National Library of Energy BETA

Sample records for fungal polyketide cyclization

  1. Structure Illuminates Mechanism of Fungal Polyketide Cyclization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Structure Illuminates Mechanism of Fungal Polyketide Cyclization Structure Illuminates Mechanism of Fungal Polyketide Cyclization Print Wednesday, 31 March 2010 00:00 Polyketide natural products produced by bacteria and fungi are often characterized by the presence of multiple aromatic rings that are responsible for the activity of polyketides as both beneficial antibiotic and anticancer agents and as dangerous toxic compounds, such as the highly carcinogenic aflatoxins that are produced by

  2. Structure Illuminates Mechanism of Fungal Polyketide Cyclization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Structure Illuminates Mechanism of Fungal Polyketide Cyclization Print Polyketide natural products produced by bacteria and fungi are often characterized by the presence of multiple aromatic rings that are responsible for the activity of polyketides as both beneficial antibiotic and anticancer agents and as dangerous toxic compounds, such as the highly carcinogenic aflatoxins that are produced by fungal species from the Aspergillus family of molds. Polyketide ring formation by fungal enzymes

  3. Structure Illuminates Mechanism of Fungal Polyketide Cyclization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Structure Illuminates Mechanism of Fungal Polyketide Cyclization Print Polyketide natural products produced by bacteria and fungi are often characterized by the presence of multiple aromatic rings that are responsible for the activity of polyketides as both beneficial antibiotic and anticancer agents and as dangerous toxic compounds, such as the highly carcinogenic aflatoxins that are produced by fungal species from the Aspergillus family of molds. Polyketide ring formation by fungal enzymes

  4. Structure Illuminates Mechanism of Fungal Polyketide Cyclization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Structure Illuminates Mechanism of Fungal Polyketide Cyclization Print Polyketide natural products produced by bacteria and fungi are often characterized by the presence of multiple aromatic rings that are responsible for the activity of polyketides as both beneficial antibiotic and anticancer agents and as dangerous toxic compounds, such as the highly carcinogenic aflatoxins that are produced by fungal species from the Aspergillus family of molds. Polyketide ring formation by fungal enzymes

  5. Structure Illuminates Mechanism of Fungal Polyketide Cyclization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Structure Illuminates Mechanism of Fungal Polyketide Cyclization Print Polyketide natural products produced by bacteria and fungi are often characterized by the presence of multiple aromatic rings that are responsible for the activity of polyketides as both beneficial antibiotic and anticancer agents and as dangerous toxic compounds, such as the highly carcinogenic aflatoxins that are produced by fungal species from the Aspergillus family of molds. Polyketide ring formation by fungal enzymes

  6. Structure Illuminates Mechanism of Fungal Polyketide Cyclization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    specific cyclization pattern exclusive to fungi, an amazing feat of origami. In contrast, bacteria fold the linear chain into a completely different pattern, as promoted by an...

  7. ALSNews Vol. 307

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Mechanism of Fungal Polyketide Cyclization Polyketides are synthesized in bacteria and fungi by a protein megacomplex called polyketide synthase (PKS), which is mediated by the...

  8. Producing biofuels using polyketide synthases

    DOE Patents [OSTI]

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  9. Producing dicarboxylic acids using polyketide synthases

    DOE Patents [OSTI]

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-10-29

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  10. Producing dicarboxylic acids using polyketide synthases

    DOE Patents [OSTI]

    Katz, Leonard; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-05-26

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  11. Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

    SciTech Connect (OSTI)

    Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

    2012-02-01

    Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

  12. The role of structural parameters in DNA cyclization

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Alexandrov, Ludmil B.; Bishop, Alan R.; Rasmussen, Kim O.; Alexandrov, Boian S.

    2016-02-04

    The intrinsic bendability of DNA plays an important role with relevance for myriad of essential cellular mechanisms. The flexibility of a DNA fragment can be experimentally and computationally examined by its propensity for cyclization, quantified by the Jacobson-Stockmayer J factor. In this paper, we use a well-established coarse-grained three-dimensional model of DNA and seven distinct sets of experimentally and computationally derived conformational parameters of the double helix to evaluate the role of structural parameters in calculating DNA cyclization.

  13. Producing a trimethylpentanoic acid using hybrid polyketide synthases

    DOE Patents [OSTI]

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2014-10-07

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

  14. Fungal Genomics Program

    SciTech Connect (OSTI)

    Grigoriev, Igor

    2012-03-12

    The JGI Fungal Genomics Program aims to scale up sequencing and analysis of fungal genomes to explore the diversity of fungi important for energy and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world in fungal genome sequencing and analysis. Over 120 sequenced fungal genomes with analytical tools are available via MycoCosm (www.jgi.doe.gov/fungi), a web-portal for fungal biologists. Our model of interacting with user communities, unique among other sequencing centers, helps organize these communities, improves genome annotation and analysis work, and facilitates new larger-scale genomic projects. This resulted in 20 high-profile papers published in 2011 alone and contributing to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts). Our next grand challenges include larger scale exploration of fungal diversity (1000 fungal genomes), developing molecular tools for DOE-relevant model organisms, and analysis of complex systems and metagenomes.

  15. JGI Fungal Genomics Program

    SciTech Connect (OSTI)

    Grigoriev, Igor V.

    2011-03-14

    Genomes of energy and environment fungi are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 50 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such 'parts' suggested by comparative genomics and functional analysis in these areas are presented here

  16. Fungal Genome Sequencing and Bioenergy

    SciTech Connect (OSTI)

    Schadt, Christopher Warren; Baker, Scott; Thykaer, Jette; Adney, William S; Brettin, Tom; Brockman, Fred; Dhaeseleer, Patrick; Martinez, A diego; Miller, R michael; Rokhsar, Daniel; Torok, Tamas; Tuskan, Gerald A; Bennett, Joan; Berka, Randy; Briggs, Steven; Heitman, Joseph; Rizvi, L; Taylor, John; Turgeon, Gillian; Werner-Washburne, Maggie; Himmel, Michael

    2008-01-01

    To date, the number of ongoing filamentous fungal genome sequencing projects is almost tenfold fewer than those of bacterial and archaeal genome projects. The fungi chosen for sequencing represent narrow kingdom diversity; most are pathogens or models. We advocate an ambitious, forward-looking phylogenetic-based genome sequencing program, designed to capture metabolic diversity within the fungal kingdom, thereby enhancing research into alternative bioenergy sources, bioremediation, and fungal-environment interactions.

  17. Fungal Genome Sequencing and Bioenergy

    SciTech Connect (OSTI)

    Baker, Scott; Thykaer, Jette; Adney, William S; Brettin, Tom; Brockman, Fred; Dhaeseleer, Patrick; Martinez, A diego; Miller, R michael; Rokhsar, Daniel; Schadt, Christopher Warren; Torok, Tamas; Tuskan, Gerald A; Bennett, Joan; Berka, Randy; Briggs, Steven; Heitman, Joseph; Taylor, John; Turgeon, Gillian; Werner-Washburne, Maggie; Himmel, Michael E

    2008-01-01

    To date, the number of ongoing filamentous fungal genome sequencing projects is almost tenfold fewer than those of bacterial and archaeal genome projects. The fungi chosen for sequencing represent narrow kingdom diversity; most are pathogens or models. We advocate an ambitious, forward-looking phylogenetic-based genome sequencing program, designed to capture metabolic diversity within the fungal kingdom, thereby enhancing research into alternative bioenergy sources, bioremediation, and fungal-environment interactions. Published by Elsevier Ltd on behalf of The British Mycological Society.

  18. ALSNews Vol. 307

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 ALSNews Vol. 307 Print Wednesday, 31 March 2010 00:00 In This Issue ALS Social Media is Here Structures of the Ribosome in Intermediate States of Ratcheting Structure Illuminates Mechanism of Fungal Polyketide Cyclization New Infrared Beamline 5.4, BSISB Facility Open ALS Controls Upgrade: Meeting the Needs of a Growing Facility Ring Leaders: Accelerator Operations and Development Announcements: Guest House Special Extended, and VUVX 2010 Who's in the News Operations Update UEC Corner News

  19. ALSNews Vol. 307

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Print In This Issue ALS Social Media is Here Structures of the Ribosome in Intermediate States of Ratcheting Structure Illuminates Mechanism of Fungal Polyketide Cyclization New Infrared Beamline 5.4, BSISB Facility Open ALS Controls Upgrade: Meeting the Needs of a Growing Facility Ring Leaders: Accelerator Operations and Development Announcements: Guest House Special Extended, and VUVX 2010 Who's in the News Operations Update UEC Corner News Links RingLeaders Ring Leaders Accelerator

  20. ALSNews Vol. 307

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Print In This Issue ALS Social Media is Here Structures of the Ribosome in Intermediate States of Ratcheting Structure Illuminates Mechanism of Fungal Polyketide Cyclization New Infrared Beamline 5.4, BSISB Facility Open ALS Controls Upgrade: Meeting the Needs of a Growing Facility Ring Leaders: Accelerator Operations and Development Announcements: Guest House Special Extended, and VUVX 2010 Who's in the News Operations Update UEC Corner News Links RingLeaders Ring Leaders Accelerator

  1. ALSNews Vol. 307

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Print In This Issue ALS Social Media is Here Structures of the Ribosome in Intermediate States of Ratcheting Structure Illuminates Mechanism of Fungal Polyketide Cyclization New Infrared Beamline 5.4, BSISB Facility Open ALS Controls Upgrade: Meeting the Needs of a Growing Facility Ring Leaders: Accelerator Operations and Development Announcements: Guest House Special Extended, and VUVX 2010 Who's in the News Operations Update UEC Corner News Links RingLeaders Ring Leaders Accelerator

  2. Narrowing the gap between the promise and reality of polyketide synthases as a synthetic biology platform

    SciTech Connect (OSTI)

    Poust, S; Hagen, A; Katz, L; Keasling, JD

    2014-12-01

    Engineering modular polyketide synthases (PKSs) has the potential to be an effective methodology to produce existing and novel chemicals. However, this potential has only just begun to be realized. We propose the adoption of an iterative design-build-test-learn paradigm to improve PKS engineering. We suggest methods to improve engineered PKS design by learning from laboratory-based selection; adoption of DNA design software and automation to build constructs and libraries more easily; tools for the expression of engineered proteins in a variety of heterologous hosts; and mass spectrometry-based high-throughput screening methods. Finally, lessons learned during iterations of the design-build-test-learn cycle can serve as a knowledge base for the development of a single retrosynthesis algorithm usable by both PKS experts and non-experts alike.

  3. Enzyme-Like Catalysis of the Nazarov Cyclization by Supramolecular Encapsulation

    SciTech Connect (OSTI)

    Hastings, Courtney; Pluth, Michael; Bergman, Robert; Raymond, Kenneth

    2010-03-29

    A primary goal in the design and synthesis of molecular hosts has been the selective recognition and binding of a variety of guests using non-covalent interactions. Supramolecular catalysis, which is the application of such hosts towards catalysis, has much in common with many enzymatic reactions, chiefly the use of both spatially appropriate binding pockets and precisely oriented functional groups to recognize and activate specific substrate molecules. Although there are now many examples which demonstrate how selective encapsulation in a host cavity can enhance the reactivity of a bound guest, all have failed to reach the degree of increased reactivity typical of enzymes. We now report the catalysis of the Nazarov cyclization by a self-assembled coordination cage, a carbon-carbon bond-forming reaction which proceeds under mild, aqueous conditions. The acceleration in this system is over a million-fold, and represents the first example of supramolecular catalysis that achieves the level of rate enhancement comparable to that observed in several enzymes. We explain the unprecedented degree of rate increase as due to the combination of (a) preorganization of the encapsulated substrate molecule, (b) stabilization of the transition state of the cyclization by constrictive binding, and (c) increase in the basicity of the complexed alcohol functionality.

  4. PNNL Fungal Biotechnology Core DOE-OBP Project

    SciTech Connect (OSTI)

    Baker, Scott E.; Bruno, Kenneth S.; Butcher, Mark G.; Collett, James R.; Culley, David E.; Dai, Ziyu; Magnuson, Jon K.; Panisko, Ellen A.

    2009-11-30

    In 2009, we continued to address barriers to fungal fermentation in the primary areas of morphology control, genomics, proteomics, fungal hyperproductivity, biomass-to-products via fungal based consolidated bioprocesses, and filamentous fungal ethanol. “Alternative renewable fuels from fungi” was added as a new subtask. Plans were also made to launch a new advanced strain development subtask in FY2010.

  5. Fueling the Future with Fungal Genomes

    SciTech Connect (OSTI)

    Grigoriev, Igor V.

    2014-10-27

    Genomes of fungi relevant to energy and environment are in focus of the JGI Fungal Genomic Program. One of its projects, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts and pathogens) and biorefinery processes (cellulose degradation and sugar fermentation) by means of genome sequencing and analysis. New chapters of the Encyclopedia can be opened with user proposals to the JGI Community Science Program (CSP). Another JGI project, the 1000 fungal genomes, explores fungal diversity on genome level at scale and is open for users to nominate new species for sequencing. Over 400 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics will lead to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such ‘parts’ suggested by comparative genomics and functional analysis in these areas are presented here.

  6. MycoCosm, an Integrated Fungal Genomics Resource (Conference...

    Office of Scientific and Technical Information (OSTI)

    In-Document Search Title: MycoCosm, an Integrated Fungal Genomics Resource MycoCosm is a web-based interactive fungal genomics resource, which was first released in March 2010, in...

  7. Ice Nucleation of Fungal Spores from the Classes Agaricomycetes...

    Office of Scientific and Technical Information (OSTI)

    Simulations show that inclusion of ice nucleation scavenging of fungal spores in mixed-phase clouds can decrease the surface annual mean mixing ratios of fungal spores over the ...

  8. PNNL Fungal Biotechnology Core DOE-OBP Project (Technical Report...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: PNNL Fungal Biotechnology Core DOE-OBP Project Citation Details In-Document Search Title: PNNL Fungal Biotechnology Core DOE-OBP Project In 2009, we continued to ...

  9. Grass fungal endophytes and uses thereof

    SciTech Connect (OSTI)

    Craven, Kelly

    2015-03-10

    The invention provides isolated fungal endophytes and synthetic combinations thereof with host grass plants. Methods for inoculating grass plant with the endophytes, for propagating the grass-endophyte combinations, and for producing feeds and biofuels from grass-endophyte combinations are also provided.

  10. MycoCosm portal: gearing up for 1000 fungal genomes

    SciTech Connect (OSTI)

    Grigoriev, Igor V.; Nikitin, Roman; Haridas, Sajeet; Kuo, Alan; Ohm, Robin; Riley, Robert; Salamov, Asaf; Zhao, Xueling; Korzeniewski, Frank; Smirnova, Tatyana; Nordberg, Henrik; Dubchak, Inna; Shabalov, Igor

    2013-10-09

    MycoCosm is a fungal genomics portal (http://jgi.doe.gov/fungi), developed by the US Department of Energy Joint Genome Institute to support integration, analysis and dissemination of fungal genome sequences and other omics data by providing interactive web-based tools. MycoCosm also promotes and facilitates user community participation through the nomination of new species of fungi for sequencing, and the annotation and analysis of resulting data. By efficiently filling gaps in the Fungal Tree of Life, MycoCosm will help address important problems associated with energy and the environment, taking advantage of growing fungal genomics resources.

  11. Fungal diversity within the Populus rhizosphere and endosphere | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    of Energy Fungal diversity within the Populus rhizosphere and endosphere Fungal diversity within the Populus rhizosphere and endosphere This presentation was given by Gerald Tuskan at the Symbiosis Conference. symbiosis_conference_tuskan.pdf (1.76 MB) More Documents & Publications Symbiosis Conference Speaker and Attendee List Consent Order, UT-Battelle, LLC Integrating Environmental, Safety, and Quality Management System Audits

  12. MycoCosm, an Integrated Fungal Genomics Resource Shabalov, Igor...

    Office of Scientific and Technical Information (OSTI)

    Resource Shabalov, Igor; Grigoriev, Igor 59 BASIC BIOLOGICAL SCIENCES MycoCosm is a web-based interactive fungal genomics resource, which was first released in March 2010, in...

  13. Fungal biology: compiling genomes and exploiting them

    SciTech Connect (OSTI)

    Labbe, Jessy L; Uehling, Jessie K; Payen, Thibaut; Plett, Jonathan

    2014-01-01

    The last 10 years have seen the cost of sequencing complete genomes decrease at an incredible speed. This has led to an increase in the number of genomes sequenced in all the fungal tree of life as well as a wide variety of plant genomes. The increase in sequencing has permitted us to study the evolution of organisms on a genomic scale. A number of talks during the conference discussed the importance of transposable elements (TEs) that are present in almost all species of fungi. These TEs represent an especially large percentage of genomic space in fungi that interact with plants. Thierry Rouxel (INRA, Nancy, France) showed the link between speciation in the Leptosphaeria complex and the expansion of TE families. For example in the Leptosphaeria complex, one species associated with oilseed rape has experienced a recent and massive burst of movement by a few TE families. The alterations caused by these TEs took place in discrete regions of the genome leading to shuffling of the genomic landscape and the appearance of genes specific to the species, such as effectors useful for the interactions with a particular plant (Rouxel et al., 2011). Other presentations showed the importance of TEs in affecting genome organization. For example, in Amanita different species appear to have been invaded by different TE families (Veneault-Fourrey & Martin, 2011).

  14. Convergent bacterial microbiotas in the fungal agricultural systems of insects

    SciTech Connect (OSTI)

    Aylward, Frank O.; Suen, Garret; Biedermann, Peter H. W.; Adams, Aaron S.; Scott, Jarrod J.; Malfatti, Stephanie A.; Glavina del Rio, Tijana; Tringe, Susannah G.; Poulsen, Michael; Raffa, Kenneth F.; Klepzig, Kier D.; Currie, Cameron R.

    2014-11-18

    The ability to cultivate food is an innovation that has produced some of the most successful ecological strategies on the planet. Although most well recognized in humans, where agriculture represents a defining feature of civilization, species of ants, beetles, and termites have also independently evolved symbioses with fungi that they cultivate for food. Despite occurring across divergent insect and fungal lineages, the fungivorous niches of these insects are remarkably similar, indicating convergent evolution toward this successful ecological strategy. Here, we characterize the microbiota of ants, beetles, and termites engaged in nutritional symbioses with fungi to define the bacterial groups associated with these prominent herbivores and forest pests. Using culture-independent techniques and the in silico reconstruction of 37 composite genomes of dominant community members, we demonstrate that different insect-fungal symbioses that collectively shape ecosystems worldwide have highly similar bacterial microbiotas comprised primarily of the genera Enterobacter, Rahnella, and Pseudomonas. Although these symbioses span three orders of insects and two phyla of fungi, we show that they are associated with bacteria sharing high whole-genome nucleotide identity. Due to the fine-scale correspondence of the bacterial microbiotas of insects engaged in fungal symbioses, our findings indicate that this represents an example of convergence of entire host-microbe complexes.

  15. Convergent bacterial microbiotas in the fungal agricultural systems of insects

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Aylward, Frank O.; Suen, Garret; Biedermann, Peter H. W.; Adams, Aaron S.; Scott, Jarrod J.; Malfatti, Stephanie A.; Glavina del Rio, Tijana; Tringe, Susannah G.; Poulsen, Michael; Raffa, Kenneth F.; et al

    2014-11-18

    The ability to cultivate food is an innovation that has produced some of the most successful ecological strategies on the planet. Although most well recognized in humans, where agriculture represents a defining feature of civilization, species of ants, beetles, and termites have also independently evolved symbioses with fungi that they cultivate for food. Despite occurring across divergent insect and fungal lineages, the fungivorous niches of these insects are remarkably similar, indicating convergent evolution toward this successful ecological strategy. Here, we characterize the microbiota of ants, beetles, and termites engaged in nutritional symbioses with fungi to define the bacterial groups associatedmore » with these prominent herbivores and forest pests. Using culture-independent techniques and the in silico reconstruction of 37 composite genomes of dominant community members, we demonstrate that different insect-fungal symbioses that collectively shape ecosystems worldwide have highly similar bacterial microbiotas comprised primarily of the genera Enterobacter, Rahnella, and Pseudomonas. Although these symbioses span three orders of insects and two phyla of fungi, we show that they are associated with bacteria sharing high whole-genome nucleotide identity. Due to the fine-scale correspondence of the bacterial microbiotas of insects engaged in fungal symbioses, our findings indicate that this represents an example of convergence of entire host-microbe complexes.« less

  16. Cyclization of N-alkyl azinium cations with bifunctional nucleophiles. 21. Regioisomeric 1,3,4-thiadiazino(5,6-b)quinoxalines

    SciTech Connect (OSTI)

    Baklykov, V.G.; Charushin, V.N.; Chupakhin, O.N.; Drozd, V.N.

    1987-10-01

    Thiobenzyhydrazides undergo cyclization with N-alkyl-quinoxalinium salts to give 5-alkyl-substituted 1,4,4a,5,10,10a-hexahydro-1,3,4-thiadiazino(5,6-b)quinoxalines, which undergo isomerization to 10-alkyl-substituted thiadiazinoquinoxalines when they are heated in ethanol or in the presence of acids. The IR spectra of suspensions of the compounds in mineral oil were recorded with a UR-20 spectrometer. The PMR spectra of solutions in d/sub 6/-DMSO were recorded with Perkin-Elmer R-12B (60 MHz) and Brucker WP-80 (80 MHz) spectrometers with tetramethylsilane (TMS) and hexamethyldisiloxane (HMDS) as the internal standards. The /sup 13/C NMR spectra of solutions in d/sub 6/-DMSO were recorded with Brucker WH-90 (22.62 MHz) and Varian FT-80A (20.13 MHz) spectrometers. The chemical shifts were measured with respect to the signal of the solvent (d/sub 6/-DMSO, 39.6 ppm).

  17. An efficient and practical synthesis of [2-11C]indole via superfast nucleophilic [11C]cyanation and RANEY® Nickel catalyzed reductive cyclization

    SciTech Connect (OSTI)

    So Jeong Lee; Fowler, Joanna S.; Alexoff, David; Schueller, Michael; Kim, Dohyun; Nauth, Alexander; Weber, Carina; Kim, Sung Won; Hooker, Jacob M.; Ma, Ling; Qu, Wenchao

    2015-09-21

    We developed a rapid method for the synthesis of carbon-11 radiolabeled indole using a sub-nanomolar quantity of no-carrier-added [11C]cyanide as radio-precursor. Based upon a reported synthesis of 2-(2-nitrophenyl)acetonitrile (2), a highly reactive substrate 2-nitrobenzyl bromide (1) was evaluated for nucleophilic [11C]cyanation. Additionally, related reaction conditions were explored with the goal of obtaining of highly reactive 2-(2-nitrophenyl)-[1-11C]acetonitrile ([11C]-2) while inhibiting its rapid conversion to 2,3-bis(2-nitrophenyl)-[1-11C]propanenitrile ([11C]-3). Next, a Raney Nickel catalyzed reductive cyclization method was utilized for synthesizing the desired [2-11C]indole with hydrazinium monoformate as the active reducing agent. Extensive and iterative screening of basicity, temperature and stoichiometry was required to overcome the large stoichiometry bias that favored 2-nitrobenzylbromide (1) over [11C]cyanide, which both caused further alkylation of the desired nitrile and poisoned the Raney Nickel catalyst. The result is an efficient two-step, streamlined method to reliably synthesize [2-11C]indole with an entire radiochemical yield of 21 ± 2.2% (n = 5, ranging from 18 – 24%). The radiochemical purity of the final product was > 98% and specific activity was 176 ± 24.8 GBq/μmol (n = 5, ranging from 141 – 204 GBq/μmol). The total radiosynthesis time including product purification by semi-preparative HPLC was 50 – 55 min from end of cyclotron bombardment.

  18. An efficient and practical synthesis of [2-11C]indole via superfast nucleophilic [11C]cyanation and RANEY® Nickel catalyzed reductive cyclization

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    So Jeong Lee; Fowler, Joanna S.; Alexoff, David; Schueller, Michael; Kim, Dohyun; Nauth, Alexander; Weber, Carina; Kim, Sung Won; Hooker, Jacob M.; Ma, Ling; et al

    2015-09-21

    We developed a rapid method for the synthesis of carbon-11 radiolabeled indole using a sub-nanomolar quantity of no-carrier-added [11C]cyanide as radio-precursor. Based upon a reported synthesis of 2-(2-nitrophenyl)acetonitrile (2), a highly reactive substrate 2-nitrobenzyl bromide (1) was evaluated for nucleophilic [11C]cyanation. Additionally, related reaction conditions were explored with the goal of obtaining of highly reactive 2-(2-nitrophenyl)-[1-11C]acetonitrile ([11C]-2) while inhibiting its rapid conversion to 2,3-bis(2-nitrophenyl)-[1-11C]propanenitrile ([11C]-3). Next, a Raney Nickel catalyzed reductive cyclization method was utilized for synthesizing the desired [2-11C]indole with hydrazinium monoformate as the active reducing agent. Extensive and iterative screening of basicity, temperature and stoichiometry was required tomore » overcome the large stoichiometry bias that favored 2-nitrobenzylbromide (1) over [11C]cyanide, which both caused further alkylation of the desired nitrile and poisoned the Raney Nickel catalyst. The result is an efficient two-step, streamlined method to reliably synthesize [2-11C]indole with an entire radiochemical yield of 21 ± 2.2% (n = 5, ranging from 18 – 24%). The radiochemical purity of the final product was > 98% and specific activity was 176 ± 24.8 GBq/μmol (n = 5, ranging from 141 – 204 GBq/μmol). The total radiosynthesis time including product purification by semi-preparative HPLC was 50 – 55 min from end of cyclotron bombardment.« less

  19. Twenty-Seventh Fungal Genetics Conference, Asilomar, CA, March 12-17, 2013

    SciTech Connect (OSTI)

    Walton, Jonathan

    2013-03-17

    This meeting brings together ~900 international scientists to discuss the latest research on fungal genetics. Sessions of particular relevance to DOE include lignocellulose degradation, cellulose conversion to fermentable sugars, fermentation of sugars to fuel molecules. Other sessions cover fungal diseases of biomass crops (miscanthus, corn, switchgrass, etc.).

  20. LysM receptor-like kinases to improve plant defense response against fungal pathogens

    DOE Patents [OSTI]

    Wan, Jinrong; Stacey, Gary; Stacey, Minviluz; Zhang, Xuecheng

    2013-10-15

    Perception of chitin fragments (chitooligosaccharides) is an important first step in plant defense response against fungal pathogen. LysM receptor-like kinases (LysM RLKs) are instrumental in this perception process. LysM RLKs also play a role in activating transcription of chitin-responsive genes (CRGs) in plants. Mutations in the LysM kinase receptor genes or the downstream CRGs may affect the fungal susceptibility of a plant. Mutations in LysM RLKs or transgenes carrying the same may be beneficial in imparting resistance against fungal pathogens.

  1. LysM receptor-like kinases to improve plant defense response against fungal pathogens

    DOE Patents [OSTI]

    Wan, Jinrong; Stacey, Gary; Stacey, Minviluz; Zhang, Xuecheng

    2012-01-17

    Perception of chitin fragments (chitooligosaccharides) is an important first step in plant defense response against fungal pathogen. LysM receptor-like kinases (LysM RLKs) are instrumental in this perception process. LysM RLKs also play a role in activating transcription of chitin-responsive genes (CRGs) in plants. Mutations in the LysM kinase receptor genes or the downstream CRGs may affect the fungal susceptibility of a plant. Mutations in LysM RLKs or transgenes carrying the same may be beneficial in imparting resistance against fungal pathogens.

  2. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  3. Fungi in the future: Interannual variation and effects of atmospheric change on arbuscular mycorrhizal fungal communities

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cotton, T. E. Anne; Fitter, Alastair H.; Miller, R. Michael; Dumbrell, Alex J.; Helgason, Thorunn

    2015-01-05

    Understanding the natural dynamics of arbuscular mycorrhizal (AM) fungi and their response to global environmental change is essential for the prediction of future plant growth and ecosystem functions. We investigated the long-term temporal dynamics and effect of elevated atmospheric carbon dioxide (CO2) and ozone (O3) concentrations on AM fungal communities. Molecular methods were used to characterize the AM fungal communities of soybean (Glycine max) grown under elevated and ambient atmospheric concentrations of both CO2 and O3 within a free air concentration enrichment experiment in three growing seasons over 5 yr. Elevated CO2 altered the community composition of AM fungi, increasingmore » the ratio of Glomeraceae to Gigasporaceae. By contrast, no effect of elevated O3 on AM fungal communities was detected. However, the greatest compositional differences detected were between years, suggesting that, at least in the short term, large-scale interannual temporal dynamics are stronger mediators than atmospheric CO2 concentrations of AM fungal communities. We conclude that, although atmospheric change may significantly alter AM fungal communities, this effect may be masked by the influences of natural changes and successional patterns through time. We suggest that changes in carbon availability are important determinants of the community dynamics of AM fungi.« less

  4. Intercropped silviculture systems, a key to achieving soil fungal community management in eucalyptus plantations

    SciTech Connect (OSTI)

    Caio T.C.C. Rachid; Balieiro, Fabiano C.; Fonseca, Eduardo S.; Peixoto, Raquel Silva; Chaer, Guilherme M.; Tiedje, James M.; Rosado, Alexandre S.

    2015-02-23

    Fungi are ubiquitous and important contributors to soil nutrient cycling, playing a vital role in C, N and P turnover, with many fungi having direct beneficial relationships with plants. However, the factors that modulate the soil fungal community are poorly understood. We studied the degree to which the composition of tree species affected the soil fungal community structure and diversity by pyrosequencing the 28S rRNA gene in soil DNA. We were also interested in whether intercropping (mixed plantation of two plant species) could be used to select fungal species. More than 50,000 high quality sequences were analyzed from three treatments: monoculture of Eucalyptus; monoculture of Acacia mangium; and a mixed plantation with both species sampled 2 and 3 years after planting. We found that the plant type had a major effect on the soil fungal community structure, with 75% of the sequences from the Eucalyptus soil belonging to Basidiomycota and 19% to Ascomycota, and the Acacia soil having a sequence distribution of 28% and 62%, respectively. The intercropping of Acacia mangium in a Eucalyptus plantation significantly increased the number of fungal genera and the diversity indices and introduced or increased the frequency of several genera that were not found in the monoculture cultivation samples. Our results suggest that management of soil fungi is possible by manipulating the composition of the plant community, and intercropped systems can be a means to achieve that.

  5. Fungi in the future: Interannual variation and effects of atmospheric change on arbuscular mycorrhizal fungal communities

    SciTech Connect (OSTI)

    Cotton, T. E. Anne; Fitter, Alastair H.; Miller, R. Michael; Dumbrell, Alex J.; Helgason, Thorunn

    2015-01-05

    Understanding the natural dynamics of arbuscular mycorrhizal (AM) fungi and their response to global environmental change is essential for the prediction of future plant growth and ecosystem functions. We investigated the long-term temporal dynamics and effect of elevated atmospheric carbon dioxide (CO2) and ozone (O3) concentrations on AM fungal communities. Molecular methods were used to characterize the AM fungal communities of soybean (Glycine max) grown under elevated and ambient atmospheric concentrations of both CO2 and O3 within a free air concentration enrichment experiment in three growing seasons over 5 yr. Elevated CO2 altered the community composition of AM fungi, increasing the ratio of Glomeraceae to Gigasporaceae. By contrast, no effect of elevated O3 on AM fungal communities was detected. However, the greatest compositional differences detected were between years, suggesting that, at least in the short term, large-scale interannual temporal dynamics are stronger mediators than atmospheric CO2 concentrations of AM fungal communities. We conclude that, although atmospheric change may significantly alter AM fungal communities, this effect may be masked by the influences of natural changes and successional patterns through time. We suggest that changes in carbon availability are important determinants of the community dynamics of AM fungi.

  6. Intercropped silviculture systems, a key to achieving soil fungal community management in eucalyptus plantations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Caio T.C.C. Rachid; Balieiro, Fabiano C.; Fonseca, Eduardo S.; Peixoto, Raquel Silva; Chaer, Guilherme M.; Tiedje, James M.; Rosado, Alexandre S.

    2015-02-23

    Fungi are ubiquitous and important contributors to soil nutrient cycling, playing a vital role in C, N and P turnover, with many fungi having direct beneficial relationships with plants. However, the factors that modulate the soil fungal community are poorly understood. We studied the degree to which the composition of tree species affected the soil fungal community structure and diversity by pyrosequencing the 28S rRNA gene in soil DNA. We were also interested in whether intercropping (mixed plantation of two plant species) could be used to select fungal species. More than 50,000 high quality sequences were analyzed from three treatments:more » monoculture of Eucalyptus; monoculture of Acacia mangium; and a mixed plantation with both species sampled 2 and 3 years after planting. We found that the plant type had a major effect on the soil fungal community structure, with 75% of the sequences from the Eucalyptus soil belonging to Basidiomycota and 19% to Ascomycota, and the Acacia soil having a sequence distribution of 28% and 62%, respectively. The intercropping of Acacia mangium in a Eucalyptus plantation significantly increased the number of fungal genera and the diversity indices and introduced or increased the frequency of several genera that were not found in the monoculture cultivation samples. Our results suggest that management of soil fungi is possible by manipulating the composition of the plant community, and intercropped systems can be a means to achieve that.« less

  7. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect (OSTI)

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  8. 2012 CELLULAR & MOLECULAR FUNGAL BIOLOGY GORDON RESEARCH CONFERENCE, JUNE 17 - 22, 2012

    SciTech Connect (OSTI)

    Judith Berman

    2012-06-22

    The Gordon Research Conference on CELLULAR & MOLECULAR FUNGAL BIOLOGY was held at Holderness School, Holderness New Hampshire, June 17 - 22, 2012. The 2012 Gordon Conference on Cellular and Molecular Fungal Biology (CMFB) will present the latest, cutting-edge research on the exciting and growing field of molecular and cellular aspects of fungal biology. Topics will range from yeast to filamentous fungi, from model systems to economically important organisms, and from saprophytes and commensals to pathogens of plants and animals. The CMFB conference will feature a wide range of topics including systems biology, cell biology and morphogenesis, organismal interactions, genome organisation and regulation, pathogenesis, energy metabolism, biomass production and population genomics. The Conference was well-attended with 136 participants. Gordon Research Conferences does not permit publication of meeting proceedings.

  9. Field tolerance to fungal pathogens of Brassica napus constitutively expressing a chimeric chitinase gene

    SciTech Connect (OSTI)

    Grison, R.; Grezes-Besset, B.; Lucante, N.

    1996-05-01

    Constitutive overexpression of a protein involved in plant defense mechanisms to disease is one of the strategies proposed to increase plant tolerance to fungal pathogens. A hybrid endochitinase gene under a constitutive promoter was introduced by Agrobacterium-mediated transformation into a winter-type oilseed rape (Brassica napus var. oleifera) inbred line. Progeny from transformed plants was challenged using three different fungal pathogens (Cylindrosporium concentricum, Phoma lingam, Sclerotinia sclerotiorum) in field trials at two different geographical locations. These plants exhibited an increased tolerance to disease as compared with the nontransgenic parental plants. 31 refs., 1 fig., 2 tabs.

  10. Forest floor community metatranscriptomes identify fungal and bacterial responses to N deposition in two maple forests

    SciTech Connect (OSTI)

    Hesse, Cedar N.; Mueller, Rebecca C.; Vuyisich, Momchilo; Gallegos-Graves, La Verne; Gleasner, Cheryl D.; Zak, Donald R.; Kuske, Cheryl R.

    2015-04-23

    Anthropogenic N deposition alters patterns of C and N cycling in temperate forests, where forest floor litter decomposition is a key process mediated by a diverse community of bacteria and fungi. To track forest floor decomposer activity we generated metatranscriptomes that simultaneously surveyed the actively expressed bacterial and eukaryote genes in the forest floor, to compare the impact of N deposition on the decomposers in two natural maple forests in Michigan, USA, where replicate field plots had been amended with N for 16 years. Site and N amendment responses were compared using about 74,000 carbohydrate active enzyme transcript sequences (CAZymes) in each metatranscriptome. Parallel ribosomal RNA (rRNA) surveys of bacterial and fungal biomass and taxonomic composition showed no significant differences in either biomass or OTU richness between the two sites or in response to N. Site and N amendment were not significant variables defining bacterial taxonomic composition, but they were significant for fungal community composition, explaining 17 and 14% of the variability, respectively. The relative abundance of expressed bacterial and fungal CAZymes changed significantly with N amendment in one of the forests, and N-response trends were also identified in the second forest. Although the two ambient forests were similar in community biomass, taxonomic structure and active CAZyme profile, the shifts in active CAZyme profiles in response to N-amendment differed between the sites. One site responded with an over-expression of bacterial CAZymes, and the other site responded with an over-expression of both fungal and different bacterial CAZymes. Both sites showed reduced representation of fungal lignocellulose degrading enzymes in N-amendment plots. The metatranscriptome approach provided a holistic assessment of eukaryote and bacterial gene expression and is applicable to other systems where eukaryotes and bacteria interact.

  11. Forest floor community metatranscriptomes identify fungal and bacterial responses to N deposition in two maple forests

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hesse, Cedar N.; Mueller, Rebecca C.; Vuyisich, Momchilo; Gallegos-Graves, La Verne; Gleasner, Cheryl D.; Zak, Donald R.; Kuske, Cheryl R.

    2015-04-23

    Anthropogenic N deposition alters patterns of C and N cycling in temperate forests, where forest floor litter decomposition is a key process mediated by a diverse community of bacteria and fungi. To track forest floor decomposer activity we generated metatranscriptomes that simultaneously surveyed the actively expressed bacterial and eukaryote genes in the forest floor, to compare the impact of N deposition on the decomposers in two natural maple forests in Michigan, USA, where replicate field plots had been amended with N for 16 years. Site and N amendment responses were compared using about 74,000 carbohydrate active enzyme transcript sequences (CAZymes)more » in each metatranscriptome. Parallel ribosomal RNA (rRNA) surveys of bacterial and fungal biomass and taxonomic composition showed no significant differences in either biomass or OTU richness between the two sites or in response to N. Site and N amendment were not significant variables defining bacterial taxonomic composition, but they were significant for fungal community composition, explaining 17 and 14% of the variability, respectively. The relative abundance of expressed bacterial and fungal CAZymes changed significantly with N amendment in one of the forests, and N-response trends were also identified in the second forest. Although the two ambient forests were similar in community biomass, taxonomic structure and active CAZyme profile, the shifts in active CAZyme profiles in response to N-amendment differed between the sites. One site responded with an over-expression of bacterial CAZymes, and the other site responded with an over-expression of both fungal and different bacterial CAZymes. Both sites showed reduced representation of fungal lignocellulose degrading enzymes in N-amendment plots. The metatranscriptome approach provided a holistic assessment of eukaryote and bacterial gene expression and is applicable to other systems where eukaryotes and bacteria interact.« less

  12. Enzymatic Digestibility of Corn Stover Fractions in Response to Fungal Pretreatment

    SciTech Connect (OSTI)

    Cui, Z. F.; Wan, C. X.; Shi, J.; Sykes, R. W.; Li, Y. B.

    2012-05-30

    Corn stover fractions (leaves, cobs, and stalks) were studied for enzymatic digestibility after pretreatment with a white rot fungus, Ceriporiopsis subvermispora. Among the three fractions, leaves had the least recalcitrance to fungal pretreatment and the lignin degradation reached 45% after 30 days of pretreatment. The lignin degradation of stalks and cobs was similar but was significantly lower than that of leaves (p < 0.05). For all fractions, xylan and glucan degradation followed a pattern similar to lignin degradation, with leaves having a significantly higher percentage of degradation (p < 0.05). Hydrolytic enzyme activity also revealed that the fungus was more active in the degradation of carbohydrates in leaves. As a result of fungal pretreatment, the highest sugar yield, however, was obtained with corn cobs.

  13. Dereplicating and spatial mapping of secondary metabolites from fungal cultures in situ

    SciTech Connect (OSTI)

    Kertesz, Vilmos; Van Berkel, Gary J.; Sica, Vincent P.; Raja, Huzefa A.; El-Elimat, Tamam; Oberlies, Nicholas H.; Pearce, Cedric J.

    2015-07-30

    Ambient ionization techniques coupled to mass spectrometry have recently become prevalent in natural product research due to their ability to examine secondary metabolites in situ. Identifying, mapping, and monitoring secondary metabolites directly on an organism provides invaluable spatial and temporal details that are lost through traditional extraction processes. Most ambient ionization techniques do not collect mutually supportive data, such as chromatographic retention times and/or UV/VIS spectra, and this can limit the ability to identify certain metabolites, such as differentiating isomers. To overcome this, the droplet liquid microjunction surface sampling probe (droplet LMJ SSP) was coupled with UPLC PDA HRMS MS/MS, thus providing separation, retention times, and UV/VIS data used in traditional dereplication protocols. By capturing these mutually supportive data, the identity of secondary metabolites could be confidently and rapidly assigned in situ. Using the droplet LMJ SSP, a protocol was constructed to analyze the secondary metabolite profile of fungal cultures directly without any sample preparation. The results demonstrate that fungal cultures can be dereplicated from the Petri dish, thus identifying secondary metabolites, including isomers, and confirming them against reference standards. As a result, heat maps, similar to mass spectrometry imaging, can be used to ascertain the location and relative concentration of secondary metabolites directly on the surface and/or surroundings of a fungal culture.

  14. A radioisotope based methodology for plant-fungal interactions in the rhizosphere

    SciTech Connect (OSTI)

    Weisenberger, A. G.; Bonito, G.; Lee, S.; McKisson, J. E.; Gryganskyi, A.; Reid, C. D.; Smith, M. F.; Vaidyanathan, G.; Welch, B.

    2013-10-01

    In plant ecophysiology research there is interest in studying the biology of the rhizosphere because of its importance in plant nutrient-interactions. The rhizosphere is the zone of soil surrounding a plant's root system where microbes (such as fungi) are influenced by the root and the roots by the microbes. We are investigating a methodology for imaging the distribution of molecular compounds of interest in the rhizosphere without disturbing the root or soil habitat. Our intention is to develop a single photon emission computed tomography (SPECT) system (PhytoSPECT) to image the bio-distribution of fungi in association with a host plant's roots. The technique we are exploring makes use of radioactive isotopes as tracers to label molecules that bind to fungal-specific compounds of interest and to image the fungi distribution in the plant and/or soil. We report on initial experiments designed to test the ability of fungal-specific compounds labeled with an iodine radioisotope that binds to chitin monomers (N-acetylglucosamine). Chitin is a compound not found in roots but in fungal cell walls. We will test the ability to label the compound with radioactive isotopes of iodine ({sup 125}I, and {sup 123}I).

  15. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    DOE Patents [OSTI]

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  16. 2010 CELL AND MOLECULAR FUNGAL BIOLOGY GORDON RESEARCH CONFERENCE, JUNE 13-18, 2010

    SciTech Connect (OSTI)

    Michelle Momany

    2010-06-18

    The Cellular and Molecular Fungal Biology Conference provides a forum for presentation of the latest advances in fungal research with an emphasis on filamentous fungi. This open-registration scientific meeting brings together the leading scientists from academia, government and industry to discuss current research results and future directions at Holderness School, an outstanding venue for scientific interaction. A key objective of the conference is to foster interaction among scientists working on model fungi such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Neurospora crassa and Aspergillus nidulans and scientists working on a variety of filamentous fungi whose laboratory tractability is often inversely proportional to their medical, industrial or ecological importance. Sessions will be devoted to Systems Biology, Fungi and Cellulosic Biomass, Small RNAs, Population Genomics, Symbioses, Pathogenesis, Membrane Trafficking and Polarity, and Cytoskeleton and Motors. A session will also be devoted to hot topics picked from abstracts. The CMFB conference provides a unique opportunity to examine the breadth of fungal biology in a small meeting format that encourages in-depth discussion among the attendees.

  17. Structures of Cryptococcus neoformans Protein Farnesyltransferase Reveal Strategies for Developing Inhibitors That Target Fungal Pathogens

    SciTech Connect (OSTI)

    Hast, Michael A.; Nichols, Connie B.; Armstrong, Stephanie M.; Kelly, Shannon M.; Hellinga, Homme W.; Alspaugh, J. Andrew; Beese, Lorena S.

    2012-09-17

    Cryptococcus neoformans is a fungal pathogen that causes life-threatening infections in immunocompromised individuals, including AIDS patients and transplant recipients. Few antifungals can treat C. neoformans infections, and drug resistance is increasing. Protein farnesyltransferase (FTase) catalyzes post-translational lipidation of key signal transduction proteins and is essential in C. neoformans. We present a multidisciplinary study validating C. neoformans FTase (CnFTase) as a drug target, showing that several anticancer FTase inhibitors with disparate scaffolds can inhibit C. neoformans and suggesting structure-based strategies for further optimization of these leads. Structural studies are an essential element for species-specific inhibitor development strategies by revealing similarities and differences between pathogen and host orthologs that can be exploited. We, therefore, present eight crystal structures of CnFTase that define the enzymatic reaction cycle, basis of ligand selection, and structurally divergent regions of the active site. Crystal structures of clinically important anticancer FTase inhibitors in complex with CnFTase reveal opportunities for optimization of selectivity for the fungal enzyme by modifying functional groups that interact with structurally diverse regions. A substrate-induced conformational change in CnFTase is observed as part of the reaction cycle, a feature that is mechanistically distinct from human FTase. Our combined structural and functional studies provide a framework for developing FTase inhibitors to treat invasive fungal infections.

