Powered by Deep Web Technologies
Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Institut fur Solartechnologien GmbH IST | Open Energy Information  

Open Energy Info (EERE)

Institut fur Solartechnologien GmbH IST Institut fur Solartechnologien GmbH IST Jump to: navigation, search Name Institut fur Solartechnologien GmbH (IST) Place Frankfurt, Germany Zip D-15236 Sector Solar Product Solar technology research institute, founded in 1994. Coordinates 50.112065°, 8.683415° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.112065,"lon":8.683415,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alphakat GmbH | Open Energy Information  

Open Energy Info (EERE)

Alphakat GmbH Jump to: navigation, search Name: Alphakat GmbH Place: Germany Product: Developer of technology to convert waste to biodiesel. References: Alphakat GmbH1 This...


ETEC GmbH | Open Energy Information  

Open Energy Info (EERE)

ETEC GmbH Jump to: navigation, search Name: ETEC GmbH Place: Germany Sector: Services Product: General Financial & Legal Services ( Government Public sector ) References: ETEC...


Energiequelle GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: Energiequelle GmbH Place: Kallinchen, Germany Zip: 57000 Sector: Wind energy Product: Feasibility, development, financing,...


IBH GmbH | Open Energy Information  

Open Energy Info (EERE)

IBH GmbH Jump to: navigation, search Name: IBH GmbH Place: Germany Sector: Services Product: General Financial & Legal Services ( Academic Research foundation ) References: IBH...


Target GmbH | Open Energy Information  

Open Energy Info (EERE)

Target GmbH Jump to: navigation, search Name: Target GmbH Place: Germany Sector: Efficiency, Solar Product: German company with interests in solar and energy efficiency....


Keys to Effectively Create Realistic Fur in Autodesk Maya.  

E-Print Network [OSTI]

?? The tools for creating realistic fur using a computer have continued to develop sincethe first computer-generated fur was accomplished. Tools for creating fur can (more)

Normann, Annica



SCHOTT Solar GmbH formerly RWE Schott Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Solar GmbH formerly RWE Schott Solar GmbH Solar GmbH formerly RWE Schott Solar GmbH Jump to: navigation, search Name SCHOTT Solar GmbH (formerly RWE Schott Solar GmbH) Place Alzenau, Germany Zip 63755 Sector Solar Product German integrated PV manufacturer who also makes receivers for Solar Thermal Electricity Generation (STEG) projects. References SCHOTT Solar GmbH (formerly RWE Schott Solar GmbH)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. SCHOTT Solar GmbH (formerly RWE Schott Solar GmbH) is a company located in Alzenau, Germany . References ↑ "SCHOTT Solar GmbH (formerly RWE Schott Solar GmbH)" Retrieved from "http://en.openei.org/w/index.php?title=SCHOTT_Solar_GmbH_formerly_RWE_Schott_Solar_GmbH&oldid=3506


B T Umwelt Gmbh | Open Energy Information  

Open Energy Info (EERE)

Umwelt Gmbh Jump to: navigation, search Name: B+T Umwelt Gmbh Place: Germany Zip: 35418 Product: German project developer specialising in Waste-To-Energy plants. References: B+T...


Steca GmbH | Open Energy Information  

Open Energy Info (EERE)

search Name: Steca GmbH Place: Memmingen, Germany Zip: 87700 Sector: Solar Product: German-based company, Steca GmbH, develops and produces electronic modules - high technology...


Enbion GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Place: Lneburg, Germany Zip: 21335 Sector: Solar Product: Germany-based biogas and solar project developer. References: Enbion GmbH1 This article is a stub. You...


Perspectives GmbH | Open Energy Information  

Open Energy Info (EERE)

Perspectives GmbH Jump to: navigation, search Name: Perspectives GmbH Place: Hamburg, Germany Zip: 22045 Product: Germany-based consultancy focusing on CDMJI projects as well as...


Mithril GmbH | Open Energy Information  

Open Energy Info (EERE)

Mithril GmbH Jump to: navigation, search Name: Mithril GmbH Place: Germany Sector: Solar Product: Mithril is a German investment company controlled by Immo Strher who has been...


Projekt GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: Projekt GmbH Place: Oldenburg, Germany Zip: 26127 Sector: Wind energy Product: Wind energy company co-developer. Coordinates: 53.138699,...


Santon GmbH | Open Energy Information  

Open Energy Info (EERE)

Santon GmbH Jump to: navigation, search Name: Santon GmbH Place: Nettetal, Germany Sector: Solar Product: Germany-based division focused on switch technology and electro-mechanical...


Mi GmbH | Open Energy Information  

Open Energy Info (EERE)

Mi GmbH Jump to: navigation, search Name: Mi GmbH Place: Switzerland Zip: CH-6340 Sector: Solar Product: Baar-based manufacturer and distributor of fruit juices. The firm is also...


Sustainable Heat Power Europe GmbH formerly Solar Heat Power Europe GmbH |  

Open Energy Info (EERE)

Heat Power Europe GmbH formerly Solar Heat Power Europe GmbH Heat Power Europe GmbH formerly Solar Heat Power Europe GmbH Jump to: navigation, search Name Sustainable Heat & Power Europe GmbH (formerly Solar Heat & Power Europe GmbH) Place Hamburg, Schleswig-Holstein, Germany Sector Solar Product Engineering company involved in the project development, design and construction of solar thermal, PV and biogas power plants. References Sustainable Heat & Power Europe GmbH (formerly Solar Heat & Power Europe GmbH)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sustainable Heat & Power Europe GmbH (formerly Solar Heat & Power Europe GmbH) is a company located in Hamburg, Schleswig-Holstein, Germany .


Wingas Gmbh | Open Energy Information  

Open Energy Info (EERE)

Wingas Gmbh Wingas Gmbh Jump to: navigation, search Name Wingas Gmbh Place Kassel, Germany Zip D-34119 Product String representation "Joint venture o ... age facilities." is too long. Coordinates 51.311788°, 9.491211° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.311788,"lon":9.491211,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solar Kabel GmbH | Open Energy Information  

Open Energy Info (EERE)

Kabel GmbH Jump to: navigation, search Name: Solar-Kabel GmbH Place: Germany Sector: Solar Product: Germany-based solar PV cable manufacturer. References: Solar-Kabel GmbH1 This...


Inventus GmbH | Open Energy Information  

Open Energy Info (EERE)

Bergheim, Germany Zip: 50127 Sector: Wind energy Product: Produces custom wind generators for domestic-scale applications. References: Inventus GmbH1 This article is a...

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Maka Windkraft GmbH | Open Energy Information  

Open Energy Info (EERE)

Windkraft GmbH Jump to: navigation, search Name: Maka Windkraft GmbH Place: 33034, Germany Sector: Wind energy Product: Wind farm developer in Germany References: Maka...


BIOHAUS PV Handels GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: BIOHAUS PV Handels GmbH Place: Paderborn, Germany Zip: 33100 Product: Distributor of Isofoton PV products in Germany. Coordinates:...


ADAPT Elektronik GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: ADAPT Elektronik GmbH Place: Grobheubach, Germany Zip: 63920 Sector: Solar Product: Germany-based manufacturer of electronic connector...


E-Print Network 3.0 - arbeitsgemeinschaft versuchsreaktor gmbh...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Kompetenzzentrum ,,holz.bau.forschungs.gmbh... .securityresearch.at Kompetenzzentrum Automobil- und Industrie-Elektronik GmbH (KAI) ... Source: Technische Universitt Graz,...


Solar Engineering Decker Mack GmbH | Open Energy Information  

Open Energy Info (EERE)

Decker Mack GmbH Jump to: navigation, search Name: Solar Engineering Decker & Mack GmbH Place: Hannover, Germany Zip: 30165 Sector: Services, Solar Product: Firm providing...


Meridian Solare Energieprojekte GmbH | Open Energy Information  

Open Energy Info (EERE)

Energieprojekte GmbH Jump to: navigation, search Name: Meridian Solare Energieprojekte GmbH Place: Germany Sector: Solar Product: Solar power project developer. References:...


Enova GmbH | Open Energy Information  

Open Energy Info (EERE)

Enova GmbH Enova GmbH Place Bunderhee, Germany Zip 26831 Sector Renewable Energy, Wind energy Product Offers renewable energy counselling, production and acts as a project developer, focused on wind. References Enova GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Enova GmbH is a company located in Bunderhee, Germany . References ↑ "Enova GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Enova_GmbH&oldid=344968" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load)


Superwind GmbH | Open Energy Information  

Open Energy Info (EERE)

Superwind GmbH Superwind GmbH Jump to: navigation, search Name Superwind GmbH Place Bruhl, Germany Zip 50321 Sector Wind energy Product Superwind GmbH manufactures small wind generators for professional use. Coordinates 49.3951°, 8.53485° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.3951,"lon":8.53485,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Zebotec GmbH | Open Energy Information  

Open Energy Info (EERE)

Zebotec GmbH Zebotec GmbH Jump to: navigation, search Name Zebotec GmbH Place Konstanz, Germany Zip 78462 Sector Hydro, Hydrogen, Services Product zebotec GmbH offers services in the field of fuel cells and hydrogen technology. Coordinates 47.663855°, 9.17758° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.663855,"lon":9.17758,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solvis GmbH | Open Energy Information  

Open Energy Info (EERE)

Zip: 38112 Sector: Solar Product: Manufactures and markets solar collectors, hot water tanks and heating. References: Solvis GmbH1 This article is a stub. You can help OpenEI by...


ENERCON GmbH | Open Energy Information  

Open Energy Info (EERE)

towers and other components for its range of multi-megawatt direct drive wind turbines. References: ENERCON GmbH1 This article is a stub. You can help OpenEI by...


Loher GmbH | Open Energy Information  

Open Energy Info (EERE)

Wind energy Product: The world's second largest supplier of generators for large wind turbines. References: Loher GmbH1 This article is a stub. You can help OpenEI by...


Sykonec GmbH | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: Sykonec GmbH Place: NeustadtCoburg, Baden-Wrttemberg, Germany Zip: 96465 Sector: Solar Product: Germany-based manufacturer of ready-to-install...


Suntrace GmbH | Open Energy Information  

Open Energy Info (EERE)

Hamburg-based company focused on the development, investment, operation and ownership of Solar Thermal Power Plants. References: Suntrace GmbH1 This article is a stub. You can...


Solitem GmbH | Open Energy Information  

Open Energy Info (EERE)

Germany Zip: 52072 Sector: Solar Product: Environmental technology group, specialising in solar thermal. References: Solitem GmbH1 This article is a stub. You can help OpenEI by...


Des Grune Emissionshaus DGE GmbH | Open Energy Information  

Open Energy Info (EERE)

Solar, Wind energy Product: Des Grune Emissionshaus (DGE) GmbH is a financier of German wind and solar projects. References: Des Grune Emissionshaus (DGE) GmbH1 This...


Gold SolarWind GmbH | Open Energy Information  

Open Energy Info (EERE)

Gold SolarWind GmbH Place: Aiterhofen, Germany Zip: 94330 Sector: Wind energy Product: German project developer of PV and wind plants. References: Gold SolarWind GmbH1 This...


SiG Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

SiG Solar GmbH Jump to: navigation, search Name: SiG Solar GmbH Place: Stuhr-Brinkum, Germany Zip: 28816 Sector: Solar Product: Supplier of mounting systems, and trade name in...


AVG Koeln GmbH | Open Energy Information  

Open Energy Info (EERE)

AVG Koeln GmbH Jump to: navigation, search Name: AVG Koeln GmbH Place: Kln, Germany Zip: 50735 Product: Operating a Waste-to-Energy facility in Kln, Germany. References:...


Westport Germany GmbH | Open Energy Information  

Open Energy Info (EERE)

Westport Germany GmbH Jump to: navigation, search Name: Westport Germany GmbH Place: Germany Sector: Hydro, Hydrogen Product: Germany-based, regional office of Westport Innovations...

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Anton Gensler GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: Anton Gensler GmbH Place: Steinbach-Hallenberg, Germany Zip: D-98587 Product: Germany-based manufacturer of electrical cables and connectors....


ALSTOM Ballard GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: ALSTOM Ballard GmbH Place: Mannheim, Hessen, Germany Zip: D-68309 Product: Germany-based, JV of ALSTOM and Ballard Generation Systems...


Consulting Kontor GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: Consulting Kontor GmbH Place: Hamburg, Hamburg, Germany Zip: D-20457 Sector: Wind energy Product: Small Germany based firm doing consultancy...


Galip Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Galip Solar GmbH Jump to: navigation, search Name: Galip Solar GmbH Place: Germany Sector: Services, Solar Product: Germany-based solar project developer, offering end user...


EnerSys GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Jump to: navigation, search Name: EnerSys GmbH Place: Bietigheim-Bissingen, Germany Zip: D-74321 Sector: Wind energy Product: Provides turnkey windfarm planning in...


Eolic Power GmbH | Open Energy Information  

Open Energy Info (EERE)

Eolic Power GmbH Jump to: navigation, search Name: Eolic Power GmbH Place: Bremen, Germany Zip: 28195 Sector: Wind energy Product: Germany-based company that is developing the...


AVANCIS GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

GmbH Co KG Jump to: navigation, search Name: AVANCIS GmbH & Co KG Place: Torgau, Germany Product: Germany-based CIS PV cell manufacturer and subsidiary of Saint Gobain....


SiLas GmbH | Open Energy Information  

Open Energy Info (EERE)

SiLas GmbH Jump to: navigation, search Name: SiLas GmbH Place: Germany Product: Laser technology development enterprise specialising in the processing of thin-film silicon coating....


DeWind GmbH | Open Energy Information  

Open Energy Info (EERE)

DeWind GmbH Place: Lubeck, Germany Zip: D - 23569 Sector: Wind energy Product: Germany-based large scale wind turbine manufacturer. References: DeWind GmbH1 This article is a...


Solarmarkt Solar Sued Park GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Place: Memmingen, Bavaria, Germany Zip: 87700 Sector: Solar Product: Bavaria-based solar PV system installer. References: Solarmarkt Solar Sued Park GmbH1 This article is...


GWU Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: GWU Solar GmbH Place: Germany Sector: Solar Product: Solar PV and thermal system manufacturers. References: GWU Solar GmbH1 This article is a...


Green Energy World GmbH | Open Energy Information  

Open Energy Info (EERE)

Green Energy World GmbH Place: Germany Sector: Renewable Energy, Solar, Wind energy Product: Green Energy World GmbH is a service provider in the field of renewable energies. As a...


WEB Windenergie GmbH | Open Energy Information  

Open Energy Info (EERE)

WEB Windenergie GmbH Jump to: navigation, search Name: WEB Windenergie GmbH Place: Germany Sector: Wind energy Product: Germany-based wind farm developer, charged with...


Flabeg GmbH co KG | Open Energy Information  

Open Energy Info (EERE)

Name: Flabeg GmbH & co KG Place: Nrnberg, Germany Zip: 90441 Sector: Solar Product: Glass finishing for automotive and solar industry, especially STEG. References: Flabeg GmbH...


Wellbury GmbH | Open Energy Information  

Open Energy Info (EERE)

Wellbury GmbH Wellbury GmbH Jump to: navigation, search Name Wellbury GmbH Place Vienna, Austria Zip 1010 Sector Biomass, Renewable Energy, Solar, Wind energy Product Vienna-based company engaged in the project development of renewable energy particularly wind, water, solar power and biomass. Coordinates 48.202548°, 16.368805° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.202548,"lon":16.368805,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gaskatel GmbH | Open Energy Information  

Open Energy Info (EERE)

Gaskatel GmbH Gaskatel GmbH Jump to: navigation, search Name Gaskatel GmbH Place Kassel, Hessen, Germany Zip D-34127 Sector Hydro, Hydrogen, Services Product String representation "A small Germany ... tancy services." is too long. Coordinates 51.311788°, 9.491211° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.311788,"lon":9.491211,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sunworx GmbH | Open Energy Information  

Open Energy Info (EERE)

Sunworx GmbH Sunworx GmbH Jump to: navigation, search Name Sunworx GmbH Place Lauf, Germany Zip 91207 Sector Solar Product Distributor of solar photovoltaic products. Coordinates 48.653172°, 8.126482° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.653172,"lon":8.126482,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


KOENEN GmbH | Open Energy Information  

Open Energy Info (EERE)

KOENEN GmbH KOENEN GmbH Jump to: navigation, search Name KOENEN GmbH Place Ottobrunn, Germany Zip 85521 Sector Solar Product German manufacturer of printing screens and accessories for electronics and solar industries. Coordinates 48.063605°, 11.66213° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.063605,"lon":11.66213,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DEIG GmbH | Open Energy Information  

Open Energy Info (EERE)

DEIG GmbH DEIG GmbH Jump to: navigation, search Name DEIG GmbH Place Berlin, Germany Zip 12489 Sector Renewable Energy Product Based in Berlin, Germany DEIG is a partnership of renewable project developers. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SBBiogas GmbH | Open Energy Information  

Open Energy Info (EERE)

SBBiogas GmbH SBBiogas GmbH Jump to: navigation, search Name SBBiogas GmbH Place Marktbreit, Bavaria, Germany Zip 97340 Sector Efficiency Product Bavarian-based biogas turnkey provider focusing on efficiency. Coordinates 49.66564°, 10.143285° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.66564,"lon":10.143285,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Innoferm GmbH | Open Energy Information  

Open Energy Info (EERE)

Innoferm GmbH Innoferm GmbH Jump to: navigation, search Name Innoferm GmbH Place Wilhelmshaven, Germany Zip 26382 Sector Biomass Product Distributor of PV productsa and installer of biomass heat systems for the residential and small commercial sector. Coordinates 53.51958°, 8.111685° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.51958,"lon":8.111685,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ZOPF GmbH | Open Energy Information  

Open Energy Info (EERE)

ZOPF GmbH ZOPF GmbH Jump to: navigation, search Name ZOPF GmbH Place Vehlow, Germany Zip 16866 Sector Biomass, Solar, Wind energy Product Project developer and operator with wind, solar and biomass concerns. Coordinates 53.010849°, 12.32692° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.010849,"lon":12.32692,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Forseo GmbH | Open Energy Information  

Open Energy Info (EERE)

Forseo GmbH Forseo GmbH Jump to: navigation, search Name forseo GmbH Place Freiburg, Baden-Württemberg, Germany Zip 79098 Sector Efficiency, Renewable Energy Product Faciliate investment in energy efficiency and renewable energy to accelerate commercialisation. Coordinates 47.99854°, 7.849655° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.99854,"lon":7.849655,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NAU GmbH | Open Energy Information  

Open Energy Info (EERE)

NAU GmbH NAU GmbH Jump to: navigation, search Name NAU GmbH Place Moosburg, Germany Zip 85368 Sector Solar Product Manufacturing solar passive water heating systems, and storage systems for oil and wood pellets. Coordinates 48.08627°, 9.597376° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.08627,"lon":9.597376,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Formaro GmbH | Open Energy Information  

Open Energy Info (EERE)

Formaro GmbH Formaro GmbH Jump to: navigation, search Name Formaro GmbH Place Netphen, North Rhine-Westphalia, Germany Zip 57250 Sector Renewable Energy, Solar Product Germany-based renewable energy components provider, specifically in the areas of PV and thermal solar. Coordinates 50.91454°, 8.099551° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.91454,"lon":8.099551,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Kreidl GmbH | Open Energy Information  

Open Energy Info (EERE)

Kreidl GmbH Kreidl GmbH Jump to: navigation, search Name Kreidl GmbH Place Kramsach, Austria Zip 6233 Sector Solar Product Installs wood pellet burners and solar passive water heating systems. Coordinates 47.447334°, 11.883548° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.447334,"lon":11.883548,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Volkswind GmbH | Open Energy Information  

Open Energy Info (EERE)

Volkswind GmbH Volkswind GmbH Jump to: navigation, search Name Volkswind GmbH Place Ganderkesee, Germany Zip D-27777 Sector Services, Wind energy Product Offers planning, development and wind farm management services. Coordinates 53.036035°, 8.545165° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.036035,"lon":8.545165,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Voegelin GmbH | Open Energy Information  

Open Energy Info (EERE)

Voegelin GmbH Voegelin GmbH Jump to: navigation, search Name Voegelin GmbH Place Flurlingen, Switzerland Zip CH-8247 Sector Solar Product Swiss-based PV and solar thermal system installer. Coordinates 47.68414°, 8.628247° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.68414,"lon":8.628247,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


BESTEC GmbH | Open Energy Information  

Open Energy Info (EERE)

BESTEC GmbH BESTEC GmbH Jump to: navigation, search Name BESTEC GmbH Place Kapsweyer, Rhineland-Palatinate, Germany Zip D-76889 Sector Geothermal energy Product A geothermal project builder and operator based in Germany. Coordinates 49.045205°, 8.020865° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.045205,"lon":8.020865,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Jms solar handel gmbh | Open Energy Information  

Open Energy Info (EERE)

Jms solar handel gmbh Jms solar handel gmbh Jump to: navigation, search Name jms solar handel gmbh Place Grainau, Bavaria, Germany Zip 82491 Sector Solar Product Bavaria-based wholesaler of PV modules and advisor to dealers and installers of solar-energy systems. Coordinates 47.474454°, 11.024443° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.474454,"lon":11.024443,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Helukabel GmbH | Open Energy Information  

Open Energy Info (EERE)

Helukabel GmbH Helukabel GmbH Jump to: navigation, search Name Helukabel GmbH Place Stuttgart, Germany Sector Wind energy Product Stuttgart-based manufacturer of cable solutions. The firm also produces PV junction boxes and wind turbine cables. Coordinates 48.767675°, 9.171925° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.767675,"lon":9.171925,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Amann GmbH | Open Energy Information  

Open Energy Info (EERE)

Amann GmbH Amann GmbH Jump to: navigation, search Name Amann GmbH Place Munich, Germany Zip 82008 Product A Building Management Systems specialist Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Dreisatz GmbH | Open Energy Information  

Open Energy Info (EERE)

Dreisatz GmbH Dreisatz GmbH Jump to: navigation, search Name Dreisatz GmbH Place Dresden, Saxony, Germany Sector Solar Product Dresden-based solar project developer. Coordinates 51.053645°, 13.740815° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.053645,"lon":13.740815,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wolf GmbH | Open Energy Information  

Open Energy Info (EERE)

Wolf GmbH Wolf GmbH Jump to: navigation, search Name Wolf GmbH Place Mainburg, Bavaria, Germany Zip 84048 Sector Biomass, Solar Product Supplier in the field of climate control and heating systems, ventilation, PV systems and solar thermal swimming pool heating, as well as biomass boilers. Coordinates 48.64122°, 11.78004° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.64122,"lon":11.78004,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Architecture of a Fur Binding Site: a Comparative Analysis  

Science Journals Connector (OSTI)

...configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F...the ability of Fur to recognize synthetic DNA sequences containing two to four...The ability of Fur to bind synthetic DNA fragments containing one to five...

