time between progenitor birth and explosion as SNIa. The explosions and progenitors of SNIa can be probed by MeV nuclear gamma rays emitted in the decays of radioactive nickel and cobalt into iron. We compare the cosmic star formation and SNIa rates, finding that their different redshift evolution requires a large fraction of SNIa to have large delay times. A delay time distribution of the form t^{-1.0 +/- 0.3} provides a good fit, implying 50% of SNIa explode more than ~ 1 Gyr after progenitor birth. The extrapolation of the cosmic SNIa rate to z = 0 agrees with the rate we deduce from catalogs of local SNIa. We investigate prospects for gamma-ray telescopes to exploit the facts that escaping gamma rays directly reveal the power source of SNIa and uniquely provide tomography of the expanding ejecta. We find large improvements relative to earlier studies by Gehrels et al. in 1987 and Timmes & Woosley in 1997 due to larger and more certain SNIa rates and advances in gamma-ray detectors. The proposed Advanced Compton Telescope, with a narrow-line sensitivity ~ 60 times better than that of current satellites, would, on an annual basis, detect up to ~ 100 SNIa (3 sigma) and provide revolutionary model discrimination for SNIa within 20 Mpc, with gamma-ray light curves measured with ~ 10 sigma significance daily for ~ 100 days. Even more modest improvements in detector sensitivity would open a new and invaluable astronomy with frequent SNIa gamma-ray detections.

Shunsaku Horiuchi; John F. Beacom



Three-dimensional numerical simulations of Rayleigh-Taylorunstable flames in type Ia supernovae  

SciTech Connect

Flame instabilities play a dominant role in accelerating the burning front to a large fraction of the speed of sound in a Type Ia supernova. We present a three-dimensional numerical simulation of a Rayleigh-Taylor unstable carbon flame, following its evolution through the transition to turbulence. A low Mach number hydrodynamics method is used, freeing us from the harsh time step restrictions imposed by sound waves. We fully resolve the thermal structure of the flame and its reaction zone, eliminating the need for a flame model. A single density is considered, 1.5x107 gm/cc, and half carbon/half oxygen fuel--conditions under which the flame propagated in the flamelet regime in our related two-dimensional study. We compare to a corresponding two-dimensional simulation, and show that while fire-polishing keeps the small features suppressed in two dimensions, turbulence wrinkles the flame on far smaller scales in the three-dimensional case, suggesting that the transition to the distributed burning regime occurs at higher densities in three dimensions. Detailed turbulence diagnostics are provided. We show that the turbulence follows a Kolmogorov spectrum and is highly anisotropic on the large scales, with a much larger integral scale in the direction of gravity. Furthermore, we demonstrate that it becomes more isotropic as it cascades down to small scales. Based on the turbulent statistics and the flame properties of our simulation, we compute the Gibson scale. We show the progress of the turbulent flame through a classic combustion regime diagram, indicating that the flame just enters the distributed burning regime near the end of our simulation.

Zingale, M.; Woosley, S.E.; Rendleman, C.A.; Day, M.S.; Bell, J.B.



Constraining deflagration models of Type Ia supernovae through intermediate-mass elements  

E-Print Network (OSTI)

The physical structure of a nuclear flame is a basic ingredient of the theory of Type Ia supernovae (SNIa). Assuming an exponential density reduction with several characteristic times we have followed the evolution of a planar nuclear flame in an expanding background from an initial density 6.6 10^7 g/cm3 down to 2 10^6 g/cm3. The total amount of synthesized intermediate-mass elements (IME), from silicon to calcium, was monitored during the calculation. We have made use of the computed mass fractions, X_IME, of these elements to give an estimation of the total amount of IME synthesized during the deflagration of a massive white dwarf. Using X_IME and adopting the usual hypothesis that turbulence decouples the effective burning velocity from the laminar flame speed, so that the relevant flame speed is actually the turbulent speed on the integral length-scale, we have built a simple geometrical approach to model the region where IME are thought to be produced. It turns out that a healthy production of IME involves the combination of not too short expansion times, t_c > 0.2 s, and high turbulent intensities. According to our results it could be difficult to produce much more than 0.2 solar masses of intermediate-mass elements within the deflagrative paradigma. The calculations also suggest that the mass of IME scales with the mass of Fe-peak elements, making it difficult to conciliate energetic explosions with low ejected nickel masses, as in the well observed SN1991bg or in SN1998de. Thus a large production of Si-peak elements, especially in combination with a low or a moderate production of iron, could be better addressed by either the delayed detonation route in standard Chandrasekhar-mass models or, perhaps, by the off-center helium detonation in the sub Chandrasekhar-mass scenario.

D. Garcia-Senz; E. Bravo; R. M. Cabezon; S. E. Woosley


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Conference Proceedings (OSTI)

We describe the detonation mechanism composing the 'pulsationally assisted' gravitationally confined detonation (GCD) model of Type Ia supernovae. This model is analogous to the previous GCD model reported in Jordan et al.; however, the chosen initial conditions produce a substantively different detonation mechanism, resulting from a larger energy release during the deflagration phase. The resulting final kinetic energy and {sup 56}Ni yields conform better to observational values than is the case for the 'classical' GCD models. In the present class of models, the ignition of a deflagration phase leads to a rising, burning plume of ash. The ash breaks out of the surface of the white dwarf, flows laterally around the star, and converges on the collision region at the antipodal point from where it broke out. The amount of energy released during the deflagration phase is enough to cause the star to rapidly expand, so that when the ash reaches the antipodal point, the surface density is too low to initiate a detonation. Instead, as the ash flows into the collision region (while mixing with surface fuel), the star reaches its maximally expanded state and then contracts. The stellar contraction acts to increase the density of the star, including the density in the collision region. This both raises the temperature and density of the fuel-ash mixture in the collision region and ultimately leads to thermodynamic conditions that are necessary for the Zel'dovich gradient mechanism to produce a detonation. We demonstrate feasibility of this scenario with three three-dimensional (3D), full star simulations of this model using the FLASH code. We characterized the simulations by the energy released during the deflagration phase, which ranged from 38% to 78% of the white dwarf's binding energy. We show that the necessary conditions for detonation are achieved in all three of the models.

Jordan, G. C. IV; Graziani, C.; Weide, K.; Norris, J.; Hudson, R.; Lamb, D. Q. [Flash Center for Computational Science, University of Chicago, Chicago, IL 60637 (United States); Fisher, R. T. [Department of Physics, University of Massachusetts Dartmouth, 285 Old Westport Road, North Dartmouth, MA 02740 (United States); Townsley, D. M. [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL 35487 (United States); Meakin, C. [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Reid, L. B. [NTEC Environmental Technology, Subiaco WA 6008 (Australia)



GaN Nanopore Arrays: Fabrication and Characterization  

E-Print Network (OSTI)

GaN nanopore arrays with pore diameters of approximately 75 nm were fabricated by inductively coupled plasma etching (ICP) using anodic aluminum oxide (AAO) films as etch masks. Nanoporous AAO films were formed on the GaN ...

Wang, Yadong



NLE Websites -- All DOE Office Websites (Extended Search)

4183E-rev1 4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI IA AB BI IL LI IT TY Y I IN N C CA AL LI IF FO OR RN NI IA A: : E EN NV VI IR RO ON NM ME EN NT TA AL L I IM MP PA AC CT TS S A AN ND D D DE EV VI IC CE E P PE ER RF FO OR RM MA AN NC CE E E EX XP PE ER RI IM ME EN NT TA AL L E EV VA AL LU UA AT TI IO ON N O OF F I IN NS ST TA AL LL LE ED D C CO OO OK KI IN NG G E EX XH HA AU US ST T F FA AN N P PE ER RF FO OR RM MA AN NC CE E Brett C. Singer, William W. Delp and Michael G. Apte Indoor Environment Department Atmospheric Sciences Department Environmental Energy Technologies Division July 2011 (Revised February 2012) Disclaimer 1 This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor The Regents of the University of California, nor any of


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape ...  

Science Conference Proceedings (OSTI)

... Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape Memory Alloys. Peng Zhao (Dept. of Materials Science and ...


GA-AL-SC | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GA-AL-SC GA-AL-SC GA-AL-SC October 1, 2012 ALA-1-N Wholesale Power Rate Schedule Area: PowerSouth Energy Cooperative System: Georgia-Alabama-South Carolina October 1, 2012 Duke-1-E Wholesale Power Rate Schedule Area: Duke On-System System: Georgia-Alabama-South Carolina October 1, 2012 Duke-2-E Wholesale Power Rate Schedule Area: Central System: Georgia-Alabama-South Carolina October 1, 2012 Duke-3-E Wholesale Power Rate Schedule Area: None System: Georgia-Alabama-South Carolina October 1, 2012 Duke-4-E Wholesale Power Rate Schedule Area: Duke Self-Schedulers System: Georgia-Alabama-South Carolina October 1, 2012 MISS-1-N Wholesale Power Rate Schedule Area: South Mississippi Electric Power Association System: Georgia-Alabama-South Carolina October 1, 2012 Pump-1-A Wholesale Power Rate Schedule


Evolution of structural defects associated with electrical degradation in AlGaN/GaN high electron mobility transistors  

E-Print Network (OSTI)

We have investigated the surface morphology of electrically stressed AlGaN/GaN high electron mobility transistors using atomic force microscopy and scanning electron microscopy after removing the gate metallization by ...

Makaram, Prashanth


Enhancement-mode AlGaN/GaN HEMTs with high linearity fabricated by hydrogen plasma treatment  

E-Print Network (OSTI)

Enhancement-mode (E-mode) AlGaN/GaN high electron mobility transistors (HEMTs) are highly desirable for power and digital electronic circuits. Several technologies have been demonstrated in the last few years to fabricate ...

Palacios, Tomas


Advanced technologies for improving high frequency performance of AlGaN/GaN high electron mobility transistors  

E-Print Network (OSTI)

In this thesis, we have used a combination of physical analysis, numerical simulation and experimental work to identify and overcome some of the main challenges in AlGaN/GaN high electron mobility transistors (HEMTs) for ...

Chung, Jinwook W. (Jinwook Will)



GaAs photoconductive semiconductor switch  

DOE Patents (OSTI)

A high gain, optically triggered, photoconductive semiconductor switch (PCSS) implemented in GaAs as a reverse-biased pin structure with a passivation layer above the intrinsic GaAs substrate in the gap between the two electrodes of the device. The reverse-biased configuration in combination with the addition of the passivation layer greatly reduces surface current leakage that has been a problem for prior PCSS devices and enables employment of the much less expensive and more reliable DC charging systems instead of the pulsed charging systems that needed to be used with prior PCSS devices.

Loubriel, Guillermo M. (Sandia Park, NM); Baca, Albert G. (Albuquerque, NM); Zutavern, Fred J. (Albuquerque, NM)



GaN: Defect and Device Issues  

SciTech Connect

The role of extended and point defects, and key impurities such as C, O and H, on the electrical and optical properties of GaN is reviewed. Recent progress in the development of high reliability contacts, thermal processing, dry and wet etching techniques, implantation doping and isolation and gate insulator technology is detailed. Finally, the performance of GaN-based electronic and photonic devices such as field effect transistors, UV detectors, laser diodes and light-emitting diodes is covered, along with the influence of process-induced or grown-in defects and impurities on the device physics.

Pearton, S.J.; Ren, F.; Shul, R.J.; Zolper, J.C.



A New Combustion Synthesis Method for GaN:Eu3+ and Ga2O3 :Eu3+  

E-Print Network (OSTI)

A New Combustion Synthesis Method for GaN:Eu3+ and Ga2O3 :Eu3+ Luminescent Powders G. A. Hirata1 between the precursors. The preparation of Eu-doped Ga2O3 powders was achieved using a new combustion)3 and Ga(NO3)3 as the precursors and hydrazine as (non-carbonaceous) fuel. A spontaneous combustion

McKittrick, Joanna


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



GaAs/AlGaAs nanostructured composites for free-space and integrated optical devices  

E-Print Network (OSTI)

Fainman, "Influence of chlorine on etched sidewalls inFainman, Influence of chlorine on etched sidewalls inthe RIBE of GaAs with chlorine (Cl 2 ), ion beam sputtering

Tsai, Chia-Ho



K1, Molecular Beam Epitaxy of Catalyst-Free InGaN/GaN Nanowires ...  

Science Conference Proceedings (OSTI)

I4, Electrical Spin Injection in a Hybrid Organic/Inorganic Spin-Polarized Light Emitting Diode (Spin-LED) I5, Properties of MnAs/GaMnAs/MnAs Magnetic...


JJ2, Optical Polarization of Non-Polar GaInN/GaN LEDs  

Science Conference Proceedings (OSTI)

I4, Electrical Spin Injection in a Hybrid Organic/Inorganic Spin-Polarized Light Emitting Diode (Spin-LED) I5, Properties of MnAs/GaMnAs/MnAs Magnetic...


Limits on the Time Variation of the Fermi Constant G_F Based on Type Ia Supernova Observations  

E-Print Network (OSTI)

The light curve of a type Ia supernova decays at a rate set by the beta-decay lifetimes of the Ni-56 and Co-56 produced in the explosion. This makes such a light curve sensitive to the value of the Fermi constant G_F at the time of the supernova. Using data from the CfA Supernova Archive, we measure the dependence of the light curve decay rate on redshift and place a bound on the time variation of G_F of |(dG_F/dt)/G_F| < 10^(-9) / y.

Ferrero, Alejandro



Guided Neuronal Growth on Arrays of Biofunctionalized GaAs/InGaAs Semiconductor Microtubes  

E-Print Network (OSTI)

We demonstrate embedded growth of cortical mouse neurons in dense arrays of semiconductor microtubes. The microtubes, fabricated from a strained GaAs/InGaAs heterostructure, guide axon growth through them and enable electrical and optical probing of propagating action potentials. The coaxial nature of the microtubes -- similar to myelin -- is expected to enhance the signal transduction along the axon. We present a technique of suppressing arsenic toxicity and prove the success of this technique by overgrowing neuronal mouse cells.

Cornelius S. Bausch; Aune Koitme; Eric Stava; Amanda Price; Pedro J. Resto; Yu Huang; David Sonnenberg; Yuliya Stark; Christian Heyn; Justin C. Williams; Erik W. Dent; Robert H. Blick


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Recent progress in InGaAsSb/GaSb TPV devices  

DOE Green Energy (OSTI)

AstroPower is developing InGaAsSb thermophotovoltaic (TPV) devices. This photovoltaic cell is a two-layer epitaxial InGaAsSb structure formed by liquid-phase epitaxy on a GaSb substrate. The (direct) bandgap of the In{sub 1{minus}x}Ga{sub x}As{sub 1{minus}y}Sb{sub y} alloy is 0.50 to 0.55 eV, depending on its exact alloy composition (x,y); and is closely lattice-matched to the GaSb substrate. The use of the quaternary alloy, as opposed to a ternary alloy--such as, for example InGaAs/InP--permits low bandgap devices optimized for 1,000 to 1,500 C thermal sources with, at the same time, near-exact lattice matching to the GaSb substrate. Lattice matching is important since even a small degree of lattice mismatch degrades device performance and reliability and increases processing complexity. Internal quantum efficiencies as high as 95% have been measured at a wavelength of 2 microns. At 1 micron wavelengths, internal quantum efficiencies of 55% have been observed. The open-circuit voltage at currents of 0.3 A/cm{sup 2} is 0.220 volts and 0.280 V for current densities of 2 A/cm{sup 2}. Fill factors of 56% have been measured at 60 mA/cm{sup 2}. However, as current density increases there is some decrease in fill factor. The results to date show that the GaSb-based quaternary compounds provide a viable and high performance energy conversion solution for thermophotovoltaic systems operating with 1,000 to 1,500 C source temperatures.

Shellenbarger, Z.A.; Mauk, M.G.; DiNetta, L.C. [AstroPower, Inc., Newark, DE (United States); Charache, G.W. [Lockheed Martin Corp., Schenectady, NY (United States)



Type Ia Supernova Properties as a Function of the Distance to the Host Galaxy in the SDSS-II SN Survey  

E-Print Network (OSTI)

We use type-Ia supernovae (SNe Ia) discovered by the SDSS-II SN Survey to search for dependencies between SN Ia properties and the projected distance to the host galaxy center, using the distance as a proxy for local galaxy properties (local star-formation rate, local metallicity, etc.). The sample consists of almost 200 spectroscopically or photometrically confirmed SNe Ia at redshifts below 0.25. The sample is split into two groups depending on the morphology of the host galaxy. We fit light-curves using both MLCS2k2 and SALT2, and determine color (AV, c) and light-curve shape (delta, x1) parameters for each SN Ia, as well as its residual in the Hubble diagram. We then correlate these parameters with both the physical and the normalized distances to the center of the host galaxy and look for trends in the mean values and scatters of these parameters with increasing distance. The most significant (at the 4-sigma level) finding is that the average fitted AV from MLCS2k2 and c from SALT2 decrease with the proj...

Galbany, Lluis; Ostman, Linda; Brown, Peter J; Cinabro, David; D'Andrea, Chris B; Frieman, Joshua; Jha, Saurabh W; Marriner, John; Nichol, Robert C; Nordin, Jakob; Olmstead, Matthew D; Sako, Masao; Schneider, Donald P; Smith, Mathew; Sollerman, Jesper; Pan, Kaike; Snedden, Stephanie; Bizyaev, Dmitry; Brewington, Howard; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Dan; Simmons, Audrey; Shelden, Alaina



GaSb/GaP compliant interface for high electron mobility AlSb/InAs heterostructures on (001) GaP  

Science Conference Proceedings (OSTI)

We report on the epitaxial growth of an AlSb/InAs heterostructure on a (001) GaP substrate. We investigate the conditions for the most efficient relaxation of GaSb islands on GaP. In particular, we show that the GaP surface treatment and the growth temperature are crucial for the formation of a two-dimensional periodic array of 90 deg. misfit dislocations at the episubstrate interface. With this relaxation process, an AlSb/InAs heterostructure exhibiting a room temperature mobility of 25 500 cm{sup 2} V{sup -1} s{sup -1} on GaP is demonstrated. This result paves the way to the integration of Sb-based devices on Si substrates through the use of GaP/Si templates.

El Kazzi, S.; Desplanque, L.; Coinon, C.; Wallart, X. [Institut d'Electronique, de Microelectronique, et de Nanotechnologie, UMR-CNRS 8520, BP 60069, 59652 Villeneuve d'Ascq Cedex (France); Wang, Y.; Ruterana, P. [CIMAP UMR 6252 CNRS-ENSICAEN-CEA-UCBN, 6, Boulevard du Marechal Juin, 14050 Caen Cedex (France)



GaNPAs Solar Cells Lattice-Matched To GaP: Preprint  

DOE Green Energy (OSTI)

This conference paper describes the III-V semiconductors grown on silicon substrates are very attractive for lower-cost, high-efficiency multijunction solar cells, but lattice-mismatched alloys that result in high dislocation densities have been unable to achieve satisfactory performance. GaNxP1-x-yAsy is a direct-gap III-V alloy that can be grown lattice-matched to Si when y= 4.7x - 0.1. We propose the use of lattice-matched GaNPAs on silicon for high-efficiency multijunction solar cells. We have grown GaNxP1-x-yAsy on GaP (with a similar lattice constant to silicon) by metal-organic chemical vapor phase epitaxy with direct band-gaps in the range of 1.5 to 2.0 eV. We demonstrate the performance of single-junction GaNxP1-x-yAsy solar cells grown on GaP substrates and discuss the prospects for the development of monolithic high-efficiency multijunction solar cells based on silicon substrates.

Geisz, J. F.; Friedman, D. J.; Kurtz, S.



Reactive codoping of GaAlInP compound semiconductors  

DOE Patents (OSTI)

A GaAlInP compound semiconductor and a method of producing a GaAlInP compound semiconductor are provided. The apparatus and method comprises a GaAs crystal substrate in a metal organic vapor deposition reactor. Al, Ga, In vapors are prepared by thermally decomposing organometallic compounds. P vapors are prepared by thermally decomposing phospine gas, group II vapors are prepared by thermally decomposing an organometallic group IIA or IIB compound. Group VIB vapors are prepared by thermally decomposing a gaseous compound of group VIB. The Al, Ga, In, P, group II, and group VIB vapors grow a GaAlInP crystal doped with group IIA or IIB and group VIB elements on the substrate wherein the group IIA or IIB and a group VIB vapors produced a codoped GaAlInP compound semiconductor with a group IIA or IIB element serving as a p-type dopant having low group II atomic diffusion.