  18. Dereplicating and spatial mapping of secondary metabolites from fungal cultures in situ

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kertesz, Vilmos; Van Berkel, Gary J.; Sica, Vincent P.; Raja, Huzefa A.; El-Elimat, Tamam; Oberlies, Nicholas H.; Pearce, Cedric J.

    2015-07-30

    Ambient ionization techniques coupled to mass spectrometry have recently become prevalent in natural product research due to their ability to examine secondary metabolites in situ. Identifying, mapping, and monitoring secondary metabolites directly on an organism provides invaluable spatial and temporal details that are lost through traditional extraction processes. Most ambient ionization techniques do not collect mutually supportive data, such as chromatographic retention times and/or UV/VIS spectra, and this can limit the ability to identify certain metabolites, such as differentiating isomers. To overcome this, the droplet liquid microjunction surface sampling probe (droplet LMJ SSP) was coupled with UPLC PDA HRMS MS/MS,more » thus providing separation, retention times, and UV/VIS data used in traditional dereplication protocols. By capturing these mutually supportive data, the identity of secondary metabolites could be confidently and rapidly assigned in situ. Using the droplet LMJ SSP, a protocol was constructed to analyze the secondary metabolite profile of fungal cultures directly without any sample preparation. The results demonstrate that fungal cultures can be dereplicated from the Petri dish, thus identifying secondary metabolites, including isomers, and confirming them against reference standards. As a result, heat maps, similar to mass spectrometry imaging, can be used to ascertain the location and relative concentration of secondary metabolites directly on the surface and/or surroundings of a fungal culture.« less

  19. Producing dicarboxylic acids using polyketide synthases (Patent...

    Office of Scientific and Technical Information (OSTI)

    Sponsoring Org: USDOE Country of Publication: United States Language: English Subject: 59 BASIC BIOLOGICAL SCIENCES; 37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CHEMISTRY

  20. Watershed scale fungal community characterization along a pH gradient in a subsurface environment co-contaminated with uranium and nitrate

    SciTech Connect (OSTI)

    Jasrotia, Puja; Green, Stefan; Canion, Andy; Overholt, Will; Prakash, Om; Wafula, Dennis; Hubbard, Daniela; Watson, David B; Schadt, Christopher Warren; Brooks, Scott C; Kostka,

    2014-01-01

    The objective of this study was to characterize fungal communities in a subsurface environment co-contaminated with uranium and nitrate at the watershed scale, and to determine the potential contribution of fungi to contaminant transformation (nitrate attenuation). The abundance, distribution and diversity of fungi in subsurface groundwater samples were determined using quantitative and semi-quantitative molecular techniques, including quantitative PCR of eukaryotic SSU rRNA genes and pyrosequencing of fungal internal transcribed spacer (ITS) regions. Potential bacterial and fungal denitrification was assessed in sediment-groundwater slurries amended with antimicrobial compounds and in fungal pure cultures isolated from subsurface. Our results demonstrate that subsurface fungal communities are dominated by members of the phylum Ascomycota, and a pronounced shift in fungal community composition occurs across the groundwater pH gradient at the field site, with lower diversity observed under acidic (pH < 4.5) conditions. Fungal isolates recovered from subsurface sediments were shown to reduce nitrate to nitrous oxide, including cultures of the genus Coniochaeta that were detected in abundance in pyrosequence libraries of site groundwater samples. Denitrifying fungal isolates recovered from the site were classified, and found to be distributed broadly within the phylum Ascomycota, and within a single genus within the Basidiomycota. Potential denitrification rate assays with sediment-groundwater slurries showed the potential for subsurface fungi to reduce nitrate to nitrous oxide under in situ acidic pH conditions.

  1. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Gacura, Matthew D.; Sprockett, Daniel D.; Heidenreich, Bess; Blackwood, Christopher B.

    2016-02-17

    Here, fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this studywe developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from40 fungal genomes. The primerswere used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senescedmore » tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communitieswere up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystemtype were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes.« less

  2. Techno-economic analysis of corn stover fungal fermentation to ethanol

    SciTech Connect (OSTI)

    Meyer, Pimphan A.; Tews, Iva J.; Magnuson, Jon K.; Karagiosis, Sue A.; Jones, Susanne B.

    2013-11-01

    This techno-economic analysis assesses the process economics of ethanol production from lignocellulosic feedstock by fungi to identify promising opportunities, and the research needed to achieve them. Based on literature derived data, four different ethanologen strains are considered in this study: native and recombinant Saccharomyces cerevisiae, the natural pentose-fermenting yeast, Pichia stipitis and the filamentous fungus Fusarium oxysporum. In addition, filamentous fungi are applied in multi-organism and consolidated process configurations. Organism performance and technology readiness are categorized as near-term (<5 years), mid-term (5-10 years), and long-term (>10 years) process deployment. The results of the analysis suggest that the opportunity for fungal fermentation exists for lignocellulosic ethanol production.

  3. The Paleozoic origin of enzymatic mechanisms for lignin degradation reconstructed using 31 fungal genomes

    SciTech Connect (OSTI)

    Floudas, Dimitrios; Binder, Manfred; Riley, Robert; Barry, Kerrie; Blanchette, Robert A; Henrissat, Bernard; Martinez, Angel T.; Otillar, Robert; Spatafora, Joseph W.; Yadav, Jagit S.; Aerts, Andrea; Benoit, Isabelle; Boyd, Alex; Carlson, Alexis; Copeland, Alex; Coutinho, Pedro M.; de Vries, Ronald P.; Ferreira, Patricia; Findley, Keisha; Foster, Brian; Gaskell, Jill; Glotzer, Dylan; Gorecki, Pawel; Heitman, Joseph; Hesse, Cedar; Hori, Chiaki; Igarashi, Kiyohiko; Jurgens, Joel A.; Kallen, Nathan; Kersten, Phil; Kohler, Annegret; Kues, Ursula; Kumar, T. K. Arun; Kuo, Alan; LaButti, Kurt; Larrondo, Luis F.; Lindquist, Erika; Ling, Albee; Lombard, Vincent; Lucas, Susan; Lundell, Taina; Martin, Rachael; McLaughlin, David J.; Morgenstern, Ingo; Morin, Emanuelle; Murat, Claude; Nagy, Laszlo G.; Nolan, Matt; Ohm, Robin A.; Patyshakuliyeva, Aleksandrina; Rokas, Antonis; Ruiz-Duenas, Francisco J.; Sabat, Grzegorz; Salamov, Asaf; Samejima, Masahiro; Schmutz, Jeremy; Slot, Jason C.; St. John, Franz; Stenlid, Jan; Sun, Hui; Sun, Sheng; Syed, Khajamohiddin; Tsang, Adrian; Wiebenga, Ad; Young, Darcy; Pisabarro, Antonio; Eastwood, Daniel C.; Martin, Francis; Cullen, Dan; Grigoriev, Igor V.; Hibbett, David S.

    2012-03-12

    Wood is a major pool of organic carbon that is highly resistant to decay, owing largely to the presence of lignin. The only organisms capable of substantial lignin decay are white rot fungi in the Agaricomycetes, which also contains non?lignin-degrading brown rot and ectomycorrhizal species. Comparative analyses of 31 fungal genomes (12 generated for this study) suggest that lignin-degrading peroxidases expanded in the lineage leading to the ancestor of the Agaricomycetes, which is reconstructed as a white rot species, and then contracted in parallel lineages leading to brown rot and mycorrhizal species. Molecular clock analyses suggest that the origin of lignin degradation might have coincided with the sharp decrease in the rate of organic carbon burial around the end of the Carboniferous period.

  4. Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

    SciTech Connect (OSTI)

    Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.; Srivastava, Akhil

    2012-12-03

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2 gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.

  5. Bulk gold catalyzed oxidation reactions of amines and isocyanides and iron porphyrin catalyzed N-H and O-H bond insertion/cyclization reactions of diamines and aminoalcohols

    SciTech Connect (OSTI)

    Klobukowski, Erik

    2011-12-29

    conditions, it was found that the oxidative dehydrogenation of dibenzylamine to Nbenzylidenebenzylamine, with N-methylmorpholine N-oxide (NMMO), was nearly quantitative (96%) within 24 h. However, the reaction with oxygen was much slower, with only a 52% yield of imine product over the same time period. Moreover, the rate of reaction was found to be influenced by the nature of the amine N-oxide. For example, the use of the weakly basic pyridine N-oxide (PyNO) led to an imine yield of only 6% after 24 h. A comparison of amine N-oxide and O2 was also examined in the oxidation of PhCH{sub 2}OH to PhCHO catalyzed by bulk gold. In this reaction, a 52% yield of the aldehyde was achieved when NMMO was used, while only a 7% product yield was afforded when O{sub 2} was the oxidant after 48 h. The bulk gold-catalyzed oxidative dehydrogenation of cyclic amines generates amidines, which upon treatment with Aerosil and water were found to undergo hydrolysis to produce lactams. Moreover, 5-, 6-, and 7-membered lactams could be prepared through a one-pot reaction of cyclic amines by treatment with oxygen, water, bulk gold, and Aerosil. This method is much more atom economical than industrial processes, does not require corrosive acids, and does not generate undesired byproducts. Additionally, the gold and Aerosil catalysts can be readily separated from the reaction mixture. The second project involved studying iron(III) tetraphenylporphyrin chloride, Fe(TPP)Cl, as a homogeneous catalyst for the generation of carbenes from diazo reagents and their reaction with heteroatom compounds. Fe(TPP)Cl, efficiently catalyzed the insertion of carbenes derived from methyl 2-phenyldiazoacetates into O-H bonds of aliphatic and aromatic alcohols. Fe(TPP)Cl was also found to be an effective catalyst for tandem N-H and O-H insertion/cyclization reactions when 1,2-diamines and 1,2-alcoholamines were treated with diazo reagents. This approach provides a one-pot process for synthesizing piperazinones and

  6. A Conversation with Blake Simmons, Vice President, Deconstruction Division, and Jon Magnuson, Director, Fungal Biotechnology Group, Joint BioEnergy Institute, Emeryville, CA

    SciTech Connect (OSTI)

    Simmons, Blake A.; Magnuson, Jon K.

    2013-05-03

    An interview of myself and Blake Simmons conducted by Vicki Glaser, Executive Editor of Industrial Biotechnology. The subject of the interview was the relatively new PNNL led Fungal Biotechnology Group within the Joint BioEnergy Institute (JBEI).

  7. A multifactor analysis of fungal and bacterial community structure of the root microbiome of mature Populus deltoides trees

    SciTech Connect (OSTI)

    Shakya, Migun; Gottel, Neil R; Castro Gonzalez, Hector F; Yang, Zamin; Gunter, Lee E; Labbe, Jessy L; Muchero, Wellington; Bonito, Gregory; Vilgalys, Rytas; Tuskan, Gerald A; Podar, Mircea; Schadt, Christopher Warren

    2013-01-01

    Bacterial and fungal communities associated with plant roots are central to the host- health, survival and growth. However, a robust understanding of root-microbiome and the factors that drive host associated microbial community structure have remained elusive, especially in mature perennial plants from natural settings. Here, we investigated relationships of bacterial and fungal communities in the rhizosphere and root endosphere of the riparian tree species Populus deltoides, and the influence of soil parameters, environmental properties (host phenotype and aboveground environmental settings), host plant genotype (Simple Sequence Repeat (SSR) markers), season (Spring vs. Fall) and geographic setting (at scales from regional watersheds to local riparian zones) on microbial community structure. Each of the trees sampled displayed unique aspects to it s associated community structure with high numbers of Operational Taxonomic Units (OTUs) specific to an individual trees (bacteria >90%, fungi >60%). Over the diverse conditions surveyed only a small number of OTUs were common to all samples within rhizosphere (35 bacterial and 4 fungal) and endosphere (1 bacterial and 1 fungal) microbiomes. As expected, Proteobacteria and Ascomycota were dominant in root communities (>50%) while other higher-level phylogenetic groups (Chytridiomycota, Acidobacteria) displayed greatly reduced abundance in endosphere compared to the rhizosphere. Variance partitioning partially explained differences in microbiome composition between all sampled roots on the basis of seasonal and soil properties (4% to 23%). While most variation remains unattributed, we observed significant differences in the microbiota between watersheds (Tennessee vs. North Carolina) and seasons (Spring vs. Fall). SSR markers clearly delineated two host populations associated with the samples taken in TN vs. NC, but overall genotypic distances did not have a significant effect on corresponding communities that could be

  8. Edge effects, not connectivity, determine the incidence and development of a foliar fungal plant disease.

    SciTech Connect (OSTI)

    Johnson, Brenda, L.; Haddad, Nick, M.

    2011-08-01

    Using a model plant-pathogen system in a large-scale habitat corridor experiment, we found that corridors do not facilitate the movement of wind-dispersed plant pathogens, that connectivity of patches does not enhance levels of foliar fungal plant disease, and that edge effects are the key drivers of plant disease dynamics. Increased spread of infectious disease is often cited as a potential negative effect of habitat corridors used in conservation, but the impacts of corridors on pathogen movement have never been tested empirically. Using sweet corn (Zea mays) and southern corn leaf blight (Cochliobolus heterostrophus) as a model plant-pathogen system, we tested the impacts of connectivity and habitat fragmentation on pathogen movement and disease development at the Savannah River Site, South Carolina, USA. Over time, less edgy patches had higher proportions of diseased plants, and distance of host plants to habitat edges was the greatest determinant of disease development. Variation in average daytime temperatures provided a possible mechanism for these disease patterns. Our results show that worries over the potentially harmful effects of conservation corridors on disease dynamics are misplaced, and that, in a conservation context, many diseases can be better managed by mitigating edge effects.

  9. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect (OSTI)

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  10. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect (OSTI)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  11. Soil bacterial and fungal community responses to nitrogen addition across soil depth and microhabitat in an arid shrubland

    SciTech Connect (OSTI)

    Mueller, Rebecca C.; Belnap, Jayne; Kuske, Cheryl R.

    2015-09-04

    Arid shrublands are stressful environments, typified by alkaline soils low in organic matter, with biologically-limiting extremes in water availability, temperature, and UV radiation. The widely-spaced plants and interspace biological soil crusts in these regions provide soil nutrients in a localized fashion, creating a mosaic pattern of plant- or crust-associated microhabitats with distinct nutrient composition. With sporadic and limited rainfall, nutrients are primarily retained in the shallow surface soil, patterning biological activity. We examined soil bacterial and fungal community responses to simulated nitrogen (N) deposition in an arid Larrea tridentata-Ambrosia dumosa field experiment in southern Nevada, USA, using high-throughput sequencing of ribosomal RNA genes. To examine potential interactions among the N application, microhabitat and soil depth, we sampled soils associated with shrub canopies and interspace biological crusts at two soil depths (0–0.5 or 0–10 cm) across the N-amendment gradient (0, 7, and 15 kg ha–1 yr–1). We hypothesized that localized compositional differences in soil microbiota would constrain the impacts of N addition to a microhabitat distribution that would reflect highly localized geochemical conditions and microbial community composition. The richness and community composition of both bacterial and fungal communities differed significantly by microhabitat and with soil depth in each microhabitat. Only bacterial communities exhibited significant responses to the N addition. Community composition correlated with microhabitat and depth differences in soil geochemical features. Provided the distinct roles of soil bacteria and fungi in major nutrient cycles, the resilience of fungi and sensitivity of bacteria to N amendments suggests that increased N input predicted for many arid ecosystems could shift nutrient cycling toward pathways driven primarily by fungal communities.

  12. Soil bacterial and fungal community responses to nitrogen addition across soil depth and microhabitat in an arid shrubland

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mueller, Rebecca C.; Belnap, Jayne; Kuske, Cheryl R.

    2015-09-04

    Arid shrublands are stressful environments, typified by alkaline soils low in organic matter, with biologically-limiting extremes in water availability, temperature, and UV radiation. The widely-spaced plants and interspace biological soil crusts in these regions provide soil nutrients in a localized fashion, creating a mosaic pattern of plant- or crust-associated microhabitats with distinct nutrient composition. With sporadic and limited rainfall, nutrients are primarily retained in the shallow surface soil, patterning biological activity. We examined soil bacterial and fungal community responses to simulated nitrogen (N) deposition in an arid Larrea tridentata-Ambrosia dumosa field experiment in southern Nevada, USA, using high-throughput sequencing ofmore » ribosomal RNA genes. To examine potential interactions among the N application, microhabitat and soil depth, we sampled soils associated with shrub canopies and interspace biological crusts at two soil depths (0–0.5 or 0–10 cm) across the N-amendment gradient (0, 7, and 15 kg ha–1 yr–1). We hypothesized that localized compositional differences in soil microbiota would constrain the impacts of N addition to a microhabitat distribution that would reflect highly localized geochemical conditions and microbial community composition. The richness and community composition of both bacterial and fungal communities differed significantly by microhabitat and with soil depth in each microhabitat. Only bacterial communities exhibited significant responses to the N addition. Community composition correlated with microhabitat and depth differences in soil geochemical features. Provided the distinct roles of soil bacteria and fungi in major nutrient cycles, the resilience of fungi and sensitivity of bacteria to N amendments suggests that increased N input predicted for many arid ecosystems could shift nutrient cycling toward pathways driven primarily by fungal communities.« less

  13. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOE Patents [OSTI]

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  14. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOE Patents [OSTI]

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  15. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.

    2016-06-02

    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungalmore » community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.« less

  16. Ice Nucleation of Fungal Spores from the Classes Agaricomycetes, Ustilaginomycetes, and Eurotiomycetes, and the effect on the Atmospheric Transport of these Spores

    SciTech Connect (OSTI)

    Haga, D. I.; Burrows, Susannah M.; Iannone, R.; Wheeler, M. J.; Mason, R.; Chen, J.; Polishchuk, E. A.; Poschl, U.; Bertram, Allan K.

    2014-08-26

    Ice nucleation on fungal spores may affect the frequency and properties of ice and mixed-phase clouds. We studied the ice nucleation properties of 12 different species of fungal spores chosen from three classes: Agaricomycetes, Ustilagomycetes, and Eurotiomycetes. Agaricomycetes include many types of mushroom species and are cosmopolitan all over the globe. Ustilagomycetes are agricultural pathogens and have caused widespread damage to crops. Eurotiomycetes are found on all types of decaying material and include important human allergens. We focused on these classes since they are thought to be abundant in the atmosphere and because there is very little information on the ice nucleation ability of these classes of spores in the literature. All of the fungal spores investigated were found to cause freezing of water droplets at temperatures warmer than homogeneous freezing. The cumulative number of ice nuclei per spore was 0.001 at temperatures between -19 C and -29 C, 0.01 between -25.5 C and -31 C, and 0.1 between -26 C and -36 C. On average, the order of ice nucleating ability for these spores is Ustilagomycetes > Agaricomycetes ? Eurotiomycetes. We show that at temperatures below -20 C, all of the fungal spores studied here are less efficient ice nuclei compared to Asian mineral dust on a per surface area basis. We used our new freezing results together with data in the literature to compare the freezing temperatures of spores from the phyla Basidiomycota and Ascomycota, which together make up 98 % of known fungal species found on Earth. The data show that within both phyla (Ascomycota and Basidiomycota) there is a wide range of freezing properties, and also that the variation within a phylum is greater than the variation between the average freezing properties of the phyla. Using a global chemistry-climate transport model, we investigated whether ice nucleation on the studied spores, followed by precipitation, can influence the atmospheric transport and

  17. Structural and functional diversity of soil bacterial and fungal communities following woody plant encroachment in the southern Great Plains

    SciTech Connect (OSTI)

    Hollister, Emily B; Schadt, Christopher Warren; Palumbo, Anthony Vito; Ansley, R J; Boutton, Thomas W

    2010-01-01

    In the southern Great Plains (USA), encroachment of grassland ecosystems by Prosopis glandulosa (honey mesquite) is widespread. Mesquite encroachment alters net primary productivity, enhances stores of C and N in plants and soil, and leads to increased levels of soil microbial biomass and activity. While mesquite's impact on the biogeochemistry of the region is well established, it effects on soil microbial diversity and function are unknown. In this study, soils associated with four plant types (C{sub 3} perennial grasses, C{sub 4} midgrasses, C{sub 4} shortgrasses, and mesquite) from a mesquite-encroached mixed grass prairie were surveyed to in an attempt to characterize the structure, diversity, and functional capacity of their soil microbial communities. rRNA gene cloning and sequencing were used in conjunction with the GeoChip functional gene array to evaluate these potential differences. Mesquite soil supported increased bacterial and fungal diversity and harbored a distinct fungal community relative to other plant types. Despite differences in composition and diversity, few significant differences were detected with respect to the potential functional capacity of the soil microbial communities. These results may suggest that a high level of functional redundancy exists within the bacterial portion of the soil communities; however, given the bias of the GeoChip toward bacterial functional genes, potential functional differences among soil fungi could not be addressed. The results of this study illustrate the linkages shared between above- and belowground communities and demonstrate that soil microbial communities, and in particular soil fungi, may be altered by the process of woody plant encroachment.

  18. Hybrid polyketide synthases (Patent) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Berkeley, CA (United States) Sponsoring Org: USDOE Country of Publication: United States Language: English Subject: 37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CHEMISTRY

  19. Engineering a Polyketide Synthase for In Vitro Production of...

    Office of Scientific and Technical Information (OSTI)

    Additional Journal Information: Journal Volume: 5; Journal Issue: 1; Journal ID: ISSN 2161-5063 Publisher: American Chemical Society Sponsoring Org: USDOE Office of Science (SC), ...

  20. Producing a trimethylpentanoic acid using hybrid polyketide synthases...

    Office of Scientific and Technical Information (OSTI)

    The present invention also provides for a host cell comprising the PKS and when cultured ... acid, comprising: providing a host cell of the present invention, and culturing ...

  1. Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen

    SciTech Connect (OSTI)

    Olson, Ake; Aerts, Andrea; Asiegbu, Fred; Belbahri, Lassaad; Bouzid, Ourdia; Broberg, Anders; Canback, Bjorn; Coutinho, Pedro M.; Cullen, Dan; Dalman, Kerstin; Deflorio, Giuliana; van Diepen, Linda T. A.; Dunand, Christophe; Duplessis, Sebastien; Durling, Mikael; Gonthier, Paolo; Grimwood, Jane; Fossdal, Carl Gunnar; Hansson, David; Henrissat, Bernard; Hietala, Ari; Himmelstrand, Kajsa; Hoffmeister, Dirk; Hogberg, Nils; James, Timothy Y.; Karlsson, Magnus; Kohler, Annegret; Lucas, Susan; Lunden, Karl; Morin, Emmanuelle; Murat, Claude; Park, Jongsun; Raffaello, Tommaso; Rouze, Pierre; Salamov, Asaf; Schmutz, Jeremy; Solheim, Halvor; Stahlberg, Jerry; Velez, Heriberto; de Vries, Ronald P.; Wiebenga, Ad; Woodward, Steve; Yakovlev, Igor; Garbelotto, Matteo; Martin, Francis; Grigoriev, Igor V.; Stenlid, Jan

    2012-01-01

    Parasitism and saprotrophic wood decay are two fungal strategies fundamental for succession and nutrient cycling in forest ecosystems. An opportunity to assess the trade-off between these strategies is provided by the forest pathogen and wood decayer Heterobasidion annosum sensu lato. We report the annotated genome sequence and transcript profiling, as well as the quantitative trait loci mapping, of one member of the species complex: H. irregulare. Quantitative trait loci critical for pathogenicity, and rich in transposable elements, orphan and secreted genes, were identified. A wide range of cellulose-degrading enzymes are expressed during wood decay. By contrast, pathogenic interaction between H. irregulare and pine engages fewer carbohydrate-active enzymes, but involves an increase in pectinolytic enzymes, transcription modules for oxidative stress and secondary metabolite production. Our results show a trade-off in terms of constrained carbohydrate decomposition and membrane transport capacity during interaction with living hosts. Our findings establish that saprotrophic wood decay and necrotrophic parasitism involve two distinct, yet overlapping, processes.

  2. Effects of fungal degradation on the CuO oxidation products of lignin: A controlled laboratory study

    SciTech Connect (OSTI)

    Hedges, J.I.; Weliky, K.; Devol, A.H. ); Blanchette, R.A. )

    1988-11-01

    Duplicate samples of birch wood were degraded for 0, 4, 8 and 12 weeks by the white-rot fungus, Phlebia tremellosus, and for 12 weeks by 6 other white-rot and brown-rot fungi. P. tremellosus caused progressive weight losses and increased the H/C and O/C of the remnant wood by preferentially degrading the lignin component of the middle lamellae. Total yields of syringyl phenols were decreased 1.5 times as fast as total vanillyl phenol yields. Within both phenol families, aldehyde precursors were degraded faster than precursors of the corresponding ketones, which were obtained in constant proportion to the total phenol yield. Although two other white-rot fungi caused similar lignin compositional trends, a fourth white-rot species, Coriolus versicolor, simultaneously eroded all cell wall components and did not concentrate polysaccharides in the remnant wood. The brown-rot fungi also preferentially attacked syringyl structural units, but degraded all phenol precursors at a much slower rate than the white-rotters and did not produce excess vanillic acid. Degradation by P. tremellosus linearly increased the vanillic acid/vanillin ratio, (Ad/Al)v, of the remnant birch wood throughout the 12 week degradation study and exponentially decreased the absolute yields of total vanillyl phenols, total syringyl phenols and the syringyl/vanillyl phenol ratio, S/V. At the highest (Ad/Al)v of 0.50 total yields of syringyl and vanillyl phenols were decreased by 65% and 80%, respectively, with a resulting reduction of 40% in the original S/V. Many of the diagenetically related compositional trends that have been previously reported for lignins in natural environments can be explained by white-rot fungal degradation.

  3. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect (OSTI)

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  4. Enrichment and Broad Representation of Plant Biomass-Degrading Enzymes in the Specialized Hyphal Swellings of Leucoagaricus gongylophorus, the Fungal Symbiont of Leaf-Cutter Ants

    SciTech Connect (OSTI)

    Aylward, Frank O.; Khadempour, Lily; Tremmel, Daniel; McDonald, Bradon R.; Nicora, Carrie D.; Wu, Si; Moore, Ronald J.; Orton, Daniel J.; Monroe, Matthew E.; Piehowski, Paul D.; Purvine, Samuel O.; Smith, Richard D.; Lipton, Mary S.; Burnum-Johnson, Kristin E.; Currie, Cameron R.

    2015-08-28

    Leaf-cutter ants are prolific and conspicuous Neotropical herbivores that derive energy from specialized fungus gardens they cultivate using foliar biomass. The basidiomycetous cultivar of the ants, Leucoagaricus gongylophorus, produces specialized hyphal swellings called gongylidia that serve as the primary food source of ant colonies. Gongylidia also contain lignocellulases that become concentrated in ant digestive tracts and are deposited within fecal droplets onto fresh foliar material as it is foraged by the ants. Although the enzymes concentrated by L. gongylophorus within gongylidia are thought to be critical to the initial degradation of plant biomass, only a few enzymes present in these hyphal swellings have been identified. Here we use proteomic methods to identify proteins present in the gongylidia of three Atta cephalotes colonies. Our results demonstrate that a diverse but consistent set of enzymes is present in gongylidia, including numerous lignocellulases likely involved in the degradation of polysaccharides, plant toxins, and proteins. Overall, gongylidia contained over three-quarters of all lignocellulases identified in the L. gongylophorus genome, demonstrating that the majority of the enzymes produced by this fungus for biomass breakdown are ingested by the ants. We also identify a set of 23 lignocellulases enriched in gongylidia compared to whole fungus garden samples, suggesting that certain enzymes may be particularly important in the initial degradation of foliar material. Our work sheds light on the complex interplay between leaf-cutter ants and their fungal symbiont that allows for the host insects to occupy an herbivorous niche by indirectly deriving energy from plant biomass.

  5. Enrichment and broad representation of plant biomass-degrading enzymes in the specialized hyphal swellings of Leucoagaricus gongylophorus, the fungal symbiont of leaf-cutter ants

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Aylward, Frank O.; Khadempour, Lily; Tremmel, Daniel M.; McDonald, Bradon R.; Nicora, Carrie D.; Wu, Si; Moore, Ronald J.; Orton, Daniel J.; Monroe, Matthew E.; Piehowski, Paul D.; et al

    2015-08-28

    Leaf-cutter ants are prolific and conspicuous constituents of Neotropical ecosystems that derive energy from specialized fungus gardens they cultivate using prodigious amounts of foliar biomass. The basidiomycetous cultivar of the ants, Leucoagaricus gongylophorus, produces specialized hyphal swellings called gongylidia that serve as the primary food source of ant colonies. Gongylidia also contain plant biomass-degrading enzymes that become concentrated in ant digestive tracts and are deposited within fecal droplets onto fresh foliar material as ants incorporate it into the fungus garden. Although the enzymes concentrated by L. gongylophorus within gongylidia are thought to be critical to the initial degradation of plantmore » biomass, only a few enzymes present in these hyphal swellings have been identified. Here we use proteomic methods to identify proteins present in the gongylidia of three Atta cephalotes colonies. Our results demonstrate that a diverse but consistent set of enzymes is present in gongylidia, including numerous plant biomass-degrading enzymes likely involved in the degradation of polysaccharides, plant toxins, and proteins. Overall, gongylidia contained over three quarters of all biomass-degrading enzymes identified in the L. gongylophorus genome, demonstrating that the majority of the enzymes produced by this fungus for biomass breakdown are ingested by the ants. We also identify a set of 40 of these enzymes enriched in gongylidia compared to whole fungus garden samples, suggesting that certain enzymes may be particularly important in the initial degradation of foliar material. Our work sheds light on the complex interplay between leaf-cutter ants and their fungal symbiont that allows for the host insects to occupy an herbivorous niche by indirectly deriving energy from plant biomass.« less

  6. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    SciTech Connect (OSTI)

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-05-01

    Radiation-induced reduction, radiolysis of copper sites and the effect of pH value together with the concomitant geometrical distortions of the active centres were analysed in several fungal (C. gallica) laccase structures collected at cryotemperature. This study emphasizes the importance of careful interpretation when the crystallographic structure of a metalloprotein is described. X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O{sub 2}. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UVVis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O{sub 2} reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account.

  7. The Genomes of the Fungal Plant Pathogens Cladosporium fulvum and Dothistroma septosporum Reveal Adaptation to Different Hosts and Lifestyles But Also Signatures of Common Ancestry

    SciTech Connect (OSTI)

    de Wit, Pierre J. G. M.; van der Burgt, Ate; Okmen, Bilal; Stergiopoulos, Ioannis; Abd-Elsalam, Kamel A.; Aerts, Andrea L.; Bahkali, Ali H.; Beenen, Henriek G.; Chettri, Oranav; Cos, Murray P.; Datema, Erwin; de Vries, Ronald P.; DHillon, Braham; Ganley, Austen R.; Griffiths, Scott A.; Guo, Yanan; Gamelin, Richard C.; Henrissat, Bernard; Kabir, M. Shahjahan; Jashni, Mansoor Karimi; Kema, Gert; Klaubauf, Sylvia; Lapidus, Alla; Levasseur, Anthony; Lindquist, Erika; Mehrabi, Rahim; Ohm, Robin A.; Owen, Timothy J.; Salamov, Asaf; Schwelm, Arne; Schijlen, Elio; Sun, Hui; van den Burg, Harrold A.; van Burg, Roeland C. H. J.; Zhang, Shuguang; Goodwin, Stephen B.; Grigoriev, Igor V.; Collemare, Jerome; Bradshaw, Rosie E.

    2012-05-04

    We sequenced and compared the genomes of the Dothideomycete fungal plant pathogens Cladosporium fulvum (Cfu) (syn. Passalora fulva) and Dothistroma septosporum (Dse) that are closely related phylogenetically, but have different lifestyles and hosts. Although both fungi grow extracellularly in close contact with host mesophyll cells, Cfu is a biotroph infecting tomato, while Dse is a hemibiotroph infecting pine. The genomes of these fungi have a similar set of genes (70percent of gene content in both genomes are homologs), but differ significantly in size (Cfu >61.1-Mb; Dse 31.2-Mb), which is mainly due to the difference in repeat content (47.2percent in Cfu versus 3.2percent in Dse). Recent adaptation to different lifestyles and hosts is suggested by diverged sets of genes. Cfu contains an tomatinase gene that we predict might be required for detoxification of tomatine, while this gene is absent in Dse. Many genes encoding secreted proteins are unique to each species and the repeat-rich areas in Cfu are enriched for these species-specific genes. In contrast, conserved genes suggest common host ancestry. Homologs of Cfu effector genes, including Ecp2 and Avr4, are present in Dse and induce a Cf-Ecp2- and Cf-4-mediated hypersensitive response, respectively. Strikingly, genes involved in production of the toxin dothistromin, a likely virulence factor for Dse, are conserved in Cfu, but their expression differs markedly with essentially no expression by Cfu in planta. Likewise, Cfu has a carbohydrate-degrading enzyme catalog that is more similar to that of necrotrophs or hemibiotrophs and a larger pectinolytic gene arsenal than Dse, but many of these genes are not expressed in planta or are pseudogenized. Overall, comparison of their genomes suggests that these closely related plant pathogens had a common ancestral host but since adapted to different hosts and lifestyles by a combination of differentiated gene content, pseudogenization, and gene regulation.

  8. Fungal degradation of organophosphorous insecticides

    SciTech Connect (OSTI)

    Bumpus, J.A.; Kakar, S.N.; Coleman, R.D.

    1992-07-01

    Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.

  9. Fungal degradation of organophosphorous insecticides

    SciTech Connect (OSTI)

    Bumpus, J.A. ); Kakar, S.N.; Coleman, R.D. )

    1992-01-01

    Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.

  10. The effect of host structure on the selectivity and mechanism of supramolecular catalysis of Prins cyclizations

    SciTech Connect (OSTI)

    Hart-Cooper, William M.; Zhao, Chen; Triano, Rebecca M.; Yaghoubi, Parastou; Ozores, Haxel Lionel; Burford, Kristen N.; Toste, F. Dean; Bergman, Robert G.; Raymond, Kenneth N.

    2014-11-28

    The effect of host structure on the selectivity and mechanism of intramolecular Prins reactions is evaluated using K12Ga4L6 tetrahedral catalysts. The host structure was varied by modifying the structure of the chelating moieties and the size of the aromatic spacers. While variation in chelator substituents was generally observed to affect changes in rate but not selectivity, changing the host spacer afforded differences in efficiency and product diastereoselectivity. An extremely high number of turnovers (up to 840) was observed. Maximum rate accelerations were measured to be on the order of 105, which numbers among the largest magnitudes of transition state stabilization measured with a synthetic host-catalyst. Host/guest size effects were observed to play an important role in host-mediated enantioselectivity.

  11. The effect of host structure on the selectivity and mechanism of supramolecular catalysis of Prins cyclizations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hart-Cooper, William M.; Zhao, Chen; Triano, Rebecca M.; Yaghoubi, Parastou; Ozores, Haxel Lionel; Burford, Kristen N.; Toste, F. Dean; Bergman, Robert G.; Raymond, Kenneth N.

    2014-11-28

    The effect of host structure on the selectivity and mechanism of intramolecular Prins reactions is evaluated using K12Ga4L6 tetrahedral catalysts. The host structure was varied by modifying the structure of the chelating moieties and the size of the aromatic spacers. While variation in chelator substituents was generally observed to affect changes in rate but not selectivity, changing the host spacer afforded differences in efficiency and product diastereoselectivity. An extremely high number of turnovers (up to 840) was observed. Maximum rate accelerations were measured to be on the order of 105, which numbers among the largest magnitudes of transition state stabilizationmore » measured with a synthetic host-catalyst. Host/guest size effects were observed to play an important role in host-mediated enantioselectivity.« less

  12. Enrichment and broad representation of plant biomass-degrading enzymes in the specialized hyphal swellings of Leucoagaricus gongylophorus, the fungal symbiont of leaf-cutter ants

    SciTech Connect (OSTI)

    Aylward, Frank O.; Khadempour, Lily; Tremmel, Daniel M.; McDonald, Bradon R.; Nicora, Carrie D.; Wu, Si; Moore, Ronald J.; Orton, Daniel J.; Monroe, Matthew E.; Piehowski, Paul D.; Purvine, Samuel O.; Smith, Richard D.; Lipton, Mary S.; Burnum-Johnson, Kristin E.; Currie, Cameron R.; Brady, Sean

    2015-08-28

    Leaf-cutter ants are prolific and conspicuous constituents of Neotropical ecosystems that derive energy from specialized fungus gardens they cultivate using prodigious amounts of foliar biomass. The basidiomycetous cultivar of the ants, Leucoagaricus gongylophorus, produces specialized hyphal swellings called gongylidia that serve as the primary food source of ant colonies. Gongylidia also contain plant biomass-degrading enzymes that become concentrated in ant digestive tracts and are deposited within fecal droplets onto fresh foliar material as ants incorporate it into the fungus garden. Although the enzymes concentrated by L. gongylophorus within gongylidia are thought to be critical to the initial degradation of plant biomass, only a few enzymes present in these hyphal swellings have been identified. Here we use proteomic methods to identify proteins present in the gongylidia of three Atta cephalotes colonies. Our results demonstrate that a diverse but consistent set of enzymes is present in gongylidia, including numerous plant biomass-degrading enzymes likely involved in the degradation of polysaccharides, plant toxins, and proteins. Overall, gongylidia contained over three quarters of all biomass-degrading enzymes identified in the L. gongylophorus genome, demonstrating that the majority of the enzymes produced by this fungus for biomass breakdown are ingested by the ants. We also identify a set of 40 of these enzymes enriched in gongylidia compared to whole fungus garden samples, suggesting that certain enzymes may be particularly important in the initial degradation of foliar material. Our work sheds light on the complex interplay between leaf-cutter ants and their fungal symbiont that allows for the host insects to occupy an herbivorous niche by indirectly deriving energy from plant biomass.

  13. Isolated Fungal Promoters and Gene Transcription Terminators...

    Office of Scientific and Technical Information (OSTI)

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first ...

  14. Understanding the Forest Microbiome: A Fungal Perspective

    SciTech Connect (OSTI)

    Vilgalys, Rytas [Duke University

    2014-03-19

    Rytas Vilgalys, Duke University, speaking at the 9th Annual Genomics of Energy & Environment Meeting on March 19, 2014 in Walnut Creek, Calif

  15. Transcriptome and Biochemical Analyses of Fungal Degradation...

    Office of Scientific and Technical Information (OSTI)

    Because fungi are the only known microbes capable of circumventing the lignin barrier, knowledge of the enzyme they use is of great potential for biofuel processing. Nature has ...

  16. Fueling the Future with Fungal Genomics

    SciTech Connect (OSTI)

    Grigoriev, Igor V.; Cullen, Daniel; Hibbett, David; Goodwin, Stephen B.; Jeffries, Thomas W.; Kubicek, Christian P.; Kuske, Cheryl; Magnuson, Jon K.; Martin, Francis; Spatafora, Joey; Tsang, Adrian; Baker, Scott E.

    2011-04-29

    Fungi play important roles across the range of current and future biofuel production processes. From crop/feedstock health to plant biomass saccharification, enzyme production to bioprocesses for producing ethanol, higher alcohols or future hydrocarbon biofuels, fungi are involved. Research and development are underway to understand the underlying biological processes and improve them to make bioenergy production efficient on an industrial scale. Genomics is the foundation of the systems biology approach that is being used to accelerate the research and development efforts across the spectrum of topic areas that impact biofuels production. In this review, we discuss past, current and future advances made possible by genomic analyses of the fungi that impact plant/feedstock health, degradation of lignocellulosic biomass and fermentation of sugars to ethanol, hydrocarbon biofuels and renewable chemicals.

  17. JGI Fungal Genomics Program Grigoriev, Igor V. 99; BIOFUELS;...

    Office of Scientific and Technical Information (OSTI)

    Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  18. Intercropped silviculture systems, a key to achieving soil fungal...

    Office of Scientific and Technical Information (OSTI)

    Embrapa Solos (Brazil) Federal University of Rio de Janeiro (Brazil) Embrapa Agrobiologia (Brazil) Michigan State Univ., East Lansing, MI (United States) Publication Date: ...

  19. Structure–Function Relationships in Fungal Large-Subunit Catalases

    SciTech Connect (OSTI)

    Diaz, A.; Valdez, V; Rudino-Pinera, E; Horjales, E; Hansberg, W

    2009-01-01

    Neurospora crassa has two large-subunit catalases, CAT-1 and CAT-3. CAT-1 is associated with non-growing cells and accumulates particularly in asexual spores; CAT-3 is associated with growing cells and is induced under different stress conditions. It is our interest to elucidate the structure-function relationships in large-subunit catalases. Here we have determined the CAT-3 crystal structure and compared it with the previously determined CAT-1 structure. Similar to CAT-1, CAT-3 hydrogen peroxide (H{sub 2}O{sub 2}) saturation kinetics exhibited two components, consistent with the existence of two active sites: one saturated in the millimolar range and the other in the molar range. In the CAT-1 structure, we found three interesting features related to its unusual kinetics: (a) a constriction in the channel that conveys H{sub 2}O{sub 2} to the active site; (b) a covalent bond between the tyrosine, which forms the fifth coordination bound to the iron of the heme, and a vicinal cysteine; (c) oxidation of the pyrrole ring III to form a cis-hydroxyl group in C5 and a cis-{gamma}-spirolactone in C6. The site of heme oxidation marks the starts of the central channel that communicates to the central cavity and the shortest way products can exit the active site. CAT-3 has a similar constriction in its major channel, which could function as a gating system regulated by the H{sub 2}O{sub 2} concentration before the gate. CAT-3 functional tyrosine is not covalently bonded, but has instead the electron relay mechanism described for the human catalase to divert electrons from it. Pyrrole ring III in CAT-3 is not oxidized as it is in other large-subunit catalases whose structure has been determined. Different in CAT-3 from these enzymes is an occupied central cavity. Results presented here indicate that CAT-3 and CAT-1 enzymes represent a functional group of catalases with distinctive structural characteristics that determine similar kinetics.

  20. JGI Fungal Genomics Program (Technical Report) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  1. Fungal Genomics Program (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose...

  2. MycoCosm, an Integrated Fungal Genomics Resource (Conference...

    Office of Scientific and Technical Information (OSTI)

    service. Visit OSTI to utilize additional information resources in energy science and technology. A paper copy of this document is also available for sale to the public from...

  3. Pectinases Link Early Fungal Evolution to the Land Plant Lineage

    SciTech Connect (OSTI)

    Berbee, Mary [University of British Columbia

    2014-03-19

    Mary Berbee, University of British Columbia, Canada, speaking at the 9th Annual Genomics of Energy & Environment Meeting on March 19, 2014 in Walnut Creek, Calif.

  4. Fungal Genomics Program Grigoriev, Igor 59 BASIC BIOLOGICAL SCIENCES...

    Office of Scientific and Technical Information (OSTI)

    and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world...

  5. Soil fungal and bacterial responses to conversion of open land...

    Office of Scientific and Technical Information (OSTI)

    of open land to short-rotation woody biomass crops Citation Details In-Document Search ... of open land to short-rotation woody biomass crops Authors: Xue, Chao 1 ; Penton, ...

  6. Fungal diversity within the Populus rhizosphere and endosphere...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Symbiosis Conference Speaker and Attendee List Consent Order, UT-Battelle, LLC Integrating Environmental, Safety, and Quality Management System Audits

  7. Deadly Carcinogen Unraveled: The Molecular Origami of Fungal...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    solved. In the first structure, a fortuitously bound palmitic acid molecule (from E. coli purification) established the long, hydrophobic pocket and suggested that the 20-carbon...

  8. Fungal Genomics Presentation for BETO 2015 Project Peer Review

    Broader source: Energy.gov (indexed) [DOE]

    Area Review Jon Magnuson PNNL This presentation does not contain any proprietary, confidential, or otherwise restricted information Goal Statement Position: Biotechnology will ...

  9. Structural Studies of the Didomain of a 6-Deoxyerythronolide B Synthase:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Largest Structure/Asymmetric Unit Solved by MAD Technique Studies of the Didomain of a 6-Deoxyerythronolide B Synthase: Largest Structure/Asymmetric Unit Solved by MAD Technique Modular polyketide synthases (PKSs) such as the 6-deoxyerythronolide B synthase (DEBS) are a large family of polyfunctional, multi-subunit enzymes that catalyze the biosynthesis of structurally complex and medicinally important natural products known as polyketides (1, 2). Although polyketides are biosynthesized from

  10. Techno-economic analysis of corn stover fungal fermentation to ethanol

    SciTech Connect (OSTI)

    Meyer, Pimphan; Tews, Iva J.; Magnuson, Jon K.; Karagiosis, Sue A.; Jones, Susanne B.

    2013-11-01

    This techno-economic analysis assesses the process economics of ethanol production from lignocellulosic feedstock by fungi in order to identify promising opportunities and the research needed to achieve them. Based on literature derived data, four different ethanologen strains are considered in this study: native and recombinant Saccharomyces cerevisiae, the natural pentose-fermenting yeast, Pichia stipitis and the filamentous fungus Fusarium oxysporum. Organism performance and technology readiness are split into three groups: near-term (<5 years), mid-term (5-10 years) and long-term (>10 years) process deployment. Processes classified as near-term could reasonably be developed in this shorter time frame, as suggested by recent literature. Mid-term technology process models are based on lab-scale experimental data, and yields near the theoretical limit are used to estimate long-term technology goals. Further research and economic evaluation on the integrated production of chemicals and fuels in biorefineries are recommended.