Jennifer L. Lavrrar; Mark A. McIntosh



Gesture Recognition on a Smart Fur Robot Using a Dropout Neural Network to Analyze  

E-Print Network [OSTI]

The technology Smart Fur is a fur-like material. Smart Fur has built-in sensors that record the 2-dimensional in different ways, the overall resistance of the material changes. A picture of Smart Fur is shown in Figure 1 050 051 052 053 Gesture Recognition on a Smart Fur Robot Using a Dropout Neural Network to Analyze

de Freitas, Nando


Flagsol GmbH | Open Energy Information  

Open Energy Info (EERE)

Flagsol GmbH Flagsol GmbH Jump to: navigation, search Name Flagsol GmbH Place Koeln, Germany Zip 50667 Sector Solar Product German-based solar plant developer, Flagsol GmbH, is a 100% subsidiary of the solar project developer and manufacturer of solar plants, Solar Millennium AG. Coordinates 50.941655°, 6.955055° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.941655,"lon":6.955055,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Shell Solar GmbH formerly Siemens und Shell Solar GmbH | Open Energy  

Open Energy Info (EERE)

GmbH formerly Siemens und Shell Solar GmbH GmbH formerly Siemens und Shell Solar GmbH Jump to: navigation, search Name Shell Solar GmbH (formerly Siemens und Shell Solar GmbH) Place Munich, Bavaria, Germany Zip 80807 Sector Solar Product Manufacturer and distributor of solar energy equipment and products. Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aleo Solar GmbH formerly Solar Manufaktur Deutschland GmbH SMD | Open  

Open Energy Info (EERE)

GmbH formerly Solar Manufaktur Deutschland GmbH SMD GmbH formerly Solar Manufaktur Deutschland GmbH SMD Jump to: navigation, search Name Aleo Solar GmbH (formerly Solar Manufaktur Deutschland GmbH, SMD) Place Oldenburg, Germany Zip 26122 Product Produces crystalline silicon photovoltaic modules at a factory in Prenzlau, Germany. Coordinates 53.138699°, 8.21144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.138699,"lon":8.21144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Windland GmbH | Open Energy Information  

Open Energy Info (EERE)

Windland GmbH Windland GmbH Place Berlin, Germany Zip 12555 Sector Wind energy Product Wind farm developer and operator Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Maass Regenerative Energien GmbH founders | Open Energy Information  

Open Energy Info (EERE)

Maass Regenerative Energien GmbH founders Maass Regenerative Energien GmbH founders Jump to: navigation, search Name Maass Regenerative Energien GmbH founders Place Wesel, Germany Sector Solar Product Founders of the Wesel-based solar project company. References Maass Regenerative Energien GmbH founders[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Maass Regenerative Energien GmbH founders is a company located in Wesel, Germany . References ↑ "[ Maass Regenerative Energien GmbH founders]" Retrieved from "http://en.openei.org/w/index.php?title=Maass_Regenerative_Energien_GmbH_founders&oldid=348555" Categories: Clean Energy Organizations Companies Organizations Stubs What links here


Incubator Management GmbH | Open Energy Information  

Open Energy Info (EERE)

Management GmbH Management GmbH Jump to: navigation, search Name Incubator Management GmbH Place Austria Sector Services Product General Financial & Legal Services ( Private / family-controlled ) References Incubator Management GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Incubator Management GmbH is a company located in Austria . References ↑ "Incubator Management GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Incubator_Management_GmbH&oldid=346833" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties About us Disclaimers Energy blogs


Goldwind Windenergy GmbH | Open Energy Information  

Open Energy Info (EERE)

Windenergy GmbH Windenergy GmbH Jump to: navigation, search Name Goldwind Windenergy GmbH Place Saarbrück, Germany Zip 66115 Sector Wind energy Product Goldwind's German turbine base. References Goldwind Windenergy GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Goldwind Windenergy GmbH is a company located in Saarbrück, Germany . References ↑ "[ Goldwind Windenergy GmbH]" Retrieved from "http://en.openei.org/w/index.php?title=Goldwind_Windenergy_GmbH&oldid=345954" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Sunics Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Sunics Solar GmbH Sunics Solar GmbH Jump to: navigation, search Name Sunics Solar GmbH Place Nordhorn, Lower Saxony, Germany Zip 48529 Sector Solar Product German-based firm that is a supplier and general contractor for turnkey solar power plants. References Sunics Solar GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sunics Solar GmbH is a company located in Nordhorn, Lower Saxony, Germany . References ↑ "Sunics Solar GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Sunics_Solar_GmbH&oldid=351798" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link


Energy Competence Centre GmbH | Open Energy Information  

Open Energy Info (EERE)

Competence Centre GmbH Competence Centre GmbH Jump to: navigation, search Name Energy Competence Centre GmbH Place Berlin, Germany Zip 10709 Sector Wind energy Product Germany-based wind project developer with capacity to arrange third-party financing. References Energy Competence Centre GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Energy Competence Centre GmbH is a company located in Berlin, Germany . References ↑ "Energy Competence Centre GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Energy_Competence_Centre_GmbH&oldid=344839" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages


Mann Naturenergie GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Mann Naturenergie GmbH Co KG Mann Naturenergie GmbH Co KG Jump to: navigation, search Name Mann Naturenergie GmbH & Co.KG Place Langenbach/Ww, Rhineland-Palatinate, Germany Zip 57520 Sector Biofuels, Renewable Energy Product Mann Naturenergie is engaged in renewable energy production and distribution. It offers biofuels like wood chips, wood briquettes or vegetable oil but also technical expertise. References Mann Naturenergie GmbH & Co.KG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Mann Naturenergie GmbH & Co.KG is a company located in Langenbach/Ww, Rhineland-Palatinate, Germany . References ↑ "Mann Naturenergie GmbH & Co.KG" Retrieved from "http://en.openei.org/w/index.php?title=Mann_Naturenergie_GmbH_Co_KG&oldid=3486


DEE Deutsche Erneuerbare Energien GmbH | Open Energy Information  

Open Energy Info (EERE)

DEE Deutsche Erneuerbare Energien GmbH DEE Deutsche Erneuerbare Energien GmbH Jump to: navigation, search Name DEE - Deutsche Erneuerbare Energien GmbH Place Düsseldorf, Germany Zip 40215 Sector Biomass, Wind energy Product DEE is investing globally in equity of small and medium sized projects. At the moment DEE mainly focus on wind and biomass projects. References DEE - Deutsche Erneuerbare Energien GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. DEE - Deutsche Erneuerbare Energien GmbH is a company located in Düsseldorf, Germany . References ↑ "[ DEE - Deutsche Erneuerbare Energien GmbH]" Retrieved from "http://en.openei.org/w/index.php?title=DEE_Deutsche_Erneuerbare_Energien_GmbH&oldid=344


Plambeck Norderland GmbH | Open Energy Information  

Open Energy Info (EERE)

Norderland GmbH Norderland GmbH Jump to: navigation, search Name Plambeck Norderland GmbH Place Germany Sector Wind energy Product Germany-based firm focused on the acquisition and execution of onshore wind-farm projects. References Plambeck Norderland GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Plambeck Norderland GmbH is a company located in Germany . References ↑ "Plambeck Norderland GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Plambeck_Norderland_GmbH&oldid=349774" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Beck Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

Beck Energy GmbH Beck Energy GmbH Jump to: navigation, search Name Beck Energy GmbH Place Volkach-Dimbach, Germany Zip 97332 Sector Solar Product Germany-based turnkey PV plant installer; offers solar power investment programmes. References Beck Energy GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Beck Energy GmbH is a company located in Volkach-Dimbach, Germany . References ↑ "Beck Energy GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Beck_Energy_GmbH&oldid=342576" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Wallenborn Projektentwicklung GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Wallenborn Projektentwicklung GmbH Co KG Wallenborn Projektentwicklung GmbH Co KG Jump to: navigation, search Name Wallenborn Projektentwicklung GmbH & Co. KG Place Klipphausen OT Lampersdorf, Germany Zip 1665 Sector Solar, Wind energy Product Wallenborn Projektentwicklung is a wind and solar project developer. References Wallenborn Projektentwicklung GmbH & Co. KG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Wallenborn Projektentwicklung GmbH & Co. KG is a company located in Klipphausen OT Lampersdorf, Germany . References ↑ "Wallenborn Projektentwicklung GmbH & Co. KG" Retrieved from "http://en.openei.org/w/index.php?title=Wallenborn_Projektentwicklung_GmbH_Co_KG&oldid=352915


EAB Technology GmbH | Open Energy Information  

Open Energy Info (EERE)

Technology GmbH Technology GmbH Jump to: navigation, search Name EAB Technology GmbH Place Freiberg, Germany Zip 9559 Sector Wind energy Product Planning and development of wind farms, wind measurement, technical and commercial operations. References EAB Technology GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. EAB Technology GmbH is a company located in Freiberg, Germany . References ↑ "EAB Technology GmbH" Retrieved from "http://en.openei.org/w/index.php?title=EAB_Technology_GmbH&oldid=344397" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


Photovoltaic Experts GmbH | Open Energy Information  

Open Energy Info (EERE)

Photovoltaic Experts GmbH Photovoltaic Experts GmbH Jump to: navigation, search Name Photovoltaic Experts GmbH Place Germany Sector Services, Solar Product Germany-based company provides all services and products related to solar energy. References Photovoltaic Experts GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Photovoltaic Experts GmbH is a company located in Germany . References ↑ "Photovoltaic Experts GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Photovoltaic_Experts_GmbH&oldid=374821" Categories: Clean Energy Organizations Companies Organizations Stubs Photovoltaic What links here Related changes Special pages Printable version Permanent link


Ecosenergy GmbH JV | Open Energy Information  

Open Energy Info (EERE)

Ecosenergy GmbH JV Ecosenergy GmbH JV Jump to: navigation, search Name Ecosenergy GmbH JV Place Germany Sector Solar Product Germany-based Joint venture to develop solar PV projects. References Ecosenergy GmbH JV[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Ecosenergy GmbH JV is a company located in Germany . References ↑ "[ Ecosenergy GmbH JV]" Retrieved from "http://en.openei.org/w/index.php?title=Ecosenergy_GmbH_JV&oldid=344511" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load)


Herrenknecht Vertical GmbH | Open Energy Information  

Open Energy Info (EERE)

Herrenknecht Vertical GmbH Herrenknecht Vertical GmbH Jump to: navigation, search Name Herrenknecht Vertical GmbH Place Schwanau, Baden-Württemberg, Germany Zip 77961 Sector Geothermal energy Product Specialized company that builds vertical drilling equipment for the development of geothermal resources. References Herrenknecht Vertical GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Herrenknecht Vertical GmbH is a company located in Schwanau, Baden-Württemberg, Germany . References ↑ "Herrenknecht Vertical GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Herrenknecht_Vertical_GmbH&oldid=346498" Categories: Clean Energy Organizations Companies


Bernt Lorentz GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Bernt Lorentz GmbH Co KG Bernt Lorentz GmbH Co KG Jump to: navigation, search Name Bernt Lorentz GmbH & Co KG Place Henstedt-Ulzburg, Germany Zip D-24558 Sector Solar Product German manufacturer of solar tracking devices, water pumps, and related electronic and hydraulic components. References Bernt Lorentz GmbH & Co KG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Bernt Lorentz GmbH & Co KG is a company located in Henstedt-Ulzburg, Germany . References ↑ "Bernt Lorentz GmbH & Co KG" Retrieved from "http://en.openei.org/w/index.php?title=Bernt_Lorentz_GmbH_Co_KG&oldid=342681" Categories: Clean Energy Organizations Companies Organizations Stubs What links here


GTN Geothermie Neubrandenburg GmbH | Open Energy Information  

Open Energy Info (EERE)

GTN Geothermie Neubrandenburg GmbH GTN Geothermie Neubrandenburg GmbH Jump to: navigation, search Name GTN Geothermie Neubrandenburg GmbH Place Neubrandenburg, Germany Zip D-17033 Sector Geothermal energy Product Partners and works with companies designing geothermal energy plants and underground heat reservoirs. References GTN Geothermie Neubrandenburg GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. GTN Geothermie Neubrandenburg GmbH is a company located in Neubrandenburg, Germany . References ↑ "GTN Geothermie Neubrandenburg GmbH" Retrieved from "http://en.openei.org/w/index.php?title=GTN_Geothermie_Neubrandenburg_GmbH&oldid=346222" Categories: Clean Energy Organizations


ESK SIC GmbH | Open Energy Information  

Open Energy Info (EERE)

ESK SIC GmbH ESK SIC GmbH Jump to: navigation, search Name ESK-SIC GmbH Place Germany Zip D- 50226 Sector Solar Product Supplier of silicon carbide for wire saws, with some solar applications. References ESK-SIC GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. ESK-SIC GmbH is a company located in Germany . References ↑ "ESK-SIC GmbH" Retrieved from "http://en.openei.org/w/index.php?title=ESK_SIC_GmbH&oldid=345133" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation:


Allied Carbon Credit GmbH | Open Energy Information  

Open Energy Info (EERE)

Carbon Credit GmbH Carbon Credit GmbH Jump to: navigation, search Name Allied Carbon Credit GmbH Place Hessen, Germany Sector Carbon Product Frankfurt-based carbon advisory and consultancy firm. References Allied Carbon Credit GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Allied Carbon Credit GmbH is a company located in Hessen, Germany . References ↑ "Allied Carbon Credit GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Allied_Carbon_Credit_GmbH&oldid=342020" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


YellTec GmbH | Open Energy Information  

Open Energy Info (EERE)

YellTec GmbH YellTec GmbH Jump to: navigation, search Name YellTec GmbH Place Germany Sector Biofuels Product YellTec is a biofuels distribution company, based in Germany. References YellTec GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. YellTec GmbH is a company located in Germany . References ↑ "YellTec GmbH" Retrieved from "http://en.openei.org/w/index.php?title=YellTec_GmbH&oldid=353327" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties About us Disclaimers Energy blogs Linked Data Developer services OpenEI partners with a broad range of international organizations to grow


Berger Lichttechnik GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Berger Lichttechnik GmbH Co KG Berger Lichttechnik GmbH Co KG Jump to: navigation, search Name Berger Lichttechnik GmbH & Co KG Place Baierbrunn, Germany Zip D-82065 Sector Solar Product German manufacturer of solar simulators and measuring systems. References Berger Lichttechnik GmbH & Co KG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Berger Lichttechnik GmbH & Co KG is a company located in Baierbrunn, Germany . References ↑ "Berger Lichttechnik GmbH & Co KG" Retrieved from "http://en.openei.org/w/index.php?title=Berger_Lichttechnik_GmbH_Co_KG&oldid=342677" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fuhrlander Pfleiderer GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Pfleiderer GmbH Co KG Pfleiderer GmbH Co KG Jump to: navigation, search Name Fuhrlander-Pfleiderer GmbH & Co KG Place Germany Sector Wind energy Product Joint venture combining the wind power activities of Furhlander AG and Pfleiderer AG. References Fuhrlander-Pfleiderer GmbH & Co KG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Fuhrlander-Pfleiderer GmbH & Co KG is a company located in Germany . References ↑ "[ Fuhrlander-Pfleiderer GmbH & Co KG]" Retrieved from "http://en.openei.org/w/index.php?title=Fuhrlander_Pfleiderer_GmbH_Co_KG&oldid=345554" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


UTEC GmbH | Open Energy Information  

Open Energy Info (EERE)

UTEC GmbH UTEC GmbH Jump to: navigation, search Name UTEC GmbH Place Bremen, Germany Zip 28217 Sector Biomass, Services, Wind energy Product Bremen-based independent engineering consultants with operations across Germany. Involved in project development and other engineering services in wind, biomass, biogas and passive energy savings. Coordinates 53.075166°, 8.804667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.075166,"lon":8.804667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ATG GmbH | Open Energy Information  

Open Energy Info (EERE)

ATG GmbH ATG GmbH Jump to: navigation, search Name ATG GmbH Place Glött, Germany Zip 89353 Sector Vehicles Product Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel-Operating Vehicles to Straight Vegetable Oil. Coordinates 10.43443°, -61.418079° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":10.43443,"lon":-61.418079,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energiebau Solarstromsysteme GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Place: Kln, Germany Zip: 50829 Sector: Efficiency, Solar Product: A German system provider and wholesaler for solar power and energy efficiency projects....


Conergy Renewable Services GmbH | Open Energy Information  

Open Energy Info (EERE)

Conergy Renewable Services GmbH Place: Hamburg, Germany Zip: 20537 Sector: Renewable Energy, Services Product: Provides operational management services for renewable energy...


Solar Promotion International GmbH | Open Energy Information  

Open Energy Info (EERE)

Solar Promotion International GmbH Place: Pforzheim, Germany Zip: 75172 Sector: Solar Product: German organiser of global solar conferences. References: Solar Promotion...


Solar Energy Trading GmbH SET | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Solar Energy Trading GmbH (SET) Place: Mnster, Germany Zip: 48157 Sector: Solar Product: Germany-based solar project developer and...


Plan 8 GmbH | Open Energy Information  

Open Energy Info (EERE)

Plan 8 GmbH Place: Eckernfrde, Schleswig-Holstein, Germany Zip: 24340 Sector: Wind energy Product: Eckernfrde-based company that provides project planning to development in...


SeeBA Energiesysteme GmbH | Open Energy Information  

Open Energy Info (EERE)

Name: SeeBA Energiesysteme GmbH Place: Stemwede, Germany Zip: 32351 Sector: Wind energy Product: Wind energy project developer, from planning through to implementation and...


KlimaINVEST Management GmbH | Open Energy Information  

Open Energy Info (EERE)

Management GmbH Place: Hamburg, Germany Zip: 20095 Product: Hamburg based investment company targeting emerging market leaders and projects mitigating climate change....


Flore Fuetterer Solarbeteiligungen GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Place: Mecklenburg-Western Pomerania, Germany Sector: Solar Product: Private investment group with stakes in several major German solar companies. References: Flore...


Sharp Electronics Europe GmbH | Open Energy Information  

Open Energy Info (EERE)

Europe GmbH Europe GmbH Jump to: navigation, search Name Sharp Electronics (Europe) GmbH Place Hamburg, Germany Zip 20097 Sector Solar Product German-based company Sharp Electronics GmbH is an electric appliance maker and a manufacturer of solar photovoltaic materials and systems. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PowerWind GmbH | Open Energy Information  

Open Energy Info (EERE)

PowerWind GmbH PowerWind GmbH Jump to: navigation, search Name PowerWind GmbH Place Hamburg, Germany Zip 20457 Sector Wind energy Product PowerWind GmbH is a German manufacturer and service provider of wind turbines. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SunTechnics GmbH | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: SunTechnics GmbH Place: Hamburg, Germany Zip: 20537 Product: German PV turn-key supplier and installer, wtih offices all over the world. References:...


Meihui Windpark GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

GmbH & Co KG Place: Niedersachsen, Lower Saxony, Germany Sector: Wind energy Product: German-based wind farm operator, previously in ownership of Taiwan's InfraVest Wind Power...


AgriKomp GmbH | Open Energy Information  

Open Energy Info (EERE)

Germany Zip: D-91732 Product: A major German and international group specializing in biogas plants. Subdidiaries France, Italy, Czech Rep, Poland References: agriKomp GmbH1...


Sudwind Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

Sector: Services, Wind energy Product: Provides engineering services in the area of wind turbines. References: Sudwind Energy GmbH1 This article is a stub. You can help OpenEI by...


Schmid Silicon Technology GmbH SST | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name: Schmid Silicon Technology GmbH (SST) Place: Freudenstadt, Germany Zip: D-72250 Sector: Solar Product: Germany-based technology provider for high-end...


Windtest Kaiser Wilhelm Koog GmbH | Open Energy Information  

Open Energy Info (EERE)

Kaiser-Wilhelm-Koog GmbH Place: Kaiser-Wilhelm-Koog, Germany Zip: 25709 Sector: Wind energy Product: Germany-based wind turbine measurement and quality inspection company....


Johanna Solar Technology GmbH JST | Open Energy Information  

Open Energy Info (EERE)

Product: German manufacturer of copper-indium-gallium-sulphide-selenium (CIGSSe) thin-film solar modules. References: Johanna Solar Technology GmbH (JST)1 This article is a...

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ASi Industries GmbH | Open Energy Information  

Open Energy Info (EERE)

Zip: D-99310 Product: Manufacturer of monocrystalline ingots and wafers for the photovoltaics industry. References: ASi Industries GmbH1 This article is a stub. You can help...


Bull Solar GmbH Bull Holding AG | Open Energy Information  

Open Energy Info (EERE)

GmbH (Bull Holding AG) Place: North Rhine-Westphalia, Germany Sector: Solar Product: German solar installer. References: Bull Solar GmbH (Bull Holding AG)1 This article is a...


B A S Biogas Anlagen Systeme GmbH | Open Energy Information  

Open Energy Info (EERE)

A S Biogas Anlagen Systeme GmbH Jump to: navigation, search Name: B.A.S. Biogas Anlagen Systeme GmbH Place: Tellingstedt, Schleswig-Holstein, Germany Zip: 25782 Product: B.A.S....


InnoVent InfraVest GmbH | Open Energy Information  

Open Energy Info (EERE)

InfraVest GmbH Jump to: navigation, search Name: InnoVentInfraVest GmbH Place: Varel, Germany Zip: 26316 Sector: Wind energy Product: Wind farm project developer based in Germany....


Wurth Solar GmbH Co KG Wuerth Solar | Open Energy Information  

Open Energy Info (EERE)

Wurth Solar GmbH Co KG Wuerth Solar Jump to: navigation, search Name: Wurth Solar GmbH & Co KG (Wuerth Solar) Place: Schwabisch Hall, Baden-Wrttemberg, Germany Zip: D-74523...


Sonnen Solar Park GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

search Name: Sonnen Solar Park GmbH & Co KG Place: Germany Sector: Solar Product: 1.75MW solar PV park in Bavaria, developed by Voltwerk. References: Sonnen Solar Park GmbH & Co...


Siemens Nuclear Power GmbH AREVA Nuclear Power | Open Energy...  

Open Energy Info (EERE)

Nuclear Power GmbH AREVA Nuclear Power Jump to: navigation, search Name: Siemens Nuclear Power GmbH (AREVA Nuclear Power) Place: Erlangen, Germany Zip: 91058 Sector: Services...


BE Geothermal GmbH | Open Energy Information  

Open Energy Info (EERE)

BE Geothermal GmbH BE Geothermal GmbH Jump to: navigation, search Name BE Geothermal GmbH Place Munich, Bavaria, Germany Zip 80807 Sector Geothermal energy Product Munich-based geothermal project developer Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Windw rts Energie GmbH | Open Energy Information  

Open Energy Info (EERE)

Windw rts Energie GmbH Windw rts Energie GmbH Jump to: navigation, search Name Windwärts Energie GmbH Place Hannover, Germany Zip 30449 Sector Solar, Wind energy Product Wind and solar energy project developer. Coordinates 52.372278°, 9.738157° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.372278,"lon":9.738157,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Europartner Solar GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Europartner Solar GmbH Co KG Europartner Solar GmbH Co KG Jump to: navigation, search Name Europartner-Solar GmbH & Co KG Place Wurzburg, Bavaria, Germany Zip 97074 Sector Solar Product Wurzburg-based solar equipment provider for PV systems. Coordinates 49.792775°, 9.936395° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.792775,"lon":9.936395,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fronius International GmbH | Open Energy Information  

Open Energy Info (EERE)

Fronius International GmbH Fronius International GmbH Jump to: navigation, search Name Fronius International GmbH Place Wels-Thalheim, Austria Zip 4600 Sector Solar Product Focused on welding systems, solar inverters and battery chargers. Coordinates 48.15308°, 14.03049° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.15308,"lon":14.03049,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PvXchange GmbH | Open Energy Information  

Open Energy Info (EERE)

PvXchange GmbH PvXchange GmbH Jump to: navigation, search Name pvXchange GmbH Place Berlin, Germany Zip 10963 Sector Services Product A German platform for PV module spot trades. Also provides data on spot prices and offers consulting services. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ostwind technic GmbH founders | Open Energy Information  

Open Energy Info (EERE)

GmbH founders GmbH founders Jump to: navigation, search Name Ostwind technic GmbH founders Place Regensburg, Germany Sector Wind energy Product Founders of German company that operates wind energy plants and farms. Coordinates 49.01492°, 12.10173° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.01492,"lon":12.10173,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ACI ecotec GmbH | Open Energy Information  

Open Energy Info (EERE)

ACI ecotec GmbH ACI ecotec GmbH Jump to: navigation, search Name ACI-ecotec GmbH Place Zimmern, Thuringia, Germany Zip 78658 Product Germany-based PV equipment design and manufacturing company. Coordinates 51.007519°, 11.626786° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.007519,"lon":11.626786,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Azur Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Azur Solar GmbH Azur Solar GmbH Jump to: navigation, search Name Azur Solar GmbH Place Wangen, Germany Zip 88239 Sector Solar Product Supplies solar mounting systems and complete PV systems, using concentrator solar modules. Coordinates 47.19128°, 8.896405° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.19128,"lon":8.896405,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


8KU Renewables GmbH | Open Energy Information  

Open Energy Info (EERE)

KU Renewables GmbH KU Renewables GmbH Jump to: navigation, search Name 8KU Renewables GmbH Place Berlin, Germany Zip 10117 Sector Renewable Energy Product Berlin-based start-up renewables investment firm. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GEE Energy GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

GEE Energy GmbH Co KG GEE Energy GmbH Co KG Jump to: navigation, search Name GEE Energy GmbH & Co. KG Place Hamburg, Germany Zip 20459 Sector Biomass Product Biomass trader delivering wood pellets, wood and bark briquettes to Germany, Scandinavia, Austria, Italy and Switzerland. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Jonas Redmann GmbH | Open Energy Information  

Open Energy Info (EERE)

Jonas Redmann GmbH Jonas Redmann GmbH Jump to: navigation, search Name Jonas & Redmann GmbH Place Berlin, Germany Zip 10553 Product German engineer of PV cell handling systems. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PowerBlades GmbH | Open Energy Information  

Open Energy Info (EERE)

PowerBlades GmbH PowerBlades GmbH Jump to: navigation, search Name PowerBlades GmbH Place Lemwerder, Hamburg, Germany Zip 27809 Sector Wind energy Product Developement and production of in-house offshore rotor blades for wind energy turbines. Coordinates 53.160455°, 8.61374° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.160455,"lon":8.61374,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