Hanna, Mark Cooper (Boulder, CO); Reedy, Robert (Golden, CO)



Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)




Science Conference Proceedings (OSTI)

We use Type Ia supernovae (SNe Ia) discovered by the Sloan Digital Sky Survey-II SN Survey to search for dependencies between SN Ia properties and the projected distance to the host-galaxy center, using the distance as a proxy for local galaxy properties (local star formation rate, local metallicity, etc.). The sample consists of almost 200 spectroscopically or photometrically confirmed SNe Ia at redshifts below 0.25. The sample is split into two groups depending on the morphology of the host galaxy. We fit light curves using both MLCS2K2 and SALT2, and determine color (A{sub V} , c) and light-curve shape ({Delta}, x{sub 1}) parameters for each SN Ia, as well as its residual in the Hubble diagram. We then correlate these parameters with both the physical and the normalized distances to the center of the host galaxy and look for trends in the mean values and scatters of these parameters with increasing distance. The most significant (at the 4{sigma} level) finding is that the average fitted A{sub V} from MLCS2K2 and c from SALT2 decrease with the projected distance for SNe Ia in spiral galaxies. We also find indications that supernovae (SNe) in elliptical galaxies tend to have narrower light curves if they explode at larger distances, although this may be due to selection effects in our sample. We do not find strong correlations between the residuals of the distance moduli with respect to the Hubble flow and the galactocentric distances, which indicates a limited correlation between SN magnitudes after standardization and local host metallicity.

Galbany, Lluis; Miquel, Ramon; Oestman, Linda [Institut de Fisica d'Altes Energies, Universitat Autonoma de Barcelona, E-08193 Bellaterra (Barcelona) (Spain); Brown, Peter J.; Olmstead, Matthew D. [Department of Physics and Astronomy, University of Utah, Salt Lake City, UT 84112 (United States); Cinabro, David [Department of Physics and Astronomy, Wayne State University, Detroit, MI 48201 (United States); D'Andrea, Chris B.; Nichol, Robert C. [Institute of Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Burnaby Road, Portsmouth PO1 3FX (United Kingdom); Frieman, Joshua [Kavli Institute for Cosmological Physics, University of Chicago, 5640 South Ellise Avenue, Chicago, IL 60637 (United States); Jha, Saurabh W. [Department of Physics and Astronomy, Rutgers the State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Marriner, John [Center for Astrophysics, Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Nordin, Jakob [E.O. Lawrence Berkeley National Lab, 1 Cyclotron Rd., Berkeley, CA 94720 (United States); Sako, Masao [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Schneider, Donald P. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Smith, Mathew [Department of Physics, University of Western Cape, Bellville 7535, Cape Town (South Africa); Sollerman, Jesper [Oskar Klein Centre, Department of Astronomy, AlbaNova, SE-106 91 Stockholm (Sweden); Pan, Kaike; Snedden, Stephanie; Bizyaev, Dmitry; Brewington, Howard, E-mail: lluis.galbany@ist.utl.pt [Apache Point Observatory, P.O. Box 59, Sunspot, NM 88349 (United States); and others




SciTech Connect

Type Ia supernovae (SNe Ia) originate from the thermonuclear explosions of carbon-oxygen (C-O) white dwarfs (WDs). The single-degenerate scenario is a well-explored model of SNe Ia where unstable thermonuclear burning initiates in an accreting, Chandrasekhar-mass WD and forms an advancing flame. By several proposed physical processes, the rising, burning material triggers a detonation, which subsequently consumes and unbinds the WD. However, if a detonation is not triggered and the deflagration is too weak to unbind the star, a completely different scenario unfolds. We explore the failure of the gravitationally confined detonation mechanism of SNe Ia, and demonstrate through two-dimensional and three-dimensional simulations the properties of failed-detonation SNe. We show that failed-detonation SNe expel a few 0.1 M{sub Sun} of burned and partially burned material and that a fraction of the material falls back onto the WD, polluting the remnant WD with intermediate-mass and iron-group elements that likely segregate to the core forming a WD whose core is iron rich. The remaining material is asymmetrically ejected at velocities comparable to the escape velocity from the WD, and in response, the WD is kicked to velocities of a few hundred km s{sup -1}. These kicks may unbind the binary and eject a runaway/hypervelocity WD. Although the energy and ejected mass of the failed-detonation SN are a fraction of typical thermonuclear SNe, they are likely to appear as subluminous low-velocity SNe Ia. Such failed detonations might therefore explain or are related to the observed branch of peculiar SNe Ia, such as the family of low-velocity subluminous SNe (SN 2002cx/SN 2008ha-like SNe).

Jordan, George C. IV; Van Rossum, Daniel R. [Center for Astrophysical Thermonuclear Flashes, University of Chicago, Chicago, IL 60637 (United States); Perets, Hagai B. [Physics Department, Technion, Israel Institute of Technology, Haifa 32000 (Israel); Fisher, Robert T. [Department of Physics, University of Massachusetts Dartmouth, 285 Old Westport Road, North Dartmouth, MA 02740 (United States)



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Growth and photoluminescence of self-catalyzed GaP/GaNP core/shell nanowires on Si(111) by gas source molecular beam epitaxy  

Science Conference Proceedings (OSTI)

We report a study on self-catalyzed GaP/GaNP core/shell nanowires (NWs) grown on Si(111) by gas-source molecular beam epitaxy. Scanning electron microscopy images show that vertical and uniform GaP NWs and GaP/GaNP core/shell NWs are grown on Si(111). The density ranges from {approx}1 x 10{sup 7} to {approx}5 x 10{sup 8} cm{sup -2} across the substrate. Typical diameters are {approx}110 nm for GaP NWs and {approx}220 nm for GaP/GaNP NWs. Room temperature photoluminescence (PL) signal from the GaP/GaNP core/shell NWs confirms that N is incorporated in the shell and the average N content is {approx}0.9%. The PL low-energy tail is significantly reduced, compared to bulk GaNP.

Kuang, Y. J. [Department of Physics, University of California, San Diego, La Jolla, California 92093 (United States); Sukrittanon, S. [Graduate Program of Material Science and Engineering, University of California, San Diego, La Jolla, California 92093 (United States); Li, H. [Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, California 92093 (United States); Tu, C. W. [Graduate Program of Material Science and Engineering, University of California, San Diego, La Jolla, California 92093 (United States); Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, California 92093 (United States)



Mn-doped Ga(As,P) and (Al,Ga)As ferromagnetic semiconductors: Electronic structure calculations  

E-Print Network (OSTI)

A remarkable progress towards functional ferromagnetic semiconductor materials for spintronics has been achieved in p-type (Ga,Mn)As. Robust hole-mediated ferromagnetism has, however, been observed also in other III-V hosts such as antimonides, GaP, or (Al,Ga)As, which opens a wide area of possibilities for optimizing the host composition towards higher ferromagnetic Curie temperatures. Here we explore theoretically hole-mediated ferromagnetism and Mn incorporation in Ga(As,P) and (Al,Ga)As ternary hosts. While alloying (Ga,Mn)As with Al has only a small effect on the Curie temperature we predict a sizable enhancement of Curie temperatures in the smaller lattice constant Ga(As,P) hosts. Mn-doped Ga(As,P) is also favorable, as compared to (Al,Ga)As, with respect to the formation of carrier and moment compensating interstitial Mn impurities. In (Ga,Mn) (As,P) we find a marked decrease of the partial concentration of these detrimental impurities with increasing P content.

Masek, J.; Kudrnovsky, J.; Maca, F.; Sinova, Jairo; MacDonald, A. H.; Campion, R. P.; Gallagher, B. L.; Jungwirth, T.



A Measurement of the Rate of type-Ia Supernovae at Redshift $z\\approx$ 0.1 from the First Season of the SDSS-II Supernova Survey  

E-Print Network (OSTI)

We present a measurement of the rate of type Ia supernovae (SNe Ia) from the first of three seasons of data from the SDSS-II Supernova Survey. For this measurement, we include 17 SNe Ia at redshift $z\\le0.12$. Assuming a flat cosmology with $\\Omega_m = 0.3=1-\\Omega_\\Lambda$, we find a volumetric SN Ia rate of $[2.93^{+0.17}_{-0.04}({\\rm systematic})^{+0.90}_{-0.71}({\\rm statistical})] \\times 10^{-5} {\\rm SNe} {\\rm Mpc}^{-3} h_{70}^3 {\\rm year}^{-1}$, at a volume-weighted mean redshift of 0.09. This result is consistent with previous measurements of the SN Ia rate in a similar redshift range. The systematic errors are well controlled, resulting in the most precise measurement of the SN Ia rate in this redshift range. We use a maximum likelihood method to fit SN rate models to the SDSS-II Supernova Survey data in combination with other rate measurements, thereby constraining models for the redshift-evolution of the SN Ia rate. Fitting the combined data to a simple power-law evolution of the volumetric SN Ia rat...

Dilday, Benjamin; Frieman, J A; Holtzman, J; Marriner, J; Miknaitis, G; Nichol, R C; Romani, R; Sako, M; Bassett, B; Becker, A; Cinabro, D; De Jongh, F; Depoy, D L; Doi, M; Garnavich, P M; Hogan, C J; Jha, S; Konishi, K; Lampeitl, H; Marshall, J L; McGinnis, D; Prieto, J L; Riess, A G; Richmond, M W; Schneider, D P; Smith, M; Takanashi, N; Tokita, K; van der Heyden, K; Zheng, N Yasuda C; Barentine, J; Brewington, H; Choi, C; Crotts, A; Dembicky, J; Harvanek, M; Im, M; Ketzeback, W; Kleinman, S J; Krzesi?ski, J; Long, D C; Malanushenko, E; Malanushenko, V; McMillan, R J; Nitta, A; Pan, K; Saurage, G; Snedden, S A; Watters, S; Wheeler, J C; York, D



Temperature-Dependence of Exciton Radiative Recombination in (Al,Ga)N/GaN Quantum Wells Grown on a-Plane GaN Substrates  

E-Print Network (OSTI)

5221, 34095 Montpellier, France E-mail: pmc53@cam.ac.uk Received October 12, 2012; accepted November 22, 2012; published online May 20, 2013 This article presents the dynamics of excitons in a-plane (Al,Ga)N/GaN single quantum wells of various...

Corfdir, Pierre; Dussaigne, Amlie; Teisseyre, Henryk; Suski, Tadeusz; Grzegory, Izabella; Lefebvre, Pierre; Giraud, Etienne; Shahmohammadi, Mehran; Phillips, Richard; Ganire, Jean-Daniel; Grandjean, Nicolas; Deveaud, Benot


Growth orientation dependent photoluminescence of GaAsN alloys  

SciTech Connect

We report photoluminescence (PL) studies of both as-grown and electron-irradiated GaAsN epilayers on (311)A/B and (100) GaAs substrates. A long room-temperature (RT) PL lifetime, as well as an enhanced N incorporation, is observed in (311)B GaAsN epilayers as compared with (311)A and (100) samples. There is no direct correlation between the RT PL lifetime and the emission intensity from Ga vacancy complex detected at low temperature. The lifetime damage coefficient is relatively low for (311)B GaAsN. The irradiation-induced nonradiative recombination defects are suggested to be N- and/or As-related according to a geometrical analysis based on the tetrahedral coordination of GaAsN crystal.

Han, Xiuxun; Tanaka, Tomohiro; Kojima, Nobuaki; Ohshita, Yoshio; Yamaguchi, Masafumi [Toyota Technological Institute, 2-12-1 Hisakata, Tempaku, Nagoya 468-8511 (Japan); Sato, Shinichiro [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)



InGaAs and Ge MOSFETs with high ? dielectrics  

Science Conference Proceedings (OSTI)

InGaAs and Ge MOSFETs with high @k's are now the leading candidates for technology beyond the 15nm node CMOS. The UHV-Al"2O"3/Ga"2O"3(Gd"2O"3) [GGO]/InGaAs has low electrical leakage current densities, C-V characteristics with low interfacial densities ... Keywords: Atomic layer deposition, Germanium, High ? dielectrics, III-V Compound semiconductor, MOSFETs, Molecular beam epitaxy

W. C. Lee; P. Chang; T. D. Lin; L. K. Chu; H. C. Chiu; J. Kwo; M. Hong



Radiation Hard AlGaN Detectors and Imager  

Science Conference Proceedings (OSTI)

Radiation hardness of AlGaN photodiodes was tested using a 65 MeV proton beam with a total proton fluence of 3x10{sup 12} protons/cm{sup 2}. AlGaN Deep UV Photodiode have extremely high radiation hardness. These new devices have mission critical applications in high energy density physics (HEDP) and space explorations. These new devices satisfy radiation hardness requirements by NIF. NSTec is developing next generation AlGaN optoelectronics and imagers.




Effect of Temperature on GaGdO/GaN Metal Oxide Semiconductor Field Effect Transistors  

SciTech Connect

GaGdO was deposited on GaN for use as a gate dielectric in order to fabricate a depletion metal oxide semiconductor field effect transistor (MOSFET). This is the fmt demonstration of such a device in the III-Nitride system. Analysis of the effect of temperature on the device shows that gate leakage is significantly reduced at elevated temperature relative to a conventional metal semiconductor field effeet transistor (MESFET) fabricated on the same GaN layer. MOSFET device operation in fact improved upon heating to 400 C. Modeling of the effeet of temperature on contact resistance suggests that the improvement is due to a reduction in the parasitic resistances present in the device.

Abernathy, C.R.; Baca, A.; Chu, S.N.G.; Hong, M.; Lothian, J.R.; Marcus, M.A.; Pearton, S.J.; Ren, F.; Schurman, M.J.



Growth and Fabrication of GaN/AlGaN Heterojunction Bipolar Transistor  

SciTech Connect

A GaN/AlGaN heterojunction bipolar transistor structure with Mg doping in the base and Si Doping in the emitter and collector regions was grown by Metal Organic Chemical Vapor Deposition in c-axis Al(2)O(3). Secondary Ion Mass Spectrometry measurements showed no increase in the O concentration (2-3x10(18) cm(-3)) in the AlGaN emitter and fairly low levels of C (~4-5x10(17) cm (-3)) throughout the structure. Due to the non-ohmic behavior of the base contact at room temperature, the current gain of large area (~90 um diameter) devices was <3. Increasing the device operating temperature led to higher ionization fractions of the mg acceptors in the base, and current gains of ~10 were obtained at 300 degree C.

Abernathy, C.R.; Baca, A.G.; Cao, X.A.; Cho, H.; Dang, G.T.; Donovan, S.M.; Han, J.; Jung, K.B.; Pearton, S.J.; Ren, F.; Shul, R.J.; Willison, C.G.; Wilson, R.G.; Zhang, A.P.; Zhang, L



A InGaN/GaN quantum dot green ({lambda}=524 nm) laser  

SciTech Connect

The characteristics of self-organized InGaN/GaN quantum dot lasers are reported. The laser heterostructures were grown on c-plane GaN substrates by plasma-assisted molecular beam epitaxy and the laser facets were formed by focused ion beam etching with gallium. Emission above threshold is characterized by a peak at 524 nm (green) and linewidth of 0.7 nm. The lowest measured threshold current density is 1.2 kA/cm{sup 2} at 278 K. The slope and wall plug efficiencies are 0.74 W/A and {approx}1.1%, respectively, at 1.3 kA/cm{sup 2}. The value of T{sub 0}=233 K in the temperature range of 260-300 K.

Zhang Meng; Banerjee, Animesh; Lee, Chi-Sen; Hinckley, John M.; Bhattacharya, Pallab [Department of Electrical Engineering and Computer Science, Center for Nanoscale Photonics and Spintronics, University of Michigan, Ann Arbor, Michigan 48109-2122 (United States)



Evaluation of defects and degradation in GaAs-GaAlAs wafers using transmission cathodoluminescence  

Science Conference Proceedings (OSTI)

A large number of GaAs substrates GaAlAs double-heterostructure (DH) wafers, and high-radiance GaAlAs DH light-emitting diodes (LEDS) were evaluated using transmission cathodoluminescence (TCL). We show that only epitaxial wafers with a high defect density as revealed by TCL readily develop dark line defects (DLDs) with current injection, optical excitation, or electron beam excitation. Furthermore, in agreement with the previous work, the electron-beam-induced DLDs originate at dislocations and their growth requires minority-carrier injection. Based on these results, it is inferred that TCL can serve as a nondestructive screening technique for the selection of materials that produces a high yield of reliable LEDs.

Chin, A.K.; Keramidas, V.G.; Johnston, W.D. Jr.; Mahajan, S.; Roccasecca, D.D.


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GaInSb and GaInAsSb thermophotovoltaic device fabrication and characterization  

DOE Green Energy (OSTI)

Thermophotovoltaic (TPV) devices have been fabricated using epitaxial ternary and quaternary layers grown on GaSb substrates. The GaInSb layers were grown by organometallic vapor phase epitaxy (OMVPE) and the InGaAsSb lattice-matched layers were grown by liquid phase epitaxy (LPE). Device fabrication steps include unannealed p-type ohmic contacts, annealed Sn/Au n-type ohmic contacts, and a thick Ag top-surface contact using a lift-off process. Devices are characterized primarily by dark I-V, photo I-V, and quantum efficiency measurements, which are correlated to microscopic and macroscopic material properties. Particular emphasis has been on material enhancements to increase quantum efficiency and decrease dark saturation current density. TPV device performance is presently limited by the base diffusion length, typically 1 to 2 microns.

Hitchcock, C.; Gutmann, R.; Borrego, J.; Ehsani, H.; Bhat, I. [Rensselaer Polytechnic Inst., Troy, NY (United States); Freeman, M.; Charache, G. [Lockheed Martin, Inc., Schenectady, NY (United States)



Transport properties of InGaAs/GaAs Heterostructures with {delta}-doped quantum wells  

Science Conference Proceedings (OSTI)

The lateral transport of electrons in single- and double-well pseudomorphic GaAs/n-InGaAs/GaAs heterostructures with quantum wells 50-100 meV deep and impurity {delta}-layers in the wells, with concentrations in the range 10{sup 11} electron mobility with an increase in the impurity concentration. The results obtained indicate that the impurity-band electron states play an important role in the conductivity of these structures. Involvement of the impurity band also allows to explain adequately the characteristics of the conductivity of double-well structures; in contrast to single-well structures, band bending caused by asymmetric doping is of great importance. The numerical calculations of conductivity within the model under consideration confirm these suggestions.

Baidus, N. V. [Nizhni Novgorod State University, Physical-Technical Research Institute (Russian Federation); Vainberg, V. V. [National Academy of Sciences of Ukraine, Institute of Physics (Ukraine); Zvonkov, B. N. [Nizhni Novgorod State University, Physical-Technical Research Institute (Russian Federation); Pylypchuk, A. S., E-mail: pylypchuk@iop.kiev.ua; Poroshin, V. N.; Sarbey, O. G. [National Academy of Sciences of Ukraine, Institute of Physics (Ukraine)



P8, Fabrication of Subwavelength Pillar Arrays on GaAs by Confined ...  

Science Conference Proceedings (OSTI)

DD3, A New Approach to Make ZnO-Cu2O Heterojunctions for Solar Cells ... E2, AlGaAs/GaAs/GaN Wafer Fused HBTs with Ar Implanted Extrinsic Collectors.


II4, Compositionally-Graded Layers Composed of Tandem InGaAs ...  

Science Conference Proceedings (OSTI)

The specification of the 6 miscut is important because it provides step ..... of Metamorphic InGaP on GaAs and GaP for Wide-Bandgap Photovoltaic Junctions.


Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur


Highly Polarized Green Light Emitting Diode in m-Axis GaInN/GaN Shi You, Theeradetch Detchprohm, Mingwei Zhu  

E-Print Network (OSTI)

Highly Polarized Green Light Emitting Diode in m-Axis GaInN/GaN Shi You, Theeradetch Detchprohm in nonpolar light-emitting diodes (LEDs) covering the blue to green spectral range. In photo- luminescence, m's overall power efficiency. Linearly polarized light can be efficiently generated in GaInN/GaN-based light-emitting

Wetzel, Christian M.


Atomistic Modeling of Thermodynamic Properties of Pu-Ga Alloys ...  

Science Conference Proceedings (OSTI)

Atomistic Modeling of Thermodynamic Properties of Pu-Ga Alloys Based on the ... Resources for the Selection and Use of Interatomic Potentials in Atomistic...


GA Hot Cell D&D Closeout Report  

Office of Legacy Management (LM)

contractors supported the dismantlement including asbestos removal and concrete cutting, electrical, and HVAC. Project support functions were provided by GA organizations...


