National Library of Energy BETA

Sample records for frequency regulation signal

  1. Frequency regulator for synchronous generators

    DOE Patents [OSTI]

    Karlicek, R.F.

    1982-08-10

    The present invention is directed to a novel frequency regulator which controls a generator output frequency for variations in both the input power to the generator and the power supplied to an uncontrolled external load. The present invention further includes over current and current balance protection devices which are relatively inexpensive to manufacture, which may be encapsulated to provide protection from the operating environment and which respond more quickly than previously known electromechanical devices. 11 figs.

  2. Frequency regulator for synchronous generators

    DOE Patents [OSTI]

    Karlicek, Robert F. (1920 Camino Centroloma, Fullerton, CA 92633)

    1982-01-01

    The present invention is directed to a novel frequency regulator which controls a generator output frequency for variations in both the input power to the generator and the power supplied to an uncontrolled external load. The present invention further includes over current and current balance protection devices which are relatively inexpensive to manufacture, which may be encapsulated to provide protection from the operating environment and which respond more quickly than previously known electromechanical devices.

  3. Low frequency phase signal measurement with high frequency squeezing

    E-Print Network [OSTI]

    Zehui Zhai; Jiangrui Gao

    2011-08-24

    We calculate the utility of high-frequency squeezed-state enhanced two-frequency interferometry for low-frequency phase measurement. To use the high-frequency sidebands of the squeezed light, a two-frequency intense laser is used in the interferometry instead of a single-frequency laser as usual. We find that the readout signal can be contaminated by the high-frequency phase vibration, but this is easy to check and avoid. A proof-of-principle experiment is in the reach of modern quantum optics technology.

  4. EA-1631: Beacon Power Corporation Frequency Regulation Facility...

    Office of Environmental Management (EM)

    1: Beacon Power Corporation Frequency Regulation Facility in Stephentown, NY EA-1631: Beacon Power Corporation Frequency Regulation Facility in Stephentown, NY February 2, 2009...

  5. Neurofibromin Regulation of ERK Signaling Modulates

    E-Print Network [OSTI]

    Silva, Alcino

    Neurofibromin Regulation of ERK Signaling Modulates GABA Release and Learning Yijun Cui,1 Rui M@mednet.ucla.edu DOI 10.1016/j.cell.2008.09.060 SUMMARY We uncovered a role for ERK signaling in GABA re- lease, long demonstrate that neurofibromin modulates ERK/synapsin I-dependent GABA re- lease, which in turn modulates

  6. (U) modulator to provide a continuous stepped frequency signal format

    DOE Patents [OSTI]

    Walters, Glenn A. (Escondido, CA)

    1991-01-01

    A modulator provides a continuous signal format composed of discrete freqcy steps and is designed to eliminate frequency overlap or smearing normally associated with filter ringing.

  7. Energy storage for frequency regulation on the electric grid

    E-Print Network [OSTI]

    Leitermann, Olivia

    2012-01-01

    Ancillary services such as frequency regulation are required for reliable operation of the electric grid. Currently, the same traditional thermal generators that supply bulk power also perform nearly all frequency regulation. ...

  8. Time-Frequency Approach for Stochastic Signal Detection

    SciTech Connect (OSTI)

    Ghosh, Ripul; Akula, Aparna; Kumar, Satish; Sardana, H. K. [Academy of Scientific and Innovative Research (AcSIR), Central Scientific Instruments Organisation, Chandigarh - 160030 (India)

    2011-10-20

    The detection of events in a stochastic signal has been a subject of great interest. One of the oldest signal processing technique, Fourier Transform of a signal contains information regarding frequency content, but it cannot resolve the exact onset of changes in the frequency, all temporal information is contained in the phase of the transform. On the other hand, Spectrogram is better able to resolve temporal evolution of frequency content, but has a trade-off in time resolution versus frequency resolution in accordance with the uncertainty principle. Therefore, time-frequency representations are considered for energetic characterisation of the non-stationary signals. Wigner Ville Distribution (WVD) is the most prominent quadratic time-frequency signal representation and used for analysing frequency variations in signals.WVD allows for instantaneous frequency estimation at each data point, for a typical temporal resolution of fractions of a second. This paper through simulations describes the way time frequency models are applied for the detection of event in a stochastic signal.

  9. Effect of low-magnitude, high-frequency vibration on osteocytes in the regulation of osteoclasts

    E-Print Network [OSTI]

    You, Lidan

    - frequency (HF; 20­90 Hz) vibrations have gained interest as studies show that such a mechanical signal canEffect of low-magnitude, high-frequency vibration on osteocytes in the regulation of osteoclasts of Mechanical and Industrial Engineering, University of Toronto, Toronto, ON, Canada c Department

  10. Detection of variable frequency signals using a fast chirp transform

    E-Print Network [OSTI]

    F. A. Jenet; T. A. Prince

    2000-12-07

    The detection of signals with varying frequency is important in many areas of physics and astrophysics. The current work was motivated by a desire to detect gravitational waves from the binary inspiral of neutron stars and black holes, a topic of significant interest for the new generation of interferometric gravitational wave detectors such as LIGO. However, this work has significant generality beyond gravitational wave signal detection. We define a Fast Chirp Transform (FCT) analogous to the Fast Fourier Transform (FFT). Use of the FCT provides a simple and powerful formalism for detection of signals with variable frequency just as Fourier transform techniques provide a formalism for the detection of signals of constant frequency. In particular, use of the FCT can alleviate the requirement of generating complicated families of filter functions typically required in the conventional matched filtering process. We briefly discuss the application of the FCT to several signal detection problems of current interest.

  11. Fact Sheet: Beacon Power 20 MW Flywheel Frequency Regulation...

    Office of Environmental Management (EM)

    Frequency Regulation Plant (August 2013) More Documents & Publications Energy Storage Systems 2014 Peer Review Presentations - Session 7 STEPHENTOWN SPINDLE Energy Storage...

  12. Characterization of Cardio signals by time-frequency domain analysis

    E-Print Network [OSTI]

    Sayan Mukherjee; Sanjay Kumar Palit; Santo Banerjee; MRK Ariffin; Lamberto Rondoni; Dilip Kumar Bhattacharya

    2014-09-04

    Long term behavior of nonlinear deterministic continuous time signals can be studied in terms of their reconstructed attractors. Reconstructed attractors of a continuous signal are meant to be topologically equivalent representations of the dynamics of the unknown dynamical system which generates the signal. Sometimes, geometry of the attractor or its complexity may give important information on the system of interest. However, if the trajectories of the attractor behave as if they are not coming from continuous system or there exists many spike like structures on the path of the system trajectories, then there is no way to characterize the shape of the attractor. In this article, the traditional attractor reconstruction method is first used for two types of ECG signals: Normal healthy persons (NHP) and Congestive Heart failure patients (CHFP). As common in such a framework, the reconstructed attractors are not at all well formed and hence it is not possible to adequately characterize their geometrical features. Thus, we incorporate frequency domain information to the given time signals. This is done by transforming the signals to a time frequency domain by means of suitable Wavelet transforms (WT). The transformed signal concerns two non homogeneous variables and is still quite difficult to use to reconstruct some dynamics out of it. By applying a suitable mapping, this signal is further converted into integer domain and a new type of 3D plot, called integer lag plot, which characterizes and distinguishes the ECG signals of NHP and CHFP, is finally obtained.

  13. Frequency Regulation from Flexible Loads: Potential, Economics, and Implementation

    E-Print Network [OSTI]

    Sanandaji, Borhan M.

    Frequency Regulation from Flexible Loads: Potential, Economics, and Implementation He Hao1,, Borhan potential for providing regulation reserve to the grid. This paper aims to provide a foundation for a practical method of enabling TCLs to provide regulation service. We study the economic, regulatory

  14. Demonstration of HVAC chiller control for power grid frequency regulation

    E-Print Network [OSTI]

    Su, Po-An (Po-An Leo)

    2015-01-01

    Secondary frequency regulation is a necessary electric grid ancillary service that balances electric power system supply and demand on short time intervals of seconds to minutes. Commercial HVAC chillers may be well ...

  15. ORIGINAL ARTICLE FGF and ERK signaling coordinately regulate mineralization-

    E-Print Network [OSTI]

    ORIGINAL ARTICLE FGF and ERK signaling coordinately regulate mineralization- related genes and play for Bone and Mineral Research and Springer 2011 Abstract To examine the roles of FGF and ERK MAPK signaling-Y4. This experiment identified a number of miner- alization-related genes that were regulated by FGF2

  16. Signaling pathways that regulate cellular senescence

    E-Print Network [OSTI]

    Freund, Adam Mark

    2010-01-01

    M) p53 inactivation increases DDR signaling but not p38MAPKexpression does not induce a DDR. Cells were infected asthat DNA damage response (DDR) signaling is essential but

  17. Reliability of frequency- and amplitude-decoding in gene regulation

    E-Print Network [OSTI]

    Filipe Tostevin; Wiet de Ronde; Pieter Rein ten Wolde

    2012-02-07

    In biochemical signaling, information is often encoded in oscillatory signals. However, the advantages of such a coding strategy over an amplitude encoding scheme of constant signals remain unclear. Here we study the dynamics of a simple model gene promoter in response to oscillating and constant transcription factor signals. We find that in biologically-relevant parameter regimes an oscillating input can produce a more constant protein level than a constant input. Our results suggest that oscillating signals may be used to minimize noise in gene regulation.

  18. System for transmitting low frequency analog signals over AC power lines

    DOE Patents [OSTI]

    Baker, Steven P. (Powell, TN); Durall, Robert L. (Lenoir City, TN); Haynes, Howard D. (Knoxville, TN)

    1989-01-01

    A system for transmitting low frequency analog signals over AC power lines using FM modulation. A low frequency analog signal to be transmitted is first applied to a voltage-to-frequency converter where it is converted to a signal whose frequency varies in proportion to the analog signal amplitude. This signal is then used to modulate the carrier frequency of an FM transmitter coupled to an AC power line. The modulation signal frequency range in selected to be within the response band of the FM transmitter. The FM modulated carrier signal is received by an FM receiver coupled to the AC power line, demodulated and the demodulated signal frequency is converted by a frequency-to-voltage converter back to the form of the original low frequency analog input signal.

  19. A system for tranmitting low frequency analog signals over ac power lines

    DOE Patents [OSTI]

    Baker, S.P.; Durall, R.L.; Haynes, H.D.

    1987-07-30

    A system for transmitting low frequency analog signals over ac power lines using FM modulation. A low frequency analog signal to be transmitted is first applied to a voltage-to-frequency converter where it is converted to a signal whose frequency varies in proportion to the analog signal amplitude. This signal is then used to modulate the carrier frequency of an FM transmitter coupled to an ac power line. The modulation signal frequency range is selected to be within the response band of the FM transmitter. The FM modulated carrier signal is received by an FM receiver coupled to the ac power line, demodulated and the demodulated signal frequency is converted by a frequency-to-voltage converter back to the form of the original low frequency analog input signal. 4 figs.

  20. Autonomous Demand Response for Primary Frequency Regulation

    SciTech Connect (OSTI)

    Donnelly, Matt; Trudnowski, Daniel J.; Mattix, S.; Dagle, Jeffery E.

    2012-02-28

    The research documented within this report examines the use of autonomous demand response to provide primary frequency response in an interconnected power grid. The work builds on previous studies in several key areas: it uses a large realistic model (i.e., the interconnection of the western United States and Canada); it establishes a set of metrics that can be used to assess the effectiveness of autonomous demand response; and it independently adjusts various parameters associated with using autonomous demand response to assess effectiveness and to examine possible threats or vulnerabilities associated with the technology.

  1. Time-frequency analysis of synthetic aperture radar signals

    SciTech Connect (OSTI)

    Johnston, B.

    1996-08-01

    Synthetic aperture radar (SAR) has become an important tool for remote sensing of the environment. SAR is a set of digital signal processing algorithms that are used to focus the signal returned to the radar because radar systems in themselves cannot produce the high resolution images required in remote sensing applications. To reconstruct an image, several parameters must be estimated and the quality of output image depends on the degree of accuracy of these parameters. In this thesis, we derive the fundamental SAR algorithms and concentrate on the estimation of one of its critical parameters. We show that the common technique for estimating this particular parameter can sometimes lead to erroneous results and reduced quality images. We also employ time-frequency analysis techniques to examine variations in the radar signals caused by platform motion and show how these results can be used to improve output image quality.

  2. Interspecific Nematode Signals Regulate Dispersal Fatma Kaplan1

    E-Print Network [OSTI]

    Burns, Jacqueline K.

    Interspecific Nematode Signals Regulate Dispersal Behavior Fatma Kaplan1 *, Hans T. Alborn1. Citation: Kaplan F, Alborn HT, von Reuss SH, Ajredini R, Ali JG, et al. (2012) Interspecific Nematode

  3. Oscillatory Dynamics of the Extracellular Signal-regulated Kinase Pathway

    SciTech Connect (OSTI)

    Shankaran, Harish; Wiley, H. S.

    2010-12-01

    The extracellular signal-regulated kinase (ERK) pathway is a central signaling pathway in development and disease and is regulated by multiple negative and positive feedback loops. Recent studies have shown negative feedback from ERK to upstream regulators can give rise to biochemical oscillations with a periodicity of between 15-30 minutes. Feedback due to the stimulated transcription of negative regulators of the ERK pathway can also give rise to transcriptional oscillations with a periodicity of 1-2h. The biological significance of these oscillations is not clear, but recent evidence suggests that transcriptional oscillations participate in developmental processes, such as somite formation. Biochemical oscillations are more enigmatic, but could provide a mechanism for encoding different types of inputs into a common signaling pathway.

  4. The role of high frequencies in convolutive blind source separation of speech signals

    E-Print Network [OSTI]

    Plumbley, Mark

    The role of high frequencies in convolutive blind source separation of speech signals Maria G load of FD-BSS algorithms, we consider here the role of high frequencies in source separation of speech sig- nals. We show that high frequencies are not as important as low frequencies, This work was funded

  5. Time-Frequency Representation of Microseismic Signals using the Synchrosqueezing Transform

    E-Print Network [OSTI]

    Herrera, Roberto H; van der Baan, Mirko

    2013-01-01

    Resonance frequencies can provide useful information on the deformation occurring during fracturing experiments or $CO_2$ management, complementary to the microseismic event distribution. An accurate time-frequency representation is of crucial importance prior to interpreting the cause of resonance frequencies during microseismic experiments. The popular methods of Short-Time Fourier Transform (STFT) and wavelet analysis have limitations in representing close frequencies and dealing with fast varying instantaneous frequencies and this is often the nature of microseismic signals. The synchrosqueezing transform (SST) is a promising tool to track these resonant frequencies and provide a detailed time-frequency representation. Here we apply the synchrosqueezing transform to microseismic signals and also show its potential to general seismic signal processing applications.

  6. OPTIMAL TRAINING SIGNALS FOR SISO OFDM CHANNEL ESTIMATION IN THE ABSENCE/PRESENCE OF FREQUENCY OFFSETS

    E-Print Network [OSTI]

    Minn, Hlaing

    OPTIMAL TRAINING SIGNALS FOR SISO OFDM CHANNEL ESTIMATION IN THE ABSENCE/PRESENCE OF FREQUENCY.minn, aldhahir @utdallas.edu Abstract-- All existing training signal designs for channel estima- tion in OFDM the performance of OFDM systems. In this paper, we address the problem of design- ing optimal training signals

  7. Denoising and Frequency Analysis of Noninvasive Magnetoencephalography Sensor Signals for Functional Brain Mapping

    E-Print Network [OSTI]

    Ukil, A

    2015-01-01

    Magnetoencephalography (MEG) is an important noninvasive, nonhazardous technology for functional brain mapping, measuring the magnetic fields due to the intracellular neuronal current flow in the brain. However, most often, the inherent level of noise in the MEG sensor data collection process is large enough to obscure the signal(s) of interest. In this paper, a denoising technique based on the wavelet transform and the multiresolution signal decomposition technique along with thresholding is presented, substantiated by application results. Thereafter, different frequency analysis are performed on the denoised MEG signals to identify the major frequencies of the brain oscillations present in the denoised signals. Time-frequency plots (spectrograms) of the denoised signals are also provided.