R bsamen Windenergie GmbH | Open Energy Information  

Open Energy Info (EERE)

bsamen Windenergie GmbH bsamen Windenergie GmbH Jump to: navigation, search Name Rübsamen Windenergie GmbH Place Halstenbek, Germany Zip D-25469 Sector Wind energy Product Wind energy project developer, owner and operator. Service group active in Germany and France. Coordinates 53.634558°, 9.84078° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.634558,"lon":9.84078,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BMP Biomasse Projekt GmbH | Open Energy Information  

Open Energy Info (EERE)

BMP Biomasse Projekt GmbH BMP Biomasse Projekt GmbH Jump to: navigation, search Name BMP Biomasse Projekt GmbH Place Radolfzell, Germany Zip 78315 Sector Biomass Product Germany-based biomass project developer and operator. Coordinates 47.74493°, 8.97017° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.74493,"lon":8.97017,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EPURON GmbH formerly Voltwerk AG | Open Energy Information  

Open Energy Info (EERE)

EPURON GmbH formerly Voltwerk AG EPURON GmbH formerly Voltwerk AG Jump to: navigation, search Name EPURON GmbH (formerly Voltwerk AG) Place Hamburg, Germany Zip 20537 Sector Solar, Wind energy Product Develops, finances, implements and operates solar, wind and biogas power projects. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AS Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH GmbH Jump to: navigation, search Name AS Solar GmbH Place Niedersachsen, Lower Saxony, Germany Sector Solar Product AS Solar is a German integrated solar energy systems wholeseller that maintains a strategic focus on Germany, Italy, and Spain. Coordinates 52.5947°, 9.13939° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.5947,"lon":9.13939,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


K C Schmidt GmbH Gbr | Open Energy Information  

Open Energy Info (EERE)

Schmidt GmbH Gbr Schmidt GmbH Gbr Jump to: navigation, search Name K+C Schmidt GmbH / Gbr Place Grevenbroich, Germany Zip 41516 Sector Wind energy Product Real estate company, with some activities in wind and PV project development, ownership and operation. Coordinates 51.08931°, 6.59033° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.08931,"lon":6.59033,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Umwelt Sonne Energie GmbH USE | Open Energy Information  

Open Energy Info (EERE)

Umwelt Sonne Energie GmbH USE Umwelt Sonne Energie GmbH USE Jump to: navigation, search Name Umwelt Sonne Energie GmbH (USE) Place Holzgerlingen, Baden-Württemberg, Germany Zip 71088 Sector Solar Product German solar integrator and distributor based in Holzgerlingen, near Stuttgart. Coordinates 48.636665°, 9.011795° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.636665,"lon":9.011795,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AE E Lentjes GmbH | Open Energy Information  

Open Energy Info (EERE)

Lentjes GmbH Lentjes GmbH Jump to: navigation, search Name AE&E Lentjes GmbH Place Ratingen, Germany Zip 40880 Sector Biomass Product Process and turnkey plant engineering of fossil fuel, biomass and waste to energy plants. Coordinates 51.29715°, 6.848095° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.29715,"lon":6.848095,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ib vogt GmbH | Open Energy Information  

Open Energy Info (EERE)

Ib vogt GmbH Ib vogt GmbH Jump to: navigation, search Name ib vogt GmbH Place Berlin, Germany Zip 10587 Product German engineering firm specialising in PV manufacturing plants. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geo X GmbH | Open Energy Information  

Open Energy Info (EERE)

X GmbH X GmbH Jump to: navigation, search Name Geo X GmbH Place Landau, Germany Zip 76829 Sector Geothermal energy Product Germany-based geothermal project developer. Coordinates 48.672821°, 12.69422° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.672821,"lon":12.69422,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


3P Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

Energy GmbH Energy GmbH Jump to: navigation, search Name 3P-Energy GmbH Place Schwerin, Mecklenburg-Western Pomerania, Germany Zip 19061 Product Develops novel, miniaturised direct methanol fuel cells based on a patented membrane for portable applications. Coordinates 53.625925°, 11.416545° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.625925,"lon":11.416545,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A f GmbH | Open Energy Information  

Open Energy Info (EERE)

a+f GmbH a+f GmbH Place Wurzberg, Germany Zip D-97076 Product The SunCarrier is a tracker-system for PV modules der a+f GmbH. Coordinates 48.286678°, 13.73149° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.286678,"lon":13.73149,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Projekt Oekovest GmbH | Open Energy Information  

Open Energy Info (EERE)

Oekovest GmbH Oekovest GmbH Jump to: navigation, search Name Projekt Oekovest GmbH Place Oldenburg, Germany Zip 26127 Sector Services, Wind energy Product String representation "Projekt Oekoves ... ices providers." is too long. Coordinates 53.138699°, 8.21144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.138699,"lon":8.21144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ramgraber Semiconductor Equipment GmbH | Open Energy Information  

Open Energy Info (EERE)

Ramgraber Semiconductor Equipment GmbH Ramgraber Semiconductor Equipment GmbH Jump to: navigation, search Name Ramgraber Semiconductor Equipment GmbH Place Brunnthal, Germany Zip 85649 Sector Solar Product Makes semiconductor processing equipment, including solar cell manufacturing lines. Coordinates 48.006898°, 11.684687° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.006898,"lon":11.684687,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nordwind Energieanlagen GmbH | Open Energy Information  

Open Energy Info (EERE)

Nordwind Energieanlagen GmbH Nordwind Energieanlagen GmbH Jump to: navigation, search Name Nordwind Energieanlagen GmbH Place Neubrandenburg, Mecklenburg-Western Pomerania, Germany Zip 17033 Sector Hydro, Wind energy Product Neubrandenburg-headquartered developer and producer of two-bladed wind turbines with hydrostatic drives. Coordinates 53.558425°, 13.26123° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.558425,"lon":13.26123,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


KACO Geraetetechnik GmbH | Open Energy Information  

Open Energy Info (EERE)

Geraetetechnik GmbH Geraetetechnik GmbH Jump to: navigation, search Name KACO Geraetetechnik GmbH Place Neckarsulm, Germany Zip 74172 Sector Solar Product Provides inverters and power electronics, including voltage stabilisers and systems monitoring, with a particular focus on products for solar power applications. Coordinates 49.192528°, 9.225127° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.192528,"lon":9.225127,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PROKON Nord Energiesysteme GmbH | Open Energy Information  

Open Energy Info (EERE)

Energiesysteme GmbH Energiesysteme GmbH Jump to: navigation, search Name PROKON Nord Energiesysteme GmbH Place Leer, Lower Saxony, Germany Zip 26789 Sector Biomass, Wind energy Product Germany-based developer of wind and biomass energy power plants. Coordinates 45.197795°, -83.728994° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.197795,"lon":-83.728994,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alpensolar Einkauf GmbH | Open Energy Information  

Open Energy Info (EERE)

Alpensolar Einkauf GmbH Alpensolar Einkauf GmbH Jump to: navigation, search Name Alpensolar Einkauf GmbH Place Dietmannsried, Germany Zip 87463 Sector Solar Product Germany-based supplier of solar components and PV junction boxes. Coordinates 47.808827°, 10.289951° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.808827,"lon":10.289951,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ideematec Deutschland GmbH | Open Energy Information  

Open Energy Info (EERE)

Ideematec Deutschland GmbH Ideematec Deutschland GmbH Jump to: navigation, search Name Ideematec Deutschland GmbH Place Wallerfing, Germany Zip 94574 Sector Solar Product Manufacturer of solar tracking and mounting systems. Coordinates 48.684251°, 12.88043° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.684251,"lon":12.88043,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Notus Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

Notus Energy GmbH Notus Energy GmbH Jump to: navigation, search Name Notus Energy GmbH Place Potsdam, Brandenburg, Germany Zip 14469 Sector Wind energy Product A German company that specializes in the development of wind farm projects and plans to diversify into the fuel cell technology. Coordinates 52.399355°, 13.047931° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.399355,"lon":13.047931,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ostwind technic GmbH | Open Energy Information  

Open Energy Info (EERE)

technic GmbH technic GmbH Jump to: navigation, search Name Ostwind technic GmbH Place Regensburg, Germany Zip 4703 Sector Wind energy Product Based in Bockelwitz, Germany. Owns and operates wind energy plants and farms. Coordinates 49.01492°, 12.10173° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.01492,"lon":12.10173,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Windstream Energieumwandlung GmbH | Open Energy Information  

Open Energy Info (EERE)

Windstream Energieumwandlung GmbH Windstream Energieumwandlung GmbH Jump to: navigation, search Name Windstream Energieumwandlung GmbH Place Bremen, Germany Zip 28195 Sector Wind energy Product Wind energy project developer. Coordinates 53.075166°, 8.804667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.075166,"lon":8.804667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MDP Wiemken GmbH | Open Energy Information  

Open Energy Info (EERE)

MDP Wiemken GmbH MDP Wiemken GmbH Jump to: navigation, search Name MDP & Wiemken GmbH Place Neuschoo, Germany Zip 26487 Sector Solar, Wind energy Product Wind, biogas and solar project developer. Coordinates 53.574875°, 7.51469° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.574875,"lon":7.51469,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bayer Raach GmbH | Open Energy Information  

Open Energy Info (EERE)

Raach GmbH Raach GmbH Jump to: navigation, search Name Bayer & Raach GmbH Place Gauingen, Baden-Württemberg, Germany Zip 88529 Sector Solar Product German-based solar installation company. Coordinates 48.240898°, 9.43676° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.240898,"lon":9.43676,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Weier Electric GmbH | Open Energy Information  

Open Energy Info (EERE)

Weier Electric GmbH Weier Electric GmbH Jump to: navigation, search Name Weier Electric GmbH Place Eutin, Germany Zip 23701 Sector Wind energy Product Manufacturer of advanced generators for use in wind turbines. Coordinates 54.138718°, 10.61445° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.138718,"lon":10.61445,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Krinner Schraubfundamente GmbH | Open Energy Information  

Open Energy Info (EERE)

Krinner Schraubfundamente GmbH Krinner Schraubfundamente GmbH Jump to: navigation, search Name Krinner Schraubfundamente GmbH Place Strasskirchen, Germany Zip 94342 Sector Solar Product German manufacturer of solar panel mounting systems. Coordinates 48.83023°, 12.723775° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.83023,"lon":12.723775,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AMB Apparate Maschinenbau GmbH | Open Energy Information  

Open Energy Info (EERE)

AMB Apparate Maschinenbau GmbH AMB Apparate Maschinenbau GmbH Jump to: navigation, search Name AMB Apparate + Maschinenbau GmbH Place Langweid, Germany Zip 86462 Sector Solar Product Germany-based firm that offers automation technology for the solar industry, focussing on wafer handling. Coordinates 48.4907°, 10.85775° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.4907,"lon":10.85775,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FirstGeoTherm GmbH | Open Energy Information  

Open Energy Info (EERE)

FirstGeoTherm GmbH FirstGeoTherm GmbH Jump to: navigation, search Name FirstGeoTherm GmbH Place Waldsee, Germany Zip 67165 Sector Geothermal energy Product FirstGeoTherm plans and engineers geothermal plants in Germany. Coordinates 49.39388°, 8.441115° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.39388,"lon":8.441115,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NordStrom Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

NordStrom Solar GmbH NordStrom Solar GmbH Jump to: navigation, search Name NordStrom Solar GmbH Place Husum, Germany Zip 25813 Sector Solar Product Solar PV project developer. Coordinates 45.799479°, -121.486901° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.799479,"lon":-121.486901,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Donauer Solartechnik Vertriebs GmbH | Open Energy Information  

Open Energy Info (EERE)

Donauer Solartechnik Vertriebs GmbH Donauer Solartechnik Vertriebs GmbH Jump to: navigation, search Name Donauer Solartechnik Vertriebs GmbH Place Gauting-Hausen, Germany Zip 82131 Sector Solar Product German-based solar photovoltaic and thermal equipment distributor. Also began developing its own projects. Coordinates 48.042049°, 11.3305° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.042049,"lon":11.3305,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Pulse Asset Management GmbH | Open Energy Information  

Open Energy Info (EERE)

Pulse Asset Management GmbH Pulse Asset Management GmbH Jump to: navigation, search Name Pulse Asset Management GmbH Place Hamburg, Germany Zip 20354 Sector Solar Product Hamburg-based investor in solar projects in Europe. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alwitra Flachdach Systeme GmbH Co | Open Energy Information  

Open Energy Info (EERE)

Alwitra Flachdach Systeme GmbH Co Alwitra Flachdach Systeme GmbH Co Jump to: navigation, search Name Alwitra Flachdach Systeme GmbH & Co. Place Trier, Germany Zip 54229 Sector Buildings, Solar Product Develops and markets systems for energy efficient buildings, focusing in particular on solar roofing materials. Coordinates 49.757256°, 6.636521° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.757256,"lon":6.636521,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Etimex Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Etimex Solar GmbH Etimex Solar GmbH Jump to: navigation, search Name Etimex Solar GmbH Place Dietenheim, Baden-Württemberg, Germany Zip 89165 Sector Solar Product A German manufacturer of encapsulation films for solar modules. Coordinates 48.214087°, 10.069196° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.214087,"lon":10.069196,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aescusoft GmbH Automation | Open Energy Information  

Open Energy Info (EERE)

Aescusoft GmbH Automation Aescusoft GmbH Automation Jump to: navigation, search Name Aescusoft GmbH Automation Place Ettenheim, Germany Zip 77955 Product Offers PV cell testing lines. Coordinates 48.256309°, 7.813654° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.256309,"lon":7.813654,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Iliotec Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Iliotec Solar GmbH Iliotec Solar GmbH Jump to: navigation, search Name Iliotec Solar GmbH Place Regensburg, Bavaria, Germany Zip 93055 Sector Solar Product German solar installer which also operates outside of Germany through its ILIOTEC International division. Coordinates 49.01492°, 12.10173° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.01492,"lon":12.10173,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Winvest Financing Service GmbH Co | Open Energy Information  

Open Energy Info (EERE)

Winvest Financing Service GmbH Co Winvest Financing Service GmbH Co Jump to: navigation, search Name Winvest Financing Service GmbH & Co Place Rheine, Germany Zip 48431 Sector Wind energy Product Assesses and arranges the financing of wind farms. Works closely with Germania Windpark. Coordinates 52.278749°, 7.434676° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.278749,"lon":7.434676,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Envitec Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Envitec Solar GmbH Envitec Solar GmbH Jump to: navigation, search Name Envitec Solar GmbH Place Heiligenkreuz, Austria Sector Solar Product Domiciled in Austria, Envitec Solar operates as the thin-film module manufacturing arm of Envitec Energy. Coordinates 48.056085°, 16.127975° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.056085,"lon":16.127975,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Offshore Wind Technologie GmbH OWT | Open Energy Information  

Open Energy Info (EERE)

Technologie GmbH OWT Technologie GmbH OWT Jump to: navigation, search Name Offshore Wind Technologie GmbH (OWT) Place Leer, Germany Zip 26789 Sector Wind energy Product Germany-based wind project developer. Coordinates 45.197795°, -83.728994° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.197795,"lon":-83.728994,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Pro Solar Solarstrom GmbH | Open Energy Information  

Open Energy Info (EERE)

Solarstrom GmbH Solarstrom GmbH Jump to: navigation, search Name Pro Solar Solarstrom GmbH Place Ravensburg, Germany Zip 88214 Sector Solar Product Distributor of PV modules, including Canadian Solar's, in Germany. Coordinates 47.782018°, 9.614622° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.782018,"lon":9.614622,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PowerAvenue GmbH | Open Energy Information  

Open Energy Info (EERE)

PowerAvenue GmbH PowerAvenue GmbH Jump to: navigation, search Name PowerAvenue GmbH Place Schwabach, Germany Zip 91126 Sector Hydro, Hydrogen Product Distributor of fuel cell and hydrogen education systems. Coordinates 49.328729°, 11.022157° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.328729,"lon":11.022157,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sunset Energietechnik GmbH | Open Energy Information  

Open Energy Info (EERE)

Sunset Energietechnik GmbH Sunset Energietechnik GmbH Jump to: navigation, search Name Sunset Energietechnik GmbH Place Adelsdorf, Germany Zip 91325 Sector Wind energy Product Sunset supplies various photovoltaic products and wind generators. Coordinates 49.714608°, 10.894794° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.714608,"lon":10.894794,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Unlimited Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

Unlimited Energy GmbH Unlimited Energy GmbH Jump to: navigation, search Name Unlimited Energy GmbH Place Berlin, Germany Zip 12435 Sector Solar, Wind energy Product Unlimited Energy is a German-based project developer, specialising in wind and solar projects. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Bauer Solarenergie GmbH | Open Energy Information  

Open Energy Info (EERE)

Solarenergie GmbH Solarenergie GmbH Jump to: navigation, search Name Bauer Solarenergie GmbH Place Selzen, Lower Saxony, Germany Zip 55278 Sector Solar Product Selzen-based manufacturer of solar components including junction boxes, modules and inverters. Coordinates 49.86446°, 8.252973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.86446,"lon":8.252973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Agridea BioPower GmbH | Open Energy Information  

Open Energy Info (EERE)

Agridea BioPower GmbH Agridea BioPower GmbH Jump to: navigation, search Name Agridea BioPower GmbH Place Luebbecke, North Rhine-Westphalia, Germany Zip 32312 Product German developer and operator of biogas plants. Coordinates 52.303048°, 8.612882° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.303048,"lon":8.612882,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


WeserWind GmbH | Open Energy Information  

Open Energy Info (EERE)

WeserWind GmbH WeserWind GmbH Jump to: navigation, search Name WeserWind GmbH Place Bremerhaven, Germany Zip 27570 Sector Wind energy Product String representation "With an integra ... nd on landside." is too long. Coordinates 53.54429°, 8.582082° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.54429,"lon":8.582082,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wacker Schott Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

Schott Solar GmbH Schott Solar GmbH Jump to: navigation, search Name Wacker Schott Solar GmbH Place Alzenau, Germany Sector Solar Product JV set up between Wacker Chemie and Schott Solar to produce multicrystalline silicon ingots and solar wafers. Coordinates 50.086317°, 9.073625° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.086317,"lon":9.073625,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GEC Graeber Engineering Consultants GmbH | Open Energy Information  

Open Energy Info (EERE)

GEC Graeber Engineering Consultants GmbH GEC Graeber Engineering Consultants GmbH Jump to: navigation, search Name GEC Graeber Engineering Consultants GmbH Place Ottobrunn, Bavaria, Germany Zip 85521 Sector Hydro, Hydrogen Product Involved in the supply of hydrogen reduction reactors and hydrogenation reactors. Coordinates 48.063605°, 11.66213° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.063605,"lon":11.66213,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AEROGIE Verwaltungs GmbH | Open Energy Information  

Open Energy Info (EERE)

AEROGIE Verwaltungs GmbH AEROGIE Verwaltungs GmbH Jump to: navigation, search Name AEROGIE Verwaltungs GmbH Place Berlin, Germany Zip 12526 Sector Wind energy Product Wind energy project developer, wind farm construction planner. Coordinates 52.516074°, 13.376987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.516074,"lon":13.376987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AET Alternative Energie Technik GmbH | Open Energy Information  

Open Energy Info (EERE)

AET Alternative Energie Technik GmbH AET Alternative Energie Technik GmbH Jump to: navigation, search Name AET Alternative-Energie-Technik GmbH Place Sulzbach-Neuweiler, Saarland, Germany Zip 66280 Sector Solar Product An independent solar module and system wholesaler. Coordinates 49.300941°, 7.06632° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.300941,"lon":7.06632,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Logomatic Gmbh Grinding Machines Fabrication | Open Energy Information  

Open Energy Info (EERE)

Logomatic Gmbh Grinding Machines Fabrication Logomatic Gmbh Grinding Machines Fabrication Jump to: navigation, search Name Logomatic Gmbh Grinding Machines Fabrication Place Mainaschaff, Germany Zip D-63814 Sector Solar Product German manufacturer of capital equipment for semiconductor and solar industries; for solar, offers diamond cropping and squaring machines. Coordinates 49.97746°, 9.085379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.97746,"lon":9.085379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ads-tec GmbH | Open Energy Information  

Open Energy Info (EERE)

Ads-tec GmbH Ads-tec GmbH Jump to: navigation, search Logo: ads-tec GmbH Name ads-tec GmbH Address Raiffeisenstrasse 14 Place Leinfelden Echterdingen Zip 70771 Sector Services Product Energy Storage Systems Number of employees 51-200 Company Type For Profit Website http://www.ads-tec.de Coordinates 48.70567°, 9.128594° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.70567,"lon":9.128594,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


KSL Kuttler Automation Systems GmbH | Open Energy Information  

Open Energy Info (EERE)

KSL Kuttler Automation Systems GmbH KSL Kuttler Automation Systems GmbH Jump to: navigation, search Name KSL-Kuttler Automation Systems GmbH Place Dauchingen, Baden-Württemberg, Germany Zip 78083 Sector Solar Product KSL-Kuttler Automation Systems GmbH is a manufacturer of automation systems for the PCB-industry and solar industry. KSL Kuttler was acquired by Suntech in April 2008. Coordinates 48.090319°, 8.552377° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.090319,"lon":8.552377,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EnergiePerformance Sugg GmbH | Open Energy Information  

Open Energy Info (EERE)

EnergiePerformance Sugg GmbH EnergiePerformance Sugg GmbH Jump to: navigation, search Name EnergiePerformance Sugg GmbH Place Karlsruhe, Baden-Württemberg, Germany Zip 76131 Sector Solar Product German-based solar project developer, EnergiePerformance Sugg GmbH provides planning, consulting and setting in the solar and photovoltaic area. Coordinates 49.01076°, 8.408695° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.01076,"lon":8.408695,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Archea ME LE Anlagenbau GmbH | Open Energy Information  

Open Energy Info (EERE)

ME LE Anlagenbau GmbH ME LE Anlagenbau GmbH Jump to: navigation, search Name Archea ME-LE Anlagenbau GmbH Place Torgelow, Mecklenburg-Western Pomerania, Germany Product Archea ME-LE Anlagenbau GmbH is a JV set up to manufacture and construct Archea biogas plants. Coordinates 53.629674°, 14.010779° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.629674,"lon":14.010779,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Analysis of a Ferric Uptake Regulator (Fur) Mutant ofDesulfovibrio vulgaris Hildenborough  

SciTech Connect (OSTI)

Previous experiments examining the transcriptional profileof the anaerobe Desulfovibrio vulgaris demonstrated up-regulation of theFur regulon in response to various environmental stressors. To test theinvolvement of Fur in the growth response and transcriptional regulationof D. vulgaris, a targeted mutagenesis procedure was used for deletingthe fur gene. Growth of the resulting ?fur mutant (JW707) was notaffected by iron availability, but the mutant did exhibit increasedsensitivity to nitrite and osmotic stresses compared to the wild type.Transcriptional profiling of JW707 indicated that iron-bound Fur acts asa traditional repressor for ferrous iron uptake genes (feoAB) and othergenes containing a predicted Fur binding site within their promoter.Despite the apparent lack of siderophore biosynthesis genes within the D.vulgaris genome, a large 12-gene operon encoding orthologs to TonB andTolQR also appeared to be repressed by iron-bound Fur. While other genespredicted to be involved in iron homeostasis were unaffected by thepresence or absence of Fur, alternative expression patterns that could beinterpreted as repression or activation by iron-free Fur were observed.Both the physiological and transcriptional data implicate a globalregulatory role for Fur in the sulfate-reducing bacterium D.vulgaris.

Bender, Kelly S.; Yen, Huei-Che Bill; Hemme, Christopher L.; Yang, Zamin K.; He, Zhili; He, Qiang; Zhou, Jizhong; Huang, Katherine H.; Alm, Eric J.; Hazen, Terry C.; Arkin, Adam P.; Wall, Judy D.