Light emission from InGaAs:Bi/GaAs quantum wells at 1.3 {mu}m  

Science Conference Proceedings (OSTI)

Highly strained InGaAs:Bi quantum wells (QWs) were grown on (001)-oriented GaAs substrates by molecular beam epitaxy (MBE). Photoluminescence (PL) reveals strong improvements in the optical properties evidenced by 10 times enhancement in PL intensity and extended emission wavelength up to 1.29 {mu}m when Bi is introduced to InGaAs/GaAs QWs. The improved optical quality results from the Bi surfactant effect as well as the Bi incorporation. Post growth thermal annealing shows that Bi atoms in InGaAs/GaAs QWs do not show good thermal stability at 650 Degree-Sign C and tend to diffuse out of the QWs resulting in large wavelength blue-shifts.

Ye Hong; Song Yuxin; Wang Shumin [Department of Microtechnology and Nanoscience, Chalmers University of Technology, Gothenburg SE-41296 (Sweden); Gu Yi [Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China)



Impact of the Ga/In ratio on the N incorporation into (In,Ga)(As,N) quantum dots  

Science Conference Proceedings (OSTI)

In this work, we demonstrate the dependence of the nitrogen incorporation on the Ga/In content into (In,Ga)(As,N) quantum dots (QDs) grown on GaAs (100) by radio-frequency plasma assisted molecular beam epitaxy (MBE). Morphological analysis by atomic force microscopy and cross-sectional transmission electron microscopy, together with an estimation of the transition thickness, monitored in situ during the growth, predict a maximum in the N incorporation for 30% Ga content. This result is confirmed by photoluminescence measurements of the as-grown and post-growth annealed samples. We attribute this behavior to a trade off between two mechanisms depending on the Ga/In content: one related to the stability of the Ga-N bond, and the other related to the surface strain and/or In segregation.

Gargallo-Caballero, R.; Guzman, A.; Ulloa, J. M.; Hierro, A. [Instituto de Sistemas Optoelectronicos y Microtecnologia (ISOM)-Departamento de Ingenieria Electronica, ETSI Telecomunicacion, Universidad Politecnica de Madrid, Ciudad Universitaria s/n, 28040 Madrid (Spain); Hopkinson, M. [Department of Electronic and Electrical Engineering, University of Sheffield, Sheffield S1 3JD (United Kingdom); Luna, E.; Trampert, A. [Paul Drude Institut fuer Festkoerperelektronik, Hausvogteiplatz 5-7, 10117 Berlin (Germany)



Bulk growth of GaSb and Ga{sub 1{minus}x}In{sub x}Sb  

DOE Green Energy (OSTI)

GaSb and InGaSb have been demonstrated to be suitable choices for high efficiency thermophotovoltaic (TPV) cells. Synthesis and growth of bulk GaSb single crystals and GaInSb polycrystals have been carried out by the vertical Bridgman technique, with a baffle immersed in the melt and by complete encapsulation of the melt by low melting temperature alkali halides or oxides. The critical roles of the baffle and the encapsulation are discussed. Efforts in obtaining device grade GaSb with superior structural and electrical properties and compositionally homogeneous GaInSb are described, emphasizing the key steps in the growth cycle developed to obtain good crystalline quality.

Dutta, P.S.; Ostrogorsky, A.G.; Gutmann, R.J.



Making the Standard Candle: A study of how the progenitor white dwarf modulates the peak luminosity of type Ia supernovae  

SciTech Connect

The goals of the proposed research as stated in the proposal were to: Build a suite of one-dimensional initial models of different metallicities and central densities. Using the improved flame capturing scheme, simulate the explosion of a white dwarf with embedded Lagrangian tracer particles, and post-process the thermal histories of the tracers to reconstruct the nucleosynthesis of the explosion. Survey the effects of a changing progenitor metallicity on the isotopic yields. Of particular interest is 1) whether the linear relation between the mass of 56Ni synthesized and the pro- genitor metallicity is moderated by the effect of electron captures in the core; and 2) how a varying central density alters the relation between metallicity and 56Ni mass. Using these results, examine how the observed metallicity distribution would affect the brightness distribution of SNe Ia and the isotopic ratios about the Fe-peak.

Brown, Edward F [Michigan State University



Determining the motion of the solar system relative to the cosmic microwave background using type Ia supernovae  

E-Print Network (OSTI)

We estimate the solar system motion relative to the cosmic microwave background using type Ia supernovae (SNe) measurements. We take into account the correlations in the error bars of the SNe measurements arising from correlated peculiar velocities. Without accounting for correlations in the peculiar velocities, the SNe data we use appear to detect the peculiar velocity of the solar system at about the 3.5 sigma level. However, when the correlations are correctly accounted for, the SNe data only detects the solar system peculiar velocity at about the 2.5 sigma level. We forecast that the solar system peculiar velocity will be detected at the 9 sigma level by GAIA and the 11 sigma level by the LSST. For these surveys we find the correlations are much less important as most of the signal comes from higher redshifts where the number density of SNe is insufficient for the correlations to be important.

Christopher Gordon; Kate Land; Anze Slosar



Effect of gas feeding methods on optical properties of GaN grown by rapid thermal chemical vapor deposition reactor  

Science Conference Proceedings (OSTI)

Keywords: Ga vacancies, GaN growth, gas feeding method, optical property, rapid thermal chemical vapor deposition (RTCVD), yellow luminescence

Sun Jung Kim; Young Hun Seo; Kee Suk Nahm; Yun Bong Hahn; Hyun Wook Shim; Eun-Kyung Suh; Kee Young Lim; Hyung Jae Lee



An inverted AlGaAs/GaAs patterned-Ge tunnel junction cascade concentrator solar cell  

DOE Green Energy (OSTI)

This report describes work to develop inverted-grown Al[sub 0.34]Ga[sub 0.66]As/GaAs cascades. Several significant developments are reported on as follows: (1) The AM1.5 1-sun total-area efficiency of the top Al[sub 0.34]Ga[sub 0.66]As cell for the cascade was improved from 11.3% to 13.2% (NREL measurement [total-area]). (2) The cycled'' organometallic vapor phase epitaxy growth (OMVPE) was studied in detail utilizing a combination of characterization techniques including Hall-data, photoluminescence, and secondary ion mass spectroscopy. (3) A technique called eutectic-metal-bonding (EMB) was developed by strain-free mounting of thin GaAs-AlGaAs films (based on lattice-matched growth on Ge substrates and selective plasma etching of Ge substrates) onto Si carrier substrates. Minority-carrier lifetime in an EMB GaAs double-heterostructure was measured as high as 103 nsec, the highest lifetime report for a freestanding GaAs thin film. (4) A thin-film, inverted-grown GaAs cell with a 1-sun AM1.5 active-area efficiency of 20.3% was obtained. This cell was eutectic-metal-bonded onto Si. (5) A thin-film inverted-grown, Al[sub 0.34]Ga[sub 0.66]As/GaAs cascade with AM1.5 efficiency of 19.9% and 21% at 1-sun and 7-suns, respectively, was obtained. This represents an important milestone in the development of an AlGaAs/GaAs cascade by OMVPE utilizing a tunnel interconnect and demonstrates a proof-of-concept for the inverted-growth approach.

Venkatasubramanian, R. (Research Triangle Inst., Research Triangle Park, NC (United States))



SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


Functional Imprinting Structures on GaN-Based Light-Emitting ...  

Science Conference Proceedings (OSTI)

Keywords: GaN, light-emitting diode (LED), imprinting technology, far-field pattern modulation, light extraction. 1. Introduction. GaN-based light-emitting diodes...


Bonding and gap states at GaAs-oxide interfaces  

Science Conference Proceedings (OSTI)

The nature of bonding and possible causes of Fermi level pinning at high mobility-high dielectric constant oxide GaAs:HfO"2 interfaces are discussed. It is argued that these are atoms with defective bonding, rather than states due to the bulk semiconductor ... Keywords: GaAs, bonding, interface

John Robertson; Liang Lin



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Elastic properties of Pu metal and Pu-Ga alloys  

Science Conference Proceedings (OSTI)

We present elastic properties, theoretical and experimental, of Pu metal and Pu-Ga ({delta}) alloys together with ab initio equilibrium equation-of-state for these systems. For the theoretical treatment we employ density-functional theory in conjunction with spin-orbit coupling and orbital polarization for the metal and coherent-potential approximation for the alloys. Pu and Pu-Ga alloys are also investigated experimentally using resonant ultrasound spectroscopy. We show that orbital correlations become more important proceeding from {alpha} {yields} {beta} {yields} {gamma} plutonium, thus suggesting increasing f-electron correlation (localization). For the {delta}-Pu-Ga alloys we find a softening with larger Ga content, i.e., atomic volume, bulk modulus, and elastic constants, suggest a weakened chemical bonding with addition of Ga. Our measurements confirm qualitatively the theory but uncertainties remain when comparing the model with experiments.

Soderlind, P; Landa, A; Klepeis, J E; Suzuki, Y; Migliori, A



Near ultraviolet emission from nonpolar cubic AlxGa1-xN/GaN quantum wells  

E-Print Network (OSTI)

Near ultraviolet emission from nonpolar cubic AlxGa1-xN/GaN quantum wells J. Schörmann,a S and multiple quantum wells. The well widths ranged from 2.5 to 7.5 nm. Samples were grown by rf-plasma assisted wells clear reflection high energy electron diffraction oscillations were observed indicating a two

As, Donat Josef


High Breakdown ( > \\hbox {1500 V} ) AlGaN/GaN HEMTs by Substrate-Transfer Technology  

E-Print Network (OSTI)

In this letter, we present a new technology to increase the breakdown voltage of AlGaN/GaN high-electron-mobility transistors (HEMTs) grown on Si substrates. This new technology is based on the removal of the original Si ...

Lu, Bin


Development of high power green light emitting diode dies in piezoelectric GaInN/GaN  

E-Print Network (OSTI)

Development of high power green light emitting diode dies in piezoelectric GaInN/GaN Christian in green light emitting diodes is one of the big challenges towards all-solid- state lighting. The prime,3], and commercialization [4,5] of high brightness light emitting diodes LEDs has led to a 1.82 Billion-$/year world market

Detchprohm, Theeradetch


Wavelength-resolved low-frequency noise of GaInN/GaN green light emitting diodes  

E-Print Network (OSTI)

Wavelength-resolved low-frequency noise of GaInN/GaN green light emitting diodes S. L. Rumyantseva well light emitting diodes. The light intensity noise was measured as a function of wavelength within the light emitting diode spectral emission line. The spectral noise density is found to increase

Wetzel, Christian M.


Lasing characteristics of GaSb/GaAs self-assembled quantum dots embedded in an InGaAs quantum well  

E-Print Network (OSTI)

be applicable to light sources in fiber-optic communication systems.13 However, there have been no reports intriguing optoelectronic device possibilities on GaAs substrates including lasers, detectors, or solar cells

Jalali. Bahram


Structural and optical studies of nitrogen incorporation into GaSb-based GaInSb quantum wells  

Science Conference Proceedings (OSTI)

We investigate the incorporation of nitrogen into (Ga,In)Sb grown on GaSb and report room temperature photoluminescence from GaInSb(N) quantum wells. X-ray diffraction and channeling nuclear reaction analysis, together with Rutherford backscattering, were employed to identify the optimal molecular beam epitaxial growth conditions that minimized the incorporation of non-substitutional nitrogen into GaNSb. Consistent with this hypothesis, GaInSb(N) quantum wells grown under the conditions that minimized non-substitutional nitrogen exhibited room temperature photoluminescence, indicative of significantly improved radiative efficiency. Further development of this material system could enable type-I laser diodes emitting throughout the (3-5 {mu}m) wavelength range.

Nair, Hari P.; Crook, Adam M.; Bank, Seth R. [Microelectronics Research Center, Electrical and Computer Engineering, University of Texas at Austin, 10100 Burnet Rd, Austin, Texas 78712 (United States); Yu, Kin M. [Electronic Materials Program, Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)



GaSb/GaAs quantum dot formation and demolition studied with cross-sectional scanning tunneling microscopy  

Science Conference Proceedings (OSTI)

We present a cross-sectional scanning tunneling microscopy study of GaSb/GaAs quantum dots grown by molecular beam epitaxy. Various nanostructures are observed as a function of the growth parameters. During growth, relaxation of the high local strain fields of the nanostructures plays an important role in their formation. Pyramidal dots with a high Sb content are often accompanied by threading dislocations above them. GaSb ring formation is favored by the use of a thin GaAs first cap layer and a high growth temperature of the second cap layer. At these capping conditions, strain-driven Sb diffusion combined with As/Sb exchange and Sb segregation remove the center of a nanostructure, creating a ring. Clusters of GaSb without a well defined morphology also appear regularly, often with a highly inhomogeneous structure which is sometimes divided up in fragments.

Smakman, E. P.; Garleff, J. K.; Rambabu, P.; Koenraad, P. M. [Department of Applied Physics, Eindhoven University of Technology, Eindhoven 5612 AZ (Netherlands); Young, R. J.; Hayne, M. [Department of Physics, Lancaster University, Lancaster LA1 4YB (United Kingdom)



Effect of Sb on the Properties of GaInP Top Cells (Presentation)  

DOE Green Energy (OSTI)

The summary of this report is that: (1) Sb can be used to increase V{sub oc} of a GaInP top cell; (2) the photovoltaic quality of GaInP is relatively unaffected by the presence of Sb; and (3) Sb-doped GaInP/GaAs tandem cells show promise for achieving efficiencies over 32%.

Olson, J. M.; McMahon, W. E.; Kurtz, S.



Dielectrics for GaN based MIS-diodes  

SciTech Connect

GaN MIS diodes were demonstrated utilizing AlN and Ga{sub 2}O{sub 3}(Gd{sub 2}O{sub 3}) as insulators. A 345 {angstrom} of AlN was grown on the MOCVD grown n-GaN in a MOMBE system using trimethylamine alane as Al precursor and nitrogen generated from a wavemat ECR N2 plasma. For the Ga{sub 2}O{sub 3}(Gd{sub 2}O{sub 3}) growth, a multi MBE chamber was used and a 195 {angstrom} oxide is E-beam evaporated from a single crystal source of Ga{sub 5}Gd{sub 3}O{sub 12}. The forward breakdown voltage of AlN and Ga{sub 2}O{sub 3}(Gd{sub 2}O{sub 3}) diodes are 5V and 6V, respectively, which are significantly improved from {approximately} 1.2 V of schottky contact. From the C-V measurements, both kinds of diodes showed good charge modulation from accumulation to depletion at different frequencies. The insulator GaN interface roughness and the thickness of the insulator were measured with x-ray reflectivity.

Ren, F.; Abernathy, C.R.; MacKenzie, J.D. [Univ. of Florida, Gainesville, FL (United States)] [and others




Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A localised subgrid scale model for fluid dynamical simulations in astrophysics II: Application to type Ia supernovae  

E-Print Network (OSTI)

The dynamics of the explosive burning process is highly sensitive to the flame speed model in numerical simulations of type Ia supernovae. Based upon the hypothesis that the effective flame speed is determined by the unresolved turbulent velocity fluctuations, we employ a new subgrid scale model which includes a localised treatment of the energy transfer through the turbulence cascade in combination with semi-statistical closures for the dissipation and non-local transport of turbulence energy. In addition, subgrid scale buoyancy effects are included. In the limit of negligible energy transfer and transport, the dynamical model reduces to the Sharp-Wheeler relation. According to our findings, the Sharp-Wheeler relation is insuffcient to account for the complicated turbulent dynamics of flames in thermonuclear supernovae. The application of a co-moving grid technique enables us to achieve very high spatial resolution in the burning region. Turbulence is produced mostly at the flame surface and in the interior ash regions. Consequently, there is a pronounced anisotropy in the vicinity of the flame fronts. The localised subgrid scale model predicts significantly enhanced energy generation and less unburnt carbon and oxygen at low velocities compared to earlier simulations.

W. Schmidt; J. C. Niemeyer; W. Hillebrandt; F. K. Roepke



Early and late time VLT spectroscopy of SN 2001el - progenitor constraints for a type Ia supernova  

E-Print Network (OSTI)

We present early time high-resolution (VLT/UVES) and late time low-resolution (VLT/FORS) optical spectra of the normal type Ia supernova, SN 2001el. The high-resolution spectra were obtained 9 and 2 days before (B-band) maximum light in order to detect narrow hydrogen and/or helium emission lines from the SN CSM. No such lines were detected in our data. We therefore use photoionisation models to derive upper limits of 1x10^-5 and 6x10^-5 Msol/yr, assuming wind velocities of 10 and 50 km/s, respectively, for the mass loss rate from the progenitor system of SN 2001el. This excludes a symbiotic star in the upper mass loss rate regime from being the progenitor of SN 2001el. The low-resolution spectrum was obtained in the nebular phase of the supernova, \\~400 days after the maximum light, to search for any hydrogen rich gas originating from the SN progenitor system. However, we see no signs of Balmer lines in our spectrum. Therefore, we model the late time spectra to derive an upper limit of ~0.03 Msol for solar a...

Mattila, S; Sollerman, J; Kozma, C; Baron, E; Fransson, C; Leibundgut, B; Nomoto, K



lntersubbancl transitions in high indium content InGaAs/AIGaAs quantum wells  

E-Print Network (OSTI)

lntersubbancl transitions in high indium content InGaAs/AIGaAs quantum wells H. C. Chui, S. M. Lord report the first observation of intersubband transitions in In,Ga, -#s(y=O.3,0.5)/ AlGaAs quantum wells. These quantum wells were grown on a GaAs substrate with a linearly graded InGaAs buffer to achieve strain

Fejer, Martin M.


Atomic hydrogen cleaning of polarized GaAs photocathodes  

DOE Green Energy (OSTI)

Atomic hydrogen cleaning followed by heat cleaning at 450 C was used to prepare negative-electron-affinity GaAs photocathodes. When hydrogen ions were eliminated, quantum efficiencies of 15% were obtained for bulk GaAs cathodes, higher than the results obtained using conventional 600 C heat cleaning. The low-temperature cleaning technique was successfully applied to thin, strained GaAs cathodes used for producing highly polarized electrons. No depolarization was observed even when the optimum cleaning time of about 30 seconds was extended by a factor of 100.

Maruyama, Takashi



Outdoor Testing of GaInP2/GaAs Tandem Cells with Top Cell Thickness Varied  

DOE Green Energy (OSTI)

In this study, we measure the performance of GaInP2/GaAs tandem cells under direct beam sunlight outdoors in order to quantify their sensitivity to both spectral variation and GaInP2 top-cell thickness. A set of cells with five different top-cell thicknesses was mounted on a two-axis tracker with the incident sunlight collimated to exclude all except the direct beam. Current-voltage (I-V) curves were taken throughout the course of several days, along with measurements of the direct solar spectrum. Our two major conclusions are: (1) GaInP2/GaAs tandem cells designed for either the ASTM G-173 direct (G-173D) spectrum or the "air mass 1.5 global" (AM1.5G) spectrum perform the best, and (2) cells can be characterized indoors and modeled using outdoor spectra with the same result. These results are equally valid for GaInP2/GaAs/Ge triple-junction cells.

McMahon, W. E.; Emergy, K. E.; Friedman, D. J.; Ottoson, L.; Young, M. S.; Ward, J. S.; Kramer, C. M.; Duda, A.; Kurtz, S.



On-Sun Comparison of GaInP2/GaAs Tandem Cells with Top Cell Thickness Varied  

DOE Green Energy (OSTI)

This study compares the on-sun performance of a set of GaInP2/GaAs tandem cells with different GaInP2 top-cell thicknesses. Because high-efficiency III-V cells are best suited to concentrating photovoltaic (CPV) applications, the cells were mounted on a two-axis tracker with the incident sunlight collimated to exclude all except the direct beam. Current-voltage (I-V) curves were taken throughout the course of several days, along with measurements of the direct solar spectrum. Our two major conclusions are: (1) GaInP2/GaAs tandem cells designed for an ''air mass 1.5 global'' (AM 1.5G) or a ''low aerosol optical depth'' (Low AOD) spectrum perform the best, and (2) cells can be characterized indoors and modeled using outdoor spectra to predict the correct result. These results are equally valid for GaInP2/GaAs/Ge triple-junction cells.

McMahon, W. E.; Emery, K. E.; Friedman, D. J.; Ottoson, L.; Young, M. S.; Ward, J. S.; Kramer, C. M.; Duda, A.; Kurtz, S.



Realization of compressively strained GaN films grown on Si(110) substrates by inserting a thin AlN/GaN superlattice interlayer  

Science Conference Proceedings (OSTI)

We investigate the strain properties of GaN films grown by plasma-assisted molecular beam epitaxy on Si(110) substrates. It is found that the strain of the GaN film can be converted from a tensile to a compressive state simply by inserting a thin AlN/GaN superlattice structure (SLs) within the GaN film. The GaN layers seperated by the SLs can have different strain states, which indicates that the SLs plays a key role in the strain modulation during the growth and the cooling down processes. Using this simple technique, we grow a crack-free GaN film exceeding 2-{mu}m-thick. The realization of the compressively strained GaN film makes it possible to grow thick GaN films without crack generation on Si substrates for optic and electronic device applications.