  11. Fungal biodegradation of lignopolystyrene graft copolymers. [Pleurotus ostreatus; Phanerochaete chrysosporium; Trametes versicolor; Gloeophyllum trabeum

    SciTech Connect (OSTI)

    Milstein, O.; Gersonde, R.; Huttermann, A. ); MengJiu Chen; Meister, J.J )

    1992-10-01

    White rot basidiomycetes were able to biodegrade styrene (1-phenylethene) graft copolymers of lignin containing different proportions of lignin and polystyrene (poly(1-phenylethylene)). The biodegradation tests were run on lignin-styrene copolymerization products which contained 10.3, 32.2, and 50.4{percent} (wt/wt) lignin. The polymer samples were incubated with the white rot fungi Pleurotus ostreatus, Phanerochaete chrysosporium, and Trametes versicolor and the brown rot fungus Gloeophyllum trabeum. White rot fungi degraded the plastic samples at a rate which increased with increasing lignin content in the copolymer sample. Both polystyrene and lignin components of the copolymer were readily degraded. Polystyrene pellets were not degradable in these tests. Degradation was verified for both incubated and control samples by weight loss, quantitative UV spectrophotometric analysis of both lignin and styrene residues, scanning electron microscopy of the plastic surface, and the presence of enzymes active in degradation during incubation. Brown rot fungus did not affect any of the plastics. White rot fungi produced and secreted oxidative enzymes associated with lignin degradation in liquid media during incubation with lignin-polystyrene copolymer.

  12. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... acids (1) constraint-based model (1) crystal structure (1) cyclization (1) dark-anoxic ... PCC 7002 (Synechococcus 7002), a fast growing cyanobacterium whose genome has been ...

  13. Final Technical Report for DOE Grant, number DE-FG02-05ER15701...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Final Technical Report for DOE Grant, number DE-FG02-05ER15701; Probing Surface Chemistry Under Catalytic Conditions: Olefin Hydrogenation,Cyclization and ...

  14. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    DOE Patents [OSTI]

    Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

    2014-05-27

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  15. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    DOE Patents [OSTI]

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  16. Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

    DOE Patents [OSTI]

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  17. Rapid genome resequencing of an atoxigenic strain of Aspergillus

    Office of Scientific and Technical Information (OSTI)

    de Barcelona, Bellaterra, Catalonia (Spain) 59 BASIC BIOLOGICAL SCIENCES fungal genomics; gene regulatory networks fungal genomics; gene regulatory networks In...

  18. Synthesis of 6-Methyl-9-propyldibenzothiophene-4-ol

    SciTech Connect (OSTI)

    Eisenbraun, E.J.

    1991-02-15

    The synthesis route for preparing the title compound, has been carried out on a small scale for the preparation of a mixture of isomers. Alternative routes for the cyclization are being explored. (DLC)

  19. Synthesis of 6-Methyl-9-propyldibenzothiophene-4-ol. Technical progress report No. 2, October 25, 1990--January 25, 1991

    SciTech Connect (OSTI)

    Eisenbraun, E.J.

    1991-02-15

    The synthesis route for preparing the title compound, has been carried out on a small scale for the preparation of a mixture of isomers. Alternative routes for the cyclization are being explored. (DLC)

  20. A P-loop Mutation in G[alpha] Subunits Prevents Transition to the Active State: Implications for G-protein Signaling in Fungal Pathogenesis

    SciTech Connect (OSTI)

    Bosch, Dustin E.; Willard, Francis S.; Ramanujam, Ravikrishna; Kimple, Adam J.; Willard, Melinda D.; Naqvi, Naweed I.; Siderovski, David P.

    2012-10-23

    Heterotrimeric G-proteins are molecular switches integral to a panoply of different physiological responses that many organisms make to environmental cues. The switch from inactive to active G{alpha}{beta}{gamma} heterotrimer relies on nucleotide cycling by the G{alpha} subunit: exchange of GTP for GDP activates G{alpha}, whereas its intrinsic enzymatic activity catalyzes GTP hydrolysis to GDP and inorganic phosphate, thereby reverting G{alpha} to its inactive state. In several genetic studies of filamentous fungi, such as the rice blast fungus Magnaporthe oryzae, a G42R mutation in the phosphate-binding loop of G{alpha} subunits is assumed to be GTPase-deficient and thus constitutively active. Here, we demonstrate that G{alpha}(G42R) mutants are not GTPase deficient, but rather incapable of achieving the activated conformation. Two crystal structure models suggest that Arg-42 prevents a typical switch region conformational change upon G{alpha}{sub i1}(G42R) binding to GDP {center_dot} AlF{sub 4}{sup -} or GTP, but rotameric flexibility at this locus allows for unperturbed GTP hydrolysis. G{alpha}(G42R) mutants do not engage the active state-selective peptide KB-1753 nor RGS domains with high affinity, but instead favor interaction with G{beta}{gamma} and GoLoco motifs in any nucleotide state. The corresponding G{alpha}{sub q}(G48R) mutant is not constitutively active in cells and responds poorly to aluminum tetrafluoride activation. Comparative analyses of M. oryzae strains harboring either G42R or GTPase-deficient Q/L mutations in the G{alpha} subunits MagA or MagB illustrate functional differences in environmental cue processing and intracellular signaling outcomes between these two G{alpha} mutants, thus demonstrating the in vivo functional divergence of G42R and activating G-protein mutants.

  1. Antifungal polypeptides

    DOE Patents [OSTI]

    Altier, Daniel J.; Ellanskaya, Irina; Ellanskaya, legal representative, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2009-09-15

    The invention relates to antifungal compositions and methods for protecting a plant from a fungal pathogen. Compositions including antifungal polypeptides isolated from a fungal fermentation broth are provided.

  2. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Aut noma de Barcelona Bellaterra Catalonia Spain BASIC BIOLOGICAL SCIENCES fungal genomics gene regulatory networks fungal genomics gene regulatory networks In microorganisms...

  3. Evolution of novel wood decay mechanisms in Agaricales revealed...

    Office of Scientific and Technical Information (OSTI)

    Type: Publisher's Accepted Manuscript Journal Name: Fungal Genetics and Biology (Print) Additional Journal Information: Journal Name: Fungal Genetics and Biology (Print); Journal ...

  4. Antifungal polypeptides

    SciTech Connect (OSTI)

    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, legal representative, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2009-10-06

    The invention relates to compositions including amino acid sequences isolated from fungal fermentation broths and methods for protecting a plant from a pathogen, particularly a fungal pathogen.

  5. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketenealkene [2+2] cycloadditions and late-stage CH oxidation

    SciTech Connect (OSTI)

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketenealkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp)H oxidation. The synthesis requires only eight steps from norbornadiene.

  6. SSRL HEADLINES Dec 2006

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 December, 2006 __________________________________________________________________________ Contents of this Issue: Science Highlight - SSRL Examines Stardust Science Highlight - High Resolution Structural Study of a Modular Polyketide Synthase Didomain Science Highlight - The Structural Basis of Transcription Holiday Greetings from the Director SLAC Policy Committee Fall Meeting Michael Casassa, DOE-BES, Visits Ultrafast Facilities at SLAC and Stanford Piero Pianetta Awarded APS Fellowship Test

  7. Draft genome sequence of Streptomyces vitaminophilus ATCC 31673, a producer of pyrrolomycin antibiotics, some of which contain a nitro group

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich; Parry, Ronald J.; Graham, David E.

    2016-01-21

    Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.

  8. Enantioselective Intramolecular Hydroarylation of Alkenes via Directed C-H Bond Activation

    SciTech Connect (OSTI)

    Harada, Hitoshi; Thalji, Reema; Bergman, Robert; Ellman, Jonathan

    2008-05-22

    Highly enantioselective catalytic intramolecular ortho-alkylation of aromatic imines containing alkenyl groups tethered at the meta position relative to the imine directing group has been achieved using [RhCl(coe){sub 2}]{sub 2} and chiral phosphoramidite ligands. Cyclization of substrates containing 1,1- and 1,2-disubstituted as well as trisubstituted alkenes were achieved with enantioselectivities >90% ee for each substrate class. Cyclization of substrates with Z-alkene isomers proceeded much more efficiently than substrates with E-alkene isomers. This further enabled the highly stereoselective intramolecular alkylation of certain substrates containing Z/E-alkene mixtures via a Rh-catalyzed alkene isomerization with preferential cyclization of the Z-isomer.

  9. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... Center Office of Groundwater and Soil Remediation Office of Nonproliferation and ... bioaerosols composed of vegetative bacteria, bacteria spores, ormore fungal ...

  10. 2013 DOE Bioenergy Technologies Office (BETO) Project Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Fungal Genomics aka Fungal Biotechnology May 21, 2013 Technology Area Review: Biochemical Conversion Principal Investigator: Jon Magnuson Organization: PNNL This presentation does not contain any proprietary, confidential, or otherwise restricted information 2 | Bioenergy Technologies Office eere.energy.gov Goal Statement * Our goal is enabling accelerated development of fungal bioprocesses using fungi that are industrially relevant. * Use systems biology, genetic engineering and bioreactors to

  11. Synthetic route to meso-tetra hydrocarbyl or substituted hydrocarbyl porphyrins and derivatives

    DOE Patents [OSTI]

    Wijesekera, Tilak P.; Wagner, Richard W.

    1993-01-01

    The hydroxyl group in a pyrrolic compound having in the 2-position thereof a group having the formula R(OH)CH--R is hydrocarbyl or substituted hydrocarbyl, is replaced by a group, for example a p-nitrobenzoate group, having better leaving properties than those of hydroxyl for a subsequent self-condensation and cyclization of the pyrrolic compound to form a meso-hydrocarbyl or meso-substituted hydrocarbyl porphyrin.

  12. Synthetic route to meso-tetra hydrocarbyl or substituted hydrocarbyl porphyrins and derivatives

    DOE Patents [OSTI]

    Wijesekera, T.P.; Wagner, R.W.

    1993-08-31

    The hydroxyl group in a pyrrolic compound having in the 2-position thereof a group having the formula R(OH)CH-R is hydrocarbyl or substituted hydrocarbyl, is replaced by a group, for example a p-nitrobenzoate group, having better leaving properties than those of hydroxyl for a subsequent self-condensation and cyclization of the pyrrolic compound to form a meso-hydrocarbyl or meso-substituted hydrocarbyl porphyrin.

  13. Methods for monitoring multiple gene expression

    DOE Patents [OSTI]

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  14. Methods for monitoring multiple gene expression

    DOE Patents [OSTI]

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2008-06-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  15. Methods for monitoring multiple gene expression

    DOE Patents [OSTI]

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  16. Applications of Carboxylic Acid Reductases in Oleaginous Microbes...

    Office of Scientific and Technical Information (OSTI)

    Here, we express four CAR enzymes from different fungal origins to test their activity against fatty acids commonly produced in oleaginous microbes. These in vitro results will ...

  17. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Genomics Resource Shabalov Igor Grigoriev Igor BASIC BIOLOGICAL SCIENCES MycoCosm is a web based interactive fungal genomics resource which was first released in March in...

  18. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    (1) biosynthesis (1) bisabolane (1) cations (1) cluster compounds (1) drugs (1) ethanol (1) ethanol fuels (1) food (1) fungal genomics (1) fungi (1) inorganic, organic, physical, ...

  19. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    and Environmental Research (BER) (SC-23)","59 BASIC BIOLOGICAL SCIENCES fungal genomics; gene regulatory networks",,"In microorganisms, Ion Torrent sequencing technology has...

  20. Rapid genome resequencing of an atoxigenic strain of Aspergillus...

    Office of Scientific and Technical Information (OSTI)

    United States Language: English Subject: 59 BASIC BIOLOGICAL SCIENCES fungal genomics; gene regulatory networks Word Cloud More Like This Free Publicly Accessible Full...

  1. Antimicrobial and anti-inflammatory activity of switchgrass-derived extractives

    DOE Patents [OSTI]

    Labbe, Nicole; Ownley, Bonnie H.; Gwinn, Kimberly D.; Moustaid-Moussa, Naima; D'Souza, Doris H.

    2016-03-15

    Switchgrass is an increasingly important biofuel crop, but knowledge of switchgrass fungal pathogens is not extensive. The purpose of this research was to identify the fungal pathogens that decrease crop yield of switchgrass grown in Tennessee and to investigate a potential sustainable disease management strategy from a value-added by-product of the switchgrass biofuel conversion process. The specific objectives were 1) to identify and characterize prevalent fungal pathogens of switchgrass in Tennessee, 2) assess switchgrass seed produced in the United States for seedborne fungal pathogens, and 3) evaluate switchgrass extractives for antimicrobial activity against plant pathogens.

  2. Assembly and Activity of Engineered Minicellulosomes (Poster)

    SciTech Connect (OSTI)

    Xu, Q.; Baker, J.; Michener, B.; Brunecky R.; Adney, B.; Ding, S.-Y.; Himmel, M. E.

    2009-06-01

    This poster describes the optimization of reaction conditions for c thermocellum cellulase, a comparison of c thermocellum and fungal cellulases, and development of a library of cellulosomal enzymes.

  3. Thermophilic Cellulases Compatible with Ionic Liquid Pretreatment...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ionic liquids dissolve cellulose, which can then be separated out in an additional process. However, significant decreases in the available commercial fungal cellulase activity in ...

  4. NREL: Biomass Research - Mark R. Nimlos

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and function of cellulase enzymes and their interaction with cellulose substrates. ... for Processivity in a Family 1 Carbohydrate-Binding Module from a Fungal Cellulase." ...

  5. Cellulosome preparations for cellulose hydrolysis - Energy Innovation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    thermocellum is added to a fungal cellulase mixture, such as those found in ... The bioethanol industry also is poised to utilize low cost cellulase enzyme mixtures by ...

  6. Diverse Fungi Secrete Similar Suite of Decomposition Enzymes...

    Office of Science (SC) Website

    role in biofuel production and bioremediation of metal-contaminated soils and water. ... fungal species can be harnessed to remove toxic metals from contaminated soils and water. ...

  7. Applications of Carboxylic Acid Reductases in Oleaginous Microbes...

    Office of Scientific and Technical Information (OSTI)

    Here, we express four CAR enzymes from different fungal origins to test their activity ... done via hydrotreating catalysis at high temperatures and hydrogen pressures. ...

  8. Isolation of a significant fraction of non-phototroph diversity...

    Office of Scientific and Technical Information (OSTI)

    strategies (media with varying nutrient availability and protection from oxidative stress) we recovered 402 bacterial and one fungal isolate in axenic culture, which comprised...

  9. ReaxFF Study of the Oxidation of Softwood Lignin in View of Carbon Fiber Production

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Beste, Ariana

    2014-10-06

    We investigate the oxidative, thermal conversion of softwood lignin by performing molecular dynamics simulations based on a reactive force field (ReaxFF). The lignin samples are constructed from coniferyl alcohol units, which are connected through linkages that are randomly selected from a natural distribution of linkages in softwood. The goal of this work is to simulate the oxidative stabilization step during carbon fiber production from lignin precursor. We find that at simulation conditions where stabilization reactions occur, the lignin fragments have already undergone extensive degradation. The 5-5 linkage shows the highest reactivity towards cyclization and dehydrogenation.

  10. ReaxFF Study of the Oxidation of Softwood Lignin in View of Carbon Fiber Production

    SciTech Connect (OSTI)

    Beste, Ariana

    2014-01-01

    We investigate the oxidative, thermal conversion of softwood lignin by performing molecular dynamics simulations based on a reactive force field (ReaxFF). The lignin samples are constructed from coniferyl alcohol units, which are connected through linkages that are randomly selected from a natural distribution of linkages in softwood. The goal of this work is to simulate the oxidative stabilization step during carbon fiber production from lignin precursor. We find that at simulation conditions where stabilization reactions occur, the lignin fragments have already undergone extensive degradation. The 5-5 linkage shows the highest reactivity towards cyclization and dehydrogenation.

  11. Global diversity and geography of soil fungi. Minus one widespread group

    SciTech Connect (OSTI)

    Schadt, Christopher Warren; Rosling, Anna

    2015-04-15

    In their research article Global diversity and geography of soil fungi Tedersoo et al. (28 November, 2014) present a compelling study regarding patterns of biodiversity of fungi, at a scale unprecedented to date for fungal biogeographical studies. The study demonstrates strong global biogeographic patterns in richness and community composition of soil fungi, what concerns us with the study is what we don t see. Unfortunately this study underestimates fungal diversity of at least one key group of soil fungi due to reliance on a single traditional primer with known flaws, and as a consequence the overall relative abundance of fungal groups may also be skewed.

  12. Synthesis and properties of photosensitive rubbers. III. Synthesis of chloroacetylated polybutadiene and its photosensitivity

    SciTech Connect (OSTI)

    Azuma, C.; Hiramatsu, T.; Tanaka, H.; Sanui, K.; Ogata, N.

    1984-02-01

    Polymers having chloroacetate groups were prepared by addition reaction of various chloroacetic acids, such as mono-, di-, and trichloroacetic acids, to cis-1,4-polybutadiene under nitrogen atmosphere for obtaining photosensitive rubbers. The structure of products obtained was identified as a cyclized polybutadiene having pendent chloroacetate groups. The amount of the incorporated substituent increased up to the maximum of around 20 mol %, and the amount of the residual unsaturated groups in the polymer backbone decreased due to the cyclization of the double bond. Chloroacetylated polybutadiene had higher photocrosslinkability by UV irradiation than chloroacetylated chitosan or PVA owing to the high reactivity of the chloroacetate groups and the double bonds in the polymer. The photosensitivity depends both on the amount of the incorporated chloroacetate groups and the residual double bonds in the polymer and also depends on the glass transition temperature (T/sub g/) of the polymer, and the dependence of the crosslinking reaction on T/sub g/ was interpreted to be due to diffusion controlled reaction between excited dichloroacetate groups and olefinic groups in the polymer.

  13. Understanding the role of histidine in the GHSxG acyltransferase active site motif: Evidence for histidine stabilization of the malonyl-enzyme intermediate

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Poust, Sean; Yoon, Isu; Adams, Paul D.; Katz, Leonard; Petzold, Christopher J.; Keasling, Jay D.

    2014-10-06

    Acyltransferases determine which extender units are incorporated into polyketide and fatty acid products. Thus, the ping-pong acyltransferase mechanism utilizes a serine in a conserved GHSxG motif. However, the role of the conserved histidine in this motif is poorly understood. We observed that a histidine to alanine mutation (H640A) in the GHSxG motif of the malonyl-CoA specific yersiniabactin acyltransferase results in an approximately seven-fold higher hydrolysis rate over the wildtype enzyme, while retaining transacylation activity. We propose two possibilities for the reduction in hydrolysis rate: either H640 structurally stabilizes the protein by hydrogen bonding with a conserved asparagine in the ferredoxin-likemore » subdomain of the protein, or a water-mediated hydrogen bond between H640 and the malonyl moiety stabilizes the malonyl-O-AT ester intermediate.« less

  14. Cellulases and coding sequences

    DOE Patents [OSTI]

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2001-01-01

    The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

  15. Cellulases and coding sequences

    DOE Patents [OSTI]

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2001-02-20

    The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

  16. Genomic Encyclopedia of Fungi

    SciTech Connect (OSTI)

    Grigoriev, Igor

    2012-08-10

    Genomes of fungi relevant to energy and environment are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 150 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such parts suggested by comparative genomics and functional analysis in these areas are presented here.

  17. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    MycoCosm, an Integrated Fungal Genomics Resource","Shabalov, Igor; Grigoriev, Igor","2012-03-16T04:00:00Z",1165859,,"LBNL-6823E","DE-AC02-05CH11231",,"Conference",,,"Conference:...

  18. Exo-endo cellulase fusion protein

    DOE Patents [OSTI]

    Bower, Benjamin S.; Larenas, Edmund A.; Mitchinson, Colin

    2012-01-17

    The present invention relates to a heterologous exo-endo cellulase fusion construct, which encodes a fusion protein having cellulolytic activity comprising a catalytic domain derived from a fungal exo-cellobiohydrolase and a catalytic domain derived from an endoglucanase. The invention also relates to vectors and fungal host cells comprising the heterologous exo-endo cellulase fusion construct as well as methods for producing a cellulase fusion protein and enzymatic cellulase compositions.

  19. Assembly of Repeat Content Using Next Generation Sequencing Data

    SciTech Connect (OSTI)

    labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex

    2014-03-17

    Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.

  20. Transition metal complexes of oxazolinylboranes and cyclopentadienyl-bis(oxazolinyl)borates: Catalysts for asymmetric olefin hydroamination and acceptorless alcohol decarbonylation

    SciTech Connect (OSTI)

    Manna, Kuntal [Ames Laboratory

    2012-12-17

    The research presented and discussed in this dissertation involves the synthesis of transition metal complexes of oxazolinylboranes and cyclopentadienyl-bis(oxazolinyl)borates, and their application in catalytic enantioselective olefin hydroamination and acceptorless alcohol decarbonylation. Neutral oxazolinylboranes are excellent synthetic intermediates for preparing new borate ligands and also developing organometallic complexes. Achiral and optically active bis(oxazolinyl)phenylboranes are synthesized by reaction of 2-lithio-2-oxazolide and 0.50 equiv of dichlorophenylborane. These bis(oxazolinyl)phenylboranes are oligomeric species in solid state resulting from the coordination of an oxazoline to the boron center of another borane monomer. The treatment of chiral bis(oxazolinyl)phenylboranes with sodium cyclopentadienide provide optically active cyclopentadienyl-bis(oxazolinyl)borates H[PhB(C{sub 5}H{sub 5})(Ox{sup R}){sub 2}] [Ox{sup R} = Ox{sup 4S-iPr,Me2}, Ox{sup 4R-iPr,Me2}, Ox{sup 4S-tBu]}. These optically active proligands react with an equivalent of M(NMe{sub 2}){sub 4} (M = Ti, Zr, Hf) to afford corresponding cyclopentadienyl-bis(oxazolinyl)borato group 4 complexes {PhB(C{sub 5}H{sub 4})(Ox{sup R}){sub 2}}M(NMe{sub 2}){sub 2} in high yields. These group 4 compounds catalyze cyclization of aminoalkenes at room temperature or below, providing pyrrolidine, piperidine, and azepane with enantiomeric excesses up to 99%. Our mechanistic investigations suggest a non-insertive mechanism involving concerted C?N/C?H bond formation in the turnover limiting step of the catalytic cycle. Among cyclopentadienyl-bis(oxazolinyl)borato group 4 catalysts, the zirconium complex {PhB(C{sub 5}H{sub 4})(Ox{sup 4S-iPr,Me2}){sub 2}}Zr(NMe{sub 2}){sub 2} ({S-2}Zr(NMe{sub 2}){sub 2}) displays highest activity and enantioselectivity. Interestingly, {S-2}Zr(NMe{sub 2}){sub 2} also desymmetrizes olefin moieties of achiral non-conjugated aminodienes and aminodiynes during cyclization

  1. New Palladium-Catalyzed Approaches to Heterocycles and Carbocycles

    SciTech Connect (OSTI)

    Qinhua Huang

    2004-12-19

    The tert-butylimines of o-(1-alkynyl)benzaldehydes and analogous pyridinecarbaldehydes have been cyclized under very mild reaction conditions in the presence of I{sub 2}, ICl, PhSeCl, PhSCl and p-O{sub 2}NC{sub 6}H{sub 4}SCl to give the corresponding halogen-, selenium- and sulfur-containing disubstituted isoquinolines and naphthyridines, respectively. Monosubstituted isoquinolines and naphthyridines have been synthesized by the metal-catalyzed ring closure of these same iminoalkynes. This methodology accommodates a variety of iminoalkynes and affords the anticipated heterocycles in moderate to excellent yields. The Pd(II)-catalyzed cyclization of 2-(1-alkynyl)arylaldimines in the presence of various alkenes provides an efficient way to synthesize a variety of 4-(1-alkenyl)-3-arylisoquinolines in moderate to excellent yields. The introduction of an ortho-methoxy group on the arylaldimine promotes the Pd-catalyzed cyclization and stabilizes the resulting Pd(II) intermediate, improving the yields of the isoquinoline products. Highly substituted naphthalenes have been synthesized by the palladium-catalyzed annulation of a variety of internal alkynes, in which two new carbon-carbon bonds are formed in a single step under relatively mild reaction conditions. This method has also been used to synthesize carbazoles, although a higher reaction temperature is necessary. The process involves arylpalladation of the alkyne, followed by intramolecular Heck olefination and double bond isomerization. This method accommodates a variety of functional groups and affords the anticipated highly substituted naphthalenes and carbazoles in good to excellent yields. Novel palladium migratiodarylation methodology for the synthesis of complex fused polycycles has been developed, in which one or more sequential Pd-catalyzed intramolecular migration processes involving C-H activation are employed. The chemistry works best with electron-rich aromatics, which is in agreement with the idea that

  2. Emissive sensors and devices incorporating these sensors

    DOE Patents [OSTI]

    Swager, Timothy M; Zhang, Shi-Wei

    2013-02-05

    The present invention generally relates to luminescent and/or optically absorbing compositions and/or precursors to those compositions, including solid films incorporating these compositions/precursors, exhibiting increased luminescent lifetimes, quantum yields, enhanced stabilities and/or amplified emissions. The present invention also relates to sensors and methods for sensing analytes through luminescent and/or optically absorbing properties of these compositions and/or precursors. Examples of analytes detectable by the invention include electrophiles, alkylating agents, thionyl halides, and phosphate ester groups including phosphoryl halides, cyanides and thioates such as those found in certain chemical warfare agents. The present invention additionally relates to devices and methods for amplifying emissions, such as those produced using the above-described compositions and/or precursors, by incorporating the composition and/or precursor within a polymer having an energy migration pathway. In some cases, the compositions and/or precursors thereof include a compound capable of undergoing a cyclization reaction.

  3. Use of hydrides in motor vehicles

    SciTech Connect (OSTI)

    Toepler, J.; Bernauer, O.; Buchner, H.

    1980-09-01

    Results of research on hydrogen driven vehicles and hydride storage tanks are presented, along with a detailed discussion of the operational possibilities of low temperature hydrides, such as TiFe-H2, and of high temperature hydrides, such as Mg2Ni-H4. Attention is given to their cyclization stability and thermal conductivity. Heat storage and heat recovery with the aid of hydrides are discussed, and a theoretical hydride storage capacity of a Mg-Ni-alloy is presented. It was concluded that all hydride tanks will be 10 to 20 times heavier than the conventional gasoline tank. The problems of tank weight and gasoline shortage can be solved by a combination hydrogen/gasoline fuel. Existing energy infrastructures must be utilized, as the setting up of a hydrogen infrastructure is, at the present time, both technically and economically unfeasible.

  4. United abominations: Density functional studies of heavy metal chemistry

    SciTech Connect (OSTI)

    Schoendorff, George

    2012-04-02

    Carbonyl and nitrile addition to uranyl (UO{sup 2}{sup 2+}) are studied. The competition between nitrile and water ligands in the formation of uranyl complexes is investigated. The possibility of hypercoordinated uranyl with acetone ligands is examined. Uranyl is studied with diactone alcohol ligands as a means to explain the apparent hypercoordinated uranyl. A discussion of the formation of mesityl oxide ligands is also included. A joint theory/experimental study of reactions of zwitterionic boratoiridium(I) complexes with oxazoline-based scorpionate ligands is reported. A computational study was done of the catalytic hydroamination/cyclization of aminoalkenes with zirconium-based catalysts. Techniques are surveyed for programming for graphical processing units (GPUs) using Fortran.

  5. The role of atropisomers on the photo-reactivity and fatigue of diarylethene-based metal–organic frameworks

    SciTech Connect (OSTI)

    Walton, Ian M.; Cox, Jordan M.; Benson, Cassidy A.; Patel, Dinesh G.; Chen, Yu-Sheng; Benedict, Jason B.

    2016-01-01

    Photo-responsive metal–organic frameworks (MOFs) are one example of light controlled smart materials for use in advanced sensors, data storage, actuators and molecular switches. Herein we show the design, synthesis and characterization of a photo-responsive linker that is subsequently reacted to yield MOF single crystals. The photo-responsive properties of the resulting UBMOF-2 arise from the photo-induced cyclization of the diarylethene moiety designed into the linker. Computational modeling to assess the relative energies of linker atropisomers reveals a large energetic barrier preventing facile interconversion between key species. The role of this barrier on the observed photo-induced fatigue provides useful insight into the development of advanced photo-responsive nanoporous materials.

  6. Structures and functions of oligosaccharins. Progress report, June 15, 1993--March 14, 1995

    SciTech Connect (OSTI)

    Albersheim, P.

    1995-03-01

    This research focuses on the following: Purification, characterization, and cell wall localization of an {alpha}-fucosidase that inactivates a xyloglucan oligosaccharin; Oligogalacturonides inhibit the formation of roots on tobacco explants; Activation of a tobacco glycine-rich protein gene by a fungal glucan preparation; Fusarium moniliforme secretes four endopolygalacturonases derived from a single gene product; Polygalacturonase-inhibiting protein accumulates in Phaseolus vulgaris L. in response to wounding, elicitors and fungal infection; Generation of {beta}-glucan elicitors by plant enzymes and inhibition of the enzymes by a fungal protein; Polygalacturonase inhibitor proteins from bean (Phaseolus vulgaris L.), pear (Pyrus communis L.) and tomato (Lycopersicon esculentum): Immunological relatedness and specificity of polygalacturonase inhibition; Fungi protect themselves against plant pathogenesis-related glycanases; Purification, cloning, and characterization of two xylanases from Magnaporthe grisea, the rice blast fungus; and Molecular cloning and expression pattern of an {alpha}-fucosidase gene from pea seedlings.

  7. Methods for producing secreted polypeptides

    DOE Patents [OSTI]

    Maiyuran, Suchindra; Fidantsef, Ana; Brody, Howard

    2008-07-01

    The present invention relates to methods for producing a polypeptide, comprising: (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a nucleic acid construct comprising a first nucleotide sequence encoding a signal peptide operably linked to a second nucleotide sequence encoding the polypeptide, wherein the first nucleotide sequence is foreign to the second nucleotide sequence and the 3' end of the first nucleotide sequence is immediately upstream of the initiator codon of the second nucleotide sequence. The present invention also relates to the isolated signal peptide sequences and to constructs, vectors, and fungal host cells comprising the signal peptide sequences operably linked to nucleotide sequences encoding polypeptides.

  8. Global diversity and geography of soil fungi. Minus one widespread group

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Schadt, Christopher Warren; Rosling, Anna

    2015-04-15

    In their research article Global diversity and geography of soil fungi Tedersoo et al. (28 November, 2014) present a compelling study regarding patterns of biodiversity of fungi, at a scale unprecedented to date for fungal biogeographical studies. The study demonstrates strong global biogeographic patterns in richness and community composition of soil fungi, what concerns us with the study is what we don t see. Unfortunately this study underestimates fungal diversity of at least one key group of soil fungi due to reliance on a single traditional primer with known flaws, and as a consequence the overall relative abundance of fungalmore » groups may also be skewed.« less

  9. Genome analysis of Elusimicrobium minutum, the first cultivated representative of the Elusimicrobia phylum (formerly Termite Group 1)

    SciTech Connect (OSTI)

    Herlemann, D. P. R.; Geissinger, O.; Ikeda-Ohtsubo, W.; Kunin, V.; Sun, H.; Lapidus, A.; Hugenholtz, P.; Brune, A.

    2009-02-01

    The candidate phylum Termite group 1 (TG1), is regularly 1 encountered in termite hindguts but is present also in many other habitats. Here we report the complete genome sequence (1.64 Mbp) of Elusimicrobium minutum strain Pei191{sup T}, the first cultured representative of the TG1 phylum. We reconstructed the metabolism of this strictly anaerobic bacterium isolated from a beetle larva gut and discuss the findings in light of physiological data. E. minutum has all genes required for uptake and fermentation of sugars via the Embden-Meyerhof pathway, including several hydrogenases, and an unusual peptide degradation pathway comprising transamination reactions and leading to the formation of alanine, which is excreted in substantial amounts. The presence of genes encoding lipopolysaccharide biosynthesis and the presence of a pathway for peptidoglycan formation are consistent with ultrastructural evidence of a Gram-negative cell envelope. Even though electron micrographs showed no cell appendages, the genome encodes many genes putatively involved in pilus assembly. We assigned some to a type II secretion system, but the function of 60 pilE-like genes remains unknown. Numerous genes with hypothetical functions, e.g., polyketide synthesis, non-ribosomal peptide synthesis, antibiotic transport, and oxygen stress protection, indicate the presence of hitherto undiscovered physiological traits. Comparative analysis of 22 concatenated single-copy marker genes corroborated the status of Elusimicrobia (formerly TG1) as a separate phylum in the bacterial domain, which was so far based only on 16S rRNA sequence analysis.

  10. Phylum-wide comparative genomics unravel the diversity of secondary metabolism in Cyanobacteria

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Calteau, Alexandra; Fewer, David P.; Latifi, Amel; Coursin, Thérèse; Laurent, Thierry; Jokela, Jouni; Kerfeld, Cheryl A.; Sivonen, Kaarina; Piel, Jörn; Gugger, Muriel

    2014-11-18

    Cyanobacteria are an ancient lineage of photosynthetic bacteria from which hundreds of natural products have been described, including many notorious toxins but also potent natural products of interest to the pharmaceutical and biotechnological industries. Many of these compounds are the products of non-ribosomal peptide synthetase (NRPS) or polyketide synthase (PKS) pathways. However, current understanding of the diversification of these pathways is largely based on the chemical structure of the bioactive compounds, while the evolutionary forces driving their remarkable chemical diversity are poorly understood. We carried out a phylum-wide investigation of genetic diversification of the cyanobacterial NRPS and PKS pathways formore » the production of bioactive compounds. 452 NRPS and PKS gene clusters were identified from 89 cyanobacterial genomes, revealing a clear burst in late-branching lineages. Our genomic analysis further grouped the clusters into 286 highly diversified cluster families (CF) of pathways. Some CFs appeared vertically inherited, while others presented a more complex evolutionary history. Only a few horizontal gene transfers were evidenced amongst strongly conserved CFs in the phylum, while several others have undergone drastic gene shuffling events, which could result in the observed diversification of the pathways. In addition to toxin production, several NRPS and PKS gene clusters are devoted to important cellular processes of these bacteria such as nitrogen fixation and iron uptake. The majority of the biosynthetic clusters identified here have unknown end products, highlighting the power of genome mining for the discovery of new natural products.« less

  11. Phylum-wide comparative genomics unravel the diversity of secondary metabolism in Cyanobacteria

    SciTech Connect (OSTI)

    Calteau, Alexandra; Fewer, David P.; Latifi, Amel; Coursin, Thrse; Laurent, Thierry; Jokela, Jouni; Kerfeld, Cheryl A.; Sivonen, Kaarina; Piel, Jrn; Gugger, Muriel

    2014-11-18

    Cyanobacteria are an ancient lineage of photosynthetic bacteria from which hundreds of natural products have been described, including many notorious toxins but also potent natural products of interest to the pharmaceutical and biotechnological industries. Many of these compounds are the products of non-ribosomal peptide synthetase (NRPS) or polyketide synthase (PKS) pathways. However, current understanding of the diversification of these pathways is largely based on the chemical structure of the bioactive compounds, while the evolutionary forces driving their remarkable chemical diversity are poorly understood. We carried out a phylum-wide investigation of genetic diversification of the cyanobacterial NRPS and PKS pathways for the production of bioactive compounds. 452 NRPS and PKS gene clusters were identified from 89 cyanobacterial genomes, revealing a clear burst in late-branching lineages. Our genomic analysis further grouped the clusters into 286 highly diversified cluster families (CF) of pathways. Some CFs appeared vertically inherited, while others presented a more complex evolutionary history. Only a few horizontal gene transfers were evidenced amongst strongly conserved CFs in the phylum, while several others have undergone drastic gene shuffling events, which could result in the observed diversification of the pathways. In addition to toxin production, several NRPS and PKS gene clusters are devoted to important cellular processes of these bacteria such as nitrogen fixation and iron uptake. The majority of the biosynthetic clusters identified here have unknown end products, highlighting the power of genome mining for the discovery of new natural products.

  12. Genome Sequence and Transcriptome Analyses of Chrysochromulina tobin: Metabolic Tools for Enhanced Algal Fitness in the Prominent Order Prymnesiales (Haptophyceae)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hovde, Blake T.; Deodato, Chloe R.; Hunsperger, Heather M.; Ryken, Scott A.; Yost, Will; Jha, Ramesh K.; Patterson, Johnathan; Monnat, Raymond J.; Barlow, Steven B.; Starkenburg, Shawn R.; et al

    2015-09-23

    Haptophytes are recognized as seminal players in aquatic ecosystem function. These algae are important in global carbon sequestration, form destructive harmful blooms, and given their rich fatty acid content, serve as a highly nutritive food source to a broad range of eco-cohorts. Haptophyte dominance in both fresh and marine waters is supported by the mixotrophic nature of many taxa. Despite their importance the nuclear genome sequence of only one haptophyte, Emiliania huxleyi (Isochrysidales), is available. Here we report the draft genome sequence of Chrysochromulina tobin (Prymnesiales), and transcriptome data collected at seven time points over a 24-hour light/dark cycle. Themore » nuclear genome of C. tobin is small (59 Mb), compact (∼40% of the genome is protein coding) and encodes approximately 16,777 genes. Genes important to fatty acid synthesis, modification, and catabolism show distinct patterns of expression when monitored over the circadian photoperiod. The C. tobin genome harbors the first hybrid polyketide synthase/non-ribosomal peptide synthase gene complex reported for an algal species, and encodes potential anti-microbial peptides and proteins involved in multidrug and toxic compound extrusion. A new haptophyte xanthorhodopsin was also identified, together with two “red” RuBisCO activases that are shared across many algal lineages. In conclusion, the Chrysochromulina tobin genome sequence provides new information on the evolutionary history, ecology and economic importance of haptophytes.« less

  13. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect (OSTI)

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  14. Comparative Genome Structure, Secondary Metabolite, and Effector Coding Capacity across Cochliobolus Pathogens

    SciTech Connect (OSTI)

    Condon, Bradford J.; Leng, Yueqiang; Wu, Dongliang; Bushley, Kathryn E.; Ohm, Robin A.; Otillar, Robert; Martin, Joel; Schackwitz, Wendy; Grimwood, Jane; MohdZainudin, NurAinlzzati; Xue, Chunsheng; Wang, Rui; Manning, Viola A.; Dhillon, Braham; Tu, Zheng Jin; Steffenson, Brian J.; Salamov, Asaf; Sun, Hui; Lowry, Steve; LaButti, Kurt; Han, James; Copeland, Alex; Lindquist, Erika; Barry, Kerrie; Schmutz, Jeremy; Baker, Scott E.; Ciuffetti, Lynda M.; Grigoriev, Igor V.; Zhong, Shaobin; Turgeon, B. Gillian

    2013-01-24

    The genomes of five Cochliobolus heterostrophus strains, two Cochliobolus sativus strains, three additional Cochliobolus species (Cochliobolus victoriae, Cochliobolus carbonum, Cochliobolus miyabeanus), and closely related Setosphaeria turcica were sequenced at the Joint Genome Institute (JGI). The datasets were used to identify SNPs between strains and species, unique genomic regions, core secondary metabolism genes, and small secreted protein (SSP) candidate effector encoding genes with a view towards pinpointing structural elements and gene content associated with specificity of these closely related fungi to different cereal hosts. Whole-genome alignment shows that three to five of each genome differs between strains of the same species, while a quarter of each genome differs between species. On average, SNP counts among field isolates of the same C. heterostrophus species are more than 25 higher than those between inbred lines and 50 lower than SNPs between Cochliobolus species. The suites of nonribosomal peptide synthetase (NRPS), polyketide synthase (PKS), and SSP encoding genes are astoundingly diverse among species but remarkably conserved among isolates of the same species, whether inbred or field strains, except for defining examples that map to unique genomic regions. Functional analysis of several strain-unique PKSs and NRPSs reveal a strong correlation with a role in virulence.

  15. The occurrence of tricin and its derivatives in plants

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Li, Mi; Pu, Yunqiao; Yoo, Chang Geun; Ragauskas, Arthur J.

    2016-02-02

    Our understanding of the structure and biosynthetic pathway of lignin, a phenylpropanoid heteropolymer, continues to evolve, especially with the discovery of new lignin monomers/structural moieties such as monolignol acetate, hydroxycinnamyl aldehyde/alcohol, and p-hydroxybenzoate in the past decades. Recently, tricin has been reported as a component incorporated into monocot lignin. As a flavonoid compound widely distributed in herbaceous plants, tricin has been extensively studied due to its biological significance in plant growth as well as its potential for pharmaceutical importance. Tricin is biosynthesized as a constituent of plant secondary metabolites through a combination of phenylpropanoid and polyketide pathways. Tricin occurs inmore » plants in either free or conjugated forms such as tricin-glycosides, tricin-lignans, and tricin-lignan-glycosides.The emergence of tricin covalently incorporated with lignin biopolymer implies the possible association of lignification and tricin biosynthesis. This review summarizes the occurrence of tricin and its derivatives in plants. Additionally, synthesis, potential application, and characterization of tricin are discussed.« less

  16. Airlift bioreactors. (Latest citations from the Biobusiness database). Published Search

    SciTech Connect (OSTI)

    Not Available

    1993-04-01

    The bibliography contains citations concerning industrial and research applications of airlift bioreactors. Citations include biofilm formation, patents, pharmaceutical production, oxygen mass transfer studies, antibiotic production, wastewater treatment, culture media aspects, and growth kinetics. Topics also explore the culturing of bacterial, fungal, insect, and animal cells. (Contains a minimum of 99 citations and includes a subject term index and title list.)

  17. 3.1.1.2 Feed Processing and Handling DL2 Final Report

    SciTech Connect (OSTI)

    Elliott, Douglas C.; Magnuson, Jon K.; Wend, Christopher F.

    2006-09-30

    This milestone report is the deliverable for our Feed Processing and Handling project. It includes results of wet biomass feedstock analysis, slurry pumping information, fungal processing to produce a lignin-rich biorefinery residue and two subcontracted efforts to quantify the amount of wet biomass feedstocks currently available within the corn processing and paper processing industries.

  18. Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor

    SciTech Connect (OSTI)

    Collins, P.J.; Dobson, A.D.W.; Kotterman, M.J.J.; Field, J.A.

    1996-12-01

    Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.

  19. Lichenase and coding sequences

    DOE Patents [OSTI]

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2000-08-15

    The present invention provides a fungal lichenase, i.e., an endo-1,3-1,4-.beta.-D-glucanohydrolase, its coding sequence, recombinant DNA molecules comprising the lichenase coding sequences, recombinant host cells and methods for producing same. The present lichenase is from Orpinomyces PC-2.

  20. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, Donald L. (Moscow, ID); Ramachandra, Muralidhara (Moscow, ID)

    1993-01-01

    A newly discovered lignin peroxidase enzyme is provided. The enzyme is obtained from a bacterial source and is capable of degrading the lignin portion of lignocellulose in the presence of hydrogen peroxide. The enzyme is extracellular, oxidative, inducible by lignin, larch wood xylan, or related substrates and capable of attacking certain lignin substructure chemical bonds that are not degradable by fungal lignin peroxidases.

  1. Synthesis of 6-Methyl-9-propyldibenzothiophene-4-ol amended to 9-isopropyl-6-methyldibenzothiophene-4-ol. Final technical report, July 25, 1991--January 25, 1993

    SciTech Connect (OSTI)

    Eisenbraun, E.J.

    1992-02-17

    This is a draft final technical report on Task 1 of a contract to synthesize 6-Methyl-9-propyldibenzothiophene-4-ol, as amended to 9- isopropyl-6-methyldibenzothiophene-4-ol. This report is a compilation of data presented in earlier reports. The first annual report dealt with an attempted synthesis of 4-methoxy-6-methyl-9- propyldibenzothiophene (the original target compound), the successful synthesis and delivery of 200 grams of the sulfide 1,4-diethyl-2- [(2{prime}-methoxyphenyl)-thio]benzene, and initial work on a new synthesis route for the preparation of the new target compound 9- isopropyl-6-methyldibenzothiophene-4-ol. The change to the new target compound and the new synthesis route became necessary when it was learned that the sulfide mixture could not be cyclized to the substituted dibenzothiophene mixture. The second annual report described the successful preparation of 45 g of the new target compound using the new synthesis route. Subsequently funds were provided to synthesize an additional 45 g of the new target using the same reaction scheme. This task was recently completed.

  2. The effect of rhenium, sulfur and alumina on the conversion of hydrocarbons over platinum single crystals: Surface science and catalytic studies

    SciTech Connect (OSTI)

    Kim, C.