Arkona Windpark Entwicklungs GmbH | Open Energy Information  

Open Energy Info (EERE)

Arkona Windpark Entwicklungs GmbH Arkona Windpark Entwicklungs GmbH Jump to: navigation, search Name Arkona-Windpark-Entwicklungs-GmbH Place Stralsund, Mecklenburg-Western Pomerania, Germany Zip 18439 Sector Wind energy Product Offshore wind project developer in Northern Germany. Coordinates 54.31574°, 13.09085° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.31574,"lon":13.09085,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aqua Society GmbH | Open Energy Information  

Open Energy Info (EERE)

Aqua Society GmbH Aqua Society GmbH Place Herten, North Rhine-Westphalia, Germany Zip 45699 Product Germany-based, waste heat to energy technology designer and developer. Coordinates 51.592529°, 7.137416° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.592529,"lon":7.137416,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


W2E Wind To Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

E Wind To Energy GmbH E Wind To Energy GmbH Jump to: navigation, search Name W2E Wind To Energy GmbH Place Germany Sector Wind energy Product German technology provider of wind turbines. References W2E Wind To Energy GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. W2E Wind To Energy GmbH is a company located in Germany . References ↑ "W2E Wind To Energy GmbH" Retrieved from "http://en.openei.org/w/index.php?title=W2E_Wind_To_Energy_GmbH&oldid=352903" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)


Asola Advanced and Automotive Solar Systems GmbH | Open Energy Information  

Open Energy Info (EERE)

Asola Advanced and Automotive Solar Systems GmbH Asola Advanced and Automotive Solar Systems GmbH Jump to: navigation, search Name Asola Advanced and Automotive Solar Systems GmbH Place Erfurt, Germany Zip D-99428 Sector Solar Product German manufacturer of PV modules and spherical solar sun roofs for the automotive industry. References Asola Advanced and Automotive Solar Systems GmbH[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Asola Advanced and Automotive Solar Systems GmbH is a company located in Erfurt, Germany . References ↑ "Asola Advanced and Automotive Solar Systems GmbH" Retrieved from "http://en.openei.org/w/index.php?title=Asola_Advanced_and_Automotive_Solar_Systems_GmbH&oldid=34237


Heliocentris Energiesysteme GmbH aka Heliocentris Fuel Cells AG | Open  

Open Energy Info (EERE)

Heliocentris Energiesysteme GmbH aka Heliocentris Fuel Cells AG Heliocentris Energiesysteme GmbH aka Heliocentris Fuel Cells AG Jump to: navigation, search Name Heliocentris Energiesysteme GmbH (aka Heliocentris Fuel Cells AG) Place Berlin, Germany Zip 12489 Product Specialised in fuel cell demonstration applications for education and outreach. References Heliocentris Energiesysteme GmbH (aka Heliocentris Fuel Cells AG)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Heliocentris Energiesysteme GmbH (aka Heliocentris Fuel Cells AG) is a company located in Berlin, Germany . References ↑ "[ Heliocentris Energiesysteme GmbH (aka Heliocentris Fuel Cells AG)]" Retrieved from "http://en.openei.org/w/index.php?title=Heliocentris_Energiesysteme_GmbH_aka_Heliocentris_Fuel_Cells_AG&oldid=346452"


Sovello AG formerly EverQ GmbH | Open Energy Information  

Open Energy Info (EERE)

Sovello AG formerly EverQ GmbH Sovello AG formerly EverQ GmbH Jump to: navigation, search Name Sovello AG (formerly EverQ GmbH) Place Bitterfeld-Wolfen, Saxony-Anhalt, Germany Zip 6766 Sector Renewable Energy, Solar Product JV between Evergreen Solar, Q-Cells and Renewable Energy Corp to develop PV wafers, cells and panels through string ribbon process. References Sovello AG (formerly EverQ GmbH)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sovello AG (formerly EverQ GmbH) is a company located in Bitterfeld-Wolfen, Saxony-Anhalt, Germany . References ↑ "Sovello AG (formerly EverQ GmbH)" Retrieved from "http://en.openei.org/w/index.php?title=Sovello_AG_formerly_EverQ_GmbH&oldid=35158


DEWI OCC Offshore and Certification Centre GmbH DEWI OCC | Open Energy  

Open Energy Info (EERE)

DEWI OCC Offshore and Certification Centre GmbH DEWI OCC DEWI OCC Offshore and Certification Centre GmbH DEWI OCC Jump to: navigation, search Name DEWI-OCC Offshore and Certification Centre GmbH (DEWI-OCC) Place Cuxhaven, Germany Sector Wind energy Product A certification body for onshore and offshore wind turbines and components, accredited by the DAP (Deutsches Akkreditierungssystem Prüfwesen). References DEWI-OCC Offshore and Certification Centre GmbH (DEWI-OCC)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. DEWI-OCC Offshore and Certification Centre GmbH (DEWI-OCC) is a company located in Cuxhaven, Germany . References ↑ "DEWI-OCC Offshore and Certification Centre GmbH (DEWI-OCC)" Retrieved from

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Deutsche Rotor und Turm Service GmbH Co KG DRTS | Open Energy Information  

Open Energy Info (EERE)

Rotor und Turm Service GmbH Co KG DRTS Rotor und Turm Service GmbH Co KG DRTS Jump to: navigation, search Name Deutsche Rotor und Turm Service GmbH & Co KG (DRTS) Place Bremen, Germany Zip 28239 Sector Wind energy Product Service company for wind turbine blades and towers. References Deutsche Rotor und Turm Service GmbH & Co KG (DRTS)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Deutsche Rotor und Turm Service GmbH & Co KG (DRTS) is a company located in Bremen, Germany . References ↑ "Deutsche Rotor und Turm Service GmbH & Co KG (DRTS)" Retrieved from "http://en.openei.org/w/index.php?title=Deutsche_Rotor_und_Turm_Service_GmbH_Co_KG_DRTS&oldid=344202" Categories:


Green Energy Geotherm Power Fonds GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Geotherm Power Fonds GmbH Co KG Geotherm Power Fonds GmbH Co KG Jump to: navigation, search Name Green Energy Geotherm Power Fonds GmbH & Co. KG Place Hannover, Lower Saxony, Germany Zip 30559 Sector Geothermal energy Product German-based fund that will invest in geothermal projects to be developed by Green Energy Group. References Green Energy Geotherm Power Fonds GmbH & Co. KG[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Green Energy Geotherm Power Fonds GmbH & Co. KG is a company located in Hannover, Lower Saxony, Germany . References ↑ "Green Energy Geotherm Power Fonds GmbH & Co. KG" Retrieved from "http://en.openei.org/w/index.php?title=Green_Energy_Geotherm_Power_Fonds_GmbH_Co_KG&oldid=346014"


Aufwind Schmack Neue Energien GmbH | Open Energy Information  

Open Energy Info (EERE)

Neue Energien GmbH Neue Energien GmbH Jump to: navigation, search Name Aufwind Schmack Neue Energien GmbH Place Regensburg, Germany Zip 93059 Sector Geothermal energy, Wind energy Product Germany-based power project developer, particularly active in wind and biogas projects and now starting to do geothermal. Coordinates 49.01492°, 12.10173° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.01492,"lon":12.10173,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GEO NET Umweltconsulting GmbH | Open Energy Information  

Open Energy Info (EERE)

GEO NET Umweltconsulting GmbH GEO NET Umweltconsulting GmbH Jump to: navigation, search Name GEO-NET Umweltconsulting GmbH Place Hannover, Germany Zip 30161 Sector Wind energy Product Undertakes environmental planning and consulting in wind and other sectors. Part of the GEO-NET interdisciplinary technology-oriented research, consulting and service agency. Coordinates 52.372278°, 9.738157° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.372278,"lon":9.738157,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Kraftanlagen M nchen GmbH | Open Energy Information  

Open Energy Info (EERE)

Kraftanlagen M nchen GmbH Kraftanlagen M nchen GmbH Jump to: navigation, search Name Kraftanlagen München GmbH Place Munich, North Rhine-Westphalia, Germany Zip D-80339 Sector Biomass, Services, Solar Product Provides technical engineering services for Solar Thermal Electricity Generation (STEG) and biomass plants, and makes a STEG receiver, "Solair" with ceramic inserts. Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


L B Systemtechnik GmbH | Open Energy Information  

Open Energy Info (EERE)

L B Systemtechnik GmbH L B Systemtechnik GmbH Jump to: navigation, search Name L-B-Systemtechnik GmbH Place Ottobrunn, Germany Zip 85521 Sector Hydro, Hydrogen, Solar Product L-B-Systemtechnik is a consulting and research service firm supported by a public sector. The company focuses on hydrogen and solar power generation. Coordinates 48.063605°, 11.66213° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.063605,"lon":11.66213,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Allianz Climate Solutions ACS GmbH | Open Energy Information  

Open Energy Info (EERE)

Allianz Climate Solutions ACS GmbH Allianz Climate Solutions ACS GmbH Jump to: navigation, search Name Allianz Climate Solutions (ACS) GmbH Place Munich, Germany Zip 80802 Product Munich-based subsidiary of insurance and asset management provider Allianz SE. ACS acts as investment manager, service provider and advisor of climate solutions for Allianz Group and external customers. Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FutureCarbon GmbH | Open Energy Information  

Open Energy Info (EERE)

FutureCarbon GmbH FutureCarbon GmbH Jump to: navigation, search Name FutureCarbon GmbH Place Bayreuth, Germany Zip 95448 Sector Carbon, Efficiency, Hydro, Hydrogen Product The company originated out of a former Mannesmann think tank. Its focus is the development of carbon nano materials.They are developing materials for efficiency improvents of PME fuel cells and others for hydrogen storage. Coordinates 49.945189°, 11.571023° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.945189,"lon":11.571023,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PSE GmbH Forschung Entwicklung Marketing | Open Energy Information  

Open Energy Info (EERE)

PSE GmbH Forschung Entwicklung Marketing PSE GmbH Forschung Entwicklung Marketing Jump to: navigation, search Name PSE GmbH - Forschung, Entwicklung, Marketing Place Freiburg, Germany Zip 79072 Sector Solar Product German R&D organisation that is working on Fresnel linear reflector solar thermal electricity generation systems and unidentified PV system. Coordinates 47.99854°, 7.849655° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.99854,"lon":7.849655,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SSB Antriebstechnik GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

SSB Antriebstechnik GmbH Co KG SSB Antriebstechnik GmbH Co KG Jump to: navigation, search Name SSB-Antriebstechnik GmbH & Co KG Place Salzbergen, Germany Zip 48499 Sector Wind energy Product Salzbergen-based provider of pitch and control systems for wind turbines including motors, gearboxes, control and switchgear and their maintenance. Coordinates 52.323136°, 7.347278° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.323136,"lon":7.347278,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


RIO Energie GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

RIO Energie GmbH Co KG RIO Energie GmbH Co KG Jump to: navigation, search Name RIO Energie GmbH & Co KG Place Mainz, Germany Zip 55118 Sector Wind energy Product Subsidiary of the juwi group, Rio Energie develops and installs small and medium sized PV systems and wind projects. Coordinates 50.000605°, 8.2723° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.000605,"lon":8.2723,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


BBB Umwelttechnik GmbH | Open Energy Information  

Open Energy Info (EERE)

BBB Umwelttechnik GmbH BBB Umwelttechnik GmbH Jump to: navigation, search Name BBB Umwelttechnik GmbH Place Gelsenkirchen, Germany Zip D-45886 Sector Services, Wind energy Product BBB Umwelttechnik is a middle-sized enterprise acting all over Europe and offers its customers a complete range of services for the projection, realisation and operation of wind turbines. Coordinates 51.511335°, 7.09253° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.511335,"lon":7.09253,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fichtner GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Fichtner GmbH Co KG Fichtner GmbH Co KG Jump to: navigation, search Name Fichtner GmbH & Co KG Place Stuttgart, Baden-Württemberg, Germany Zip 70191 Sector Solar Product Consulting engineering company, focusses on large scale projects in the infrastructure sector. Leading consultant for Solar Thermal Electricity Generation (STEG) projects. Coordinates 48.767675°, 9.171925° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.767675,"lon":9.171925,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Air Energy GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH GmbH Jump to: navigation, search Name Air Energy GmbH Place Aachen, North Rhine-Westphalia, Germany Zip 52064 Product German design, development and project engineering company with a focus on lithium batteries and battery management systems, ultralight aircraft and pressure components for airships and balloons. Coordinates 50.778138°, 6.088498° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.778138,"lon":6.088498,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ET EnergieTechnologie GmbH | Open Energy Information  

Open Energy Info (EERE)

ET EnergieTechnologie GmbH ET EnergieTechnologie GmbH Jump to: navigation, search Name ET - EnergieTechnologie GmbH Place Brunnthal-Nord, Bavaria, Germany Zip 85649 Sector Hydro, Hydrogen Product ET originated in 1998 as a spin-off from Dasa's space department. Its activities include engineering, construction and operation of teststands for cryogenic technologies, especially hydrogen, test of hydrogentanks for automobiles. Coordinates 48.79786°, 9.19222° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.79786,"lon":9.19222,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



E-Print Network [OSTI]

respectively. Fish accounted for 66.4% of food biomass (69.4% of total energy consumption); squidINCREASED FOOD AND ENERGY CONSUMPTION OF LACTATING NORTHERN FUR SEALS, CALWRHINUS URSINUS MICHAEL A on ter- restrial mammals have specifically shown increased energy consumption by lactating females


GEA Refrigeration Technologies / GEA Refrigeration Germany GmbH Wolfgang Dietrich / Dr. Ole Fredrich  

E-Print Network [OSTI]

GEA Refrigeration Technologies / GEA Refrigeration Germany GmbH Wolfgang Dietrich / Dr. Ole Technologies3 Achema 2012 // heat pumps using ammonia Industrial demand on heat in Germany Heatdemandin

Oak Ridge National Laboratory


E-Print Network 3.0 - aircraft engines gmbh Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

.daimler.com Bosch Sicherheitssysteme GmbH www.bosch.de Electrical industry, vehicle, industrial engineering Atena... Engineering ... Source: Collection: Physics ; Materials...


Vensys Energy AG formerly Vensys Energiesysteme GmbH | Open Energy...  

Open Energy Info (EERE)

GmbH ) Place: Saarbrcken, Germany Zip: 66115 Sector: Wind energy Product: Wind turbine manufacturer based in Germany. References: Vensys Energy AG (formerly Vensys...


E-Print Network 3.0 - antarctic fur seals Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

population of New Zealand fur seals (Arctocephalus forsteri) Summary: and southern elephant seals at Gough Island. S. Afr. J. Antarct. Res. 20: 912. Bonner, W. N. (1968). The...

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Z . anorg. allg. Chem. 623 (1997) 309-315 Zeitschrift fur anorganische  

E-Print Network [OSTI]

Z . anorg. allg. Chem. 623 (1997) 309-315 Zeitschrift fur anorganische und allgemeine Chemie 0 Universitat Bert Werner, Thomas Krauter und Bernhard Neumiiller* Marburg, Fachbereich fur Chemie der.-Doz. Dr. B. Neumuller Fachbereich Chemie der Universitat Hans-Meerwein-StraRe D-35032 Marburg

Bluemel, Janet


The Subsistence Harvest of Northern Fur Seals St. George Island in 2006  

E-Print Network [OSTI]

.................................................................................................................... 6 By Products and Waste..................................... 6 Heat Strokes on: a) the number of sub-adult male fur seals harvested, b) incidence of by-products and waste during


WindStrom Innovative Energiesysteme GmbH | Open Energy Information  

Open Energy Info (EERE)

WindStrom Innovative Energiesysteme GmbH WindStrom Innovative Energiesysteme GmbH Jump to: navigation, search Name WindStrom Innovative Energiesysteme GmbH Place Edemissen, Germany Zip 31234 Sector Wind energy Product Germany-based wind project developer and owner. Coordinates 52.3851°, 10.258519° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.3851,"lon":10.258519,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wacker Chemie AG formerly Wacker GmbH | Open Energy Information  

Open Energy Info (EERE)

Chemie AG formerly Wacker GmbH Chemie AG formerly Wacker GmbH Jump to: navigation, search Name Wacker Chemie AG (formerly Wacker GmbH) Place Munich, Germany Zip 81737 Sector Solar Product German chemicals company; major manufacturer of polysilicon for solar and semiconductor industries. Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Plambeck Neue Energien Solar Technik GmbH | Open Energy Information  

Open Energy Info (EERE)

Solar Technik GmbH Solar Technik GmbH Jump to: navigation, search Name Plambeck Neue Energien Solar-Technik GmbH Place Cuxhaven, Germany Zip D-27472 Sector Solar Product Germany-based developer of solar power projects. Coordinates 53.858306°, 8.697818° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.858306,"lon":8.697818,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A S NaturEnergie GmbH | Open Energy Information  

Open Energy Info (EERE)

NaturEnergie GmbH NaturEnergie GmbH Jump to: navigation, search Name A + S NaturEnergie GmbH Place Pfaffenhofen, Germany Zip 74397 Sector Biomass Product Germany-based producer of solid biofuel for energy production and biomass (CHP) plant developer. Coordinates 49.064011°, 8.977104° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.064011,"lon":8.977104,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Paradigma Energie und Umwelttechnik GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Paradigma Energie und Umwelttechnik GmbH Co KG Paradigma Energie und Umwelttechnik GmbH Co KG Jump to: navigation, search Name Paradigma Energie- und Umwelttechnik GmbH & Co KG Place Karlsbad, Germany Zip 76307 Sector Solar Product A manufacturer of solar energy products and systems Coordinates 48.914742°, 8.506386° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.914742,"lon":8.506386,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Deutsche Solar AG formerly Bayer Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

AG formerly Bayer Solar GmbH AG formerly Bayer Solar GmbH Jump to: navigation, search Name Deutsche Solar AG (formerly Bayer Solar GmbH) Place Freiberg/Sachsen, Germany Zip 9599 Sector Solar Product Producers of mono- and multicrystalline silicon wafers for solar cells. Coordinates 50.916956°, 13.339619° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.916956,"lon":13.339619,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


BioEnergie Park Soesetal GmbH | Open Energy Information  

Open Energy Info (EERE)

BioEnergie Park Soesetal GmbH BioEnergie Park Soesetal GmbH Jump to: navigation, search Name BioEnergie-Park Soesetal GmbH Place Osterode, Lower Saxony, Germany Zip 37520 Sector Biomass Product Lower Saxony-based biomass project developer. Coordinates 53.695599°, 19.973301° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.695599,"lon":19.973301,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Offshore Burger Windpark Butendiek GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Burger Windpark Butendiek GmbH Co KG Burger Windpark Butendiek GmbH Co KG Jump to: navigation, search Name Offshore-Burger-Windpark Butendiek GmbH & Co KG Place Husum, Germany Zip 25813 Sector Wind energy Product Developing the 240MW Butendiek offshore wind farm. Coordinates 45.799479°, -121.486901° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.799479,"lon":-121.486901,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The FUR (ferric uptake regulator) superfamily: Diversity and versatility of key transcriptional regulators  

Science Journals Connector (OSTI)

Abstract Control of metal homeostasis is essential for life in all kingdoms. In most prokaryotic organisms the FUR (ferric uptake regulator) family of transcriptional regulators is involved in the regulation of iron and zinc metabolism through control by Fur and Zur proteins. A third member of this family, the peroxide-stress response PerR, is present in most Gram-positives, establishing a tight functional interaction with the global regulator Fur. These proteins play a pivotal role for microbial survival under adverse conditions and in the expression of virulence in most pathogens. In this paper we present the current state of the art in the knowledge of the FUR family, including those members only present in more reduced numbers of bacteria, namely Mur, Nur and Irr. The huge amount of work done in the two last decades shows that FUR proteins present considerable diversity in their regulatory mechanisms and interesting structural differences. However, much work needs to be done to obtain a more complete picture of this family, especially in connection with the roles of some members as gas and redox sensors as well as to fully characterize their participation in bacterial adaptative responses.

Mara F. Fillat




E-Print Network [OSTI]

;TCGTTTCCCTTCAGTCGCTG#7;#7;CBU2012 forward#7;CGAAGAACTGGATAGCGAAAG#7;#7; Beta-Galactosidase Assay C loned plasmids were electroporated into either BN4020 pMH15 or BN4020 pNP104 electrocompetent cells to form two plasmid heterolo ssay was performed...;#7;pMH15#7;pACYC184 with E. coli fur#7;#7;#7;pBlue TOPO#7;TA cloning vector, promoter trap#7;Invitrogen#7;#7;pNP104#7;pACYC184 with complete C. burnetii fur#7;This work#7;#7;BN4020#7;E. coli fur deletion strain#7;This work#7;#7; Table 2. List of all...

Wilson, Mary J



Ernst Ising 1900-1998 Technische Universitat Dresden, Institut fur Theoretische Physik, D-01062 Dresden, Germany  

E-Print Network [OSTI]

Ernst Ising 1900-1998 S. Kobe Technische Universitat Dresden, Institut fur Theoretische Physik, D-01062 Dresden, Germany (July 20, 2000) The Ising model is one of the standard models in statistical by Ernst Ising in his doctor dissertation. His life covers most of the past century and was interwoven

Kobe, Sigismund


Rates of maximum food intake in young northern fur seals (Callorhinus ursinus) and the seasonal  

E-Print Network [OSTI]

- ports body growth and energy storage, which ultimately af- fect survival and reproductive success to compensate by further increasing their levels of consumption on subsequent feeding days. Absolute levels, the fur seals did not appear to efficiently convert this additional energy into mass growth, particularly


ABO Wind Biogas Sachsen Anhalt GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

ABO Wind Biogas Sachsen Anhalt GmbH Co KG ABO Wind Biogas Sachsen Anhalt GmbH Co KG Jump to: navigation, search Name ABO Wind Biogas Sachsen-Anhalt GmbH & Co. KG Place Wiesbaden, Saxony-Anhalt, Germany Zip 65193 Product Company set up to build and operate three biogas plants in Saxony-Anhalt Germany. Coordinates 50.084592°, 8.242302° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.084592,"lon":8.242302,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Umwelt Windrad GmbH Co KG UWR | Open Energy Information  

Open Energy Info (EERE)

Windrad GmbH Co KG UWR Windrad GmbH Co KG UWR Jump to: navigation, search Name Umwelt Windrad GmbH & Co KG (UWR) Place Rheine, Germany Zip 48431 Sector Wind energy Product Germany-based, subsidiary of Novera Energy owner of the Prutzke and Rohlsdorf windfarms in northern Germany. Coordinates 52.278749°, 7.434676° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.278749,"lon":7.434676,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


KvH Projekt GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

KvH Projekt GmbH Co KG KvH Projekt GmbH Co KG Jump to: navigation, search Name KvH Projekt GmbH & Co KG Place Hamburg, Germany Zip D-20259 Sector Biomass, Solar, Wind energy Product Project developer in wind, solar, biomass and smart architecture. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geothermie Unterhaching GmbH und Co KG | Open Energy Information  

Open Energy Info (EERE)

Unterhaching GmbH und Co KG Unterhaching GmbH und Co KG Jump to: navigation, search Name Geothermie Unterhaching GmbH und Co KG Place Unterhaching, Bavaria, Germany Zip 82008 Sector Geothermal energy Product The SPV was established by the municipal authority Unterhaching in order to carry out a geothermal project. Coordinates 48.066195°, 11.609048° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.066195,"lon":11.609048,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Germanischer Lloyd WindEnergie GmbH | Open Energy Information  

Open Energy Info (EERE)

Germanischer Lloyd WindEnergie GmbH Germanischer Lloyd WindEnergie GmbH Jump to: navigation, search Name Germanischer Lloyd WindEnergie GmbH Place Hamburg, Hamburg, Germany Zip D-20459 Sector Wind energy Product Germanischer Lloyd WindEnergie specialises in the certification and testing of wind turbines in several different countries. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Building America Case Study: Duct in Conditioned Space in a Dropped Ceiling or Fur-down, Gainesville, Florida (Fact Sheet)  

SciTech Connect (OSTI)

Forced air distribution systems (duct systems) typically are installed out of sight for aesthetic reasons, most often in unconditioned areas such as an attic or crawlspace. Any leakage of air to or from the duct system (duct leakage) in unconditioned space not only loses energy, but impacts home and equipment durability and indoor air quality. An obvious solution to this problem is to bring the duct system into the interior of the house, either by sealing the area where the ducts are installed (sealed attic or crawlspace) or by building an interior cavity or chase above the ceiling plane (raised ceiling or fur-up chase) or below the ceiling plane (dropped ceiling or fur-down) for the duct system. This case study examines one Building America builder partner's implementation of an inexpensive, quick and effective method of building a fur-down or dropped ceiling chase.