Shen, X. Q.; Takahashi, T.; Kawashima, H.; Ide, T.; Shimizu, M. [Advanced Power Electronics Research Center, National Institute of Advanced Industrial Science and Technology (AIST), Umezono 1-1-1, Central 2, Tsukuba-shi, Ibaraki 305-8568 (Japan)



Fabrication of Two-Dimensional Photonic Crystals in AlGaInP/GaInP Membranes by Inductively Coupled Plasma Etching  

E-Print Network (OSTI)

The fabrication process of two-dimensional photonic crystals in an AlGaInP/GaInP multi-quantum-well membrane structure is developed. The process includes high resolution electron-beam lithography, pattern transfer into ...

Chen, A.


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



FUPWG Meeting Agenda - Atlanta, GA | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Atlanta, GA Atlanta, GA FUPWG Meeting Agenda - Atlanta, GA October 7, 2013 - 3:16pm Addthis Energy on My Mind / FUPWG / Atlanta, GA / May 3-4, 2006 Hosted by: AGL Resources Logo May 3-4, 2006 Hosted by AGL Resources Atlanta, Georgia Tuesday, May 2, 2006 5:00 - 6:30 Steering Committee meeting in the Danube Tigris Room 6:30 until... Networking dinner at the Marriott Wednesday, May 3, 2006 7:45 am Registration/Continental Breakfast 8:30 - 8:45 Welcome from Suzanne Sitherwood, SVP, Southern Operations, President, Atlanta Gas Light, Chattanooga Gas & Florida City Gas 8:45 - 9:00 FEMP Southeast Regional Office Welcome Traci Leath, FEMP 9:00 - 9:45 Washington Update David McAndrew, FEMP 9:45 - 10:15 Break - Networking 10:15 - 11:20 Navy Technical Program Update Paul Kistler, U.S. Navy


Elba Island, GA Liquefied Natural Gas Imports from Qatar (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Liquefied Natural Gas Imports from Qatar (Million Cubic Feet) Elba Island, GA Liquefied Natural Gas Imports from Qatar (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep...


Lattice vibrations of pure and doped GaSe  

Science Conference Proceedings (OSTI)

The Bridgman method is used to grow especially undoped and doped single crystals of GaSe. Composition and impurity content of the grown crystals were determined using X-ray fluorescence (XRF) method. X-ray diffraction, Raman scattering, photoluminescence (PL), and IR transmission measurements were performed at room temperature. The long wavelength lattice vibrations of four modifications of GaSe were described in the framework of modified one-layer linear-chain model which also takes into consideration the interaction of the selenium (Se) atom with the second nearest neighbor gallium (Ga) atom in the same layer. The existence of an eight-layer modification of GaSe is suggested and the vibrational frequencies of this modification are explained in the framework of a lattice dynamical model considered in the present work. Frequencies and the type of vibrations (gap, local, or resonance) for the impurity atoms were calculated and compared with the experimental results.

Allakhverdiev, K. [Materials Institute, Marmara Research Center, TUBITAK, Gebze/Kocaeli 41470 (Turkey) and Institute of Physics, Azerbaijan National Academy of Sciences, Baku AZ1143 (Azerbaijan)]. E-mail: kerim.allahverdi@mam.gov.tr; Baykara, T. [Materials Institute, Marmara Research Center, TUBITAK, Gebze/Kocaeli 41470 (Turkey); Ellialtioglu, S. [Department of Physics, Middle East Technical University, Ankara 06531 (Turkey); Hashimzade, F. [Institute of Physics, Azerbaijan National Academy of Sciences, Baku AZ1143 (Azerbaijan); Huseinova, D. [Institute of Physics, Azerbaijan National Academy of Sciences, Baku AZ1143 (Azerbaijan); Kawamura, K. [Institute of Materials Science, University of Tsukuba 305-8573 (Japan); Kaya, A.A. [Materials Institute, Marmara Research Center, TUBITAK, Gebze/Kocaeli 41470 (Turkey); Kulibekov, A.M. [Department of Physics, Mugla University, Mugla 48000 (Turkey); Onari, S. [Institute of Materials Science, University of Tsukuba 305-8573 (Japan)



Preparation of GaAs photocathodes at low temperature  

SciTech Connect

The preparation of an atomically clean surface is a necessary step in the formation of negative electron affinity (NEA) GaAs. Traditional methods to this end include cleaving, heat cleaning and epitaxial growth. Cleaving has the advantage of yielding a fresh surface after each cleave, but is limited to small areas and is not suitable for specialized structures. Heat cleaning is both simple and highly successful, so it is used as a preparation method in virtually all laboratories employing a NEA source on a regular basis. Due to its high cost and complexity, epitaxial growth of GaAs with subsequent in vacuo transfer is not a practical solution for most end users of GaAs as a NEA electron source. While simple, the heating cleaning process has a number of disadvantages. Here, a variety of cleaning techniques related to preparation of an atomically clean GaAs surface without heating to 600 C are discussed and evaluated.

Mulhollan, G.; Clendenin, J.; Tang, H.



HH5, Antiferromagnetic Interlayer Exchange Couplings in Ga  

Science Conference Proceedings (OSTI)

Author(s), Sun Jae Chung, Sanghoon Lee, Brian J. Kirby, Julie A. Borchers, ... LATE NEWS: KK3, Non-Catalytic Synthesis of GaN Nanostructures at Low...


Micro Raman Spectroscopy of Annealed Erbium Implanted GaN  

E-Print Network (OSTI)

Wurtzite GaN epilayers grown by metal organic chemical vapor deposition on sapphire substrates were subsequently ion implanted with Er to a dose of 510? cm?. The implanted samples were annealed in nitrogen atmosphere ...

Vajpeyi, Agam P.


GaAs Films Prepared by RF-Magnetron Sputtering  

DOE Green Energy (OSTI)

The authors reported on the optical absorption, adhesion, and microstructure of RF-magnetron sputtered films of hydrogenated amorphous and microcrystalline GaAs films for the 1 to 25 {micro}m infrared wavelength rate. Sputtering parameters which were varied include sputtering power, temperature and pressure, and hydrogen sputtering-gas concentration. TEM results show a sharp transition from purely amorphous GaAs to a mixture of microcrystalline GaAs in an amorphous matrix at 34 {+-} 2 C. By optimizing the sputtering parameters, the optical absorption coefficient can be decreased below 100 cm{sup -1} for wavelengths greater than about 1.25 {micro}m. These results represent the lowest reported values of optical absorption for sputtered films of GaAs directly measured by spectrophotometry for the near-infrared wavelength region.

L.H. Ouyang; D.L. Rode; T. Zulkifli; B. Abraham-Shrauner; N. Lewis; M.R. Freeman



Elba Island, GA Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Equatorial Guinea (Million Cubic Feet) Elba Island, GA Natural Gas Liquefied Natural Gas Imports from Equatorial Guinea (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3...


Elba Island, GA Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Nigeria (Million Cubic Feet) Elba Island, GA Natural Gas Liquefied Natural Gas Imports from Nigeria (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Cathodoluminescence Microanalysis of Suspended GaN Nano ...  

Science Conference Proceedings (OSTI)

CL from bulk GaN is dominated by the ~3.4 eV near-band-edge emission. In contrast, the suspended nano-membranes emit a broad defect associated emission...


BB2, Novel Cs-Free GaN Photocathodes  

Science Conference Proceedings (OSTI)

L6, PECVD-SiN, Si or Si/Al2O3-Capped ED-Mode AlN/GaN Inverters Hide details for [

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Elba Island, GA Natural Gas Liquefied Natural Gas Imports from...  

Gasoline and Diesel Fuel Update (EIA)

Trinidad and Tobago (Million Cubic Feet) Elba Island, GA Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul...


Elba Island, GA Natural Gas Liquefied Natural Gas Imports from...  

Gasoline and Diesel Fuel Update (EIA)

Egypt (Million Cubic Feet) Elba Island, GA Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 5,780...


Elba Island, GA Liquefied Natural Gas Total Imports (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Liquefied Natural Gas Total Imports (Million Cubic Feet) Elba Island, GA Liquefied Natural Gas Total Imports (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...


Thermal carrier emission and nonradiative recombinations in nonpolar (Al,Ga)N/GaN quantum wells grown on bulk GaN  

Science Conference Proceedings (OSTI)

We investigate, via time-resolved photoluminescence, the temperature-dependence of charge carrier recombination mechanisms in nonpolar (Al,Ga)N/GaN single quantum wells (QWs) grown via molecular beam epitaxy on the a-facet of bulk GaN crystals. We study the influence of both QW width and barrier Al content on the dynamics of excitons in the 10-320 K range. We first show that the effective lifetime of QW excitons {tau} increases with temperature, which is evidence that nonradiative mechanisms do not play any significant role in the low-temperature range. The temperature range for increasing {tau} depends on the QW width and Al content in the (Al,Ga)N barriers. For higher temperatures, we observe a reduction in the QW emission lifetime combined with an increase in the decay time for excitons in the barriers, until both exciton populations get fully thermalized. Based on analysis of the ratio between barrier and QW emission intensities, we demonstrate that the main mechanism limiting the radiative efficiency in our set of samples is related to nonradiative recombination in the (Al,Ga)N barriers of charge carriers that have been thermally emitted from the QWs.

Corfdir, P.; Dussaigne, A.; Giraud, E.; Ganiere, J.-D.; Grandjean, N.; Deveaud-Pledran, B. [Institute of Condensed Matter Physics, Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Teisseyre, H. [Institute of Physics, Polish Academy of Sciences, 02-668 Warsaw (Poland); Institute of High Pressure Physics, Polish Academy of Sciences, 01-142 Warsaw (Poland); Suski, T.; Grzegory, I. [Institute of High Pressure Physics, Polish Academy of Sciences, 01-142 Warsaw (Poland); Lefebvre, P. [Laboratoire Charles Coulomb - UMR5221 - CNRS - Universite Montpellier 2, 34095 Montpellier (France)



Modeling of InGaSb thermophotovoltaic cells and materials  

DOE Green Energy (OSTI)

A closed form computer program has been developed for the simulation and optimization of In{sub x}Ga{sub 1{minus}x}Sb thermophotovoltaic cells operating at room temperature. The program includes material parameter models of the energy bandgap, optical absorption constant, electron and hole mobility, intrinsic carrier concentration and index of refraction for any composition of GaInSb alloys.

Zierak, M.; Borrego, J.M.; Bhat, I.; Gutmann, R.J. [Rensselaer Polytechnic Inst., Troy, NY (United States); Charache, G. [Lockheed Martin, Inc., Schenectady, NY (United States)



SEU design consideration for MESFETs on LT GaAs  

SciTech Connect

Computer simulation results are reported on transistor design and single-event charge collection modeling of metal-semiconductor field effect transistors (MESFETs) fabricated in the Vitesse H-GaAsIII{reg_sign} process on Low Temperature grown (LT) GaAs epitaxial layers. Tradeoffs in Single Event Upset (SEU) immunity and transistor design are discussed. Effects due to active loads and diffusion barriers are examined.

Weatherford, T.R.; Radice, R.; Eskins, D. [Naval Postgraduate School, Monterey, CA (United States)] [and others



Influence of defect formation as a result of incorporation of a Mn {delta} layer on the photosensitiviy spectrum of InGaAs/GaAs quantum wells  

Science Conference Proceedings (OSTI)

The influence of defect formation upon the deposition of a Mn {delta} layer and a GaAs coating layer (with the use of laser evaporation) on the photosensitivity spectra of heterostructures with InGaAs/GaAs quantum wells located in the near-surface region has been studied.

Gorshkov, A. P., E-mail: gorskovap@phys.unn.ru; Karpovich, I. A.; Pavlova, E. D.; Kalenteva, I. L. [Lobachevsky State University of Nizhny Novgorod (Russian Federation)



Charge Profiling of the p-AlGaN Electron Blocking Layer in AlGaInN Light Emitting Diode Structures  

E-Print Network (OSTI)

Charge Profiling of the p-AlGaN Electron Blocking Layer in AlGaInN Light Emitting Diode Structures, U.S.A. ABSTRACT Characterization of operational AlGaInN heterostructure light emitting diodes (LEDs the device lifetime in a non-destructive mode. INTRODUCTION Group ­ III nitride light emitting diodes (LEDs

Wetzel, Christian M.



Science Conference Proceedings (OSTI)

The nature of the progenitor systems of Type Ia supernovae is still uncertain. One way to distinguish between the single-degenerate scenario and double-degenerate scenario is to search for the post-impact remnant star. To examine the characteristics of the post-impact remnant star, we have carried out three-dimensional hydrodynamic simulations of supernova impacts on main-sequence-like stars. We explore the evolution of the post-impact remnants using the stellar evolution code MESA. We find that the luminosity and radius of the remnant star dramatically increase just after the impact. After the explosion, post-impact companions continue to expand on a progenitor-dependent timescale of {approx}10{sup 2.5}-10{sup 3} years before contracting. It is found that the time evolution of the remnant star is dependent not only on the amount of energy absorbed but also on the depth of the energy deposition. We examine the viability of the candidate star Tycho G as the possible remnant companion in Tycho's supernova by comparing it to the evolved post-impact remnant stars in our simulations. The closest model in our simulations has a similar effective temperature, but the luminosity and radius are twice as large. By examining the angular momentum distribution in our simulations, we find that the surface rotational speed could drop to {approx}10 km s{sup -1} if the specific angular momentum is conserved during the post-impact evolution, implying that Tycho G cannot be completely ruled out because of its low surface rotation speed.

Pan, Kuo-Chuan; Ricker, Paul M. [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States); Taam, Ronald E., E-mail: kpan2@illinois.edu, E-mail: pmricker@illinois.edu, E-mail: taam@northwestern.edu [Department of Physics and Astronomy, Northwestern University, 2145 Sheridan Road, Evanston, IL 60208 (United States)



Excitons in single and double GaAs/AlGaAs/ZnSe/Zn(Cd)MnSe heterovalent quantum wells  

Science Conference Proceedings (OSTI)

Exciton photoluminescence spectra, photoluminescence excitation spectra, and magnetophotoluminescence spectra of single (GaAs/AlGaAs/ZnMnSe) and double (GaAs/AlGaAs/ZnSe/ZnCdMnSe) heterovalent quantum wells formed by molecular beam epitaxy are studied. It is shown that the exciton absorption spectrum of such quantum wells mainly reproduces the resonant exciton spectrum expected for usual quantum wells with similar parameters, while the radiative exciton recombination have substantial distinctions, in particular the additional localization mechanism determined by defects generated by heterovalent interface exists. The nature of these localization centers is not currently clarified; their presence leads to broadening of photoluminescence lines and to an increase in the Stokes shift between the peaks of luminescence and absorption, as well as determining the variation in the magnetic g factor of bound exciton complexes.

Toropov, A. A., E-mail: toropov@beam.ioffe.ru; Kaibyshev, V. Kh.; Terent'ev, Ya. V.; Ivanov, S. V.; Kop'ev, P. S. [Russian Academy of Sciences, Ioffe Physical Technical Institute (Russian Federation)



Optical anisotropy of GaSb type-II nanorods on vicinal (111)B GaAs  

SciTech Connect

We form self-assembled GaSb type-II nanorods on a vicinal (111)B GaAs substrate by molecular beam epitaxy and study their optical anisotropy. The GaSb nanorods are elongated and aligned along the [-1 0 1] direction, where the average length, width, and height are about 84, 30, and 2.5 nm. In polarized photoluminescence (PL) measurements, the peak of the GaSb nanorods is observed at about 1.1 eV, where the PL intensity is largest for the [-1 0 1] polarization and smallest for the polarization perpendicular to it. The degree of polarization is more than 20% and depends on the recombination energy. By comparing with a theoretical model based on 4 x 4 Luttinger-Kohn Hamiltonian, we find that the experimental results are explained by considering the Sb/As inter-diffusion and the nanorod height distribution.

Kawazu, Takuya; Noda, Takeshi; Mano, Takaaki; Sakuma, Yoshiki [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Akiyama, Yoshihiro [Toyota Technological Institute, 2-12-1 Hisakata, Tempaku-ku, Nagoya (Japan); Sakaki, Hiroyuki [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Toyota Technological Institute, 2-12-1 Hisakata, Tempaku-ku, Nagoya (Japan)



EE9, MBE Grown InGaAsSbN/GaSb Single Quantum Wells for Mid ...  

Science Conference Proceedings (OSTI)

I4, Electrical Spin Injection in a Hybrid Organic/Inorganic Spin-Polarized Light Emitting Diode (Spin-LED) I5, Properties of MnAs/GaMnAs/MnAs Magnetic...


Mechanism for radiative recombination and defect properties of GaP/GaNP core/shell nanowires  

SciTech Connect

Recombination processes in GaP/GaNP core/shell nanowires (NWs) grown on a Si substrate by molecular beam epitaxy are examined using a variety of optical characterization techniques, including cw- and time-resolved photoluminescence and optically detected magnetic resonance (ODMR). Superior optical quality of the structures is demonstrated based on the observation of intense emission from a single NW at room temperature. This emission is shown to originate from radiative transitions within N-related localized states. From ODMR, growth of GaP/GaNP NWs is also found to facilitate formation of complex defects containing a P atom at its core that act as centers of competing non-radiative recombination.

Dobrovolsky, A.; Stehr, J. E.; Chen, S. L.; Chen, W. M.; Buyanova, I. A. [Department of Physics, Chemistry and Biology, Linkoeping University, S-581 83 Linkoeping (Sweden); Kuang, Y. J. [Department of Physics, University of California, La Jolla, California 92093 (United States); Sukrittanon, S. [Graduate Program of Materials Science and Engineering, La Jolla, California 92093 (United States); Tu, C. W. [Department of Electrical and Computer Engineering, University of California, La Jolla, California 92093 (United States)



II3, 2?m Thick Device Quality GaN on Si(111) Using AlGaN Graded ...  

Science Conference Proceedings (OSTI)

I4, Electrical Spin Injection in a Hybrid Organic/Inorganic Spin-Polarized Light Emitting Diode (Spin-LED) I5, Properties of MnAs/GaMnAs/MnAs Magnetic...


JJ1, Internal Quantum Efficiency of Polar and Non-Polar GaInN/GaN ...  

Science Conference Proceedings (OSTI)

I4, Electrical Spin Injection in a Hybrid Organic/Inorganic Spin-Polarized Light Emitting Diode (Spin-LED) I5, Properties of MnAs/GaMnAs/MnAs Magnetic...


Reducing the efficiency droop by lateral carrier confinement in InGaN/GaN quantum-well nanorods  

E-Print Network (OSTI)

Efficiency droop is a major obstacle facing high-power application of InGaN/GaN quantum-well (QW) light-emitting diodes. In this letter, we report the suppression of efficiency droop induced by density-activated defect recombination in nanorod structure of a-plane InGaN/GaN QWs. In the high carrier density regime, the retained emission efficiency in a dry-etched nanorod sample is observed to be over two times higher than that in its parent QW sample. We further argue that the improvement is a combined effect of the amendment contributed by lateral carrier confinement and the deterioration made by surface trapping.

Shi, Chentian; Yang, Fan; Park, Min Joo; Kwak, Joon Seop; Jung, Sukkoo; Choi, Yoon-Ho; Wang, Xiaoyong; Xiao, Min



SnO2-gated AlGaN/GaN high electron mobility transistors based oxygen sensors  

Science Conference Proceedings (OSTI)

Hydrothermally grown SnO2 was integrated with AlGaN/GaN high electron mobility transistor (HEMT) sensor as the gate electrode for oxygen detection. The crystalline of the SnO2 was improved after annealing at 400 C. The grain growth kinetics of the SnO2 nanomaterials, together with the O2 gas sensing properties and sensing mechanism of the SnO2 gated HEMT sensors were investigated. Detection of 1% oxygen in nitrogen at 100 C was possible. A low operation temperature and low power consumption oxygen sensor can be achieved by combining the SnO2 films with the AlGaN/GaN HEMT structure

Hung, S.T. [Feng Chia University, Taichung, Taiwan; Chung, Chi-Jung [Feng Chia University, Taichung, Taiwan; Chen, Chin Ching [University of Florida, Gainesville; Lo, C. F. [University of Florida; Ren, F. [University of Florida; Pearton, S. J. [University of Florida; Kravchenko, Ivan I [ORNL



Elimination of charge-enhancement effects in GaAs FETs with a low-temperature grown GaAs buffer layer  

Science Conference Proceedings (OSTI)

The use of low temperature grown GaAs (LT GaAs) buffer layer in GaAs FETs is shown via computer simulation and experimental measurement to reduce ion-induced charge collection by two to three orders of magnitude. This reduction in collected charge is associated with the efficient reduction of charge-enhancement mechanisms in the FETs. Error rate calculations indicate that the soft error rate of LT GaAs integrated circuits will be reduced by several orders of magnitude when compared to conventional FET-based GaAs ICs.