  8. System and method for constructing filters for detecting signals whose frequency content varies with time

    DOE Patents [OSTI]

    Qian, Shie (Austin, TX); Dunham, Mark E. (Los Alamos, NM)

    1996-01-01

    A system and method for constructing a bank of filters which detect the presence of signals whose frequency content varies with time. The present invention includes a novel system and method for developing one or more time templates designed to match the received signals of interest and the bank of matched filters use the one or more time templates to detect the received signals. Each matched filter compares the received signal x(t) with a respective, unique time template that has been designed to approximate a form of the signals of interest. The robust time domain template is assumed to be of the order of w(t)=A(t)cos{2.pi..phi.(t)} and the present invention uses the trajectory of a joint time-frequency representation of x(t) as an approximation of the instantaneous frequency function {.phi.'(t). First, numerous data samples of the received signal x(t) are collected. A joint time frequency representation is then applied to represent the signal, preferably using the time frequency distribution series (also known as the Gabor spectrogram). The joint time-frequency transformation represents the analyzed signal energy at time t and frequency .function., P(t,f), which is a three-dimensional plot of time vs. frequency vs. signal energy. Then P(t,f) is reduced to a multivalued function f(t), a two dimensional plot of time vs. frequency, using a thresholding process. Curve fitting steps are then performed on the time/frequency plot, preferably using Levenberg-Marquardt curve fitting techniques, to derive a general instantaneous frequency function .phi.'(t) which best fits the multivalued function f(t), a trajectory of the joint time-frequency domain representation of x(t). Integrating .phi.'(t) along t yields .phi.(t), which is then inserted into the form of the time template equation. A suitable amplitude A(t) is also preferably determined. Once the time template has been determined, one or more filters are developed which each use a version or form of the time template.

  9. System and method for constructing filters for detecting signals whose frequency content varies with time

    DOE Patents [OSTI]

    Qian, S.; Dunham, M.E.

    1996-11-12

    A system and method are disclosed for constructing a bank of filters which detect the presence of signals whose frequency content varies with time. The present invention includes a novel system and method for developing one or more time templates designed to match the received signals of interest and the bank of matched filters use the one or more time templates to detect the received signals. Each matched filter compares the received signal x(t) with a respective, unique time template that has been designed to approximate a form of the signals of interest. The robust time domain template is assumed to be of the order of w(t)=A(t)cos(2{pi}{phi}(t)) and the present invention uses the trajectory of a joint time-frequency representation of x(t) as an approximation of the instantaneous frequency function {phi}{prime}(t). First, numerous data samples of the received signal x(t) are collected. A joint time frequency representation is then applied to represent the signal, preferably using the time frequency distribution series. The joint time-frequency transformation represents the analyzed signal energy at time t and frequency f, P(t,f), which is a three-dimensional plot of time vs. frequency vs. signal energy. Then P(t,f) is reduced to a multivalued function f(t), a two dimensional plot of time vs. frequency, using a thresholding process. Curve fitting steps are then performed on the time/frequency plot, preferably using Levenberg-Marquardt curve fitting techniques, to derive a general instantaneous frequency function {phi}{prime}(t) which best fits the multivalued function f(t). Integrating {phi}{prime}(t) along t yields {phi}{prime}(t), which is then inserted into the form of the time template equation. A suitable amplitude A(t) is also preferably determined. Once the time template has been determined, one or more filters are developed which each use a version or form of the time template. 7 figs.

  10. Requirements for Defining Utility Drive Cycles: An Exploratory Analysis of Grid Frequency Regulation Data for Establishing Battery Performance Testing Standards

    SciTech Connect (OSTI)

    Hafen, Ryan P.; Vishwanathan, Vilanyur V.; Subbarao, Krishnappa; Kintner-Meyer, Michael CW

    2011-10-19

    Battery testing procedures are important for understanding battery performance, including degradation over the life of the battery. Standards are important to provide clear rules and uniformity to an industry. The work described in this report addresses the need for standard battery testing procedures that reflect real-world applications of energy storage systems to provide regulation services to grid operators. This work was motivated by the need to develop Vehicle-to-Grid (V2G) testing procedures, or V2G drive cycles. Likewise, the stationary energy storage community is equally interested in standardized testing protocols that reflect real-world grid applications for providing regulation services. As the first of several steps toward standardizing battery testing cycles, this work focused on a statistical analysis of frequency regulation signals from the Pennsylvania-New Jersey-Maryland Interconnect with the goal to identify patterns in the regulation signal that would be representative of the entire signal as a typical regulation data set. Results from an extensive time-series analysis are discussed, and the results are explained from both the statistical and the battery-testing perspectives. The results then are interpreted in the context of defining a small set of V2G drive cycles for standardization, offering some recommendations for the next steps toward standardizing testing protocols.

  11. Effects of Signal Processing and Antenna Frequency on the Geostatistical Structure of Ground-Penetrating Radar Data

    E-Print Network [OSTI]

    Barrash, Warren

    Effects of Signal Processing and Antenna Frequency on the Geostatistical Structure of Ground with application of signal processing or by changing the signal frequency. We perform geostatistical analyses of surface radar reflection profiles in order to investigate the effects of data processing and antenna

  12. Wind/PV Generation for Frequency Regulation and Oscillation Damping in the Eastern Interconnection

    SciTech Connect (OSTI)

    Liu, Yong; Gracia, Jose R; Hadley, Stanton W; Liu, Yilu

    2013-12-01

    This report presents the control of renewable energy sources, including the variable-speed wind generators and solar photovoltaic (PV) generators, for frequency regulation and inter-area oscillation damping in the U.S. Eastern Interconnection (EI). In this report, based on the user-defined wind/PV generator electrical control model and the 16,000-bus Eastern Interconnection dynamic model, the additional controllers for frequency regulation and inter-area oscillation damping are developed and incorporated and the potential contributions of renewable energy sources to the EI system frequency regulation and inter-area oscillation damping are evaluated.

  13. A Mixed-SignalASIC Power-Factor-Correction(PFC) Controller for High Frequency Switching Rectifiers

    E-Print Network [OSTI]

    A Mixed-SignalASIC Power-Factor-Correction(PFC) Controller for High Frequency Switching Rectifiers power-stage interfacing should be simple with few components needed. To reduce design costs, very little design should be necessary to implement the con- troller using the most common power stages

  14. PEV-Based Combined Frequency and Voltage Regulation for Smart Grid

    E-Print Network [OSTI]

    Mohsenian-Rad, Hamed

    by either adjusting supply or changing demand. While various demand side management programs have used benefit both users and utilities. Index Terms--Smart grid, plug-in electric vehicles, demand side management, reactive power compensation, ancillary ser- vices, frequency regulation, voltage regulation

  15. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  16. Frequency response testing at Experimental Breeder Reactor II using discrete-level periodic signals

    SciTech Connect (OSTI)

    Rhodes, W.D.; Larson, H.A. (Idaho State Univ., Pocatello, ID (USA). Coll. of Engineering); Dean, E.M. (Argonne National Lab., Idaho Falls, ID (USA))

    1990-01-01

    The Experimental Breeder Reactor 2 (EBR-2) reactivity-to-power frequency-response function was measured with pseudo-random, discrete-level, periodic signals. The reactor power deviation was small with insignificant perturbation of normal operation and in-place irradiation experiments. Comparison of results with measured rod oscillator data and with theoretical predictions show good agreement. Moreover, measures of input signal quality (autocorrelation function and energy spectra) confirm the ability to enable this type of frequency response determination at EBR-2. Measurements were made with the pseudo-random binary sequence, quadratic residue binary sequence, pseudo-random ternary sequence, and the multifrequency binary sequence. 10 refs., 7 figs., 3 tabs.

  17. Low Actuation Voltage RF MEMS SwitchesWith Signal Frequencies From 0.25GHz to 40GHz

    E-Print Network [OSTI]

    Shen, Shyh-Chiang

    Low Actuation Voltage RF MEMS SwitchesWith Signal Frequencies From 0.25GHz to 40GHz Shyh-voltage radio-frequency micro- electromechanical system (RF MEMS) switch is reported. The device switching of better than 27 dB over the frequency band from 0.25GHz to 40GHz was achieved. The RF MEMS switch

  18. Association between Regulator of G Protein Signaling 9–2 and Body Weight

    E-Print Network [OSTI]

    Waugh, Jeffrey L.

    Regulator of G protein signaling 9–2 (RGS9–2) is a protein that is highly enriched in the striatum, a brain region that mediates motivation, movement and reward responses. We identified a naturally occurring 5 nucleotide ...

  19. The Regulation of Growth Factor Signaling in Drosophila Development and Disease 

    E-Print Network [OSTI]

    Lindner, Jonathan Ryan

    2012-02-14

    Developmental signaling pathways have many diverse roles throughout the life of an organism. The proper regulation of these pathways is essential for normal development, and misregulation can lead to diseases such as cancer. ...

  20. Regulation of the Pregnane X Receptor Signaling Pathway

    E-Print Network [OSTI]

    Lichti-Kaiser, Kristin Nicole

    2009-04-23

    Liver-enriched nuclear receptors (NRs) collectively function as metabolic and toxicological `sensors' that mediate liver-specific gene-activation in mammals. NR-mediated gene-environment interaction regulates important ...

  1. First low frequency all-sky search for continuous gravitational wave signals

    E-Print Network [OSTI]

    The LIGO Scientific Collaboration; the Virgo Collaboration; J. Aasi; B. P. Abbott; R. Abbott; T. D. Abbott; M. R. Abernathy; F. Acernese; K. Ackley; C. Adams; T. Adams; P. Addesso; R. X. Adhikari; V. B. Adya; C. Affeldt; M. Agathos; K. Agatsuma; N. Aggarwal; O. D. Aguiar; A. Ain; P. Ajith; B. Allen; A. Allocca; D. V. Amariutei; M. Andersen; S. B. Anderson; W. G. Anderson; K. Arai; M. C. Araya; C. C. Arceneaux; J. S. Areeda; N. Arnaud; G. Ashton; S. M. Aston; P. Astone; P. Aufmuth; C. Aulbert; S. Babak; P. T. Baker; F. Baldaccini; G. Ballardin; S. W. Ballmer; J. C. Barayoga; S. E. Barclay; B. C. Barish; D. Barker; F. Barone; B. Barr; L. Barsotti; M. Barsuglia; J. Bartlett; M. A. Barton; I. Bartos; R. Bassiri; A. Basti; J. C. Batch; C. Baune; V. Bavigadda; B. Behnke; M. Bejger; C. Belczynski; A. S. Bell; B. K. Berger; J. Bergman; G. Bergmann; C. P. L. Berry; D. Bersanetti; A. Bertolini; J. Betzwieser; S. Bhagwat; R. Bhandare; I. A. Bilenko; G. Billingsley; J. Birch; R. Birney; S. Biscans; M. Bitossi; C. Biwer; M. A. Bizouard; J. K. Blackburn; C. D. Blair; D. Blair; S. Bloemen; O. Bock; T. P. Bodiya; M. Boer; G. Bogaert; P. Bojtos; C. Bond; F. Bondu; R. Bonnand; R. Bork; M. Born; V. Boschi; Sukanta Bose; C. Bradaschia; P. R. Brady; V. B. Braginsky; M. Branchesi; V. Branco; J. E. Brau; T. Briant; A. Brillet; M. Brinkmann; V. Brisson; P. Brockill; A. F. Brooks; D. A. Brown; D. Brown; D. D. Brown; N. M. Brown; C. C. Buchanan; A. Buikema; T. Bulik; H. J. Bulten; A. Buonanno; D. Buskulic; C. Buy; R. L. Byer; L. Cadonati; G. Cagnoli; J. Calderón Bustillo; E. Calloni; J. B. Camp; K. C. Cannon; J. Cao; C. D. Capano; E. Capocasa; F. Carbognani; S. Caride; J. Casanueva Diaz; C. Casentini; S. Caudill; M. Cavaglià; F. Cavalier; R. Cavalieri; C. Celerier; G. Cella; C. Cepeda; L. Cerboni Baiardi; G. Cerretani; E. Cesarini; R. Chakraborty; T. Chalermsongsak; S. J. Chamberlin; S. Chao; P. Charlton; E. Chassande-Mottin; X. Chen; Y. Chen; C. Cheng; A. Chincarini; A. Chiummo; H. S. Cho; M. Cho; J. H. Chow; N. Christensen; Q. Chu; S. Chua; S. Chung; G. Ciani; F. Clara; J. A. Clark; F. Cleva; E. Coccia; P. -F. Cohadon; A. Colla; C. G. Collette; M. Colombini; M. Constancio Jr.; A. Conte; L. Conti; D. Cook; T. R. Corbitt; N. Cornish; A. Corsi; C. A. Costa; M. W. Coughlin; S. B. Coughlin; J. -P. Coulon; S. T. Countryman; P. Couvares; D. M. Coward; M. J. Cowart; D. C. Coyne; R. Coyne; K. Craig; J. D. E. Creighton; J. Cripe; S. G. Crowder; A. Cumming; L. Cunningham; E. Cuoco; T. Dal Canton; M. D. Damjanic; S. L. Danilishin; S. D'Antonio; K. Danzmann; N. S. Darman; V. Dattilo; I. Dave; H. P. Daveloza; M. Davier; G. S. Davies; E. J. Daw; R. Day; D. DeBra; G. Debreczeni; J. Degallaix; M. De Laurentis; S. Deléglise; W. Del Pozzo; T. Denker; T. Dent; H. Dereli; V. Dergachev; R. De Rosa; R. T. DeRosa; R. DeSalvo; S. Dhurandhar; M. C. Díaz; L. Di Fiore; M. Di Giovanni; A. Di Lieto; I. Di Palma; A. Di Virgilio; G. Dojcinoski; V. Dolique; E. Dominguez; F. Donovan; K. L. Dooley; S. Doravari; R. Douglas; T. P. Downes; M. Drago; R. W. P. Drever; J. C. Driggers; Z. Du; M. Ducrot; S. E. Dwyer; T. B. Edo; M. C. Edwards; M. Edwards; A. Effler; H. -B. Eggenstein; P. Ehrens; J. M. Eichholz; S. S. Eikenberry; R. C. Essick; T. Etzel; M. Evans; T. M. Evans; R. Everett; M. Factourovich; V. Fafone; S. Fairhurst; Q. Fang; S. Farinon; B. Farr; W. M. Farr; M. Favata; M. Fays; H. Fehrmann; M. M. Fejer; D. Feldbaum; I. Ferrante; E. C. Ferreira; F. Ferrini; F. Fidecaro; I. Fiori; R. P. Fisher; R. Flaminio; J. -D. Fournier; S. Franco; S. Frasca; F. Frasconi; M. Frede; Z. Frei; A. Freise; R. Frey; T. T. Fricke; P. Fritschel; V. V. Frolov; P. Fulda; M. Fyffe; H. A. G. Gabbard; J. R. Gair; L. Gammaitoni; S. G. Gaonkar; F. Garufi; A. Gatto; N. Gehrels; G. Gemme; B. Gendre; E. Genin; A. Gennai; L. Á. Gergely; V. Germain; A. Ghosh; S. Ghosh; J. A. Giaime; K. D. Giardina; A. Giazotto; J. R. Gleason; E. Goetz; R. Goetz; L. Gondan; G. González; J. Gonzalez; A. Gopakumar; N. A. Gordon; M. L. Gorodetsky; S. E. Gossan; M. Gosselin; S. Goßler; R. Gouaty; C. Graef; P. B. Graff; M. Granata; A. Grant; S. Gras; C. Gray; G. Greco; P. Groot; H. Grote; K. Grover; S. Grunewald; G. M. Guidi; C. J. Guido; X. Guo; A. Gupta; M. K. Gupta; K. E. Gushwa; E. K. Gustafson; R. Gustafson; J. J. Hacker; B. R. Hall; E. D. Hall; D. Hammer; G. Hammond; M. Haney; M. M. Hanke; J. Hanks; C. Hanna; M. D. Hannam; J. Hanson; T. Hardwick; J. Harms; G. M. Harry; I. W. Harry; M. J. Hart; M. T. Hartman; C. -J. Haster; K. Haughian; A. Heidmann; M. C. Heintze; H. Heitmann; P. Hello; G. Hemming; M. Hendry; I. S. Heng; J. Hennig; A. W. Heptonstall; M. Heurs; S. Hild; D. Hoak; K. A. Hodge; J. Hoelscher-Obermaier; D. Hofman; S. E. Hollitt; K. Holt; P. Hopkins; D. J. Hosken; J. Hough; E. A. Houston; E. J. Howell; Y. M. Hu; S. Huang; E. A. Huerta; D. Huet; B. Hughey

    2015-10-13

    In this paper we present the results of the first low frequency all-sky search of continuous gravitational wave signals conducted on Virgo VSR2 and VSR4 data. The search covered the full sky, a frequency range between 20 Hz and 128 Hz with a range of spin-down between $-1.0 \\times 10^{-10}$ Hz/s and $+1.5 \\times 10^{-11}$ Hz/s, and was based on a hierarchical approach. The starting point was a set of short Fast Fourier Transforms (FFT), of length 8192 seconds, built from the calibrated strain data. Aggressive data cleaning, both in the time and frequency domains, has been done in order to remove, as much as possible, the effect of disturbances of instrumental origin. On each dataset a number of candidates has been selected, using the FrequencyHough transform in an incoherent step. Only coincident candidates among VSR2 and VSR4 have been examined in order to strongly reduce the false alarm probability, and the most significant candidates have been selected. The criteria we have used for candidate selection and for the coincidence step greatly reduce the harmful effect of large instrumental artifacts. Selected candidates have been subject to a follow-up by constructing a new set of longer FFTs followed by a further incoherent analysis. No evidence for continuous gravitational wave signals was found, therefore we have set a population-based joint VSR2-VSR4 90$\\%$ confidence level upper limit on the dimensionless gravitational wave strain in the frequency range between 20 Hz and 128 Hz. This is the first all-sky search for continuous gravitational waves conducted at frequencies below 50 Hz. We set upper limits in the range between about $10^{-24}$ and $2\\times 10^{-23}$ at most frequencies. Our upper limits on signal strain show an improvement of up to a factor of $\\sim$2 with respect to the results of previous all-sky searches at frequencies below $80~\\mathrm{Hz}$.