Not Available


Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH | Open  

Open Energy Info (EERE)

Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Jump to: navigation, search Logo: Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Name Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Address Dag-Hammarskjöld-Weg 1-5 65760 Eschborn Germany Number of employees 10,000+"+" is not declared as a valid unit of measurement for this property. Year founded 1975 Phone number +49 6196 79-0 Website http://www.gtz.de/en/index.htm Coordinates 50.1466915°, 8.5540848° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.1466915,"lon":8.5540848,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH | Open  

Open Energy Info (EERE)

Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH (Redirected from GTZ) Jump to: navigation, search Logo: Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Name Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Address Dag-Hammarskjöld-Weg 1-5 65760 Eschborn Germany Number of employees 10,000+"+" is not declared as a valid unit of measurement for this property. Year founded 1975 Phone number +49 6196 79-0 Website http://www.gtz.de/en/index.htm Coordinates 50.1466915°, 8.5540848° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.1466915,"lon":8.5540848,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH | Open  

Open Energy Info (EERE)

Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH (Redirected from German Society for International Cooperation (GIZ)) Jump to: navigation, search Logo: Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Name Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Address Dag-Hammarskjöld-Weg 1-5 65760 Eschborn Germany Number of employees 10,000+ Year founded 1975 Phone number +49 6196 79-0 Website http://www.gtz.de/en/index.htm Coordinates 50.1466915°, 8.5540848° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.1466915,"lon":8.5540848,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3649 www.advmat.de  

E-Print Network [OSTI]

� 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3649 www.advmat.de www.Materials was used as the active metal electrode (Figure 1a, bottom panel). To switch the pristine insulating device from the anode to the cathode in a step-by-step manner. Sec- ondly, it is rather a series of clusters

Wang, Wei Hua


Ihr Heidelberg Marketing-Pressekontakt: Heidelberg Marketing GmbH Steffen Schmid Ziegelhuser Landstr. 3 D-69120 Heidelberg  

E-Print Network [OSTI]

Ihr Heidelberg Marketing-Pressekontakt: Heidelberg Marketing GmbH Steffen Schmid Ziegelhäuser Landstr. 3 D-69120 Heidelberg Tel +49(0)6221 ­ 58 40 230 Fax +49(0)6221 ­ 58 40 222 schmid@heidelberg-marketing.de www.heidelberg-marketing.de - 1 - P R E S S E M I T T E I L U N G Medizin-Tourismus in Heidelberg

Heermann, Dieter W.


Results of analyses of fur samples from the San Joaquin Kit Fox and associated soil and water samples from the Naval Petroleum Reserve No. 1, Tupman, California  

SciTech Connect (OSTI)

The purpose of this study was to determine whether analysis of the elemental content of fur from San Joaquin kit foxes (Vulpes macrotis mutica) and of water and soil from kit fox habitats could be used to make inferences concerning the cause of an observed decline in the kit fox population on Naval Petroleum Reserve No. 1 (NPR-1). Fur samples that had been collected previously from NPR-1, another oil field (NPR-2), and two sites with no oil development were subjected to neutron activation analysis. In addition, soil samples were collected from the home ranges of individual foxes from undisturbed portions of major soil types on NPR-1 and from wastewater samples were collected from tanks and sumps and subjected to neutron activation analysis. Most elemental concentrations in fur were highest at Camp Roberts and lowest on the undeveloped portions of NPR-I. Fur concentrations were intermediate on the developed oil fields but were correlated with percent disturbance and with number of wells on NPR-1 and NPR-2. The fact that most elements covaried across the range of sites suggests that some pervasive source such as soil was responsible. However, fur concentrations were not correlated with soft concentrations. The kit foxes on the developed portion of NPR-1 did not have concentrations of elements in fur relative to other sites that would account for the population decline in the early 1980s. The oil-related elements As, Ba, and V were elevated in fox fur from oil fields, but only As was sufficiently elevated to suggest a risk of toxicity in individual foxes. However, arsenic concentrations suggestive of sublethal toxicity were found in only 0.56% of foxes from developed oil fields, too few to account for a population decline.

Suter, G.W. II; Rosen, A.E.; Beauchamp, J.J. [Oak Ridge National Lab., TN (United States); Kato, T.T. [EG and G Energy Measurements, Inc., Tupman, CA (United States)



Stable isotope assessment of temporal and geographic differences in feeding ecology of northern fur seals (Callorhinus ursinus)  

E-Print Network [OSTI]

and muscle tissue were examined in this study due to time and financial constraints. In addition, 92 prey items were collected in trawls by National Oceanic and Atmospheric Administration P4OAA) Fisheries Oceanography Coordinated Investigations (FOCI... fulfillment of the requirements for the degree of MASTER OF SCIENCE December 1998 Major Subject: Wildlife and Fisheries Sciences STABLE ISOTOPE ASSESSMENT OF TEMPORAL AND GEOGRAPHIC DIFFERENCES IN FEEDING ECOLOGY OF NORTHERN FUR SEALS (Callarhinus...

Kurle, Carolyn Mary



341 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim wileyonlinelibrary.com How Do the Electrical Properties of Graphene Change  

E-Print Network [OSTI]

341© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim wileyonlinelibrary.com Graphene How Do the Electrical Properties of Graphene Change with its Functionalization? T. S. Sreeprasad and Vikas Berry* Functionalization of graphene is essential to interface it with other moieties to expand the scope of its electrical

Berry, Vikas


1038 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheimwileyonlinelibrary.com Molecular Self-Assembly on Graphene  

E-Print Network [OSTI]

1038 © 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheimwileyonlinelibrary.com reviews Graphene Molecular Self-Assembly on Graphene J. M. MacLeod,* and F. Rosei* The formation of ordered arrays with tailored properties. In recent years, graphene has emerged as an appealing substrate for molecular self


Building America Technology Solutions for New and Existing Homes: Duct in Conditioned Space in a Dropped Ceiling or Fur-down, Gainesville, Florida (Fact Sheet)  

Broader source: Energy.gov [DOE]

This case study examines a Building America builder partners implementation of an inexpensive, quick and effective method of building a fur-down or dropped ceiling chase, which brings the duct system into the interior of the house to reduce air leakage and improve durability and indoor air quality


Measure Guideline: Summary of Interior Ducts in New Construction, Including an Efficient, Affordable Method to Install Fur-Down Interior Ducts  

SciTech Connect (OSTI)

This document illustrates guidelines for the efficient installation of interior duct systems in new housing, including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces. This document illustrates guidelines for the efficient installation of interior duct systems in new housing. Interior ducts result from bringing the duct work inside a home's thermal and air barrier. Architects, designers, builders, and new home buyers should thoroughly investigate any opportunity for energy savings that is as easy to implement during construction, such as the opportunity to construct interior duct work. In addition to enhanced energy efficiency, interior ductwork results in other important advantages, such as improved indoor air quality, increased system durability and increased homeowner comfort. While the advantages of well-designed and constructed interior duct systems are recognized, the implementation of this approach has not gained a significant market acceptance. This guideline describes a variety of methods to create interior ducts including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces. As communication of the intent of an interior duct system, and collaboration on its construction are paramount to success, this guideline details the critical design, planning, construction, inspection, and verification steps that must be taken. Involved in this process are individuals from the design team; sales/marketing team; and mechanical, insulation, plumbing, electrical, framing, drywall and solar contractors.

Beal, D.; McIlvaine , J.; Fonorow, K.; Martin, E.



An Alaska fur seal family on St. Paul Island, Pribilof Group, Alaska . (Photo: V.B . Scheffe SEC. STANS REPORTS FAVORABLY ON  

E-Print Network [OSTI]

Pribilof Isl ands off Alaska in the Bering iea on July 8 and 9. He went to observe fur-seal management, I onservation practices, and to review har- esting methods because of recent criticisms. He consulted with 6 CLUSIO S liAs a result of my meetings and my per- sonal review of the situation, II he said, "I can


Qtac Product PresentationQtac Product PresentationQtac Product PresentationQtac Product Presentation ION-TOF GmbH  

E-Print Network [OSTI]

Presentation ION-TOF GmbH Heisenbergstr. 15 D-48149 Münster / Germany www.iontof.com Sven Kayser Sales Atomic Layer Ne+ @ 3 keV Intensity Ne+ @ 3 keV 192 Ir 55 Mn 0 1000 2000 3000 Energy (eV) Intensity 103 Rh(a.u.) energy (eV) #12;Principle of the ToF Mass Filter Different flight times for ions with different masses

Gilchrist, James F.


COLLOQUE DE PHYSIQUE Colloque C4, supplhment au n014, Tome 51, 15 juillet 1990  

E-Print Network [OSTI]

/Clausthal, 0-3400 Gbttingen, F.R.G. Institut fur Werkstofforschung, GKSS-Forschungszentrum Geesthacht GmbH, 0-2054 Geesthacht. F.R.G. Abstract - The thermodynamic functions of the phases in the Ni-Zr and the CO-Zr system

Paris-Sud XI, Université de


Universitat Stuttgart -Institut fur Wasserbau Lehrstuhl fur Hydromechanik und Hydrosystemmodellierung  

E-Print Network [OSTI]

Hydrosystemmodellierung Prof. Dr.-Ing. Rainer Helmig Diplomarbeit CO2 sequestration simulations: A comparison study for intermediate term clean energy? . 1 1.2 Current work . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 1.3 Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 1

Cirpka, Olaf Arie


Universitat Stuttgart -Institut fur Wasserbau Lehrstuhl fur Hydromechanik und Hydrosystemmodellierung  

E-Print Network [OSTI]

formations or in depleted oil and gas reservoirs, use CO2 for enhanced oil and gas recovery (EGRLookeren Calculation Methods for Linear and Radial Steam Flow in Oil Reservoirs, 1983. (Prof. Dr.-Ing. R. Helmig to the idea of storing CO2 in geologic formations. Suitable reservoirs are to be found that are capable

Cirpka, Olaf Arie


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

bundle). A simplest example of a nonholonomic dynamical system is given by a solid body rolling without gliding over another body. Among various images that spring to mind, the simplest is a ball on a rough plane ([Poi]) or a bike on asphalt. At the tangency point of the wheel with asphalt, the velocity


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

? ?¹?Ð ? ¹Á??????f¨ur Mathematik in den Naturwissenschaften Leipzig Parallel Transports in Webs by Christian Fleischhack Preprint no.: 31 2003 #12;#12;Parallel Transports in Webs Christian Fleischhack Max Abstract For connected reductive linear algebraic structure groups it is proven that every web


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

information processing, which outperforms its classical counterpart, such as building quantum protocols detect entangled states that the MABK inequality fails to detect. [13] introduced another family of Bell to the multi-qudit case. In addition, Bell inequalities that can detect more (mixed) entangled quantum states


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

practical applications. PACS numbers: 05.45.Xt, 89.75.Kd Electronic address: gautam@ipr.res.in Electronic address: abhijit@ipr.res.in Electronic address: atay@member.ams.org 1 #12;The study of time delay induced

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gunter Last Institut fur Stochastik  

E-Print Network [OSTI]

Geometry Lecture 1 Point processes and random measures G¨unter Last Lectures presented at the Department of Mathematical Sciences University of Bath May 2011 #12;1. Definition of random measures Setting (S, S) = measurable (state) space. (, F, P) = probability space. Remark Sometimes it is useful to assume that P


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

solution of hyaluronic acid with added salts NaCl and CaCl2. Hyaluronic acid is a high molecular weight) with added salts NaCl and CaCl2. The experimental data for osmotic pressure, which were obtained in Ref.16


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

the use of this diagnostic tool in the numerical calculation of phase diagrams. Key words. coarse from materials and polymers to biological systems. Such systems are typically simulated by Molecular necessary for extensive sys- tems. The integration issue is handled by adopting a semi-empirical strategy


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

rocks are seldom monomineral --like ice in glaciers and ice sheets, or pure halite (rock-salt) in salt-rich halite in large salt deposits in the crust (Hobbs et al. 1976; Chopra 1986). The corroboration


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

], provided a counterexample to Bethuel's claim by demonstrating that despite the equality 3(CIP2 ) = 0, C (CIP3 , CIP2 ) is not dense in W1,3 (CIP3 , CIP2 ). Therefore when searching for a necessary


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

. . . . . 11 3 Bulk scalings 14 3.1 The small particle limit . . . . . . . . . . . . . . . . . . . . . 15 3 . . . . . . . . . . . . . . . . . . . . . . . . 87 8.1.2 Identification of four scaling regimes . . . . . . . . . . 91 8.1.3 Asymptotic identification of the unstable mode in Regime III . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97 8


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

Bulk scalings 14 3.1 The small particle limit . . . . . . . . . . . . . . . . . . . . . 15 3.2 Large . . . . . . . . . . . . . . . . . . . . . . . . 86 8.1.2 Identification of four scaling regimes . . . . . . . . . . 90 8.1.3 Asymptotic identification of the unstable mode in Regime III . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96 8


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

; Secondary 81R60. Keywords. Noncommutative Geometry, spectral action principle, standard model of particle physics, generally covariant quantum theory. 1. Introduction The question is not whether god did create covariance, the motion of test particles along geodesics and the assumption that the energy-momentum tensor


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

]. The original algorithm is restricted to accuracy eps where eps is the machine accuracy; eps 10-16 for double


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

-random and self sustaining entities at first place from an assumed completely random scenario [1, 2]. From a naive


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

Graz University of Technology, Institute of Applied Mechanics, Technikerstr. 4, 8010 Graz, Aus- tria, e conditions was presented by Antes [5]. A completely different approach to handle dynamic problems utilizing the phenomenon as it evolves. But, as all time-stepping procedures, such a formulation requires an adequate


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

and the nonlinear Hartree and (nonlocal) exchange operators at all steps of the iterative process. We apply the self and related operators arising in the discretisation and solution process 1 #12;posed in a multivariate calculations are based on the Galerkin approximation in the problem-dependent Gaussian-type orbitals (GTO) ba


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

and the Mass of the Higgs Boson by J¨urgen Tolksdorf, and Torsten Thumst¨adter Preprint no.: 21 2006 #12;#12;Dirac Type Gauge Theories and the Mass of the Higgs Boson J¨urgen Tolksdorf Max-Planck Inst, 2006 Abstract We discuss the mass of the (physical component of the) Higgs boson in one-loop and top


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

. They are labeled by the value of the total electric charge, leading to a decomposition of the physical Hilbert the observable algebra from the tree data . . . . . 15 3.3 Functional analytic structure to realistic gauge theories is still a big challenge. Some partial results in this direction already exist, see


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

. For simplicity, the bank does not have customer deposits, and therefore refinances itself by debt capital. We with the state of the economy. This leads us to consider a random state of the economy, modelled as a two- s


fur Mathematik in den Naturwissenschaften  

E-Print Network [OSTI]

). (H2) For all ~U near U and all directions of propagation Rd , = 0, the eigen- values of N(, ~U an additional kinetic rule g((U- , V - ), (U+ , V + ), s, N) = 0, (7) where g is a real-valued function) are all semi-simple and their multiplicity is independent of ~U and (constant multiplicity


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

.2 Compatibility & incompatibility . . . . . . . . . . . . . . . . . . 5 2.3 Self . Moreover, our arguments illustrate the role of self-accommodation to achieve the minimal scaling


Universitat Leipzig Fakultat fur Mathematik und Informatik  

E-Print Network [OSTI]

-established description of the electrical activity of the heart, is given by t + Iion(, W) - div Mi i = Ii for a. a. (x, t) ? [ 0 , T ] ; (1.1) t + Iion(, W) + div Me e = -Ie for a. a. (x, t) ? [ 0 , T ] ; (1.2) W specifications of the ionic current Iion and the function G within the gating equation (1.3). 02) Within

Wagner, Marcus


Universitat Leipzig Fakultat fur Mathematik und Informatik  

E-Print Network [OSTI]

-accepted description of the electrical activity of the heart, is given by 01) tr t + Iion(tr, W) - div Mi i = Ii for almost all (x, t) ? [ 0 , T ] ; (1.1) tr t + Iion(tr, W) + div Me e = -Ie for almost all (x, t) ? [ 0 for the ionic current Iion in (1.1) and (1.2) and the gating function G in (1.3) will be made below. We shall

Wagner, Marcus


Universitat Leipzig Fakultat fur Mathematik und Informatik  

E-Print Network [OSTI]

, the bidomain system reads as follows: 01) (B)0 tr t + Iion(tr, W) - div Mi i = Ii for almost all (x, t) ? [ 0 , T ] ; (1.1) tr t + Iion(tr, W) + div Me e = -Ie for almost all (x, t) ? [ 0 , T ] ; (1.2) W t + G(tr, W potential. The ionic current Iion and the function G within the gating equation (1.3) will be specified

Wagner, Marcus

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

. In organisms proteins fold into a compact state attaining a well defined biological function by exposing


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

-assembly in dif- ferent physico-chemical systems like micelle formation, proteins folding, macro- and microphase


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

compact manifolds. When M is noncompact, geometry and analysis on it becomes more complicated. Concretely these findings to Ricci solitons and self-shrinkers. Keywords and phrases: Omori-Yau maximum principle, V-Laplacian, V-harmonic map, Ricci soliton, self-shrinker. MSC 2000: 58E20, 53C27. 1. Introduction


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

. transfer semiflow ), which is always Date: March 17, 2011. 2000 Mathematics Subject Classification. 34D23


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

and the Waewski principle only give us a non-empty positive invariant set. Date: March 17, 2011. 2000 Mathematics


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

Abstract It is discussed how a probabilistic generalization of classical mechanics of a point-particle mechanics, intrinsically mo- tivates a multi-particle concept. This corresponds to the unattainability The behavior at a node 7 5 Conclusions 11 1 Introduction Perhaps, everybody knows about Einstein's \\god does


MaxPlanckInstitut fur Mathematik  

E-Print Network [OSTI]

, 1999 Abstract It is discussed how a probabilistic generalization of classical mechanics of a point­particle mechanics, intrinsically mo­ tivates a multi­particle concept. This corresponds to the unattainability The behavior at a node 7 5 Conclusions 11 1 Introduction Perhaps, everybody knows about Einstein's ``god does


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

and Rose, 1984; Hodgkin and Huxley, 1952; Nagumo et al., 1962), neural mass models (Freeman, 1978; Jansen and Rit, 1995; Jansen et al., 1993; Lopes da Silva et al., 1974; Lopes da Silva et al., 1976; Nunez, 1974


Technische Universitat Munchen Institut fur Informatik  

E-Print Network [OSTI]

Technische Universit¨at M¨unchen Institut f¨ur Informatik Prof. Tobias Nipkow, Ph. D. SS 2005 4. 5 nat), k¨onnen wie folgt in Isabelle/HOL repr¨asentiert werden: datatype tree = Tip | Nd tree nat tree Definieren Sie eine Funktion consts set_of :: "tree nat set" die einen solchen bin¨aren Baum als Argument

Cengarle, María Victoria


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

Finster and J¨urgen Tolksdorf Preprint no.: 12 2012 #12;#12;arXiv:1201.5497v2[math-ph]1May2012 BOSONIC, the solution of the Cauchy problem is expressed in terms of tree diagrams which involve the retarded Green's function and have one outgoing leg. In order to obtain general tree diagrams, we set up a "classical


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

distribution. This is a spatial approach which does not describe the intrinsically temporal aspects that we have a system consisting of elementary units #23; 2 V . With each non-empty subsystem S #26; V we that there is a \\composition" map : Q #23;2V O f#23;g ,! O V that de#12;nes how to put ob- jects of the individual units


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

. The main results of this paper are formulated in Lemma 1 and Theorem 2. Lemma 1 is proved in Section 2. In Section 3 an example of applications of our result is given. There is a large literature [1, 2, 3||. (11) We assume that a(t) > 0, a(t) ten


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

, exponential family, information topology, information projection. AMS Subject Classification: 62F30, 54C10, 52 as for example the International Workshop on Bayesian Inference and Maximum Entropy Methods in Science the relative entropy D(P Q) := X log( dP dQ )dP from Q. Thereby dP dQ is the Radon-Nikodým derivative of P


EPR Bingo Revisited Institut fur Theoretische Phyik  

E-Print Network [OSTI]

EPR Bingo Revisited H. Roos Institut f¨ur Theoretische Phyik Universt¨at G¨ottingen Bunsenstr.9, D at superluminal speed in O. Steinmann's EPR bingo (Helv. Phys. Acta 69, 702 (1996)). Submitted to Helv. Phys. Acta There is a paper by O. Steinmann [1], the ``EPR bingo'', presenting an EPR­like thought experiment which seems


Technische Universitat Berlin Institut fur Mathematik  

E-Print Network [OSTI]

;Regularization and Numerical Simulation of Dynamical Systems Modeled with Modelica Randolf Altmeyer and Andreas. Modelica is an object-oriented language for complex systems containing several subsystems, e.g., mechanical of Dynamical Systems Modeled with Modelica Randolf Altmeyer and Andreas Steinbrecher Preprint 2013

Nabben, Reinhard


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

Max-Planck-Institut f¨ur Mathematik in den Naturwissenschaften Leipzig A Note on Resistance of NPT 2013 #12;#12;A Note on Resistance of NPT to Mixture of Separable States Bobo Hua1 , Xiu-Hong Gao2 of the whole matrix. Hence the positivity of T1 is equivalent to the positivity of T2 . A quantum state


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

, then the corresponding energy is trapping, and orbits, visiting these sup- ports in any prescribed succession, can if the boundary of Hill's region is non-empty and not homeomorphic to a sphere. For non-trapping energies we introduce a topological degree which can be non-trivial for low energies, and for Coulombic and other singu


Mathematik fur Physiker III Michael Dreher  

E-Print Network [OSTI]

or a prettier shell than ordinary, whilst the great ocean of truth lay all undiscovered before me. Sir Isaac 2.3 Power Series Expansions (Or How to Determine the Sound of a Drum) . . . . . . . . . . . 28 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85 6.2 Solutions to First Order BVPs

Dreher, Michael


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

. 2010 Mathematics Subject Classification. 20F65 (54E35,20F18,22E25,05C63). Key words and phrases. metric


Max-Planck-Institut fur Mathematik  

E-Print Network [OSTI]

]. The absence of physical oscillator excitations of the string also implies that all scattering amplitudes-Mills from the N=2 String by Chandrashekar Devchand and Olaf Lechtenfeld Preprint-Nr.: 39 1997 #12;#12;hep-th/9712043 ITP{UH{31/97 EXTENDED SELF-DUAL YANG-MILLS FROM THE N=2 STRING Chandrashekar Devchand Max

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2011 Fur Seal Subsistence Harvest Report The Subsistence Harvest of Northern Fur Seals  

E-Print Network [OSTI]

.................................................................................................................... 6 By-products and Waste.............................. 6 Heat Strokes seals harvested b) incidence of by-products and waste during the harvest process c) the occurrence


Aerodyn Energiesysteme GmbH | Open Energy Information  

Open Energy Info (EERE)

in converter conception and development, load simulation, aerodynamics, fibre-composite technology, mechanical engineering, finite-element analysis (FEA) and the complete...


Goldbeck Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

an der Bergstrae, Germany Zip: 69493 Sector: Solar Product: A daughter company of German construction- and service company Goldbeck, Goldbeck Solar installs and maintains PV...


Agri capital GmbH | Open Energy Information  

Open Energy Info (EERE)

Zip: 48155 Product: Muenster-based agri.capital develops and operates decentralised biogas plants. Coordinates: 33.652, -97.376364 Show Map Loading map......


MT Energie GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

Saxony, Germany Zip: 27404 Sector: Services Product: MT-Energie provides both turn-key biogas plants and related components and services. Coordinates: 53.295765, 9.27964...


UTS Biogastechnik GmbH | Open Energy Information  

Open Energy Info (EERE)

Sector: Services Product: Bavaria-based specialist consultancy in the construction of biogas plants as well as selling related components and services. Coordinates: 48.27304,...


WELtec BioPower GmbH | Open Energy Information  

Open Energy Info (EERE)

Saxony, Germany Zip: 49377 Sector: Services Product: WELtec BioPower provides turnkey biogas plants and related services. Coordinates: 52.728997, 8.286404 Show Map Loading...


AN Windenergie GmbH | Open Energy Information  

Open Energy Info (EERE)

Germany Zip: 28217 Sector: Wind energy Product: Major supplier of large scale wind turbines in close collaboration with BONUS Energy AS, the Danish turbine manufacturer....


NOI Rotortechnik GmbH | Open Energy Information  

Open Energy Info (EERE)

Sector: Wind energy Product: Manufacturer of fibre glass blades for multi-megawatt wind turbines. Coordinates: 51.502175, 10.794781 Loading map... "minzoom":false,"mappingser...


Smart Hydro Power GmbH | Open Energy Information  

Open Energy Info (EERE)

Str. 17 Place: Garatshausen Zip: 82340 Sector: Marine and Hydrokinetic Product: Micro Hydro Kinetic Turbine Website: http:www.smart-hydro.de Coordinates: 47.9257,...