McMorrow, D.; Weatherford, T.R.; Curtice, W.R.; Knudson, A.R.; Buchner, S.; Melinger, J.S.; Tran, L.H.; Campbell, A.B. [Naval Research Lab., Washington, DC (United States)



Suppression of nuclear spin diffusion at a GaAs/AlGaAs interface measured with a single quantum dot nano-probe  

E-Print Network (OSTI)

Nuclear spin polarization dynamics are measured in optically pumped individual GaAs/AlGaAs interface quantum dots by detecting the time-dependence of the Overhauser shift in photoluminescence (PL) spectra. Long nuclear polarization decay times of ~ 1 minute have been found indicating inefficient nuclear spin diffusion from the GaAs dot into the surrounding AlGaAs matrix in externally applied magnetic field. A spin diffusion coefficient two orders lower than that previously found in bulk GaAs is deduced.

A. E. Nikolaenko; E. A. Chekhovich; M. N. Makhonin; I. W. Drouzas; A. B. Vankov; J. Skiba-Szymanska; M. S. Skolnick; P. Senellart; A. Lemaitre; A. I. Tartakovskii



Active region based on graded-gap InGaN/GaN superlattices for high-power 440- to 470-nm light-emitting diodes  

SciTech Connect

The structural and optical properties of light-emitting diode structures with an active region based on ultrathin InGaN quantum wells limited by short-period InGaN/GaN superlattices from both sides have been investigated. The dependences of the external quantum efficiency on the active region design are analyzed. It is shown that the use of InGaN/GaN structures as limiting graded-gap short-period superlattices may significantly increase the quantum efficiency.

Tsatsulnikov, A. F., E-mail: Andrew@beam.ioffe.ru; Lundin, W. V.; Sakharov, A. V.; Zavarin, E. E.; Usov, S. O.; Nikolaev, A. E.; Cherkashin, N. A.; Ber, B. Ya.; Kazantsev, D. Yu. [Russian Academy of Sciences, Ioffe Physicotechnical Institute (Russian Federation); Mizerov, M. N. [Russian Academy of Sciences, Center for Microelectronics, Ioffe Physicotechnical Institute (Russian Federation); Park, Hee Seok [Samsung Electro-Mechanics Co. Ltd. (Korea, Republic of); Hytch, M.; Hue, F. [National Center for Scientific Research, Center for Material Elaboration and Structural Studies (France)


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CC2, Two-Dimensional Electron Gas in In X Al 1-X N/Aln/GaN ...  

Science Conference Proceedings (OSTI)

DD3, A New Approach to Make ZnO-Cu2O Heterojunctions for Solar Cells ... E2, AlGaAs/GaAs/GaN Wafer Fused HBTs with Ar Implanted Extrinsic Collectors.


Strain relaxation in GaN/Al{sub x}Ga{sub 1-x}N superlattices grown by plasma-assisted molecular-beam epitaxy  

SciTech Connect

We have investigated the misfit relaxation process in GaN/Al{sub x}Ga{sub 1-x}N (x = 0.1, 0.3, 0.44) superlattices (SL) deposited by plasma-assisted molecular beam epitaxy. The SLs under consideration were designed to achieve intersubband absorption in the mid-infrared spectral range. We have considered the case of growth on GaN (tensile stress) and on AlGaN (compressive stress) buffer layers, both deposited on GaN-on-sapphire templates. Using GaN buffer layers, the SL remains almost pseudomorphic for x = 0.1, 0.3, with edge-type threading dislocation densities below 9 x 10{sup 8} cm{sup -2} to 2 x 10{sup 9} cm{sup -2}. Increasing the Al mole fraction to 0.44, we observe an enhancement of misfit relaxation resulting in dislocation densities above 10{sup 10} cm{sup -2}. In the case of growth on AlGaN, strain relaxation is systematically stronger, with the corresponding increase in the dislocation density. In addition to the average relaxation trend of the SL, in situ measurements indicate a periodic fluctuation of the in-plane lattice parameter, which is explained by the different elastic response of the GaN and AlGaN surfaces to the Ga excess at the growth front. The results are compared with GaN/AlN SLs designed for near-infrared intersubband absorption.

Kotsar, Y.; Bellet-Amalric, E.; Das, A.; Monroy, E. [CEA-Grenoble, INAC/SP2M/NPSC, 17 Rue des Martyrs, 38054 Grenoble cedex 9 (France); Doisneau, B. [SIMaP, Grenoble INP, Domaine Universitaire, BP 75, 38402 Saint Martin d'Heres (France); Sarigiannidou, E. [LMGP, Grenoble INP, 3 Parvis Louis Neel, BP 257, 38016 Grenoble cedex 1 (France)



Phonon Knudsen flow in GaAs/AlAs superlattices  

DOE Green Energy (OSTI)

The measured in-plane thermal conductivity, {delta}{sub SL} of GaAs/AlAs superlattices with even moderate layer thicknesses are significantly smaller than the weighted average, {delta}{sub l} = 67 W/Km, of the bulk GaAs and AlAs conductivities. One expects a suppression of the thermal conductivity to that of an actual Al{sub 0.5}Ga{sub 0.5}As alloy when the thickness of the GaAs and AlAs layers approaches that of a single monolayer. However, the observed superlattice thermal conductivity remains suppressed even at layer thickness {approx_gt} 10 nm. The low thermal conductivities, and very high mobilities, make n-doped GaAs/AlAs superlattices attractive possibilities for thermoelectric devices. With Molecular-Beam-Epitaxial grown GaAs/AlAs superlattices one can expect the individual GaAs and AlAs layers to be extremely clean. Defect and/or alloy scattering is limited to be near the heterostructure interfaces. The authors estimate the room-temperature phonon mean-free-path to be 42 (22) nm for the longitudinal (transverse) mode and thus comparable to or smaller than the layer thicknesses. Thus they expect an important phonon scattering at the interfaces. They study this phonon scattering at the superlattice interfaces assuming a Knudsen flow characterized by diffusive scattering. The solid curve in the figure shows the Knudsen-flow theory estimated for the superlattice thermal conductivity which shows a significant reduction when the layer thickness is shorter than the estimated phonon mean free paths.

Hyldgaard, P.; Mahan, G.D. [Oak Ridge National Lab., TN (United States). Solid State Div.]|[Univ. of Tennessee, Knoxville, TN (United States). Dept. of Physics and Astronomy



High Voltage GaN Schottky Rectifiers  

SciTech Connect

Mesa and planar GaN Schottky diode rectifiers with reverse breakdown voltages (V{sub RB}) up to 550V and >2000V, respectively, have been fabricated. The on-state resistance, R{sub ON}, was 6m{Omega}{center_dot} cm{sup 2} and 0.8{Omega}cm{sup 2}, respectively, producing figure-of-merit values for (V{sub RB}){sup 2}/R{sub ON} in the range 5-48 MW{center_dot}cm{sup -2}. At low biases the reverse leakage current was proportional to the size of the rectifying contact perimeter, while at high biases the current was proportional to the area of this contact. These results suggest that at low reverse biases, the leakage is dominated by the surface component, while at higher biases the bulk component dominates. On-state voltages were 3.5V for the 550V diodes and {ge}15 for the 2kV diodes. Reverse recovery times were <0.2{micro}sec for devices switched from a forward current density of {approx}500A{center_dot}cm{sup -2} to a reverse bias of 100V.




Testing of ethylene propylene seals for the GA-4/GA-9 casks  

SciTech Connect

The primary O-ring seal of the GA-4 and GA-9 casks was tested for leakage with a full-scale mockup of the cask lid and flange. Tests were performed at temperatures of ambient, {minus}41{degrees}, 121{degrees}, and 193{degrees}C. Shim plates between the lid and flange simulated gaps caused by thermal distortion. The testing used a helium mass spectrometer leak detector (MSLD). Results showed that the primary seal was leaktight for all test conditions. Helium permeation through the seal began in 13--23 minutes for the ambient tests and in 1--2 minutes for the tests at elevated temperatures. After each test several hours of the pumping were typically required to reduce the MSLD background reading to an acceptable level for the next test, indicating that the seal had become saturated with helium. To verify that the test results showed permeation and not real leakage, several response checks were conducted in which a calibrated leak source was inserted in the detector line near the seal. When the leak source was activated the detector responded within seconds.

Boonstra, R.H.




NLE Websites -- All DOE Office Websites (Extended Search)

(3D) Radiation Codes (Cahalan 2000). In the present work, the broadband fluxes of solar radiation are calculated using two different approaches. The purpose is * to compare...


Neutron Diffraction Residual Strain Tensor Measurements Within The Phase IA Weld Mock-up Plate P-5  

SciTech Connect

Oak Ridge National Laboratory (ORNL) has worked with NRC and EPRI to apply neutron and X-ray diffraction methods to characterize the residual stresses in a number of dissimilar metal weld mockups and samples. The design of the Phase IA specimens aimed to enable stress measurements by several methods and computational modeling of the weld residual stresses. The partial groove in the 304L stainless steel plate was filled with weld beads of Alloy 82. A summary of the weld conditions for each plate is provided in Table 1. The plates were constrained along the long edges during and after welding by bolts with spring-loaded washers attached to the 1-inch thick Al backing plate. The purpose was to avoid stress relief due to bending of the welded stainless steel plate. The neutron diffraction method was one of the methods selected by EPRI for non-destructive through thickness strain and stress measurement. Four different plates (P-3 to P-6) were studied by neutron diffraction strain mapping, representing four different welding conditions. Through thickness neutron diffraction strain mappings at NRSF2 for the four plates and associated strain-free d-zero specimens involved measurement along seven lines across the weld and at six to seven depths. The mountings of each plate for neutron diffraction measurements were such that the diffraction vector was parallel to each of the three primary orthogonal directions of the plate: two in-plane directions, longitudinal and transverse, and the direction normal to the plate (shown in left figure within Table 1). From the three orthogonal strains for each location, the residual stresses along the three plate directions were calculated. The principal axes of the strain and stress tensors, however, need not necessarily align with the plate coordinate system. To explore this, plate P-5 was selected for examination of the possibility that the principal axes of strain are not along the sample coordinate system axes. If adequate data could be collected the goal would be to determine the strain tensor's orientation and magnitude of strain along each principle axis direction.

Hubbard, Camden R [ORNL



Early and late time VLT spectroscopy of SN 2001el - progenitor constraints for a type Ia supernova  

E-Print Network (OSTI)

We present early time high-resolution (VLT/UVES) and late time low-resolution (VLT/FORS) optical spectra of the normal type Ia supernova, SN 2001el. The high-resolution spectra were obtained at -9 and -2 days to allow the detection of narrow hydrogen and/or helium emission lines from the circumstellar medium of the SN. No such lines were detected, and we therefore use photoionisation models to derive upper limits of 9x10^-6 Msun/yr and 5x10^-5 Msun/yr for the mass loss rate from the progenitor system assuming velocities of 10 km/s and 50 km/s, respectively, for a wind extending to outside at least a few x 10^15 cm away from the SN explosion site. These limits exclude a symbiotic star in the upper mass loss rate regime from being the progenitor of SN 2001el. The low resolution spectrum was obtained in the nebular phase of the SN, 400 days after the maximum light, to search for any hydrogen rich gas originating from the SN progenitor system. However, we see no signs of Balmer lines in our spectrum. Therefore, we model the late time spectra to derive an upper limit of ~0.03 Msun for solar abundance material present at velocities lower than 1000 km/s within the SN explosion site. According to simulations of Marietta et al. (2000) this is less than the expected mass lost by a subgiant, red giant or main sequence secondary star at a small binary separation as a result of the SN explosion. Finally, we discuss the origin of high velocity Ca II lines. We see both the CaII IR triplet and the H&K lines in the -9 days spectrum at a very high velocity of up to 34000 km/s. The spectrum also shows a flat-bottomed Si II `6150 A' feature similar to the one previously observed in SN 1990N at -14 days. We compare these spectral features to those observed in SNe 1984A and 1990N at even higher velocities.

S. Mattila; P. Lundqvist; J. Sollerman; C. Kozma; E. Baron; C. Fransson; B. Leibundgut; K. Nomoto



Nanostructuring of silicon substrates for the site-controlled growth of GaAs/In0.15Ga0.85As/GaAs nanostructures  

Science Conference Proceedings (OSTI)

We report the optimization of electron beam lithography and inductively coupled plasma (ICP) dry etching processes to fabricate pre-patterned Si (100) substrates with sub-100nm holes with controlled size and shape. An efficient in situ cleaning sequence ... Keywords: Electron beam lithography, ICP dry etching, InGaAs quantum dots, MBE growth, Nanostructuring of silicon

Muhammad Usman; Tariq Alzoubi; Mohamed Benyoucef; Johann Peter Reithmaier



A Measurement of the Rate of type-Ia Supernovae at Redshift $z\\approx$ 0.1 from the First Season of the SDSS-II Supernova Survey  

E-Print Network (OSTI)

We present a measurement of the rate of type Ia supernovae (SNe Ia) from the first of three seasons of data from the SDSS-II Supernova Survey. For this measurement, we include 17 SNe Ia at redshift $z\\le0.12$. Assuming a flat cosmology with $\\Omega_m = 0.3=1-\\Omega_\\Lambda$, we find a volumetric SN Ia rate of $[2.93^{+0.17}_{-0.04}({\\rm systematic})^{+0.90}_{-0.71}({\\rm statistical})] \\times 10^{-5} {\\rm SNe} {\\rm Mpc}^{-3} h_{70}^3 {\\rm year}^{-1}$, at a volume-weighted mean redshift of 0.09. This result is consistent with previous measurements of the SN Ia rate in a similar redshift range. The systematic errors are well controlled, resulting in the most precise measurement of the SN Ia rate in this redshift range. We use a maximum likelihood method to fit SN rate models to the SDSS-II Supernova Survey data in combination with other rate measurements, thereby constraining models for the redshift-evolution of the SN Ia rate. Fitting the combined data to a simple power-law evolution of the volumetric SN Ia rate, $r_V \\propto (1+z)^{\\beta}$, we obtain a value of $\\beta = 1.5 \\pm 0.6$, i.e. the SN Ia rate is determined to be an increasing function of redshift at the $\\sim 2.5 \\sigma$ level. Fitting the results to a model in which the volumetric SN rate, $r_V=A\\rho(t)+B\\dot \\rho(t)$, where $\\rho(t)$ is the stellar mass density and $\\dot \\rho(t)$ is the star formation rate, we find $A = (2.8 \\pm 1.2) \\times 10^{-14} \\mathrm{SNe} \\mathrm{M}_{\\sun}^{-1} \\mathrm{year}^{-1}$, $B = (9.3^{+3.4}_{-3.1})\\times 10^{-4} \\mathrm{SNe} \\mathrm{M}_{\\sun}^{-1}$.

Benjamin Dilday; R. Kessler; J. A. Frieman; J. Holtzman; J. Marriner; G. Miknaitis; R. C. Nichol; R. Romani; M. Sako; B. Bassett; A. Becker; D. Cinabro; F. DeJongh; D. L. Depoy; M. Doi; P. M. Garnavich; C. J. Hogan; S. Jha; K. Konishi; H. Lampeitl; J. L. Marshall; D. McGinnis; J. L. Prieto; A. G. Riess; M. W. Richmond; D. P. Schneider; M. Smith; N. Takanashi; K. Tokita; K. van der Heyden; N. Yasuda; C. Zheng; J. Barentine; H. Brewington; C. Choi; A. Crotts; J. Dembicky; M. Harvanek; M. Im; W. Ketzeback; S. J. Kleinman; J. Krzesi?ski; D. C. Long; E. Malanushenko; V. Malanushenko; R. J. McMillan; A. Nitta; K. Pan; G. Saurage; S. A. Snedden; S. Watters; J. C. Wheeler; D. York



Electric field engineering in GaN high electron mobility transistors  

E-Print Network (OSTI)

In the last few years, AlGaN/GaN high electron mobility transistors (HEMTs) have become the top choice for power amplification at frequencies up to 20 GHz. Great interest currently exists in industry and academia to increase ...

Zhao, Xu, S.M. Massachusetts Institute of Technology



Light extraction in individual GaN nanowires on Si for LEDs  

E-Print Network (OSTI)

GaN-based nanowires hold great promise for solid state lighting applications because of their waveguiding properties and the ability to grow nonpolar GaN nanowire-based heterostructures, which could lead to increased light ...

Zhou, Xiang


High electron mobility in Ga(In)NAs films grown by molecular beam epitaxy  

Science Conference Proceedings (OSTI)

We report the highest mobility values above 2000 cm{sup 2}/Vs in Si doped GaNAs film grown by molecular beam epitaxy. To understand the feature of the origin which limits the electron mobility in GaNAs, temperature dependences of mobility were measured for high mobility GaNAs and referential low mobility GaInNAs. Temperature dependent mobility for high mobility GaNAs is similar to the GaAs case, while that for low mobility GaInNAs shows large decrease in lower temperature region. The electron mobility of high quality GaNAs can be explained by intrinsic limiting factor of random alloy scattering and extrinsic factor of ionized impurity scattering.

Miyashita, Naoya; Ahsan, Nazmul; Monirul Islam, Muhammad; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8904 (Japan); Inagaki, Makoto [Toyota Technological Institute, 2-12-1 Hisakata, Tempaku-ku, Nagoya 468-8511, Aichi (Japan); Yamaguchi, Masafumi [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8904 (Japan); Toyota Technological Institute, 2-12-1 Hisakata, Tempaku-ku, Nagoya 468-8511, Aichi (Japan)



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Black-body radiation shift of the Ga$^{+}$ clock transition  

E-Print Network (OSTI)

The blackbody radiation shift of the Ga$^+$ $4s^2 \\ ^1S^e_0 \\to 4s4p \\ ^3P^o_0$ clock transition is computed to be $-$$0.0140 \\pm 0.0048$ Hz at 300 K. The small shift is consistent with the blackbody shifts of the clock transitions of other group III ions which are of a similar size. The polarizabilities of the Ga$^+$ $4s^2 \\ ^1S^e_0$, $4s4p \\ ^3P^o_0$, and $4s4p \\ ^1P^o_1$ states were computed using the configuration interaction method with an underlying semi-empirical core potential. A byproduct of the analysis involved large scale calculations of the low lying spectrum and oscillator strengths of the Ga$^{2+}$ ion.

Cheng, Yongjun



Aug. 8-9, 2006 HAPL meeting, GA Open Discussion on Advanced Armor  

E-Print Network (OSTI)

Aug. 8-9, 2006 HAPL meeting, GA 1 Open Discussion on Advanced Armor Concepts Moderated by A. René in case the W armor does not work. #12;Aug. 8-9, 2006 HAPL meeting, GA 3 Roman Aquaduct at Pont du Gard, Provence #12;Aug. 8-9, 2006 HAPL meeting, GA 4 Possible Advanced Armor Options Include: · Engineered

Raffray, A. René


Current injection efficiency of InGaAsN quantum-well lasers Nelson Tansua  

E-Print Network (OSTI)

Current injection efficiency of InGaAsN quantum-well lasers Nelson Tansua Department of Electrical-threshold current injection efficiency of quantum well QW lasers is clarified. The analysis presented here is applied to the current injection efficiency of 1200 nm emitting InGaAs and 1300 nm emitting InGaAsN QW

Gilchrist, James F.


Seamless On-Wafer Integration of Si(100) MOSFETs and GaN HEMTs  

E-Print Network (OSTI)

The first on-wafer integration of Si(100) MOSFETs and AlGaN/GaN high electron mobility transistors (HEMTs) is demonstrated. To enable a fully Si-compatible process, we fabricated a novel Si(100)-GaN-Si(100) virtual substrate ...

Piner, Edwin L.