  2. Mechanical regulation of signaling pathways in bone, William R. Thompson a,

    E-Print Network [OSTI]

    , cyclooxygenase 2; LMMS, low magnitude mechanical stimulation; LIV, low intensity vibration; CT, micro compReview Mechanical regulation of signaling pathways in bone, William R. Thompson a, , Clinton T A wide range of cell types depend on mechanically induced signals to enable appropriate physiological re

  3. Brassinosteroid regulated kinases (BRKs) that mediate brassinosteroid signal transduction and uses thereof

    SciTech Connect (OSTI)

    Wang, Zhi-Yong; Tang, Wenqiang

    2013-09-24

    The present invention identifies a novel family of kinases regulated by brassinosteroids, referred to as BRKs (brassinosteroid regulated kinases) or BSKs (brassinosteroid signaling kinases). The present invention provides methods for modulating the response of a plant cell to a brassinosteroid using BRKs.

  4. A functional RNAi screen for regulators of receptor tyrosine kinase and ERK signalling

    E-Print Network [OSTI]

    Perrimon, Norbert

    LETTERS A functional RNAi screen for regulators of receptor tyrosine kinase and ERK signalling Adam-regulated kinases (ERKs) has pivotal roles during metazoan development, underlying processes as diverse as fate deter- mination, differentiation, proliferation, survival, migration and growth. Abnormal RTK/ERK

  5. ROP GTPase Signaling in The Hormonal Regulation of Plant Growth

    SciTech Connect (OSTI)

    Yang, Zhenbiao

    2013-05-24

    I secured funding from the DOE to investigate the effect of auxin signaling on ROP9. This was based on our preliminary data showing that ROP9 is activated by auxin. However, we were unable to show that rop9 knockout mutants have altered sensitivity to auxin. Instead, we found that auxin activates both ROP2 and ROP6, and relevant mutants exhibit reduced sensitivity to auxin. Therefore we used the fund to strengthen our research on ROP2 and ROP6. My laboratory made major advancements in the recent years in the understanding of the effect of auxin signaling on ROP2 and ROP6. This is clearly exemplified by the numerous publications acknowledging fund DE-FG0204ER15555 as the source of funding.

  6. An analysis on the mid-latitude scintillation and coherence frequency bandwidth using transionospheric VHF signals

    SciTech Connect (OSTI)

    Juang, Zhen [Los Alamos National Laboratory; Roussel-dupre, Robert [Los Alamos National Laboratory

    2008-01-01

    An analysis was perfonned on the mid-latitude scintillation and coherence frequency bandwidth (Fcoh) using transionospheric VHF signal data. The data include 1062 events spanning from November 1997 to June 2002. Each event records FORTE satellite received VHF signals from LAPP located at Los Alamos, New Mexico. Fcohs were derived to study scintillation characteristics on diurnal and seasonal variations, as well as changes due to solar and geomagnetic activities. Comparisons to the VHFIUHF coherence frequency bandwidth studies previously reported at equatorial and mid-latitude regions are made using a 4th power frequency dependence relationship. Furthennore, a wideband ionospheric scintillation model, WBMOD, was used to estimate Fcohs and compared with our VHF Fcoh values. Our analysis indicates mid-latitude scintillation characteristics that are not previously revealed. At the VHF bottom frequency range (3035 MHz), distinguished smaller Fcohs are found in time period from sunset to midnight, in wann season from May to August, and in low solar activity years. The effects of geomagnetic storm activity on Fcoh are characterized by a sudden transition at a Kp index of 50-60. Comparisons with median Fcohs estimated from other studies validated our VHF Fcohs for daytime while an order of magnitude larger Fcohs are found for nighttime, implying a time-dependent issue in applying the 4th order power relationship. Furthermore, comparisons with WBMOD-estimated Fcohs indicated generally matched median scintillation level estimates while differences do exist for those events undergoing high geomagnetic stonn activity which may imply underestimates of scintillation level by the WBMOD in the mid-latitude regions.

  7. Porcine circovirus type 2 replication is impaired by inhibition of the extracellular signal-regulated kinase (ERK) signaling pathway

    SciTech Connect (OSTI)

    Wei Li [Institute of Animal Husbandry and Veterinary Medicine, Beijing Municipal Academy of Agriculture and Forestry Sciences, No.9 Shuguang Garden Central Road, Haidian District, Beijing 100097 (China); Liu Jue [Institute of Animal Husbandry and Veterinary Medicine, Beijing Municipal Academy of Agriculture and Forestry Sciences, No.9 Shuguang Garden Central Road, Haidian District, Beijing 100097 (China)], E-mail: liujue@263.net

    2009-03-30

    Postweaning multisystemic wasting syndrome, which is primarily caused by porcine circovirus type 2 (PCV2), is an emerging and important swine disease. We have recently shown that PCV2 induces nuclear factor kappa B activation and its activation is required for active replication, but the other cellular factors involved in PCV2 replication are not well defined. The extracellular signal-regulated kinase (ERK) which served as an important component of cellular signal transduction pathways has been shown to regulate many viral infections. In this report, we show that PCV2 activates ERK1/2 in PCV2-infected PK15 cells dependent on viral replication. The PCV2-induced ERK1/2 leads to phosphorylation of the ternary complex factor Elk-1, which kinetically paralleled ERK1/2 activation. Inhibition of ERK activation with U0126, a specific MEK1/2 inhibitor, significantly reduced viral progeny release. Investigations into the mechanism of ERK1/2 regulation revealed that inhibition of ERK activation leads to decreased viral transcription and lower virus protein expression. These data indicate that the ERK signaling pathway is involved in PCV2 infection and beneficial to PCV2 replication in the cultured cells.

  8. Reagan win signals new direction in environmental regulation

    SciTech Connect (OSTI)

    Smock, R.

    1981-01-01

    Environmental policy under the Reagan Administration will experience a shift in direction as new administrators are named and the political balances in Congressional committees changes. Predictions of what may happen include the possible removal of regulations governing prevention of significant deterioration (PSD) and fugitive emissions, abolishing the Council on Environmental Quality, and weakening the Clean Air Act. Pressures to continue strict pollution controls reflect a growing concern about acid rain. Several steps that the Environmental Protection Agency could take without new legislation could affect national ambient-air-quality standards, enforcement of existing state plans, ambient sulfur dioxide and nitrogen emission standards, and stack heights. New scrubber trends show a shift to dry scrubbers. Test results show the superiority of limestone scrubbing, although a new dual-alkali system is doing well. Improved scrubbing technologies are proving to be efficient and economical ways to control pollution. 1 figure, 2 tables. (DCK)

  9. UNCORRECTEDPROOF Please cite this article in press as: Ramos JW, The regulation of extracellular signal-regulated kinase (ERK) in mammalian cells, Int J Biochem Cell

    E-Print Network [OSTI]

    Ramos, Joe W.

    signal-regulated kinase (ERK) in mammalian cells, Int J Biochem Cell Biol (2008), doi:10.1016/j of extracellular signal-regulated kinase (ERK) in mammalian cells 2 3 Joe W. Ramos 2 Department of Natural Products Received in revised form 18 April 20089 Accepted 25 April 200810 Available online xxx11 12 Keywords:13 ERK

  10. Time-frequency analysis of non-stationary fusion plasma signals using an improved Hilbert-Huang transform

    SciTech Connect (OSTI)

    Liu, Yangqing, E-mail: liuyq05@gmail.com; Tan, Yi; Xie, Huiqiao; Wang, Wenhao; Gao, Zhe [Department of Engineering Physics, Tsinghua University, Beijing 100084 (China)

    2014-07-15

    An improved Hilbert-Huang transform method is developed to the time-frequency analysis of non-stationary signals in tokamak plasmas. Maximal overlap discrete wavelet packet transform rather than wavelet packet transform is proposed as a preprocessor to decompose a signal into various narrow-band components. Then, a correlation coefficient based selection method is utilized to eliminate the irrelevant intrinsic mode functions obtained from empirical mode decomposition of those narrow-band components. Subsequently, a time varying vector autoregressive moving average model instead of Hilbert spectral analysis is performed to compute the Hilbert spectrum, i.e., a three-dimensional time-frequency distribution of the signal. The feasibility and effectiveness of the improved Hilbert-Huang transform method is demonstrated by analyzing a non-stationary simulated signal and actual experimental signals in fusion plasmas.

  11. Mechanical Loading Regulates NFATc1 and -Catenin Signaling through a GSK3 Control Node*

    E-Print Network [OSTI]

    Mechanical Loading Regulates NFATc1 and -Catenin Signaling through a GSK3 Control Node* Received at Stony Brook, Stony Brook, New York 11794 Mechanical stimulation can prevent adipogenic and im- prove of -catenin levels. We asked whether mechanical up-regula- tion of -catenin was critical to reduction

  12. Drosophila C-terminal Src kinase regulates growth via the Hippo signaling pathway

    E-Print Network [OSTI]

    Singh, Amit

    with poor prognosis. The Drosophila C-terminal Src kinase (d-Csk) is a genetic modifier of warts (wts size during development. Given the similarity in the loss-of-function phenotypes of d-Csk and wts, we of the network of genes that interact to regulate Wts and its effector Yki in the Hippo signaling pathway. & 2014

  13. Properties and Regulation of a Transiently Assembled ERK2,Ets-1 Signaling Complex

    E-Print Network [OSTI]

    Riggs, Austen

    Properties and Regulation of a Transiently Assembled ERK2,Ets-1 Signaling Complex Kari A. Callaway: ERK2 is a proline-directed protein kinase that displays a high specificity for a single threonine (Thr binds ERK2 to promote the phosphorylation of Thr-38 while simultaneously discriminating against

  14. Salmonella pathogenesis reveals that BMP signaling regulates blood cell homeostasis and immune

    E-Print Network [OSTI]

    Newfeld, Stuart J.

    Salmonella pathogenesis reveals that BMP signaling regulates blood cell homeostasis and immune of plasmatocytes. Salmonella challenge revealed that in dpp mutants the misregu- lation of this cascade also that combining Drosophila and Salmonella genetics can provide novel opportunities for advancing our knowledge

  15. Regulation of signal duration and the statistical dynamics of kinase activation by scaffold proteins

    E-Print Network [OSTI]

    Jason W. Locasale; Arup K. Chakraborty

    2008-10-29

    Scaffolding proteins that direct the assembly of multiple kinases into a spatially localized signaling complex are often essential for the maintenance of an appropriate biological response. Although scaffolds are widely believed to have dramatic effects on the dynamics of signal propagation, the mechanisms that underlie these consequences are not well understood. Here, Monte Carlo simulations of a model kinase cascade are used to investigate how the temporal characteristics of signaling cascades can be influenced by the presence of scaffold proteins. Specifically, we examine the effects of spatially localizing kinase components on a scaffold on signaling dynamics. The simulations indicate that a major effect that scaffolds exert on the dynamics of cell signaling is to control how the activation of protein kinases is distributed over time. Scaffolds can influence the timing of kinase activation by allowing for kinases to become activated over a broad range of times, thus allowing for signaling at both early and late times. Scaffold concentrations that result in optimal signal amplitude also result in the broadest distributions of times over which kinases are activated. These calculations provide insights into one mechanism that describes how the duration of a signal can potentially be regulated in a scaffold mediated protein kinase cascade. Our results illustrate another complexity in the broad array of control properties that emerge from the physical effects of spatially localizing components of kinase cascades on scaffold proteins.

  16. Robust frequency diversity based algorithm for clutter noise reduction of ultrasonic signals using multiple sub-spectrum phase coherence

    SciTech Connect (OSTI)

    Gongzhang, R.; Xiao, B.; Lardner, T.; Gachagan, A.; Li, M.

    2014-02-18

    This paper presents a robust frequency diversity based algorithm for clutter reduction in ultrasonic A-scan waveforms. The performance of conventional spectral-temporal techniques like Split Spectrum Processing (SSP) is highly dependent on the parameter selection, especially when the signal to noise ratio (SNR) is low. Although spatial beamforming offers noise reduction with less sensitivity to parameter variation, phased array techniques are not always available. The proposed algorithm first selects an ascending series of frequency bands. A signal is reconstructed for each selected band in which a defect is present when all frequency components are in uniform sign. Combining all reconstructed signals through averaging gives a probability profile of potential defect position. To facilitate data collection and validate the proposed algorithm, Full Matrix Capture is applied on the austenitic steel and high nickel alloy (HNA) samples with 5MHz transducer arrays. When processing A-scan signals with unrefined parameters, the proposed algorithm enhances SNR by 20dB for both samples and consequently, defects are more visible in B-scan images created from the large amount of A-scan traces. Importantly, the proposed algorithm is considered robust, while SSP is shown to fail on the austenitic steel data and achieves less SNR enhancement on the HNA data.

  17. Human Glucocorticoid-Induced TNF Receptor Ligand Regulates its Signaling Activity Through Multiple Oligomerization States

    SciTech Connect (OSTI)

    Zhou,Z.; Dong, X.; Berezov, A.; Zhang, G.; Li, Y.; Zhang, H.; Murali, R.; Li, B.; Greene, M.

    2008-01-01

    Ligation between glucocorticoid-induced tumor necrosis factor receptor (GITR) and its ligand (GITRL) provides an undefined signal that renders CD4+CD25- effector T cells resistant to the inhibitory effects of CD4+CD25+ regulatory T cells. To understand the structural basis of GITRL function, we have expressed and purified the extracellular domain of human GITR ligand in Escherichia coli. Chromotography and cross-linking studies indicate that human GITRL (hGITRL) exists as dimers and trimers in solution and also can form a supercluster. To gain insight into the nature of GITRL oligomerization, we determined the crystallographic structures of hGITRL, which revealed a loosely associated open trimer with a deep cavity at the molecular center and a flexible C-terminal tail bent for trimerization. Moreover, a tetramer of trimers (i.e., supercluster) has also been observed in the crystal, consistent with the cross-linking analysis. Deletion of the C-terminal distal three residues disrupts the loosely assembled trimer and favors the formation of a dimer that has compromised receptor binding and signaling activity. Collectively, our studies identify multiple oligomeric species of hGITRL that possess distinct kinetics of ERK activation. The studies address the functional implications and structural models for a process by which hGITRL utilizes multiple oligomerization states to regulate GITR-mediated signaling during T cell costimulation.

  18. Current mode integrators and their applications in low-voltage high frequency CMOS signal processing 

    E-Print Network [OSTI]

    Smith, Sterling Lane

    1993-01-01

    Low voltage CMOS fully differential integrators for high frequency continuous-time filters using current-mode techniques are presented.. Current mode techniques are employed to avoid the use of the floating differential ...

  19. Rac1 and Cdc42 GTPases regulate shear stress-driven ?-catenin signaling in osteoblasts

    SciTech Connect (OSTI)

    Wan, Qiaoqiao; Cho, Eunhye; Yokota, Hiroki; Department of Anatomy and Cell Biology, Indiana University School of Medicine, Indianapolis, IN 46202 ; Na, Sungsoo

    2013-04-19

    Highlights: •Shear stress increased TCF/LEF activity and stimulated ?-catenin nuclear localization. •Rac1, Cdc42, and RhoA displayed distinct dynamic activity patterns under flow. •Rac1 and Cdc42, but not RhoA, regulate shear stress-driven TCF/LEF activation. •Cytoskeleton did not significantly affect shear stress-induced TCF/LEF activation. -- Abstract: Beta-catenin-dependent TCF/LEF (T-cell factor/lymphocyte enhancing factor) is known to be mechanosensitive and an important regulator for promoting bone formation. However, the functional connection between TCF/LEF activity and Rho family GTPases is not well understood in osteoblasts. Herein we investigated the molecular mechanisms underlying oscillatory shear stress-induced TCF/LEF activity in MC3T3-E1 osteoblast cells using live cell imaging. We employed fluorescence resonance energy transfer (FRET)-based and green fluorescent protein (GFP)-based biosensors, which allowed us to monitor signal transduction in living cells in real time. Oscillatory (1 Hz) shear stress (10 dynes/cm{sup 2}) increased TCF/LEF activity and stimulated translocation of ?-catenin to the nucleus with the distinct activity patterns of Rac1 and Cdc42. The shear stress-induced TCF/LEF activity was blocked by the inhibition of Rac1 and Cdc42 with their dominant negative mutants or selective drugs, but not by a dominant negative mutant of RhoA. In contrast, constitutively active Rac1 and Cdc42 mutants caused a significant enhancement of TCF/LEF activity. Moreover, activation of Rac1 and Cdc42 increased the basal level of TCF/LEF activity, while their inhibition decreased the basal level. Interestingly, disruption of cytoskeletal structures or inhibition of myosin activity did not significantly affect shear stress-induced TCF/LEF activity. Although Rac1 is reported to be involved in ?-catenin in cancer cells, the involvement of Cdc42 in ?-catenin signaling in osteoblasts has not been identified. Our findings in this study demonstrate that both Rac1 and Cdc42 GTPases are critical regulators in shear stress-driven ?-catenin signaling in osteoblasts.