EnXco GmbH | Open Energy Information  

Open Energy Info (EERE)

Pinneberg, Germany Pinneberg, Germany Zip D-25421 Sector Solar, Wind energy Product Wind and solar energy project developer. Coordinates 53.6623°, 9.796525° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.6623,"lon":9.796525,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rheinische Friedrich-Wilhelms-Universitat Bonn Institut fur Informatik I  

E-Print Network [OSTI]

Bonn, Germany. 2 Braunschweig University of Technology, Computer Science, Algorithms Group, M¨uhlenpfordtstra?e 23, 38106 Braunschweig, Germany #12;#12;Abstract We investigate the online exploration problem (aka. Or the agent has to visit every part of the environment for cleaning or lawn mowing, and a cell

Klein, Rolf


Spray Foam Exterior Insulation with Stand-Off Furring  

SciTech Connect (OSTI)

IBACOS, in collaboration with GreenHomes America, was contracted by the New York State Energy Research and Development Authority to research exterior wall insulation solutions. This research investigated cost-effective deep energy retrofit (DER) solutions for improving the building shell exterior while achieving a cost-reduction goal, including reduced labor costs to reach a 50/50 split between material and labor. The strategies included exterior wall insulation plus energy upgrades as needed in the attic, mechanical and ventilation systems, and basement band joist, walls, and floors. The work can be integrated with other home improvements such as siding or window replacement. This strategy minimizes physical connections to existing wall studs, encapsulates existing siding materials (including lead paint) with spray foam, and creates a vented rain screen assembly to promote drying. GreenHomes America applied construction details created by IBACOS to a test home. 2x4 framing members were attached to the wall at band joists and top plates using 'L' clips, with spray foam insulating the wall after framing was installed. Windows were installed simultaneously with the framing, including extension jambs. The use of clips in specific areas provided the best strength potential, and 'picture framing' the spray foam held the 2x4s in place. Short-term testing was performed at this house, with monitoring equipment installed for long-term testing. Testing measurements will be provided in a later report, as well as utility impact (before and after), costs (labor and materials), construction time, standard specifications, and analysis for the exterior wall insulation strategy.

Herk, A.; Baker, R.; Prahl, D.



Lineare Algebra und Geometrie fur LehramtskandidatInnen  

E-Print Network [OSTI]

: Andreas.Cap@esi.ac.at #12;#12;Inhaltsverzeichnis Vorwort v Kapitel 6. Determinanten 1 Existenz der Notation von oben als [id]B ~B bzw [id] ~B B = ([id]B ~B )-1 schreiben kann. Analog gibt es zu einer weiteren Basis ~C f¨ur W die entsprechenden Basiswechselmatrizen, und es gilt [f] ~B ~C = [id]C ~C [f]B C

Drmota, Michael


DEDUCTIVE CAUSECONSEQUENCE ANALYSIS Lehrstuhl fur Softwaretechnik und Programmiersprachen,  

E-Print Network [OSTI]

: failure modes and e#ects analysis (FMEA) and fault tree analysis (FTA). We apply the method to a real). This technique is a generalization of well­known safety analysis methods like FMEA [McDermott et al. (1996)][IEC expressive (in terms of what can by analyzed) than traditional FMEA. We show, that the results of DCCA have

Reif, Wolfgang


DEDUCTIVE CAUSE-CONSEQUENCE ANALYSIS Lehrstuhl fur Softwaretechnik und Programmiersprachen,  

E-Print Network [OSTI]

: failure modes and effects analysis (FMEA) and fault tree analysis (FTA). We apply the method to a real). This technique is a generalization of well-known safety analysis methods like FMEA [McDermott et al. (1996)][IEC expressive (in terms of what can by analyzed) than traditional FMEA. We show, that the results of DCCA have

Reif, Wolfgang


Rheinisch-Westfalische Technische Hochschule Aachen Institut fur Mathematik  

E-Print Network [OSTI]

¨achentreu und winkeltreu sind, iso- metrisch zueinander sind. 1 #12;Aufgabe 3 [Diffeomorphe Fl¨achen] (i) Sei N zwischen Immersionen] Zeigen Sie, dass die Definition des Differentials dfp : Tp TwX Tf(p) ~ T ~w ~X, p


Aus dem Institut fur Informationssysteme der Universitat zu Lubeck  

E-Print Network [OSTI]

-Naturwissenschaftlichen Fakult¨at - Vorgelegt von Henrike Schuhart aus Geesthacht L¨ubeck, M¨arz 2006 #12;ii #12;Acknowledgements

Lübeck, Universität zu


A Dominant-Negative fur Mutation in Bradyrhizobium japonicum  

Science Journals Connector (OSTI)

...mung bean plants were grown in modified Leonard jars with N-free medium. Soybeans were placed in a greenhouse with supplemental lighting. Cowpea and mung bean were grown in growth chambers at a temperature range of 25 to 28C. Soybean plants...

Heather P. Benson; Kristin LeVier; Mary Lou Guerinot



Rheinische Friedrich-Wilhelms-Universitat Bonn Institut fur Informatik IV  

E-Print Network [OSTI]

und Wiedergabe von Tastatur-Eingabesequenzen mittels Arduino Mikrocontroller Andreas J. Fritz zeigen, wie die Aufnahme und Wiedergabe von Tastatur-Eingabesequenzen mittels eines Arduino . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 2.3 Arduino Mikrocontroller . . . . . . . . . . . . . . . . . . . . . . 8 2.4 Verwandte Arbeiten

Eckmiller, Rolf

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Monatshefte fur Chemie 130, 947960 (1999) Invited Review  

E-Print Network [OSTI]

Monatshefte fu?r Chemie 130, 947±960 (1999) Invited Review Hydrogen Bonding: From Small Clusters to Biopolymers Peter Schuster? and Peter Wolschann Institut fu?r Theoretische Chemie und Molekulare

Schuster, Peter


Technische Universitat Ilmenau Wintersemester 2010/2011 Institut fur Mathematik  

E-Print Network [OSTI]

) Es m¨ussen mindestens 2 Aufgaben in der ¨Ubung an der Tafel vorgerechnet werden. ¨Uber den Erhalt des.berger@tu-ilmenau.de geschickt werden. Weiterhin werden f¨ur das Vorrechnen an der Tafel bis zu 2 Zusatzpunkte vergeben



Technische Universitat Ilmenau Sommersemester 2012 Institut fur Mathematik  

E-Print Network [OSTI]

in der ¨Ubung an der Tafel vorgerechnet werden. F¨ur jede weitere Aufgabe, die an der Tafel vorgerechnet



Mathematik in der Chemie Gerhard Taubmann, Institut fur Theoretische Chemie  

E-Print Network [OSTI]

Acetaldehyd ( Ethanol zu Ethanal ) 2 CH3 - CH2 - OH + O2 2 CH3 - CHO + 2 H2O · Wieviele Gramm Ethylalkohol: Differentialgleichung ­ Typeset by FoilTEX ­ 4 #12;Die Kinetik der Oxidation von Ethanol ist von gro?er praktischer / Blutalkohol abgebaut. ­ Typeset by FoilTEX ­ 5 #12;R¨aumliche Struktur eines Molek¨uls Z. B. Ethanol C H O

Ulm, Universität


Differential-und Integralrechnung III Losungen fur Woche 4  

E-Print Network [OSTI]

(i) = xi und g(j) = yj. Dann saft die H¨older-Ungleichung: n i=1 |xiyi| (|xi|p ) 1 p |yj|q () 1 q wo 1/p

Mitchener, Paul


Zentrum fur Technomathematik Fachbereich 3 Mathematik und Informatik  

E-Print Network [OSTI]

is the speed of light, and T the time between transmitting the pulse and measuring/sampling the last value Bremen January 5, 2004 Abstract This manuscript is concerned with modeling the measurement process electromagnetic waves and to measure backscattered components. Let us assume that the transmitter 1 #12;and

Bremen, Universität


Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH | Open  

Open Energy Info (EERE)

Agency for International Cooperation (GIZ)) Agency for International Cooperation (GIZ)) Jump to: navigation, search Logo: Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Name Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Address Dag-Hammarskjöld-Weg 1-5 65760 Eschborn Germany Number of employees 10,000+"+" is not declared as a valid unit of measurement for this property. Year founded 1975 Phone number +49 6196 79-0 Website http://www.gtz.de/en/index.htm Coordinates 50.1466915°, 8.5540848° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.1466915,"lon":8.5540848,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH | Open  

Open Energy Info (EERE)

International Cooperation (GIZ)) International Cooperation (GIZ)) Jump to: navigation, search Logo: Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Name Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) Address Dag-Hammarskjöld-Weg 1-5 65760 Eschborn Germany Number of employees 10,000+"+" is not declared as a valid unit of measurement for this property. Year founded 1975 Phone number +49 6196 79-0 Website http://www.gtz.de/en/index.htm Coordinates 50.1466915°, 8.5540848° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.1466915,"lon":8.5540848,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim COMMUNICATION  

E-Print Network [OSTI]

than solar energy does. Moreover, the mechan- ical energy generated by human motion, such as walking or shaking, is usually wasted.[9] Harvesting this kind of energy has potential for powering portable-metal film materials have been extensively developed to power some small electronic devices (such as liquid

Wang, Zhong L.


168 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Biotechnology  

E-Print Network [OSTI]

., Biotechnol. J. 2012, 7, 213­224. Succinate has been recognized as an important platform chemical that can be synthesized by microbial fermentation or chemical polymerization using monomer precursors provided by diverse to a variety of other industrial chemicals and polymers. Applications range from use in the food industry


636 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Biotechnology  

E-Print Network [OSTI]

.201000216 Biotechnol. J. 2010, 5, 636­637 biology efforts will help guide the ultimate emergence of genome-scale synthetic biology via in silico design. This will be an incredibly exciting endeavor for the coming years the achievements to date are more modest than those envi- sioned, progress in integrating high-throughput data


2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim COMMUNICATION  

E-Print Network [OSTI]

particles on solar panels. The structure of the solar cell, with ZnO NWs on Si the main limiting factor for current solar-cell technologies. A large portion of the energy loss during solar-cell operation is attributed to optical loss, namely the loss of the incoming light by reflection

Wang, Zhong L.


Field trip to WTE facility Floetzersteig/Fernwaerme Wien GmbH  

E-Print Network [OSTI]

to provide gas control that complied with new environmental legislation. A three-stage gas cleaning system to 5 tons of waste). Every truck is weighted and unloads the waste at one of the six tipping stations the bunker to the combustion chambers Figure 4: Unloading the trucks at the tipping stations #12;- 4 - Figure

Columbia University


CERTIFICATEIQNet and DQS GmbH Deutsche Gesellschaft zur Zertifizierung von Managementsystemen  

E-Print Network [OSTI]

fulfills the requirements of the following standard: ISO 9001 : 2008 Date of certification 2011-12-06 Valid AND TECHNOLOGY HELLAS (FORTH) N.Plastira 100 70013 Heraklion Greece has implemented and maintains a Quality Management System. Scope: Design, Development and Implementation of Information and Communication

Markatos, Evangelos P.


988 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim PROGRESSREPORT  

E-Print Network [OSTI]

.MaterialsViews.com www.advenergymat.de Adv. Energy Mater. 2011, 1, 988­1001 1. Introduction Dye-sensitized solar cells several advantages over silicon-based p-n junction solar cells, including lower cost in both materials for chemical adsorption of the dye molecules.[6­8] The dye molecules, serving as the sensitizer of the solar

Cao, Guozhong


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim COMMUNICATION  

E-Print Network [OSTI]

, such as a piezoelectric nanogenerator and lithium-ion battery.[4�9] Recently, we presented a novel fundamental mech- anism into and simultaneously stored as electrochemical energy.[10] When the traditional separator film of a lithium-ion battery graphene materials and piezoelectric polyvinylidene fluoride (PVDF) separator are sealed in liquid

Wang, Zhong L.


PSTproducts GmbH, 2010 Page 1 www.pstproducts.com To be published in 38  

E-Print Network [OSTI]

and chassis components · Tubes and valves for water, oil and gas · Nuclear fuel rods from ODS alloys · Pharma.g. batteries) · Aluminium scaffolding tubes · HVAC pressure vessels for CO2 (Fig 3) · Solar panels

Cambridge, University of


Screenshot der Panono-Kampagne bei Indiegogo, Panono GmbH Agnes von Matuschka  

E-Print Network [OSTI]

der TU Berlin (CfE). In seiner Diplomarbeit entwickelte Jonas Pfeil den ersten Prototypen der Kamera Björn Bollensdorff, ,,durch das CfE lief alles unbürokratisch und schnell." Rund 1,5 Jahre arbeitete das Team in einem Büro im StarTUp Inkubator des CfE und wurde in dieser Zeit intensiv unterstützt. ,,Wir

Wichmann, Felix


JAHRESBERICHT Institut fr Solarenergieforschung GmbH in Hameln/Emmerthal An-Institut der  

E-Print Network [OSTI]

of the solar fair SOLTEC 2005 on the podium in the Weserbergland-Zentrum in Hamelin. Abb. 3: Siliciumwafer vor the quartz glass boat is visible, in the background the furnace at red heat. Abb. 4: Gruppenbild mit


Das Praxisbeispiel:Positionierung und Kommunikationspraxis fr Frucht- und Gemsesfteder Saft GmbH  

Science Journals Connector (OSTI)

In diesem Kapitel lernen Sie die Vorgehensweise fr die Entwicklung einer Positionierung kennen, mit der sich ein fhrendes Unternehmen auf einem harten und turbulenten Marktsegment erfolgreich durchgesetzt ha...


Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1094 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Biotechnology  

E-Print Network [OSTI]

Corporation (HSBC), the already planned budget for green growth in major devel- oped countries this year sums


Companies Operating a Matching Gift Scheme 3i Deutschland GmbH  

E-Print Network [OSTI]

Royal Exchange plc Halifax plc HSBC Midland plc IBM IDEO Industrial Bank of Japan Innogy Plc Invensys J

Royal Holloway, University of London


Ernst Ising Physicist and Teacher Technische Universitat Dresden, Institut fur Theoretische Physik,  

E-Print Network [OSTI]

Ernst Ising ­ Physicist and Teacher S. Kobe Technische Universit¨at Dresden, Institut f¨ur Theoretische Physik, D­01062 Dresden, Germany The Ising model is one of the standard models in statistical physics. Since 1969 more than 13800 publications using this model have appeared. In 1997 Ernst Ising

Kobe, Sigismund


Technische Universitat Munchen WS 2008/09 Institut fur Informatik 7. 11. 2008  

E-Print Network [OSTI]

Nipkow, Ph.D. Alexander Krauss, Sascha B¨ohme Logic Mini-Project 1 Deadline: Monday, 24 November 2008, 8 with DPLL A Sudoku is a 9 ? 9 grid where each cell contains a digit from 1 to 9. In a valid solution every by an incomplete grid and the task is to complete it to a valid solution. 2 5 3 9 1 1 4 4 7 2 8 5 2 9 8 1 4 3 3 6 7

Cengarle, María Victoria


Trawling Operations and South African (Cape) Fur Seals, Arctocepha/us pusillus pusil/us  

E-Print Network [OSTI]

. Wickens is with the Marine Biology Re search Institute, University of Cape Town, Rondebosch 7700, South, but this is negligible (0.3%) in terms ofthe value ofthe fishery. Seal mortality is mainly caused by drown ing in trawl are deliberately killed annually, but this most likely takes place only when caught and they enter the area below


Early Migratory Behavior of Northern Fur Seal (Callorhinus ursinus) Pups from Bering Island, Russia  

E-Print Network [OSTI]

examined the early migratory behavior and habitat associations of pups from Bering Island (BI), Russia. I instrumented 35 pups with Mk10-AL satellite tags and stomach temperature telemeters which provided diving, foraging and location data. I hypothesized...

Lee, Olivia Astillero



Zeitschrift fur Physikalische Chemie, 208 (1957), pp. 3341. UBER KINETIK UND GLEICHGEWICHT DER  

E-Print Network [OSTI]

Zeitschrift f¨ur Physikalische Chemie, 208 (1957), pp. 33­41. ¨UBER KINETIK UND GLEICHGEWICHT DER¨or¨ok Institut f¨ur allgemeine und anorganische Chemie der E¨otv¨os Lor´and Univ. Budapest (Mit 3 Tabellen im


Monatshefte fur Chemie (Chemical Monthly) 125: 167188 (1994) Fast Folding and Comparison of RNA  

E-Print Network [OSTI]

Monatshefte f¨ur Chemie (Chemical Monthly) 125: 167­188 (1994) Fast Folding and Comparison of RNA¨ur Theoretische Chemie der Universit¨at Wien A­1090 Wien, Austria b Institut f¨ur Molekulare Biotechnologie D of Oxford South Parks Road, Oxford OX1 3PS, UK \\Lambda Mailing Address: Institut f¨ur Theoretische Chemie

Stadler, Peter F.


E-Print Network 3.0 - alstom schusselmuhle fur Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Arizona, Reaction International Engineering Inc., and Alstom Power Inc. The Praxair technology enhances... the combustion process with oxygen, which improves NOx ......


Stand-Off Furring in Deep Energy Retrofits, Syracuse, New York (Fact Sheet)  

SciTech Connect (OSTI)

IBACOS, in collaboration with GreenHomes America, was contracted by the New York State Energy Research and Development Authority to research exterior wall insulation solutions. This research investigated cost-effective deep energy retrofit (DER) solutions for improving the building shell exterior while achieving a cost-reduction goal, including reduced labor costs to reach a 50/50 split between material and labor. The strategies included exterior wall insulation plus energy upgrades as needed in the attic, mechanical and ventilation systems, and basement band joist, walls, and floors. The work can be integrated with other home improvements such as siding or window replacement. This strategy minimizes physical connections to existing wall studs, encapsulates existing siding materials (including lead paint) with spray foam, and creates a vented rain screen assembly to promote drying. GreenHomes America applied construction details created by IBACOS to a test home. 2x4 framing members were attached to the wall at band joists and top plates using 'L' clips, with spray foam insulating the wall after framing was installed. Windows were installed simultaneously with the framing, including extension jambs. The use of clips in specific areas provided the best strength potential, and 'picture framing' the spray foam held the 2x4s in place. Short-term testing was performed at this house, with monitoring equipment installed for long-term testing. Testing measurements will be provided in a later report, as well as utility impact (before and after), costs (labor and materials), construction time, standard specifications, and analysis for the exterior wall insulation strategy.

Not Available



RHEIN.-WESTF. TECHN. HOCHSCHULE AACHEN Institut fur Reine und Angewandte Mathematik  

E-Print Network [OSTI]

oben sei M N i=1 B/2(xi) und w¨ahle f¨ur jedes i: mi M B/2(xi) (= ) ; dann gilt M N i=1 B(mi), denn f¨ur geeignetes i gilt dann m - mi m - xi + xi - mi nach Definiton. "" Sei > 0 gegeben und M N i=1 B/2(mi); da B/2(mi) B(mi) gilt auch M N i=1 B(mi

Lledó, Fernando


Introduction to Simulation Techniques Institut fur Theoretische Physik and Centre for Theoretical Sciences (NTZ),  

E-Print Network [OSTI]

and disordered magnets, or of the huge field of biologically motivated problems such as protein folding and parallel tempering methods which are very useful for simulations of complex, possibly disordered systems. Finally, also the impor- tant alternative approach using multicanonical ensembles is briefly outlined. 5

Janke, Wolfhard



E-Print Network [OSTI]

toughness. Keywords crack growth · fracture energy · cohesive zone modeling · ceramic matrix composites-9131-8528503 E-mail: steinmann@ltm.uni-erlangen.de Abstract In brittle composite materials, failure mech- anisms like debonding of the matrix-fiber interface or fiber breakage can result in crack deflection and hence

Gugat, Martin


J. reine angew. Math. 522 (2000), 161171 Journal fur die reine und angewandte Mathematik  

E-Print Network [OSTI]

?tement universel ~X est iso- morphe au produit i e I Ui de varie?te?s complexes lisses et sur lequel le groupe p1X?monstration. Ecrivons v? TX OP1 a1 l Á Á Á l OP1 an avec a1 Á Á Á an 0 (corollaire 1). L'application tangente TP1 3

Druel, Stéphane


Physik-Department Walther-Meissner-Institut Bayerische Akademie Lehrstuhl E23 fur Tieftemperaturforschung der Wissenschaften  

E-Print Network [OSTI]

. . . . . . . . . . . . . . . . . . . . . . . 9 2.3.2 Electrical discharge machining . . . . . . . . . . . . . . . . . . . . 10 3 Raman . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 2.8 Single cycle of a EDM process . . . . . . . . . . . . . . . . . . . . . . . . 11 2.9 Old EDM with the old EDM setup . . . . . . . . . . . . . . . . . 13 2.11 Schematic depiction of the new EDM apparatus

Gross, Rudolf


J. reine angew. Math. 537 (2001), 132 Journal fur die reine und angewandte Mathematik  

E-Print Network [OSTI]

units and the Stickelberger ideal. Recently, Anderson [2] found a brand new way to compute the fq1g and let DrH X ljrH l?2 k0 ksk l Y then Theorem B. The image of the family DrH ljrH 1 l 4 5 X irH jr a 1 m ? 1 32 e a ? 1 m ? 1 3 X Then x is a Gr-homomorphism from Ur to Fmr? . The image H0 x Dr

Ouang, Yi


Prufung aus Mathematik (2) fur BI Zuname: . . . . . . . . . . . . . . . . . . . . . . . . . . am 6. 3. 2003 Vorname: . . . . . . . . . . . . . . . . . . . . . . . . .  

E-Print Network [OSTI]

Prinzip) die L¨osung an eine AB u(r, ; 0) = f(r, ) an? Anleitung: Zu l¨osen ist die DG ut = c2u¨osung der Schwingungsgleichung utt = c2u f¨ur die kreisf¨ormige Membran; lediglich der Zeitterm f

Gruber, Peter M.


Technische Universitat Munchen SS 2007 Institut fur Informatik 28. 06. 2007  

E-Print Network [OSTI]

t = in_tree x t" sorry #12;2 Rot-Schwarz-B¨aume Literaturhinweise zu Rot-Schwarz-B¨aumen: Literatur [Wik] Thomas H. Cormen, Charles E. Leiserson, Ronald L. Rivest, and Clifford Stein. In- troduction

Cengarle, María Victoria


The Subsistence Harvest of Northern Fur Seals St. George Island in 2010  

E-Print Network [OSTI]

.................................................................................................................... 6 By-products and Waste..................................... 7 Heat Strokes seals harvested, b) incidence of by-products and waste during the harvest process, c) the occurrence


The Subsistence Harvest of Northern Fur Seals St. George Island in 2007  

E-Print Network [OSTI]

.................................................................................................................... 6 By-products and Waste..................................... 6 Heat Strokes, b) incidence of by-products and waste during the harvest process, c) the occurrence of males 124

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Subsistence Harvest of Northern Fur Seals St. George Island in 2009  

E-Print Network [OSTI]

.................................................................................................................... 5 By-products and Waste..................................... 6 Heat Strokes seals harvested, b) incidence of by-products and waste during the harvest process, c) the occurrence


The Subsistence Harvest of Northern Fur Seals St. George Island in 2008  

E-Print Network [OSTI]

.................................................................................................................... 6 By-products and Waste..................................... 7 Heat Strokes, b) incidence of by-products and waste during the harvest process, c) the occurrence of older male


Technische Universitat Munchen WS 2008/09 Institut fur Informatik 06. 02. 2009  

E-Print Network [OSTI]

Nipkow, Ph.D. Alexander Krauss, Sascha B¨ohme Logic Exercise Sheet 13 Exercise 13.1 Th(R, 0, 1, +, -, min, max, the binary functions min and max. b) Use the elimination to prove the following formula: abcd. max(a, b

Cengarle, María Victoria


Fur Activates Expression of the 2-Oxoglutarate Oxidoreductase Genes (oorDABC) in Helicobacter pylori  

Science Journals Connector (OSTI)

...than one-half of the world's population (7, 22...central metabolism and energy conservation. While some...and in maintaining the energy reserves within the bacterial cell...mucosa of ?50% of the world's population. Within...

Jeremy J. Gilbreath; Abby L. West; Oscar Q. Pich; Beth M. Carpenter; Sarah Michel; D. Scott Merrell



Wegweiser fu?r Ansiedler im Territorium Kansas Selections: Guide for Settlers in Kansas Territory  

E-Print Network [OSTI]

be addressed to Timothy J. Holian, University of Wisconsin-Waukesha, 1500 N. University Dr., Waukesha, WI 53188-2799. The Newsletter appears four times a year. Items for the Newsletter should be submitted to La Vern J. Rippley, Saint Olaf College, Northfield... University Hartmut Froeschle, University of Toronto Jerry Glenn, University of Cincinnati Timothy J. Holian, University of Wisconsin-Waukesha Antonius Holtmann, Universitt Oldenburg Giles R. Hoyt, Indiana University-Purdue University Indianapolis...