    1992-04-01

    Conversion reactions of hydrocarbons over Pt-Re model catalyst surfaces modified by sulfur and alumina have been studied. A plasma deposition source has been developed to deposit Pt, Re, and Al on metal substrates variable coverage in ultrahigh vacuum without excessive heating. Conversion of n-hexane was performed over the Re-covered Pt and Pt-covered Re surfaces. The presence of the second metal increased hydrogenolysis activity of both Pt-Re surfaces. Addition of sulfur on the model Catalyst surfaces suppressed hydrogenolysis activity and increased the cyclization rate of n-hexane to methylcyclopentane over Pt-Re surfaces. Sulfiding also increased the dehydrogenation rate of cyclohexane to benzene Over Pt-Re surfaces. It has been proposed that the PtRe bimetallic catalysts show unique properties when combined with sulfur, and electronic interactions exist between platinum, rhenium and sulfur. Decomposition of hydrocarbons on the sulfur-covered Pt-Re surfaces supported that argument. For the conversion of 1-butene over the planar Pt/AlO[sub x], the addition of Pt increased the selectivity of hydrogenation over isomerization.

  3. The effect of rhenium, sulfur and alumina on the conversion of hydrocarbons over platinum single crystals: Surface science and catalytic studies

    SciTech Connect (OSTI)

    Kim, C.

    1992-04-01

    Conversion reactions of hydrocarbons over Pt-Re model catalyst surfaces modified by sulfur and alumina have been studied. A plasma deposition source has been developed to deposit Pt, Re, and Al on metal substrates variable coverage in ultrahigh vacuum without excessive heating. Conversion of n-hexane was performed over the Re-covered Pt and Pt-covered Re surfaces. The presence of the second metal increased hydrogenolysis activity of both Pt-Re surfaces. Addition of sulfur on the model Catalyst surfaces suppressed hydrogenolysis activity and increased the cyclization rate of n-hexane to methylcyclopentane over Pt-Re surfaces. Sulfiding also increased the dehydrogenation rate of cyclohexane to benzene Over Pt-Re surfaces. It has been proposed that the PtRe bimetallic catalysts show unique properties when combined with sulfur, and electronic interactions exist between platinum, rhenium and sulfur. Decomposition of hydrocarbons on the sulfur-covered Pt-Re surfaces supported that argument. For the conversion of 1-butene over the planar Pt/AlO{sub x}, the addition of Pt increased the selectivity of hydrogenation over isomerization.

  4. Static and dynamic pressure effects on the thermolysis of nitroalkanes in solution

    SciTech Connect (OSTI)

    Brower, K.R. [New Mexico Inst. of Mining and Technology, Socorro, NM (United States). Dept. of Chemistry; Davis, L.L.; Naud, D.L. [Los Alamos National Lab., NM (United States); Wang, J. [Univ. of Southern California, Los Angeles, CA (United States). Dept. of Chemistry

    1998-12-31

    The authors have measured the effects of static and shock-induced pressures on the decomposition rates and mechanisms of various nitroalkanes dissolved in different solvents with and without organic amine catalysts. While nitroalkanes without {alpha}-hydrogen decompose by homolysis of the C-NO{sub 2} bond over a wide range of conditions, the decomposition pathway of nitroalkanes having {alpha}-hydrogens (i.e., acidic nitroalkanes) is complicated and follows different decomposition mechanisms depending on the availability of organic base and reaction pressure. The Nef reaction is also an important reaction pathway. The five known decomposition pathways, homolysis of the C-NO{sub 2} bond, bimolecular reaction between the aci-form and aci-ion, cyclization of the aci-form, elimination of nitrous acid, and the Nef reaction, are highly dependent on the reaction conditions, such as pressure, presence of organic amines, water, alcohols, and polarity of solvent. The authors discuss the results of several tests used to support these various decomposition mechanisms.

  5. Structure-Based Design of Novel HIV-1 Protease Inhibitors to Combat Drug Resistance

    SciTech Connect (OSTI)

    Ghosh,A.; Sridhar, P.; Leshchenko, S.; Hussain, A.; Li, J.; Kovalevsky, A.; Walters, D.; Wedelind, J.; Grum-Tokars, V.; et al.

    2006-01-01

    Structure-based design and synthesis of novel HIV protease inhibitors are described. The inhibitors are designed specifically to interact with the backbone of HIV protease active site to combat drug resistance. Inhibitor 3 has exhibited exceedingly potent enzyme inhibitory and antiviral potency. Furthermore, this inhibitor maintains impressive potency against a wide spectrum of HIV including a variety of multi-PI-resistant clinical strains. The inhibitors incorporated a stereochemically defined 5-hexahydrocyclopenta[b]furanyl urethane as the P2-ligand into the (R)-(hydroxyethylamino)sulfonamide isostere. Optically active (3aS,5R,6aR)-5-hydroxy-hexahydrocyclopenta[b]furan was prepared by an enzymatic asymmetrization of meso-diacetate with acetyl cholinesterase, radical cyclization, and Lewis acid-catalyzed anomeric reduction as the key steps. A protein-ligand X-ray crystal structure of inhibitor 3-bound HIV-1 protease (1.35 Angstroms resolution) revealed extensive interactions in the HIV protease active site including strong hydrogen bonding interactions with the backbone. This design strategy may lead to novel inhibitors that can combat drug resistance.

  6. The Greening of a Plutonium Facility through Personnel Safety, Operational Efficiency, and Infrastructure Improvements - 12108

    SciTech Connect (OSTI)

    Dodge, Robert L.; Cournoyer, Michael E.

    2012-07-01

    Chemical and metallurgical operations involving plutonium and other hazardous materials account for most activities performed at the Los Alamos National Laboratory's Plutonium Facility (TA-55). Engineered barriers provide the most effective protection from hazardous materials. These safety features serve to protect workers and provide defense in depth against the hazards associated with operations. Although not designed to specifically meet environmental requirements the safety-based design does meet or exceed the requirements of the environmental regulations enacted during and since its construction. TA-55's Waste Services Group supports this safety methodology by ensuring safe, efficient and compliant management of all radioactive and hazardous wastes generated at the TA-55. A key function of this group is the implementation of measures that lower the overall risk of radiological and hazardous material operations. Processes and procedures that reduce waste generation compared to current, prevalent processes or procedures used for the same purpose are identified. Some of these 'Best Practices' include implementation of a chemical control system, elimination of aerosol cans, reduction in hazardous waste, implementation of zero liquid discharge, and the re-cyclization of nitric acid. P2/WMin opportunities have been implemented in the areas of personnel and facility attributes, environmental compliance, energy conservation, and green focused infrastructure expansion with the overall objective of minimizing raw material and energy consumption and waste generation. This increases technical knowledge and augments operational safety. (authors)

  7. Process for the preparation of benozotriazoles and their polymers, and 2(2-hydroxy-5-isopropenylphenyl)2H-benzotriazole produced thereby

    DOE Patents [OSTI]

    Vogl, Otto; Nir, Zohar

    1989-03-14

    The compound 2(2-hydroxy-5-isopropenylphenyl)2H-benzotriazole (2H5P) is produced by azo coupling of o-nitrophenyl diazonium chloride with p-hydroxyacetophenone, subjecting the resulting isolated azo compound to reductive cyclization with zinc in the presence of sodium hydroxide at a temperature of about 50.degree.-70.degree. C., acidifying the resulting mixture so as to produce (2(2-hydroxy-5-acetylphenyl)2H-benzotriazole (2H5A), acetylating the isolated 2(2-hydroxy-5-acetylphenyl)2H-benzotriazole (2H5A), so as to produce 2(2-acetoxy-5-acetylphenyl)2H-benzotriazole (2A5A), methylating the isolated 2(2-acetoxy-5-acetylphenyl(2H-benzotriazole (2A5A) with a methyl Grignard reagent and dehydrating the isolated reaction product with potassium hydrogen sulfate so as to produce 2(2-hydroxy-5-isopropenylphenyl)2H-benzotriazole (2H5P). The compound is used as a polymerizable ultra violet light stabilizer.

  8. Intramolecular condensation reactions of {alpha},{omega}-bis(triethoxysilyl)alkanes. Formation of cyclic disilsesquioxanes

    SciTech Connect (OSTI)

    Loy, D.A.; Carpenter, J.P.; Myers, S.A.; Assink, R.A.; Small, J.H.; Greaves, J.; Shea, K.J.

    1996-09-04

    In this paper, we used mass spectrometry and {sup 29}Si NMR spectroscopy to discover that the length of the alkylene-bridging groups had a pronounced effect on the competition between cyclization and polymerization of {alpha},{omega}-bis(triethoxysilyl)alkanes and on the formation of polymeric gels. While the intramolecular reaction clearly slows gelation, the cyclic disilsesquioxanes are still tetrafunctional monomers theoretically capable of forming polymeric gels. If the ring structures, which bear a striking resemblence to carbohydrates, are preserved through the polymerization, the resulting poly(cyclic disilsesquioxane) gels may have structural similarities to branched or cross-linked carbohydrates, such as cellulose or chitosan. Under base-catalyzed sol-gel polymerization conditions, 3 and 4 (six- and seven-membered cyclic disilsesquioxanes, respectively) quickly reacted to give gels with significant ring opening as determined from the {sup 29}Si chemical shifts in solid-state (CP MAS) NMR spectra. However, gels prepared under acidic conditions reveal some or all of the cyclic disilsesquioxane functionality was preserved in the polymers. 13 refs., 1 fig.

  9. Probing the Conformational Distributions of Sub-Persistence Length DNA

    SciTech Connect (OSTI)

    Mastroianni, Alexander; Sivak, David; Geissler, Phillip; Alivisatos, Paul

    2009-06-08

    We have measured the bending elasticity of short double-stranded DNA (dsDNA) chains through small-angle X-ray scattering from solutions of dsDNA-linked dimers of gold nanoparticles. This method, which does not require exertion of external forces or binding to a substrate, reports on the equilibrium distribution of bending fluctuations, not just an average value (as in ensemble FRET) or an extreme value (as in cyclization), and in principle provides a more robust data set for assessing the suitability of theoretical models. Our experimental results for dsDNA comprising 42-94 basepairs (bp) are consistent with a simple worm-like chain model of dsDNA elasticity, whose behavior we have determined from Monte Carlo simulations that explicitly represent nanoparticles and their alkane tethers. A persistence length of 50 nm (150 bp) gave a favorable comparison, consistent with the results of single-molecule force-extension experiments on much longer dsDNA chains, but in contrast to recent suggestions of enhanced flexibility at these length scales.

  10. Evidence of covalent synergy in silicon–sulfur–graphene yielding highly efficient and long-life lithium-ion batteries

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hassan, Fathy M.; Batmaz, Rasim; Li, Jingde; Wang, Xiaolei; Xiao, Xingcheng; Yu, Aiping; Chen, Zhongwei

    2015-10-26

    Silicon has the potential to revolutionize the energy storage capacities of lithium-ion batteries to meet the ever increasing power demands of next generation technologies. To avoid the operational stability problems of silicon-based anodes, we propose synergistic physicochemical alteration of electrode structures during their design. This capitalizes on covalent interaction of Si nanoparticles with sulfur-doped graphene and with cyclized polyacrylonitrile to provide a robust nanoarchitecture. This hierarchical structure stabilized the solid electrolyte interphase leading to superior reversible capacity of over 1,000 mAh g-1 for 2,275 cycles at 2 A g-1. Furthermore, the nanoarchitectured design lowered the contact of the electrolyte tomore » the electrode leading to not only high coulombic efficiency of 99.9% but also maintaining high stability even with high electrode loading associated with 3.4 mAh cm-2. As a result, the excellent performance combined with the simplistic, scalable and non-hazardous approach render the process as a very promising candidate for Li-ion battery technology.« less

  11. Evidence of covalent synergy in silicon–sulfur–graphene yielding highly efficient and long-life lithium-ion batteries

    SciTech Connect (OSTI)

    Hassan, Fathy M.; Batmaz, Rasim; Li, Jingde; Wang, Xiaolei; Xiao, Xingcheng; Yu, Aiping; Chen, Zhongwei

    2015-10-26

    Silicon has the potential to revolutionize the energy storage capacities of lithium-ion batteries to meet the ever increasing power demands of next generation technologies. To avoid the operational stability problems of silicon-based anodes, we propose synergistic physicochemical alteration of electrode structures during their design. This capitalizes on covalent interaction of Si nanoparticles with sulfur-doped graphene and with cyclized polyacrylonitrile to provide a robust nanoarchitecture. This hierarchical structure stabilized the solid electrolyte interphase leading to superior reversible capacity of over 1,000 mAh g-1 for 2,275 cycles at 2 A g-1. Furthermore, the nanoarchitectured design lowered the contact of the electrolyte to the electrode leading to not only high coulombic efficiency of 99.9% but also maintaining high stability even with high electrode loading associated with 3.4 mAh cm-2. As a result, the excellent performance combined with the simplistic, scalable and non-hazardous approach render the process as a very promising candidate for Li-ion battery technology.

  12. Mechanism of protein splicing of the Pyrococcus abyssi lon protease intein

    SciTech Connect (OSTI)

    O'Brien, Kevin M.; Schufreider, Ann K.; McGill, Melissa A.; O'Brien, Kathryn M.; Reitter, Julie N.; Mills, Kenneth V.

    2010-12-17

    Research highlights: {yields} The Pyrococcus abyssi lon protease intein promotes efficient protein splicing. {yields} Inteins with mutations that interfere with individual steps of splicing do not promote unproductive side reactions. {yields} The intein splices with Lys in place of the highly conserved penultimate His. {yields} The intein is flanked by a Gly-rich region at its C terminus that may increase the efficiency of the third step of splicing, Asn cyclization coupled to peptide bond cleavage. -- Abstract: Protein splicing is a post-translational process by which an intervening polypeptide, the intein, excises itself from the flanking polypeptides, the exteins, coupled to ligation of the exteins. The lon protease of Pyrococcus abyssi (Pab) is interrupted by an intein. When over-expressed as a fusion protein in Escherichia coli, the Pab lon protease intein can promote efficient protein splicing. Mutations that block individual steps of splicing generally do not lead to unproductive side reactions, suggesting that the intein tightly coordinates the splicing process. The intein can splice, although it has Lys in place of the highly conserved penultimate His, and mutants of the intein in the C-terminal region lead to the accumulation of stable branched-ester intermediate.

  13. Enrichment, isolation and characterization of fungi tolerant to 1-ethyl-3-methylimidazolium acetate

    SciTech Connect (OSTI)

    Singer, S.W.; Reddy, A. P.; Gladden, J. M.; Guo, H.; Hazen, T.C.; Simmons, B. A.; VanderGheynst, J. S.

    2010-12-15

    This work aims to characterize microbial tolerance to 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), ionic liquid that has emerged as a novel biomass pretreatment for lignocellulosic biomass. Enrichment experiments performed using inocula treated with [C2mim][OAc] under solid and liquid cultivation yielded fungal populationsdominated by Aspergilli. Ionic liquid-tolerant Aspergillus isolates from these enrichments were capable of growing in a radial plate growth assay in the presence of 10% [C2mim][OAc]. When a [C2mim][OAc]-tolerant Aspergillus fumigatus strain was grown in the presence of switchgrass, endoglucanases and xylanases were secreted that retained residual enzymatic activity in the presence of 20% [C2mim][OAc]. The results of the study suggest tolerance to ionic liquids is a general property of Aspergilli. Tolerance to an industrially important ionic liquid was discovered in a fungal genera that is widely used in biotechnology, including biomass deconstruction.

  14. Nucleic acids encoding antifungal polypeptides and uses thereof

    DOE Patents [OSTI]

    Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-11-02

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  15. Convergent losses of decay mechanisms and rapid turnover of symbiosis genes in mycorrhizal mutualists

    SciTech Connect (OSTI)

    Kohler, Annegret; Kuo, Alan; Nagy, Laszlo G.; Morin, Emmanuelle; Barry, Kerrie W.; Buscot, Francois; Canbäck, Björn; Choi, Cindy; Cichocki, Nicolas; Clum, Alicia; Colpaert, Jan; Copeland, Alex; Costa, Mauricio D.; Doré, Jeanne; Floudas, Dimitrios; Gay, Gilles; Girlanda, Mariangela; Henrissat, Bernard; Herrmann, Sylvie; Hess, Jaqueline; Högberg, Nils; Johansson, Tomas; Khouja, Hassine-Radhouane; LaButti, Kurt; Lahrmann, Urs; Levasseur, Anthony; Lindquist, Erika A.; Lipzen, Anna; Marmeisse, Roland; Martino, Elena; Murat, Claude; Ngan, Chew Y.; Nehls, Uwe; Plett, Jonathan M.; Pringle, Anne; Ohm, Robin A.; Perotto, Silvia; Peter, Martina; Riley, Robert; Rineau, Francois; Ruytinx, Joske; Salamov, Asaf; Shah, Firoz; Sun, Hui; Tarkka, Mika; Tritt, Andrew; Veneault-Fourrey, Claire; Zuccaro, Alga; Tunlid, Anders; Grigoriev, Igor V.; Hibbett, David S.; Martin, Francis

    2015-02-23

    To elucidate the genetic bases of mycorrhizal lifestyle evolution, we sequenced new fungal genomes, including 13 ectomycorrhizal (ECM), orchid (ORM) and ericoid (ERM) species, and five saprotrophs, which we analyzed along with other fungal genomes. Ectomycorrhizal fungi have a reduced complement of genes encoding plant cell wall-degrading enzymes (PCWDEs), as compared to their ancestral wood decayers. Nevertheless, they have retained a unique array of PCWDEs, thus suggesting that they possess diverse abilities to decompose lignocellulose. Similar functional categories of nonorthologous genes are induced in symbiosis. Of induced genes, 7-38% are orphan genes, including genes that encode secreted effector-like proteins. Convergent evolution of the mycorrhizal habit in fungi occurred via the repeated evolution of a 'symbiosis toolkit', with reduced numbers of PCWDEs and lineage-specific suites of mycorrhiza-induced genes.

  16. Microbial desulphurization of Turkish lignites by White Rot Fungi

    SciTech Connect (OSTI)

    Pinar Aytar; Mesut Sam; Ahmet Cabuk

    2008-03-15

    Biodesulphurization experiments were carried out with Tuncbilek lignite, characterized by high sulfur content (2.59%) by using Trametes versicolor ATCC 200801 and Phanerochaete chrysosporium ME 446. At fungal biomass studies, the effects of various parameters on fungal desulphurization of coals such as pH, temperature, pulp density, incubation time, and sterilization were investigated for both microorganisms. The maximum desulphurization (40%) was observed after 6 days of incubation at 35{sup o}C for T. versicolor. The optimum pH was measured at 6, and the agitation rate was fixed at 125 rpm. The pulp density was found as 5% (w/v) for the high extent of desulphurization. Also, calorific value did not change during this experiment. However, the ash and metal contents of coal were eliminated. 30 refs., 6 figs., 2 tabs.

  17. Methods of increasing secretion of polypeptides having biological activity

    DOE Patents [OSTI]

    Merino, Sandra

    2014-10-28

    The present invention relates to methods for producing a secreted polypeptide having biological activity, comprising: (a) transforming a fungal host cell with a fusion protein construct encoding a fusion protein, which comprises: (i) a first polynucleotide encoding a signal peptide; (ii) a second polynucleotide encoding at least a catalytic domain of an endoglucanase or a portion thereof; and (iii) a third polynucleotide encoding at least a catalytic domain of a polypeptide having biological activity; wherein the signal peptide and at least the catalytic domain of the endoglucanase increases secretion of the polypeptide having biological activity compared to the absence of at least the catalytic domain of the endoglucanase; (b) cultivating the transformed fungal host cell under conditions suitable for production of the fusion protein; and (c) recovering the fusion protein, a component thereof, or a combination thereof, having biological activity, from the cultivation medium.

  18. Methods of increasing secretion of polypeptides having biological activity

    DOE Patents [OSTI]

    Merino, Sandra

    2013-10-01

    The present invention relates to methods for producing a secreted polypeptide having biological activity, comprising: (a) transforming a fungal host cell with a fusion protein construct encoding a fusion protein, which comprises: (i) a first polynucleotide encoding a signal peptide; (ii) a second polynucleotide encoding at least a catalytic domain of an endoglucanase or a portion thereof; and (iii) a third polynucleotide encoding at least a catalytic domain of a polypeptide having biological activity; wherein the signal peptide and at least the catalytic domain of the endoglucanase increases secretion of the polypeptide having biological activity compared to the absence of at least the catalytic domain of the endoglucanase; (b) cultivating the transformed fungal host cell under conditions suitable for production of the fusion protein; and (c) recovering the fusion protein, a component thereof, or a combination thereof, having biological activity, from the cultivation medium.

  19. Methods of increasing secretion of polypeptides having biological activity

    DOE Patents [OSTI]

    Merino, Sandra

    2014-05-27

    The present invention relates to methods for producing a secreted polypeptide having biological activity, comprising: (a) transforming a fungal host cell with a fusion protein construct encoding a fusion protein, which comprises: (i) a first polynucleotide encoding a signal peptide; (ii) a second polynucleotide encoding at least a catalytic domain of an endoglucanase or a portion thereof; and (iii) a third polynucleotide encoding at least a catalytic domain of a polypeptide having biological activity; wherein the signal peptide and at least the catalytic domain of the endoglucanase increases secretion of the polypeptide having biological activity compared to the absence of at least the catalytic domain of the endoglucanase; (b) cultivating the transformed fungal host cell under conditions suitable for production of the fusion protein; and (c) recovering the fusion protein, a component thereof, or a combination thereof, having biological activity, from the cultivation medium.

  20. Methods of increasing secretion of polypeptides having biological activity

    DOE Patents [OSTI]

    Merino, Sandra

    2015-04-14

    The present invention relates to methods for producing a secreted polypeptide having biological activity, comprising: (a) transforming a fungal host cell with a fusion protein construct encoding a fusion protein, which comprises: (i) a first polynucleotide encoding a signal peptide; (ii) a second polynucleotide encoding at least a catalytic domain of an endoglucanase or a portion thereof; and (iii) a third polynucleotide encoding at least a catalytic domain of a polypeptide having biological activity; wherein the signal peptide and at least the catalytic domain of the endoglucanase increases secretion of the polypeptide having biological activity compared to the absence of at least the catalytic domain of the endoglucanase; (b) cultivating the transformed fungal host cell under conditions suitable for production of the fusion protein; and (c) recovering the fusion protein, a component thereof, or a combination thereof, having biological activity, from the cultivation medium.

  1. Convergent losses of decay mechanisms and rapid turnover of symbiosis genes in mycorrhizal mutualists

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kohler, Annegret; Kuo, Alan; Nagy, Laszlo G.; Morin, Emmanuelle; Barry, Kerrie W.; Buscot, Francois; Canbäck, Björn; Choi, Cindy; Cichocki, Nicolas; Clum, Alicia; et al

    2015-02-23

    To elucidate the genetic bases of mycorrhizal lifestyle evolution, we sequenced new fungal genomes, including 13 ectomycorrhizal (ECM), orchid (ORM) and ericoid (ERM) species, and five saprotrophs, which we analyzed along with other fungal genomes. Ectomycorrhizal fungi have a reduced complement of genes encoding plant cell wall-degrading enzymes (PCWDEs), as compared to their ancestral wood decayers. Nevertheless, they have retained a unique array of PCWDEs, thus suggesting that they possess diverse abilities to decompose lignocellulose. Similar functional categories of nonorthologous genes are induced in symbiosis. Of induced genes, 7-38% are orphan genes, including genes that encode secreted effector-like proteins. Convergentmore » evolution of the mycorrhizal habit in fungi occurred via the repeated evolution of a 'symbiosis toolkit', with reduced numbers of PCWDEs and lineage-specific suites of mycorrhiza-induced genes.« less

  2. Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

    DOE Patents [OSTI]

    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-04-20

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  3. Spatial regulation of a common precursor from two distinct genes generates metabolite diversity

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Guo, Chun -Jun; Sun, Wei -Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C. C.

    2015-07-13

    In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPSlike genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. In hyphae this compound is converted to aspulvinones whereas inmore » conidia it is converted to melanin. The genes are expressed in different tissues and this spatial control is probably regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is located in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. Our data reveal the first case in secondary metabolite biosynthesis in which the tissue specific production of a single compound directs it into two separate pathways, producing distinct compounds with different functions. Our data also reveal that a single trans-prenyltransferase, AbpB, prenylates two substrates, aspulvinones and butyrolactones, revealing that genes outside of contiguous secondary metabolism gene clusters can modify more than one compound thereby expanding metabolite diversity. Our study raises the possibility of incorporation of spatial, cell-type specificity in expression of secondary metabolites of biological interest and provides new insight into designing and reconstituting their biosynthetic pathways.« less

  4. Spatial regulation of a common precursor from two distinct genes generates metabolite diversity

    SciTech Connect (OSTI)

    Guo, Chun -Jun; Sun, Wei -Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C. C.

    2015-07-13

    In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPSlike genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. In hyphae this compound is converted to aspulvinones whereas in conidia it is converted to melanin. The genes are expressed in different tissues and this spatial control is probably regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is located in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. Our data reveal the first case in secondary metabolite biosynthesis in which the tissue specific production of a single compound directs it into two separate pathways, producing distinct compounds with different functions. Our data also reveal that a single trans-prenyltransferase, AbpB, prenylates two substrates, aspulvinones and butyrolactones, revealing that genes outside of contiguous secondary metabolism gene clusters can modify more than one compound thereby expanding metabolite diversity. Our study raises the possibility of incorporation of spatial, cell-type specificity in expression of secondary metabolites of biological interest and provides new insight into designing and reconstituting their biosynthetic pathways.

  5. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    SciTech Connect (OSTI)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  6. Novel Combination of Enzyme Systems Could Lower Biofuel Costs (Fact Sheet), Highlights in Science, NREL (National Renewable Energy Laboratory)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Two natural enzyme systems-one produced by fungi and the other by bacteria-break down cel- lulose faster if used in combination. The resulting process shows promise for less expensive biofuels. Researchers from the National Renewable Energy Laboratory (NREL) and their partners studied a cocktail of individual fungal enzymes that depoly- merize biomass, and an alternative bacterial system in which multiple biomass-degrading enzymes, termed the cellulosome, are linked together by a protein

  7. Advantages of Enzyme Could Lead to Improved Biofuels Production (Fact Sheet), NREL Highlights in Science, NREL (National Renewable Energy Laboratory)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cellulase C. bescii CelA, a highly active and stable enzyme, exhibits a new cellulose digestion paradigm promoting inter-cellulase synergy. C. bescii CelA, a hydrolytic enzyme with multiple functional domains, may have several advantages over other fungal and bacterial cellulases for use in biofuels production: very high specific activity, stability at elevated tempera- tures, and a novel digestion mechanism. A research team from the U.S. Department of Energy's Bio- Energy Science Center, which

  8. Over-expression of NADH-dependent oxidoreductase (fucO) for increasing furfural or 5-hydroxymethylfurfural tolerance

    DOE Patents [OSTI]

    Miller, Elliot N.; Zhang, Xueli; Yomano, Lorraine P.; Wang, Xuan; Shanmugam, Keelnatham T.; Ingram, Lonnie O'Neal

    2015-10-13

    The subject invention pertains to the discovery that the NADH-dependent propanediol oxidoreductase (FucO) can reduce furfural. This allows for a new approach to improve furfural tolerance in bacterial and/or yeast cells used to produce desired products. Thus, novel biocatalysts (bacterial, fungal or yeast cells) exhibiting increased tolerance to furfural and 5-hydroxymethylfurfural (5-HMF) are provided as are methods of making and using such biocatalysts for the production of a desired product.

  9. Microorganisms having enhanced tolerance to inhibitors and stress

    DOE Patents [OSTI]

    Brown, Steven D.; Yang, Shihui

    2014-07-29

    The present invention provides genetically modified strains of microorganisms that display enhanced tolerance to stress and/or inhibitors such as sodium acetate and vanillin. The enhanced tolerance can be achieved by increasing the expression of a protein of the Sm-like superfamily such as a bacterial Hfq protein and a fungal Sm or Lsm protein. Further, the present invention provides methods of producing alcohol from biomass materials by using the genetically modified microorganisms of the present invention.

  10. Combining Strategies Speeds the Work of Enzymes - News Releases | NREL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Combining Strategies Speeds the Work of Enzymes NREL research finds synergy in two approaches to breaking down cell walls of biomass April 26, 2013 Enzymes could break down cell walls faster - leading to less expensive biofuels for transportation - if two enzyme systems are brought together in an industrial setting, new research by the Energy Department's National Renewable Energy Laboratory suggests. A paper on the breakthrough, "Fungal Cellulases and Complexed Cellulosomal Enzymes Exhibit

  11. LAMP detection assays for boxwood blight pathogens: A comparative genomics approach

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Malapi-Wight, Martha; Demers, Jill E.; Veltri, Daniel; Marra, Robert E.; Crouch, Jo Anne

    2016-05-20

    Rapid and accurate molecular diagnostic tools are critical to efforts to minimize the impact and spread of emergent pathogens. The identification of diagnostic markers for novel pathogens presents several challenges, especially in the absence of information about population diversity and where genetic resources are limited. The objective of this study was to use comparative genomics datasets to find unique target regions suitable for the diagnosis of two fungal species causing a newly emergent blight disease of boxwood. Candidate marker regions for loop-mediated isothermal amplification (LAMP) assays were identified from draft genomes of Calonectria henricotiae and C. pseudonaviculata, as well asmore » three related species not associated with this disease. To increase the probability of identifying unique targets, we used three approaches to mine genome datasets, based on (i) unique regions, (ii) polymorphisms, and (iii) presence/absence of regions across datasets. From a pool of candidate markers, we demonstrate LAMP assay specificity by testing related fungal species, common boxwood pathogens, and environmental samples containing 445 diverse fungal taxa. In conclusion, this comparative-genomics-based approach to the development of LAMP diagnostic assays is the first of its kind for fungi and could be easily applied to diagnostic marker development for other newly emergent plant pathogens.« less

  12. Production and analysis of the biopolymer chitosan from Mucor rouxii. Final report, December 1985-July 1987

    SciTech Connect (OSTI)

    Arcidiacono, S.; Kaplan, D.L.

    1987-11-01

    To determine the potential for the production of chitosan with physiochemical properties from a fungal source, growth studies were conducted using Mucor rouxii. Growth of the organism under a variety of conditions was studied to determine the effects on polymer molecular-weight distributions and biomass production. Modifications of processing protocols were also evaluated to examine the effects of yields of chitosan extracted from the fungal cell wall as well as molecular-weight distribution. This represents the first such study where these factors were correlated to the yield and molecular-weight distribution of chitosan. Of the growth parameters evaluated, length of incubation, culture volume, source of inorganic salt in defined medium, and medium component concentration in complex medium had an effect on biomass and MW distributions. Processing parameters affecting the amount of chitosan extracted were the type and strength of acid and the homogenization of cell wall material prior to refluxing. Overall, weight average molecular weights of chitosan varied up to 8-fold in studies relating to fungal age, while up to 2-fold changes in molecular weight were affected by pH, medium type, and culture vessel size.

  13. Theoretical Investigations on the Formation and Dehydrogenation Reaction Pathways of H(NH2BH2)nH (n=1-4) Oligomers: Importance of Dihydrogen Interactions (DHI)

    SciTech Connect (OSTI)

    Li, Jun; Kathmann, Shawn M.; Hu, Han-Shi; Schenter, Gregory K.; Autrey, Thomas; Gutowski, Maciej S.

    2010-09-06

    The H(NH2BH2)nH oligomers are possible products from dehydrogenation of ammonia borane (NH3BH3) and ammonium borohydride (NH4BH4), which belong to a class of boron-nitrogen-hydrogen (BNHx) compounds that are promising materials for chemical hydrogen storage. Understanding the kinetics and reaction pathways of formation of these oligomers and their further dehydrogenation is essential for developing BNHx-based hydrogen storage materials. We have performed computational modeling using density functional theory (DFT), ab initio wavefunction theory, and Car-Parrinello molecular dynamics (CPMD) simulations on the energetics and formation pathways for the H(NH2BH2)nH (n=1-4) oligomers, polyaminoborane (PAB), from NH3BH3 monomers and the subsequent dehydrogenation steps to form polyiminoborane (PIB). Through transition state searches and evaluation of the intrinsic reaction coordinates, we have investigated the B-N bond cleavage, the reactions of NH3BH3 molecule with intermediates, dihydrogen release through intra- and intermolecular hydrogen transfer, dehydrocoupling/cyclization of the oligomers, and the dimerization of NH3BH3 molecules. We discovered the formation mechanism of H(NH2BH2)n+1H oligomers through reactions of the H(NH2BH2)nH oligomers first with BH3 followed by reactions with NH3 and the release of H2, where the BH3 and NH3 intermediates are formed through dissociation of NH3BH3. We also found that the dimerization of the NH3BH3 molecules to form c-(NH2BH2)2 is slightly exothermic, with an unexpected transition state that leads to the simultaneous release of two H2 molecules. The dehydrogenations of the oligomers are also exothermic, typically by less than 10 kcal/(mol of H2), with the largest exothermicity for n=3. The transition state search shows that the one-step direct dehydrocoupling cyclization of the oligomers is not a favored pathway because of high activation barriers. The dihydrogen bonding, in which protic (HN) hydrogens interact with hydridic

  14. Cyclopentadienyl-bis(oxazoline) magnesium and zirconium complexes in aminoalkene hydroaminations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Eedugurala, Naresh; Hovey, Megan; Ho, Hung -An; Jana, Barun; Lampland, Nicole L.; Ellern, Arkady; Sadow, Aaron D.

    2015-11-25

    Here, a new class of cyclopentadiene-bis(oxazoline) compounds and their piano-stool-type organometallic complexes have been prepared as catalysts for hydroamination of aminoalkenes. The two compounds MeC(OxMe2)2C5H5 (BoMCpH; OxMe2 = 4,4-dimethyl-2-oxazoline) and MeC(OxMe2)2C5Me4H (BoMCptetH) are synthesized from C5R4HI (R = H, Me) and MeC(OxMe2)2Li. These cyclopentadiene-bis(oxazolines) are converted into ligands that support a variety of metal centers in piano-stool-type geometries, and here we report the preparation of Mg, Tl, Ti, and Zr compounds. BoMCpH and BoMCptetH react with MgMe2(O2C4H8)2 to give the magnesium methyl complexes {BoMCp}MgMe and {BoMCptet}MgMe. BoMCpH and BoMCptetH are converted to BoMCpTl and BoMCptetTl by reaction with TlOEt. Themore » thallium derivatives react with TiCl3(THF)3 to provide [{BoMCp}TiCl(μ-Cl)]2 and [{BoMCptet}TiCl(μ-Cl)]2, the former of which is crystallographically characterized as a dimeric species. BoMCpH and Zr(NMe2)4 react to eliminate dimethylamine and afford {BoMCp}Zr(NMe2)3, which is crystallographically characterized as a monomeric four-legged piano-stool compound. {BoMCp}Zr(NMe2)3, {BoMCp}MgMe, and {BoMCptet}MgMe are efficient catalysts for the hydroamination/cyclization of aminoalkenes under mild conditions.« less

  15. Analytical Methodologies for Detection of Gamma-Valerolactone, Delta-Valerolactone, Acephate and Azinphos Methyl and Their Associated Metabolites in Complex Biological Matrices

    SciTech Connect (OSTI)

    Zink, E.; Clark, R.; Grant, K.; Campbell, J.; Hoppe, E.

    2005-01-01

    Non-invasive biomonitoring for chemicals of interest in law enforcement and similar monitoring of pesticides, together with their metabolites, can not only save money but can lead to faster medical attention for individuals exposed to these chemicals. This study describes methods developed for the analysis of gamma-valerolactone (GVL), delta-valerolactone (DVL), acephate, and azinphos methyl in saliva and serum. Liquid chromatography/mass spectrometry (LC/MS) operated in the negative and positive ion mode and gas chromatography/mass spectrometry (GC/MS) were used to analyze GVL and DVL. Although both analytical techniques worked well, lower detection limits were obtained with GC/MS. The lactones and their corresponding sodium salts were spiked into both saliva and serum. The lactones were isolated from saliva or serum using newly developed extraction techniques and then subsequently analyzed using GC/MS. The sodium salts of the lactones are nonvolatile and require derivatization prior to analysis by this method. N-methyl-N-(t-butyldimethylsilyl)-trifluoroacetamide (MTBSTFA) was ultimately selected as the reagent for derivatization because the acidic conditions required for reactions with diazomethane caused the salts to undergo intramolecular cyclization to the corresponding lactones. In vitro studies were conducted using rat liver microsomes to determine other metabolites associated with these compounds. Azinphos methyl and acephate are classified as organophosphate pesticides, and are known to be cholinesterase inhibitors in humans and insects, causing neurotoxicity. For this reason they have both exposure and environmental impact implications. These compounds were spiked into serum and saliva and prepared for analysis by GC/MS. Continuation of this research would include analysis by GC/MS under positive ion mode to determine the parent ions of the unknown metabolites. Further research is planned through an in vivo analysis of the lactones and pesticides. These

  16. An Exocyclic Methylene Group Acts As a Bioisostere of the 2′-Oxygen Atom in LNA

    SciTech Connect (OSTI)

    Seth, Punit P.; Allerson, Charles R.; Berdeja, Andres; Siwkowski, Andrew; Pallan, Pradeep S.; Gaus, Hans; Prakash, Thazha P.; Watt, Andrew T.; Egli, Martin; Swayze, Eric E.

    2010-12-07

    We show for the first time that it is possible to obtain LNA-like (Locked Nucleic Acid 1) binding affinity and biological activity with carbocyclic LNA (cLNA) analogs by replacing the 2{prime}-oxygen atom in LNA with an exocyclic methylene group. Synthesis of the methylene-cLNA nucleoside was accomplished by an intramolecular cyclization reaction between a radical at the 2{prime}-position and a propynyl group at the C-4{prime} position. Only methylene-cLNA modified oligonucleotides showed similar thermal stability and mismatch discrimination properties for complementary nucleic acids as LNA. In contrast, the close structurally related methyl-cLNA analogs showed diminished hybridization properties. Analysis of crystal structures of cLNA modified self-complementary DNA decamer duplexes revealed that the methylene group participates in a tight interaction with a 2{prime}-deoxyribose residue of the 5{prime}-terminal G of a neighboring duplex, resulting in the formation of a CH...O type hydrogen bond. This indicates that the methylene group retains a negative polarization at the edge of the minor groove in the absence of a hydrophilic 2{prime}-substituent and provides a rationale for the superior thermal stability of this modification. In animal experiments, methylene-cLNA antisense oligonucleotides (ASOs) showed similar in vivo activity but reduced toxicity as compared to LNA ASOs. Our work highlights the interchangeable role of oxygen and unsaturated moieties in nucleic acid structure and emphasizes greater use of this bioisostere to improve the properties of nucleic acids for therapeutic and diagnostic applications.

  17. HARNESSING THE CHEMISTRY OF CO2

    SciTech Connect (OSTI)

    Louie, Janis

    2010-05-11

    Our research program is broadly focused on activating CO{sub 2} through the use of organic and organometallic based catalysts. Some of our methods have centered on annulation reactions of unsaturated hydrocarbons (and carbonyl substrates) to provide a diverse array of carbocycles and heterocycles. We use a combination of catalyst discovery and optimization in conjunction with classical physical organic chemistry to elucidate the key mechanistic features of the cycloaddition reactions such that the next big advances in catalyst development can be made. Key to all of our cycloaddition reactions is the use of a sterically hindered, electron donating N heterocyclic carbene (NHC) ligand, namely IPr (or SIPr), in conjunction with a low valent nickel pre-catalyst. The efficacy of this ligand is two-fold: (1) the high {delta}-donating ability of the NHC increases the nucleophilicity of the metal center which thereby facilitates interaction with the electrophilic carbonyl and (2) the steric hindrance prevents an otherwise competitive side reaction involving only the alkyne substrate. Such a system has allowed for the facile cycloaddition to prepare highly functionalized pyrones, pyridones, pyrans, as well as novel carbocycles. Importantly, all reactions proceed under extremely mild conditions (room temperature, atmospheric pressures, and short reaction times), require only catalytic amounts of Ni/NHC and readily available starting materials, and afford annulated products in excellent yields. Our current focus revolves around understanding the fundamental processes that govern these cycloadditions such that the next big advance in the cyclization chemistry of CO{sub 2} can be made. Concurrent to our annulation chemistry is our investigation of the potential for imidazolylidenes to function as thermally-actuated CO{sub 2} sequestering and delivery agents.

  18. SYNTHESIS OF NOVEL CROWN ETHERS BEARING THE exo-cis-2,3-NORBORNYL GROUP AS POTENTIAL Na+ AND K+ EXTRACTANTS

    SciTech Connect (OSTI)

    Robeson, R.M.; Bonnesen, P.

    2007-01-01

    The synthesis of a series of novel dinorbornyl-16-crown-5 and dinorbornyl-18-crown-6 ethers that incorporate the exo-cis-2,3-norbornyl moiety within the macrocycle framework is described. The key starting material for the crown ethers, exo-cis-2,3-norbornanediol, was successfully prepared on a large (>30g) scale in 88% yield from norbornylene by osmium tetroxide-catalyzed hydroxylation. The syn and anti isomers of the dinorbornyl-16-crown-5 ether family were prepared using diethylene glycol with ring closure achieved using a methallyl linkage. The isomers cis-syn-cis and cis-anti-cis di-norbornano-15-methyleno-16-crown-5 (6A and 6B) could be separated using column chromatography, and a single crystal of the syn isomer 6A suitable for X-ray crystal structure analysis was obtained, thereby confi rming the syn orientation. The syn and anti isomers of the dinorbornyl-18-crown-6 ether family were successfully prepared employing a different synthetic strategy, involving the potassium–templated cyclization of two bis-hydroxyethoxy-substituted exo-cis-2,3-norbornyl groups under high dilution conditions. Attempts to fully separate cis-syn-cis di-norbornano-18-crown-6 (10A) and cis-anti-cis di-norbornano-18-crown-6 (10B) from one another using column chromatography were unsuccessful. All intermediates and products were checked for purity using either thin layer chromatography or gas chromatography, and characterized by proton and carbon NMR. Crown ethers 6AB and 10AB are to our knowledge the fi rst crown ethers to incorporate the exo-cis-2,3-norbornyl moiety into the crown ring to be successfully synthesized and characterized.

  19. Biological lignocellulose solubilization: Comparative evaluation of biocatalysts and enhancement via cotreatment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Paye, Julie M. D.; Guseva, Anna; Hammer, Sarah K.; Gjersing, Erica; Davis, Mark F.; Davison, Brian H.; Olstad, Jessica; Donohoe, Bryon S.; Nguyen, Thanh Yen; Wyman, Charles E.; et al

    2016-01-12

    Feedstock recalcitrance is the most important barrier impeding cost-effective production of cellulosic biofuels. Pioneer commercial cellulosic ethanol facilities employ thermochemical pretreatment and addition of fungal cellulase, reflecting the main research emphasis in the field. However, it has been suggested that it may be possible to process cellulosic biomass without thermochemical pretreatment using thermophilic, cellulolytic bacteria. Thus, to further explore this idea, we examine the ability of various biocatalysts to solubilize autoclaved but otherwise unpretreated cellulosic biomass under controlled but not industrial conditions.

  20. Biodegradation of ion-exchange media

    SciTech Connect (OSTI)

    Bowerman, B.S.; Clinton, J.H.; Cowdery, S.R.

    1988-01-01

    The purpose of this study was to investigate further the potential for ion-exchange media (resin beads or powdered filter media) to support biological growth. A mixed microbial culture was grown from resin wastes obtained from the BNL HFBR by mixing the resin with a nutrient salt solution containing peptone and yeast extract. Bacterial and fungal growths appeared in the solution and on the resins after 7 to 10 days incubation at 337)degree)C. The mixed microbial cultures were used to inoculate several resin types, both irradiated and unirradiated. 12 refs., 5 tabs.

  1. Trichoderma: the genomics of opportunistic success

    SciTech Connect (OSTI)

    Druzhinina, Irina S.; Seiboth, Verena Seidl; Estrella, Alfredo Herrera; Horwitz, Benjamin A.; Kenerley, Charles M.; Monte, Enrique; Mukherjee, Prasun K.; Zeilinger, Susanne; Grigoriev, Igor V.; Kubicek, Christian P.

    2011-01-01

    Trichoderma is a genus of common filamentous fungi that display a remarkable range of lifestyles and interactions with other fungi, animals and plants. Because of their ability to antagonize plant-pathogenic fungi and to stimulate plant growth and defence responses, some Trichoderma strains are used for biological control of plant diseases. In this Review, we discuss recent advances in molecular ecology and genomics which indicate that the interactions of Trichoderma spp. with animals and plants may have evolved as a result of saprotrophy on fungal biomass (mycotrophy) and various forms of parasitism on other fungi (mycoparasitism), combined with broad environmental opportunism.

  2. 2012 U.S. Department of Energy: Joint Genome Institute: Progress Report

    SciTech Connect (OSTI)

    Gilbert, David

    2013-01-01

    The mission of the U.S. Department of Energy Joint Genome Institute (DOE JGI) is to serve the diverse scientific community as a user facility, enabling the application of large-scale genomics and analysis of plants, microbes, and communities of microbes to address the DOE mission goals in bioenergy and the environment. The DOE JGI's sequencing efforts fall under the Eukaryote Super Program, which includes the Plant and Fungal Genomics Programs; and the Prokaryote Super Program, which includes the Microbial Genomics and Metagenomics Programs. In 2012, several projects made news for their contributions to energy and environment research.

  3. Methods for recalibration of mass spectrometry data

    DOE Patents [OSTI]

    Tolmachev, Aleksey V.; Smith, Richard D.