  20. A Test of Vehicle-to-Grid (V2G) for Energy Storage and Frequency Regulation in the PJM

    E-Print Network [OSTI]

    Firestone, Jeremy

    A Test of Vehicle-to-Grid (V2G) for Energy Storage and Frequency Regulation in the PJM System energy storage for intermittent but renewable resources such as wind and solar. The results of the study frequent dispatch. The primary revenue in both of these markets is for capacity rather than energy

  1. Vascular endothelial growth factor signaling regulates the segregation of artery and vein via ERK activity during vascular development

    SciTech Connect (OSTI)

    Kim, Se-Hee [McAllister Heart Institute, Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States)] [McAllister Heart Institute, Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Schmitt, Christopher E.; Woolls, Melissa J. [McAllister Heart Institute, Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States) [McAllister Heart Institute, Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Yale Cardiovascular Research Center and Section of Cardiovascular Medicine, Dept. of Internal Medicine, Yale University School of Medicine, New Haven, CT 06511 (United States); Holland, Melinda B. [McAllister Heart Institute, Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States)] [McAllister Heart Institute, Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Kim, Jun-Dae [Yale Cardiovascular Research Center and Section of Cardiovascular Medicine, Dept. of Internal Medicine, Yale University School of Medicine, New Haven, CT 06511 (United States)] [Yale Cardiovascular Research Center and Section of Cardiovascular Medicine, Dept. of Internal Medicine, Yale University School of Medicine, New Haven, CT 06511 (United States); Jin, Suk-Won, E-mail: suk-won.jin@yale.edu [Yale Cardiovascular Research Center and Section of Cardiovascular Medicine, Dept. of Internal Medicine, Yale University School of Medicine, New Haven, CT 06511 (United States)] [Yale Cardiovascular Research Center and Section of Cardiovascular Medicine, Dept. of Internal Medicine, Yale University School of Medicine, New Haven, CT 06511 (United States)

    2013-01-25

    Highlights: ? VEGF-A signaling regulates the segregation of axial vessels. ? VEGF-A signaling is mediated by PKC and ERK in this process. ? Ectopic activation of ERK is sufficient to rescue defects in vessel segregation. -- Abstract: Segregation of two axial vessels, the dorsal aorta and caudal vein, is one of the earliest patterning events occur during development of vasculature. Despite the importance of this process and recent advances in our understanding on vascular patterning during development, molecular mechanisms that coordinate the segregation of axial vessels remain largely elusive. In this report, we find that vascular endothelial growth factor-A (Vegf-A) signaling regulates the segregation of dorsal aorta and axial vein during development. Inhibition of Vegf-A pathway components including ligand Vegf-A and its cognate receptor Kdrl, caused failure in segregation of axial vessels in zebrafish embryos. Similarly, chemical inhibition of Mitogen-activated protein kinase kinase (Map2k1)/Extracellular-signal-regulated kinases (Erk) and phosphatidylinositol 3-kinases (PI3 K), which are downstream effectors of Vegf-A signaling pathway, led to the fusion of two axial vessels. Moreover, we find that restoring Erk activity by over-expression of constitutively active MEK in embryos with a reduced level of Vegf-A signaling can rescue the defects in axial vessel segregation. Taken together, our data show that segregation of axial vessels requires the function of Vegf-A signaling, and Erk may function as the major downstream effector in this process.

  2. Molecular Mimicry Regulates ABA Signaling by SnRK2 Kinases and PP2C Phosphatases

    SciTech Connect (OSTI)

    Soon, Fen-Fen; Ng, Ley-Moy; Zhou, X. Edward; West, Graham M.; Kovach, Amanda; Tan, M.H. Eileen; Suino-Powell, Kelly M.; He, Yuanzheng; Xu, Yong; Chalmers, Michael J.; Brunzelle, Joseph S.; Zhang, Huiming; Yang, Huaiyu; Jiang, Hualiang; Li, Jun; Yong, Eu-Leong; Cutler, Sean; Zhu, Jian-Kang; Griffin, Patrick R.; Melcher, Karsten; Xu, H. Eric (Van Andel); (Scripps); (NWU); (Purdue); (UCR); (Chinese Aca. Sci.); (NU Singapore)

    2014-10-02

    Abscisic acid (ABA) is an essential hormone for plants to survive environmental stresses. At the center of the ABA signaling network is a subfamily of type 2C protein phosphatases (PP2Cs), which form exclusive interactions with ABA receptors and subfamily 2 Snfl-related kinase (SnRK2s). Here, we report a SnRK2-PP2C complex structure, which reveals marked similarity in PP2C recognition by SnRK2 and ABA receptors. In the complex, the kinase activation loop docks into the active site of PP2C, while the conserved ABA-sensing tryptophan of PP2C inserts into the kinase catalytic cleft, thus mimicking receptor-PP2C interactions. These structural results provide a simple mechanism that directly couples ABA binding to SnRK2 kinase activation and highlight a new paradigm of kinase-phosphatase regulation through mutual packing of their catalytic sites.

  3. IEEE SIGNAL PROCESSING LETTERS, VOL. 20, NO. 6, JUNE 2013 575 Joint Frequency and Phasor Estimation

    E-Print Network [OSTI]

    Tong, Lang

    , constrained maximum likelihood estimation, frequency estimation, phasor measurement unit (PMU), power system in the context of power system state estimation using phasor measurement units (PMUs). A key feature of PMU meters period. PMU provides syn- chronized direct measurements of bus voltages and currents. Under normal

  4. Quality factor tuning of high-frequency high-Q filter biquads using adaptive signal processing 

    E-Print Network [OSTI]

    Stevenson, Jan-Michael

    1997-01-01

    A quality factor (Q) tuning technique for high-frequency and high-Q continuous-time filter biquads is proposed. The method is based on the existing magnitude locked loop Q-tuning technique, but it utilizes the continuous-time adaptive LMS algorithm...

  5. Genome-scale RNAi on living-cell microarrays identifies novel regulators of Drosophila melanogaster TORC1–S6K pathway signaling

    E-Print Network [OSTI]

    Lindquist, Robert A.

    The evolutionarily conserved target of rapamycin complex 1 (TORC1) controls cell growth in response to nutrient availability and growth factors. TORC1 signaling is hyperactive in cancer, and regulators of TORC1 signaling ...

  6. IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS--I: FUNDAMENTAL THEORY AND APPLICATIONS, VOL. 50, NO. 8, AUGUST 2003 1103 Small-Signal Analysis of Frequency-Controlled

    E-Print Network [OSTI]

    IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS--I: FUNDAMENTAL THEORY AND APPLICATIONS, VOL. 50, NO. 8, AUGUST 2003 1103 Small-Signal Analysis of Frequency-Controlled Electronic Ballasts Yan Yin, Student of frequency-controlled dimming electronic ballasts. A modified phasor transformation is proposed that converts

  7. Signal photon flux generated by high-frequency relic gravitational waves

    E-Print Network [OSTI]

    Xin Li; Sai Wang; Hao Wen

    2015-08-26

    The power spectrum of primordial tensor perturbations $\\mathcal{P}_t$ increases rapidly in high frequency region if the spectral index $n_t>0$. It is shown that the amplitude of relic gravitational wave $h_t$($5\\times10^9$Hz) varies from $10^{-36}$ to $10^{-25}$ while $n_t$ varies from $-6.25\\times 10^{-3}$ to $0.87$. High frequency gravitational waves detector that is proposed by F.-Y. Li detects gravitational waves through observing the perturbed photon flux that is generated by interaction between the relic gravitational waves and electromagnetic system. It is shown that the perturbative photon flux $N_x^1$($5\\times10^9$Hz) varies from $1.40\\times10^{-4}\\rm s^{-1}$ to $2.85\\times10^{7}\\rm s^{-1}$ while $n_t$ varies from $-6.25\\times 10^{-3}$ to $0.87$. Correspondingly, the ratio of the transverse perturbative photon flux $N_x^1$ to the background photon flux varies from $10^{-28}$ to $10^{-16}$.

  8. Supplementary Information for Friedman and Perrimon, "A functional genomic RNAi screen for novel regulators of RTK and ERK signaling," 2006.

    E-Print Network [OSTI]

    Higgins, Darren

    regulators of RTK and ERK signaling," 2006. Supplementary Methods Genome-wide RNAi Screening The genome of S2R+ cells overexpressing cDNAs for the Drosophila ERK ortholog Rolled, tagged at its CUAST and expressed under actinGal4 control. We observed similar kinetics of ERK activation in response to stimulus

  9. Involvement of Extracellular Signal-Regulated Kinase (ERK) in Pardaxin-Induced Dopamine Release from PC12 Cells

    E-Print Network [OSTI]

    Linial, Michal

    Involvement of Extracellular Signal-Regulated Kinase (ERK) in Pardaxin-Induced Dopamine Release kinase (ERK)/mitogen-activated protein kinase (MAPK) in pardaxin-induced dopamine (DA) release DA release. Time course exper- iments indicated that PX, at nontoxic concentrations, stimu- lated ERK

  10. Improved Battery Models of an Aggregation of Thermostatically Controlled Loads for Frequency Regulation

    E-Print Network [OSTI]

    Sanandaji, Borhan M.

    Integration and Regulating Reserve Service Vast and deep integration of renewable energy resources into the existing power grid is essential in achieving the envi- sioned sustainable energy future. Environmental, stochasticity, and intermittency characteristics of renewable energies, however, present challenges

  11. Modeling of GE Appliances: Cost Benefit Study of Smart Appliances in Wholesale Energy, Frequency Regulation, and Spinning Reserve Markets

    SciTech Connect (OSTI)

    Fuller, Jason C.; Parker, Graham B.

    2012-12-31

    This report is the second in a series of three reports describing the potential of GE’s DR-enabled appliances to provide benefits to the utility grid. The first report described the modeling methodology used to represent the GE appliances in the GridLAB-D simulation environment and the estimated potential for peak demand reduction at various deployment levels. The third report will explore the technical capability of aggregated group actions to positively impact grid stability, including frequency and voltage regulation and spinning reserves, and the impacts on distribution feeder voltage regulation, including mitigation of fluctuations caused by high penetration of photovoltaic distributed generation. In this report, a series of analytical methods were presented to estimate the potential cost benefit of smart appliances while utilizing demand response. Previous work estimated the potential technical benefit (i.e., peak reduction) of smart appliances, while this report focuses on the monetary value of that participation. The effects on wholesale energy cost and possible additional revenue available by participating in frequency regulation and spinning reserve markets were explored.

  12. An Off-Chip Capacitor Free Low Dropout Regulator with PSR Enhancement at Higher Frequencies 

    E-Print Network [OSTI]

    Gopalraju, Seenu

    2012-02-14

    closer to open loop?s unity-gain frequency. The stability and PSR are totally valid even for load capacitor varying from 0 to 100 pF. The proposed capacitor-less LDO is fabricated in On-Semi 0.5 ?m fully CMOS process. Experimental results confirm a PSR...

  13. Grid regulation services for energy storage devices based on grid frequency

    SciTech Connect (OSTI)

    Pratt, Richard M; Hammerstrom, Donald J; Kintner-Meyer, Michael C.W.; Tuffner, Francis K

    2013-07-02

    Disclosed herein are representative embodiments of methods, apparatus, and systems for charging and discharging an energy storage device connected to an electrical power distribution system. In one exemplary embodiment, a controller monitors electrical characteristics of an electrical power distribution system and provides an output to a bi-directional charger causing the charger to charge or discharge an energy storage device (e.g., a battery in a plug-in hybrid electric vehicle (PHEV)). The controller can help stabilize the electrical power distribution system by increasing the charging rate when there is excess power in the electrical power distribution system (e.g., when the frequency of an AC power grid exceeds an average value), or by discharging power from the energy storage device to stabilize the grid when there is a shortage of power in the electrical power distribution system (e.g., when the frequency of an AC power grid is below an average value).

  14. Grid regulation services for energy storage devices based on grid frequency

    DOE Patents [OSTI]

    Pratt, Richard M; Hammerstrom, Donald J; Kintner-Meyer, Michael C.W.; Tuffner, Francis K

    2014-04-15

    Disclosed herein are representative embodiments of methods, apparatus, and systems for charging and discharging an energy storage device connected to an electrical power distribution system. In one exemplary embodiment, a controller monitors electrical characteristics of an electrical power distribution system and provides an output to a bi-directional charger causing the charger to charge or discharge an energy storage device (e.g., a battery in a plug-in hybrid electric vehicle (PHEV)). The controller can help stabilize the electrical power distribution system by increasing the charging rate when there is excess power in the electrical power distribution system (e.g., when the frequency of an AC power grid exceeds an average value), or by discharging power from the energy storage device to stabilize the grid when there is a shortage of power in the electrical power distribution system (e.g., when the frequency of an AC power grid is below an average value).

  15. Published in Mechanical Systems and Signal Processing 23 (2009) 1112-1122 Designing structures for dynamical properties via natural frequencies separation.

    E-Print Network [OSTI]

    Sultan, Cornel

    2009-01-01

    1 Published in Mechanical Systems and Signal Processing 23 (2009) 1112-1122 Designing structures for dynamical properties via natural frequencies separation. Application to tensegrity structures design Cornel The design of structures for dynamic properties is addressed by placing conditions on the separation between

  16. Role of fibroblast growth factor signalling on the regulation of embryonic stem cells 

    E-Print Network [OSTI]

    Freile Vinuela, Paz

    2008-01-01

    Fibroblast growth factor (FGF) signalling plays many fundamentally important roles during the development of the mammalian embryo. However, its effects on pluripotent stem cells derived from mouse and human embryos appear ...

  17. Estradiol-Induced Object Memory Consolidation in Middle-Aged Female Mice Requires Dorsal Hippocampal Extracellular Signal-Regulated Kinase and Phosphatidylinositol 3-Kinase Activation

    E-Print Network [OSTI]

    Lewis, Michael C.

    We previously demonstrated that dorsal hippocampal extracellular signal-regulated kinase (ERK) activation is necessary for 17?[beta]-estradiol (E2[E subscript 2]) to enhance novel object recognition in young ovariectomized ...

  18. Regulation of horizontal gene transfer by intercellular peptide signaling in Bacillus subtilis

    E-Print Network [OSTI]

    Auchtung, Jennifer M

    2006-01-01

    Horizontal gene transfer plays an important role in bacterial evolution. Although acquisition of foreign DNA can be beneficial to cells, it can also be detrimental. Therefore, cells that possess mechanisms to regulate ...

  19. Regulated ADAM17-dependent EGF family ligand release by substrate-selecting signaling pathways

    E-Print Network [OSTI]

    Dang, Michelle

    Ectodomain cleavage of cell-surface proteins by A disintegrin and metalloproteinases (ADAMs) is highly regulated, and its dysregulation has been linked to many diseases. ADAM10 and ADAM17 cleave most disease-relevant ...

  20. Distinct regulation of dopamine D2S and D2L autoreceptor signaling by calcium

    E-Print Network [OSTI]

    Gantz, Stephanie C.

    D2 autoreceptors regulate dopamine release throughout the brain. Two isoforms of the D2 receptor, D2S and D2L, are expressed in midbrain dopamine neurons. Differential roles of these isoforms as autoreceptors are poorly ...

  1. Regulation and function of the Rho GTPase mediated signaling pathways in metastasis and lenticular differentiation 

    E-Print Network [OSTI]

    Mitchell, Dianne Courtenay

    2007-09-17

    Modulation of the actin-based cytoskeleton and transcription factor regulation are merely two essential functions in a wide array of cellular activities that the Rho family of small GTPases is responsible for mediating. ...

  2. From Signaling to Structure: Regulation of Extracellular Matrix in C. elegans 

    E-Print Network [OSTI]

    Schultz, Robbie

    2015-04-03

    The extracellular matrix is a meshwork of molecules that reside in the microenvironment between cells. Extracellular matrix, while historically known as an inert scaffold, is critical in regulating cell communication, ...