Keel, William; Trumpold, Julia; Kob, Karl Friedrich



2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1wileyonlinelibrary.com COMMUNICATION  

E-Print Network [OSTI]

. Recently, the TENG has been employed to collect energy from human motion under in vitro conditions,[31 Powering of Pacemaker by Breathing-Driven Implanted Triboelectric Nanogenerator Qiang Zheng, Bojing Shi- ting diodes (LEDs)[26,28] and charge a lithium-ion battery[30] for powering some small equipment

Wang, Zhong L.


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim2818 www.advmat.de  

E-Print Network [OSTI]

a Moving Object or Human Motion in Contact and Non-contact Modes Sihong Wang, Yannan Xie, Simiao Niu, Long sliding. One typical FTENG can deliver a maximum power density of 6.7 W/m2 on an external load. Compared

Wang, Zhong L.


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

S2 hydrotreating catalysts was demonstrated in scanning tunneling microscopy studies.[25,26] However

Krasheninnikov, Arkady V.


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 2857 www.advmat.de  

E-Print Network [OSTI]

S2 hydrotreating catalysts was demonstrated in scanning tunneling microscopy studies.[25,26] However

Krasheninnikov, Arkady V.


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.advhealthmat.de  

E-Print Network [OSTI]

, and plastic surgery, as well as for the implantation of a variety of artificial organs.[5,6] It is now of early and late thrombotic occlusion.[1,7,8] Despite advances in tissue engineering that have yielded) in a non-human primate model of acute graft thrombosis. Rapid one-step modification of TM with synthetic

Liu, David R.


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1399 www.advmat.de  

E-Print Network [OSTI]

similar to Pt-based cathode catalysts in PEMFCs.[8] Very recently, Wu et al. described an approach-based catalysts in PEMFCs.[9] It is generally recognized that interactions among the carbon support, transition Platinum (Pt)-based materials are the most frequently investigated catalysts for ORR due to their superior


www.afm-journal.de 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

the power output. Here, we present a 3D stack integrated TENG that is designed to rationally solve for mobile electronics. In addition, with specific dimensional design, we integrated a 3D-TENG inside a ball environment, such as ocean waves, vehicle systems, highway, bridge and building vibration. And the majority

Wang, Zhong L.


www.afm-journal.de 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

integrated with other nano/micro scale functional devices to build self-powered systems.[10] Thus, over to be evaluated and optimized. The vertical integrated NG (VING) structure, is the dominant design used to harvest as the building blocks of piezoelectric mechanical energy harvesters called nanogenerators (NG)[11­13] as well

Wang, Zhong L.


2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 407wileyonlinelibrary.com  

E-Print Network [OSTI]

promising photovoltaic technologies, both for their low-cost materials and high power conversion efficien Fédérale de Lausanne 1015 Lausanne, Switzerland DOI: 10.1002/aenm.201100046 1. Introduction Photovoltaic on Photovoltaic Performance in Solid-State Dye-Sensitized Solar Cells A detailed investigation of the effect

McGehee, Michael


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

the contribution made by the piezo-phototronics effect from these other factors through theoretical analysis-phototronic devices. The strain applied to cause the deformation of the nanowires is mainly through shape change experimentally. Theoretical calculation of the piezopotential along ZnO nanowires under different strain has been

Wang, Zhong L.


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim5598 www.advmat.de  

E-Print Network [OSTI]

are widely used in the synthesis of metal, metal oxide, and metal sulfide NCs with various shapes and dimensions in a controllable manner.[1­9] However, they are unsuitable for the synthesis of carbides precursors. Carbide and nitride NCs are of significant interest for biomedical applications and optical


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 6193wileyonlinelibrary.com COMMUNICATION  

E-Print Network [OSTI]

. Sefat, Dr. B. C. Sales Materials Science and Technology Division Oak Ridge National Laboratory Oak Ridge for Nanophase Materials Sciences Oak Ridge National Laboratory Oak Ridge, TN 37831, USA Dr. T. Berlijn Computer Science and Mathematics Division Oak Ridge National Laboratory Oak Ridge, Tennessee 37831, USA Prof. E

Tennessee, University of


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

National Academy of Sciences of Ukraine 46, pr. Nauki, 03028 Kiev, Ukraine Dr. E. A. Eliseev Institute for Problems of Materials Science National Academy of Science of Ukraine 3, Krjijanovskogo, 03142 Kiev, Ukraine

Pennycook, Steve


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

electrostatic energy from water and illustrate the natural generation of electricity in atmospheric phenomena demonstrated that water itself could be one of the materials to generate triboelectricity. The contact of falling water to generate an electric potential difference through electrostatic induction between two

Wang, Zhong L.


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3513 www.advmat.de  

E-Print Network [OSTI]

21218, USA Dr. J. Y. Kim Fuel Cell Research Center Korea Institute of Science and Technology (KIST of larger CQDs have kept the record power conversion efficiency of 1.0 eV bandgap PbS CQDs solar cells at 3 and low materials cost will be required simultaneously for a competitive PbS-CQD-based technology

Sargent, Edward H. "Ted"

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Titel. Author(s) Copyright 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim  

E-Print Network [OSTI]

semiconductor lasers [56], inertial confinement [67], combustion [81], and chemical reactions [10], could Many physical, chemical, and biological systems of interest evolve in a non- equilibrium environment as open-loop control. In contrast, the closed-loop control is based on feedback: it aims to stabilize

Handel, Andreas


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

-of-the-art device with ca. 7% power conversion efficiency (PCE), made with a 300 nm absorbing layer fabricated in 80 loss (down to ca. 5% PCE), likely due to incom- plete ligand exchange within the thicker QD films even worse (ca. 3.7% PCE), due in large part to a reduction in Voc, indicative of trap for- mation

Sargent, Edward H. "Ted"


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

, enabling avenues to enhanced PCE. In this work, we build a solar cell that is inverted in architecture com spacer in a CQD photovoltaic device in order to enhance PCE by tuning the spatial distribution


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

of Electromagnetic Induction Generator and Triboelectric Nanogenerator for Harvesting Mechanical Energy Chi Zhang in 1831, the electromagnetic induction generator (EMIG) has been invented as one of the most important and industrial production.[6­11] Since the electromagnetic induction effect was discovered by Michael Faraday

Wang, Zhong L.


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

the air/fuel ratio to improve combustion efficiency and reduce pollution. Compared with traditional sensors are widely used in deep sea and space exploration, underground mines, and oil fields for life

Wang, Zhong L.


www.afm-journal.de 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 4427  

E-Print Network [OSTI]

-oxide-semiconductor (CMOS) transis- tors and simple circuits, solar cells, strain/temperature sensors, digital imaging and bio- logically benign end products. This type of technology, sometimes referred to as a class-inspired organic active and passive materials.[8�10] An important advance followed from the obser- vation

Rogers, John A.


www.afm-journal.de 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

.MaterialsViews.com wileyonlinelibrary.com Chensha Li, Ye Liu, Xuezhen Huang, and Hongrui Jiang* 1. Introduction Heliotropism the sun for increased light interception.[1] Inspired by nature, we have realized artificial heliotropic) nanocomposite that we have developed. The mechanism of our artificial heliotropism is realized via direct

Jiang, Hongrui


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3879 www.advmat.de  

E-Print Network [OSTI]

.[12�14] Conventional Mg primary batteries use cathode materials (e.g., non-conductive AgCl, Cu-lasting current collectors and packages.[13,16] Replacing the cathode materials with biodegradable metals[17Cl or CuCl. The water-activated primary batteries that we report here involve constituent materials

Cheng, Jianjun


www.afm-journal.de 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

as they can absorb the fraction of the solar radiation which is carcinogenic for human. Additionally, while Zn, while PL is caused by the interaction between photon and materials. CL possesses many advantages over PL and other luminescence techniques. Higher spatial resolution (up to a few nm) and higher energy of electron

Kim, Bongsoo


2452 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheimwileyonlinelibrary.com full papers  

E-Print Network [OSTI]

. Production of hydrogen using solar light has been intensively investigated due to its distinct advantages to the current energy and environmental issues.[2] Many semiconductor materials have been used in solar energy. Introduction Hydrogen energy is widely accepted as a promising alterna- tive to traditional fossil fuels

Gong, Jian Ru


2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim2844 www.advmat.de  

E-Print Network [OSTI]

to Si solar cells to deliver efficient energy conversion with inexpensive fabrica- tion.[1 for the development of next generation organic/inorganic hybrid solar cells as one of the most promising alternatives,2] These conjugated polymer-based photovoltaic devices capitalize on the advantages peculiar to conjugated polymers

Lin, Zhiqun


1 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim wileyonlinelibrary.com 1. Introduction  

E-Print Network [OSTI]

Nanoparticles (NPs) with an asymmetry in polarity or chem- ical composition, so-called Janus particles (JPs)[1�3] referring to the double-faced Roman god, or asymmetric patchy parti- cles,[4,5] are of great interest, since-shell particles. In this context silver/silver halide (Ag/AgX) NPs have recently been reported to be very

Steiner, Ullrich


www.afm-journal.de 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

pro- vide only single measurement capabilities, in closed loop form for application around carbon-black-doped poly(dimethylsiloxane) (CB-PDMS) for the strain gauges due to its high resistivity and strong dependence on strain, and thick carbon-nanotube-doped PDMS (CNT- PDMS) for the interconnects due

Rogers, John A.


2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3801 www.advmat.de  

E-Print Network [OSTI]

alloys are responsible for the widespread application of a vast array of optoelectronic devices including of optoelectronic devices with unique characteristics, such as semiconductor lasers,[2] thin film solar cells,[3

Kimball, Gregory


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

-frequency transistors and optoelectronic devices.1­3 It has been reported that self-heating effects in GaN transistors and for tuning the wavelength of the emitted light in optoelectronic devices. They were also proposed

Atwater, Harry


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim722 wileyonlinelibrary.com  

E-Print Network [OSTI]

and material degradation is crucial for the rational design of high-performance lithium ion batteries (LIBs-layer graphene nanorib- bons remain mechanically robust after lithiation. This distinct contrast manifests. In addition, a new in situ chemical lithiation method is introduced for fast screening of battery materials

Chen, Sow-Hsin


2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim4318 www.advmat.de  

E-Print Network [OSTI]

materials in energy storage devices, such as electrochemical capacitors, fuel cells, and lithium batteries been pro- posed as promising lithium ion battery electrodes.[2­5] Silicon has a theoretical charge capacity of 4200 mA h g-1 as the anode for lithium ion batteries. However, the major problems pre- venting

Rubloff, Gary W.


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1wileyonlinelibrary.com COMMUNICATION  

E-Print Network [OSTI]

via hydrothermal processing the facile uniform deposition of electrochemically active materials Hydrothermal Fabrication of Three-Dimensional Secondary Battery Anodes Jinyun Liu, Hui Gang Zhang, Junjie Wang a generalized hydrothermal strategy for fabricating 3D mesostructured battery electrodes. While hydrothermal

Braun, Paul


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim2578 www.advmat.de  

E-Print Network [OSTI]

of devices ranging from electrical circuits to battery electrode materials. Mismatches in thermal expansion­5] The repeated lithiation and delithiation of battery electrode materials upon charging and discharging- grated sensing add complexity, weight, and cost to fault-tolerant designs. In battery materials

Braun, Paul


Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2013  

E-Print Network [OSTI]

), or a Chiralpak IC column (4.6 mm x 10 cm) obtained from Daicel Chemical Industries, Ltd. High resolution mass temperatures were controlled by an IKAmag temperature modulator. TLC was performed using E. Merck silica gel 60, or KMnO4 staining. ICN silica gel (particle size 0.032-0.0653 mm) was used for flash column

Stoltz, Brian M.

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2012  

E-Print Network [OSTI]

column (4.6 mm x 25 cm) obtained from Daicel Chemical Industries, Ltd with visualization at 254 nm 25 cm), or a Chiralpak IC column (4.6 mm x 10 cm) obtained from Daicel Chemical Industries, Ltd modulator. Thin-layer chromatography (TLC) was performed using E. Merck silica gel 60 F254 precoated plates

Stoltz, Brian M.


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1923 www.advmat.de  

E-Print Network [OSTI]

.MaterialsViews.com wileyonlinelibrary.com COMMUNICATION How High Local Charge Carrier Mobility and an Energy Cascade in a Three conversion efficiency and field-independent internal quantum efficien- cies over 90%.[1] However be due to the fact that the mixed region has been reported to have energy levels that are shifted

McGehee, Michael


www.afm-journal.de 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

(nano-CT)].[22] Phase contrast is impor- tant for obtaining reasonable signal-to-noise ratios (SNR) when transport and high electrochemical activity is crucial to achieving high performance, long lifetimes

Litster, Shawn


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

used as theranostic nanomedicine platforms for targeted drug delivery and high-throughput imaging.[8 theranostic nanobiomaterials. Polymeric nanoparticles are usually conjugated with additional organic dyes

Yang, Jian


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.advhealthmat.de  

E-Print Network [OSTI]

at the forefront of theranostic (therapeutic + diag- nostic) nanomedicine.[4,17,18] For example, fluorescent

Yang, Jian


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.advhealthmat.de  

E-Print Network [OSTI]

will be an important step in realizing the full potentials of MSNs as theranostic nanomedicines.[1,4] Aptamers, single

Cheng, Jianjun


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.advhealthmat.de  

E-Print Network [OSTI]

-determined areas of the microfluidic channel, we inte- grated miniature thermoelectric modules under predetermined interface material (poly(N- isopropylacrylamide), (PNIPAAm) and thermoelectric local tem- perature control-specific capture and release (Figure 1A and B). Cooled thermoresponsive channels (Figure 1C) and channels heated

Demirci, Utkan


www.afm-journal.de 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim2180  

E-Print Network [OSTI]

made using 3D printing. Neodymium­iron­boron (NdFeB) ring magnets are embedded in these components

Liu, X. Shirley


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3215 www.advmat.de  

E-Print Network [OSTI]

�11] Silica aerogels and core-shell nanoparticles have been used to this end;[12�14] however, due and coated by a hydrophilic surface. There are various techniques to produce porous particles.[15�17] One


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim2926 www.advmat.de  

E-Print Network [OSTI]

. The coating further leads to a plateau in the aerogel thermal conductivity over a range of temperatures, which�300 K) thermal, electrical, and thermoelectric properties of SWCNT aerogels with ultralow density ( 6.6 kg m-3 ). The aerogels are three-dimensional, isotropic networks of SWCNTs held together by van der

Islam, Mohammad F.


2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

limita- tions of traditional power supplies by providing a supplemen- tary electric power source appliances, such as washing machines and refrigera- tors, to bouncing automobile tires on a gravel road harvesting have been limited to transductions based on piezo- electric effect,[1­5] electromagnetic effect,[6

Wang, Zhong L.


2250 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheimwileyonlinelibrary.com full papers  

E-Print Network [OSTI]

of epitaxial transition metal templates for graphene growth have recently been demonstrated, including Ru(0001 transition metal films have recently been introduced as substrates for the scalable synthesis of transferable and uniform thickness are critical to harnessing these properties in applications. Growth on non-carbide

Ciobanu, Cristian


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1 www.advmat.de  

E-Print Network [OSTI]

] solar cells[9] and LEDs.[10,11] Most recently, several piezo-phototronic effect based thin-film devices furnace, and a silicon wafer with 2 nm Au layer placed at 25 cm from the source at the downstream. Figure

Wang, Zhong L.


2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1wileyonlinelibrary.com COMMUNICATION  

E-Print Network [OSTI]

.88% Efficient Tin Sulfide Solar Cells using Congruent Thermal Evaporation Vera Steinmann,* R. Jaramillo, Katy reported PCE for TE SnS solar cells is 1.6%, with a small device area of 0.01 cm2.[10] The cur- rent Sn this precursor powder in a dedicated tube furnace under vacuum (approximately 15 mTorr) at 500 °C for 60 min


www.afm-journal.de 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1  

E-Print Network [OSTI]

to the first, second and fourth power of the stretch, , respectively, where is defined as the linear length. Demonstrations of har- vesting electrical energy from diverse mechanical energy sources, including ocean waves and cycles, have been reported in the literature[2­8] since DEGs were first proposed in 2001,[1] the energy

Suo, Zhigang


www.afm-journal.de 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim5056  

E-Print Network [OSTI]

to the first, second and fourth power of the stretch, , respectively, where is defined as the linear length. Demonstrations of har- vesting electrical energy from diverse mechanical energy sources, including ocean waves and cycles, have been reported in the literature[2­8] since DEGs were first proposed in 2001,[1] the energy

Suo, Zhigang


High-Frequency Radars: Beamforming Calibrations Using Ships as Reflectors* X. FLORES-VIDAL  

E-Print Network [OSTI]

Rimouski, Universite du Quebec a Rimouski, Rimouski, Quebec, Canada K.-W. GURGEL Institut fur Meereskunde


VR Finanzen (Dr. Jankowitsch)  

E-Print Network [OSTI]

Automobil- und Industrieelektronik GmbH MCL Materials Center Leoben Forschung GmbH rTUb: researchTUb Gmb

Szmolyan, Peter


VR Finanzen (Dr. Jankowitsch)  

E-Print Network [OSTI]

TS Universitäres Gründerservice Wien GmbH KAI: KAI Kompetenzzentrum Automobil- und Industrieelektronik GmbH MCL

Szmolyan, Peter


Recent International R&D Activities in the Extraction of Uranium from Seawater  

E-Print Network [OSTI]

GKSS-Forschungszentrum Geesthacht G..m..b..H. , Fed. Rep.GKSS-Forschungszentrum Geesthacht G..m..b..H. , Fed. Rep.

Rao, Linfeng


Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Korporativ Frdernde Mitglieder Seite 1 von 12 Stand 26.03.2014  

E-Print Network [OSTI]

Hewlett-Packard GmbH Berlin HSBC Trinkaus & Burkhardt AG Düsseldorf H. Hugendubel GmbH & Co. KG München


imulation und Optimierung der Standort- und Kapazitatsauswahl in der Planung von Ladeinfrastruktur fur batterieelektrische Fahrzeug?otten  

E-Print Network [OSTI]

mit einem Verbrennungsmotor. Das erste batteriebetriebeneim Vergleich zum Verbrennungsmotor deutlich schlechterbei Fahrzeugen mit Verbrennungsmotor. Bei gleichem Gewicht

Siefen, Kostja



ATLAS-Experiment Abbildung 48: Monte-Carlo-Simulation eines tt-Ereignisses in einem Layout fur den Inne-  

E-Print Network [OSTI]

ATLAS-Experiment Abbildung 48: Monte-Carlo-Simulation eines t¯t-Ereignisses in einem Layout f¨ur den Inne- ren Detektor des ATLAS-Experiments mit vier Lagen von Silizium-Pixeldetektoren und f¨unf Lagen von Silizium-Streifendetektoren. 82 #12;ATLAS-Experiment ATLAS-Experiment Gruppenleiter: M


Phase transition in a chain of quantum vortices Institut fur Theoretische Festkorperphysik, Universitat Karlsruhe, D-76128 Karlsruhe, Germany  

E-Print Network [OSTI]

. In the commensurate phase an elementary excitation is a soliton with energy separated from the ground state quantum; the propagation of solitons leads to a finite resistance of the array. We find the dependence of the resistance activation energy on the magnetic field and parameters of the Josephson array. This energy

van Oudenaarden, Alexander


X-ray Absorption Spectroscopy Study of Prototype Chemical Systems: Theory vs. Experiment  

E-Print Network [OSTI]

E. Teller, Zeitschrift Fur Physikalische Chemie-AbteilungB-Chemie Der Elementarprozesse Aufbau Der Materie 21 (5/6),Zeitschrift Fur Physikalische Chemie-Abteilung B-Chemie Der

Schwartz, Craig Philip



Please cite this article in press as: Schlachter, C., et al., Biosens. Bioelectron. (2011), doi:10.1016/j.bios.2011.11.003 ARTICLE IN PRESS  

E-Print Network [OSTI]

University Berlin, Thielallee 63, 14195 Berlin, Germany d Alacris Theranostics GmbH, Fabeckstr. 60, 14195

Konthur, Zoltán


Control of DNA Strand Displacement Kinetics Using Toehold Exchange  

E-Print Network [OSTI]

static structures that self-assemble from synthetic DNA oligonucleotides of defined sequence.1-4 Fur

Zhang, David Yu


A Modular Building Controls Virtual Test Bed for the Integrations of Heterogeneous Systems  

E-Print Network [OSTI]

Martin Otter, Proceedings of the 2nd Modelica con- ference.Modelica Association and Deutsches Zen- trum fur Luft- und

Wetter, Michael



Spring 2012 Space and Time  

E-Print Network [OSTI]

accept that we orbit a thermonuclear fur- nace, the Sun, whose physical properties are quite common, so


The ecology of furbearers in the Upland Post Oak Region of Eastern Texas  

E-Print Network [OSTI]

prime and unprime pelts . . . 165 38. Ringtail pelts, prime and unprime. 166 39. Ringtail fur mounts showing frayed hair, . . . . . . . . 167 Illustrations (continued) 40. Unprime gray fox hide. ................. . 167 41. Gray fox fur mounts... prime and unprime pelts . . . 165 38. Ringtail pelts, prime and unprime. 166 39. Ringtail fur mounts showing frayed hair, . . . . . . . . 167 Illustrations (continued) 40. Unprime gray fox hide. ................. . 167 41. Gray fox fur mounts...

Wood, John Eugene



12 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim small 2011, 7, No. 1, 1248wileyonlinelibrary.com Biomicrofluidics  

E-Print Network [OSTI]

.com reviews Biomicrofluidics Microfluidic Devices for Bioapplications Leslie Y. Yeo,* Hsueh-Chia Chang, Peggy and manipulate bioparticles such as DNA, cells, and molecules at the microscale, microfluidics is a powerful tool in microfluidic technology are a wide range of promising laboratory and consumer biotechnological applications

Chang, Hsueh-Chia


2011 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimAdv. Mater. 2011, XX, 15 1 www.advmat.de  

E-Print Network [OSTI]

plants, wind farms, solar farms, and more recently, novel piezoelectric devices[1] for power generation from mechanical vibration.[2] Fully utilizing power sources such as light,[3­5] thermal, and mechanical of a simulated sun emission (100 mW/cm2 ), the optimum power is enhanced by 6% after incorporating

Wang, Zhong L.


2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim phys. stat. sol. (b) 245, No. 11, 25992604 (2008) / DOI 10.1002/pssb.200743502  

E-Print Network [OSTI]

the influence of imperfect surfaces on polarization distribution, phase-transition temperature, dielectric Polarization properties of ferroelectric thin films on transverse Ising model Punan Sun1, 2 , Tianquan Lü*, 1 temperature as a func- tion of superlattice wavelength and quantitatively explain the experimental data of KTa

Cao, Wenwu


2011 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimAdv. Mater. 2011, XX, 16 1 www.advmat.de  

E-Print Network [OSTI]

fugitive inks in combination with vertical printing to create 3D interpenetrating microvascular networks to create true 3D biomimetic microvascular networks. Here, we demonstrate the omnidirectional printing (ODP of 3D Microvascular Networks W. Wu, A. DeConinck, Prof. J. A. Lewis Department of Materials Science

Lewis, Jennifer


2836 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheimwileyonlinelibrary.com small 2011, 7, No. 20, 28362839 Nanoscience  

E-Print Network [OSTI]

, 2836­2839 essay Nanoscience Introduction: Defining the Field Various definitions of the fields of nanoscience and nano- technology have been widely debated in the literature.[1] Despite the accusations- ence of nanoscience and nanotechnology on long-established fields in the pure and applied sciences

Zhang, Minghua


Proceedings of ERAD (2002): 95103 c Copernicus GmbH 2002 Extraction and analysis of structural features in cloud radar and  

E-Print Network [OSTI]

. Zhariy3 , P. Maa?3 , and K. Sassen4 1 GKSS Research Center, Institute for Coastal Research, Geesthacht the morphology of cloud fields as well as cloud internal structure. The GKSS 95 GHz cloud radar: M. Quante (markus.quante@gkss.de) is of importance for the development of strategies and codes

Teschke, Gerd


WILEY-VCH Verlag GmbH, 69451 Weinheim, 2002 0038-9056/2002/0707-0273 $17.50+.50/0 Starch/Strke 54 (2002) 273284 273  

E-Print Network [OSTI]

solids and treat water for recycling in many food process- ing industries. Several reviews have been processing industry; these include pretreatment of fresh water, recovery of solids and wastewater treatment- ducing evaporation costs, improving product recovery and removing solids prior to wastewater treatment


www.afm-journal.de 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Adv. Funct. Mater. 2010, 20, 391839243918  

E-Print Network [OSTI]

photovoltaic. This is first example of a large area plasmonic solar cell with organized nanostructures commercial solar cells.[13] Despite all these promising applica- tions, most of the work with PANHs reported production. Hence, any possible implementation of applications based on EOT using PANHs requires a method

Brolo, Alexandre G.