    2009-03-03

    Disclosed are methods for recalibrating mass spectrometry data that provide improvement in both mass accuracy and precision by adjusting for experimental variance in parameters that have a substantial impact on mass measurement accuracy. Optimal coefficients are determined using correlated pairs of mass values compiled by matching sets of measured and putative mass values that minimize overall effective mass error and mass error spread. Coefficients are subsequently used to correct mass values for peaks detected in the measured dataset, providing recalibration thereof. Sub-ppm mass measurement accuracy has been demonstrated on a complex fungal proteome after recalibration, providing improved confidence for peptide identifications.

  4. A survey of macromycete diversity at Los Alamos National Laboratory, Bandelier National Monument, and Los Alamos County; A preliminary report

    SciTech Connect (OSTI)

    Jarmie, N.; Rogers, F.J.

    1997-11-01

    The authors have completed a 5-year survey (1991--1995) of macromycetes found in Los Alamos County, Los Alamos National Laboratory, and Bandelier National Monument. The authors have compiled a database of 1,048 collections, their characteristics, and identifications. The database represents 123 (98%) genera and 175 (73%) species reliably identified. Issues of habitat loss, species extinction, and ecological relationships are addressed, and comparisons with other surveys are made. With this baseline information and modeling of this baseline data, one can begin to understand more about the fungal flora of the area.

  5. 2012 MITOCHONDRIA AND CHLOROPLASTS GORDON RESEARCH CONFERENCE & GORDON RESEARCH SEMINAR, JULY 29 - AUGUST 3, 2012

    SciTech Connect (OSTI)

    Barkan, Alice

    2012-08-03

    The 2012 Gordon Research Conference on Mitochondria and Chloroplasts will assemble an international group of scientists investigating fundamental properties of these organelles, and their integration into broader physiological processes. The conference will emphasize the many commonalities between mitochondria and chloroplasts: their evolution from bacterial endosymbionts, their genomes and gene expression systems, their energy transducing membranes whose proteins derive from both nuclear and organellar genes, the challenge of maintaining organelle integrity in the presence of the reactive oxygen species that are generated during energy transduction, their incorporation into organismal signaling pathways, and more. The conference will bring together investigators working in animal, plant, fungal and protozoan systems who specialize in cell biology, genetics, biochemistry, physiology, proteomics, genomics, and structural biology. As such, this conference will provide a unique forum that engenders cross-disciplinary discussions concerning the biogenesis, dynamics, and regulation of these key cellular structures. By fostering interactions among mammalian, fungal and plant organellar biologists, this conference also provides a conduit for the transmission of mechanistic insights obtained in model organisms to applications in medicine and agriculture. The 2012 conference will highlight areas that are moving rapidly and emerging themes. These include new insights into the ultrastructure and organization of the energy transducing membranes, the coupling of organellar gene expression with the assembly of photosynthetic and respiratory complexes, the regulatory networks that couple organelle biogenesis with developmental and physiological signals, the signaling events through which organellar physiology influences nuclear gene expression, and the roles of organelles in disease and development.

  6. Stronger warming effects on microbial abundances in colder regions

    SciTech Connect (OSTI)

    Chen, Ji; Luo, Yiqi; Xia, Jianyang; Jiang, Lifen; Zhou, Xuhui; Lu, Meng; Liang, Junyi; Shi, Zheng; Shelton, Shelby; Cao, Junji

    2015-12-10

    Soil microbes play critical roles in regulating terrestrial carbon (C) cycle and its feedback to climate change. However, it is still unclear how the soil microbial community and abundance respond to future climate change scenarios. In this meta-analysis, we synthesized the responses of microbial community and abundance to experimental warming from 64 published field studies. Our results showed that warming significantly increased soil microbial abundance by 7.6% on average. When grouped by vegetation or soil types, tundras and histosols had the strongest microbial responses to warming with increased microbial, fungal, and bacterial abundances by 15.0%, 9.5% and 37.0% in tundra, and 16.5%, 13.2% and 13.3% in histosols, respectively. We found significant negative relationships of the response ratios of microbial, fungal and bacterial abundances with the mean annual temperature, indicating that warming had stronger effects in colder than warmer regions. Moreover, the response ratios of microbial abundance to warming were positively correlated with those of soil respiration. Our results therefore indicate that the large quantities of C stored in colder regions are likely to be more vulnerable to climate warming than the soil C stored in other warmer regions.

  7. Stronger warming effects on microbial abundances in colder regions

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chen, Ji; Luo, Yiqi; Xia, Jianyang; Jiang, Lifen; Zhou, Xuhui; Lu, Meng; Liang, Junyi; Shi, Zheng; Shelton, Shelby; Cao, Junji

    2015-12-10

    Soil microbes play critical roles in regulating terrestrial carbon (C) cycle and its feedback to climate change. However, it is still unclear how the soil microbial community and abundance respond to future climate change scenarios. In this meta-analysis, we synthesized the responses of microbial community and abundance to experimental warming from 64 published field studies. Our results showed that warming significantly increased soil microbial abundance by 7.6% on average. When grouped by vegetation or soil types, tundras and histosols had the strongest microbial responses to warming with increased microbial, fungal, and bacterial abundances by 15.0%, 9.5% and 37.0% in tundra,more » and 16.5%, 13.2% and 13.3% in histosols, respectively. We found significant negative relationships of the response ratios of microbial, fungal and bacterial abundances with the mean annual temperature, indicating that warming had stronger effects in colder than warmer regions. Moreover, the response ratios of microbial abundance to warming were positively correlated with those of soil respiration. Our results therefore indicate that the large quantities of C stored in colder regions are likely to be more vulnerable to climate warming than the soil C stored in other warmer regions.« less

  8. Influence of corn steep liquor and glucose on colonization of control and CCB (Cu/Cr/B)-treated wood by brown rot fungi

    SciTech Connect (OSTI)

    Humar, Miha; Pohleven, Franc

    2006-07-01

    There are increasing problems with regard to the disposal of treated wood waste. Due to heavy metals or arsenic in impregnated wood waste, burning and landfill disposal options are not considered to be environmentally friendly solutions for dealing with this problem. Extraction of the heavy metals and recycling of the preservatives from the wood waste is a much more promising and environmentally friendly solution. In order to study the scale up of this process, copper/chromium/boron-treated wood specimens were exposed to copper tolerant (Antrodia vaillantii and Leucogyrophana pinastri) and copper sensitive wood decay fungi (Gloeophyllum trabeum and Poria monticola). Afterwards, the ability of fungal hyphae to penetrate and overgrow the wood specimens was investigated. The fungal growths were stimulated by immersing the specimens into aqueous solution of glucose or corn steep liquor prior to exposure to the fungi. The fastest colonization of the impregnated wood was by the copper tolerant A. vaillantii. Addition of glucose onto the surface of the wood specimens increased the fungi colonization of the specimens; however, immersion of the specimens into the solution of corn steep liquor did not have the same positive influence. These results are important in elucidating copper toxicity in wood decay fungi and for using these fungi for bioremediation of treated wood wastes.

  9. Fungi contribute critical but spatially varying roles in nitrogen and carbon cycling in acid mine drainage

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mosier, Annika C.; Miller, Christopher S.; Frischkorn, Kyle R.; Ohm, Robin A.; Li, Zhou; LaButti, Kurt; Lapidus, Alla; Lipzen, Anna; Chen, Cindy; Johnson, Jenifer; et al

    2016-03-03

    The ecosystem roles of fungi have been extensively studied by targeting one organism and/or biological process at a time, but the full metabolic potential of fungi has rarely been captured in an environmental context. We hypothesized that fungal genome sequences could be assembled directly from the environment using metagenomics and that transcriptomics and proteomics could simultaneously reveal metabolic differentiation across habitats. We reconstructed the near-complete 27 Mbp genome of a filamentous fungus, Acidomyces richmondensis, and evaluated transcript and protein expression in floating and streamer biofilms from an acid mine drainage (AMD) system. A. richmondensis transcripts involved in denitrification and inmore » the degradation of complex carbon sources (including cellulose) were up-regulated in floating biofilms, whereas central carbon metabolism and stress-related transcripts were significantly up-regulated in streamer biofilms. Finally, these findings suggest that the biofilm niches are distinguished by distinct carbon and nitrogen resource utilization, oxygen availability, and environmental challenges. An isolated A. richmondensis strain from this environment was used to validate the metagenomics-derived genome and confirm nitrous oxide production at pH 1. Overall, our analyses defined mechanisms of fungal adaptation and identified a functional shift related to different roles in carbon and nitrogen turnover for the same species of fungi growing in closely located but distinct biofilm niches.« less

  10. Understanding Free and Complexed Enzyme Mechanisms and Factors Contributing to Cell Wall Recalcitrance (Presentation)

    SciTech Connect (OSTI)

    Resch, M.; Donohoe, B.; Katahira, R.; Ashutosh, M.; Beckham, G.; Himmel, M.; Decker, S.

    2014-04-01

    Fungal free enzymes and bacterial complexed cellulosomes deconstruct biomass using different physical mechanisms. Free enzymes, which typically contain a large proportion of GH7 cellobiohydrolase, diffuse throughout the substrate and hydrolyze primarily from the cellulose reducing end, resulting in 'sharpened' macrofibrils. In contrast, complexed cellulosomes contain a diverse array of carbohydrate binding modules and multiple catalytic specificities leading to delamination and physical peeling of the cellulose macrofibril structures. To investigate how cellulose structure contributes to recalcitrance, we compared the deconstruction of cellulose I, II, and III; using free and complexed enzyme systems. We also evaluated both systems on Clean Fractionation and alkaline pretreated biomass, which remove much of the lignin, to determine the impact on enzyme loading reduction. Free fungal enzymes demonstrated a swelling of the outer surface of the plant cell walls while removing localized disruptions, resulting in a smooth surface appearance. Cellulosomes produced cell wall surfaces with localized areas of disruption and little surface layer swelling. These studies contribute to the overall understanding of biomass recalcitrance and how combining different enzymatic paradigms may lead to the formulation of new enzyme cocktails to reduce the cost of producing sugars from plant cell wall carbohydrates.

  11. Relationship between the fine structure of native cellulose and cellulose degradability by the cellulase complexes of Trichoderma reesei and Clostridium thermocellum

    SciTech Connect (OSTI)

    Weimer, P.J.; Weston, W.M.

    1985-11-01

    The initial rate of hydrolysis of six commercially available native (type 1) celluloses was determined for the crude cellulase complexes of the thermophilic anaerobic bacterium C. thermocellum and the mesophilic fungus T. reesei. These rates were then compared with certain physical features of the substrates in an attempt to determine the role of cellulose structure in its degradability. Within the substrate series tested, the Clostridium system showed a greater relative range in rate of enzymatic hydrolysis than did the Trichoderma system. Average correlation coefficients for the kinetic rates from bacterial and fungal cellulases, respectively, and the following physical parameters were obtained: relative crystallinity index (RCI) from acid hydrolysis, -0.61 and -0.85; RCI from x-ray diffraction, -0.75 and -0.89; accessibility to formylation at 4 degrees C, +0.49 and +0.60; nonaccessibility to formylation at 65 degrees, -0.40 and - 0.73; fiber saturation point, +0.83 and +0.85. Kinetic and pore volume distribution data suggest that the rate-limiting components of both the bacterial and fungal cellulase systems are of similar size, approximately 43 Angstroms along one axis. 32 references.

  12. An overview of biopulping consortia research

    SciTech Connect (OSTI)

    Akhtar, M.; Lirk, T.K.

    1996-10-01

    This paper provides an overview of a 8-year biopulping research effort conducted under the auspices of two biopulping consortia, involving the Universities of Wisconsin and Minnesota, the Forest Products Laboratory, and the industry. Biopulping, defined as the fungal pretreatment of wood chips for pulping, is an environmentally benign process that saves at least 30% electrical energy during mechanical refining, and improves paper quality in a 2-week period during laboratory trials. A rapid method of evaluating the benefits of biopulping has been found using the Simons staining procedures. We have identified a white-rot fungus Ceriporiopsis subvermispora which is effective on both hardwood and softwood species. This fungus can perform biopulping effectively if chips are steamed using the atmospheric steam for a very short period of time prior to fungal inoculation. Also, one of the major costs during the scale-up of biopulping is inoculum production. To this end, we have reduced the amount of inoculum dramatically (from 3 kg to 0.25 g dry weight of fungus per ton of dry wood) by adding corn steep liquor to the mycelial suspension. Current research is focused on large-scale decontamination of chips and maintenance of suitable temperature, aeration and moisture in chip piles so that biopulping can become a successful industrial process.

  13. Continuous-flow wood chip reactor for biodegradation of 2,4-DCP

    SciTech Connect (OSTI)

    Yum, K.J.; Peirce, J.J.

    1998-02-01

    Chlorinated phenols are by-products of chlorine bleaching in numerous industries including pulp and paper mills and can be emitted from a variety of incineration processes. This research investigates the ability and efficiency of continuous-flow wood chip reactors seeded with a white-rot fungus to degrade 2,4-dichlorophenol (2,4-DCP) using wood chips as a carbon source. When 2,4-DCP was the only substrate (nonglucose treatment conditions), the wood chip reactor system had a high degradation efficiency and operated continuously without excessive fungal biomass buildup on the wood chips. In the presence of added glucose, a clogging problem and an effluent contamination problem of fungal cells are found during the reactor operating period. In addition, 2,4-DCP is degraded effectively both under low-nitrogen as well as high-nitrogen treatment conditions. The 2,4-DCP is degraded to a greater extent with small-size wood chips and hardwood chips as a carbon source. The results of this research demonstrate a potential application of wood chip reactor systems for the treatment of contaminated water while expanding the use of wasted forest products.

  14. Functional chitosan-based grapefruit seed extract composite films for applications in food packaging technology

    SciTech Connect (OSTI)

    Tan, Y.M.; Lim, S.H.; Tay, B.Y.; Lee, M.W.; Thian, E.S.

    2015-09-15

    Highlights: • Chitosan-based grapefruit seed extract (GFSE) films were solution casted. • GFSE was uniformly dispersed within all chitosan film matrices. • All chitosan-based composite films showed remarkable transparency. • Increasing amounts of GFSE incorporated increased the elongation at break of films. • Chitosan-based GFSE composite films inhibited the proliferation of fungal growth. - Abstract: Chitosan-based composite films with different amounts of grapefruit seed extract (GFSE) (0.5, 1.0 and 1.5% v/v) were fabricated via solution casting technique. Experimental results showed that GFSE was uniformly dispersed within all chitosan film matrices. The presence of GFSE made the films more amorphous and tensile strength decreased, while elongation at break values increased as GFSE content increased. Results from the measurement of light transmission revealed that increasing amounts of GFSE (from 0.5 to 1.5% v/v) did not affect transparency of the films. Furthermore, packaging of bread samples with chitosan-based GFSE composite films inhibited the proliferation of fungal growth as compared to control samples. Hence, chitosan-based GFSE composite films have the potential to be a useful material in the area of food technology.

  15. 2010 GORDON RESEARCH CONFERENCE ON MITOCHONDRIA & CHLOROPLASTS, LUCCA, ITALY, JULY 11-16, 2010

    SciTech Connect (OSTI)

    Alice Barkan

    2010-07-16

    The 2010 GRC on Mitochondria & Chloroplasts will assemble an international group of molecular, structural and cellular biologists, biochemists and geneticists investigating a broad spectrum of fundamental problems related to the biology of these organelles in animal, plant and fungal cells. This field has witnessed an extraordinary expansion in recent years, fueled by the discovery of the role of mitochondria in human disease and ageing, and of the synergy of chloroplasts and mitochondria in energetic output, the identification of novel factors involved in organelle division, movement, signaling and acclimation to changing environmental conditions, and by the powerful tools of organelle proteomics. The 2010 GRC will highlight advances in the elucidation of molecular mechanisms of organelle biogenesis including regulation of genome structure, evolution and expression, organellar protein import, assembly and turnover of respiratory and photosynthetic complexes, bidirectional signaling between organelles and nucleus, organelle morphology and dynamics, and the integration of cellular metabolism. We will also explore progress in mechanisms of disease and ageing/ senescence in animals and plants. The organellar field has forged new fronts toward a global and comprehensive understanding of mitochondrial and chloroplast biology at the molecular level. Many of the molecules under study in model organisms are responsible for human diseases, providing significant impetus for a meeting that encourages interactions between mammalian, fungal and plant organellar biologists.

  16. Transcriptional and metabolic flux profiling of triadimefon effects on cultured hepatocytes

    SciTech Connect (OSTI)

    Iyer, Vidya V.; Ovacik, Meric A.; Androulakis, Ioannis P.; Roth, Charles M.; Ierapetritou, Marianthi G.

    2010-11-01

    Conazoles are a class of azole fungicides used to prevent fungal growth in agriculture, for treatment of fungal infections, and are found to be tumorigenic in rats and/or mice. In this study, cultured primary rat hepatocytes were treated to two different concentrations (0.3 and 0.15 mM) of triadimefon, which is a tumorigenic conazole in rat and mouse liver, on a temporal basis with daily media change. Following treatment, cells were harvested for microarray data ranging from 6 to 72 h. Supernatant was collected daily for three days, and the concentrations of various metabolites in the media and supernatant were quantified. Gene expression changes were most significant following exposure to 0.3 mM triadimefon and were characterized mainly by metabolic pathways related to carbohydrate, lipid and amino acid metabolism. Correspondingly, metabolic network flexibility analysis demonstrated a switch from fatty acid synthesis to fatty acid oxidation in cells exposed to triadimefon. It is likely that fatty acid oxidation is active in order to supply energy required for triadimefon detoxification. In 0.15 mM triadimefon treatment, the hepatocytes are able to detoxify the relatively low concentration of triadimefon with less pronounced changes in hepatic metabolism.

  17. Expanding genomics of mycorrhizal symbiosis

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kuo, Alan; Kohler, Annegret; Martin, Francis M.; Grigoriev, Igor V.

    2014-11-04

    The mycorrhizal symbiosis between soil fungi and plant roots is a ubiquitous mutualism that plays key roles in plant nutrition, soil health, and carbon cycling. The symbiosis evolved repeatedly and independently as multiple morphotypes [e.g., arbuscular mycorrhizae (AM), ectomycorrhizal (ECM)] in multiple fungal clades (e.g., phyla Glomeromycota, Ascomycota, Basidiomycota). The accessibility and cultivability of many mycorrhizal partners make them ideal models for symbiosis studies. Alongside molecular, physiological, and ecological investigations, sequencing led to the first three mycorrhizal fungal genomes, representing two morphotypes and three phyla. The genome of the ECM basidiomycete Laccaria bicolor showed that the mycorrhizal lifestyle can evolvemore » through loss of plant cell wall-degrading enzymes (PCWDEs) and expansion of lineage-specific gene families such as short secreted protein (SSP) effectors. The genome of the ECM ascomycete Tuber melanosporum showed that the ECM type can evolve without expansion of families as in Laccaria, and thus a different set of symbiosis genes. The genome of the AM glomeromycete Rhizophagus irregularis showed that despite enormous phylogenetic distance and morphological difference from the other two fungi, symbiosis can involve similar solutions as symbiosis-induced SSPs and loss of PCWDEs. The three genomes provide a solid base for addressing fundamental questions about the nature and role of a vital mutualism.« less

  18. Expanding genomics of mycorrhizal symbiosis

    SciTech Connect (OSTI)

    Kuo, Alan; Kohler, Annegret; Martin, Francis M.; Grigoriev, Igor V.

    2014-11-04

    The mycorrhizal symbiosis between soil fungi and plant roots is a ubiquitous mutualism that plays key roles in plant nutrition, soil health, and carbon cycling. The symbiosis evolved repeatedly and independently as multiple morphotypes [e.g., arbuscular mycorrhizae (AM), ectomycorrhizal (ECM)] in multiple fungal clades (e.g., phyla Glomeromycota, Ascomycota, Basidiomycota). The accessibility and cultivability of many mycorrhizal partners make them ideal models for symbiosis studies. Alongside molecular, physiological, and ecological investigations, sequencing led to the first three mycorrhizal fungal genomes, representing two morphotypes and three phyla. The genome of the ECM basidiomycete Laccaria bicolor showed that the mycorrhizal lifestyle can evolve through loss of plant cell wall-degrading enzymes (PCWDEs) and expansion of lineage-specific gene families such as short secreted protein (SSP) effectors. The genome of the ECM ascomycete Tuber melanosporum showed that the ECM type can evolve without expansion of families as in Laccaria, and thus a different set of symbiosis genes. The genome of the AM glomeromycete Rhizophagus irregularis showed that despite enormous phylogenetic distance and morphological difference from the other two fungi, symbiosis can involve similar solutions as symbiosis-induced SSPs and loss of PCWDEs. The three genomes provide a solid base for addressing fundamental questions about the nature and role of a vital mutualism.

  19. Cyclopentadienyl-bis(oxazoline) magnesium and zirconium complexes in aminoalkene hydroaminations

    SciTech Connect (OSTI)

    Eedugurala, Naresh; Hovey, Megan; Ho, Hung -An; Jana, Barun; Lampland, Nicole L.; Ellern, Arkady; Sadow, Aaron D.

    2015-11-25

    Here, a new class of cyclopentadiene-bis(oxazoline) compounds and their piano-stool-type organometallic complexes have been prepared as catalysts for hydroamination of aminoalkenes. The two compounds MeC(OxMe2)2C5H5 (BoMCpH; OxMe2 = 4,4-dimethyl-2-oxazoline) and MeC(OxMe2)2C5Me4H (BoMCptetH) are synthesized from C5R4HI (R = H, Me) and MeC(OxMe2)2Li. These cyclopentadiene-bis(oxazolines) are converted into ligands that support a variety of metal centers in piano-stool-type geometries, and here we report the preparation of Mg, Tl, Ti, and Zr compounds. BoMCpH and BoMCptetH react with MgMe2(O2C4H8)2 to give the magnesium methyl complexes {BoMCp}MgMe and {BoMCptet}MgMe. BoMCpH and BoMCptetH are converted to BoMCpTl and BoMCptetTl by reaction with TlOEt. The thallium derivatives react with TiCl3(THF)3 to provide [{BoMCp}TiCl(μ-Cl)]2 and [{BoMCptet}TiCl(μ-Cl)]2, the former of which is crystallographically characterized as a dimeric species. BoMCpH and Zr(NMe2)4 react to eliminate dimethylamine and afford {BoMCp}Zr(NMe2)3, which is crystallographically characterized as a monomeric four-legged piano-stool compound. {BoMCp}Zr(NMe2)3, {BoMCp}MgMe, and {BoMCptet}MgMe are efficient catalysts for the hydroamination/cyclization of aminoalkenes under mild conditions.

  20. Novel Aryne Chemistry in Organic Synthesis

    SciTech Connect (OSTI)

    Zhijian Liu

    2006-12-12

    Arynes are among the most intensively studied systems in chemistry. However, many aspects of the chemistry of these reactive intermediates are not well understood yet and their use as reagents in synthetic organic chemistry has been somewhat limited, due to the harsh conditions needed to generate arynes and the often uncontrolled reactivity exhibited by these species. Recently, o-silylaryl triflates, which can generate the corresponding arynes under very mild reaction conditions, have been found very useful in organic synthesis. This thesis describes several novel and useful methodologies by employing arynes, which generate from o-silylaryl triflates, in organic synthesis. An efficient, reliable method for the N-arylation of amines, sulfonamides and carbamates, and the O-arylation of phenols and carboxylic acids is described in Chapter 1. Amines, sulfonamides, phenols, and carboxylic acids are good nucleophiles, which can react with arynes generated from a-silylaryl triflates to afford the corresponding N- and O-arylated products in very high yields. The regioselectivity of unsymmetrical arynes has also been studied. A lot of useful, functional groups can tolerate our reaction conditions. Carbazoles and dibenzofurans are important heteroaromatic compounds, which have a variety of biological activities. A variety of substituted carbazoles and dibenzofwans are readily prepared in good to excellent yields starting with the corresponding o-iodoanilines or o-iodophenols and o-silylaryl triflates by a treatment with CsF, followed by a Pd-catalyzed cyclization, which overall provides a one-pot, two-step process. By using this methodology, the carbazole alkaloid mukonine has been concisely synthesized in a very good yield. Insertion of an aryne into a {sigma}-bond between a nucleophile and an electrophile (Nu-E) should potentially be a very beneficial process from the standpoint of organic synthesis. A variety of substituted ketones and sulfoxides have been synthesized in

  1. Heterotrophic Soil Respiration in Warming Experiments: Using Microbial Indicators to Partition Contributions from Labile and Recalcitrant Soil Organic Carbon. Final Report

    SciTech Connect (OSTI)

    Bradford, M A; Melillo, J M; Reynolds, J F; Treseder, K K; Wallenstein, M D

    2010-06-10

    The central objective of the proposed work was to develop a genomic approach (nucleic acid-based) that elucidates the mechanistic basis for the observed impacts of experimental soil warming on forest soil respiration. The need to understand the mechanistic basis arises from the importance of such information for developing effective adaptation strategies for dealing with projected climate change. Specifically, robust predictions of future climate will permit the tailoring of the most effective adaptation efforts. And one of the greatest uncertainties in current global climate models is whether there will be a net loss of carbon from soils to the atmosphere as climate warms. Given that soils contain approximately 2.5 times as much carbon as the atmosphere, a net loss could lead to runaway climate warming. Indeed, most ecosystem models predict that climate warming will stimulate microbial decomposition of soil carbon, producing such a positive feedback to rising global temperatures. Yet the IPCC highlights the uncertainty regarding this projected feedback. The uncertainty arises because although warming-experiments document an initial increase in the loss of carbon from soils, the increase in respiration is short-lived, declining to control levels in a few years. This attenuation could result from changes in microbial physiology with temperature. We explored possible microbial responses to warming using experiments and modeling. Our work advances our understanding of how soil microbial communities and their activities are structured, generating insight into how soil carbon might respond to warming. We show the importance of resource partitioning in structuring microbial communities. Specifically, we quantified the relative abundance of fungal taxa that proliferated following the addition of organic substrates to soil. We added glycine, sucrose, cellulose, lignin, or tannin-protein to soils in conjunction with 3-bromo-deoxyuridine (BrdU), a nucleotide analog. Active

  2. Antifungal polypeptides

    DOE Patents [OSTI]

    Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2011-04-12

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  3. Antifungal polypeptides

    DOE Patents [OSTI]

    Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, Irina; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2012-04-03

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  4. Antifungal polypeptides

    DOE Patents [OSTI]

    Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

    2007-12-11

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  5. Antifungal polypeptides

    DOE Patents [OSTI]

    Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-08-10

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  6. Compartmentalized microchannel array for high-throughput analysis of single cell polarized growth and dynamics

    SciTech Connect (OSTI)

    Geng, Tao; Bredeweg, Erin L.; Szymanski, Craig J.; Liu, Bingwen; Baker, Scott E.; Orr, Galya; Evans, James E.; Kelly, Ryan T.

    2015-11-04

    Interrogating polarized growth is technologically challenging due to extensive cellular branching and uncontrollable environmental conditions in conventional assays. Here we present a robust and high-performance microfluidic system that enables observations of polarized growth with enhanced temporal and spatial control over prolonged periods. The system has built-in tunability and versatility to accommodate a variety of science applications requiring precisely controlled environments. Using the model filamentous fungus, Neurospora crassa, this microfluidic system enabled direct visualization and analysis of cellular heterogeneity in a clonal fungal cell population, nuclear distribution and dynamics at the subhyphal level, and quantitative dynamics of gene expression with single hyphal compartment resolution in response to carbon source starvation and exchange experiments. Although the microfluidic device is demonstrated on filamentous fungi, our technology is immediately extensible to a wide array of other biosystems that exhibit similar polarized cell growth with applications ranging from bioenergy production to human health.

  7. Compartmentalized microchannel array for high-throughput analysis of single cell polarized growth and dynamics

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Geng, Tao; Bredeweg, Erin L.; Szymanski, Craig J.; Liu, Bingwen; Baker, Scott E.; Orr, Galya; Evans, James E.; Kelly, Ryan T.

    2015-11-04

    Here, interrogating polarized growth is technologically challenging due to extensive cellular branching and uncontrollable environmental conditions in conventional assays. Here we present a robust and high-performance microfluidic system that enables observations of polarized growth with enhanced temporal and spatial control over prolonged periods. The system has built-in tunability and versatility to accommodate a variety of science applications requiring precisely controlled environments. Using the model filamentous fungus, Neurospora crassa, this microfluidic system enabled direct visualization and analysis of cellular heterogeneity in a clonal fungal cell population, nuclear distribution and dynamics at the subhyphal level, and quantitative dynamics of gene expression withmore » single hyphal compartment resolution in response to carbon source starvation and exchange experiments. Although the microfluidic device is demonstrated on filamentous fungi, our technology is immediately extensible to a wide array of other biosystems that exhibit similar polarized cell growth with applications ranging from bioenergy production to human health.« less

  8. Development of a commercial enzymes system for lignocellulosic biomass saccharification

    SciTech Connect (OSTI)

    Kumar, Manoj

    2012-12-20

    DSM Innovation Inc., in its four year effort was able to evaluate and develop its in-house DSM fungal cellulolytic enzymes system to reach enzyme efficiency mandates set by DoE Biomass program MYPP goals. DSM enzyme cocktail is uniquely active at high temperature and acidic pH, offering many benefits and product differentiation in 2G bioethanol production. Under this project, strain and process development, ratio optimization of enzymes, protein and genetic engineering has led to multitudes of improvement in productivity and efficiency making development of a commercial enzyme system for lignocellulosic biomass saccharification viable. DSM is continuing further improvement by additional biodiversity screening, protein engineering and overexpression of enzymes to continue to further lower the cost of enzymes for saccharification of biomass.

  9. Biological pretreatment for thermomechanical (TMP) and chemithermomechanical (CTMP) pulping processes

    SciTech Connect (OSTI)

    Myers, G.C.; Akhtar, M.; Lentz, M.

    1996-10-01

    Treatment of wood chips with lignin-degrading fungi prior to preparing a refiner mechanical pulp (RMP) has substantially reduced energy consumption and increased paper strength properties. This study reports on thermomechanical (TMP) and chemithermo-mechanical pulping (CTMP) of fungus treated wood chips. Loblolly pine chips were innoculated with Ceriporiopsis subvermispora, strain L14807 SS-3, and incubated two weeks in a chip silo. A pressurized 305 mm diameter disk refiner was used to prepare TMP and CTMP`s from fungal treated and non-treated wood chips. Two procedures were used to prepare the CTMP`s, injecting a sodium hydroxide and hydrogen peroxide solution into the pressurized refiner, and impregnating the wood chips with a sodium sulfite solution. Energy consumption during pulp preparation and handsheet strength and optical properties will be presented and discussed.

  10. Mechanism-Based Tuning of a LOV Domain Photoreceptor

    SciTech Connect (OSTI)

    Zoltowski, B.; Vaccaro, B; Crane, B

    2009-01-01

    Phototropin-like LOV domains form a cysteinyl-flavin adduct in response to blue light but show considerable variation in output signal and the lifetime of the photo-adduct signaling state. Mechanistic studies of the slow-cycling fungal LOV photoreceptor Vivid (VVD) reveal the importance of reactive cysteine conformation, flavin electronic environment and solvent accessibility for adduct scission and thermal reversion. Proton inventory, pH effects, base catalysis and structural studies implicate flavin N5 deprotonation as rate-determining for recovery. Substitutions of active site residues Ile74, Ile85, Met135 and Met165 alter photoadduct lifetimes by over four orders of magnitude in VVD, and similar changes in other LOV proteins show analogous effects. Adduct state decay rates also correlate with changes in conformational and oligomeric properties of the protein necessary for signaling. These findings link natural sequence variation of LOV domains to function and provide a means to design broadly reactive light-sensitive probes.

  11. Status report on a solar photovoltaic concentrating energy system for a hospital in Hawaii

    SciTech Connect (OSTI)

    Seki, A.; Curtis, G.; Yuen, P.

    1983-06-01

    The largest parabolic concentrating photovoltaic/solar thermal system in the U.S. began producing electricity and hot water for a hospital on the island of Kauai, Hawaii in November 1981. Each of the 80 parabolic collectors is 6 feet by 10 feet and concentrates incident sunlight on photovoltaic cells mounted on two faces of the receiver at the focus. Although the 35 kilowatt system has been designed to produce 22,000 net kilowatt-hours per year of electricity and 620,000 gallons of 180 F water, electrical output (12 to 15 kilowatt-hours per day) is only 20 percent of that expected, primarily because insolation at the site has been only 40 percent of predicted values. A second problem with fungal attack on the receivers has been solved by better sealing. The system has also withstood a hurricane with negligible damage.

  12. Compartmentalized microchannel array for high-throughput analysis of single cell polarized growth and dynamics

    SciTech Connect (OSTI)

    Geng, Tao; Bredeweg, Erin L.; Szymanski, Craig J.; Liu, Bingwen; Baker, Scott E.; Orr, Galya; Evans, James E.; Kelly, Ryan T.

    2015-11-04

    Here, interrogating polarized growth is technologically challenging due to extensive cellular branching and uncontrollable environmental conditions in conventional assays. Here we present a robust and high-performance microfluidic system that enables observations of polarized growth with enhanced temporal and spatial control over prolonged periods. The system has built-in tunability and versatility to accommodate a variety of science applications requiring precisely controlled environments. Using the model filamentous fungus, Neurospora crassa, this microfluidic system enabled direct visualization and analysis of cellular heterogeneity in a clonal fungal cell population, nuclear distribution and dynamics at the subhyphal level, and quantitative dynamics of gene expression with single hyphal compartment resolution in response to carbon source starvation and exchange experiments. Although the microfluidic device is demonstrated on filamentous fungi, our technology is immediately extensible to a wide array of other biosystems that exhibit similar polarized cell growth with applications ranging from bioenergy production to human health.

  13. The plant cell wall decomposing machinery underlies the functional diversity of forest fungi

    SciTech Connect (OSTI)

    Eastwood, Daniel C.; Floudas, Dimitrios; Binder, Manfred; Majcherczyk, Andrzej; Schneider, Patrick; Aerts, Andrea; Asiegbu, Fred O.; Baker, Scott E.; Barry, Kerrie; Bendiksby, Mika; Blumentritt, Melanie; Coutinho, Pedro M.; Cullen, Dan; Vries, Ronald P. de; Gathman, Allen; Goodell, Barry; Henrissat, Bernard; Ihrmark, Katarina; Kauserud, Hä; vard,; Kohler, Annegret; LaButti, Kurt; Lapidus, Alla; Lavin, José; L.; Lee, Yong-Hwan; Lindquist, Erika; Lilly, Walt; Lucas, Susan; Morin, Emmanuelle; Murat, Claude; Oguiza, José; A.; Park, Jongsun; Pisabarro, Antonio G.; Riley, Robert; Rosling, Anna; Salamov, Asaf; Schmidt, Olaf; Schmutz, Jeremy; Skrede, Inger; Stenlid, Jan; Wiebenga, Ad; Xie, Xinfeng; Kü; es, Ursula; Hibbett, David S.; Hoffmeister, Dirk; Hö; gberg, Nils; Martin, Francis; Grigoriev, Igor V.; Watkinson, Sarah C.

    2011-05-01

    Brown rot decay removes cellulose and hemicellulose from wood?residual lignin contributing up to 30percent of forest soil carbon?and is derived from an ancestral white rot saprotrophy in which both lignin and cellulose are decomposed. Comparative and functional genomics of the ?dry rot? fungus Serpula lacrymans, derived from forest ancestors, demonstrated that the evolution of both ectomycorrhizal biotrophy and brown rot saprotrophy were accompanied by reductions and losses in specific protein families, suggesting adaptation to an intercellular interaction with plant tissue. Transcriptome and proteome analysis also identified differences in wood decomposition in S. lacrymans relative to the brown rot Postia placenta. Furthermore, fungal nutritional mode diversification suggests that the boreal forest biome originated via genetic coevolution of above- and below-ground biota

  14. Comparative analysis of secretomes from Ectomycorrhizal fungi with an emphasis on small-secreted proteins

    SciTech Connect (OSTI)

    Pellegrin, Clement; Morin, Emmanuelle; Martin, Francis M.; Veneault-Fourrey, Claire

    2015-11-18

    Fungi are major players in the carbon cycle in forest ecosystems due to the wide range of interactions they have with plants either through soil degradation processes by litter decayers or biotrophic interactions with pathogenic and ectomycorrhizal symbionts. Secretion of fungal proteins mediates these interactions by allowing the fungus to interact with its environment and/or host. Ectomycorrhizal (ECM) symbiosis independently appeared several times throughout evolution and involves approximately 80% of trees. Despite extensive physiological studies on ECM symbionts, little is known about the composition and specificities of their secretomes. In this study, we used a bioinformatics pipeline to predict and analyze the secretomes of 49 fungal species, including 11 ECM fungi, wood and soil decayers and pathogenic fungi to tackle the following questions: (1) Are there differences between the secretomes of saprophytic and ECM fungi? (2) Are small-secreted proteins (SSPs) more abundant in biotrophic fungi than in saprophytic fungi? and (3) Are there SSPs shared between ECM, saprotrophic and pathogenic fungi? We showed that the number of predicted secreted proteins is similar in the surveyed species, independently of their lifestyle. The secretome from ECM fungi is characterized by a restricted number of secreted CAZymes, but their repertoires of secreted proteases and lipases are similar to those of saprotrophic fungi. Focusing on SSPs, we showed that the secretome of ECM fungi is enriched in SSPs compared with other species. Most of the SSPs are coded by orphan genes with no known PFAM domain or similarities to known sequences in databases. Finally, based on the clustering analysis, we identified shared- and lifestyle-specific SSPs between saprotrophic and ECM fungi. The presence of SSPs is not limited to fungi interacting with living plants as the genome of saprotrophic fungi also code for numerous SSPs. As a result, ECM fungi shared lifestyle-specific SSPs likely

  15. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    SciTech Connect (OSTI)

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-10-16

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. Here, we explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. In conclusion, taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs.

  16. Comparative analysis of secretomes from Ectomycorrhizal fungi with an emphasis on small-secreted proteins

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pellegrin, Clement; Morin, Emmanuelle; Martin, Francis M.; Veneault-Fourrey, Claire

    2015-11-18

    Fungi are major players in the carbon cycle in forest ecosystems due to the wide range of interactions they have with plants either through soil degradation processes by litter decayers or biotrophic interactions with pathogenic and ectomycorrhizal symbionts. Secretion of fungal proteins mediates these interactions by allowing the fungus to interact with its environment and/or host. Ectomycorrhizal (ECM) symbiosis independently appeared several times throughout evolution and involves approximately 80% of trees. Despite extensive physiological studies on ECM symbionts, little is known about the composition and specificities of their secretomes. In this study, we used a bioinformatics pipeline to predict andmore » analyze the secretomes of 49 fungal species, including 11 ECM fungi, wood and soil decayers and pathogenic fungi to tackle the following questions: (1) Are there differences between the secretomes of saprophytic and ECM fungi? (2) Are small-secreted proteins (SSPs) more abundant in biotrophic fungi than in saprophytic fungi? and (3) Are there SSPs shared between ECM, saprotrophic and pathogenic fungi? We showed that the number of predicted secreted proteins is similar in the surveyed species, independently of their lifestyle. The secretome from ECM fungi is characterized by a restricted number of secreted CAZymes, but their repertoires of secreted proteases and lipases are similar to those of saprotrophic fungi. Focusing on SSPs, we showed that the secretome of ECM fungi is enriched in SSPs compared with other species. Most of the SSPs are coded by orphan genes with no known PFAM domain or similarities to known sequences in databases. Finally, based on the clustering analysis, we identified shared- and lifestyle-specific SSPs between saprotrophic and ECM fungi. The presence of SSPs is not limited to fungi interacting with living plants as the genome of saprotrophic fungi also code for numerous SSPs. As a result, ECM fungi shared lifestyle-specific SSPs

  17. Isolation of a significant fraction of non-phototroph diversity from a desert Biological Soil Crust

    SciTech Connect (OSTI)

    Nunes da Rocha, Ulisses; Cadillo-Quiroz, Hinsby; Karaoz, Ulas; Rajeev, Lara; Klitgord, Niels; Dunn, Sean; Truong, Viet; Buenrostro, Mayra; Bowen, Benjamin P.; Garcia-Pichel, Ferran; Mukhopadhyay, Aindrila; Northen, Trent R.; Brodie, Eoin L.

    2015-04-14

    Biological Soil Crusts (BSCs) are organosedimentary assemblages comprised of microbes and minerals in topsoil of terrestrial environments. BSCs strongly impact soil quality in dryland ecosystems (e.g., soil structure and nutrient yields) due to pioneer species such as Microcoleus vaginatus; phototrophs that produce filaments that bind the soil together, and support an array of heterotrophic microorganisms. These microorganisms in turn contribute to soil stability and biogeochemistry of BSCs. Non-cyanobacterial populations of BSCs are less well known than cyanobacterial populations. Therefore, we attempted to isolate a broad range of numerically significant and phylogenetically representative BSC aerobic heterotrophs. Combining simple pre-treatments (hydration of BSCs under dark and light) and isolation strategies (media with varying nutrient availability and protection from oxidative stress) we recovered 402 bacterial and one fungal isolate in axenic culture, which comprised 116 phylotypes (at 97% 16S rRNA gene sequence homology), 115 bacterial and one fungal. Each medium enriched a mostly distinct subset of phylotypes, and cultivated phylotypes varied due to the BSC pre-treatment. The fraction of the total phylotype diversity isolated, weighted by relative abundance in the community, was determined by the overlap between isolate sequences and OTUs reconstructed from metagenome or metatranscriptome reads. Together, more than 8% of relative abundance of OTUs in the metagenome was represented by our isolates, a cultivation efficiency much larger than typically expected from most soils. We conclude that simple cultivation procedures combined with specific pre-treatment of samples afford a significant reduction in the culturability gap, enabling physiological and metabolic assays that rely on ecologically relevant axenic cultures.

  18. Challenges in Whole-Genome Annotation of Pyrosequenced Eukaryotic Genomes

    SciTech Connect (OSTI)

    Kuo, Alan; Grigoriev, Igor

    2009-04-17

    Pyrosequencing technologies such as 454/Roche and Solexa/Illumina vastly lower the cost of nucleotide sequencing compared to the traditional Sanger method, and thus promise to greatly expand the number of sequenced eukaryotic genomes. However, the new technologies also bring new challenges such as shorter reads and new kinds and higher rates of sequencing errors, which complicate genome assembly and gene prediction. At JGI we are deploying 454 technology for the sequencing and assembly of ever-larger eukaryotic genomes. Here we describe our first whole-genome annotation of a purely 454-sequenced fungal genome that is larger than a yeast (>30 Mbp). The pezizomycotine (filamentous ascomycote) Aspergillus carbonarius belongs to the Aspergillus section Nigri species complex, members of which are significant as platforms for bioenergy and bioindustrial technology, as members of soil microbial communities and players in the global carbon cycle, and as agricultural toxigens. Application of a modified version of the standard JGI Annotation Pipeline has so far predicted ~;;10k genes. ~;;12percent of these preliminary annotations suffer a potential frameshift error, which is somewhat higher than the ~;;9percent rate in the Sanger-sequenced and conventionally assembled and annotated genome of fellow Aspergillus section Nigri member A. niger. Also,>90percent of A. niger genes have potential homologs in the A. carbonarius preliminary annotation. Weconclude, and with further annotation and comparative analysis expect to confirm, that 454 sequencing strategies provide a promising substrate for annotation of modestly sized eukaryotic genomes. We will also present results of annotation of a number of other pyrosequenced fungal genomes of bioenergy interest.

  19. Isolation of a significant fraction of non-phototroph diversity from a desert Biological Soil Crust

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Nunes da Rocha, Ulisses; Cadillo-Quiroz, Hinsby; Karaoz, Ulas; Rajeev, Lara; Klitgord, Niels; Dunn, Sean; Truong, Viet; Buenrostro, Mayra; Bowen, Benjamin P.; Garcia-Pichel, Ferran; et al

    2015-04-14

    Biological Soil Crusts (BSCs) are organosedimentary assemblages comprised of microbes and minerals in topsoil of terrestrial environments. BSCs strongly impact soil quality in dryland ecosystems (e.g., soil structure and nutrient yields) due to pioneer species such as Microcoleus vaginatus; phototrophs that produce filaments that bind the soil together, and support an array of heterotrophic microorganisms. These microorganisms in turn contribute to soil stability and biogeochemistry of BSCs. Non-cyanobacterial populations of BSCs are less well known than cyanobacterial populations. Therefore, we attempted to isolate a broad range of numerically significant and phylogenetically representative BSC aerobic heterotrophs. Combining simple pre-treatments (hydration ofmore » BSCs under dark and light) and isolation strategies (media with varying nutrient availability and protection from oxidative stress) we recovered 402 bacterial and one fungal isolate in axenic culture, which comprised 116 phylotypes (at 97% 16S rRNA gene sequence homology), 115 bacterial and one fungal. Each medium enriched a mostly distinct subset of phylotypes, and cultivated phylotypes varied due to the BSC pre-treatment. The fraction of the total phylotype diversity isolated, weighted by relative abundance in the community, was determined by the overlap between isolate sequences and OTUs reconstructed from metagenome or metatranscriptome reads. Together, more than 8% of relative abundance of OTUs in the metagenome was represented by our isolates, a cultivation efficiency much larger than typically expected from most soils. We conclude that simple cultivation procedures combined with specific pre-treatment of samples afford a significant reduction in the culturability gap, enabling physiological and metabolic assays that rely on ecologically relevant axenic cultures.« less

  20. Genome analysis of Daldinia eschscholtzii strains UM 1400 and UM 1020, wood-decaying fungi isolated from human hosts

    SciTech Connect (OSTI)

    Chan, Chai Ling; Yew, Su Mei; Ngeow, Yun Fong; Na, Shiang Ling; Lee, Kok Wei; Hoh, Chee-Choong; Yee, Wai-Yan; Ng, Kee Peng

    2015-11-18

    Background: Daldinia eschscholtzii is a wood-inhabiting fungus that causes wood decay under certain conditions. It has a broad host range and produces a large repertoire of potentially bioactive compounds. However, there is no extensive genome analysis on this fungal species. Results: Two fungal isolates (UM 1400 and UM 1020) from human specimens were identified as Daldinia eschscholtzii by morphological features and ITS-based phylogenetic analysis. Both genomes were similar in size with 10,822 predicted genes in UM 1400 (35.8 Mb) and 11,120 predicted genes in UM 1020 (35.5 Mb). A total of 751 gene families were shared among both UM isolates, including gene families associated with fungus-host interactions. In the CAZyme comparative analysis, both genomes were found to contain arrays of CAZyme related to plant cell wall degradation. Genes encoding secreted peptidases were found in the genomes, which encode for the peptidases involved in the degradation of structural proteins in plant cell wall. In addition, arrays of secondary metabolite backbone genes were identified in both genomes, indicating of their potential to produce bioactive secondary metabolites. Both genomes also contained an abundance of gene encoding signaling components, with three proposed MAPK cascades involved in cell wall integrity, osmoregulation, and mating/filamentation. Besides genomic evidence for degrading capability, both isolates also harbored an array of genes encoding stress response proteins that are potentially significant for adaptation to living in the hostile environments. In conclusion: Our genomic studies provide further information for the biological understanding of the D. eschscholtzii and suggest that these wood-decaying fungi are also equipped for adaptation to adverse environments in the human host.