  3. Extracellular signal-regulated kinase 2 (ERK-2) mediated phosphorylation regulates nucleo-cytoplasmic shuttling and cell growth control of Ras-associated tumor suppressor protein, RASSF2

    SciTech Connect (OSTI)

    Kumari, Gita [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India)] [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India); Mahalingam, S., E-mail: mahalingam@iitm.ac.in [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India); Department of Biotechnology, Laboratory of Molecular Virology and Cell Biology, Indian Institute of Technology-Madras, Chennai 600 036 (India)

    2009-10-01

    Ras GTPase controls the normal cell growth through binding with an array of effector molecules, such as Raf and PI3-kinase in a GTP-dependent manner. RASSF2, a member of the Ras association domain family, is known to be involved in the suppression of cell growth and is frequently down-regulated in various tumor tissues by promoter hypermethylation. In the present study, we demonstrate that RASSF2 shuttles between nucleus and cytoplasm by a signal-mediated process and its export from the nucleus is sensitive to leptomycin B. Amino acids between 240 to 260 in the C-terminus of RASSF2 harbor a functional nuclear export signal (NES), which is necessary and sufficient for efficient export of RASSF2 from the nucleus. Substitution of conserved Ile254, Val257 and Leu259 within the minimal NES impaired RASSF2 export from the nucleus. In addition, wild type but not the nuclear export defective RASSF2 mutant interacts with export receptor, CRM-1 and exported from the nucleus. Surprisingly, we observed nucleolar localization for the nuclear export defective mutant suggesting the possibility that RASSF2 may localize in different cellular compartments transiently in a cell cycle dependent manner and the observed nuclear localization for wild type protein may be due to faster export kinetics from the nucleolus. Furthermore, our data suggest that RASSF2 is specifically phosphorylated by MAPK/ERK-2 and the inhibitors of MAPK pathway impair the phosphorylation and subsequently block the export of RASSF2 from the nucleus. These data clearly suggest that ERK-2 mediated phosphorylation plays an important role in regulating the nucleo-cytoplasmic shuttling of RASSF2. Interestingly, nuclear import defective mutant of RASSF2 failed to induce cell cycle arrest at G1/S phase and apoptosis suggesting that RASSF2 regulates cell growth in a nuclear localization dependent manner. Collectively, these data provided evidence for the first time that MAPK/ERK-2 mediated phosphorylation regulates nucleo-cytoplasmic transport and cell growth arrest activity of RASSF2. Taken together, the present study suggests that active transport between nucleus and cytoplasm may constitute an important regulatory mechanism for RASSF2 function.

  4. Dmp1 Regulates Osteocyte Function Via Wnt/?-Catenin Signaling Pathway 

    E-Print Network [OSTI]

    Lin, Shuxian

    2014-05-06

    -regulating neutral endopeptidase, X-linked PTHR Parathyroid receptor PL Periodontal ligament P Pulp Pi Phosphorus PTH Parathyroid hormone viii RGD Arginine-glycine-aspartic acid Runx2 Runt-related transcription factor 2 RBC Red blood cell SIBLINGs... .........................................................................................................................22 Discussion ...................................................................................................................26 CHAPTER III NUCLEUS-TARGETED DMP1 FAILS TO RESCUE DENTAL DEFECTS IN DMP1 NULL MICE...

  5. Genomes & Developmental Control Wnt/-catenin signaling controls Mespo expression to regulate

    E-Print Network [OSTI]

    Tian, Weidong

    21 December 2006 Abstract The vertebral column is derived from somites, which are transient segments of the paraxial mesoderm that are present in developing vertebrates. The strict spatial and temporal regulation-K; Wnt; Xenopus laevis Introduction During vertebrate embryogenesis, the paraxial mesoderm separates

  6. Frequency-domain gravitational waves from non-precessing black-hole binaries. I. New numerical waveforms and anatomy of the signal

    E-Print Network [OSTI]

    Sascha Husa; Sebastian Khan; Mark Hannam; Michael Pürrer; Frank Ohme; Xisco Jiménez Forteza; Alejandro Bohé

    2015-08-28

    In this paper we discuss the anatomy of frequency-domain gravitational-wave signals from non-precessing black-hole coalescences with the goal of constructing accurate phenomenological waveform models. We first present new numerical-relativity simulations for mass ratios up to 18 including spins. From a comparison of different post-Newtonian approximants with numerical-relativity data we select the uncalibrated SEOBNRv2 model as the most appropriate for the purpose of constructing hybrid post-Newtonian/numerical-relativity waveforms, and we discuss how we prepare time-domain and frequency-domain hybrid data sets. We then use our data together with results in the literature to calibrate simple explicit expressions for the final spin and radiated energy. Equipped with our prediction for the final state we then develop a simple and accurate merger-ringdown-model based on modified Lorentzians in the gravitational wave amplitude and phase, and we discuss a simple method to represent the low frequency signal augmenting the TaylorF2 post-Newtonian approximant with terms corresponding to higher orders in the post-Newtonian expansion. We finally discuss different options for modelling the small intermediate frequency regime between inspiral and merger-ringdown. A complete phenomenological model based on the present work is presented in a companion paper.

  7. Effect on the condition of the metal in A K-300-3.5 turbine owing to multicycle fatigue from participation of a power generating unit in grid frequency and power regulation

    SciTech Connect (OSTI)

    Lebedeva, A. I.; Zorchenko, N. V.; Prudnikov, A. A.

    2011-09-15

    The effect on the condition of the rotor material owing to multicycle fatigue caused by variable stresses during participation of a power generating unit in grid frequency and power regulation is evaluated using the K-300-23.5 steam turbine as an example. It is shown that during normalized primary frequency regulation the safety factor is at least 50, while during automatic secondary regulation of frequency and power there is essentially no damage to the metal.

  8. Apparatus and method for detecting and measuring changes in linear relationships between a number of high frequency signals

    DOE Patents [OSTI]

    Bittner, John W. (Shoreham, NY); Biscardi, Richard W. (Ridge, NY)

    1991-01-01

    An electronic measurement circuit for high speed comparison of the relative amplitudes of a predetermined number of electrical input signals independent of variations in the magnitude of the sum of the signals. The circuit includes a high speed electronic switch that is operably connected to receive on its respective input terminals one of said electrical input signals and to have its common terminal serve as an input for a variable-gain amplifier-detector circuit that is operably connected to feed its output to a common terminal of a second high speed electronic switch. The respective terminals of the second high speed electronic switch are operably connected to a plurality of integrating sample and hold circuits, which in turn have their outputs connected to a summing logic circuit that is operable to develop first, second and third output voltages, the first output voltage being proportional to a predetermined ratio of sums and differences between the compared input signals, the second output voltage being proportional to a second summed ratio of predetermined sums and differences between said input signals, and the third output voltage being proportional to the sum of signals to the summing logic circuit. A servo system that is operably connected to receive said third output signal and compare it with a reference voltage to develop a slowly varying feedback voltage to control the variable-gain amplifier in said common amplifier-detector circuit in order to make said first and second output signals independent of variations in the magnitude of the sum of said input signals.

  9. Identification of the nuclear export signals that regulate the intracellular localization of the mouse CMP-sialic acid synthetase

    SciTech Connect (OSTI)

    Fujita, Akiko; Sato, Chihiro; Kitajima, Ken. E-mail: kitajima@agr.nagoya-u.ac.jp

    2007-03-30

    The CMP-sialic acid synthetase (CSS) catalyzes the activation of sialic acid (Sia) to CMP-Sia which is a donor substrate of sialyltransferases. The vertebrate CSSs are usually localized in nucleus due to the nuclear localization signal (NLS) on the molecule. In this study, we first point out that a small, but significant population of the mouse CMP-sialic acid synthetase (mCSS) is also present in cytoplasm, though mostly in nucleus. As a mechanism for the localization in cytoplasm, we first identified two nuclear export signals (NESs) in mCSS, based on the localization studies of the potential NES-deleted mCSS mutants as well as the potential NES-tagged eGFP proteins. These two NESs are conserved among mammalian and fish CSSs, but not present in the bacterial or insect CSS. These results suggest that the intracellular localization of vertebrate CSSs is regulated by not only the NLS, but also the NES sequences.

  10. INDEPENDENT SIGNALS FROM THE INFLUENCE OF INTERNAL MAGNETIC LAYERS ON THE FREQUENCIES OF SOLAR p-MODES

    SciTech Connect (OSTI)

    Foullon, C.; Nakariakov, V. M. [Centre for Fusion, Space and Astrophysics, Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)], E-mail: claire.foullon@warwick.ac.uk

    2010-05-01

    The discovery that p-mode frequencies of low degree do not follow changes of solar surface activity during the recent solar minimum offers the possibility of a new diagnostic signature of the responsible pressure perturbation in the wave guiding medium, potentially rich of information regarding the structure of the Sun and the cause of the unusually long solar minimum. Magnetic fields, as well as temperature changes, introduce equilibrium pressure deviations that modify the resonant frequencies of p-mode oscillations. Assuming the perturbation to be caused by a horizontal layer of magnetic field located in a plane-stratified model of the Sun, we compile analytical frequency shifts and process them to allow direct comparison with observations. The effect of magnetism itself on the central p-mode frequencies can be neglected in comparison with the thermal effect of a perturbative layer buried in the solar interior. A parametric study shows that a layer as thin as 2100 km at subsurface depths is able to reproduce reported mean anomalous frequency shifts (not correlated with the surface activity), while a layer of size around 4200 km increasing by a small amount at depths near 0.08 R {sub sun} can explain individual low-degree shifts. It is also possible to obtain the mean shifts via the upward motion through depths near 0.03 R {sub sun} of a rising perturbative layer of thickness around 7000 km. Hence, the anomalous frequency shifts are best explained by thermal effects in the upper regions of the convection zone. The effects of latitudinal distribution are not treated here.

  11. Positive regulation of the Egr-1/osteopontin positive feedback loop in rat vascular smooth muscle cells by TGF-{beta}, ERK, JNK, and p38 MAPK signaling

    SciTech Connect (OSTI)

    Yu, Hong-Wei; Liu, Qi-Feng [Department of Cardiology, The First Affiliated Hospital of China Medical University, 155th North of Nanjing Street, Heping Block, Shenyang, 110001 Liaoning Province (China)] [Department of Cardiology, The First Affiliated Hospital of China Medical University, 155th North of Nanjing Street, Heping Block, Shenyang, 110001 Liaoning Province (China); Liu, Gui-Nan, E-mail: guinanliu@hotmail.com [Department of Cardiology, The First Affiliated Hospital of China Medical University, 155th North of Nanjing Street, Heping Block, Shenyang, 110001 Liaoning Province (China)] [Department of Cardiology, The First Affiliated Hospital of China Medical University, 155th North of Nanjing Street, Heping Block, Shenyang, 110001 Liaoning Province (China)

    2010-05-28

    Previous studies identified a positive feedback loop in rat vascular smooth muscle cells (VSMCs) in which early growth response factor-1 (Egr-1) binds to the osteopontin (OPN) promoter and upregulates OPN expression, and OPN upregulates Egr-1 expression via the extracellular signal-regulated protein kinase (ERK) signaling pathway. The current study examined whether transforming growth factor-{beta} (TGF-{beta}) activity contributes to Egr-1 binding to the OPN promoter, and whether other signaling pathways act downstream of OPN to regulate Egr-1 expression. ChIP assays using an anti-Egr-1 antibody showed that amplification of the OPN promoter sequence decreased in TGF-{beta} DNA enzyme-transfected VSMCs relative to control VSMCs. Treatment of VSMCs with PD98059 (ERK inhibitor), SP600125 (JNK inhibitor), or SB203580 (p38 MAPK inhibitor) significantly inhibited OPN-induced Egr-1 expression, and PD98059 treatment was associated with the most significant decrease in Egr-1 expression. OPN-stimulated VSMC cell migration was inhibited by SP600125 or SB203580, but not by PD98059. Furthermore, MTT assays showed that OPN-mediated cell proliferation was inhibited by PD98059, but not by SP600125 or SB203580. Taken together, the results of the current study show that Egr-1 binding to the OPN promoter is positively regulated by TGF-{beta}, and that the p38 MAPK, JNK, and ERK pathways are involved in OPN-mediated Egr-1 upregulation.

  12. Design & development fo a 20-MW flywheel-based frequency regulation power plant : a study for the DOE Energy Storage Systems program.

    SciTech Connect (OSTI)

    Rounds, Robert (Beacon Power, Tyngsboro, MA); Peek, Georgianne Huff

    2009-01-01

    This report describes the successful efforts of Beacon Power to design and develop a 20-MW frequency regulation power plant based solely on flywheels. Beacon's Smart Matrix (Flywheel) Systems regulation power plant, unlike coal or natural gas generators, will not burn fossil fuel or directly produce particulates or other air emissions and will have the ability to ramp up or down in a matter of seconds. The report describes how data from the scaled Beacon system, deployed in California and New York, proved that the flywheel-based systems provided faster responding regulation services in terms of cost-performance and environmental impact. Included in the report is a description of Beacon's design package for a generic, multi-MW flywheel-based regulation power plant that allows accurate bids from a design/build contractor and Beacon's recommendations for site requirements that would ensure the fastest possible construction. The paper concludes with a statement about Beacon's plans for a lower cost, modular-style substation based on the 20-MW design.

  13. Radio frequency detection assembly and method for detecting radio frequencies

    DOE Patents [OSTI]

    Cown, Steven H. (Rigby, ID); Derr, Kurt Warren (Idaho Falls, ID)

    2010-03-16

    A radio frequency detection assembly is described and which includes a radio frequency detector which detects a radio frequency emission produced by a radio frequency emitter from a given location which is remote relative to the radio frequency detector; a location assembly electrically coupled with the radio frequency detector and which is operable to estimate the location of the radio frequency emitter from the radio frequency emission which has been received; and a radio frequency transmitter electrically coupled with the radio frequency detector and the location assembly, and which transmits a radio frequency signal which reports the presence of the radio frequency emitter.

  14. ADAM-10 and -17 regulate endometriotic cell migration via concerted ligand and receptor shedding feedback on kinase signaling

    E-Print Network [OSTI]

    Miller, Miles Aaron

    A Disintegrin and Metalloproteinases (ADAMs) are the principal enzymes for shedding receptor tyrosine kinase (RTK) ectodomains and ligands from the cell surface. Multiple layers of activity regulation, feedback, and catalytic ...

  15. Effects of interferon-[] on activation of the Jak/Stat signal transduction pathway and regulation of ovine endometrial gene expression 

    E-Print Network [OSTI]

    Stewart, Milton David

    2001-01-01

    Interferon-[] (IFN[]) is a Type I IFN produced by the trophectoderm of ruminant conceptuses for maternal recognition of pregnancy. IFN[] prevents transcriptional up-regulation of estrogen receptor ? (ER?) and oxytocin receptor (OTR) genes...

  16. Fibroblast growth factor-2 up-regulates the expression of nestin through the Ras–Raf–ERK–Sp1 signaling axis in C6 glioma cells

    SciTech Connect (OSTI)

    Chang, Kai-Wei; Huang, Yuan-Li; Wong, Zong-Ruei; Su, Peng-Han; Huang, Bu-Miin; Ju, Tsai-Kai; Technology Commons, College of Life Science, National Taiwan University, Taipei 106, Taiwan ; Yang, Hsi-Yuan

    2013-05-17

    Highlights: •Nestin expression in C6 glioma cells is induced by FGF-2. •Nestin expression is induced by FGF-2 via de novo RNA and protein synthesis. •The FGFR inhibitor SU5402 blocks the FGF-2-induced nestin expression. •The mRNA of FGFR1 and 3 are detected in C6 glioma cells. •Ras–Raf–ERK–Sp1 signaling pathway is responsibe for FGF-2-induced nestin expression. -- Abstract: Nestin is a 240-kDa intermediate filament protein expressed mainly in neural and myogenic stem cells. Although a substantial number of studies have focused on the expression of nestin during development of the central nervous system, little is known about the factors that induce and regulate its expression. Fibroblast growth factor-2 (FGF-2) is an effective mitogen and stimulates the proliferation and differentiation of a subset of nestin-expressing cells, including neural progenitor cells, glial precursor cells, and smooth muscle cells. To assess whether FGF-2 is a potent factor that induces the expression of nestin, C6 glioma cells were used. The results showed that nestin expression was up-regulated by FGF-2 via de novo RNA and protein synthesis. Our RT-PCR results showed that C6 glioma cells express FGFR1/3, and FGFRs is required for FGF-2-induced nestin expression. Further signaling analysis also revealed that FGF-2-induced nestin expression is mediated through FGFR–MAPK–ERK signaling axis and the transcriptional factor Sp1. These findings provide new insight into the regulation of nestin in glial system and enable the further studies on the function of nestin in glial cells.

  17. Spatial Phosphoprotein Profiling Reveals a Compartmentalized Extracellular Signal-regulated Kinase Switch Governing Neurite Growth and Retraction

    SciTech Connect (OSTI)

    Wang, Yingchun; Yang, Feng; Fu, Yi; Huang, Xiahe; Wang, Wei; Jiang, Xining; Gritsenko, Marina A.; Zhao, Rui; Monroe, Matthew E.; Pertz, Olivier C.; Purvine, Samuel O.; Orton, Daniel J.; Jacobs, Jon M.; Camp, David G.; Smith, Richard D.; Klemke, Richard L.