2037 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim wileyonlinelibrary.comsmall 2011, 7, No. 14, 20372040 Silver Nanoparticles  

E-Print Network [OSTI]

, and controllable pore systems for applications in heterogeneous catalysis, fuel cell development, solar energy control of the composition and shell thickness of the struc- ture are the biggest advantages

Yang, Peidong


2011 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimAdv. Mater. 2011, XX, 17 1 www.advmat.de  

E-Print Network [OSTI]

cost-effective integration of in- frared optoelectronic devices with well-established silicon been able to produce the high quality electronic material needed in optoelectronic devices, since

Atwater, Harry

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim phys. stat. sol. (RRL) 1, No. 5, 169171 (2007) / DOI 10.1002/pssr.200701106  

E-Print Network [OSTI]

. This makes them attractive for optoelectronic devices that need short wavelength of the vis- ible range. This enables the tuning of the emission wavelength of the optoelectronic devices by choosing a suitable

Nabben, Reinhard


2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim p s scurrent topics in solid state physics  

E-Print Network [OSTI]

periods of GaInN/GaN MQWs with well width of 3 nm are grown above. A 0.03 µm p-type AlGaN cladding layer . For comparison, commercial green LEDs provided by Nichia Inc. were studied. A 325-nm HeCd laser was used as the source of bias excitation. The power density is 0.5 kW/cm2 . The continu- ous wave laser beams were

Wetzel, Christian M.


1 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim wileyonlinelibrary.com Intelligent and Ultrasensitive Analysis of Mercury  

E-Print Network [OSTI]

handling and analysis procedures, SERS obtained from the metama- terials is a direct measurement and can. Zhang, Prof. Q.-H. Xiong Division of Physics and Applied Physics School of Physical and Mathematical Sciences Nanyang Technological University Singapore 637371 E-mail: Qihua@ntu.edu.sg Prof. Q.-H. Xiong

Xiong, Qihua


2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Adv. Mater. 2010, 22, 332233263322 www.advmat.de  

E-Print Network [OSTI]

] molecular recognition,[1g] and, more recently, as proton exchange membranes for high temperature fuel cells-controlled MOF nanocrystals and ii) the optimization of film microstructures, including grain size and shape

Li, Weixue


phys. stat. sol. (c), 14 (2003) / DOI 10.1002/pssc.200303518 2003 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim  

E-Print Network [OSTI]

assigned; citable using Digital Object Identifier ­ DOI) High-speed solar-blind AlGaN-based metal 2003 Published online 14 November 2003 PACS 85.60.Dw, 85.60.Gz Solar-blind AlGaN metal bias. Photoconductive gain-assisted photoresponse was observed with a peak responsivity of 1.26 A

Aytür, Orhan


2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim p s scurrent topics in solid state physics  

E-Print Network [OSTI]

directing elements for light emitting devices. Many recent activities in the NSAG field have focused on Ga. Comparison of the stress properties between the nanodots, nanostripes, and continu- ous GaN film grown by metal organic vapor phase epitaxy. By varying the growth reactor pressure, we have been able to grow

Sirenko, Andrei


2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim p s scurrent topics in solid state physics  

E-Print Network [OSTI]

Samples were grown by low- pressure MOVPE in a single-wafer Aixtron system with a horizontal reactor growth rate ratio of ~0.3 through a comparison of the top to sidewall facet MQW periods. Masks orientated along the crystallographic direction showed stronger growth enhancement along with large global

Sirenko, Andrei


2010 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimAdv. Mater. 2010, 22, 32773281 3277 www.advmat.de  

E-Print Network [OSTI]

energy-conversion efficiencies using material that has a low ratio of minority-carrier collec- tion. These systems offer the potential for attaining high solar energy-conversion efficiencies using modest diffusion effect of Cu as an impurity in p-Si based solar cells.[15] Minority-carrier collection lengths >10 m have

Atwater, Harry


0014-2980/02/0909-2644$17.50+.50/0 2002 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Impact of antigen expression kinetics  

E-Print Network [OSTI]

infections [11, 12]. The HIV proteins Tat, Rev and Nef have been detected at 6 h of antigen expression kinetics on the effectiveness of HIV-specific cytotoxic T lymphocytes Carel A. van this applies to the effectiveness of HIV-1-specific CTL, we measured virus production in cultures containing CD

van Baalen, Minus


www.afm-journal.de 2011 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimAdv. Funct. Mater. 2011, XX, 19 1  

E-Print Network [OSTI]

, by con- forming to both micro- and nano-scale asperities, achieve a large true area of con- tact, so environmental conditions the gecko adhesive pads, by changing their hydro- phobicity under humid conditions of polydimethylsiloxane (PDMS) were fabri- cated using massively parallel micro-electromechanical systems (MEMS


271 Ernst & Sohn Verlag fr Architektur und technische Wissenschaften GmbH & Co. KG, Berlin Bauphysik 31 (2009), Heft 5 Die Entwicklung energetisch optimierter Lftungsstrategien fr  

E-Print Network [OSTI]

of this work was to develop a flexible, object- oriented, hygrothermal model library based on the Modelica mo werden. New object-oriented hygrothermal model library for calculating hygrothermal and hygienic comfort Modellierungssprache Modelica, für die Simulation und die Analyse der Wechselwirkungen zwischen Raumklima, Bauteil


2011 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimAdv. Mater. 2011, XX, 15 1 www.advmat.de  

E-Print Network [OSTI]

, Ontario M5S 3G4, Canada E-mail: ted.sargent@utoronto.ca Dr. D. A. R. Barkhouse IBM Thomas J. Watson Research Center Kitchawan Road, Yorktown Heights, NY, 10598, USA Dr. A. G. Pattantyus-Abraham Quantum Solar Power Corporation 1055 W. Hastings, Ste. 300, Vancouver, BC, V6E 2E9, Canada Dr. L. Etgar, Prof. M


Second-order Raman spectra of single and multiwalled carbon nanotubes Institut fur Festkorperphysik, Technische Universtat Berlin, Hardenbergstrasse 36, 10623 Berlin, Germany  

E-Print Network [OSTI]

. The excitation-energy dependence of the D and D? modes in single-walled nanotubes is 38 and 90 cm 1 /eSecond-order Raman spectra of single and multiwalled carbon nanotubes C. Thomsen Institut fu of single- walled nanotubes softens by 30 cm 1 over the value of graphite. A comparison of the phonon

Nabben, Reinhard


The Ornibactin Biosynthesis and Transport Genes of Burkholderia cenocepacia Are Regulated by an Extracytoplasmic Function ? Factor Which Is a Part of the Fur Regulon  

Science Journals Connector (OSTI)

...replacement. pSHAFT-orbS::Tp was mobilized from E. coli S17-1...integrity of candidate orbS::Tp mutants was confirmed by two...dfrB2 (Tpr) gene from p34E-Tp. Genomic DNA fragments corresponding...of transformants was made on Iso-Sensitest agar (Oxoid, Basingstoke...

Kirsty Agnoli; Carolyn A. Lowe; Kate L. Farmer; Seyyed I. Husnain; Mark S. Thomas



Lunar cycles in diel prey migrations exert a stronger effect on the diving of juveniles than adult Gal pagos fur seals  

Science Journals Connector (OSTI)

...of Marine Biology,Texas A MUniversity at Galveston, , 5007 Avenue U...of Marine Biology, Texas A & M University at Galveston 77551, USA. horningm...of Marine Biology,Texas A & M University at Galveston, 5007 Avenue U, Galveston...



Northern Fur Seals (Callorhinus ursinus) of the Commander Islands: Summer Feeding Trips, Winter Migrations and Interactions with Killer Whales (Orcinus orca)  

E-Print Network [OSTI]

direction, dive depth) of animals from two nearby rookeries on Bering Island, 2) winter migration from Medny and Bering Islands relative to patterns of ocean productivity, and 3) the potential impact of killer whale predation on population dynamics. Data...

Belonovich, Olga Andreevna



Validated SCR Concept Development  

Broader source: Energy.gov (indexed) [DOE]

Validated SCR Concept Development 2007 DEER Conference, Detroit, MI Dr. Michael Traver, IAV Inc James Ireton, IAV Inc Dr. Lutz Krmer, IAV GmbH Jrgen Manns, IAV GmbH Poster...


Comparison of measured and calculated dose rates for the castor HAW 20/28 CG  

Science Journals Connector (OSTI)

......Scheib 2 A. Rimpler 2 Corresponding author: kuehl@wti.wse.de 1 WTI Wissenschaftlich-Technische Ingenieurberatung GmbH...10) dose rate from the Bonner sphere system. | WTI Wissenschaftlich-Technische Ingenieurberatung GmbH......

O. Ringleb; H. Khl; H. Scheib; A. Rimpler



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


(Trippstadter Str.) Ab 18:00 Uhr Auftaktveranstaltung UNISPORT (UNISPORT-Halle)  

E-Print Network [OSTI]

DFKI 9 Energieagentur Rheinland-Pfalz GmbH 11 FH Kaiserslautern 13 Fraunhofer IESE 15 Fraunhofer ITWM. V. #12;6 7 bic Business + Innovation Center Kaiserslautern GmbH ,,Enabling Spaces" ,,Enabling Spaces

Pinnau, René

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Individual monitoring for internal exposure in Europe and the integration of dosimetric data  

Science Journals Connector (OSTI)

......Oppenheim E.ON Kernkraft GmbH, Messstelle Inkorporation, Brokdorf Kernkraftwerk Krummel GmbH, Inkorporationsmessstelle, Geesthacht VKTA Rossendorf e.V., Inkorporationsmessstelle, Dresden Denmark (DK) This Scandinavian country has no legally approved......

M. A. Lopez Ponte; C. M. Castellani; L. Currivan; R. Falk; P. Olko; C. Wernli



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


E-Print Network 3.0 - austrian research center seibersdorf Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CSM... -Chrysler AG, Germany Austrian Research Center Seibersdorf GmbH, Austria Fraunhofer Institut, Germany... ... Source: Ris National Laboratory Collection:...


Advanced Diesel Common Rail Injection System for Future Emission Legislation  

Broader source: Energy.gov [DOE]

2004 Diesel Engine Emissions Reduction (DEER) Conference Presentation: Robert Bosch GMBH Common Rail System Engineering for PC Diesel Systems


Differential schlieren-interferometry with a simple adjustable Wollaston-like prism  

E-Print Network [OSTI]

known to the authors include: Bernhard Halle Nachfl. GmbH (Germany), Red Optronics (USA), CVI Optical

Settles, Gary S.


Atmos. Chem. Phys., 8, 251264, 2008 www.atmos-chem-phys.net/8/251/2008/  

E-Print Network [OSTI]

and Institut f¨ur K¨ustenforschung, GKSS-Forschungszentrum Geesthacht GmbH, 21502 Geesthacht, Germany Received

Paris-Sud XI, Université de


2, 14031427, 2002 Polarization  

E-Print Network [OSTI]

, University of Bremen, Germany 2 GKSS Research Center Geesthacht GmbH, Geesthacht, Germany Received: 30 August

Paris-Sud XI, Université de


Vol. 63 No. 4 JOM 105www.tms.org/jom.html research Activities of Biomedical  

E-Print Network [OSTI]

Forschungszentrum Geesthacht GmbH, much research on biodegrad- able Mg alloys has been done in China

Zheng, Yufeng


Atmos. Chem. Phys., 3, 3948, 2003 www.atmos-chem-phys.org/acp/3/39/ Atmospheric  

E-Print Network [OSTI]

of Environmental Physics, University of Bremen, Germany 2GKSS Research Center Geesthacht GmbH, Geesthacht, Germany

Paris-Sud XI, Université de


Atmos. Chem. Phys., 11, 47794787, 2011 www.atmos-chem-phys.net/11/4779/2011/  

E-Print Network [OSTI]

, Stellenbosch 7599, South Africa 3GKSS Forschungszentrum Geesthacht GmbH, Max-Planck-Strasse, 21502 Geesthacht

Meskhidze, Nicholas


Industriepartner und Partnerinstitute mit denen unser Fachgebiet kooperiert Partnerinstitut bzw. Hochschule bzw. Hochschulen im  

E-Print Network [OSTI]

, Fachgebiet Montagetechnik und Fabrikbetrieb Industriepartner: BSH Bosch und Siemens Hausgeräte GmbH, Berlin

Berlin,Technische Universität


Biosensors and Bioelectronics 31 (2012) 571574 Contents lists available at SciVerse ScienceDirect  

E-Print Network [OSTI]

/Biochemistry, Free University Berlin, Thielallee 63, 14195 Berlin, Germany d Alacris Theranostics GmbH, Fabeckstr. 60

Konthur, Zoltán


Curriculum Vitae Dr. Matthias Zahn  

E-Print Network [OSTI]

Mitarbeiter im ,,SFB-512" am GKSS-Forschungszentrum Geesthacht GmbH 11/2008 ­ 04/2009 Wissenschaftlicher der Universität Hamburg und am GKSS-Forschungszentrum Geesthacht GmbH Titel: 'Trends and variability Küstenforschung im GKSS-Forschungszentrum Geesthacht GmbH Studium an der Universität Lüneburg 07/2005 Diplom

Zahn, Matthias


E-Print Network 3.0 - auf die kosten Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Abteilung Informatikdienste Summary: MacOS XLinux Stata Preis auf Anfrage DeutschEnglisch WinMacOS XLinux Die Kosten fur das Mac OS X... Sprache Betriebssystem...


E-Print Network 3.0 - albula complex teleostei Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for independent origin of two spring-spawning ciscoes (Salmoniformes: Coregonidae) in Germany Summary: von Coregonus albula L. (Teleostei; Coregonidae). Zeitschrift fur...


DISSERTATION Cluster Simulation in Time-Triggered  

E-Print Network [OSTI]

die Knoten wird besonders in der Automobil- und in der Flugzeugindustrie von sogenannten Entwicklungsproze von solchen verteilten Applikationen speziell fur die Unternehmensstruktur der Automobil- und der


Building America Technology Solutions for New and Existing Homes...  

Energy Savers [EERE]

Florida (Fact Sheet) Building America Technology Solutions for New and Existing Homes: Duct in Conditioned Space in a Dropped Ceiling or Fur-down, Gainesville, Florida...


E-Print Network 3.0 - amazonian chocolate tree Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(Davis 1975). Fur of neck and shoulders is paler than body... Venezuela), Guyana, Suriname, French Guiana, and eastern Amazonian Ecuador (Albuja V. 1999; Anderson 1997......


The use of the Robertson meter to measure the penetration of solar ...  

Science Journals Connector (OSTI)

Oct 12, 1974 ... University of Massachusetts. Amherst 01002. References. BERNER, R. A. 1969. Migration of iron and sul- fur within anaerobic sediments...



E-Print Network 3.0 - activation heat Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to collect and distribute solar heat. These buildings have active solar heating systems. Active... in an ordinary fur- nace system. ... Source: North Carolina State...

Note: This page contains sample records for the topic "fur solartechnologien gmbh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - absorption spectrometry feasibility Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Franc&o, CA 94101&fM, USA Laser Microprobe Mass Spectrometry Summary: graphite fur- nace atomic absorption spectrometry (ETAAS) measurement of tin in sulfate matrices were......


E-Print Network 3.0 - activity rules periodic Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Active and Deductive Databases by Institut fur Informatik ---Report 70 Summary: , passive query rules and active transition rules within a simple, yet flexible logical...


Designing for Learning: Multiplayer Digital Game Learning Environments  

E-Print Network [OSTI]

Networked Virtual Environments: Design and Implementation.Performance Within Virtual Environments. In W. Barfield andFurness (Eds. ), Virtual Environments and Advanced Interface

Kim, Chung



6/26/07:swh 1 New Courses and Course Changes  

E-Print Network [OSTI]

revolution & industrial archaeology; slavery & inequality; and military sites archaeology. Recommended: Anth. Topics include heritage, history, and interpretation; the archaeology of the fur trade; the industrial

Bertini, Robert L.


2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 1725 Biotechnol. J. 2009, 4, 17251739 DOI 10.1002/biot.200900127 www.biotechnology-journal.com  

E-Print Network [OSTI]

-added chemicals from renewable sources. Because of its association with reduced energy consumption, greenhouse gas of chemicals, materials, and fuels from renewable sources, using living cells and/or their enzymes. This field players in industrial biotechnology in- clude the European Union [3, 4], China, India, and Brazil

Zhao, Huimin


ChemBioChem 2004, 5, 379 383 DOI: 10.1002/cbic.200300804 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 379 Probing Protein Carbohydrate  

E-Print Network [OSTI]

Daniel M. Ratner,[a] Eddie W. Adams,[a] Jing Su,[b] Barry R. O'Keefe,[c] Milan Mrksich,[b] and Peter H ¥ luminescence ¥ monolayers ¥ self-assembly [1] a) T. R. Cach, A. J. Zang, P. J. Grabowski, Cell, 1981, 27, 487 ± 496; b) C. Guerrier-Takeda, K. Gardiner, T. Marsh, N. Pace, S. Altman, Cell, 1983, 35, 849 ± 857. [2

Ratner, Daniel M.


COMMUNICATIONS 1432 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1998 1433-7851/98/3710-1432 $ 17.50+.50/0 Angew. Chem. Int. Ed. 1998, 37, No. 10  

E-Print Network [OSTI]

hinders the growth of single crystals and is difficult to remove. Ammonia was condensed onto elemental, M. L. H. Green, M. A. Kelland, J. B. Leach, P. Mountford, G. Stringer, N. M. Walker, L. L. Wong, J. Chem. Soc. Chem. Commun. 1988, 799. [3] M. L. H. Green, P. Mountford, P. D. Grebenik, J. B. Leach, J. M

Müller, Peter


2014 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1wileyonlinelibrary.com www.particle-journal.comwww.MaterialsViews.com  

E-Print Network [OSTI]

producing metallic spherical nanoparticle tips using only a simple electrochemical cell. Fabrication of Au to flu- orine-doped tin oxide (FTO) conductive glass, used as a workingDOI: 10.1002/ppsc.201400104 Facile has become dedicated to the use of sharp metal tips as nanoscale optical antennae, exploiting sur

Steiner, Ullrich


2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 1 Biotechnol. J. 2010, 5 DOI 10.1002/biot.200900303 www.biotechnology-journal.com  

E-Print Network [OSTI]

.200900303 www.biotechnology-journal.com 1 Introduction Many biotechnologically relevant processes in- volve production ­ Theoretical analysis for biotechnological applications Stefan Schuster1, Jan-Ulrich Kreft2 in terms of biotechnologically relevant parameters. For any given population density, three distinct

Ruppin, Eytan


COMMUNICATIONS Angew. Chem. Int. Ed. 1999, 38, No. 6 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1999 1433-7851/99/3806-0813 $ 17.50+.50/0 813  

E-Print Network [OSTI]

1433-7851/99/3806-0813 $ 17.50+.50/0 813 [{MeAl(m2-F)}2N(2,6-iPr2C6H3)]4Ð A Molecular Al-F-N Cage describe the synthesis of [(2,6-iPr2C6H3NH)MeAl(m2-F)]4 (1) and its pyrolysis to the first Al-F-N cageF and (2,6-iPr2C6H3)NH2 (Scheme 1). Scheme 1. Synthesis of 1 and 2. Ar 2,6-iPr2C6H3. In the first step

Müller, Peter


COMMUNICATIONS 1100 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1998 1433-7851/98/3708-1100 $ 17.50+.50/0 Angew. Chem. Int. Ed. 1998, 37, No. 8  

E-Print Network [OSTI]

R R OMs OMs R R OH OH PH2 PH2 P P R R R R R = Me, 1 , NaH > 99 % MsCl, Et3N CH2Cl2 R = iPr , 2 R = Me, 3 R = iPr, 4 R = Me, 5, 43 % R = iPr, 6, 54%HMPA, THF, 0 °C 20 °C Scheme 1. Synthesis of the PennPho

Zhang, Xumu


COMMUNICATIONS Angew. Chem. Int. Ed. 2000, 39, No. 22 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2000 1433-7851/00/3922-4041 $ 17.50+.50/0 4041  

E-Print Network [OSTI]

cationic brucite-like layers, by simple ion exchange. The LDH can protect the DNA from degradation brucite-like layers and exchangeable interlayer anions (Figure 1A).[1] The unique anion exchange interaction between cationic brucite layers and anionic biomolecules, as depicted in Figure 1C. Here

Park, Jong-Sang


ChemPhysChem 2004, 5, 321 326 DOI: 10.1002/cphc.200300776 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 321 Infrared Cavity Ringdown Spectroscopy of Jet-  

E-Print Network [OSTI]

products of incomplete hydrocarbon combustion processes,[1] and are now generally acknowledgedA, Weinheim 321 Infrared Cavity Ringdown Spectroscopy of Jet- Cooled Polycyclic Aromatic Hydrocarbons Alex J for naphthalene, anthracene, phenanthrene, pyrene, and perylene using a heated, supersonic, slit-jet source

Cohen, Ronald C.


2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 791 Biotechnol. J. 2010, 5, 791 DOI 10.1002/biot.201000262 www.biotechnology-journal.com  

E-Print Network [OSTI]

to achieve a number of goals such as production of drugs, chemicals, fuel and materials, or degradation single-cell organism) in vitro. To the public it may seem that scientists are play- ing God, which


phys. stat. sol. (c) 0, No. 4, 11771180 (2003) / DOI 10.1002/pssc.200303033 2003 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1610-1634/03/00007-1177 $ 17.50+.50/0  

E-Print Network [OSTI]

epitaxial structures and fully processed laser diodes against particle irradiation as compared to bulk and 2 of a GaAs substrate, the active layer together with GaAs cladding layers were placed between two Al techniques. The excita- tion was performed by a Ti:sapphire laser system including an OPO, with spectrally

Nabben, Reinhard


2003 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 0947-6539/03/0902-0372 $ 20.00+.50/0 Chem. Eur. J. 2003, 9, No. 2372 P. G. Wang et al.  

E-Print Network [OSTI]

for NTP and NDP-sugars (re)generation. The sources of energy for regeneration consist of cheaper high-energy phosphate compounds or polyphosphate (step I, Figure 1).[3] Polyphosphate is the cheapest alternative cycles are necessary for the glycosylation. The multistep enzyme reaction can be efficiently car

Chen, Xi


Proceedings of Eurosun 2004, published by PSE GmbH, Freiburg, Germany, pp. (3) 916-920, 2004 HelioClim: a long-term database on solar radiation for  

E-Print Network [OSTI]

- tions, urban air quality studies, sizing of space borne sensors, solar energy engineering or evenClim: a long-term database on solar radiation for Europe and Africa S. Cros, M. Albuisson, M. Lefèvre, C-series of solar radiation data. Daily irradiation values are available over Europe, Africa and Atlantic Ocean

Paris-Sud XI, Université de


COMMUNICATIONS Angew. Chem. Int. Ed. 2001, 40, No. 22 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2001 1433-7851/01/4022-4239 $ 17.50+.50/0 4239  

E-Print Network [OSTI]

superstructure. In contrast to many, or most man-made, catalysts, naturally occurring enzymes tend to rely upon on a Marresearch Image Plate system using MoKa radiation with the crystal positioned at 70 mm from the Image Plate


652 WILEY-VCH Verlag GmbH, 69451 Weinheim, Germany, 2002 1433-7851/02/4104-0652 $ 17.50+.50/0 Angew. Chem. Int. Ed. 2002, 41, No. 4 Autonomous Movement and Self-Assembly**  

E-Print Network [OSTI]

in motion. This paper describes the behavior of small (small area the components move autonomously by ejecting small bubbles of gas formed by catalytic decomposition of a liquid motion indefinitely. Metallic plati- num is an excellent catalyst for the decomposition of hydro- ge

Prentiss, Mara


COMMUNICATIONS 2748 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2000 1433-7851/00/3915-2748 $ 17.50+.50/0 Angew. Chem. Int. Ed. 2000, 39, No. 15  

E-Print Network [OSTI]

-resolved differential cross-section (DCS)[9, 10] for the H H2 and D H2 reactions. The past ten years have witnessed introduced to explain sharp features in the collision cross-section of neutrons with heavy nuclei efforts. In the late 1980s, Nieh and Valentini[6] reported scattering resonances in the integral cross-section

Zare, Richard N.