  1. Genome analysis of Daldinia eschscholtzii strains UM 1400 and UM 1020, wood-decaying fungi isolated from human hosts

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chan, Chai Ling; Yew, Su Mei; Ngeow, Yun Fong; Na, Shiang Ling; Lee, Kok Wei; Hoh, Chee-Choong; Yee, Wai-Yan; Ng, Kee Peng

    2015-11-18

    Background: Daldinia eschscholtzii is a wood-inhabiting fungus that causes wood decay under certain conditions. It has a broad host range and produces a large repertoire of potentially bioactive compounds. However, there is no extensive genome analysis on this fungal species. Results: Two fungal isolates (UM 1400 and UM 1020) from human specimens were identified as Daldinia eschscholtzii by morphological features and ITS-based phylogenetic analysis. Both genomes were similar in size with 10,822 predicted genes in UM 1400 (35.8 Mb) and 11,120 predicted genes in UM 1020 (35.5 Mb). A total of 751 gene families were shared among both UM isolates,more » including gene families associated with fungus-host interactions. In the CAZyme comparative analysis, both genomes were found to contain arrays of CAZyme related to plant cell wall degradation. Genes encoding secreted peptidases were found in the genomes, which encode for the peptidases involved in the degradation of structural proteins in plant cell wall. In addition, arrays of secondary metabolite backbone genes were identified in both genomes, indicating of their potential to produce bioactive secondary metabolites. Both genomes also contained an abundance of gene encoding signaling components, with three proposed MAPK cascades involved in cell wall integrity, osmoregulation, and mating/filamentation. Besides genomic evidence for degrading capability, both isolates also harbored an array of genes encoding stress response proteins that are potentially significant for adaptation to living in the hostile environments. In conclusion: Our genomic studies provide further information for the biological understanding of the D. eschscholtzii and suggest that these wood-decaying fungi are also equipped for adaptation to adverse environments in the human host.« less

  2. Accumulation of several heavy metals and lanthanides in mushrooms (Agaricales) from the Chicago region.

    SciTech Connect (OSTI)

    Aruguete, D. M.; Aldstadt, J. H., III; Mueller, G. M.; Environmental Research; Univ. of Chicago; Field Museum of Natural History

    1998-01-01

    This study explored the differences in metal uptake in sporocarps of ectomycorrhizae-forming fungi relative to (1) fungal species; (2) collection location; (3) differential metal uptake and variation within single-species, single-area populations; and (4) mobile metal content of soil substrate for the fungi. In addition, this study examined levels of some of the lanthanides in these mushrooms, as lanthanide uptake in higher fungi has not been quantified to date. In 1995 and 1996, sporocarps from three species of ectomycorrhizal fungi (Amanita flavorubescens, Amanita rubescens, and Russula pectinatoides) were collected from Cowles Bog, Indiana Dunes National Lakeshore (near an industrial area) and the Palos forest preserves (near a residential area). Soil was also collected from the Cowles Bog plots; metals were extracted from the soil, either with local Lake Michigan water or with nitric acid. These two extractions were meant to simulate the natural soil equilibrium concentrations of soluble metals and the maximum possible effects of any fungal chelating chemicals, respectively. An inductively coupled plasma mass spectrometer was used to analyze soil extracts and nitric acid digests of whole sporocarps for the target analytes. The metals found at elevated levels in the mushrooms included four of environmental interest (Ag, Cd, Ba, and Pb) and three lanthanides (La, Ce, and Nd). Significant differences in uptake of metals were observed between A. rubescens and R. pectinatoides, while A. rubescens and A. flavorubescens were not significantly different. With regard to location, more cadmium was found in Cowles Bog collections of A. rubescens, while Palos forest A. rubescens had more of the lanthanides and barium. Significant specimen-to-specimen variation occurred in all populations examined. Correlation analysis between pairs of trace elements within each sporocarp population revealed strong positive correlations between the lanthanides. Sporocarps concentrated more

  3. IDENTIFICATION, PRODUCTION AND CHARACTERIZATION OF NOVEL LIGNASE PROTEINS FROM TERMITES FOR DEPOLYMERIZATION OF LIGNOCELLULOSE

    SciTech Connect (OSTI)

    SLACK, JEFFREY, M.

    2012-12-06

    significantly reducing proteases and preventing blackening immune reactions that occur when caterpillars are homogenized. Proteases may degrade enzymes and immune reaction blackening may inactivate enzymes thus compromising the ability of these crude recombinant expressed termite enzyme preparations to release sugars. Commercial preparations of fungal enzymes currently are used to digest wood for ethanol production. We demonstrated in this study that termite enzymes could improve the efficiency of fungal enzyme cocktails. Although the economic feasibility of using caterpillar expressed termite enzymes alone to treat wood was not proven, this work points to the potential to combine C-PERLXpressed insect enzymes with industrial enzyme cocktails to boost their efficiency at treating wood for biofuels.

  4. Neutron Reflectometry and QCM-D Study of the Interaction of Cellulase Enzymes with Films of Amorphous Cellulose

    SciTech Connect (OSTI)

    Halbert, Candice E; Ankner, John Francis; Kent, Michael S; Jaclyn, Murton K; Browning, Jim; Cheng, Gang; Liu, Zelin; Majewski, Jaroslaw; Supratim, Datta; Michael, Jablin; Bulent, Akgun; Alan, Esker; Simmons, Blake

    2011-01-01

    Improving the efficiency of enzymatic hydrolysis of cellulose is one of the key technological hurdles to reduce the cost of producing ethanol and other transportation fuels from lignocellulosic material. A better understanding of how soluble enzymes interact with insoluble cellulose will aid in the design of more efficient enzyme systems. We report a study involving neutron reflectometry (NR) and quartz crystal microbalance with dissipation (QCM-D) of the interaction of a commercial fungal enzyme extract (T. viride), two purified endoglucanses from thermophilic bacteria (Cel9A from A. acidocaldarius and Cel5A from T. maritima), and a mesophilic fungal endoglucanase (Cel45A from H. insolens) with amorphous cellulose films. The use of amorphous cellulose is motivated by the promise of ionic liquid pretreatment as a second generation technology that disrupts the native crystalline structure of cellulose. NR reveals the profile of water through the film at nm resolution, while QCM-D provides changes in mass and film stiffness. At 20 oC and 0.3 mg/ml, the T. viride cocktail rapidly digested the entire film, beginning from the surface followed by activity throughout the bulk of the film. For similar conditions, Cel9A and Cel5A were active for only a short period of time and only at the surface of the film, with Cel9A releasing 40 from the ~ 700 film and Cel5A resulting in only a slight roughening/swelling effect at the surface. Subsequent elevation of the temperature to the Topt in each case resulted in a very limited increase in activity, corresponding to the loss of an additional 60 from the film for Cel9A and 20 from the film for Cel5A, and very weak penetration into and digestion within the bulk of the film, before the activity again ceased. The results for Cel9A and Cel5A contrast sharply with results for Cel45A where very rapid and extensive penetration and digestion within the bulk of the film was observed at 20 C. We speculate that the large differences are due

  5. Underground and earth sheltered food storage: historical, geographic, and economic considerations

    SciTech Connect (OSTI)

    Dunkel, F.V.

    1985-01-01

    Storage structures now used for bulk grain and beans have been derived from a combination of scientific experiments and tradition. Recent generations of US farmers have grown up with the understanding that grain is best stored in round metal bins or wooden cribs aboveground. It is generally thought that natural wind movements in the crib structures and forced air flow from aeration fans in metal bins will keep grain and beans safe, i.e., free of moisture accumulation and the resulting insect and fungal growth, and protected from germination, all of which deteriorate the commodity. North American farmers further believe that the low temperature of northern winters combined with careful use of aerating fans will keep the grain dry or beans safe (less than 14% moisture content) for years of storage. Traditional forms of grain and bean storage in other parts of the world have evolved differently. With the exception of North America, the people of every continent in the world have developed underground structures for long-term storage of food. A review of the varieties of underground structures that have evolved throughout the world, and research related to underground storage of grain and beans is presented.

  6. Community dynamics and glycoside hydrolase activities of thermophilic bacterial consortia adapted to switchgrass

    SciTech Connect (OSTI)

    Gladden, J.M.; Allgaier, M.; Miller, C.S.; Hazen, T.C.; VanderGheynst, J.S.; Hugenholtz, P.; Simmons, B.A.; Singer, S.W.

    2011-05-01

    Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60 C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80 C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.

  7. Improvements In Ethanologenic Escherichia Coli and Klebsiella Oxytoca

    SciTech Connect (OSTI)

    Dr. David Nunn

    2010-09-30

    The current Verenium cellulosic ethanol process is based on the dilute-acid pretreatment of a biomass feedstock, followed by a two-stage fermentation of the pentose sugar-containing hydrolysate by a genetically modified ethanologenic Escherichia coli strain and a separate simultaneous saccharification-fermentation (SSF) of the cellulosic fraction by a genetically modified ethanologenic Klebsiella oxytoca strain and a fungal enzyme cocktail. In order to reduce unit operations and produce a fermentation beer with higher ethanol concentrations to reduce distillation costs, we have proposed to develop a simultaneous saccharification co-fermentation (SScF) process, where the fermentation of the pentose-containing hydrolysate and cellulosic fraction occurs within the same fermentation vessel. In order to accomplish this goal, improvements in the ethanologens must be made to address a number of issues that arise, including improved hydrolysate tolerance, co-fermentation of the pentose and hexose sugars and increased ethanol tolerance. Using a variety of approaches, including transcriptomics, strain adaptation, metagenomics and directed evolution, this work describes the efforts of a team of scientists from Verenium, University of Florida, Massachusetts Institute of Technology and Genomatica to improve the E. coli and K. oxytoca ethanologens to meet these requirements.

  8. Expression of the Acidothermus cellulolyticus E1 endoglucanase in Caldicellulosiruptor bescii enhances its ability to deconstruct crystalline cellulose

    SciTech Connect (OSTI)

    Chung, Daehwan; Young, Jenna; Cha, Minseok; Brunecky, Roman; Bomble, Yannick J.; Himmel, Michael E.; Westpheling, Janet

    2015-08-13

    The Caldicellulosiruptor bescii genome encodes a potent set of carbohydrate-active enzymes (CAZymes), found primarily as multi-domain enzymes that exhibit high cellulolytic and hemicellulolytic activity on and allow utilization of a broad range of substrates, including plant biomass without conventional pretreatment. CelA, the most abundant cellulase in the C. bescii secretome, uniquely combines a GH9 endoglucanase and a GH48 exoglucanase in one protein. The most effective commercial enzyme cocktails used in vitro to pretreat biomass are derived from fungal cellulases (cellobiohydrolases, endoglucanases and a β-d-glucosidases) that act synergistically to release sugars for microbial conversion. The C. bescii genome contains six GH5 domains in five different open reading frames. Four exist in multi-domain proteins and two as single catalytic domains. E1 is a GH5 endoglucanase reported to have high specific activity and simple architecture and is active at the growth temperature of C. bescii. E1 is an endo-1,4-β-glucanase linked to a family 2 carbohydrate-binding module shown to bind primarily to cellulosic substrates. As a result, we tested if the addition of this protein to the C. bescii secretome would improve its cellulolytic activity.

  9. Morphological changes of Ganoderma boninense mycelia after challenged by Trichoderma and Bacillus

    SciTech Connect (OSTI)

    Alexander, Arnnyitte; Chong, Khim-Phin; Dayou, Jedol

    2015-07-22

    Ganoderma boninense is a fungal pathogen that causes Basal Stem Rot (BSR) disease in oil palm. This deadly disease has caused major losses in the oil palm industry and no remedy is reported to date. The more promising control on G. boninense is the use of biological control agents (BCAs). Despite many attempts in using BCAs as a control agent but evidence on the colonization of BCAs and morphological changes of the pathogen is not well documented. We have investigated the effect of antagonist activity on the combination of Trichoderma spp. and Bacillus spp. on the morphology of G. boninense. The antagonist activity was evaluated using agar well diffusion assay. BCAs suppressed the mycelia growth of G. boninense up to 70%. Observation under Scanning Electron Microscopy (SEM) shows these BCAs induced stripping of G. boninense hyphal structure by destroying the cellular structure. Highly disrupted, disaggerated, shrivelled and lysis of G. boninense hyphal were also observed. The antifungal activity of Trichoderma spp. and Bacillus spp. observed could be associated with the production of Cell Wall Degrading Enzymes (CWDE)

  10. Interspecific Comparison and annotation of two complete mitochondrial genome sequences from the plant pathogenic fungus Mycosphaerella graminicola

    SciTech Connect (OSTI)

    Millenbaugh, Bonnie A; Pangilinan, Jasmyn L.; Torriani, Stefano F.F.; Goodwin, Stephen B.; Kema, Gert H.J.; McDonald, Bruce A.

    2007-12-07

    The mitochondrial genomes of two isolates of the wheat pathogen Mycosphaerella graminicola were sequenced completely and compared to identify polymorphic regions. This organism is of interest because it is phylogenetically distant from other fungi with sequenced mitochondrial genomes and it has shown discordant patterns of nuclear and mitochondrial diversity. The mitochondrial genome of M. graminicola is a circular molecule of approximately 43,960 bp containing the typical genes coding for 14 proteins related to oxidative phosphorylation, one RNA polymerase, two rRNA genes and a set of 27 tRNAs. The mitochondrial DNA of M. graminicola lacks the gene encoding the putative ribosomal protein (rps5-like), commonly found in fungal mitochondrial genomes. Most of the tRNA genes were clustered with a gene order conserved with many other ascomycetes. A sample of thirty-five additional strains representing the known global mt diversity was partially sequenced to measure overall mitochondrial variability within the species. Little variation was found, confirming previous RFLP-based findings of low mitochondrial diversity. The mitochondrial sequence of M. graminicola is the first reported from the family Mycosphaerellaceae or the order Capnodiales. The sequence also provides a tool to better understand the development of fungicide resistance and the conflicting pattern of high nuclear and low mitochondrial diversity in global populations of this fungus.

  11. The kinase LYK5 is a major chitin receptor in Arabidopsis and forms a chitin-induced complex with related kinase CERK1

    SciTech Connect (OSTI)

    Cao, Yangrong; Liang, Yan; Tanaka, Kiwamu; Nguyen, Cuong T.; Jedrzejczak, Robert P.; Joachimiak, Andrzej; Stacey, Gary

    2014-10-23

    Chitin is a fungal microbe-associated molecular pattern recognized in Arabidopsis by a lysin motif receptor kinase (LYK), AtCERK1. Previous research suggested that AtCERK1 is the major chitin receptor and mediates chitin-induced signaling through homodimerization and phosphorylation. However, the reported chitin binding affinity of AtCERK1 is quite low, suggesting another receptor with high chitin binding affinity might be present. Here, we propose that AtLYK5 is the primary chitin receptor in Arabidopsis. Mutations in AtLYK5 resulted in a significant reduction in chitin response. AtLYK5 shares overlapping function with AtLYK4 and, therefore, Atlyk4/Atlyk5-2 double mutants show a complete loss of chitin response. AtLYK5 interacts with AtCERK1 in a chitin-dependent manner. Chitin binding to AtLYK5 is indispensable for chitin-induced AtCERK1 phosphorylation. AtLYK5 binds chitin at a much higher affinity than AtCERK1. The data suggest that AtLYK5 is the primary receptor for chitin, forming a chitin inducible complex with AtCERK1 to induce plant immunity.

  12. Book review of Insect Symbiosis. Volume 2. Bourtzis, K.A. and Miller, T.A. editros. 2006 CRC Press, Taylor and Francis Group, Boca Raton, FL, 276 pp. ISBN 0-8493-1286-8

    SciTech Connect (OSTI)

    Hoy, M.A. [Department of Entomology and Nematology, University of Florida, Gainesville, FL (United States)

    2007-03-15

    There are several definitions of symbiosis, but in this book it involves an association where one organism (the symbiont) lives within or on the body of another organism (the host), regardless of the actual effect on the host. Some symbioses are mutualistic, some parasitic, and some involve commensalism, in which one partner derives some benefit without either harming or benefiting the other. This is the second volume in this exciting and rapidly advancing topic by these editors. The first volume was published in 2003 and during the intervening three years additional data have been produced that make this book a useful addition to your library. The first book provided chapters that provided an overview of insect symbiosis, discussions of the primary aphid symbiont Buchnera and other aphid symbionts, symbiosis in tsetse, symbionts in the weevil Sitophilus , the possible use of paratransgenic symbionts of Rhodnius prolixis to prevent disease transmission, bark beetle and fungal symbiosis, symbionts of tephritid fruit flies, symbionts affecting termite behavior, an overview of microsporidia as symbionts (parasites?) of insects, an overview of a newly discovered bacterium that causes sex-ratio distortion in insects and mites (from the Bacteroides group), symbionts that selectively kill male insects, and several chapters on the ubiquitous endosymbiont Wolbachia.

  13. Fifteenth symposium on biotechnology for fuels and chemicals: Program and abstracts

    SciTech Connect (OSTI)

    Not Available

    1993-07-01

    This collection contains 173 abstracts from presented papers and poster sessions. The five sessions of the conference were on the subjects of: (1) Thermal, Chemical, and Biological Processing, (2) Applied Biological Research, (3) Bioprocessing Research (4), Process Economics and Commercialization, and (5) Environmental Biotechnology. Examples of specific topics in the first session include the kinetics of ripening cheese, microbial liquefaction of lignite, and wheat as a feedstock for fuel ethanol. Typical topics in the second session were synergism studies of bacterial and fungal celluloses, conversion of inulin from jerusalem artichokes to sorbitol and ethanol by saccharomyces cerevisiae, and microbial conversion of high rank coals to methane. The third session entertained topics such as hydrodynamic modeling of a liquid fluidized bed bioreactor for coal biosolubilization, aqueous biphasic systems for biological particle partitioning, and arabinose utilization by xylose-fermenting yeast and fungi. The fourth session included such topics as silage processing of forage biomass to alcohol fuels, economics of molasses to ethanol in India, and production of lactic acid from renewable resources. the final session contained papers on such subjects as bioluminescent detection of contaminants in soils, characterization of petroleum contaminated soils in coral atolls in the south Pacific, and landfill management for methane generation and emission control.

  14. Method for collecting spores from a mold

    DOE Patents [OSTI]

    Au, Frederick H. F.; Beckert, Werner F.

    1977-01-01

    A technique and apparatus used therewith for determining the uptake of plutonium and other contaminants by soil microorganisms which, in turn, gives a measure of the plutonium and/or other contaminants available to the biosphere at that particular time. A measured quantity of uncontaminated spores of a selected mold is added to a moistened sample of the soil to be tested. The mixture is allowed to sit a predetermined number of days under specified temperature conditions. An agar layer is then applied to the top of the sample. After three or more days, when spores of the mold growing in the sample have formed, the spores are collected by a miniature vacuum collection apparatus operated under preselected vacuum conditions, which collect only the spores with essentially no contamination by mycelial fragments or culture medium. After collection, the fungal spores are dried and analyzed for the plutonium and/or other contaminants. The apparatus is also suitable for collection of pollen, small insects, dust and other small particles, material from thin-layer chromatography plates, etc.

  15. System for sampling and monitoring microscopic organisms and substances

    DOE Patents [OSTI]

    Au, Frederick H. F.; Beckert, Werner F.

    1976-01-01

    A technique and apparatus used therewith for determining the uptake of plutonium and other contaminants by soil microorganisms which, in turn, gives a measure of the plutonium and/or other contaminants available to the biosphere at that particular time. A measured quantity of uncontaminated spores of a selected mold is added to a moistened sample of the soil to be tested. The mixture is allowed to sit a predetermined number of days under specified temperature conditions. An agar layer is then applied to the top of the sample. After three or more days, when spores of the mold growing in the sample have formed, the spores are collected by a miniature vacuum collection apparatus operated under preselected vacuum conditions, which collect only the spores with essentially no contamination by mycelial fragments or culture medium. After collection, the fungal spores are dried and analyzed for the plutonium and/or other contaminants. The apparatus is also suitable for collection of pollen, small insects, dust and other small particles, material from thin-layer chromatography plates, etc.

  16. Rapid genome resequencing of an atoxigenic strain of Aspergillus carbonarius

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cabañes, F. Javier; Sanseverino, Walter; Castellá, Gemma; Bragulat, M. Rosa; Cigliano, Riccardo Aiese; Sánchez, Armand

    2015-03-13

    In microorganisms, Ion Torrent sequencing technology has been proved to be useful in whole-genome sequencing of bacterial genomes (5 Mbp). In our study, for the first time we used this technology to perform a resequencing approach in a whole fungal genome (36 Mbp), a non-ochratoxin A producing strain of Aspergillus carbonarius. Ochratoxin A (OTA) is a potent nephrotoxin which is found mainly in cereals and their products, but it also occurs in a variety of common foods and beverages. Due to the fact that this strain does not produce OTA, we focused some of the bioinformatics analyses in genes involvedmore » in OTA biosynthesis, using a reference genome of an OTA producing strain of the same species. This study revealed that in the atoxigenic strain there is a high accumulation of nonsense and missense mutations in several genes. Importantly, a two fold increase in gene mutation ratio was observed in PKS and NRPS encoding genes which are suggested to be involved in OTA biosynthesis.« less

  17. Genome Improvement at JGI-HAGSC

    SciTech Connect (OSTI)

    Grimwood, Jane: Schmutz, Jeremy, J.: Myers, Richard, M.

    2012-03-03

    Since the completion of the sequencing of the human genome, the JGI has rapidly expanded its scientific goals in several DOE mission-relevant areas. At the JGI-HAGSC, we have kept pace with this rapid expansion of projects with our focus on assessing, assembling, improving and finishing eukaryotic whole genome shotgun (WGS) projects for which the shotgun sequence is generated at the Production Genomic Facility (JGI-PGF). We follow this by combining the draft WGS with genomic resources generated at JGI-HAGSC or in collaborator laboratories (including BAC end sequences, genetic maps and FLcDNA sequences) to produce an improved draft sequence. For eukaryotic genomes important to the DOE mission, we then add further information from directed experiments to produce reference genomic sequences that are publicly available for any scientific researcher. Also, we have continued our program for producing BAC-based finished sequence, both for adding information to JGI genome projects and for small BAC-based sequencing projects proposed through any of the JGI sequencing programs. We have now built our computational expertise in WGS assembly and analysis and have moved eukaryotic genome assembly from the JGI-PGF to JGI-HAGSC. We have concentrated our assembly development work on large plant genomes and complex fungal and algal genomes.

  18. Glionitrin A, an antibiotic-antitumor metabolite derived from competitive interaction between abandoned mine microbes

    SciTech Connect (OSTI)

    Park, H.B.; Kown, H.C.; Lee, C.H.; Yang, H.O.

    2009-02-15

    The nutrient conditions present in abandoned coal mine drainages create an extreme environment where defensive and offensive microbial interactions could be critical for survival and fitness. Coculture of a mine drainage-derived Sphingomonas bacterial strain, KMK-001, and a mine drainage-derived Aspergillus fumigatus fungal strain, KMC-901, resulted in isolation of a new diketopiperazine disulfide, glionitrin A (1). Compound 1 was not detected in monoculture broths of KMK-001 or KMC-901. The structure of 1, a (3S,10aS) diketopiperazine disulfide containing a nitro aromatic ring, was based on analysis of MS, NMR, and circular dichroism spectra and confirmed by X-ray crystal data. Glionitrin A displayed significant antibiotic activity against a series of microbes including methicillin-resistant Staphylococcus aureus. An in vitro MTT cytotoxicity assay revealed that 1 had potent submicromolar cytotoxic activity against four human cancer cell lines: HCT-116, A549, AGS, and DU145. The results provide further evidence that microbial coculture can produce novel biologically relevant molecules.

  19. Warming and increased precipitation frequency on the Colorado Plateau: implications for biological soil crusts and soil processes

    SciTech Connect (OSTI)

    Zelikova TJ; Housman DC; Grote EE; Neher DA; Belnap J

    2012-01-01

    Changes in temperature and precipitation are expected to influence ecosystem processes worldwide. Despite their globally large extent, few studies to date have examined the effects of climate change in desert ecosystems, where biological soil crusts are key nutrient cycling components. The goal of this work was to assess how increased temperature and frequency of summertime precipitation affect the contributions of crust organisms to soil processes. With a combination of experimental 2°C warming and altered summer precipitation frequency applied over 2 years, we measured soil nutrient cycling and the structure and function of crust communities. We saw no change in crust cover, composition, or other measures of crust function in response to 2°C warming and no effects on any measure of soil chemistry. In contrast, crust cover and function responded to increased frequency of summer precipitation, shifting from moss to cyanobacteria-dominated crusts; however, in the short timeframe we measured, there was no accompanying change in soil chemistry. Total bacterial and fungal biomass was also reduced in watered plots, while the activity of two enzymes increased, indicating a functional change in the microbial community. Taken together, our results highlight the limited effects of warming alone on biological soil crust communities and soil chemistry, but demonstrate the substantially larger effects of altered summertime precipitation.

  20. Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

    SciTech Connect (OSTI)

    Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.; Suen, Garret; Tringe, Susannah G.; Adams, Sandra M.; Barry, Kerrie W.; Nicora, Carrie D.; Piehowski, Paul D.; Purvine, Samuel O.; Starrett, Gabriel J.; Goodwin, Lynne A.; Smith, Richard D.; Lipton, Mary S.; Currie, Cameron R.

    2012-09-01

    Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.

  1. The kinase LYK5 is a major chitin receptor in Arabidopsis and forms a chitin-induced complex with related kinase CERK1

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cao, Yangrong; Liang, Yan; Tanaka, Kiwamu; Nguyen, Cuong T.; Jedrzejczak, Robert P.; Joachimiak, Andrzej; Stacey, Gary

    2014-10-23

    Chitin is a fungal microbe-associated molecular pattern recognized in Arabidopsis by a lysin motif receptor kinase (LYK), AtCERK1. Previous research suggested that AtCERK1 is the major chitin receptor and mediates chitin-induced signaling through homodimerization and phosphorylation. However, the reported chitin binding affinity of AtCERK1 is quite low, suggesting another receptor with high chitin binding affinity might be present. Here, we propose that AtLYK5 is the primary chitin receptor in Arabidopsis. Mutations in AtLYK5 resulted in a significant reduction in chitin response. AtLYK5 shares overlapping function with AtLYK4 and, therefore, Atlyk4/Atlyk5-2 double mutants show a complete loss of chitin response. AtLYK5more » interacts with AtCERK1 in a chitin-dependent manner. Chitin binding to AtLYK5 is indispensable for chitin-induced AtCERK1 phosphorylation. AtLYK5 binds chitin at a much higher affinity than AtCERK1. The data suggest that AtLYK5 is the primary receptor for chitin, forming a chitin inducible complex with AtCERK1 to induce plant immunity.« less

  2. Utility of four strains of white-rot fungi for the detoxification of 2,4,6-trinitrotoluene in liquid culture

    SciTech Connect (OSTI)

    Donnelly, K.C.; Chen, J.C.; Huebner, H.J.; Brown, K.W.; Autenrieth, R.L.; Bonner, J.S.

    1997-06-01

    The purpose of this study was to investigate the potential of four different strains of white-rot fungi (Phanerochaete chrysosporium, Phanerochaete sordida, Phlebia brevispora, and Cyathus stercoreus) to degrade 2,4,6-trinitrotoluene (TNT) in liquid medium. Loss of TNT from the culture medium was determined using high-performance liquid chromatography (HPLC), while the mutagenicity of the medium residues were evaluated using the Salmonella/microsome bioassay. The data indicate that within 21 d of incubation, all fungi were able to reduce the TNT concentration in the liquid medium to below detection limits. In this study, P. sordida showed a relatively high growth rate and the fastest rate of TNT degradation. The fungal treatment also produced a significant reduction of TNT mutagenicity. Treatment with C. stercoreus, P. brevispora, P. sordida, and P. chrysosporium resulted in the elimination of 94%, 90%, 87%, and 67% of the initial TNT-amended medium mutagenicity, respectively. The data also demonstrate that during incubation, TNT was eliminated from the culture medium two to eight times faster than the reduction in mutagenic potential. These results suggest that TNT disappearance alone cannot be used as the sole criterion in TNT remediation. Chemical analysis revealed that the major metabolites in the initial transformation of TNT were the monoamino-dinitrotoluenes, which were also degraded by the selected white-rot fungi. The study demonstrated that the white-rot fungi are capable of metabolizing and detoxifying TNT under aerobic conditions in nonligninolytic liquid medium.

  3. Differential Expression in Phanerochaete chrysosporium of Membrane-Associated Proteins Relevant to Lignin Degradation

    SciTech Connect (OSTI)

    Shary, Semarjit; Kapich, Alexander N.; Panisko, Ellen A.; Magnuson, Jon K.; Cullen, Dan; Hammel, Ken

    2008-10-02

    Fungal lignin-degrading systems must include membrane-associated proteins that participate in diverse processes such as uptake and oxidation of lignin fragments, secretion of ligninolytic secondary metabolites, and defense of the mycelium against ligninolytic oxidants. Despite their importance, little is known about the nature or regulation of these membrane-associated components. We grew the white rot basidiomycete Phanerochaete chrysosporium on cellulose or glucose as the carbon source and monitored the mineralization of a 14C-labeled synthetic lignin by these cultures to assess their ligninolytic competence. The results showed that the cellulose-grown cultures were ligninolytic, whereas the glucose-grown ones were not. We isolated microsomal membrane fractions from both types of culture and analyzed tryptic digests of them by shotgun liquid chromatography/tandem mass spectrometry. Comparison of the results against the predicted P. chrysosporium proteome showed that a catalase (Joint Genome Institute P. chrysosporium protein I.D. 124398), an alcohol oxidase (126879), two transporters (137220 and 132234), and two cytochrome P450s (5011 and 8912) were up-regulated under ligninolytic conditions. Real time reverse transcription polymerase chain reaction assays showed that RNA transcripts encoding all of these proteins were also up-regulated in ligninolytic cultures. Catalase 124398, alcohol oxidase 126879, and transporter 137220 were found in a proteomic analysis of partially purified plasma membranes from ligninolytic P. chrysosporium, and are therefore most likely associated with the outer envelope of the fungus.

  4. Producing a True Lignin Depolymerase for Biobleaching Softwood Kraft Pulp

    SciTech Connect (OSTI)

    Simo Sarkanen

    2002-02-04

    This project constituted an intensive effort devoted to producing, from the white-rot fungus Tramets Cingulata, a lignin degrading enzyme (lignin depolymerase) that is directly able to biobleach or delignify softwood kraft pulp brownstock. To this end, the solutions in which T. cingulata was grown contained dissolved kraft lignin which fulfilled two functions; it behaved as a lignin deploymerase substrate and it also appeared to act as an inducer of enzyme expression. However, the lignin depolymerase isoenzymes (and other extracellular T. cingulata enzymes) interacted very strongly with both the kraft lignin components and the fungal hypae, so the isolating these proteins from the culture solutions proved to be unexpectedly difficult. Even after extensive experimentation with a variety of protein purification techniques, only one approach appeared to be capable of purifying lignin depolymerases to homogeneity. Unfortunately the procedure was extremely laborious; it involved the iso electric focusing of concentrated buffer-exchanged culture solutions followed by electro-elution of the desired protein bands from the appropriate polyacrylamide gel segments

  5. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    SciTech Connect (OSTI)

    Nakamura, Tomofumi; Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 ; Ichinose, Hirofumi; Wariishi, Hiroyuki; Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581; Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  6. Multi-omics approach identifies molecular mechanisms of plant-fungus mycorrhizal interaction

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Larsen, Peter E.; Sreedasyam, Avinash; Trivedi, Geetika; Desai, Shalaka D.; Dai, Yang; Cseke, Leland; Collart, Frank R.

    2016-01-19

    In mycorrhizal symbiosis, plant roots form close, mutually beneficial interactions with soil fungi. Before this mycorrhizal interaction can be established however, plant roots must be capable of detecting potential beneficial fungal partners and initiating the gene expression patterns necessary to begin symbiosis. To predict a plant root – mycorrhizal fungi sensor systems, we analyzed in vitro experiments of Populus tremuloides (aspen tree) and Laccaria bicolor (mycorrhizal fungi) interaction and leveraged over 200 previously published transcriptomic experimental data sets, 159 experimentally validated plant transcription factor binding motifs, and more than 120-thousand experimentally validated protein-protein interactions to generate models of pre-mycorrhizal sensormore » systems in aspen root. These sensor mechanisms link extracellular signaling molecules with gene regulation through a network comprised of membrane receptors, signal cascade proteins, transcription factors, and transcription factor biding DNA motifs. Modeling predicted four pre-mycorrhizal sensor complexes in aspen that interact with fifteen transcription factors to regulate the expression of 1184 genes in response to extracellular signals synthesized by Laccaria. Predicted extracellular signaling molecules include common signaling molecules such as phenylpropanoids, salicylate, and, jasmonic acid. Lastly, this multi-omic computational modeling approach for predicting the complex sensory networks yielded specific, testable biological hypotheses for mycorrhizal interaction signaling compounds, sensor complexes, and mechanisms of gene regulation.« less

  7. Rapid genome resequencing of an atoxigenic strain of Aspergillus carbonarius

    SciTech Connect (OSTI)

    Cabañes, F. Javier; Sanseverino, Walter; Castellá, Gemma; Bragulat, M. Rosa; Cigliano, Riccardo Aiese; Sánchez, Armand

    2015-03-13

    In microorganisms, Ion Torrent sequencing technology has been proved to be useful in whole-genome sequencing of bacterial genomes (5 Mbp). In our study, for the first time we used this technology to perform a resequencing approach in a whole fungal genome (36 Mbp), a non-ochratoxin A producing strain of Aspergillus carbonarius. Ochratoxin A (OTA) is a potent nephrotoxin which is found mainly in cereals and their products, but it also occurs in a variety of common foods and beverages. Due to the fact that this strain does not produce OTA, we focused some of the bioinformatics analyses in genes involved in OTA biosynthesis, using a reference genome of an OTA producing strain of the same species. This study revealed that in the atoxigenic strain there is a high accumulation of nonsense and missense mutations in several genes. Importantly, a two fold increase in gene mutation ratio was observed in PKS and NRPS encoding genes which are suggested to be involved in OTA biosynthesis.

  8. Proteomics based compositional analysis of complex cellulase-hemicellulase mixtures

    SciTech Connect (OSTI)

    Chundawat, Shishir P.; Lipton, Mary S.; Purvine, Samuel O.; Uppugundla, Nirmal; Gao, Dahai; Balan, Venkatesh; Dale, Bruce E.

    2011-10-07

    Efficient deconstruction of cellulosic biomass to fermentable sugars for fuel and chemical production is accomplished by a complex mixture of cellulases, hemicellulases and accessory enzymes (e.g., >50 extracellular proteins). Cellulolytic enzyme mixtures, produced industrially mostly using fungi like Trichoderma reesei, are poorly characterized in terms of their protein composition and its correlation to hydrolytic activity on cellulosic biomass. The secretomes of commercial glycosyl hydrolase producing microbes was explored using a proteomics approach with high-throughput quantification using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Here, we show that proteomics based spectral counting approach is a reasonably accurate and rapid analytical technique that can be used to determine protein composition of complex glycosyl hydrolase mixtures that also correlates with the specific activity of individual enzymes present within the mixture. For example, a strong linear correlation was seen between Avicelase activity and total cellobiohydrolase content. Reliable, quantitative and cheaper analytical methods that provide insight into the cellulosic biomass degrading fungal and bacterial secretomes would lead to further improvements towards commercialization of plant biomass derived fuels and chemicals.

  9. Structure and Function of the Clostridium thermocellum Cellobiohydrolase A X1-Module Repeat: Enhancement Through Stabilization of the CbhA Complex

    SciTech Connect (OSTI)

    Brunecky, R.; Alahuhta, M.; Bomble, Y. J.; Xu, Q.; Baker, J. O.; Ding, S. Y.; Himmel, M. E.; Lunin, V. V.

    2012-03-01

    The efficient deconstruction of lignocellulosic biomass remains a significant barrier to the commercialization of biofuels. Whereas most commercial plant cell-wall-degrading enzyme preparations used today are derived from fungi, the cellulosomal enzyme system from Clostridium thermocellum is an equally effective catalyst, yet of considerably different structure. A key difference between fungal enzyme systems and cellulosomal enzyme systems is that cellulosomal enzyme systems utilize self-assembled scaffolded multimodule enzymes to deconstruct biomass. Here, the possible function of the X1 modules in the complex multimodular enzyme system cellobiohydrolase A (CbhA) from C. thermocellum is explored. The crystal structures of the two X1 modules from C. thermocellum CbhA have been solved individually and together as one construct. The role that calcium may play in the stability of the X1 modules has also been investigated, as well as the possibility that they interact with each other. Furthermore, the results show that whereas the X1 modules do not seem to act as cellulose disruptors, they do aid in the thermostability of the CbhA complex, effectively allowing it to deconstruct cellulose at a higher temperature.

  10. Cellulolytic potential under environmental changes in microbial communities from grassland litter

    SciTech Connect (OSTI)

    Berlemont, Renaud; Allison, Steven D.; Weihe, Claudia; Lu, Ying; Brodie, Eoin L.; Martiny, Jennifer B. H.; Martiny, Adam C.

    2014-11-25

    In many ecosystems, global changes are likely to profoundly affect microorganisms. In Southern California, changes in precipitation and nitrogen deposition may influence the composition and functional potential of microbial communities and their resulting ability to degrade plant material. To test whether such environmental changes impact the distribution of functional groups involved in leaf litter degradation, we determined how the genomic diversity of microbial communities in a semi-arid grassland ecosystem changed under reduced precipitation or increased N deposition. We monitored communities seasonally over a period of 2 years to place environmental change responses into the context of natural variation. Fungal and bacterial communities displayed strong seasonal patterns, Fungi being mostly detected during the dry season whereas Bacteria were common during wet periods. Most putative cellulose degraders were associated with 33 bacterial genera and predicted to constitute 18% of the microbial community. Precipitation reduction reduced bacterial abundance and cellulolytic potential whereas nitrogen addition did not affect the cellulolytic potential of the microbial community. Finally, we detected a strong correlation between the frequencies of genera of putative cellulose degraders and cellulase genes. Thus, microbial taxonomic composition was predictive of cellulolytic potential. This work provides a framework for how environmental changes affect microorganisms responsible for plant litter deconstruction.

  11. Cellulolytic potential under environmental changes in microbial communities from grassland litter

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Berlemont, Renaud; Allison, Steven D.; Weihe, Claudia; Lu, Ying; Brodie, Eoin L.; Martiny, Jennifer B. H.; Martiny, Adam C.

    2014-11-25

    In many ecosystems, global changes are likely to profoundly affect microorganisms. In Southern California, changes in precipitation and nitrogen deposition may influence the composition and functional potential of microbial communities and their resulting ability to degrade plant material. To test whether such environmental changes impact the distribution of functional groups involved in leaf litter degradation, we determined how the genomic diversity of microbial communities in a semi-arid grassland ecosystem changed under reduced precipitation or increased N deposition. We monitored communities seasonally over a period of 2 years to place environmental change responses into the context of natural variation. Fungal andmore » bacterial communities displayed strong seasonal patterns, Fungi being mostly detected during the dry season whereas Bacteria were common during wet periods. Most putative cellulose degraders were associated with 33 bacterial genera and predicted to constitute 18% of the microbial community. Precipitation reduction reduced bacterial abundance and cellulolytic potential whereas nitrogen addition did not affect the cellulolytic potential of the microbial community. Finally, we detected a strong correlation between the frequencies of genera of putative cellulose degraders and cellulase genes. Thus, microbial taxonomic composition was predictive of cellulolytic potential. This work provides a framework for how environmental changes affect microorganisms responsible for plant litter deconstruction.« less

  12. 3-Nitropropionic Acid is a Suicide Inhibitor of MitochondrialRespiration that, Upon Oxidation by Complex II, Forms a Covalent AdductWith a Catalytic Base Arginine in the Active Site of the Enzyme

    SciTech Connect (OSTI)

    Huang, Li-shar; Sun, Gang; Cobessi, David; Wang, Andy C.; Shen,John T.; Tung, Eric Y.; Anderson, Vernon E.; Berry, Edward A.

    2005-12-01

    We report three new structures of mitochondrial respiratory Complex II (succinate ubiquinone oxidoreductase, E.C. 1.3.5.1) at up to 2.1 {angstrom} resolution, with various inhibitors. The structures define the conformation of the bound inhibitors and suggest the residues involved in substrate binding and catalysis at the dicarboxylate site. In particular they support the role of Arg297 as a general base catalyst accepting a proton in the dehydrogenation of succinate. The dicarboxylate ligand in oxaloacetate-containing crystals appears to be the same as that reported for Shewanella flavocytochrome c treated with fumarate. The plant and fungal toxin 3-nitropropionic acid, an irreversible inactivator of succinate dehydrogenase, forms a covalent adduct with the side chain of Arg297. The modification eliminates a trypsin cleavage site in the flavoprotein, and tandem mass spectroscopic analysis of the new fragment shows the mass of Arg 297 to be increased by 83 Da and to have potential of losing 44 Da, consistent with decarboxylation, during fragmentation.

  13. ARBUSCULAR MYCORRHIZAL COLONIZATION OF LARREA TRIDENTATA AND AMBROSIA DUMOSA ROOTS VARIES WITH PRECIPITATION AND SEASON IN THE MOJAVE DESERT

    SciTech Connect (OSTI)

    M. E. APPLE; C. I. THEE; V. L. SMITH-LONGOZO; C. R. COGAR; C. E. WELLS; R. S. NOWAK

    2004-01-01

    The percentage of fine roots colonized by arbuscular mycorrhizal (AM) fungi varied with season and with species in the co-dominant shrubs Lurreu tridentutu and Ambrosia dumosu at a site adjacent to the Nevada Desert FACE (Free-Air CO{sub 2} Enrichment) Facility (NDFF) in the Mojave Desert. We excavated downward and outward from the shrub bases in both species to collect and examine fine roots (< 1.0 mm diameter) at monthly intervals throughout 2001 and from October 2002 to September 2003. Fungal structures became visible in cleared roots stained with trypan blue. We quantified the percent colonization of roots by AM fungi via the line intercept method. In both years and for both species, colonization was highest in fall, relatively low in spring when root growth began, increased in late spring, and decreased during summer drought periods. Increases in colonization during summer and fall reflect corresponding increases in precipitation. Spring mycorrhizal colonization is low despite peaks in soil water availability and precipitation, indicating that precipitation is not the only factor influencing mycorrhizal colonization. Because the spring decrease in mycorrhizal colonization occurs when these shrubs initiate a major flush of fine root growth, other phenological events such as competing demands for carbon by fine root initiation, early season shoot growth, and flowering may reduce carbon availability to the fungus, and hence decrease colonization. Another possibility is that root growth exceeds the rate of mycorrhizal colonization.