ANN-based GA for generating the sizing curve of stand-alone photovoltaic systems  

Science Conference Proceedings (OSTI)

Recent advances in artificial intelligence techniques have allowed the application of such technologies in real engineering problems. In this paper, an artificial neural network-based genetic algorithm (ANN-GA) model was developed for generating the ... Keywords: ANN, ANN-GA, GA, Prediction, Sizing curve, Stand-alone PV system

Adel Mellit



Surface plasmon enhanced InGaN light emitter Koichi Okamoto*a  

E-Print Network (OSTI)

is a very promising method for developing the super bright light emitting diodes (LEDs). Moreover, we foundGaN/GaN, light emitting diode, quantum well, internal quantum efficiency, solid-state light source 1. INTRODUCTION Since 1993, InGaN quantum wells (QW)-based light emitting diodes (LEDs) have been continuously

Okamoto, Koichi

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TESLA-FEL 2007-03 Application of low cost GaAs LED as neutron  

E-Print Network (OSTI)

neutrons in unbiased Gallium Arsenide (GaAs) Light Emitting Diodes (LED) resulted in a reduction Keywords: COTS components, Displacement damage, Electron Linear Accelerator, GaAs Light emitting diode (LED) Gallium Arsenide (GaAs) light emitting diode (LED) for the assessment of integrated neutron fluence


Vertically aligned GaN nanotubes - Fabrication and current image analysis  

Science Conference Proceedings (OSTI)

In this work, we present a one step formation method of nanotubes on GaN film, and then map out local current of nanotubes. GaN nanotubes were formed by inductively coupled plasma (ICP) etching and found that tops of these nanotubes were hexagonal with ... Keywords: C-AFM, FESEM, GaN, ICP, Nanotubes

Shang-Chao Hung; Yan-Kuin Su; Shoou-Jinn Chang; Y. H. Chen



Luminescence Enhancement in InGaN and ZnO by Water Vapor ...  

Science Conference Proceedings (OSTI)

Dependence of Ag/In Ratio of AgInS2 Crystals Grown by Hot-Press Method ... Analysis of Temperature Characteristics of InGaP/InGaAs/Ge Triple-Junction Solar Cell ... Luminescence Enhancement in InGaN and ZnO by Water Vapor Remote...


GA Hot Cell D&D Closeout Report  

Office of Legacy Management (LM)

GENERAL ATOMICS GENERAL ATOMICS HOT CELL FACILITY DECONTAMINATION & DECOMMISSIONING PROJECT FINAL PROJECT CLOSEOUT REPORT prepared for GA HOT CELL D&D PROJECT CONTRACT NUMBERS DE-AC03-84SF11962 and DE-AC03-95SF20798 PBS VL-GA-0012 Approvals Prepared by: James Davis, III Date Project Manager, Oakland Environmental Programs Office Reviewed by: John Lee Date Deputy, Oakland Environmental Programs Office Approved by: Laurence McEwen Date Acting Director, Oakland Environmental Programs Office General Atomics Hot Cell Facility D&D Project Closeout Report Contents Page i CONTENTS CONTENTS.....................................................................................................................................


Epitaxial EuO thin films on GaAs  

SciTech Connect

We demonstrate the epitaxial growth of EuO on GaAs by reactive molecular beam epitaxy. Thin films are grown in an adsorption-controlled regime with the aid of an MgO diffusion barrier. Despite the large lattice mismatch, it is shown that EuO grows well on MgO(001) with excellent magnetic properties. Epitaxy on GaAs is cube-on-cube and longitudinal magneto-optic Kerr effect measurements demonstrate a large Kerr rotation of 0.57 deg., a significant remanent magnetization, and a Curie temperature of 69 K.

Swartz, A. G.; Ciraldo, J.; Wong, J. J. I.; Li Yan; Han Wei; Lin Tao; Shi, J.; Kawakami, R. K. [Department of Physics and Astronomy, University of California, Riverside, California 92521 (United States); Mack, S.; Awschalom, D. D. [Center for Spintronics and Quantum Computation, University of California, Santa Barbara, California 93106 (United States)



AlP/GaP distributed Bragg reflectors  

SciTech Connect

Distributed Bragg reflectors with high reflectivity bands centered at wavelengths from 530 to 690 nm (green to red) based on AlP/GaP quarter-wave stacks are prepared on (001)GaP using gas-source molecular-beam epitaxy. Additionally, the complex refractive index of AlP is measured using spectroscopic ellipsometry within the range of 330-850 nm in order to facilitate an accurate reflector design. Structures consisting of 15 quarter-wave stacks reach a peak reflectance between 95% and 98%, depending on the spectral position of the maximum.

Emberger, Valentin; Hatami, Fariba; Ted Masselink, W. [Department of Physics, Humboldt-Universitaet zu Berlin, Newtonstrasse 15, D-12489 Berlin (Germany); Peters, Sven [Sentech Instruments GmbH, Schwarzschildstr. 2, 12489 Berlin (Germany)



Simple intrinsic defects in GaAs : numerical supplement.  

SciTech Connect

This Report presents numerical tables summarizing properties of intrinsic defects in gallium arsenide, GaAs, as computed by density functional theory. This Report serves as a numerical supplement to the results published in: P.A. Schultz and O.A. von Lilienfeld, 'Simple intrinsic defects in GaAs', Modelling Simul. Mater. Sci Eng., Vol. 17, 084007 (2009), and intended for use as reference tables for a defect physics package in device models. The numerical results for density functional theory calculations of properties of simple intrinsic defects in gallium arsenide are presented.

Schultz, Peter Andrew



Electron Hall Mobility in GaAsBi  

Science Conference Proceedings (OSTI)

We present measurements of the electron Hall mobility in n-type GaAs{sub 1-x}Bi{sub x} epilayers. We observed no significant degradation in the electron mobility with Bi incorporation in GaAs, up to a concentration of 1.2%. At higher Bi concentration ({ge} 1.6%) some degradation of the electron mobility was observed, although there is no apparent trend. Temperature dependent Hall measurements of the electron mobility suggest neutral impurity scattering to be the dominant scattering mechanism.

Kini, R. N.; Bhusal, L.; Ptak, A. J.; France, R.; Mascarenhas, A.



Analyzing the growth of In{sub x}Ga{sub 1-x}N/GaN superlattices in self-induced GaN nanowires by x-ray diffraction  

Science Conference Proceedings (OSTI)

Self-induced GaN nanowires are grown by plasma-assisted molecular beam epitaxy, with In{sub x}Ga{sub 1-x}N quantum wells inserted to form an axial superlattice. From the {omega}-2{theta} scans of a laboratory x-ray diffraction experiment, we obtain the superlattice period, the thickness of the quantum wells, and the In content in this layer. The axial growth rate of the In{sub x}Ga{sub 1-x}N quantum wells is significantly enhanced, which we attribute to increased Ga diffusion along the nanowire sidewalls in the presence of In.

Woelz, M.; Kaganer, V. M.; Brandt, O.; Geelhaar, L.; Riechert, H.



Deep-Level Transient Spectroscopy in InGaAsN Lattice-Matched to GaAs: Preprint  

Science Conference Proceedings (OSTI)

This conference paper describes the deep-level transient spectroscopy (DLTS) measurements have been performed on the quaternary semiconductor InGaAsN. A series of as-grown, metal-organic chemical vapor deposited samples having varying composition were grown and measured. A GaAs sample was used as a baseline for comparison. After adding only In to GaAs, we did not detect significant additional defects; however, adding N and both N and In led to larger hole-trap peaks and additional electron-trap peaks in the DLTS data. The samples containing about 2% N, with and without about 6% In, had electron traps with activation energies of about 0.2 and 0.3 eV. A sample with 0.4% N had an electron trap with an activation energy of 0.37 eV.

Johnston, S. W.; Ahrenkiel, R. K.; Friedman, D. J.; Kurtz, S. R.



Characteristics of InGaP/InGaAs pseudomorphic high electron mobility transistors with triple delta-doped sheets  

Science Conference Proceedings (OSTI)

Fundamental and insightful characteristics of InGaP/InGaAs double channel pseudomorphic high electron mobility transistors (DCPHEMTs) with graded and uniform triple {delta}-doped sheets are coomprehensively studied and demonstrated. To gain physical insight, band diagrams, carrier densities, and direct current characteristics of devices are compared and investigated based on the 2D semiconductor simulator, Atlas. Due to uniform carrier distribution and high electron density in the double InGaAs channel, the DCPHEMT with graded triple {delta}-doped sheets exhibits better transport properties, higher and linear transconductance, and better drain current capability as compared with the uniformly triple {delta}-doped counterpart. The DCPHEMT with graded triple {delta}-doped structure is fabricated and tested, and the experimental data are found to be in good agreement with simulated results.

Chu, Kuei-Yi [National Cheng-Kung University, Institute of Microelectronics, Department of Electrical Engineering (China); Chiang, Meng-Hsueh, E-mail: mhchiang@niu.edu.tw; Cheng, Shiou-Ying, E-mail: sycheng@niu.edu.tw [National II an University, Department of Electronic Engineering (China); Liu, Wen-Chau [National Cheng-Kung University, Institute of Microelectronics, Department of Electrical Engineering (China)



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



You are now leaving Energy.gov | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Ultra High p-doping Material Research for GaN Based Light Emitters  

Science Conference Proceedings (OSTI)

The main goal of the Project is to investigate doping mechanisms in p-type GaN and AlGaN and controllably fabricate ultra high doped p-GaN materials and epitaxial structures. Highly doped p-type GaN-based materials with low electrical resistivity and abrupt doping profiles are of great importance for efficient light emitters for solid state lighting (SSL) applications. Cost-effective hydride vapor phase epitaxial (HVPE) technology was proposed to investigate and develop p-GaN materials for SSL. High p-type doping is required to improve (i) carrier injection efficiency in light emitting p-n junctions that will result in increasing of light emitting efficiency, (ii) current spreading in light emitting structures that will improve external quantum efficiency, and (iii) parameters of Ohmic contacts to reduce operating voltage and tolerate higher forward currents needed for the high output power operation of light emitters. Highly doped p-type GaN layers and AlGaN/GaN heterostructures with low electrical resistivity will lead to novel device and contact metallization designs for high-power high efficiency GaN-based light emitters. Overall, highly doped p-GaN is a key element to develop light emitting devices for the DOE SSL program. The project was focused on material research for highly doped p-type GaN materials and device structures for applications in high performance light emitters for general illumination P-GaN and p-AlGaN layers and multi-layer structures were grown by HVPE and investigated in terms of surface morphology and structure, doping concentrations and profiles, optical, electrical, and structural properties. Tasks of the project were successfully accomplished. Highly doped GaN materials with p-type conductivity were fabricated. As-grown GaN layers had concentration N{sub a}-N{sub d} as high as 3 x 10{sup 19} cm{sup -3}. Mechanisms of doping were investigated and results of material studies were reported at several International conferences providing better understanding of p-type GaN formation for Solid State Lighting community. Grown p-type GaN layers were used as substrates for blue and green InGaN-based LEDs made by HVPE technology at TDI. These results proved proposed technical approach and facilitate fabrication of highly conductive p-GaN materials by low-cost HVPE technology for solid state lighting applications. TDI has started the commercialization of p-GaN epitaxial materials.

Vladimir Dmitriev



An inverted AlGaAs/GaAs patterned-Ge tunnel junction cascade concentrator solar cell. Final subcontract report, 1 January 1991--31 August 1992  

DOE Green Energy (OSTI)

This report describes work to develop inverted-grown Al{sub 0.34}Ga{sub 0.66}As/GaAs cascades. Several significant developments are reported on as follows: (1) The AM1.5 1-sun total-area efficiency of the top Al{sub 0.34}Ga{sub 0.66}As cell for the cascade was improved from 11.3% to 13.2% (NREL measurement [total-area]). (2) The ``cycled`` organometallic vapor phase epitaxy growth (OMVPE) was studied in detail utilizing a combination of characterization techniques including Hall-data, photoluminescence, and secondary ion mass spectroscopy. (3) A technique called eutectic-metal-bonding (EMB) was developed by strain-free mounting of thin GaAs-AlGaAs films (based on lattice-matched growth on Ge substrates and selective plasma etching of Ge substrates) onto Si carrier substrates. Minority-carrier lifetime in an EMB GaAs double-heterostructure was measured as high as 103 nsec, the highest lifetime report for a freestanding GaAs thin film. (4) A thin-film, inverted-grown GaAs cell with a 1-sun AM1.5 active-area efficiency of 20.3% was obtained. This cell was eutectic-metal-bonded onto Si. (5) A thin-film inverted-grown, Al{sub 0.34}Ga{sub 0.66}As/GaAs cascade with AM1.5 efficiency of 19.9% and 21% at 1-sun and 7-suns, respectively, was obtained. This represents an important milestone in the development of an AlGaAs/GaAs cascade by OMVPE utilizing a tunnel interconnect and demonstrates a proof-of-concept for the inverted-growth approach.

Venkatasubramanian, R. [Research Triangle Inst., Research Triangle Park, NC (United States)



AlGaAsSb buffer/barrier on GaAs substrate for InAs channel devices with high electron mobility and practical reliability  

Science Conference Proceedings (OSTI)

Keywords: AlGaAsSb, Hall elements, InAs, Sb, buffer/barriers, deep quantum well, field effect transistors, reliability

S. Miya; S. Muramatsu; N. Kuze; K. Nagase; T. Iwabuchi; A. Ichii; M. Ozaki; I. Shibasaki



Characterization and device performance of (AgCu)(InGa)Se2 absorber layers  

DOE Green Energy (OSTI)

The study of (AgCu)(InGa)Se2 absorber layers is of interest in that Ag-chalcopyrites exhibit both wider bandgaps and lower melting points than their Cu counterparts. (AgCu)(InGa)Se2 absorber layers were deposited over the composition range 0 < Ag/(Ag+Cu) < 1 and 0.3 < Ga/(In+Ga) < 1.0 using a variety of elemental co-evaporation processes. Films were found to be singlephase over the entire composition range, in contrast to prior studies. Devices with Ga content 0.3 < Ga/(In+Ga) <0.5 tolerated Ag incorporation up to Ag/(Ag+Cu) = 0.5 without appreciable performance loss. Ag-containing films with Ga/(In+Ga) = 0.8 showed improved device characteristics over Cu-only control samples, in particular a 30-40% increase in short-circuit current. An absorber layer with composition Ag/(Ag+Cu) = 0.75 and Ga/(In+Ga) = 0.8 yielded a device with VOC = 890 mV, JSC = 20.5mA/cm2, fill factor = 71.3%, and ? = 13.0%.

Hanket, Gregory; Boyle, Jonathan H.; Shafarman, William N.



Using GA-ANN algorithm to predicate coal bump energy  

Science Conference Proceedings (OSTI)

A GA-ANN network was constructed for preidcating coal bump energy, based on the 300 training samples form simulated results with PFC2D software for different coal particle stiffness. It was tested that the average relative error of fitted-output value ... Keywords: artificial neural network, coal bump, energy, genetic algorithm, predication

Yunliang Tan; Tongbin Zhao; Zhigang Zhao



Development of ZnO:Ga as an Ultrafast Scintillator  

DOE Green Energy (OSTI)

We report on several methods for synthesizing the ultra-fast scintillator ZnO(Ga), and measurements of the resulting products. This material has characteristics that make it an excellent alpha detector for tagging the time and direction of individual neutrons produced by t-d and d-d neutron generators (associated particle imaging). The intensity and decay time are strongly dependent on the method used for dopant incorporation. We compare samples made by diffusion of Ga metal to samples made by solid state reaction between ZnO and Ga2O3 followed by reduction in hydrogen. The latter is much more successful and has a pure, strong near-band-edge fluorescence and an ultra-fast decay time of the x-ray-excited luminescence. The luminescence increases dramatically as the temperature is reduced to 10K. We also present results of an alternate low-temperature synthesis that produces luminescent particles with a more uniform size distribution. We examine possible mechanisms for the bright near-band-edge scintillation and favor the explanation that it is due to the recombination of Ga3+ donor electrons with ionization holes trapped on H+ ion acceptors.

Bourret-Courchesne, E.D.; Derenzo, S.E.; Weber, M.J.



Properties of H, O and C in GaN  

DOE Green Energy (OSTI)

The electrical properties of the light ion impurities H, O and C in GaN have been examined in both as-grown and implanted material. H is found to efficiently passivate acceptors such as Mg, Ca and C. Reactivation occurs at {ge} 450 C and is enhanced by minority carrier injection. The hydrogen does not leave the GaN crystal until > 800 C, and its diffusivity is relatively high ({approximately} 10{sup {minus}11} cm{sup 2}/s) even at low temperatures (< 200 C) during injection by wet etching, boiling in water or plasma exposure. Oxygen shows a low donor activation efficiency when implanted into GaN, with an ionization level of 30--40 meV. It is essentially immobile up to 1,100 C. Carbon can produce low p-type levels (3 {times} 10{sup 17} cm{sup {minus}3}) in GaN during MOMBE, although there is some evidence it may also create n-type conduction in other nitrides.

Pearton, S.J.; Abernathy, C.R.; Lee, J.W. [Univ. of Florida, Gainesville, FL (United States)] [and others


Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Optimization on Seawater Desulfurization Efficiency Based on LSSVM-GA  

Science Conference Proceedings (OSTI)

Seawater flue gas Desulfurization (SFGD) was adopted in many coal-fired power plants of littoral for its low cost and high desulfurization efficiency. Operating Parameters would seriously affect SFGD efficiency, the desulfurization efficiency can be ... Keywords: SFGD, desulfurization efficiency, LSSVM, GA, optimization

Liu Ding-ping; Li Xiao-wei



Low cost high power GaSB photovoltaic cells  

Science Conference Proceedings (OSTI)

High power density and high capacity factor are important attributes of a thermophotovoltaics (TPV) system and GaSb cells are enabling for TPV systems. A TPV cogeneration unit at an off grid site will compliment solar arrays producing heat and electricity on cloudy days with the solar arrays generating electricity on sunny days. Herein

Lewis M. Fraas; Han X. Huang; Shi-Zhong Ye; She Hui; James Avery; Russell Ballantyne



Low cost high power GaSb thermophotovoltaic cells  

Science Conference Proceedings (OSTI)

High power density and high capacity factor are important attributes of a TPV system and GaSb cells are enabling for TPV systems. A TPV cogeneration unit at an off grid site will compliment solar arrays producing heat and electricity on cloudy days with the solar arrays generating electricity on sunny days. Herein

Lewis M. Fraas; Han X. Huang; Shi-Zhong Ye; James Avery; Russell Ballantyne



Optical and quantum efficiency analysis of (Ag,Cu)(In,Ga)Se2 absorber layers  

DOE Green Energy (OSTI)

(Ag,Cu)(In,Ga)Se2 thin films have been deposited by elemental co-evaporation over a wide range of compositions and their optical properties characterized by transmission and reflection measurements and by relative shift analysis of quantum efficiency device measurements. The optical bandgaps were determined by performing linear fits of (?h?)2 vs. h?, and the quantum efficiency bandgaps were determined by relative shift analysis of device curves with fixed Ga/(In+Ga) composition, but varying Ag/(Cu+Ag) composition. The determined experimental optical bandgap ranges of the Ga/(In+Ga) = 0.31, 0.52, and 0.82 groups, with Ag/(Cu+Ag) ranging from 0 to 1, were 1.19-1.45 eV, 1.32-1.56 eV, and 1.52-1.76 eV, respectively. The optical bowing parameter of the different Ga/(In+Ga) groups was also determined.

Boyle, Jonathan; Hanket, Gregory; Shafarman, William




SciTech Connect

The light from a shock breakout of stellar explosions, which carries a wealth of information, strongly depends on the shock velocity at the time of the breakout. The emission from Newtonian breakouts, typical in regular core-collapse supernovae (SNe), has been explored extensively. However, a large variety of explosions result in mildly or ultrarelativistic breakouts, where the observed signature is unknown. Here we calculate the luminosity and spectrum produced by relativistic breakouts. In order to do so, we improve the analytic description of relativistic radiation-mediated shocks and follow the system from the breakout itself, through the planar phase and into the spherical phase. We limit our calculation to cases where the post-breakout acceleration of the gas ends during the planar phase (i.e., the final gas Lorentz factor {approx}< 30). We find that spherical relativistic breakouts produce a flash of gamma rays with energy, E{sub bo}, temperature, T{sub bo}, and duration, t{sup obs} b{sub o}, that provide the breakout radius ( Almost-Equal-To 5 R{sub Sun }(t{sup obs}{sub bo}/10 s)(T{sub bo}/50 keV){sup 2}) and the Lorentz factor ( Almost-Equal-To T{sub bo}/50 keV). They also always satisfy a relativistic breakout relation (t{sup obs}{sub bo}/20 s) {approx} (E{sub bo}/10{sup 46} erg){sup 1/2}(T{sub bo}/50 keV){sup -2.68}. The breakout flare is typically followed, on longer timescales, by X-rays that carry a comparable energy. We apply our model to a variety of explosions, including Type Ia and .Ia SNe, accretion-induced collapse, energetic SNe, and gamma-ray bursts (GRBs). We find that all these events produce detectable gamma-ray signals, some of which may have already been seen. Some particular examples are: (1) relativistic shock breakouts provide a natural explanation to the energy, temperature, and timescales of low-luminosity GRBs. Indeed, all observed low-luminosity GRBs satisfy the relativistic breakout relation. (2) Nearby broad-line Type Ib/c (like SN 2002ap) may produce a detectable {gamma}-ray signal. (3) Galactic Type Ia SNe may produce detectable {gamma}-ray flares. We conclude that relativistic shock breakouts provide a generic process for the production of gamma-ray flares.