    2011-05-20

    Abstract - Brain development and spinal cord regeneration require neurite sprouting and growth cone navigation in response to extension and collapsing factors present in the extracellular environment. These external guidance cues control neurite growth cone extension and retraction processes through intracellular protein phosphorylation of numerous cytoskeletal, adhesion, and polarity complex signaling proteins. However, the complex kinase/substrate signaling networks that mediate neuritogenesis have not been investigated. Here, we compare the neurite phosphoproteome under growth and retraction conditions using neurite purification methodology combined with mass spectrometry. More than 4000 non-redundant phosphorylation sites from 1883 proteins have been annotated and mapped to signaling pathways that control kinase/phosphatase networks, cytoskeleton remodeling, and axon/dendrite specification. Comprehensive informatics and functional studies revealed a compartmentalized ERK activation/deactivation cytoskeletal switch that governs neurite growth and retraction, respectively. Our findings provide the first system-wide analysis of the phosphoprotein signaling networks that enable neurite growth and retraction and reveal an important molecular switch that governs neuritogenesis.

  18. Ethanol Negatively Regulates Hepatic Differentiation of hESC by Inhibition of the MAPK/ERK Signaling Pathway

    E-Print Network [OSTI]

    Ferrara, Katherine W.

    Ethanol Negatively Regulates Hepatic Differentiation of hESC by Inhibition of the MAPK progenitor cells derived from hESCs to study the impact of ethanol on hepatocyte differentiation by exposure of these progenitor cells to ethanol during hepatocyte differentiation. Results: We found that ethanol negatively

  19. AP-1 regulates {alpha}{sub 2}{beta}{sub 1} integrin expression by ERK-dependent signals during megakaryocytic differentiation of K562 cells

    SciTech Connect (OSTI)

    Eriksson, Minna [Molecular Cancer Biology Research Program, Biomedicum Helsinki and Haartman Institute, P.O. Box 63, FIN-00014 Helsinki (Finland); Department of Oncology, Helsinki University Central Hospital, P.O. Box 180, FIN-00029 HUCH (Finland); Arminen, Laura [Molecular Cancer Biology Research Program, Biomedicum Helsinki and Haartman Institute, P.O. Box 63, FIN-00014 Helsinki (Finland); Department of Oncology, Helsinki University Central Hospital, P.O. Box 180, FIN-00029 HUCH (Finland); Karjalainen-Lindsberg, Marja-Liisa [University of Helsinki, P.O. Box 63, FIN-00014 Helsinki (Finland); Leppae, Sirpa [Molecular Cancer Biology Research Program, Biomedicum Helsinki and Haartman Institute, P.O. Box 63, FIN-00014 Helsinki (Finland) and Department of Oncology, Helsinki University Central Hospital, P.O. Box 180, FIN-00029 HUCH (Finland)]. E-mail: sirpa.leppa@hus.fi

    2005-03-10

    Mitogen-activated protein kinases (MAPKs) have been implicated as regulators of cellular differentiation. The biological effect of MAPK signaling in the nucleus is achieved by signal-responsive transcription factors. Here, we have investigated the connection of MAPKs, transcription factor AP-1, and {alpha}{sub 2}{beta}{sub 1} integrin expression in K562 cells undergoing differentiation along the megakaryocytic pathway. We report that three distinct MAPKs, ERK, JNK, and p38, are activated during the TPA-induced megakaryocytic differentiation. Activation of MAPK pathways is followed by acquisition of the AP-1 DNA-binding and transactivation capacities. AP-1 DNA-binding activity consists primarily of JunD, c-Fos, and Fra-1, and is accompanied with the increased expression and phosphorylation of these subunits. While inhibition of JNK mainly prevents expression and phosphorylation of JunD and c-Jun, inhibition of the ERK pathway suppresses both phosphorylation and expression of Jun proteins, and expression of c-Fos and Fra-1. Furthermore, only the activity of the ERK pathway is essential for the differentiation response, as determined by expression of {alpha}{sub 2}{beta}{sub 1} (CD49b) integrin. The importance of AP-1 as a mediator ERK signaling during differentiation is demonstrated by the findings that expression of c-fos siRNA and dominant negative AP-1/c-Jun{sup bZIP} downregulate the TPA- and ERK-induced expression of {alpha}{sub 2}{beta}{sub 1} integrin mRNAs and proteins. Conversely, coexpression of JunD or c-Jun and c-Fos can induce {alpha}{sub 2}{beta}{sub 1} integrin expression independently of upstream signals. Taken together, the results show that AP-1 is a nuclear target of the ERK-pathway and mediates {alpha}{sub 2}{beta}{sub 1} integrin expression during megakaryocytic differentiation of K562 cells.

  20. Erlotinib inhibits T-cell-mediated immune response via down-regulation of the c-Raf/ERK cascade and Akt signaling pathway

    SciTech Connect (OSTI)

    Luo Qiong [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University 22 Han Kou Road, Nanjing 210093 (China); Gu Yanhong [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Zheng Wei; Wu Xingxin; Gong Fangyuan; Gu Liyun; Sun Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University 22 Han Kou Road, Nanjing 210093 (China); Xu Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University 22 Han Kou Road, Nanjing 210093 (China)

    2011-03-01

    Erlotinib is a potent inhibitor of epidermal growth factor receptor tyrosine kinase and has been demonstrated to treat advanced or metastatic non-small cell lung cancer to prolong survival after failure of first-line or second-line chemotherapy. However, little is known about its effects on immune system. In the present study, we aimed to investigate the immunosuppressive activity of erlotinib on T lymphocytes both in vitro and in vivo, and further explore its potential molecular mechanism. Erlotinib exerted a significant inhibition on the T cell proliferation and activation induced by concanavalin A, anti-CD3 plus anti-CD28, staphylococcal enterotoxin B or phorbol myristate acetate respectively in a concentration-dependent manner and it also inhibited the secretion of the proinflammatory cytokines such as IL-2 and IFN-{gamma} of activated T cells. Further study showed that erlotinib caused G0/G1 arrest and suppressed the phosphorylations of c-Raf, ERK and Akt in activated T cells. Moreover, erlotinib significantly ameliorated picryl chloride-induced ear contact dermatitis in a dose-dependent manner in vivo. In summary, these findings suggest that erlotinib may cause the impairment of T-cell-mediated immune response both in vitro and in vivo through inhibiting T cell proliferation and activation, which is closely associated with its potent down-regulation of the c-Raf/ERK cascade and Akt signaling pathway. - Graphical abstract: Erlotinib may cause the impairment of T-cell-mediated immune response both in vitro and in vivo through inhibiting T cell proliferation and activation, which is closely associated with its potent down-regulation of the c-Raf/ERK cascade and Akt signaling pathway. Display Omitted

  1. Mangiferin exerts antitumor activity in breast cancer cells by regulating matrix metalloproteinases, epithelial to mesenchymal transition, and ?-catenin signaling pathway

    SciTech Connect (OSTI)

    Li, Hongzhong; Huang, Jing; Yang, Bing; Xiang, Tingxiu; Yin, Xuedong; Peng, Weiyan; Cheng, Wei; Wan, Jingyuan; Luo, Fuling; Li, Hongyuan; Ren, Guosheng

    2013-10-01

    Although mangiferin which is a naturally occurring glucosylxanthone has exhibited promising anticancer activities, the detailed molecular mechanism of mangiferin on cancers still remains enigmatic. In this study, the anticancer activity of mangiferin was evaluated in breast cancer cell line-based in vitro and in vivo models. We showed that mangiferin treatment resulted in decreased cell viability and suppression of metastatic potential in breast cancer cells. Further mechanistic investigation revealed that mangiferin induced decreased matrix metalloproteinase (MMP)-7 and -9, and reversal of epithelial–mesenchymal transition (EMT). Moreover, it was demonstrated that mangiferin significantly inhibited the activation of ?-catenin pathway. Subsequent experiments showed that inhibiting ?-catenin pathway might play a central role in mangiferin-induced anticancer activity through modulation of MMP-7 and -9, and EMT. Consistent with these findings in vitro, the antitumor potential was also verified in mangiferin-treated MDA-MB-231 xenograft mice where significantly decreased tumor volume, weight and proliferation, and increased apoptosis were obtained, with lower expression of MMP-7 and -9, vimentin and active ?-catenin, and higher expression of E-cadherin. Taken together, our study suggests that mangiferin might be used as an effective chemopreventive agent against breast cancer. - Highlights: • Mangiferin inhibits growth and metastatic potential in breast cancer cells. • Mangiferin down-regulates MMP-7 and -9 in breast cancer cells. • Mangiferin induces the reversal of EMT in metastatic breast cancer cells. • Mangiferin inhibits the activation of ?-catenin pathway in breast cancer cells. • Inhibiting ?-catenin is responsible for the antitumor activity of mangiferin.

  2. Graphene Frequency Multipliers

    E-Print Network [OSTI]

    Wang, Han

    In this letter, the ambipolar transport properties of graphene flakes have been used to fabricate full-wave signal rectifiers and frequency-doubling devices. By correctly biasing an ambipolar graphene field-effect transistor ...

  3. Lactoferrin inhibits dexamethasone-induced chondrocyte impairment from osteoarthritic cartilage through up-regulation of extracellular signal-regulated kinase 1/2 and suppression of FASL, FAS, and Caspase 3

    SciTech Connect (OSTI)

    Tu, Yihui [Department of Orthopaedics, Yangpu District Central Hospital Affiliated to Tongji University School of Medicine, 450 Tengyue Road, Shanghai (China)] [Department of Orthopaedics, Yangpu District Central Hospital Affiliated to Tongji University School of Medicine, 450 Tengyue Road, Shanghai (China); Xue, Huaming [Department of Orthopaedics, Yangpu District Central Hospital Affiliated to Tongji University School of Medicine, 450 Tengyue Road, Shanghai (China) [Department of Orthopaedics, Yangpu District Central Hospital Affiliated to Tongji University School of Medicine, 450 Tengyue Road, Shanghai (China); Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom); Francis, Wendy [Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom)] [Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom); Davies, Andrew P. [Department of Orthopaedics and Trauma, Moriston Hospital, Swansea (United Kingdom)] [Department of Orthopaedics and Trauma, Moriston Hospital, Swansea (United Kingdom); Pallister, Ian; Kanamarlapudi, Venkateswarlu [Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom)] [Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom); Xia, Zhidao, E-mail: zhidao.xia@gmail.com [Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom)] [Institute of Life Science, College of Medicine, Swansea University, Singleton Park (United Kingdom)

    2013-11-08

    Highlights: •Dex exerts dose-dependant inhibition of HACs viability and induction of apoptosis. •Dex-induced impairment of chondrocytes was attenuated by rhLF. •ERK and FASL/FAS signaling are involved in the effects of rhLF. •OA patients with glucocorticoid-induced cartilage damage may benefit from treatment with rhLF. -- Abstract: Dexamethasone (Dex) is commonly used for osteoarthritis (OA) with excellent anti-inflammatory and analgesic effect. However, Dex also has many side effects following repeated use over prolonged periods mainly through increasing apoptosis and inhibiting proliferation. Lactoferrin (LF) exerts significantly anabolic effect on many cells and little is known about its effect on OA chondrocytes. Therefore, the aim of this study is to investigate whether LF can inhibit Dex-induced OA chondrocytes apoptosis and explore its possible molecular mechanism involved in. MTT assay was used to determine the optimal concentration of Dex and recombinant human LF (rhLF) on chondrocytes at different time and dose points. Chondrocytes were then stimulated with Dex in the absence or presence of optimal concentration of rhLF. Cell proliferation and viability were evaluated using MTT and LIVE/DEAD assay, respectively. Cell apoptosis was evaluated by multi-parameter apoptosis assay kit using both confocal microscopy and flow cytometry, respectively. The expression of extracellular signal-regulated kinase (ERK), FAS, FASL, and Caspase-3 (CASP3) at the mRNA and protein levels were examined by real-time polymerase chain reaction (PCR) and immunocytochemistry, respectively. The optimal concentration of Dex (25 ?g/ml) and rhLF (200 ?g/ml) were chosen for the following experiments. rhLF significantly reversed the detrimental effect of Dex on chondrocytes proliferation, viability, and apoptosis. In addition, rhLF significantly prevented Dex-induced down-regulation of ERK and up-regulation of FAS, FASL, and CASP3. These findings demonstrated that rhLF acts as an anabolic effect on chondrocytes through significantly reversing Dex-induced chondrocytes apoptosis. This study may contribute to further investigating the clinical application of LF on OA.

  4. Frequency spectrum analyzer with phase-lock

    DOE Patents [OSTI]

    Boland, Thomas J. (Idaho Falls, ID)

    1984-01-01

    A frequency-spectrum analyzer with phase-lock for analyzing the frequency and amplitude of an input signal is comprised of a voltage controlled oscillator (VCO) which is driven by a ramp generator, and a phase error detector circuit. The phase error detector circuit measures the difference in phase between the VCO and the input signal, and drives the VCO locking it in phase momentarily with the input signal. The input signal and the output of the VCO are fed into a correlator which transfers the input signal to a frequency domain, while providing an accurate absolute amplitude measurement of each frequency component of the input signal.

  5. Stepped frequency ground penetrating radar

    DOE Patents [OSTI]

    Vadnais, Kenneth G. (Ojai, CA); Bashforth, Michael B. (Buellton, CA); Lewallen, Tricia S. (Ventura, CA); Nammath, Sharyn R. (Santa Barbara, CA)

    1994-01-01

    A stepped frequency ground penetrating radar system is described comprising an RF signal generating section capable of producing stepped frequency signals in spaced and equal increments of time and frequency over a preselected bandwidth which serves as a common RF signal source for both a transmit portion and a receive portion of the system. In the transmit portion of the system the signal is processed into in-phase and quadrature signals which are then amplified and then transmitted toward a target. The reflected signals from the target are then received by a receive antenna and mixed with a reference signal from the common RF signal source in a mixer whose output is then fed through a low pass filter. The DC output, after amplification and demodulation, is digitized and converted into a frequency domain signal by a Fast Fourier Transform. A plot of the frequency domain signals from all of the stepped frequencies broadcast toward and received from the target yields information concerning the range (distance) and cross section (size) of the target.

  6. Regulation in EAE Costimulatory Signals

    E-Print Network [OSTI]

    Shihadeh, Alan

    1 10 100 0 50 100 150 200 0 1 10 100 CD28KO C57BL/6 WT IFN-gpg/ml IFN-gProducingCells MOG peptide 1 10 100 *p=0.0009 **p=0.009 MOG peptide concentration IFN-gpg/ml IFN-gProducingCells CD28KO C57BL/6

  7. Optical fibers with interferometric path length stability by controlled heating for transmission of optical signals and as components in frequency standards

    E-Print Network [OSTI]

    Müller, H; Peters, A; Braxmaier, Claus; Mueller, Holger; Peters, Achim

    2006-01-01

    We present a simple method to stabilize the optical path length of an optical fiber to an accuracy of about 1/100 of the laser wavelength. We study the dynamic response of the path length to modulation of an electrically conductive heater layer of the fiber. The path length is measured against the laser wavelength by use of the Pound-Drever-Hall method; negative feedback is applied via the heater. We apply the method in the context of a cryogenic resonator frequency standard.

  8. Proteasome inhibition-induced p38 MAPK/ERK signaling regulates autophagy and apoptosis through the dual phosphorylation of glycogen synthase kinase 3{beta}

    SciTech Connect (OSTI)

    Choi, Cheol-Hee [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of) [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Department of Pharmacology, College of Medicine, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Lee, Byung-Hoon [College of Pharmacy and Multiscreening Center for Drug Development, Seoul National University, Seoul 151-742 (Korea, Republic of)] [College of Pharmacy and Multiscreening Center for Drug Development, Seoul National University, Seoul 151-742 (Korea, Republic of); Ahn, Sang-Gun [Department of Pathology, College of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of)] [Department of Pathology, College of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of); Oh, Seon-Hee, E-mail: oshccw@hanmail.net [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)] [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer MG132 induces the phosphorylation of GSK3{beta}{sup Ser9} and, to a lesser extent, of GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer MG132 induces dephosphorylation of p70S6K{sup Thr389} and phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 dephosphorylates GSK3{beta}{sup Ser9} and phosphorylates GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer Inactivation of p38 phosphorylates p70S6K{sup Thr389} and increases the phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3{beta} (GSK3{beta}) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3{beta} at Ser{sup 9} and, to a lesser extent, Thr{sup 390}, the dephosphorylation of p70S6K at Thr{sup 389}, and the phosphorylation of p70S6K at Thr{sup 421} and Ser{sup 424}. The specific p38 inhibitor SB203080 reduced the p-GSK3{beta}{sup Ser9} and autophagy through the phosphorylation of p70S6K{sup Thr389}; however, it augmented the levels of p-ERK, p-GSK3{beta}{sup Thr390}, and p-70S6K{sup Thr421/Ser424} induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our data show that proteasome inhibition regulates p38/GSK{sup Ser9}/p70S6K{sup Thr380} and ERK/GSK3{beta}{sup Thr390}/p70S6K{sup Thr421/Ser424} kinase signaling, which is involved in cell survival and cell death.