  14. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hori, Chiaki; Ishida, Takuya; Igarashi, Kiyohiko; Samejima, Masahiro; Suzuki, Hitoshi; Master, Emma; Ferreira, Patricia; Ruiz-Dueñas, Francisco J.; Held, Benjamin; Canessa, Paulo; et al

    2014-12-04

    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other fungal species. The mechanism(s) by which P. gigantea tolerates and metabolizes resinous compounds have not been explored. Here, we report the annotated P. gigantea genome and compare profiles of its transcriptome and secretome when cultured on freshcut versus solvent-extracted loblolly pine wood. The P. gigantea genome contains a conventional repertoire of hydrolase genesmore » involved in cellulose/hemicellulose degradation, whose patterns of expression were relatively unperturbed by the absence of extractives. The expression of genes typically ascribed to lignin degradation was also largely unaffected. In contrast, genes likely involved in the transformation and detoxification of wood extractives were highly induced in its presence. Their products included an ABC transporter, lipases, cytochrome P450s, glutathione S-transferase and aldehyde dehydrogenase. Other regulated genes of unknown function and several constitutively expressed genes are also likely involved in P. gigantea’s extractives metabolism. These results contribute to our fundamental understanding of pioneer colonization of conifer wood and provide insight into the diverse chemistries employed by fungi in carbon cycling processes.« less

  15. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

    SciTech Connect (OSTI)

    Hori, Chiaki; Ishida, Takuya; Igarashi, Kiyohiko; Samejima, Masahiro; Suzuki, Hitoshi; Master, Emma; Ferreira, Patricia; Ruiz-Dueñas, Francisco J.; Held, Benjamin; Canessa, Paulo; Larrondo, Luis F.; Schmoll, Monika; Druzhinina, Irina S.; Kubicek, Christian P.; Gaskell, Jill A.; Kersten, Phil; St. John, Franz; Glasner, Jeremy; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit; Mgbeahuruike, Anthony C.; Kovalchuk, Andriy; Asiegbu, Fred O.; Lackner, Gerald; Hoffmeister, Dirk; Rencoret, Jorge; Gutiérrez, Ana; Sun, Hui; Lindquist, Erika; Barry, Kerrie; Riley, Robert; Grigoriev, Igor V.; Henrissat, Bernard; Berka, Randy M.; Martínez, Angel T.; Covert, Sarah F.; Blanchette, Robert A.; Cullen, Daniel; Copenhaver, Gregory P.

    2014-12-04

    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other fungal species. The mechanism(s) by which P. gigantea tolerates and metabolizes resinous compounds have not been explored. Here, we report the annotated P. gigantea genome and compare profiles of its transcriptome and secretome when cultured on freshcut versus solvent-extracted loblolly pine wood. The P. gigantea genome contains a conventional repertoire of hydrolase genes involved in cellulose/hemicellulose degradation, whose patterns of expression were relatively unperturbed by the absence of extractives. The expression of genes typically ascribed to lignin degradation was also largely unaffected. In contrast, genes likely involved in the transformation and detoxification of wood extractives were highly induced in its presence. Their products included an ABC transporter, lipases, cytochrome P450s, glutathione S-transferase and aldehyde dehydrogenase. Other regulated genes of unknown function and several constitutively expressed genes are also likely involved in P. gigantea’s extractives metabolism. These results contribute to our fundamental understanding of pioneer colonization of conifer wood and provide insight into the diverse chemistries employed by fungi in carbon cycling processes.

  16. Expression of the Acidothermus cellulolyticus E1 endoglucanase in Caldicellulosiruptor bescii enhances its ability to deconstruct crystalline cellulose

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chung, Daehwan; Young, Jenna; Cha, Minseok; Brunecky, Roman; Bomble, Yannick J.; Himmel, Michael E.; Westpheling, Janet

    2015-08-13

    The Caldicellulosiruptor bescii genome encodes a potent set of carbohydrate-active enzymes (CAZymes), found primarily as multi-domain enzymes that exhibit high cellulolytic and hemicellulolytic activity on and allow utilization of a broad range of substrates, including plant biomass without conventional pretreatment. CelA, the most abundant cellulase in the C. bescii secretome, uniquely combines a GH9 endoglucanase and a GH48 exoglucanase in one protein. The most effective commercial enzyme cocktails used in vitro to pretreat biomass are derived from fungal cellulases (cellobiohydrolases, endoglucanases and a β-d-glucosidases) that act synergistically to release sugars for microbial conversion. The C. bescii genome contains six GH5more » domains in five different open reading frames. Four exist in multi-domain proteins and two as single catalytic domains. E1 is a GH5 endoglucanase reported to have high specific activity and simple architecture and is active at the growth temperature of C. bescii. E1 is an endo-1,4-β-glucanase linked to a family 2 carbohydrate-binding module shown to bind primarily to cellulosic substrates. As a result, we tested if the addition of this protein to the C. bescii secretome would improve its cellulolytic activity.« less

  17. Trichodermin induces cell apoptosis through mitochondrial dysfunction and endoplasmic reticulum stress in human chondrosarcoma cells

    SciTech Connect (OSTI)

    Su, Chen-Ming; Wang, Shih-Wei; Lee, Tzong-Huei; Tzeng, Wen-Pei; Hsiao, Che-Jen; Liu, Shih-Chia; Tang, Chih-Hsin

    2013-10-15

    Chondrosarcoma is the second most common primary bone tumor, and it responds poorly to both chemotherapy and radiation treatment. Nalanthamala psidii was described originally as Myxosporium in 1926. This is the first study to investigate the anti-tumor activity of trichodermin (trichothec-9-en-4-ol, 12,13-epoxy-, acetate), an endophytic fungal metabolite from N. psidii against human chondrosarcoma cells. We demonstrated that trichodermin induced cell apoptosis in human chondrosarcoma cell lines (JJ012 and SW1353 cells) instead of primary chondrocytes. In addition, trichodermin triggered endoplasmic reticulum (ER) stress protein levels of IRE1, p-PERK, GRP78, and GRP94, which were characterized by changes in cytosolic calcium levels. Furthermore, trichodermin induced the upregulation of Bax and Bid, the downregulation of Bcl-2, and the dysfunction of mitochondria, which released cytochrome c and activated caspase-3 in human chondrosarcoma. In addition, animal experiments illustrated reduced tumor volume, which led to an increased number of terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells and an increased level of cleaved PARP protein following trichodermin treatment. Together, this study demonstrates that trichodermin is a novel anti-tumor agent against human chondrosarcoma cells both in vitro and in vivo via mitochondrial dysfunction and ER stress. - Highlights: Trichodermin induces chondrosarcoma apoptosis. ER stress is involved in trichodermin-induced cell death. Trichodermin induces chondrosarcoma death in vivo.

  18. Prevention of Prespawning Mortality: Cause of Salmon Headburns and Cranial Lesions

    SciTech Connect (OSTI)

    Neitzel, Duane A.; Elston, R A.; Abernethy, Cary S.

    2004-06-01

    This project was to undertaken to provide information about a condition known as ''headburn''. Information from the project will enable U.S. Corps of Engineers managers to make adjustments in operational procedures or facilities on the Columbia and Snake rivers to prevent loss of pre-spawning adult salmonids that migrate through the facilities. Headburn is a descriptive clinical term used by fishery biologists to describe scalping or exfoliation of skin and ulceration of underlying connective tissue and muscle, primarily of the jaw and cranial region of salmonids observed at fish passage facilities. Headburn lesions are primarily caused when fish collide with concrete or other structures at dams and fish passage facilities, and may be exacerbated in some fish that ''fallback'' or pass over spillways or through turbine assemblies after having passed the dam through a fish ladder. Prespawning mortality of headburned salmonids can be prevented or greatly reduced by therapeutic treatment of both hatchery and wild fish. Treatments would consist of topical application of an anti-fungal agent, injection of replacement plasma electrolytes into the peritoneal cavity, and injection of a broad-spectrum antibacterial agent at fish passage and trapping facilities or hatcheries.

  19. Genome Improvement at JGI-HAGSC

    SciTech Connect (OSTI)

    Grimwood, Jane; Schmutz, Jeremy J.; Myers, Richard M.

    2012-03-03

    Since the completion of the sequencing of the human genome, the Joint Genome Institute (JGI) has rapidly expanded its scientific goals in several DOE mission-relevant areas. At the JGI-HAGSC, we have kept pace with this rapid expansion of projects with our focus on assessing, assembling, improving and finishing eukaryotic whole genome shotgun (WGS) projects for which the shotgun sequence is generated at the Production Genomic Facility (JGI-PGF). We follow this by combining the draft WGS with genomic resources generated at JGI-HAGSC or in collaborator laboratories (including BAC end sequences, genetic maps and FLcDNA sequences) to produce an improved draft sequence. For eukaryotic genomes important to the DOE mission, we then add further information from directed experiments to produce reference genomic sequences that are publicly available for any scientific researcher. Also, we have continued our program for producing BAC-based finished sequence, both for adding information to JGI genome projects and for small BAC-based sequencing projects proposed through any of the JGI sequencing programs. We have now built our computational expertise in WGS assembly and analysis and have moved eukaryotic genome assembly from the JGI-PGF to JGI-HAGSC. We have concentrated our assembly development work on large plant genomes and complex fungal and algal genomes.

  20. Comparative genome analysis of Basidiomycete fungi

    SciTech Connect (OSTI)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  1. The production of fuels and chemicals from food processing wastes using a novel fermenter separator. Annual progress report, January 1991--December 1991

    SciTech Connect (OSTI)

    Dale, M.C.; Venkatesh, K.V.; Choi, Hojoon; Moelhman, M.; Saliceti, L.; Okos, M.R.; Wankat, P.C.

    1991-12-01

    During 1991, considerable progress was made on the waste utilization project. Two small Wisconsin companies have expressed an interest in promoting and developing the ICRS technology. Pilot plant sites at (1) Hopkinton, IA, for a sweet whey plant, and Beaver Dam WI, for an acid whey site have been under development siting ICRS operations. The Hopkinton, IA site is owned and operated by Permeate Refining Inc., who have built a batch ethanol plant across the street from Swiss Valley Farms cheddar cheese operations. Permeate from Swiss Valley is piped across to PRI. PRI has signed a contract to site a 300--500,000 gallon/yr to ICRS pilot plant. They feel that the lower labor, lower energy, continuous process offered by the ICRS will substantially improve their profitability. Catalytics, Inc, is involved with converting whey from a Kraft cream cheese operation to ethanol and yeast. A complete project including whey concentration, sterilization, and yeast growth has been designed for this site. Process design improvements with the ICRS focussed on ethanol recovery techniques during this year`s project. A solvent absorption/extractive distillation (SAED) process has been developed which offers the capability of obtaining an anhydrous ethanol product from vapors off 3 to 9% ethanol solutions using very little energy for distillation. Work on products from waste streams was also performed. a. Diacetyl as a high value flavor compound was very successfully produced in a Stirred Tank Reactor w/Separation. b. Yeast production from secondary carbohydrates in the whey, lactic acid, and glycerol was studied. c. Lactic acid production from cellulose and lactose studies continued. d. Production of anti-fungal reagents by immobilized plant cells; Gossypol has antifungal properties and is produced by G. arboretum.

  2. The production of fuels and chemicals from food processing wastes using a novel fermenter separator

    SciTech Connect (OSTI)

    Dale, M.C.; Venkatesh, K.V.; Choi, Hojoon; Moelhman, M.; Saliceti, L.; Okos, M.R.; Wankat, P.C.

    1991-12-01

    During 1991, considerable progress was made on the waste utilization project. Two small Wisconsin companies have expressed an interest in promoting and developing the ICRS technology. Pilot plant sites at (1) Hopkinton, IA, for a sweet whey plant, and Beaver Dam WI, for an acid whey site have been under development siting ICRS operations. The Hopkinton, IA site is owned and operated by Permeate Refining Inc., who have built a batch ethanol plant across the street from Swiss Valley Farms cheddar cheese operations. Permeate from Swiss Valley is piped across to PRI. PRI has signed a contract to site a 300--500,000 gallon/yr to ICRS pilot plant. They feel that the lower labor, lower energy, continuous process offered by the ICRS will substantially improve their profitability. Catalytics, Inc, is involved with converting whey from a Kraft cream cheese operation to ethanol and yeast. A complete project including whey concentration, sterilization, and yeast growth has been designed for this site. Process design improvements with the ICRS focussed on ethanol recovery techniques during this year's project. A solvent absorption/extractive distillation (SAED) process has been developed which offers the capability of obtaining an anhydrous ethanol product from vapors off 3 to 9% ethanol solutions using very little energy for distillation. Work on products from waste streams was also performed. a. Diacetyl as a high value flavor compound was very successfully produced in a Stirred Tank Reactor w/Separation. b. Yeast production from secondary carbohydrates in the whey, lactic acid, and glycerol was studied. c. Lactic acid production from cellulose and lactose studies continued. d. Production of anti-fungal reagents by immobilized plant cells; Gossypol has antifungal properties and is produced by G. arboretum.

  3. Characterization of Trapped Lignin-Degrading Microbes in Tropical Forest Soil

    SciTech Connect (OSTI)

    DeAngelis, Kristen; Allgaier, Martin; Chavarria, Yaucin; Fortney, Julian; Hugenholtz, Phillip; Simmons, Blake; Sublette, Kerry; Silver, Whendee; Hazen, Terry

    2011-07-14

    Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in the soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.

  4. Characterization of trapped lignin-degrading microbes in tropical forest soil

    SciTech Connect (OSTI)

    DeAngelis, K.M.; Allgaier, M.; Chavarria, Y.; Fortney, J.L.; Hugenholz, P.; Simmons, B.; Sublette, K.; Silver, W.L.; Hazen, T.C.

    2011-03-01

    Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in the soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.

  5. Effect of hydroxamate siderophores on Fe release and Pb(II) adsorption by goethite

    SciTech Connect (OSTI)

    Kraemer, Stephan M.; Cheah, Sing-Foong; Zapf, Rita; Xu, Jide; Raymond, Kenneth N.; Sposito, Garrison

    1998-08-01

    Hydroxamate siderophores are biologically-synthesized, Fe(III)-specific ligands which are common in soil environments. In this paper, we report an investigation of their adsorption by the iron oxyhydroxide, goethite; their influence on goethite dissolution kinetics; and their ability to affect Pb(II) adsorption by the goethite surface. The siderophores used were desferrioxamine B (DFO-B), a fungal siderophore, and desferrioxamine D1, an acetyl derivative of DFO-B (DFO-D1). Siderophore adsorption isotherms yielded maximum surface concentrations of 1.5 (DFO-B) or 3.5 (DFO-D1) mu-mol/g at pH 6.6, whereas adsorption envelopes showed either cation-like (DFO-B) or ligand-like (DFO-D1) behavior. Above pH 8, the adsorbed concentrations of both siderophores were similar. The dissolution rate of goethite in the presence of 240 mu M DFO-B or DFO-D1 was 0.02 or 0.17 mu-mol/g hr, respectively. Comparison of these results with related literature data on the reactions between goethite and acetohydroxamic acid, a monohydroxamate ligand, suggested that the three hydroxamate groups in DFO-D1 coordinate to Fe(III) surface sites relatively independently. The results also demonstrated a significant depleting effect of 240 mu-M DFO-B or DFO-D1 on Pb(II) adsorption by goethite at pH > 6.5, but there was no effect of adsorbed Pb(II) on the goethite dissolution rate.

  6. Comparing bacterial community composition of healthy and dark spot-affected Siderastrea siderea in Florida and the Caribbean

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kellogg, Christina A.; Piceno, Yvette M.; Tom, Lauren M.; DeSantis, Todd Z.; Gray, Michael A.; Andersen, Gary L.; Mormile, Melanie R.

    2014-10-07

    Coral disease is one of the major causes of reef degradation. Dark Spot Syndrome (DSS) was described in the early 1990's as brown or purple amorphous areas of tissue on a coral and has since become one of the most prevalent diseases reported on Caribbean reefs. It has been identified in a number of coral species, but there is debate as to whether it is in fact the same disease in different corals. Further, it is questioned whether these macroscopic signs are in fact diagnostic of an infectious disease at all. The most commonly affected species in the Caribbean ismore » the massive starlet coral Siderastrea siderea. We sampled this species in two locations, Dry Tortugas National Park and Virgin Islands National Park. Tissue biopsies were collected from both healthy colonies and those with dark spot lesions. Microbial-community DNA was extracted from coral samples (mucus, tissue, and skeleton), amplified using bacterial-specific primers, and applied to PhyloChip G3 microarrays to examine the bacterial diversity associated with this coral. Samples were also screened for the presence of a fungal ribotype that has recently been implicated as a causative agent of DSS in another coral species, but the amplifications were unsuccessful. S. siderea samples did not cluster consistently based on health state (i.e., normal versus dark spot). Various bacteria, including Cyanobacteria and Vibrios, were observed to have increased relative abundance in the discolored tissue, but the patterns were not consistent across all DSS samples. Overall, our findings do not support the hypothesis that DSS in S. siderea is linked to a bacterial pathogen or pathogens. This dataset provides the most comprehensive overview to date of the bacterial community associated with the scleractinian coral S. siderea.« less

  7. Using genotyping by sequencing to map two novel anthracnose resistance loci in Sorghum bicolor

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Felderhoff, Tery J.; McIntyre, Lauren M.; Saballos, Ana; Vermerris, Wilfred

    2016-05-18

    Colletotrichum sublineola is an aggressive fungal pathogen that causes anthracnose in sorghum [Sorghum bicolor (L.) Moench]. The obvious symptoms of anthracnose are leaf blight and stem rot. Sorghum, the fifth most widely grown cereal crop in the world, can be highly susceptible to the disease, most notably in hot and humid environments. In the southeastern United States the acreage of sorghum has been increasing steadily in recent years, spurred by growing interest in producing biofuels, bio-based products, and animal feed. Resistance to anthracnose is, therefore, of paramount importance for successful sorghum production in this region. To identify anthracnose resistance locimore » present in the highly resistant cultivar ‘Bk7’, a biparental mapping population of F3:4 and F4:5 sorghum lines was generated by crossing ‘Bk7’ with the susceptible inbred ‘Early Hegari-Sart’. Lines were phenotyped in three environments and in two different years following natural infection. The population was genotyped by sequencing. Following a stringent custom filtering protocol, totals of 5186 and 2759 informative SNP markers were identified in the two populations. Segregation data and association analysis identified resistance loci on chromosomes 7 and 9, with the resistance alleles derived from ‘Bk7’. Both loci contain multiple classes of defense-related genes based on sequence similarity and gene ontologies. Genetic analysis following an independent selection experiment of lines derived from a cross between ‘Bk7’ and sweet sorghum ‘Mer81-4’ narrowed the resistance locus on chromosome 9 substantially, validating this QTL. As observed in other species, sorghum appears to have regions of clustered resistance genes. Lastly, further characterization of these regions will facilitate the development of novel germplasm with resistance to anthracnose and other diseases.« less

  8. Differential growth responses of soil bacterial taxa to carbon substrates of varying chemical recalcitrance

    SciTech Connect (OSTI)

    Goldfarb, K.C.; Karaoz, U.; Hanson, C.A.; Santee, C.A.; Bradford, M.A.; Treseder, K.K.; Wallenstein, M.D.; Brodie, E.L.

    2011-04-18

    Soils are immensely diverse microbial habitats with thousands of co-existing bacterial, archaeal, and fungal species. Across broad spatial scales, factors such as pH and soil moisture appear to determine the diversity and structure of soil bacterial communities. Within any one site however, bacterial taxon diversity is high and factors maintaining this diversity are poorly resolved. Candidate factors include organic substrate availability and chemical recalcitrance, and given that they appear to structure bacterial communities at the phylum level, we examine whether these factors might structure bacterial communities at finer levels of taxonomic resolution. Analyzing 16S rRNA gene composition of nucleotide analog-labeled DNA by PhyloChip microarrays, we compare relative growth rates on organic substrates of increasing chemical recalcitrance of >2,200 bacterial taxa across 43 divisions/phyla. Taxa that increase in relative abundance with labile organic substrates (i.e., glycine, sucrose) are numerous (>500), phylogenetically clustered, and occur predominantly in two phyla (Proteobacteria and Actinobacteria) including orders Actinomycetales, Enterobacteriales, Burkholderiales, Rhodocyclales, Alteromonadales, and Pseudomonadales. Taxa increasing in relative abundance with more chemically recalcitrant substrates (i.e., cellulose, lignin, or tannin-protein) are fewer (168) but more phylogenetically dispersed, occurring across eight phyla and including Clostridiales, Sphingomonadalaes, Desulfovibrionales. Just over 6% of detected taxa, including many Burkholderiales increase in relative abundance with both labile and chemically recalcitrant substrates. Estimates of median rRNA copy number per genome of responding taxa demonstrate that these patterns are broadly consistent with bacterial growth strategies. Taken together, these data suggest that changes in availability of intrinsically labile substrates may result in predictable shifts in soil bacterial composition.

  9. Influence of Airflow on Laboratory Storage of High Moisture Corn Stover

    SciTech Connect (OSTI)

    Lynn M. Wendt; Ian J. Bonner; Amber N. Hoover; Rachel M. Emerson; William A. Smith

    2014-04-01

    Storing high moisture biomass for bioenergy use is a reality in many areas of the country where wet harvest conditions and environmental factors prevent dry storage from being feasible. Aerobic storage of high moisture biomass leads to microbial degradation and self-heating, but oxygen limitation can aid in material preservation. To understand the influence of oxygen presence on high moisture biomass (50 %, wet basis), three airflow rates were tested on corn stover stored in laboratory reactors. Temperature, carbon dioxide production, dry matter loss, chemical composition, fungal abundance, pH, and organic acids were used to monitor the effects of airflow on storage conditions. The results of this work indicate that oxygen availability impacts both the duration of self-heating and the severity of dry matter loss. High airflow systems experienced the greatest initial rates of loss but a shortened microbially active period that limited total dry matter loss (19 %). Intermediate airflow had improved preservation in short-term storage compared to high airflow systems but accumulated the greatest dry matter loss over time (up to 27 %) as a result of an extended microbially active period. Low airflow systems displayed the best performance with the lowest rates of loss and total loss (10 %) in storage at 50 days. Total structural sugar levels of the stored material were preserved, although glucan enrichment and xylan loss were documented in the high and intermediate flow conditions. By understanding the role of oxygen availability on biomass storage performance, the requirements for high moisture storage solutions may begin to be experimentally defined.

  10. Complete genome of the cellyloytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evloutionary adaptations

    SciTech Connect (OSTI)

    Barabote, Ravi D.; Xie, Gary; Leu, David H.; Normand, Philippe; Necsulea, Anamaria; Daubin, Vincent; Medigue, Claudine; Adney, William S.; Xu,Xin Clare; Lapidus, Alla; Detter, Chris; Pujic, Petar; Bruce, David; Lavire, Celine; Challacombe, Jean F.; Brettin, Thomas S.; Berry, Alison M.

    2009-01-01

    We present here the complete 2.4 Mb genome of the cellulolytic actinobacterial thermophile, Acidothermus cellulolyticus 11B. New secreted glycoside hydrolases and carbohydrate esterases were identified in the genome, revealing a diverse biomass-degrading enzyme repertoire far greater than previously characterized, and significantly elevating the industrial value of this organism. A sizable fraction of these hydrolytic enzymes break down plant cell walls and the remaining either degrade components in fungal cell walls or metabolize storage carbohydrates such as glycogen and trehalose, implicating the relative importance of these different carbon sources. A novel feature of the A. cellulolyticus secreted cellulolytic and xylanolytic enzymes is that they are fused to multiple tandemly arranged carbohydrate binding modules (CBM), from families 2 and 3. Interestingly, CBM3 was found to be always N-terminal to CBM2, suggesting a functional constraint driving this organization. While the catalytic domains of these modular enzymes are either diverse or unrelated, the CBMs were found to be highly conserved in sequence and may suggest selective substrate-binding interactions. For the most part, thermophilic patterns in the genome and proteome of A. cellulolyticus were weak, which may be reflective of the recent evolutionary history of A. cellulolyticus since its divergence from its closest phylogenetic neighbor Frankia, a mesophilic plant endosymbiont and soil dweller. However, ribosomal proteins and non-coding RNAs (rRNA and tRNAs) in A. cellulolyticus showed thermophilic traits suggesting the importance of adaptation of cellular translational machinery to environmental temperature. Elevated occurrence of IVYWREL amino acids in A. cellulolyticus orthologs compared to mesophiles, and inverse preferences for G and A at the first and third codon positions also point to its ongoing thermoadaptation. Additional interesting features in the genome of this cellulolytic, hot

  11. Elimination of mercury and organomercurials by nitrogen-fixing bacteria

    SciTech Connect (OSTI)

    Ghosh, S.; Sadhukhan, P.C.; Ghosh, D.K.

    1997-06-01

    Bacteria isolated from mercury-polluted environments are often resistant to mercuric ions (Hg{sup 2+}) and organomercurials. Plasmids determining mercury resistance have been well characterized in gram-negative system. However, in Staphylococcus aureus mercury resistance has been found to be chromosomally determined. The known mechanism of bacterial Hg{sup 2+}-resistance is detoxification of the toxic Hg{sup 2+} by its enzymatic transformation by mercuric reductase to Hg (o). Organomercurial lyase mediates the degradation of organomercurial compounds to Hg{sup 2+}. Mercury and organomercurial resistances have been studied in different bacterial genera. There is little information on Hg-resistance in N{sub 2}-fixing soil bacteria, however, in many developing countries, including India, mercury pollution is still a problem because Hg-based pesticides and fungicides are still used routinely as seed-dressers in agriculture to control soil-borne and seed-borne fungal diseases. Volatilization of Hg from laboratory media by mercury-resistant bacteria containing low levels of mercury has been reported by several workers. It is interesting to note that N{sub 2}-fixing, Hg-resistant soil isolates could volatilize Hg from medium containing very high amounts of HgCl{sub 2}. In the present paper we report the volatilization patterns of five N{sub 2}-fixing bacterial strains, the effect of different inducers on mercuric reductase, and the pattern of substrate utilization by organomercurial lyase. In the presence of a low concentration of HgCl{sub 2}. enzymatic detoxification is sufficient to combat the adverse situation created by the presence of Hg{sup 2+} ions. In the presence of a high concentration of HgCl{sub 2}, intracellular sequestration by Hg{sup 2+} binding components may play an additional role in counteracting Hg-toxicity.

  12. Melanin, a promising radioprotector: Mechanisms of actions in a mice model

    SciTech Connect (OSTI)

    Kunwar, A.; Adhikary, B.; Jayakumar, S.; Barik, A.; Chattopadhyay, S.; Raghukumar, S.; Priyadarsini, K.I.

    2012-10-15

    The radioprotective effect of extracellular melanin, a naturally occurring pigment, isolated from the fungus Gliocephalotrichum simplex was examined in BALB/C mice, and the probable mechanism of action was established. At an effective dose of 50 mg/kg body weight, melanin exhibited both prophylactic and mitigative activities, increasing the 30-day survival of mice by 100% and 60%, respectively, after exposure to radiation (7 Gy, whole body irradiation (WBI)). The protective activity of melanin was primarily due to inhibition of radiation-induced hematopoietic damages as evidenced by improvement in spleen parameters such as index, total cellularity, endogenous colony forming units, and maintenance of circulatory white blood cells and platelet counts. Melanin also reversed the radiation-induced decrease in ERK phosphorylation in splenic tissue, which may be the key feature in its radioprotective action. Additionally, our results indicated that the sustained activation of AKT, JNK and P38 proteins in splenic tissue of melanin pre-treated group may also play a secondary role. This was also supported by the fact that melanin could prevent apoptosis in splenic tissue by decreasing BAX/Bcl-XL ratio, and increasing the expressions of the proliferation markers (PCNA and Cyclin D1), compared to the radiation control group. Melanin also reduced the oxidative stress in hepatic tissue and abrogated immune imbalance by reducing the production of pro-inflammatory cytokines (IL6 and TNF?). In conclusion, our results confirmed that fungal melanin is a very effective radioprotector against WBI and the probable mechanisms of radioprotection are due to modulation in pro-survival (ERK) signaling, prevention of oxidative stress and immunomodulation. -- Highlights: ? Melanin showed promising radioprotection under pre and post irradiation condition. ? Melanin protects the hematopoietic system from radiation induced damage. ? Melanin modulates pro-survival pathways, immune system and

  13. Identification of a haloalkaliphilic and thermostable cellulase with improved ionic liquid tolerance

    SciTech Connect (OSTI)

    Zhang, Tao; Datta, Supratim; Eichler, Jerry; Ivanova, Natalia; Axen, Seth D.; Kerfeld, Cheryl A.; Chen, Feng; Kyrpides, Nikos; Hugenholtz, Philip; Cheng, Jan-Fang; Sale, Kenneth L.; Simmons, Blake; Rubin, Eddy

    2011-02-17

    Some ionic liquids (ILs) have been shown to be very effective solvents for biomass pretreatment. It is known that some ILs can have a strong inhibitory effect on fungal cellulases, making the digestion of cellulose inefficient in the presence of ILs. The identification of IL-tolerant enzymes that could be produced as a cellulase cocktail would reduce the costs and water use requirements of the IL pretreatment process. Due to their adaptation to high salinity environments, halophilic enzymes are hypothesized to be good candidates for screening and identifying IL-resistant cellulases. Using a genome-based approach, we have identified and characterized a halophilic cellulase (Hu-CBH1) from the halophilic archaeon, Halorhabdus utahensis. Hu-CBH1 is present in a gene cluster containing multiple putative cellulolytic enzymes. Sequence and theoretical structure analysis indicate that Hu-CBH1 is highly enriched with negatively charged acidic amino acids on the surface, which may form a solvation shell that may stabilize the enzyme, through interaction with salt ions and/or water molecules. Hu-CBH1 is a heat tolerant haloalkaliphilic cellulase and is active in salt concentrations up to 5 M NaCl. In high salt buffer, Hu-CBH1 can tolerate alkali (pH 11.5) conditions and, more importantly, is tolerant to high levels (20percent w/w) of ILs, including 1-allyl-3-methylimidazolium chloride ([Amim]Cl). Interestingly, the tolerances to heat, alkali and ILs are found to be salt-dependent, suggesting that the enzyme is stabilized by the presence of salt. Our results indicate that halophilic enzymes are good candidates for the screening of IL-tolerant cellulolytic enzymes.

  14. Structures of trihydroxynaphthalene reductase-fungicide complexes: implications for structure-based design and catalysis

    SciTech Connect (OSTI)

    Liao, D.-I.; Basarab, G.S.; Gatenby, A.A.; Valent, B.; Jordan, D.B.

    2010-03-08

    Trihydroxynaphthalene reductase catalyzes two intermediate steps in the fungal melanin biosynthetic pathway. The enzyme, a typical short-chain dehydrogenase, is the biochemical target of three commercial fungicides. The fungicides bind preferentially to the NADPH form of the enzyme. Three X-ray structures of the Magnaporthe grisea enzyme complexed with NADPH and two commercial and one experimental fungicide were determined at 1.7 {angstrom} (pyroquilon), 2.0 {angstrom} (2,3-dihydro-4-nitro-1H-inden-1-one, 1), and 2.1 {angstrom} (phthalide) resolutions. The chemically distinct inhibitors occupy similar space within the enzyme's active site. The three inhibitors share hydrogen bonds with the side chain hydroxyls of Ser-164 and Tyr-178 via a carbonyl oxygen (pyroquilon and 1) or via a carbonyl oxygen and a ring oxygen (phthalide). Active site residues occupy similar positions among the three structures. A buried water molecule that is hydrogen bonded to the NZ nitrogen of Lys-182 in each of the three structures likely serves to stabilize the cationic form of the residue for participation in catalysis. The pro S hydrogen of NADPH (which is transferred as a hydride to the enzyme's naphthol substrates) is directed toward the carbonyl carbon of the inhibitors that mimic an intermediate along the reaction coordinate. Modeling tetrahydroxynaphthalene and trihydroxynaphthalene in the active site shows steric and electrostatic repulsion between the extra hydroxyl oxygen of the former substrate and the sulfur atom of Met-283 (the C-terminal residue), which accounts, in part, for the 4-fold greater substrate specificity for trihydroxynaphthalene over tetrahydroxynaphthalene.

  15. Revealing the Differences Between Free and Complexed Enzyme Mechanisms and Factors Contributing to Cell Wall Recalcitrance

    SciTech Connect (OSTI)

    Resch, M.

    2014-09-08

    Enzymatic depolymerization of polysaccharides is a key step in the production of fuels and chemicals from lignocellulosic biomass, and discovery of synergistic biomass-degrading enzyme paradigms will enable improved conversion processes. Historically, revealing insights into enzymatic saccharification mechanisms on plant cell walls has been hindered by uncharacterized substrates and low resolution imaging techniques. Also, translating findings between model substrates to intact biomass is critical for evaluating enzyme performance. Here we employ a fungal free enzyme cocktail, a complexed cellulosomal system, and a combination of the two to investigate saccharification mechanisms on cellulose I, II and III along with corn stover from Clean Fractionation (CF), which is an Organosolv pretreatment. The insoluble Cellulose Enriched Fraction (CEF) from CF contains mainly cellulose with minor amounts of residual hemicellulose and lignin, the amount of which depends on the CF pretreatment severity. Enzymatic digestions at both low and high-solids loadings demonstrate that CF reduces the amount of enzyme required to depolymerize polysaccharides relative to deacetylated, dilute acid pretreated corn stover. Transmission and scanning electron microscopy of the biomass provides evidence for the different mechanisms of enzymatic deconstruction between free and complexed enzyme systems, and reveals the basis for the synergistic relationship between the two enzyme paradigms on a process-relevant substrate for the first time. These results also demonstrate that the presence of lignin, rather than cellulose morphology, is more detrimental to cellulosome action than to free cellulases. As enzyme costs are a major economic driver for biorefineries, this study provides key inputs for the evaluation of CF as a pretreatment method for biomass conversion.

  16. Alteration of the mode of antibacterial action of a defensin by the amino-terminal loop substitution

    SciTech Connect (OSTI)

    Gao, Bin; Zhu, Shunyi

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer Al-M is an engineered fungal defensin with the n-loop of an insect defensin. Black-Right-Pointing-Pointer Al-M adopts a native defensin-like structure with high antibacterial potency. Black-Right-Pointing-Pointer Al-M kills bacteria through a membrane disruptive mechanism. Black-Right-Pointing-Pointer This work sheds light on the functional evolution of CS{alpha}{beta}-type defensins. -- Abstract: Ancient invertebrate-type and classical insect-type defensins (AITDs and CITDs) are two groups of evolutionarily related antimicrobial peptides (AMPs) that adopt a conserved cysteine-stabilized {alpha}-helical and {beta}-sheet (CS{alpha}{beta}) fold with a different amino-terminal loop (n-loop) size and diverse modes of antibacterial action. Although they both are identified as inhibitors of cell wall biosynthesis, only CITDs evolved membrane disruptive ability by peptide oligomerization to form pores. To understand how this occurred, we modified micasin, a fungus-derived AITDs with a non-membrane disruptive mechanism, by substituting its n-loop with that of an insect-derived CITDs. After air oxidization, the synthetic hybrid defensin (termed Al-M) was structurally identified by circular dichroism (CD) and functionally evaluated by antibacterial and membrane permeability assays and electronic microscopic observation. Results showed that Al-M folded into a native-like defensin structure, as determined by its CD spectrum that is similar to that of micasin. Al-M was highly efficacious against the Gram-positive bacterium Bacillus megaterium with a lethal concentration of 1.76 {mu}M. As expected, in contrast to micasin, Al-M killed the bacteria through a membrane disruptive mechanism of action. The alteration in modes of action supports a key role of the n-loop extension in assembling functional surface of CITDs for membrane disruption. Our work provides mechanical evidence for evolutionary relationship between AITDs and CITDs.

  17. Biopulping: A new energy-saving technology for papermaking

    SciTech Connect (OSTI)

    Scott, G.M.; Akhtar, M.; Lentz, M.J.; Kirk, T.K.; Swaney, R.; Shipley, D.F.

    1997-07-01

    Biopulping is defined as the treatment of wood chips with lignin-degrading fungi prior to pulping. Fungal pretreatment prior to mechanical pulping reduces electrical energy requirements during refining or increases mill throughput, improves paper strength, reduces the pitch content, reduces cooking time for sulfite pulping, and reduces the environmental impact of pulping. The recent work involved scaling up the biopulping process towards the industrial level, investigating both the engineering and economic feasibility of the technology. The authors envision the process to be done in either a chip-pile or silo-based system for which several factors need to be considered. These factors include the degree of decontamination, a hospitable environment for the fungus, and the overall process economics. Currently, treatment of the chips with low pressure steam is sufficient for decontamination. Furthermore, a simple, forced ventilation system can be used to maintain the proper temperature, humidity, and moisture content throughout the chip bed, thus promoting uniform growth of the fungus. The pilot-scale trial resulted in the successful treatment of 4 tons, of wood chips (dry weight basis) with results comparable to those on a laboratory scale. For mechanical pulping, a 2-week treatment results in approximately 30% energy savings that, considering the additional equipment and operating costs, results in an overall savings of $9 to $20/ton of pulp in a chip-pile system. The other benefits that biopulping confers improve the economics considerably A larger, 40-ton trial was also successful, with energy savings and paper properties comparable with the laboratory scale.

  18. Membership and Behavior of Ultra-Low-Diversity Pathogen Communities Present in the Gut of Humans during Prolonged Critical Illness

    SciTech Connect (OSTI)

    Zaborin, A.; Smith, D.; Garfield, K.; Quensen, J.; Shakhsheer, B.; Kade, M.; Tirrell, M.; Tiedje, J.; Gilbert, J. A.; Zaborina, O.; Alverdy, J. C.

    2014-09-23

    We analyzed the 16S rRNA amplicon composition in fecal samples of selected patients during their prolonged stay in an intensive care unit (ICU) and observed the emergence of ultra-low-diversity communities (1 to 4 bacterial taxa) in 30% of the patients. Bacteria associated with the genera Enterococcus and Staphylococcus and the family Enterobacteriaceae comprised the majority of these communities. The composition of cultured species from stool samples correlated to the 16S rRNA analysis and additionally revealed the emergence of Candida albicans and Candida glabrata in ~75% of cases. Four of 14 ICU patients harbored 2-member pathogen communities consisting of one Candida taxon and one bacterial taxon. Bacterial members displayed a high degree of resistance to multiple antibiotics. The virulence potential of the 2-member communities was examined in C. elegans during nutrient deprivation and exposure to opioids in order to mimic local conditions in the gut during critical illness. Under conditions of nutrient deprivation, the bacterial members attenuated the virulence of fungal members, leading to a “commensal lifestyle.” However, exposure to opioids led to a breakdown in this commensalism in 2 of the ultra-low-diversity communities. Application of a novel antivirulence agent (phosphate-polyethylene glycol [Pi-PEG]) that creates local phosphate abundance prevented opioid-induced virulence among these pathogen communities, thus rescuing the commensal lifestyle. To conclude, the gut microflora in critically ill patients can consist of ultra-low-diversity communities of multidrug-resistant pathogenic microbes. Local environmental conditions in gut may direct pathogen communities to adapt to either a commensal style or a pathogenic style.

  19. Membership and Behavior of Ultra-Low-Diversity Pathogen Communities Present in the Gut of Humans during Prolonged Critical Illness

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zaborin, A.; Smith, D.; Garfield, K.; Quensen, J.; Shakhsheer, B.; Kade, M.; Tirrell, M.; Tiedje, J.; Gilbert, J. A.; Zaborina, O.; et al

    2014-09-23

    We analyzed the 16S rRNA amplicon composition in fecal samples of selected patients during their prolonged stay in an intensive care unit (ICU) and observed the emergence of ultra-low-diversity communities (1 to 4 bacterial taxa) in 30% of the patients. Bacteria associated with the genera Enterococcus and Staphylococcus and the family Enterobacteriaceae comprised the majority of these communities. The composition of cultured species from stool samples correlated to the 16S rRNA analysis and additionally revealed the emergence of Candida albicans and Candida glabrata in ~75% of cases. Four of 14 ICU patients harbored 2-member pathogen communities consisting of one Candidamore » taxon and one bacterial taxon. Bacterial members displayed a high degree of resistance to multiple antibiotics. The virulence potential of the 2-member communities was examined in C. elegans during nutrient deprivation and exposure to opioids in order to mimic local conditions in the gut during critical illness. Under conditions of nutrient deprivation, the bacterial members attenuated the virulence of fungal members, leading to a “commensal lifestyle.” However, exposure to opioids led to a breakdown in this commensalism in 2 of the ultra-low-diversity communities. Application of a novel antivirulence agent (phosphate-polyethylene glycol [Pi-PEG]) that creates local phosphate abundance prevented opioid-induced virulence among these pathogen communities, thus rescuing the commensal lifestyle. To conclude, the gut microflora in critically ill patients can consist of ultra-low-diversity communities of multidrug-resistant pathogenic microbes. Local environmental conditions in gut may direct pathogen communities to adapt to either a commensal style or a pathogenic style.« less

  20. Alcohol Fuels Program technical review, Spring 1984

    SciTech Connect (OSTI)

    Not Available

    1984-10-01

    The alcohol fuels program consists of in-house and subcontracted research for the conversion of lignocellulosic biomass into fuel alcohols via thermoconversion and bioconversion technologies. In the thermoconversion area, the SERI gasifier has been operated on a one-ton per day scale and produces a clean, medium-Btu gas that can be used to manufacture methanol with a relatively small gas-water shift reaction requirement. Recent research has produced catalysts that make methanol and a mixture of higher alcohols from the biomass-derived synthetic gas. Three hydrolysis processes have emerged as candidates for more focused research. They are: a high-temperature, dilute-acid, plug-flow approach based on the Dartmouth reactor; steam explosion pretreatment followed by hydrolysis using the RUT-C30 fungal organism; and direct microbial conversion of the cellulose to ethanol using bacteria in a single or mixed culture. Modeling studies, including parametric and sensitivity analyses, have recently been completed. The results of these studies will lead to a better definition of the present state-of-the-art for these processes and provide a framework for establishing the research and process engineering issues that still need resolution. In addition to these modeling studies, economic feasibility studies are being carried out by commercial engineering firms. Their results will supplement and add commercial validity to the program results. The feasibility contractors will provide input at two levels: Technical and economic assessment of the current state-of-the-art in alcohol production from lignocellulosic biomass via thermoconversion to produce methanol and higher alcohol mixtures and bioconversion to produce ethanol; and identification of research areas having the potential to significantly reduce the cost of production of alcohols.

  1. Comparing bacterial community composition of healthy and dark spot-affected Siderastrea siderea in Florida and the Caribbean

    SciTech Connect (OSTI)

    Kellogg, Christina A.; Piceno, Yvette M.; Tom, Lauren M.; DeSantis, Todd Z.; Gray, Michael A.; Andersen, Gary L.; Mormile, Melanie R.

    2014-10-07

    Coral disease is one of the major causes of reef degradation. Dark Spot Syndrome (DSS) was described in the early 1990's as brown or purple amorphous areas of tissue on a coral and has since become one of the most prevalent diseases reported on Caribbean reefs. It has been identified in a number of coral species, but there is debate as to whether it is in fact the same disease in different corals. Further, it is questioned whether these macroscopic signs are in fact diagnostic of an infectious disease at all. The most commonly affected species in the Caribbean is the massive starlet coral Siderastrea siderea. We sampled this species in two locations, Dry Tortugas National Park and Virgin Islands National Park. Tissue biopsies were collected from both healthy colonies and those with dark spot lesions. Microbial-community DNA was extracted from coral samples (mucus, tissue, and skeleton), amplified using bacterial-specific primers, and applied to PhyloChip G3 microarrays to examine the bacterial diversity associated with this coral. Samples were also screened for the presence of a fungal ribotype that has recently been implicated as a causative agent of DSS in another coral species, but the amplifications were unsuccessful. S. siderea samples did not cluster consistently based on health state (i.e., normal versus dark spot). Various bacteria, including Cyanobacteria and Vibrios, were observed to have increased relative abundance in the discolored tissue, but the patterns were not consistent across all DSS samples. Overall, our findings do not support the hypothesis that DSS in S. siderea is linked to a bacterial pathogen or pathogens. This dataset provides the most comprehensive overview to date of the bacterial community associated with the scleractinian coral S. siderea.

  2. The mechanism of patulin's cytotoxicity and the antioxidant activity of indole tetramic acids

    SciTech Connect (OSTI)

    Riley, R.T.; Showker, J.L. )

    1991-06-01

    In LLC-PK1 cells exposed to patulin (50 microM), lipid peroxidation, abrupt calcium influx, extensive blebbing, and total LDH release appeared to be serially connected events with each representing a step in the loss of structural integrity of the plasma membrane. The aforementioned patulin-induced events were prevented by concurrent incubation with butylated hydroxytoluene, deferoxamine, and cyclopiazonic acid, a fungal metabolite. Patulin also caused depletion of nonprotein sulfhydryls, increased 86Rb+ efflux, dome collapse, and eventually the loss of cell viability. These events were not prevented by antioxidants, results consistent with the hypothesis that they were also serially connected but occurring parallel to those previously mentioned. The earliest events observed in patulin-treated cells were the decrease in nonprotein sulfhydryls and increase in 86Rb+ efflux (5 min) which occurred before statistically significant alterations in protein-bound sulfhydryls. The increased potassium efflux (86Rb+ efflux) occurred via a pathway distinct from BaCl2, quinine, or tetraethylammonium sensitive potassium channels. This is the first published report of the antioxidant activity of indole tetramic acids (cyclopiazonic acid and cyclopiazonic acid imine). The protective effect of tetramic acids in LLC-PK1 cells was restricted to indole tetramic acids, and their prevention of lipid peroxidation did not involve iron chelation. The results of this study demonstrate that cyclopiazonic acid is a potent inhibitor of azide-insensitive, ATP-dependent, a23187-sensitive calcium uptake by the lysate of LLC-PK1 cells. This result is consistent with the hypothesis that the endoplasmic reticulum calcium transport ATPase is a sensitive target for cyclopiazonic acid in LLC-PK1 cells.