Nakar, Ehud [Raymond and Beverly Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Sari, Re'em [Racah Institute for Physics, Hebrew University, Jerusalem 91904 (Israel)



Dependence on proton energy of degradation of AlGaN/GaN high electron mobility transistors  

Science Conference Proceedings (OSTI)

The effects of proton irradiation energy on dc, small signal, and large signal rf characteristics of AlGaN/GaN high electron mobility transistors (HEMTs) were investigated. AlGaN/GaN HEMTs were irradiated with protons at fixed fluence of 51015/cm2 and energies of 5, 10, and 15 MeV. Both dc and rf characteristics revealed more degradation at lower irradiation energy, with reductions of maximum transconductance of 11%, 22%, and 38%, and decreases in drain saturation current of 10%, 24%, and 46% for HEMTs exposed to 15, 10, and 5MeV protons, respectively. The increase in device degradation with decreasing proton energy is due to the increase in linear energy transfer and corresponding increase in nonionizing energy loss with decreasing proton energy in the active region of the HEMTs. After irradiation, both subthreshold drain leakage current and reverse gate current decreased more than 1 order of magnitude for all samples. The carrier removal rate was in the range 121 336 cm1 over the range of proton energies employed in this study

Liu, L. [University of Florida, Gainesville; Xi, Y. Y. [University of Florida, Gainesville; Wang, Y.l. [University of Florida; Ren, F. [University of Florida; Pearton, S. J. [University of Florida; Kim, H.-Y. [Korea University; Kim, J. [Korea University; Fitch, Robert C [Air Force Research Laboratory, Wright-Patterson AFB, OH; Walker, Dennis E [Air Force Research Laboratory, Wright-Patterson AFB, OH; Chabak, Kelson D [Air Force Research Laboratory, Wright-Patterson AFB, OH; Gillespie, James k [Air Force Research Laboratory, Wright-Patterson AFB, OH; Tetlak, Stephen E [Air Force Research Laboratory, Wright-Patterson AFB, OH; Via, Glen D [Air Force Research Laboratory, Wright-Patterson AFB, OH; Crespo, Antonio [Air Force Research Laboratory, Wright-Patterson AFB, OH; Kravchenko, Ivan I [ORNL



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Electroluminescence and Transmission Electron Microscopy Characterization of Reverse-Biased AlGaN/GaN Devices  

Science Conference Proceedings (OSTI)

Reverse-bias stress testing has been applied to a large set of more than 50 AlGaN/GaN high electron mobility transistors, which were fabricated using the same process but with different values of the AlN mole fraction and the AlGaN barrier-layer thickness, as well as different substrates (SiC and sapphire). Two sets of devices having different defect types and densities, related to the different growth conditions and the choice of nucleation layer, were also compared. When subjected to gate drain (or gate-to-drain and source short-circuited) reverse-bias testing, all devices presented the same time-dependent failure mode, consisting of a significant increase in the gate leakage current. This failure mechanism occurred abruptly during step-stress experiments when a certain negative gate voltage, or critical voltage, was exceeded or, during constant voltage tests, at a certain time, defined as time to breakdown. Electroluminescence (EL) microscopy was systematically used to identify localized damaged areas that induced an increase of gate reverse current. This current increase was correlated with the increase of EL intensity, and significant EL emission during tests occurred only when the critical voltage was exceeded. Focused-ion-beam milling produced cross-sectional samples suitable for electron microscopy observation at the sites of failure points previously identified by EL microscopy. In highdefectivity devices, V-defects were identified that were associated with initially high gate leakage current and corresponding to EL spots already present in untreated devices. Conversely, identification of defects induced by reverse-bias testing proved to be extremely difficult, and only nanometer-size cracks or defect chains, extending vertically from the gate edges through the AlGaN/GaN heterojunction, were found. No signs of metal/semiconductor interdiffusion or extended defective areas were visible.

Cullen, David A [ORNL; Smith, David J [Arizona State University; Passaseo, Adriana [Consiglio Nazionale delle Ricerche; Tasco, Vittorianna [Consiglio Nazionale delle Ricerche; Stocco, Antonio [Universita di Padova; Meneghini, Matteo [Universita di Padova; Meneghesso, Gaudenzio [Universita di Padova; Zanoni, Enrico [Universita di Padova



Solar Wind: Manifestations of Solar Activity E N CYC LO PE D IA O F AS T R O N O MY AN D AS T R O PHYS I C S Solar Wind: Manifestations of Solar  

E-Print Network (OSTI)

Solar Wind: Manifestations of Solar Activity E N CYC LO PE D IA O F AS T R O N O MY AN D AS T R O PHYS I C S Solar Wind: Manifestations of Solar Activity The Sun's outer atmosphere, the corona, is continually heated and expands to create the solar wind. Solar activity waxes and wanes with the 11 yr cycle

Webb, David F.


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



GaSb substrates with extended IR wavelength for advanced space based applications  

SciTech Connect

GaSb substrates have advantages that make them attractive for implementation of a wide range of infrared (IR) detectors with higher operating temperatures for stealth and space based applications. A significant aspect that would enable widespread commercial application of GaSb wafers for very long wavelength IR (VLWIR) applications is the capability for transmissivity beyond 15 m. Due largely to the GaSb (antisite) defect and other point defects in undoped GaSb substrates, intrinsic GaSb is still slightly p-type and strongly absorbs in the VLWIR. This requires backside thinning of the GaSb substrate for IR transmissivity. An extremely low n-type GaSb substrate is preferred to eliminate thinning and provide a substrate solution for backside illuminated VLWIR devices. By providing a more homogeneous radial distribution of the melt solute to suppress GaSb formation and controlling the cooling rate, ultra low doped n:GaSb has been achieved. This study examines the surface properties and IR transmission spectra of ultra low doped GaSb substrates at both room and low temperatures. Atomic force microscopy (AFM), homoepitaxy by MBE, and infrared Fourier transform (FTIR) analysis was implemented to examine material quality. As compared with standard low doped GaSb, the ultra low doped substrates show over 50% transmission and consistent wavelength transparency past 23 m with improved %T at low temperature. Homoepitaxy and AFM results indicate the ultra low doped GaSb has a low thermal desorbtion character and qualified morphology. In summary, improvements in room temperature IR transmission and extended wavelength characteristics have been shown consistently for ultra low doped n:GaSb substrates.

Allen, Lisa P.; Flint, Patrick; Dallas, Gordon; Bakken, Daniel; Blanchat, Kevin; Brown, Gail J.; Vangala, Shivashankar R.; Goodhue, William D.; Krishnaswami, Kannan



Two-color picosecond experiments on anti-Stokes photoluminescence in GaAs/AlGaAs asymmetric double quantum wells  

E-Print Network (OSTI)

quantum wells S. C. Hohng and D. S. Kima) Department of Physics and Condensed Matter Research Institute in GaAs/AlGaAs asymmetric double quantum wells. Direct evidence for forbidden absorption is shown heterojunctions and asymmetric double quan- tum wells was found and its origin is still being hotly de- bated

Hohng, Sung Chul


Light output enhancement of InGaN/GaN light-emitting diodes with contrasting indium tin-oxide nanopatterned structures  

Science Conference Proceedings (OSTI)

Various nanopatterns on the transparent conducting indium tin oxide (ITO) layer are investigated to enhance the light extraction efficiency of the InGaN/GaN light-emitting diodes (LEDs). Triangular, square, and circular nanohole patterns with the square ...

Sang Hyun Jung, Keun Man Song, Young Su Choi, Hyeong-Ho Park, Hyun-Beom Shin, Ho Kwan Kang, Jaejin Lee



Optically pumped InxGa???xN/InyGa???yN multiple quantum well vertical cavity surface emitting laser operating at room temperature.  

E-Print Network (OSTI)

Room temperature vertical cavity lasing at the wavelength of 433nm has been successfully realized in InxGa???xN/InyGa???yN multiple quantum well without Bragg mirrors under photo-excitation. At high excitation intensity, ...

Chen, Zhen


Ultralow nonalloyed Ohmic contact resistance to self aligned N-polar GaN high electron mobility transistors by In(Ga)N regrowth  

Science Conference Proceedings (OSTI)

Ultralow Ohmic contact resistance and a self-aligned device structure are necessary to reduce the effect of parasitic elements and obtain higher f{sub t} and f{sub max} in high electron mobility transistors (HEMTs). N-polar (0001) GaN HEMTs, offer a natural advantage over Ga-polar HEMTs, in terms of contact resistance since the contact is not made through a high band gap material [Al(Ga)N]. In this work, we extend the advantage by making use of polarization induced three-dimensional electron-gas through regrowth of graded InGaN and thin InN cap in the contact regions by plasma (molecular beam epitaxy), to obtain an ultralow Ohmic contact resistance of 27 OMEGA mum to a GaN 2DEG.

Dasgupta, Sansaptak; Nidhi,; Brown, David F.; Wu, Feng; Keller, Stacia; Speck, James S.; Mishra, Umesh K. [Department of ECE, University of California, Santa Barbara, California 93106 (United States) and Department of Materials, University of California, Santa Barbara, California 93106 (United States)



Materials physics and device development for improved efficiency of GaN HEMT high power amplifiers.  

SciTech Connect

GaN-based microwave power amplifiers have been identified as critical components in Sandia's next generation micro-Synthetic-Aperture-Radar (SAR) operating at X-band and Ku-band (10-18 GHz). To miniaturize SAR, GaN-based amplifiers are necessary to replace bulky traveling wave tubes. Specifically, for micro-SAR development, highly reliable GaN high electron mobility transistors (HEMTs), which have delivered a factor of 10 times improvement in power performance compared to GaAs, need to be developed. Despite the great promise of GaN HEMTs, problems associated with nitride materials growth currently limit gain, linearity, power-added-efficiency, reproducibility, and reliability. These material quality issues are primarily due to heteroepitaxial growth of GaN on lattice mismatched substrates. Because SiC provides the best lattice match and thermal conductivity, SiC is currently the substrate of choice for GaN-based microwave amplifiers. Obviously for GaN-based HEMTs to fully realize their tremendous promise, several challenges related to GaN heteroepitaxy on SiC must be solved. For this LDRD, we conducted a concerted effort to resolve materials issues through in-depth research on GaN/AlGaN growth on SiC. Repeatable growth processes were developed which enabled basic studies of these device layers as well as full fabrication of microwave amplifiers. Detailed studies of the GaN and AlGaN growth of SiC were conducted and techniques to measure the structural and electrical properties of the layers were developed. Problems that limit device performance were investigated, including electron traps, dislocations, the quality of semi-insulating GaN, the GaN/AlGaN interface roughness, and surface pinning of the AlGaN gate. Surface charge was reduced by developing silicon nitride passivation. Constant feedback between material properties, physical understanding, and device performance enabled rapid progress which eventually led to the successful fabrication of state of the art HEMT transistors and amplifiers.

Kurtz, Steven Ross; Follstaedt, David Martin; Wright, Alan Francis; Baca, Albert G.; Briggs, Ronald D.; Provencio, Paula Polyak; Missert, Nancy A.; Allerman, Andrew Alan; Marsh, Phil F.; Koleske, Daniel David; Lee, Stephen Roger; Shul, Randy John; Seager, Carleton Hoover; Tigges, Christopher P.



X-ray diffraction analysis and scanning micro-Raman spectroscopy of structural irregularities and strains deep inside the multilayered InGaN/GaN heterostructure  

SciTech Connect

High-resolution X-ray diffraction analysis and scanning confocal Raman spectroscopy are used to study the spatial distribution of strains in the In{sub x}Ga{sub 1-x}N/GaN layers and structural quality of these layers in a multilayered light-emitting diode structure produced by metal-organic chemical vapor deposition onto (0001)-oriented sapphire substrates. It is shown that elastic strains almost completely relax at the heterointerface between the thick GaN buffer layer and In{sub x}Ga{sub 1-x}N/GaN buffer superlattice. It is established that the GaN layers in the superlattice are in a stretched state, whereas the alloy layers are in a compressed state. In magnitude, the stretching strains in the GaN layers are lower than the compressive strains in the InGaN layers. It is shown that, as compared to the buffer layers, the layers of the superlattice contain a smaller number of dislocations and the distribution of dislocations is more randomly disordered. In micro-Raman studies on scanning through the thickness of the multilayered structure, direct evidence is obtained for the asymmetric gradient distributions of strains and crystal imperfections of the epitaxial nitride layers along the direction of growth. It is shown that the emission intensity of the In{sub x}Ga{sub 1-x}N quantum well is considerably (more than 30 times) higher than the emission intensity of the GaN barrier layers, suggesting the high efficiency of trapping of charge carriers by the quantum well.

Strelchuk, V. V., E-mail: Strelch@isp.kiev.ua; Kladko, V. P.; Avramenko, E. A.; Kolomys, O. F.; Safryuk, N. V.; Konakova, R. V. [National Academy of Sciences of Ukraine, Lashkaryov Institute of Semiconductor Physics (Ukraine); Yavich, B. S., E-mail: byavich@soptel.ru [ZAO Svetlana-Optoelectronics (Russian Federation); Valakh, M. Ya.; Machulin, V. F.; Belyaev, A. E. [National Academy of Sciences of Ukraine, Lashkaryov Institute of Semiconductor Physics (Ukraine)



Dynamic Model of Hydrogen in GaN  

NLE Websites -- All DOE Office Websites (Extended Search)

Dynamic Model of Hydrogen in GaN by S. M. Myers and A. F. Wright Motivation-Hydrogen is incorporated into p-type GaN during MOCVD growth, producing highly stable passivation of the Mg acceptors. Complete acceptor activation by thermal H release requires temperatures that threaten material integrity, prompting compromises in device processing. At lower temperatures, forward bias of p-n junctions or electron-beam irradiation produces a metastable, reversible activation without H release. To understand and control such effects, we are developing a mathematical model of H behavior wherein state energies from density-functional theory are employed in diffusion-reaction equations. Previously, we used the greatly simplifying assumptions of local equilibrium among states

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GaN Metal Oxide Semiconductor Field Effect Transistors  

SciTech Connect

A GaN based depletion mode metal oxide semiconductor field effect transistor (MOSFET) was demonstrated using Ga{sub 2}O{sub 3}(Gd{sub 2}O{sub 3}) as the gate dielectric. The MOS gate reverse breakdown voltage was > 35V which was significantly improved from 17V of Pt Schottky gate on the same material. A maximum extrinsic transconductance of 15 mS/mm was obtained at V{sub ds} = 30 V and device performance was limited by the contact resistance. A unity current gain cut-off frequency, f{sub {tau}}, and maximum frequency of oscillation, f{sub max} of 3.1 and 10.3 GHz, respectively, were measured at V{sub ds} = 25 V and V{sub gs} = {minus}20 V.

Ren, F.; Pearton, S.J.; Abernathy, C.R.; Baca, A.; Cheng, P.; Shul, R.J.; Chu, S.N.G.; Hong, M.; Lothian, J.R.; Schurman, M.J.



Method of plasma etching GA-based compound semiconductors  

DOE Patents (OSTI)

A method of plasma etching Ga-based compound semiconductors includes providing a process chamber and a source electrode adjacent thereto. The chamber contains a Ga-based compound semiconductor sample in contact with a platen which is electrically connected to a first power supply, and the source electrode is electrically connected to a second power supply. SiCl.sub.4 and Ar gases are flowed into the chamber. RF power is supplied to the platen at a first power level, and RF power is supplied to the source electrode. A plasma is generated. Then, RF power is supplied to the platen at a second power level lower than the first power level and no greater than about 30 W. Regions of a surface of the sample adjacent to one or more masked portions of the surface are etched at a rate of no more than about 25 nm/min to create a substantially smooth etched surface.

Qiu, Weibin; Goddard, Lynford L.



Method of plasma etching Ga-based compound semiconductors  

SciTech Connect

A method of plasma etching Ga-based compound semiconductors includes providing a process chamber and a source electrode adjacent to the process chamber. The process chamber contains a sample comprising a Ga-based compound semiconductor. The sample is in contact with a platen which is electrically connected to a first power supply, and the source electrode is electrically connected to a second power supply. The method includes flowing SiCl.sub.4 gas into the chamber, flowing Ar gas into the chamber, and flowing H.sub.2 gas into the chamber. RF power is supplied independently to the source electrode and the platen. A plasma is generated based on the gases in the process chamber, and regions of a surface of the sample adjacent to one or more masked portions of the surface are etched to create a substantially smooth etched surface including features having substantially vertical walls beneath the masked portions.

Qiu, Weibin; Goddard, Lynford L.



A GaAs transceiver chip for optical data transmission  

SciTech Connect

The present article describes a transceiver VLSI chip for optical data transmission, at 1 Gbit/s (1.4 Gbit/s in selected production), made in GaAs technology. The transceiver makes the parallel-to-serial and serial-to-parallel conversion as well as the encoding and decoding of 32 bit data words. The circuit operates in a completely asynchronous mode, allowing the possibility of switching on-off the transmission in few nsec and of using the transceiver not only in point-to-point topologies, but also in flooding topologies (i.e. star connections). The radiation hardness and the relatively low power consumption, respect to TTL, of the GaAs, extend the use of the chip to a large number of applications in present and future high energy physics experimental apparatus.

Mirabelli, G.; Petrolo, E.; Valente, E. (Ist. Nazionale di Fisica Nucleare, Roma (Italy)); Cardarelli, R.; Santonico, R. (Sezione di Roma 2 and Univ. di Roma (Italy). Ist. Nazionale di Fisica Nucleare); Ferrer, M.L. (Lab. Nazionali di Frascati (Italy). Ist. Nazionale di Fisica Nucleare)



AlGaAs diode pumped tunable chromium lasers  

DOE Patents (OSTI)

An all-solid-state laser system is disclosed wherein the laser is pumped in the longwave wing of the pump absorption band. By utilizing a laser material that will accept unusually high dopant concentrations without deleterious effects on the crystal lattice one is able to compensate for the decreased cross section in the wing of the absorption band, and the number of pump sources which can be used with such a material increases correspondingly. In a particular embodiment a chromium doped colquiriite-structure crystal such as Cr:LiSrAlF.sub.6 is the laser material. The invention avoids the problems associated with using AlGaInP diodes by doping the Cr:LiSrAlF.sub.6 heavily to enable efficient pumping in the longwave wing of the absorption band with more practical AlGaAs diodes.

Krupke, William F. (Pleasanton, CA); Payne, Stephen A. (Castro Valley, CA)



CsBr/GaN Heterojunction Photoelectron Source  

Science Conference Proceedings (OSTI)

Experimental results on a new CsBr/GaN heterojunction photocathode structure are presented. The results indicate a fourfold improvement in photoyield relative to CsBr/Cr photocathodes. A model is presented based on intraband states in CsBr and electron injection from the GaN (with 1% addition of indium) substrate to explain the observed photoyield enhancement. The photocathode lifetime at high current density (>40 A/cm{sup 2}) is limited by laser heating of the small illuminated area. Calculations are presented for sapphire and diamond substrates, indicating a factor of 20 reduction in temperature for the latter. The results are encouraging for the realization of a high photoyield photocathode operating at high current density with long lifetime.

Maldonado, J.R.; /Stanford U., Elect. Eng. Dept.; Liu, Z.; Sun, Y.; /SLAC, SSRL; Schuetter, S.; /Wisconsin U., Madison; Pianetta, P.; /SLAC, SSRL; Pease, R.F.W.; /Stanford U., Elect. Eng. Dept.



Low energy electron beam induced vacancy activation in GaN  

Science Conference Proceedings (OSTI)

Experimental evidence on low energy electron beam induced point defect activation in GaN grown by metal-organic vapor phase epitaxy (MOVPE) is presented. The GaN samples are irradiated with a 5-20 keV electron beam of a scanning electron microscope and investigated by photoluminescence and positron annihilation spectroscopy measurements. The degradation of the band-to-band luminescence of the irradiated GaN films is associated with the activation of point defects. The activated defects were identified as in-grown Ga-vacancies. We propose that MOVPE-GaN contains a significant concentration of passive V{sub Ga}-H{sub n} complexes that can be activated by H removal during low energy electron irradiation.