  9. Method and apparatus for monitoring the rotating frequency of de-energized induction motors

    DOE Patents [OSTI]

    Mikesell, Harvey E. (McMurray, PA); Lucy, Eric (Murrysville, PA)

    1998-01-01

    The rotational speed of a coasting induction motor is measured by sensing e residual electrical voltages at the power terminals of the motor, thus eliminating the need for conventional tachometer equipment, additional mechanical components or modifications to the induction motor itself. The power terminal voltage signal is detected and transformed into a DC voltage proportional to the frequency of the signal. This DC voltage can be input to the control system of a variable frequency motor controller to regulate the output characteristics thereof relative to the speed of the coasting motor.

  10. Wide band stepped frequency ground penetrating radar

    DOE Patents [OSTI]

    Bashforth, M.B.; Gardner, D.; Patrick, D.; Lewallen, T.A.; Nammath, S.R.; Painter, K.D.; Vadnais, K.G.

    1996-03-12

    A wide band ground penetrating radar system is described embodying a method wherein a series of radio frequency signals is produced by a single radio frequency source and provided to a transmit antenna for transmission to a target and reflection therefrom to a receive antenna. A phase modulator modulates those portions of the radio frequency signals to be transmitted and the reflected modulated signal is combined in a mixer with the original radio frequency signal to produce a resultant signal which is demodulated to produce a series of direct current voltage signals, the envelope of which forms a cosine wave shaped plot which is processed by a Fast Fourier Transform Unit 44 into frequency domain data wherein the position of a preponderant frequency is indicative of distance to the target and magnitude is indicative of the signature of the target. 6 figs.

  11. Wide band stepped frequency ground penetrating radar

    DOE Patents [OSTI]

    Bashforth, Michael B. (Buellton, CA); Gardner, Duane (Santa Maria, CA); Patrick, Douglas (Santa Maria, CA); Lewallen, Tricia A. (Ventura, CA); Nammath, Sharyn R. (Santa Barbara, CA); Painter, Kelly D. (Goleta, CA); Vadnais, Kenneth G. (Alexandria, VA)

    1996-01-01

    A wide band ground penetrating radar system (10) embodying a method wherein a series of radio frequency signals (60) is produced by a single radio frequency source (16) and provided to a transmit antenna (26) for transmission to a target (54) and reflection therefrom to a receive antenna (28). A phase modulator (18) modulates those portion of the radio frequency signals (62) to be transmitted and the reflected modulated signal (62) is combined in a mixer (34) with the original radio frequency signal (60) to produce a resultant signal (53) which is demodulated to produce a series of direct current voltage signals (66) the envelope of which forms a cosine wave shaped plot (68) which is processed by a Fast Fourier Transform unit 44 into frequency domain data (70) wherein the position of a preponderant frequency is indicative of distance to the target (54) and magnitude is indicative of the signature of the target (54).

  12. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect (OSTI)

    Kim, Dong Joon [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of); College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of); Kang, Dong Chul [Ilsong Institute of Life Science, Hallym University, Anyang 431-060 (Korea, Republic of); Sang, Byung Chan [College of Agricultural Life and Sciences, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Myung, Pyung Keun [College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Park, Kyung Chan [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of)], E-mail: kpark@kribb.re.kr; Yeom, Young Il [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of)], E-mail: yeomyi@kribb.re.kr

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  13. Transparency in nonlinear frequency conversion

    E-Print Network [OSTI]

    Longhi, Stefano

    2015-01-01

    Suppression of wave scattering and the realization of transparency effects in engineered optical media and surfaces have attracted great attention in the past recent years. In this work the problem of transparency is considered for optical wave propagation in a nonlinear dielectric medium with second-order $\\chi^{(2)}$ susceptibility. Because of nonlinear interaction, a reference signal wave at carrier frequency $\\omega_1$ can exchange power, thus being amplified or attenuated,when phase matching conditions are satisfied and frequency conversion takes place. Therefore, rather generally the medium is not transparent to the signal wave because of 'scattering' in the frequency domain. Here we show that broadband transparency, corresponding to the full absence of frequency conversion in spite of phase matching, can be observed for the signal wave in the process of sum frequency generation whenever the effective susceptibility $\\chi^{(2)}$ along the nonlinear medium is tailored following a suitable spatial apodiza...

  14. Signal voter

    DOE Patents [OSTI]

    Goodwin, Roy L. (Chatsworth, CA)

    1981-01-01

    A voter for providing a single accurate output signal that is derived from the closest two signal levels of three input signals, each of which signals represents a measurement of the same phenomena. By means of the voting circuit, the signals are first sorted by level of amplitude and then ranked as highest, middle or lowest. The highest or lowest signal that is furthest from the middle signal is rejected, while the other highest or lowest signal is selected for processing. The selected high or low signal is then averaged with the middle signal to provide the output signal.

  15. Regulation control and energy management scheme for wireless power transfer

    DOE Patents [OSTI]

    Miller, John M.

    2015-12-29

    Power transfer rate at a charging facility can be maximized by employing a feedback scheme. The state of charge (SOC) and temperature of the regenerative energy storage system (RESS) pack of a vehicle is monitored to determine the load due to the RESS pack. An optimal frequency that cancels the imaginary component of the input impedance for the output signal from a grid converter is calculated from the load of the RESS pack, and a frequency offset f* is made to the nominal frequency f.sub.0 of the grid converter output based on the resonance frequency of a magnetically coupled circuit. The optimal frequency can maximize the efficiency of the power transfer. Further, an optimal grid converter duty ratio d* can be derived from the charge rate of the RESS pack. The grid converter duty ratio d* regulates wireless power transfer (WPT) power level.

  16. Coordinate regulation/localization of the carbohydrate responsive binding protein (ChREBP) by two nuclear export signal sites: Discovery of a new leucine-rich nuclear export signal site

    SciTech Connect (OSTI)

    Fukasawa, Masashi; Ge, Qing; Wynn, R. Max; Ishii, Seiji [Biochemistry Department, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038 (United States)] [Biochemistry Department, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038 (United States); Uyeda, Kosaku, E-mail: Kosaku.Uyeda@utsouthwestern.edu [Biochemistry Department, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038 (United States) [Biochemistry Department, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038 (United States); Dallas Veterans Affairs Medical Center, Dallas, TX 75216 (United States)

    2010-01-08

    Carbohydrate response element binding protein (ChREBP) is responsible for conversion of dietary carbohydrate to storage fat in liver by coordinating expression of the enzymes that channel glycolytic pyruvate into lipogenesis. The activation of ChREBP in response to high glucose is nuclear localization and transcription, and the inactivation of ChREBP under low glucose involves export from the nucleus to the cytosol. Here we report a new nuclear export signal site ('NES1') of ChREBP. Together these signals provide ChREBP with two NES sequences, both the previously reported NES2 and now the new NES1 coordinate to interact together with CRM1 (exportin) for nuclear export of the carbohydrate response element binding protein.

  17. Modeling a Complex Pole-Zero System in Terms of its Low-Frequency/High-Frequency Cutoffs

    E-Print Network [OSTI]

    King, Roger

    Modeling a Complex Pole-Zero System in Terms of its Low-Frequency/High-Frequency Cutoffs Introduction Even a simple amplifier circuit will tend to have multiple poles and zeros in its high-frequency will alter a signal can be gotten from its high-frequency and low-frequency cutoffs. High-Frequency Response

  18. Preliminary crystallographic studies of the regulatory domain of response regulator YycF from an essential two-component signal transduction system

    E-Print Network [OSTI]

    Zhao, Haiyan; Heroux, Annie; Sequeira, Reuben D.; Tang, Liang

    2009-07-01

    YycG through a phosphotransfer reaction and elicits responses through regulation of gene expression. The N-terminal regulatory domain of YycF from Bacillus subtilis was overproduced and purified. The protein was crystallized and X-ray data were...

  19. Arsenite evokes IL-6 secretion, autocrine regulation of STAT3 signaling, and miR-21 expression, processes involved in the EMT and malignant transformation of human bronchial epithelial cells

    SciTech Connect (OSTI)

    Luo, Fei; Xu, Yuan; Ling, Min; Zhao, Yue; Xu, Wenchao; Liang, Xiao; Jiang, Rongrong; Wang, Bairu; Bian, Qian; Liu, Qizhan

    2013-11-15

    Arsenite is an established human carcinogen, and arsenite-induced inflammation contributes to malignant transformation of cells, but the molecular mechanisms by which cancers are produced remain to be established. The present results showed that, evoked by arsenite, secretion of interleukin-6 (IL-6), a pro-inflammatory cytokine, led to the activation of STAT3, a transcription activator, and to increased levels of a microRNA, miR-21. Blocking IL-6 with anti-IL-6 antibody and inhibiting STAT3 activation reduced miR-21 expression. For human bronchial epithelial cells, cultured in the presence of anti-IL-6 antibody for 3 days, the arsenite-induced EMT and malignant transformation were reversed. Thus, IL-6, acting on STAT3 signaling, which up-regulates miR-21in an autocrine manner, contributes to the EMT induced by arsenite. These data define a link from inflammation to EMT in the arsenite-induced malignant transformation of HBE cells. This link, mediated through miRNAs, establishes a mechanism for arsenite-induced lung carcinogenesis. - Highlights: • Arsenite evokes IL-6 secretion. • IL-6 autocrine mediates STAT3 signaling and up-regulates miR-21expression. • Inflammation is involved in arsenite-induced EMT.

  20. Library Regulations Library Regulations

    E-Print Network [OSTI]

    Birmingham, University of

    Library Regulations 2012-13 Library Regulations UNIVERSITY OF BIRMINGHAM REGULATIONS LIBRARY REGULATIONS Preamble: The Library Regulations apply to all users of library facilities managed on behalf of the University by Library Services, and thus there are sections that apply also to non- members of the University

  1. Transcriptional regulation in cowpea bruchid guts during adaptation to a plant defense protease inhibitor and screening of mutants that are altered in jasmonate-regulated signal transduction pathways using Arabidopsis thaliana 

    E-Print Network [OSTI]

    Moon, Jaewoong

    2009-05-15

    .?????????????????????. 28 3-2. Flow chart of JA-signaling mutant screening???????????? 31 3-3. Maps of T-DNAs for making mutant library????????????. 35 3-4. Recovery of genomic sequences flanking T-DNA by TAIL-PCR using three left border primers (LB...1, LB2, LB3) and arbitrary degenerate primer (AD)????????????????????......??????. 36 3-5. T-DNA primer design for diagnostic PCR ????????????... 40 3-6. Two recombination reactions in gateway technology..????????.. 51 3...

  2. Multi-mode radio frequency device

    DOE Patents [OSTI]

    Gilbert, Ronald W. (Morgan Hill, CA); Carrender, Curtis Lee (Morgan Hill, CA); Anderson, Gordon A. (Benton City, WA); Steele, Kerry D. (Kennewick, WA)

    2007-02-13

    A transponder device having multiple modes of operation, such as an active mode and a passive mode, wherein the modes of operation are selected in response to the strength of a received radio frequency signal. A communication system is also provided having a transceiver configured to transmit a radio frequency signal and to receive a responsive signal, and a transponder configured to operate in a plurality of modes and to activate modes of operation in response to the radio frequency signal. Ideally, each mode of operation is activated and deactivated independent of the other modes, although two or more modes may be concurrently operational.

  3. Variable frequency microwave furnace system

    DOE Patents [OSTI]

    Bible, D.W.; Lauf, R.J.

    1994-06-14

    A variable frequency microwave furnace system designed to allow modulation of the frequency of the microwaves introduced into a furnace cavity for testing or other selected applications. The variable frequency microwave furnace system includes a microwave signal generator or microwave voltage-controlled oscillator for generating a low-power microwave signal for input to the microwave furnace. A first amplifier may be provided to amplify the magnitude of the signal output from the microwave signal generator or the microwave voltage-controlled oscillator. A second amplifier is provided for processing the signal output by the first amplifier. The second amplifier outputs the microwave signal input to the furnace cavity. In the preferred embodiment, the second amplifier is a traveling-wave tube (TWT). A power supply is provided for operation of the second amplifier. A directional coupler is provided for detecting the direction of a signal and further directing the signal depending on the detected direction. A first power meter is provided for measuring the power delivered to the microwave furnace. A second power meter detects the magnitude of reflected power. Reflected power is dissipated in the reflected power load. 5 figs.

  4. Variable frequency microwave furnace system

    DOE Patents [OSTI]

    Bible, Don W. (Clinton, TN); Lauf, Robert J. (Oak Ridge, TN)

    1994-01-01

    A variable frequency microwave furnace system (10) designed to allow modulation of the frequency of the microwaves introduced into a furnace cavity (34) for testing or other selected applications. The variable frequency microwave furnace system (10) includes a microwave signal generator (12) or microwave voltage-controlled oscillator (14) for generating a low-power microwave signal for input to the microwave furnace. A first amplifier (18) may be provided to amplify the magnitude of the signal output from the microwave signal generator (12) or the microwave voltage-controlled oscillator (14). A second amplifier (20) is provided for processing the signal output by the first amplifier (18). The second amplifier (20) outputs the microwave signal input to the furnace cavity (34). In the preferred embodiment, the second amplifier (20) is a traveling-wave tube (TWT). A power supply (22) is provided for operation of the second amplifier (20). A directional coupler (24) is provided for detecting the direction of a signal and further directing the signal depending on the detected direction. A first power meter (30) is provided for measuring the power delivered to the microwave furnace (32). A second power meter (26) detects the magnitude of reflected power. Reflected power is dissipated in the reflected power load (28).

  5. A nonlinear optoelectronic filter for electronic signal processing

    E-Print Network [OSTI]

    Loh, William

    The conversion of electrical signals into modulated optical waves and back into electrical signals provides the capacity for low-loss radio-frequency (RF) signal transfer over optical fiber. Here, we show that the unique ...

  6. Agilent E8267D PSG Vector Signal Generator

    E-Print Network [OSTI]

    Anlage, Steven

    Agilent E8267D PSG Vector Signal Generator Configuration Guide This guide is intended to assist you with the ordering process of the PSG vector signal generators. #12;2 Agilent PSG Vector Signal Generator Options generator. E8267D-532 Frequency range from 250 kHz to 31.8 GHz Selects the maximum frequency of the signal

  7. A quantitative comparison of sRNA-based and protein-based gene regulation

    E-Print Network [OSTI]

    Pankaj Mehta; Sidhartha Goyal; Ned S. Wingreen

    2008-09-02

    Small, non-coding RNAs (sRNAs) play important roles as genetic regulators in prokaryotes. sRNAs act post-transcriptionally via complementary pairing with target mRNAs to regulate protein expression. We use a quantitative approach to compare and contrast sRNAs with conventional transcription factors (TFs) to better understand the advantages of each form of regulation. In particular, we calculate the steady-state behavior, noise properties, frequency-dependent gain (amplification), and dynamical response to large input signals of both forms of regulation. While the mean steady-state behavior of sRNA-regulated proteins exhibits a distinctive tunable threshold-linear behavior, our analysis shows that transcriptional bursting leads to significantly higher intrinsic noise in sRNA-based regulation than in TF-based regulation in a large range of expression levels and limits the ability of sRNAs to perform quantitative signaling. Nonetheless, we find that sRNAs are better than TFs at filtering noise in input signals. Additionally, we find that sRNAs allow cells to respond rapidly to large changes in input signals. These features suggest a niche for sRNAs in allowing cells to transition quickly yet reliably between distinct states. This functional niche is consistent with the widespread appearance of sRNAs in stress-response and quasi-developmental networks in prokaryotes.

  8. cAMP Signaling in the Gonadotropes

    E-Print Network [OSTI]

    Yeh, Debra Ming-Yi

    2012-01-01

    36 PACAP activates ERK and ELKgrowth response protein 1 ERK extracellular signal-regulated37 Figure 16: PACAP can activate ERK and

  9. Resonance-Based Signal Decomposition: A New Sparsity-Enabled Signal Analysis Ivan W. Selesnick

    E-Print Network [OSTI]

    Selesnick, Ivan

    Numerous signals arising from physiological and physical processes, in addition to being non to disentangle by linear methods. Examples of such signals include speech, biomedical, and geophysical signals. Introduction Frequency-based analysis and filtering are fundamental tools in signal processing. However

  10. Radio-Frequency Rectification on Membrane Bound Pores

    E-Print Network [OSTI]

    Sujatha Ramachandran; Robert H. Blick; Daniel W. van der Weide

    2007-09-12

    We present measurements on direct radio-frequency pumping of ion channels and pores bound in bilipid membranes. We make use of newly developed microcoaxes, which allow delivering the high frequency signal in close proximity to the membrane bound proteins and ion channels. We find rectification of the radio-frequency signal, which is used to pump ions through the channels and pores.