  3. Crystallographic and kinetic study of riboflavin synthase from Brucella abortus, a chemotherapeutic target with an enhanced intrinsic flexibility

    SciTech Connect (OSTI)

    Serer, Mara I.; Bonomi, Hernn R.; Guimares, Beatriz G.; Rossi, Rolando C.; Goldbaum, Fernando A.; Klinke, Sebastin

    2014-05-01

    This work reports crystal structures of trimeric riboflavin synthase from the pathogen B. abortus both as the apo protein and in complex with several ligands of interest. It is shown that ligand binding drives the assembly of the unique active site of the trimer, and these findings are complemented by a detailed kinetic study on this enzyme, in which marked inhibition by substrate and product was observed. Riboflavin synthase (RS) catalyzes the last step of riboflavin biosynthesis in microorganisms and plants, which corresponds to the dismutation of two molecules of 6,7-dimethyl-8-ribityllumazine to yield one molecule of riboflavin and one molecule of 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione. Owing to the absence of this enzyme in animals and the fact that most pathogenic bacteria show a strict dependence on riboflavin biosynthesis, RS has been proposed as a potential target for antimicrobial drug development. Eubacterial, fungal and plant RSs assemble as homotrimers lacking C{sub 3} symmetry. Each monomer can bind two substrate molecules, yet there is only one active site for the whole enzyme, which is located at the interface between two neighbouring chains. This work reports the crystallographic structure of RS from the pathogenic bacterium Brucella abortus (the aetiological agent of the disease brucellosis) in its apo form, in complex with riboflavin and in complex with two different product analogues, being the first time that the structure of an intact RS trimer with bound ligands has been solved. These crystal models support the hypothesis of enhanced flexibility in the particle and also highlight the role of the ligands in assembling the unique active site. Kinetic and binding studies were also performed to complement these findings. The structural and biochemical information generated may be useful for the rational design of novel RS inhibitors with antimicrobial activity.

  4. Soil microbial responses to nitrogen addition in arid ecosystems

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sinsabaugh, Robert L.; Belnap, Jayne; Rudgers, Jennifer; Kuske, Cheryl R.; Martinez, Noelle; Sandquist, Darren

    2015-08-14

    The N cycle of arid ecosystems is influenced by low soil organic matter, high soil pH, and extremes in water potential and temperature that lead to open canopies and development of biological soil crusts (biocrusts). We investigated the effects of N amendment on soil microbial dynamics in a Larrea tridentata-Ambrosia dumosa shrubland site in southern Nevada USA. Sites were fertilized with a NO3-NH4 mix at 0, 7, and 15 kg N ha-1 y-1 from March 2012 to March 2013. In March 2013, biocrust (0–0.5 cm) and bulk soils (0–10 cm) were collected beneath Ambrosia canopies and in the interspaces betweenmore » plants. Biomass responses were assessed as bacterial and fungal SSU rRNA gene copy number and chlorophyll a concentration. Metabolic responses were measured by five ecoenzyme activities and rates of N transformation. With most measures, nutrient availability, microbial biomass, and process rates were greater in soils beneath the shrub canopy compared to the interspace between plants, and greater in the surface biocrust horizon compared to the deeper 10 cm soil profile. Most measures responded positively to experimental N addition. Effect sizes were generally greater for bulk soil than biocrust. Results were incorporated into a meta-analysis of arid ecosystem responses to N amendment that included data from 14 other studies. Effect sizes were calculated for biomass and metabolic responses. Regressions of effect sizes, calculated for biomass, and metabolic responses, showed similar trends in relation to N application rate and N load (rate × duration). The critical points separating positive from negative treatment effects were 88 kg ha-1 y-1 and 159 kg ha-1, respectively, for biomass, and 70 kg ha-1 y-1 and 114 kg ha-1, respectively, for metabolism. These critical values are comparable to those for microbial biomass, decomposition rates and respiration reported in broader meta-analyses of N amendment effects in mesic ecosystems. The large effect sizes at low N

  5. Biochemical and structural characterizations of two Dictyostelium cellobiohydrolases from the amoebozoa kingdom reveal a high level of conservation between distant phylogenetic trees of life

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad; Taylor, II, Larry E.; Borisova, Anna S.; Podkaminer, Kara K.; VanderWall, Todd A.; Himmel, Michael E.; Decker, Stephen R.; Beckham, Gregg T.; et al

    2016-04-01

    Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes often employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7Amore » and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7ACBM and DpuCel7ACBM, which were recombinantly expressed in T. reesei. DdiCel7ACBM and DpuCel7ACBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The Ki of cellobiose was significantly higher for DdiCel7ACBM and DpuCel7ACBM than for TreCel7A: 205, 130, and 29 μM, respectively. Finally, taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less

  6. Engineering towards a complete heterologous cellulase secretome in Yarrowia lipolytica reveals its potential for consolidated bioprocessing

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wei, Hui; Wang, Wei; Alahuhta, Markus; Vander Wall, Todd; Baker, John O.; Taylor, Larry E.; Decker, Stephen R.; Himmel, Michael E.; Zhang, Min

    2014-10-16

    degradation of cellulosic substrates. In Conclusion: Taken together, this work demonstrates the first case of successful expression of a chimeric CBHI with essentially full native activity in Y. lipolytica, and supports the notion that Y. lipolytica strains can be genetically engineered, ultimately by heterologous expression of fungal cellulases and other enzymes, to directly convert lignocellulosic substrates to biofuels.« less

  7. Soil microbial responses to nitrogen addition in arid ecosystems

    SciTech Connect (OSTI)

    Sinsabaugh, Robert L.; Belnap, Jayne; Rudgers, Jennifer; Kuske, Cheryl R.; Martinez, Noelle; Sandquist, Darren

    2015-08-14

    The N cycle of arid ecosystems is influenced by low soil organic matter, high soil pH, and extremes in water potential and temperature that lead to open canopies and development of biological soil crusts (biocrusts). We investigated the effects of N amendment on soil microbial dynamics in a Larrea tridentata-Ambrosia dumosa shrubland site in southern Nevada USA. Sites were fertilized with a NO3-NH4 mix at 0, 7, and 15 kg N ha-1 y-1 from March 2012 to March 2013. In March 2013, biocrust (0–0.5 cm) and bulk soils (0–10 cm) were collected beneath Ambrosia canopies and in the interspaces between plants. Biomass responses were assessed as bacterial and fungal SSU rRNA gene copy number and chlorophyll a concentration. Metabolic responses were measured by five ecoenzyme activities and rates of N transformation. With most measures, nutrient availability, microbial biomass, and process rates were greater in soils beneath the shrub canopy compared to the interspace between plants, and greater in the surface biocrust horizon compared to the deeper 10 cm soil profile. Most measures responded positively to experimental N addition. Effect sizes were generally greater for bulk soil than biocrust. Results were incorporated into a meta-analysis of arid ecosystem responses to N amendment that included data from 14 other studies. Effect sizes were calculated for biomass and metabolic responses. Regressions of effect sizes, calculated for biomass, and metabolic responses, showed similar trends in relation to N application rate and N load (rate × duration). The critical points separating positive from negative treatment effects were 88 kg ha-1 y-1 and 159 kg ha-1, respectively, for biomass, and 70 kg ha-1 y-1 and 114 kg ha-1, respectively, for metabolism. These critical values are comparable to those for microbial biomass, decomposition rates and respiration

  8. A simple novel device for air sampling by electrokinetic capture

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Gordon, Julian; Gandhi, Prasanthi; Shekhawat, Gajendra; Frazier, Angel; Hampton-Marcell, Jarrad; Gilbert, Jack A.

    2015-12-27

    A variety of different sampling devices are currently available to acquire air samples for the study of the microbiome of the air. All have a degree of technical complexity that limits deployment. Here, we evaluate the use of a novel device, which has no technical complexity and is easily deployable. An air-cleaning device powered by electrokinetic propulsion has been adapted to provide a universal method for collecting samples of the aerobiome. Plasma-induced charge in aerosol particles causes propulsion to and capture on a counter-electrode. The flow of ions creates net bulk airflow, with no moving parts. A device and electrodemore » assembly have been re-designed from air-cleaning technology to provide an average air flow of 120 lpm. This compares favorably with current air sampling devices based on physical air pumping. Capture efficiency was determined by comparison with a 0.4 μm polycarbonate reference filter, using fluorescent latex particles in a controlled environment chamber. Performance was compared with the same reference filter method in field studies in three different environments. For 23 common fungal species by quantitative polymerase chain reaction (qPCR), there was 100 % sensitivity and apparent specificity of 87%, with the reference filter taken as “gold standard.” Further, bacterial analysis of 16S RNA by amplicon sequencing showed equivalent community structure captured by the electrokinetic device and the reference filter. Unlike other current air sampling methods, capture of particles is determined by charge and so is not controlled by particle mass. We analyzed particle sizes captured from air, without regard to specific analyte by atomic force microscopy: particles at least as low as 100 nM could be captured from ambient air. This work introduces a very simple plug-and-play device that can sample air at a high-volume flow rate with no moving parts and collect particles down to the sub-micron range. In conclusion, the performance of

  9. Microbial Mechanisms Enhancing Soil C Storage

    SciTech Connect (OSTI)

    Zak, Donald

    2015-09-24

    storage. Our preliminary results support the hypothesis that simulated N deposition has down-regulated the transcription of fungal genes encoding lignocellulolytic enzymes, thereby slowing litter decay and substantially increasing soil C storage over a relative short duration. The objective of this study was to understand the molecular mechanisms and metabolic processes by which simulated N deposition has slowed microbial decay of plant detritus, thereby increasing soil C storage in the wide-spread and ecologically important northern forest ecosystem. We addressed our research objective using a combination of transcriptomic and metatranscriptomic approaches in parallel with biogeochemical analyses of soil C cycling. By linking the environmental regulation of microbial genes to biogeochemical processes, we endeavor to understanding the enhanced accumulation of soil C in response to a wide-spread agent of global change.

  10. A simple novel device for air sampling by electrokinetic capture

    SciTech Connect (OSTI)

    Gordon, Julian; Gandhi, Prasanthi; Shekhawat, Gajendra; Frazier, Angel; Hampton-Marcell, Jarrad; Gilbert, Jack A.

    2015-12-27

    A variety of different sampling devices are currently available to acquire air samples for the study of the microbiome of the air. All have a degree of technical complexity that limits deployment. Here, we evaluate the use of a novel device, which has no technical complexity and is easily deployable. An air-cleaning device powered by electrokinetic propulsion has been adapted to provide a universal method for collecting samples of the aerobiome. Plasma-induced charge in aerosol particles causes propulsion to and capture on a counter-electrode. The flow of ions creates net bulk airflow, with no moving parts. A device and electrode assembly have been re-designed from air-cleaning technology to provide an average air flow of 120 lpm. This compares favorably with current air sampling devices based on physical air pumping. Capture efficiency was determined by comparison with a 0.4 μm polycarbonate reference filter, using fluorescent latex particles in a controlled environment chamber. Performance was compared with the same reference filter method in field studies in three different environments. For 23 common fungal species by quantitative polymerase chain reaction (qPCR), there was 100 % sensitivity and apparent specificity of 87%, with the reference filter taken as “gold standard.” Further, bacterial analysis of 16S RNA by amplicon sequencing showed equivalent community structure captured by the electrokinetic device and the reference filter. Unlike other current air sampling methods, capture of particles is determined by charge and so is not controlled by particle mass. We analyzed particle sizes captured from air, without regard to specific analyte by atomic force microscopy: particles at least as low as 100 nM could be captured from ambient air. This work introduces a very simple plug-and-play device that can sample air at a high-volume flow rate with no moving parts and collect particles down to the sub-micron range. In conclusion, the performance of the

  11. HAM-5 functions as a MAP kinase scaffold during cell fusion in Neurospora crassa

    SciTech Connect (OSTI)

    Jonkers, Wilfried; Leeder, Abigail C.; Ansong, Charles; Wang, Yuexi; Yang, Feng; Starr, Trevor L.; Camp, II, David G.; Smith, Richard D.; Glass, N. Louise; Heitman, Joseph

    2014-11-20

    Cell fusion in genetically identical Neurospora crassa germlings and in hyphae is a highly regulated process involving the activation of a conserved MAP kinase cascade that includes NRC1, MEK2 and MAK2. During chemotrophic growth in germlings, the MAP kinase cascade members localize to conidial anastomosis tube (CAT) tips every 4 minutes, perfectly out of phase with another protein that is recruited to the tip: SOFT, a protein of unknown biochemical function. How this oscillation process is initiated, maintained and what proteins regulate the MAP kinase cascade is currently unclear. A global phosphoproteomics approach using an allele of mak-2 (mak-2Q100G) that can be specifically inhibited by the ATP analog 1NM-PP1 was utilized to identify MAK2 kinase targets in germlings that were potentially involved in this process. One such putative target was HAM5, a protein of unknown biochemical function. Previously, Δham-5 mutants were shown to be deficient for hyphal fusion. Here we show that HAM5-GFP co-localized with NRC1, MEK2 and MAK2 and oscillated with identical dynamics from the cytoplasm to CAT tips during chemotropic interactions. In the Δmak-2 strain, HAM5-GFP localized to punctate complexes that did not oscillate, but still localized to the germling tip, suggesting that MAK2 activity influences HAM5 function/localization. However, MAK2-GFP showed only cytoplasmic and nuclear localization in a Δham-5 strain and did not localize to puncta, as observed in wild type germlings. Via co-immunoprecipitation experiments, HAM5 was shown to physically interact with MAK2, MEK2 and NRC1, suggesting that it functions as a scaffold/transport hub for the MAP kinase cascade members during oscillation and chemotropic interactions during both germling and hyphal fusion in N. crassa. The identification of HAM5 as a scaffold-like protein will help to link the activation of MAK2 to upstream factors and other proteins involved in this intriguing process of fungal

  12. Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; Wang, Jianping; Li, Leiting; Zhu, Lin; Zhang, Xingtan; Chen, Youqiang; Ming, Ray

    2016-06-10

    Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can

  13. A structural account of substrate and inhibitor specificity differences between two Naphthol reductases

    SciTech Connect (OSTI)

    Liao, D.-I.; Thompson, J.E.; Fahnestock, S.; Valent, B.; Jordan, D.B.

    2010-03-08

    Two short chain dehydrogenase/reductases mediate naphthol reduction reactions in fungal melanin biosynthesis. An X-ray structure of 1,3,6,8-tetrahydroxynaphthalene reductase (4HNR) complexed with NADPH and pyroquilon was determined for examining substrate and inhibitor specificities that differ from those of 1,3,8-trihydroxynaphthalene reductase (3HNR). The 1.5 {angstrom} resolution structure allows for comparisons with the 1.7 {angstrom} resolution structure of 3HNR complexed with the same ligands. The sequences of the two proteins are 46% identical, and they have the same fold. The 30-fold lower affinity of the 4HNR-NADPH complex for pyroquilon (a commercial fungicide that targets 3HNR) in comparison to that of the 3HNR-NADPH complex can be explained by unfavorable interactions between the anionic carboxyl group of the C-terminal Ile282 of 4HNR and CH and CH{sub 2} groups of the inhibitor that are countered by favorable inhibitor interactions with 3HNR. 1,3,8-Trihydroxynaphthalene (3HN) and 1,3,6,8-tetrahydroxynaphthalene (4HN) were modeled onto the cyclic structure of pyroquilon in the 4HNR-NADPH-pyroquilon complex to examine the 300-fold preference of the enzyme for 4HN over 3HN. The models suggest that the C-terminal carboxyl group of Ile282 has a favorable hydrogen bonding interaction with the C6 hydroxyl group of 4HN and an unfavorable interaction with the C6 CH group of 3HN. Models of 3HN and 4HN in the 3HNR active site suggest a favorable interaction of the sulfur atom of the C-terminal Met283 with the C6 CH group of 3HN and an unfavorable one with the C6 hydroxyl group of 4HN, accounting for the 4-fold difference in substrate specificities. Thus, the C-terminal residues of the two naphthol reductase are determinants of inhibitor and substrate specificities.

  14. Identification and characterization of core cellulolytic enzymes from Talaromyces cellulolyticus (formerly Acremonium cellulolyticus) critical for hydrolysis of lignocellulosic biomass

    SciTech Connect (OSTI)

    Inoue, Hiroyuki; Decker, Stephen R.; Taylor, Larry E.; Yano, Shinichi; Sawayama, Shigeki

    2014-10-09

    Background: Enzymatic hydrolysis of pretreated lignocellulosic biomass is an essential process for the production of fermentable sugars for industrial use. A better understanding of fungal cellulase systems will provide clues for maximizing the hydrolysis of target biomass. Talaromyces cellulolyticus is a promising fungus for cellulase production and efficient biomass hydrolysis. Several cellulolytic enzymes purified from T. cellulolyticus were characterized in earlier studies, but the core enzymes critical for hydrolysis of lignocellulosic biomass remain unknown. Results: Six cellulolytic enzymes critical for the hydrolysis of crystalline cellulose were purified from T. cellulolyticus culture supernatant using an enzyme assay based on synergistic hydrolysis of Avicel. The purified enzymes were identified by their substrate specificities and analyses of trypsin-digested peptide fragments and were classified into the following glycosyl hydrolase (GH) families: GH3 (β-glucosidase, Bgl3A), GH5 (endoglucanase, Cel5A), GH6 (cellobiohydrolase II, Cel6A), GH7 (cellobiohydrolase I and endoglucanase, Cel7A and Cel7B, respectively), and GH10 (xylanase, Xyl10A). Hydrolysis of dilute acid-pretreated corn stover (PCS) with mixtures of the purified enzymes showed that Cel5A, Cel7B, and Xyl10A each had synergistic effects with a mixture of Cel6A and Cel7A. Cel5A seemed to be more effective in the synergistic hydrolysis of the PCS than Cel7B. The ratio of Cel5A, Cel6A, Cel7A, and Xyl10A was statistically optimized for the hydrolysis of PCS glucan in the presence of Bgl3A. The resultant mixture achieved higher PCS glucan hydrolysis at lower enzyme loading than a culture filtrate from T. cellulolyticus or a commercial enzyme preparation, demonstrating that the five enzymes play a role as core enzymes in the hydrolysis of PCS glucan. In Conclusion: Core cellulolytic enzymes in the T. cellulolyticus cellulase system were identified to Cel5A, Cel6A, Cel7A, Xyl10A, and Bgl3A and

  15. HAM-5 functions as a MAP kinase scaffold during cell fusion in Neurospora crassa

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jonkers, Wilfried; Leeder, Abigail C.; Ansong, Charles; Wang, Yuexi; Yang, Feng; Starr, Trevor L.; Camp, II, David G.; Smith, Richard D.; Glass, N. Louise; Heitman, Joseph

    2014-11-20

    Cell fusion in genetically identical Neurospora crassa germlings and in hyphae is a highly regulated process involving the activation of a conserved MAP kinase cascade that includes NRC1, MEK2 and MAK2. During chemotrophic growth in germlings, the MAP kinase cascade members localize to conidial anastomosis tube (CAT) tips every 4 minutes, perfectly out of phase with another protein that is recruited to the tip: SOFT, a protein of unknown biochemical function. How this oscillation process is initiated, maintained and what proteins regulate the MAP kinase cascade is currently unclear. A global phosphoproteomics approach using an allele of mak-2 (mak-2Q100G) thatmore » can be specifically inhibited by the ATP analog 1NM-PP1 was utilized to identify MAK2 kinase targets in germlings that were potentially involved in this process. One such putative target was HAM5, a protein of unknown biochemical function. Previously, Δham-5 mutants were shown to be deficient for hyphal fusion. Here we show that HAM5-GFP co-localized with NRC1, MEK2 and MAK2 and oscillated with identical dynamics from the cytoplasm to CAT tips during chemotropic interactions. In the Δmak-2 strain, HAM5-GFP localized to punctate complexes that did not oscillate, but still localized to the germling tip, suggesting that MAK2 activity influences HAM5 function/localization. However, MAK2-GFP showed only cytoplasmic and nuclear localization in a Δham-5 strain and did not localize to puncta, as observed in wild type germlings. Via co-immunoprecipitation experiments, HAM5 was shown to physically interact with MAK2, MEK2 and NRC1, suggesting that it functions as a scaffold/transport hub for the MAP kinase cascade members during oscillation and chemotropic interactions during both germling and hyphal fusion in N. crassa. The identification of HAM5 as a scaffold-like protein will help to link the activation of MAK2 to upstream factors and other proteins involved in this intriguing process of fungal

  16. Biochemical and Structural Characterization of Two Dictyostelium Cellobiohydrolases from the Amoebozoa Kingdom Reveal a High Level of Conservation Between Distant Phylogenetic Trees of Life

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad; Taylor, II, Larry E.; Borisova, Anna S.; Podkaminer, Kara K.; VanderWall, Todd A.; Himmel, Michael E.; Decker, Stephen R.; Beckham, Gregg T.; et al

    2016-06-01

    Glycoside Hydrolase Family 7 (GH7) cellobiohydrolases (CBHs) are commonly employed enzymes in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions remain regarding structure-activity relationships in these important natural and commercial enzymes. Here, we present crystal structures and biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum and Dictyostelium purpureum (DdiCel7A and DpuCel7A, respectively). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures, resolved to 2.1 Amore » (DdiCel7A), and 2.7 A (DpuCel7A), are homologous to other GH7 CBHs with an enclosed active site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH from Trichoderma reesei Cel7A (TreCel7A) occur near the hydrolytic active site and the product binding sites. To compare the activity of these enzymes with TreCel7A, the Family 1 TreCel7A CBM and linker was added to the C-terminus of the Dictyostelium enzymes, DdiCel7ACBM and DpuCel7ACBM, which were recombinantly expressed in T. reesei. DdiCel7ACBM and DpuCel7ACBM hydrolyze Avicel, pretreated corn stover, and phosphoric acid swollen cellulose as efficiently as TreCel7A when compared at their temperature optima. The Ki of cellobiose is significantly higher for DdiCel7ACBM and DpuCel7ACBM than for TreCel7A: 205, 130, and 29 uM, respectively. Taken together, the present study highlights the remarkable conservation in the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less

  17. Engineering towards a complete heterologous cellulase secretome in Yarrowia lipolytica reveals its potential for consolidated bioprocessing

    SciTech Connect (OSTI)

    Wei, Hui; Wang, Wei; Alahuhta, Markus; Vander Wall, Todd; Baker, John O.; Taylor, Larry E.; Decker, Stephen R.; Himmel, Michael E.; Zhang, Min

    2014-10-16

    degradation of cellulosic substrates. In Conclusion: Taken together, this work demonstrates the first case of successful expression of a chimeric CBHI with essentially full native activity in Y. lipolytica, and supports the notion that Y. lipolytica strains can be genetically engineered, ultimately by heterologous expression of fungal cellulases and other enzymes, to directly convert lignocellulosic substrates to biofuels.

  18. Identification and characterization of core cellulolytic enzymes from Talaromyces cellulolyticus (formerly Acremonium cellulolyticus) critical for hydrolysis of lignocellulosic biomass

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Inoue, Hiroyuki; Decker, Stephen R.; Taylor, Larry E.; Yano, Shinichi; Sawayama, Shigeki

    2014-10-09

    Background: Enzymatic hydrolysis of pretreated lignocellulosic biomass is an essential process for the production of fermentable sugars for industrial use. A better understanding of fungal cellulase systems will provide clues for maximizing the hydrolysis of target biomass. Talaromyces cellulolyticus is a promising fungus for cellulase production and efficient biomass hydrolysis. Several cellulolytic enzymes purified from T. cellulolyticus were characterized in earlier studies, but the core enzymes critical for hydrolysis of lignocellulosic biomass remain unknown. Results: Six cellulolytic enzymes critical for the hydrolysis of crystalline cellulose were purified from T. cellulolyticus culture supernatant using an enzyme assay based on synergistic hydrolysismore » of Avicel. The purified enzymes were identified by their substrate specificities and analyses of trypsin-digested peptide fragments and were classified into the following glycosyl hydrolase (GH) families: GH3 (β-glucosidase, Bgl3A), GH5 (endoglucanase, Cel5A), GH6 (cellobiohydrolase II, Cel6A), GH7 (cellobiohydrolase I and endoglucanase, Cel7A and Cel7B, respectively), and GH10 (xylanase, Xyl10A). Hydrolysis of dilute acid-pretreated corn stover (PCS) with mixtures of the purified enzymes showed that Cel5A, Cel7B, and Xyl10A each had synergistic effects with a mixture of Cel6A and Cel7A. Cel5A seemed to be more effective in the synergistic hydrolysis of the PCS than Cel7B. The ratio of Cel5A, Cel6A, Cel7A, and Xyl10A was statistically optimized for the hydrolysis of PCS glucan in the presence of Bgl3A. The resultant mixture achieved higher PCS glucan hydrolysis at lower enzyme loading than a culture filtrate from T. cellulolyticus or a commercial enzyme preparation, demonstrating that the five enzymes play a role as core enzymes in the hydrolysis of PCS glucan. In Conclusion: Core cellulolytic enzymes in the T. cellulolyticus cellulase system were identified to Cel5A, Cel6A, Cel7A, Xyl10A, and Bgl3A

  19. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    SciTech Connect (OSTI)

    Grigoriev, Igor V.; Baker, Scott E.; Andersen, Mikael R.; Salazar, Margarita P.; Schaap, Peter J.; Vondervoot, Peter J.I. van de; Culley, David; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristen F.; Albang, Richard; Albermann, Kaj; Berka, Randy M.; Braus, Gerhard H.; Braus-Stromeyer, Susanna A.; Corrochano, Luis M.; Dai, Ziyu; Dijck, Piet W.M. van; Hofmann, Gerald; Lasure, Linda L.; Magnusson, Jon K.; Meijer, Susan L.; Nielsen, Jakob B.; Nielsen, Michael L.; Ooyen, Albert J.J. van; Panther, Kathyrn S.; Pel, Herman J.; Poulsen, Lars; Samson, Rob A.; Stam, Hen; Tsang, Adrian; Brink, Johannes M. van den; Atkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Kubicek, Christian P.; Martinez, Diego; Peij, Noel N.M.E. van; Roubos, Johannes A.; Nielsen, Jens

    2011-04-28

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up-regulation of genes relevant to glucoamylase A production, such as tRNA-synthases and protein transporters. Our results and datasets from this integrative systems biology analysis resulted in a snapshot of fungal evolution and will support further optimization of cell factories based on filamentous fungi.[Supplemental materials (10 figures, three text documents and 16 tables) have been made available

  20. Interactive Effects of Climate Change and Decomposer Communities on the Stabilization of Wood-Derived Carbon Pools: Catalyst for a New Study

    SciTech Connect (OSTI)

    Resh, Sigrid C.

    2014-11-17

    Globally, forest soils store ~two-thirds as much carbon (C) as the atmosphere. Although wood makes up the majority of forest biomass, the importance of wood contributions to soil C pools is unknown. Even with recent advances in the mechanistic understanding of soil processes, integrative studies tracing C input pathways and biological fluxes within and from soils are lacking. Therefore, our research objectives were to assess the impact of different fungal decay pathways (i.e., white-rot versus brown-rot)—in interaction with wood quality, soil temperature, wood location (i.e., soil surface and buried in mineral soil), and soil texture—on the transformation of woody material into soil CO2 efflux, dissolved organic carbon (DOC), and soil C pools. The use of 13C-depleted woody biomass harvested from the Rhinelander, WI free-air carbon dioxide enrichment (Aspen-FACE) experiment affords the unique opportunity to distinguish the wood-derived C from other soil C fluxes and pools. We established 168 treatment plots across six field sites (three sand and three loam textured soil). Treatment plots consisted of full-factorial design with the following treatments: 1. Wood chips from elevated CO2, elevated CO2 + O3, or ambient atmosphere AspenFACE treatments; 2. Inoculated with white rot (Bjerkandera adusta) or brown rot (Gloeophyllum sepiarium) pure fungal cultures, or the original suite of endemic microbial community on the logs; and 3. Buried (15cm in soil as a proxy for coarse roots) or surface applied wood chips. We also created a warming treatment using open-topped, passive warming chambers on a subset of the above treatments. Control plots with no added wood (“no chip control”) were incorporated into the research design. Soils were sampled for initial δ13C values, CN concentrations, and bulk density. A subset of plots were instrumented with lysimeters for sampling soil water and temperature data loggers for measuring soil temperatures. To determine the early

  1. Sugar-Based Ethanol Biorefinery: Ethanol, Succinic Acid and By-Product Production

    SciTech Connect (OSTI)

    Donal F. Day

    2009-03-31

    The work conducted in this project is an extension of the developments itemized in DE-FG-36-04GO14236. This program is designed to help the development of a biorefinery based around a raw sugar mill, which in Louisiana is an underutilized asset. Some technical questions were answered regarding the addition of a biomass to ethanol facility to existing sugar mills. The focus of this work is on developing technology to produce ethanol and valuable by-products from bagasse. Three major areas are addressed, feedstock storage, potential by-products and the technology for producing ethanol from dilute ammonia pre-treated bagasse. Sugar mills normally store bagasse in a simple pile. During the off season there is a natural degradation of the bagasse, due to the composting action of microorganisms in the pile. This has serious implications if bagasse must be stored to operate a bagasse/biorefinery for a 300+ day operating cycle. Deterioration of the fermentables in bagasse was found to be 6.5% per month, on pile storage. This indicates that long term storage of adequate amounts of bagasse for year-round operation is probably not feasible. Lignin from pretreatment seemed to offer a potential source of valuable by-products. Although a wide range of phenolic compounds were present in the effluent from dilute ammonia pretreatment, the concentrations of each (except for benzoic acid) were too low to consider for extraction. The cellulosic hydrolysis system was modified to produce commercially recoverable quantities of cellobiose, which has a small but growing market in the food process industries. A spin-off of this led to the production of a specific oligosaccharide which appears to have both medical and commercial implications as a fungal growth inhibitor. An alternate use of sugars produced from biomass hydrolysis would be to produce succinic acid as a chemical feedstock for other conversions. An organism was developed which can do this bioconversion, but the economics of

  2. Missing links in the root-soil organic matter continuum

    SciTech Connect (OSTI)

    O'Brien, Sarah L.; Iversen, Colleen M

    2009-01-01

    range of soil processes, from the exudation of labile C compounds to the development of fungal associations. For example, Zoe Cardon demonstrated that the root-mediated redistribution of deep soil water to relatively dry shallower soil, increased soil CO{sub 2} efflux and nutrient cycling near the surface in an arid ecosystem. Andrew Kulmatiski also discussed the importance of rooting distribution throughout the soil profile for strategies of water uptake by different species in an African savanna. Later, Julie Jastrow demonstrated that living roots shape soil physical structure by promoting the formation of soil aggregates, which facilitated accrual of SOM in restored grasslands. Taken together, the evidence is compelling that living roots, and organic matter derived from root detritus, are important parts of the continuum of organic matter in the soil. Larger soil organisms (i.e. 50 {micro}m to many cm in body size) play an important role in the root-SOM continuum by grazing on roots and microbes, comminuting organic matter and aggregating soil in fecal pellets. However, litterbag and soil incubation studies necessarily exclude invertebrates, and research on faunal activity and trophic dynamics tends to be independent from research on the biogeochemistry of SOM cycling. Tim Filley used plant-derived biomarkers in invertebrate residues to bridge the gap between larger soil organisms, such as earthworms and beetle larvae, and SOM distribution. He found that larger soil organisms help to stabilize root-derived organic matter in soil aggregates. Similar coupling of biogeochemistry with food web studies could prove fruitful for describing mechanisms that underlie critical ecosystem processes. Despite considerable research efforts, the breadth of the microbial role in the root-SOM continuum remains unresolved. Using advanced pyrosequencing techniques, David Nelson demonstrated the importance of archea as nitrifiers in agricultural systems exposed to elevated [CO{sub 2

  3. Microbial Cell Imaging

    SciTech Connect (OSTI)

    Doktycz, Mitchel John; Sullivan, Claretta; Mortensen, Ninell P; Allison, David P

    2011-01-01

    the maximum scan size (roughly 100 x 100 {mu}m) and the restricted movement of the cantilever in the Z (or height) direction. In most commercial AFMs, the Z range is restricted to roughly 10 {mu}m such that the height of cells to be imaged must be seriously considered. Nevertheless, AFM can provide structural-functional information at nanometer resolution and do so in physiologically relevant environments. Further, instrumentation for scanning probe microscopy continues to advance. Systems for high-speed imaging are becoming available, and techniques for looking inside the cells are being demonstrated. The ability to combine AFM with other imaging modalities is likely to have an even greater impact on microbiological studies. AFM studies of intact microbial cells started to appear in the literature in the 1990s. For example, AFM studies of Saccharomyces cerevisiae examined buddings cars after cell division and detailed changes related to cell growth processes. Also, the first AFM studies of bacterial biofilms appeared. In the late 1990s, AFM studies of intact fungal spores described clear changes in spore surfaces upon germination, and studies of individual bacterial cells were also described. These early bacterial imaging studies examined changes in bacterial morphology due to antimicrobial peptides exposure and bacterial adhesion properties. The majority of these early studies were carried out on dried samples and took advantage of the resolving power of AFM. The lack of cell mounting procedures presented an impediment for cell imaging studies. Subsequently, several approaches to mounting microbial cells have been developed, and these techniques are described later. Also highlighted are general considerations for microbial imaging and a description of some of the various applications of AFM to microbiology.

  4. Trypanosoma Cruzi Cyp51 Inhibitor Derived from a Mycobacterium Tuberculosis Screen Hit

    SciTech Connect (OSTI)

    Chen, Chiung-Kuang; Doyle, Patricia S.; Yermalitskaya, Liudmila V.; Mackey, Zachary B.; Ang, Kenny K.H.; McKerrow, James H.; Podust, Larissa M.

    2009-02-18

    The two front-line drugs for chronic Trypanosoma cruzi infections are limited by adverse side-effects and declining efficacy. One potential new target for Chagas disease chemotherapy is sterol 14{alpha}-demethylase (CYP51), a cytochrome P450 enzyme involved in biosynthesis of membrane sterols. In a screening effort targeting Mycobacterium tuberculosis CYP51 (CYP51{sub Mt}), we previously identified the N-[4-pyridyl]-formamide moiety as a building block capable of delivering a variety of chemotypes into the CYP51 active site. In that work, the binding modes of several second generation compounds carrying this scaffold were determined by high-resolution co-crystal structures with CYP51{sub Mt}. Subsequent assays against the CYP51 orthologue in T. cruzi, CYP51{sub Tc}, demonstrated that two of the compounds tested in the earlier effort bound tightly to this enzyme. Both were tested in vitro for inhibitory effects against T. cruzi and the related protozoan parasite Trypanosoma brucei, the causative agent of African sleeping sickness. One of the compounds had potent, selective anti-T. cruzi activity in infected mouse macrophages. Cure of treated host cells was confirmed by prolonged incubation in the absence of the inhibiting compound. Discrimination between T. cruzi and T. brucei CYP51 by the inhibitor was largely based on the variability (phenylalanine versus isoleucine) of a single residue at a critical position in the active site. CYP51{sub Mt}-based crystal structure analysis revealed that the functional groups of the two tightly bound compounds are likely to occupy different spaces in the CYP51 active site, suggesting the possibility of combining the beneficial features of both inhibitors in a third generation of compounds to achieve more potent and selective inhibition of CYP51{sub Tc}. Enzyme sterol 14{alpha}-demethylase (CYP51) is a well-established target for anti-fungal therapy and is a prospective target for Chagas disease therapy. We previously identified a

  5. Causes of Indoor Air Quality Problems in Schools: Summary of Scientific Research

    SciTech Connect (OSTI)

    Bayer, C.W.

    2001-02-22

    In the modern urban setting, most individuals spend about 80% of their time indoors and are therefore exposed to the indoor environment to a much greater extent than to the outdoors (Lebowitz 1992). Concomitant with this increased habitation in urban buildings, there have been numerous reports of adverse health effects related to indoor air quality (IAQ) (sick buildings). Most of these buildings were built in the last two decades and were constructed to be energy-efficient. The quality of air in the indoor environment can be altered by a number of factors: release of volatile compounds from furnishings, floor and wall coverings, and other finishing materials or machinery; inadequate ventilation; poor temperature and humidity control; re-entrainment of outdoor volatile organic compounds (VOCs); and the contamination of the indoor environment by microbes (particularly fungi). Armstrong Laboratory (1992) found that the three most frequent causes of IAQ are (1) inadequate design and/or maintenance of the heating, ventilation, and air-conditioning (HVAC) system, (2) a shortage of fresh air, and (3) lack of humidity control. A similar study by the National Institute for Occupational Safety and Health (NIOSH 1989) recognized inadequate ventilation as the most frequent source of IAQ problems in the work environment (52% of the time). Poor IAQ due to microbial contamination can be the result of the complex interactions of physical, chemical, and biological factors. Harmful fungal populations, once established in the HVAC system or occupied space of a modern building, may episodically produce or intensify what is known as sick building syndrome (SBS) (Cummings and Withers 1998). Indeed, SBS caused by fungi may be more enduring and recalcitrant to treatment than SBS from multiple chemical exposures (Andrae 1988). An understanding of the microbial ecology of the indoor environment is crucial to ultimately resolving many IAQ problems. The incidence of SBS related to multiple

  6. Development of Geothermally Assisted Process for Production of Liquid Fuels and Chemicals from Wheat Straw

    SciTech Connect (OSTI)

    Murphy, V.G.; Linden, J.C.; Moreira, A.R.; Lenz, T.G.

    1981-06-01

    Recently there has been much interest in developing processes for producing liquid fuels from renewable resources. The most logical long term approach in terms of economics derives the carbohydrate substrate for fermentation from the hydrolysis of cellulosic crop and forest residues rather than from grains or other high grade food materials (1,2). Since the presence of lignin is the main barrier to the hydrolysis of cellulose from lignocellulosic materials, delignification processes developed by the wood pulping industry have been considered as possible prehydrolysis treatments. The delignification process under study in our laboratory is envisioned as a synthesis of two recently developed pulping processes. In the first step, called autohydrolysis, hot water is used directly to solubilize hemicellulose and to depolymerize lignin (3). Then, in a second step known as organosolv pulping (4), the autohydrolyzed material is extracted with aqueous alcohol. A s shown in Figure 1, this process can separate the original lignocellulosic material into three streams--hemicellulose in water, lignin in aqueous alcohol, and a cellulose pulp. Without further mechanical milling, delignified cellulose can be enzymatically hydrolyzed at 45-50 C to greater than 80% theoretical yield of glucose using fungal cellulases (5, 6). The resulting glucose syrup can then be fermented by yeast to produce ethanol or by selected bacteria to produce acetone and butanol or acetic and propionic acids (7). One objection to such a process, however, is the large energy input that is required. In order to extend our supplies of liquid fuels and chemicals, it is important that the use of fossil fuels in any lignocellulosic conversion process be minimized. The direct use of geothermal hot water in carrying out the autohydrolysis and extraction operations, therefore, seems especially attractive. On the one hand, it facilitates the conversion of non-food biomass to fuels and chemicals without wasting fossil

  7. Kelt Reconditioning: A Research Project to Enhance Iteroparity in Columbia Basin Steelhead (Oncorhynchus mykiss), 2005 Annual Report.

    SciTech Connect (OSTI)

    Branstetter, Ryan; Whiteaker, John; Hatch, Douglas R.

    2006-01-01

    months of long-term reconditioning) or for the duration of the experiment. Long-term steelhead kelts also received Moore-Clark pellets to provide essential minerals and nutrients necessary for gonadal redevelopment. Oxytetracycline was administered to all reconditioned fish to boost immune system response following the stress of initial capture. To control parasitic infestations two methods were used: an intubation of Ivermectin{trademark} was administered to control internal parasites (e.g., Salmincola spp). and, a Formalin drip system was administered via drip system for the duration of reconditioning to prevent fungal outbreaks. From the steelhead kelts collected at the CJMF, four experimental groups were established; in-river release, direct transport and release, short-term reconditioning and long-term reconditioning. Short-term kelts were reconditioned for 3 to 5 weeks. Surviving specimens were released on May 13, 2005 and June 30, 2005. Long-term steelhead kelts are currently being held for a 6-9 month period with a scheduled release in late November 2005.

  8. Kelt Reconditioning: A Research Project to Enhance Iteroparity in Columbia Basin Steelhead (Oncorhynchus mykiss), 2005-2006 Annual Report.

    SciTech Connect (OSTI)

    Branstetter, Ryan; Whiteaker, John; Hatch, Douglas R.

    2006-12-01

    months of long-term reconditioning) or for the duration of the experiment. Long-term steelhead kelts also received Moore-Clark pellets to provide essential minerals and nutrients necessary for gonadal redevelopment. Oxytetracycline was administered to all reconditioned fish to boost immune system response following the stress of initial capture. To control parasitic infestations two methods were used: an intubation of Ivermectin{trademark} was administered to control internal parasites (e.g., Salmincola spp.) and, a Formalin drip system was administered via drip system for the duration of reconditioning to prevent fungal outbreaks. From the steelhead kelts collected at the CJMF, four experimental groups were established; in-river release, direct transport and release, short-term reconditioning and long-term reconditioning. Short-term kelts were reconditioned for 3 to 5 weeks. Surviving specimens were released on May 15, 2006 and June 27, 2006. Long-term steelhead kelts were held for a 6-9 month period with a release in October 18, 2006. No-term release kelts and short-term reconditioned kelts received PIT-tags with a portion of each group receiving hydro-acoustic tags to assess return survival, travel time, and migratory behavior below Bonneville Dam. In total, 49 No-term release kelts and 50 short-term reconditioned kelts were PIT-tagged, with all surviving No-term and short-term reconditioned kelts successfully receiving a surgically implanted hydroacoustic tag as well. With the conclusion of this third year we have completed a number of multi year analyses to better understand how kelts are faring in the lower river as well as laying the groundwork for a cost analysis.

  9. Surgically Implanted JSATS Micro-Acoustic Transmitters Effects on Juvenile Chinook Salmon and Steelhead Tag Expulsion and Survival, 2010

    SciTech Connect (OSTI)

    Woodley, Christa M.; Carpenter, Scott M.; Carter, Kathleen M.; Wagner, Katie A.; Royer, Ida M.; Knox, Kasey M.; Kim, Jin A.; Gay, Marybeth E.; Weiland, Mark A.; Brown, Richard S.

    2011-09-16

    circular tanks at the Bonneville Dam Juvenile Monitoring Facility. Overall mortality ranged weekly from 45 to 72% for YCH, 55 to 83% for STH, and 56 to 84% for SYC. The high background mortality in all groups and species made it difficult to discern tag effects. However, for YCH, STH, and SYC, the Tagged treatment groups had the highest overall mean mortality - 62%, 79%, and 76%, respectively. Fungal infections were found on 35% of all fish. Mean tag burden for the Tagged treatment group was relatively low for YCH (1.7%) and moderate for SYC (4.2%), while STH had a very low mean tag burden (0.7%). Tag burden was significantly higher in the Tagged treatment group for all species when compared to the Sham treatment group because of the presence of two tags. Surgeon performance did not contribute to the difference in mortality between the Sham and Tagged treatment groups. Tag expulsion from fish that survived to the end of the 30-day experiment was low but occurred in all species, with only two PIT tags and one AT lost, one tag per species. The high background mortality in this experiment was not limited to a treatment, temperature, or month. The decreased number of surviving fish influenced our experimental results and thus analyses. For future research, we recommend that a more natural exposure to monitor tag effects and other factors, such as swimming ability and predator avoidance, be considered to determine the effects of AT- and PIT- implantation on fishes.

  10. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect (OSTI)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  11. Kelt Reconditioning: A Research Project to Enhance Iteroparity in Columbia Basin Steelhead (Oncorhynchus mykiss), 2004 Annual Report.

    SciTech Connect (OSTI)

    Hatch, Douglas R.; Branstetter, Ryan; Whiteaker, John

    2004-11-01

    experiment. All steelhead kelts received hw-wiegandt multi vit dietary supplement as a means to improve initial nutrition. Long-term steelhead kelts received Moore-Clark pellets to provide essential minerals and nutrients necessary for gonadal redevelopment. Oxytetracycline was administered to all reconditioned fish to boost immune system response following the stress of initial capture. To control parasitic infestations two methods were used, first, after initial capture an intubation of Ivermectin{trademark} was administered to control internal parasites (e.g., Salmincola spp.). Next, a Formalin drip was used for the duration of reconditioning to prevent fungal outbreaks. Captured kelts were separated into three experimental groups: short-term reconditioning, long-term reconditioning, and direct transport and release. Success indicators for the short-term experiment include the proportion of fish that survived the reconditioning process and the proportion of fish that initiated a feeding response. Short-term kelts were reconditioned for 3 to 5 weeks. Surviving specimens were released for natural spawning on May 11, 2004. Survival-to-release was good for the short-term experiment, with a rate of 79.0%. Long-term steelhead kelts are currently being held for a 6-9 month period with a scheduled release in December 2004. Long-term success indicators include the proportion of fish that survived the reconditioning process and the proportion of surviving fish that successfully remature. Survival and rematuration for long-term kelts has not been determined and will be presented in the 2005 annual report. Direct transport and release kelts and short-term reconditioned kelts were radio or acoustic tagged to assess their travel time and migratory behaviors below Bonneville Dam. A total of 29 direct-transport and release kelts and 29 short-term reconditioned kelts received surgically implanted radio tags, and a total of 28 direct-transport/release and 26 short-term reconditioned fish