Nykaenen, H.; Suihkonen, S.; Sopanen, M. [Department of Micro- and Nanosciences, Aalto University, P.O. Box 13500, FI-00076 Aalto (Finland); Kilanski, L. [Department of Applied Physics, Aalto University, P.O. Box 11100, FI-00076 Aalto (Finland); Institute of Physics, Polish Academy of Sciences, Al. Lotnikow 32/56, 02-668 Warsaw (Poland); Tuomisto, F. [Department of Applied Physics, Aalto University, P.O. Box 11100, FI-00076 Aalto (Finland)



Low-cost, high-efficiency solar cells utilizing GaAs-on-Si technology  

DOE Green Energy (OSTI)

This report describes work to develop technology to deposit GaAs on Si using a nucleation layer of atomic-layer-epitaxy-grown GaAs or AlAs on Si. This ensures two-dimensional nucleation and should lead to fewer defects in the final GaAs layer. As an alternative, we also developed technology for depositing GaAs on sawtooth-patterned Si. Preliminary studies showed that this material can have a very low defect density, [approximately] 1 [times] 10[sup 5] cm[sup [minus]5], as opposed to our conventionally grown GaAs on SL which has a typical defect density of over 1 [times]10[sup 7] cm[sup [minus]2]. Using these two now methods of GaAs-on-Si material growth, we made solar cells that are expected to show higher efficiencies than those of previous cells.

Vernon, S.M. (Spire Corp., Bedford, MA (United States))



Desferal (DFO) induced Ga-67 washout from normal tissue, tumor and abscess in experimental animals  

Science Conference Proceedings (OSTI)

In the experimental animal, desferal (DFO) given intravenously washes out Ga-67 from all tissues. This effect is not uniform: blood activity is reduced very markedly, while liver activity is less affected. Maximal effect of DFO occurs if given close to the Ga-67 injection. When the time interval between the two is increased, the absolute amount of Ga-67 excreted in the urine in excess of the spontaneous excretion is reduced. Administration of DFO does not effect Ga-67 gastrointestinal excretion. In three animal tumor models (EMT-6 sarcoma in Balb/c mice, spontaneous adenocarcinoma in mice, and spontaneous adenocarcinoma in the rabbit) and in sterile abscess-bearing rats, the administration of DFO 24 hrs after Ga-67-citrate improves significantly the target-to-nontarget ratio. Animals given 50 mg/kg DFO I.V. after Ga-67 citrate showed a significant reduction in the whole-body activity as seen in a one-week follow up.

Oster, Z.H.; Som, P.; Atkins, H.L.; Brill, A.B.



UV-Photoassisted Etching of GaN in KOH  

SciTech Connect

The etch rate of GaN under W-assisted photoelectrochemical conditions in KOH solutions is found to be a strong function of illumination intensity, solution molarity, sample bias and material doping level. At low e-h pair generation rates, grain boundaries are selectively etched, while at higher illumination intensities etch rates for unintentionally doped (n - 3x 10^12Gcm-3) GaN are 2 1000 .min-l. The etching is diffusion limited under our conditions with an activation energy of - 0.8kCal.mol-1. The etched surfaces are rough, but retain their stoichiometry. PEC etching is found to selectively reveal grain boundaries in GaN under low light illumination conditions. At high lamp powers the rates increase with sample temperature and the application of bias to the PEC cell, while they go through a maximum with KOH solution molarity. The etching is diffusion-limited, producing rough surface morphologies that are suitable in a limited number of device fabrication steps. The surfaces however appear to remain relatively close to their stoichiometric composition.

Abernathy, C.R.; Auh, K.H.; Cho, H.; Donovan, S.M.; Han, J.; Lambers, E.S.; Pearton, S.J.; Ren F.; Shul, R.J.



Comparative study of GaN growth process by MOVPE  

SciTech Connect

A comparative study of two different MOVPE reactors used for GaN growth is presented. Computational fluid dynamics (CFD) was used to determine common gas phase and fluid flow behaviors within these reactors. This paper focuses on the common thermal fluid features of these two MOVPE reactors with different geometries and operating pressures that can grow device-quality GaN-based materials. The study clearly shows that several growth conditions must be achieved in order to grow high quality GaN materials. The high-temperature gas flow zone must be limited to a very thin flow sheet above the susceptor, while the bulk gas phase temperature must be very low to prevent extensive pre-deposition reactions. These conditions lead to higher growth rates and improved material quality. A certain range of gas flow velocity inside the high-temperature gas flow zone is also required in order to minimize the residence time and improve the growth uniformity. These conditions can be achieved by the use of either a novel reactor structure such as a two-flow approach or by specific flow conditions. The quantitative ranges of flow velocities, gas phase temperature, and residence time required in these reactors to achieve high quality material and uniform growth are given.

Sun, J.; Redwing, J.M.; Kuech, T.F.



Low-temperature magnetization of (Ga,Mn) As semiconductors  

E-Print Network (OSTI)

We report on a comprehensive study of the ferromagnetic moment per Mn atom in (Ga,Mn)As ferromagnetic semiconductors. Theoretical discussion is based on microscopic calculations and on an effective model of Mn local moments antiferromagnetically coupled to valence band hole spins. The validity of the effective model over the range of doping studied is assessed by comparing with microscopic tight-binding/coherent-potential approximation calculations. Using the virtual crystal k center dot p model for hole states, we evaluate the zero-temperature mean-field contributions to the magnetization from the hole kinetic and exchange energies, and magnetization suppression due to quantum fluctuations of Mn moment orientations around their mean-field ground state values. Experimental low-temperature ferromagnetic moments per Mn are obtained by superconducting quantum interference device and x-ray magnetic circular dichroism measurements in a series of (Ga,Mn)As semiconductors with nominal Mn doping ranging from similar to 2 to 8%. Hall measurements in as-grown and annealed samples are used to estimate the number of uncompensated substitutional Mn moments. Based on our comparison between experiment and theory we conclude that all these Mn moments in high quality (Ga,Mn)As materials have nearly parallel ground state alignment.

Jungwirth, T.; Masek, J.; Wang, KY; Edmonds, KW; Sawicki, M.; Polini, M.; Sinova, Jairo; MacDonald, AH; Campion, RP; Zhao, LX; Farley, NRS; Johal, TK; van der Laan, G.; Foxon, CT; Gallagher, BL.



Substrate misorientation effects on epitaxial GaInAsSb  

DOE Green Energy (OSTI)

The effect of substrate misorientation on the growth of GaInAsSb was studied for epilayers grown lattice-matched to GaSb substrates by low-pressure organometallic vapor phase epitaxy. The substrates were (100) misoriented 2 or 6{degree} toward (110), (111)A, or (111)B. The surface is mirror-like and featureless for layers grown with a 6{degree} toward (111)B misorientation, while, a slight texture was observed for layers grown on all other misorientations. The optical quality of layers, as determined by the full width at half-maximum of photoluminescence spectra measured at 4K, is significantly better for layers grown on substrates with a 6{degree} toward (111)B misorientation. The incorporation of Zn as a p-type dopant in GaInAsSb is about 1.5 times more efficient on substrates with 6{degree} toward (111)B misorientation compared to 2{degree} toward (110) misorientation. The external quantum efficiency of thermophotovoltaic devices is not, however, significantly affected by substrate misorientation.

Wang, C.A.; Choi, H.K.; Oakley, D.C. [Massachusetts Inst. of Tech., Lexington, MA (United States). Lincoln Lab.; Charache, G.W. [Lockheed Martin Corp., Schenectady, NY (United States)



Subpicosecond spin relaxation in GaAsSb multiple quantum wells K. C. Hall,a)  

E-Print Network (OSTI)

Subpicosecond spin relaxation in GaAsSb multiple quantum wells K. C. Hall,a) S. W. Leonard, and H quantum wells are measured at 295 K using time-resolved circular dichroism induced by 1.5 m, 100 fs pulses times shorter than those in InGaAs and InGaAsP wells with similar band gaps. The shorter relaxation

Van Driel, Henry M.


Quaternary Bismide Alloy ByGa1-yAs1-xBix Lattice Matched to GaAs  

DOE Green Energy (OSTI)

We report on the lattice matched quaternary alloy, B{sub y}Ga{sub 1-y}As{sub 1-x}Bi{sub x} grown by molecular beam epitaxy at conditions conducive to bismuth incorporation. Incorporating a smaller atom (boron) along with the larger atom (bismuth) allows for a reduction of the epi-layer strain and lattice matching to GaAs for compositions of Bi:B{approx_equal}1.3:1. The addition of boron flux does not significantly affect the bismuth incorporation and no change in the band gap energy is observed with increasing boron content. However, excess, non-substitutional boron is incorporated which leads to an increase in hole density, as well as an increase in the density of shallow in-gap states as observed by the loss of localization of photo-excited excitons.

Deaton, D. A.; Ptak, A. J.; Alberi, K.; Mascarenhas, A.



Impact of proton irradiation on dc performance of AlGaN/GaN high electron mobility transistors  

Science Conference Proceedings (OSTI)

The effects of proton irradiation dose on dc characteristics and the reliability of AlGaN/GaN high electron mobility transistors (HEMTs) were investigated. The HEMTs were irradiated with protons at a fixed energy of 5 MeV and doses ranging from 109 to 2 1014 cm-2. For the dc characteristics, there was only minimal degradation of saturation drain current (IDSS), transconductance (gm), electron mobility and sheet carrier concentration at doses below 2 1013 cm-2, while the reduction of these parameters were 15%, 9%, 41% and 16.6%, respectively, at a dose of 2 1014 cm-2. At this same dose condition, increases of 37% in drain breakdown voltage (VBR) and of 45% in critical voltage (Vcri) were observed. The improvement of device reliability was attributed to the modification of the depletion region due to the introduction of a higher density of defects after irradiation at a higher dose.

Liu, L. [University of Florida, Gainesville; Cuervo, C.V. [University of Florida, Gainesville; Xi, Y. Y. [University of Florida, Gainesville; Ren, F. [University of Florida; Pearton, S. J. [University of Florida; Kim, H.-Y. [Korea University; Kim, J. [Korea University; Kravchenko, Ivan I [ORNL



Harmonic Responses in 2DEG AlGaAs/GaAs HEMT Devices Due to Plasma Wave Interaction  

Science Conference Proceedings (OSTI)

Plasma waves are oscillations of electron density in time and space, and in deep submicron field effect transistors, typical plasma frequencies, omega{sub p}, lie in the terahertz range and do not involve any quantum transitions. Hence, using plasma wave excitation for detection and/or generation of THz oscillations is a very promising approach. In this paper, the investigation of plasma wave interaction between the plasma waves propagating in a short-channel High-Electron-Mobility Transistor (HEMT) and the radiated electromagnetic waves was carried out. Experimentally, we have demonstrated the detection of the terahertz (THz) radiation by an AlGaAs/GaAs HEMT up to third harmonic at room temperature and their resonant responses show very good agreement with the calculated results.

Hashim, A. M.; Alias, Q. I. [Faculty of Electrical Engineering, Universiti Teknologi Malaysia, 81310 Skudai, Johor (Malaysia); Kasai, S.; Hasegawa, H. [Research Center for Integrated Quantum Electronics, Hokkaido University North 12 West 8, Sapporo 060-8628 (Japan)



Ultra-shallow quantum dots in an undoped GaAs/AlGaAs two-dimensional electron gas  

SciTech Connect

We report quantum dots fabricated on very shallow 2-dimensional electron gases, only 30 nm below the surface, in undoped GaAs/AlGaAs heterostructures grown by molecular beam epitaxy. Due to the absence of dopants, an improvement of more than one order of magnitude in mobility (at 2 Multiplication-Sign 10{sup 11} cm{sup -2}) with respect to doped heterostructures with similar depths is observed. These undoped wafers can easily be gated with surface metallic gates patterned by e-beam lithography, as demonstrated here from single-level transport through a quantum dot showing large charging energies (up to 1.75 meV) and excited state energies (up to 0.5 meV).

Mak, W. Y.; Sfigakis, F.; Beere, H. E.; Farrer, I.; Griffiths, J. P.; Jones, G. A. C.; Ritchie, D. A. [Cavendish Laboratory, University of Cambridge, Cambridge (United Kingdom)] [Cavendish Laboratory, University of Cambridge, Cambridge (United Kingdom); Das Gupta, K. [Cavendish Laboratory, University of Cambridge, Cambridge (United Kingdom) [Cavendish Laboratory, University of Cambridge, Cambridge (United Kingdom); Department of Physics, Indian Institute of Technology Bombay, Mumbai 400076 (India); Klochan, O.; Hamilton, A. R. [School of Physics, University of New South Wales, Sydney (Australia)] [School of Physics, University of New South Wales, Sydney (Australia)



Terrestrial Concentrator PV Modules Based on GaInP/GaAs/Ge TJ Cells and Minilens Panels  

SciTech Connect

This paper is a description of research activity in the field of cost-effective modules realizing the concept of very high solar concentration with small-aperture area Fresnel lenses and multijunction III-V cells. Structural simplicity and 'all-glass' design are the guiding principles of the corresponding development. The advanced concentrator modules are made with silicone Fresnel lens panels (from 8 up to 144 lenses, each lens is 4 times 4 cm{sup 2} in aperture area) with composite structure. GaInP/GaAs/Ge triple-junction cells with average efficiencies of 31.1 and 34.7% at 1000 suns were used for the modules. Conversion efficiency as high as 26.3% has been measured indoors in a test module using a newly developed large-area solar simulator.

Rumyantsev, V. D.; Sadchikov, N. A.; Chalov, A. E.; Ionova, E. A.; Friedman, D. J.; Glenn, G.



Reliability of GaN HEMTs: Electrical and Radiation-induced Failure ...  

Science Conference Proceedings (OSTI)

Symposium, Advanced Materials for Power Electronics, Power Conditioning, and Power Conversion II. Presentation Title, Reliability of GaN HEMTs: Electrical...

Note: This page contains sample records for the topic "ga ia mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


M4, Semipolar AlGaN Buffers for Deep Ultraviolet Diode Lasers  

Science Conference Proceedings (OSTI)

On-axis reciprocal space mapping of the graded AlGaN showed tilt at each interface associated ..... New Concepts and Materials for Solar Power Conversion


Solidification and Microstructure Evaluation of the Ni-Ga and Co-Ni ...  

Science Conference Proceedings (OSTI)

Ni-Ga binary system is thus one of the basic binary system which forms the dominated ? ... The Effects of Natural and Marangoni Convection on the Resultant...


Structure and Composition Peculiarities of GaN/AlN Multiple ...  

Science Conference Proceedings (OSTI)

Thickness of AlN and GaN layers in MQWs (multiple quantum wells) were ... InAs Quantum Dots by Ballistic Electron Emission Microscopy and Spectroscopy.


Thermoelectric Study of InGaN-Based Materials for Thermal Energy ...  

Science Conference Proceedings (OSTI)

Presentation Title, Thermoelectric Study of InGaN-Based Materials for Thermal ... Structural and Thermal Stability Properties of Cellulose Nanocomposites with...


X-Ray Studies of GaN Film Grown on Si Using Electrochemical Deposition Techniques  

Science Conference Proceedings (OSTI)

This paper reports on the X-ray studies of GaN thin films deposited on Si (111) substrate at different current density using electrochemical deposition technique. The structural properties of GaN films were studied by X-ray diffraction (XRD). XRD analysis showed that hexagonal wurtzite and cubic zinc blende GaN phases were both deposited on Si (111). The lattice constants, the average size of h-GaN crystals and the in-plane (along a-axis) and out of plane (along c-axis) strains were calculated from XRD analysis.

Al-Heuseen, K.; Hashim, M. R. [Nano-Optoelectronics Research and Technology Laboratory School of Physics, Universiti Sains Malaysia (USM), 11800 Minden, Penang (Malaysia)



A Paleoenvironmental Study of the 2.7 GA Tumbiana Formation, Fortescue Basin, Western Australia.  

E-Print Network (OSTI)

??A paleoecological and paleoenvironmental study was conducted on the 2.7 Ga Meentheena Member of the Tumbiana Formation, Fortescue Basin, Western Australia. It involved the integrated (more)

Coffey, Jessica



Cu-Ga-Se Thin Films Prepared by a Combination of Electrodeposition and Evaporation Techniques  

Science Conference Proceedings (OSTI)

Cu-Ga-Se thin films were prepared using a combination of electrodeposition and evaporation techniques. A Cu-Se/Mo/glass precursor thin film was first prepared by galvanostatic electrodeposition. On top of this film three different thicknesses of Ga were deposited by evaporation. The Cu-Ga-Se thin films were formed by annealing the Ga/Cu-Se/Mo/glass thin film configuration in a tubular chamber with Se powder, at different temperatures. Thin films were characterized by X-ray diffraction (XRD), photocurrent spectroscopy (PS), inductively coupled plasma (ICP) analysis, and scanning electron microscopy (SEM). The detailed analysis from X-ray reveals that after annealing at 550 C the CuGaSe{sub 2} phase is formed when the thickness of Ga is 0.25 {mu}m, however at 0.5 {mu}m and 1.0 {mu}m Ga the formation of CuGa{sub 3}Se{sub 5} and CuGa{sub 5}Se{sub 8} phases is observed respectively. Band gap values were obtained using photocurrent spectroscopy.

Fernandez, A. M.; Turner, J. A.



Effect of Mg ionization efficiency on performance of Npn AlGaN/GaN heterojunction bipolar transistors  

SciTech Connect

A drift-diffusion transport model has been used to examine the performance capabilities of AlGaN/GaN Npn heterojunction bipolar transistors (HBTs). The Gummel plot from the first GaN-based HBT structure recently demonstrated is adjusted with simulation by using experimental mobility and lifetime reported in the literature. Numerical results have been explored to study the effect of the p-type Mg doping and its incomplete ionization in the base. The high base resistance induced by the deep acceptor level is found to be the cause of limiting current gain values. Increasing the operating temperature of the device activates more carriers in the base. An improvement of the simulated current gain by a factor of 2 to 4 between 25 and 300 C agrees well with the reported experimental results. A preliminary analysis of high frequency characteristics indicates substantial progress of predicted rf performances by operating the device at higher temperature due to a reduced extrinsic base resistivity.




Plasma chemistries for dry etching GaN, AlN, InGaN and InAlN  

DOE Green Energy (OSTI)

Etch rates up to 7,000 {angstrom}/min. for GaN are obtained in Cl{sub 2}/H{sub 2}/Ar or BCl{sub 3}/Ar ECR discharges at 1--3mTorr and moderate dc biases. Typical rates with HI/H{sub 2} are about a factor of three lower under the same conditions, while CH{sub 4}/H{sub 2} produces maximum rates of only {approximately}2,000 {angstrom}/min. The role of additives such as SF{sub 6}, N{sub 2}, H{sub 2} or Ar to the basic chlorine, bromine, iodine or methane-hydrogen plasma chemistries are discussed. Their effect can be either chemical (in forming volatile products with N) or physical (in breaking bonds or enhancing desorption of the etch products). The nitrides differ from conventional III-V`s in that bond-breaking to allow formation of the etch products is a critical factor. Threshold ion energies for the onset of etching of GaN, InGaN and InAlN are {ge} 75 eV.

Pearton, S.J.; Vartuli, C.B.; Lee, J.W.; Donovan, S.M.; MacKenzie, J.D.; Abernathy, C.R. [Univ. of Florida, Gainesville, FL (United States); Shul, R.J. [Sandia National Labs., Albuquerque, NM (United States); McLane, G.F. [Army Research Lab., Fort Monmouth, NJ (United States); Ren, F. [AT and T Bell Labs., Murray Hill, NJ (United States)



Electron and hole gas in modulation-doped GaAs/Al{sub 1-x}Ga{sub x}As radial heterojunctions  

Science Conference Proceedings (OSTI)

We perform self-consistent Schroedinger-Poisson calculations with exchange and correlation corrections to determine the electron and hole gas in a radial heterojunction formed in a GaAs/AlGaAs core-multi-shell nanowire, which is either n- or p-doped. We show that the electron and hole gases can be tuned to different localizations and symmetries inside the core as a function of the doping density/gate potential. Contrary to planar heterojunctions, conduction electrons do not form a uniform 2D electron gas (2DEG) localized at the GaAs/AlGaAs interface, but rather show a transition between an isotropic, cylindrical distribution deep in the GaAs core (low doping) and a set of six tunnel-coupled quasi-1D channels at the edges of the interface (high doping). Holes, on the other hand, are much more localized at the GaAs/AlGaAs interface. At low doping, they present an additional localization pattern with six separated 2DEGs strips. The field generated by a back-gate may easily deform the electron or hole gas, breaking the sixfold symmetry. Single 2DEGs at one interface or multiple quasi-1D channels are shown to form as a function of voltage intensity, polarity, and carrier type.

Bertoni, Andrea; Royo, Miquel; Mahawish, Farah; Goldoni, Guido [CNR-NANO S3, Istituto Nanosci