  11. Multidimensional signal modulation and/or demodulation for data communications

    DOE Patents [OSTI]

    Smith, Stephen F. (London, TN); Dress, William B. (Camas, WA)

    2008-03-04

    Systems and methods are described for multidimensional signal modulation and/or demodulation for data communications. A method includes modulating a carrier signal in a first domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; modulating the carrier signal in a second domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; and modulating the carrier signal in a third domain selected from the group consisting of phase, frequency, amplitude, polarization and spread.

  12. Intrinsically Disordered Proteins: Regulation and Disease Regulation of IDPs

    E-Print Network [OSTI]

    Babu, M. Madan

    31st Jan 2011 Intrinsically Disordered Proteins: Regulation and Disease Regulation of IDPs M. Madan.....................................................................................................................................2 3.1. IDPs are tightly regulated from transcript synthesis to protein degradation ......................................................................................................................................8 #12;1 Abstract Intrinsically disordered proteins (IDPs) are often enriched in signaling

  13. Variable frequency microwave heating apparatus

    DOE Patents [OSTI]

    Bible, Don W. (Clinton, TN); Lauf, Robert J. (Oak Ridge, TN); Johnson, Arvid C. (Lake in the Hills, IL); Thigpen, Larry T. (Angier, NC)

    1999-01-01

    A variable frequency microwave heating apparatus (10) designed to allow modulation of the frequency of the microwaves introduced into a multi-mode microwave cavity (34) for testing or other selected applications. The variable frequency microwave heating apparatus (10) includes a microwave signal generator (12) and a high-power microwave amplifier (20) or a high-power microwave oscillator (14). A power supply (22) is provided for operation of the high-power microwave oscillator (14) or microwave amplifier (20). A directional coupler (24) is provided for detecting the direction and amplitude of signals incident upon and reflected from the microwave cavity (34). A first power meter (30) is provided for measuring the power delivered to the microwave furnace (32). A second power meter (26) detects the magnitude of reflected power. Reflected power is dissipated in the reflected power load (28).

  14. Frequency entrainment for micromechanical oscillator M. Zalalutdinov,a)

    E-Print Network [OSTI]

    Rand, Richard H.

    Frequency entrainment for micromechanical oscillator M. Zalalutdinov,a) K. L. Aubin, M. Pandey, A frequency. By sweeping the pilot signal frequency, we demonstrate that the entrainment zone is hysteretic . © 2003 American Institute of Physics. DOI: 10.1063/1.1618363 Frequency entrainment is one of the most

  15. Regulation XVI: GENERAL UNIVERSITY REGULATIONS

    E-Print Network [OSTI]

    Regulation XVI: GENERAL UNIVERSITY REGULATIONS APPLICATION AND INTERPRETATION 1. Unless stated otherwise, these and the following Regulations apply to students in all Faculties, including the International Faculty: General Regulations for First Degrees; General Regulations for Higher Degrees

  16. Electromagnetic Signals from Bacterial DNA

    E-Print Network [OSTI]

    A. Widom; J. Swain; Y. N. Srivastava; S. Sivasubramanian

    2012-02-09

    Chemical reactions can be induced at a distance due to the propagation of electromagnetic signals during intermediate chemical stages. Although is is well known at optical frequencies, e.g. photosynthetic reactions, electromagnetic signals hold true for muck lower frequencies. In E. coli bacteria such electromagnetic signals can be generated by electric transitions between energy levels describing electrons moving around DNA loops. The electromagnetic signals between different bacteria within a community is a "wireless" version of intercellular communication found in bacterial communities connected by "nanowires". The wireless broadcasts can in principle be of both the AM and FM variety due to the magnetic flux periodicity in electron energy spectra in bacterial DNA orbital motions.

  17. Signaling pathways that regulate cellular senescence

    E-Print Network [OSTI]

    Freund, Adam Mark

    2010-01-01

    Acrp30 Angiogenin Axl bFGF BLC BTC CTACK EGF-­?R Fas DDIS  (bFGF Angiopoie?n-­?2 AgRP BTC VEGF Amphiregulin HCC-­?4gamma MSP-­alpha NT-­4 bFGF BTC MIF TNF-­beta MIG b-­NGF

  18. Characterization of lead zirconate titanate piezoceramic using high frequency ultrasonic spectroscopy

    E-Print Network [OSTI]

    Cao, Wenwu

    Characterization of lead zirconate titanate piezoceramic using high frequency ultrasonic in medical imaging. Design high frequency trans- ducer requires better knowledge of material properties since signal. Hence, knowing the properties of the transducer materials at high frequencies is important

  19. Outphasing Control of Gallium Nitride based Very High Frequency Resonant Converters

    E-Print Network [OSTI]

    Madsen, Mickey P.

    In this paper an outphasing modulation control method suitable for line regulation of very high frequency resonant converters is described.

  20. Self-Regulation as Two-Stage Rent-Seeking

    E-Print Network [OSTI]

    von Wangemheim, Georg

    2009-01-01

    interests and self-regulation; an economic approach (pp.Jose; Llobet, Gerard (2007): “Regulation, Corporate SocialA Signaling Motive for Self-Regulation in the Shadow of

  1. Mitogen-activated protein kinase kinase 1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors sensitize reduced glucocorticoid response mediated by TNF{alpha} in human epidermal keratinocytes (HaCaT)

    SciTech Connect (OSTI)

    Onda, Kenji [Department of Clinical Pharmacology, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392 (Japan)]. E-mail: knjond@ps.toyaku.ac.jp; Nagashima, Masahiro [Department of Clinical Pharmacology, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392 (Japan); Kawakubo, Yo [Department of Dermatology, Teikyo University School of Medicine, Ichihara Hospital, Chiba (Japan); Inoue, Shota [Department of Clinical Pharmacology, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392 (Japan); Hirano, Toshihiko [Department of Clinical Pharmacology, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392 (Japan); Oka, Kitaro [Department of Clinical Pharmacology, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392 (Japan)

    2006-12-08

    Glucocorticoids (GCs) are essential drugs administered topically or systematically for the treatment of autoimmune skin diseases such as pemphigus. However, a certain proportion of patients does not respond well to GCs. Although studies on the relationship between cytokines and GC insensitivity in local tissues have attracted attention recently, little is known about the underlying mechanism(s) for GC insensitivity in epidermal keratinocytes. Here, we report that tumor necrosis factor (TNF) {alpha} reduces GC-induced transactivation of endogenous genes as well as a reporter plasmid which contains GC responsive element (GRE) in human epidermal keratinocyte cells (HaCaT). The GC insensitivity by TNF{alpha} was not accompanied by changes in mRNA expressions of GR isoforms ({alpha} or {beta}). However, we observed that mitogen-activated protein kinase kinase-1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors (PD98059 and U0126) significantly sensitized the GC-induced transactivation of anti-inflammatory genes (glucocorticoid-induced leucine zipper (GILZ) and mitogen-activated protein kinase phosphatase (MKP)-1) and FK506 binding protein (FKBP) 51 gene in the presence of TNF{alpha}. Additionally, we observed that TNF{alpha} reduced prednisolone (PSL)-dependent nuclear translocation of GR, which was restored by pre-treatment of MEK-1 inhibitors. This is the first study demonstrating a role of the MEK-1/ERK cascade in TNF{alpha}-mediated GC insensitivity. Our data suggest that overexpression of TNF{alpha} leads to topical GC insensitivity by reducing GR nuclear translocation in keratinocytes, and our findings also suggest that inhibiting the MEK-1/ERK cascade may offer a therapeutic potential for increasing GC efficacy in epidermis where sufficient inflammatory suppression is required.

  2. A nonlinear optoelectronic filter for electronic signal processing

    E-Print Network [OSTI]

    Ram, Rajeev J.

    A nonlinear optoelectronic filter for electronic signal processing William Loh1,2 , Siva signals into modulated optical waves and back into electrical signals provides the capacity for low-loss radio-frequency (RF) signal transfer over optical fiber. Here, we show that the unique properties

  3. Signal approximation using the bilinear transform

    E-Print Network [OSTI]

    Venkataraman, Archana, Ph. D. Massachusetts Institute of Technology

    2007-01-01

    This thesis explores the approximation properties of a unique basis expansion. The expansion implements a nonlinear frequency warping between a continuous-time signal and its discrete-time representation according to the ...

  4. Monitoring method and apparatus using high-frequency carrier

    DOE Patents [OSTI]

    Haynes, Howard D. (Knoxville, TN)

    1996-01-01

    A method and apparatus for monitoring an electrical-motor-driven device by injecting a high frequency carrier signal onto the power line current. The method is accomplished by injecting a high frequency carrier signal onto an AC power line current. The AC power line current supplies the electrical-motor-driven device with electrical energy. As a result, electrical and mechanical characteristics of the electrical-motor-driven device modulate the high frequency carrier signal and the AC power line current. The high frequency carrier signal is then monitored, conditioned and demodulated. Finally, the modulated high frequency carrier signal is analyzed to ascertain the operating condition of the electrical-motor-driven device.

  5. Monitoring method and apparatus using high-frequency carrier

    DOE Patents [OSTI]

    Haynes, H.D.

    1996-04-30

    A method and apparatus for monitoring an electrical-motor-driven device by injecting a high frequency carrier signal onto the power line current. The method is accomplished by injecting a high frequency carrier signal onto an AC power line current. The AC power line current supplies the electrical-motor-driven device with electrical energy. As a result, electrical and mechanical characteristics of the electrical-motor-driven device modulate the high frequency carrier signal and the AC power line current. The high frequency carrier signal is then monitored, conditioned and demodulated. Finally, the modulated high frequency carrier signal is analyzed to ascertain the operating condition of the electrical-motor-driven device. 6 figs.

  6. Effects of electromagnetic field stimulation on cellular signal transduction mechanisms: Analyses of the effects of low frequency electromagnetic fields on calcium spiking in ROS 17/2.8 cells. Final report

    SciTech Connect (OSTI)

    Sisken, B.F.; Sisken, J.E.

    1997-12-01

    The general goals of this work were to determine whether resting levels of cellular second messengers, especially calcium, are affected by low-level electromagnetic fields and the mechanisms that could lead to such changes. The work performed was directed at (1) verifying the report of McLeod et al (1990) that low frequency sinusoidal EMF can alter basal calcium fluctuations in cultured ROS 17/2.8 osteoblast-like cells and (2) reproducing the findings of Luben et al (1982) that pulsed electromagnetic fields can affect PTH-stimulated adenylate cyclase activity in osteoblasts. Initially a system was constructed so that cells could be exposed to sinusoidal electric fields using platinum electrodes. In this system, the electrodes were separated from the cells and culture medium by agar barriers. A series of experiments indicated that this system was subject to a significant, though little-known artifact in which a not well understood interaction between the electrodes and sodium ions in the medium or in plain salt solutions led to frequency and amplitude dependent emission of photons that are recorded by the detection system. They therefore designed and constructed an air gap reactor system that utilizes a ferromagnetic core to direct the magnetic flux generated by a sinusoidal coil. Studies on the effects of a 15 Hz pulsed electromagnetic field (PEMF) on cyclic AMP metabolism were performed on ROS 17/2.8 and MC3T3 cells.

  7. Wavelet transform techniques and signal analysis

    SciTech Connect (OSTI)

    Perez, R.B.; Mattingly, J.K. |; Perez, J.S.

    1993-03-01

    Traditionally, the most widely used signal analysis tool is the Fourier transform which, by producing power spectral densities (PSDs), allows time dependent signals to be studied in the frequency domain. However, the Fourier transform is global -- it extends over the entire time domain -- which makes it ill-suited to study nonstationary signals which exhibit local temporal changes in the signal`s frequency content. To analyze nonstationary signals, the family of transforms commonly designated as short-time Fourier transforms (STFTs), capable of identifying temporally localized changes in the signal`s frequency content, were developed by employing window functions to isolate temporal regions of the signal. For example, the Gabor STFT uses a Gaussian window. However, the applicability of STFTs is limited by various inadequacies. The Wavelet transform (NW), recently developed by Grossman and Morlet and explored in depth by Daubechies (2) and Mallat, remedies the inadequacies of STFTs. Like the Fourier transform, the WT can be implemented as a discrete transform (DWT) or as a continuous (integral) transform (CWT). This paper briefly illustrates some of the potential applications of the wavelet transform algorithms to signal analysis.

  8. Au Nanoparticle Conjugation for Impedance and Capacitance Signal Amplification in Biosensors

    E-Print Network [OSTI]

    Suni, Ian Ivar

    Au Nanoparticle Conjugation for Impedance and Capacitance Signal Amplification in Biosensors 46515 Amplification of the electrochemical impedance and ca- pacitance signals in a biosensor of high-sensitivity electro- chemical impedance biosensors at a single low frequency, where the signal

  9. Original Full Length Article Low magnitude mechanical signals mitigate osteopenia without compromising

    E-Print Network [OSTI]

    expansion. Given bone's inherent mechanosensitivity, low intensity vibration (LIV), a mechanical signal-frequency mechanical signals induced via low intensity vibration (LIV) are anabolic to bone, perhaps servingOriginal Full Length Article Low magnitude mechanical signals mitigate osteopenia without

  10. Synchronizing carrier frequencies of co-channel amplitude-modulated broadcast

    DOE Patents [OSTI]

    Smith, Stephen F. (London, TN); Moore, James A. (Powell, TN)

    2007-05-15

    Systems and methods are described for carrier-frequency synchronization for improved AM and TV broadcast reception. A method includes synchronizing a carrier frequency of a broadcast signal with a remote reference frequency. An apparatus includes a reference signal receiver; a phase comparator coupled to the reference signal receiver; a voltage controlled oscillator coupled to the phase comparator; and a radio frequency output coupled to the voltage controlled oscillator.

  11. Carrier-frequency synchronization system for improved amplitude modulation and television broadcast reception

    DOE Patents [OSTI]

    Smith, Stephen F.; Moore, James A.

    2003-05-13

    Systems and methods are described for carrier-frequency synchronization for improved AM and TV broadcast reception. A method includes synchronizing a carrier frequency of a broadcast signal with a remote reference frequency. An apparatus includes a reference signal receiver; a phase comparator coupled to the reference signal receiver; a voltage controlled oscillator coupled to the phase comparator; and a radio frequency output coupled to the voltage controlled oscillator.

  12. mTOR Signaling in Growth Control and Disease

    E-Print Network [OSTI]

    Laplante, Mathieu

    The mechanistic target of rapamycin (mTOR) signaling pathway senses and integrates a variety of environmental cues to regulate organismal growth and homeostasis. The pathway regulates many major cellular processes and is ...

  13. Signal and Image Processing with Sinlets

    E-Print Network [OSTI]

    Davydov, Alexander Y

    2012-01-01

    This paper presents a new family of localized orthonormal bases - sinlets - which are well suited for both signal and image processing and analysis. One-dimensional sinlets are related to specific solutions of the time-dependent harmonic oscillator equation. By construction, each sinlet is differentiable infinitely many times and has a well-defined and smoothly-varied instantaneous frequency known in analytical form. For square-integrable transient signals with infinite support, one-dimensional sinlet basis provides an advantageous alternative to the Fourier transform by rendering accurate signal representation via a countable set of real-valued coefficients. The properties of sinlets make them suitable for analyzing many real-world signals whose frequency content changes with time including radar and sonar waveforms, music, speech, biological echolocation sounds, biomedical signals, seismic acoustic waves, and signals employed in wireless communication systems. One-dimensional sinlet bases can be used to con...

  14. Assessing Emotion Regulation in Social Anxiety Disorder: The Emotion Regulation Interview

    E-Print Network [OSTI]

    Gross, James J.

    Assessing Emotion Regulation in Social Anxiety Disorder: The Emotion Regulation Interview Kelly H dysregulation in SAD has not been well characterized. In the present study, the Emotion Regulation Interview (ERI) was developed to quantify the frequency and self-efficacy of five emotion regulation strategies

  15. The cellular basis for parallel neural transmission of a high-frequency stimulus and its

    E-Print Network [OSTI]

    Benda, Jan

    The cellular basis for parallel neural transmission of a high-frequency stimulus and its low-frequency envelopes of high-frequency signals and also suggest that information about stimuli and their envelopes take EOD frequencies will generate a high-frequency envelope of their EOD that is referred

  16. Characterization of arcs in frequency domain

    SciTech Connect (OSTI)

    D'Inca, R.; Siegl, G.; Faugel, H.; Braun, F.; Eckert, B.; Bobkov, V.; El Khaldi, M.; Noterdaeme, J.-M.

    2009-11-26

    Arc detection systems are developed for ICRH on ITER to prevent arcs from damaging the RF components. One of the detectors, the Sub-Harmonic Arc Detector (SHAD) is based on the detection of the frequencies emitted in the MHz range by arcs [R1]. To ensure the high level of reliability required for this safety system, it is necessary to demonstrate that these frequencies present a signal with a Signal to Noise Ratio high enough to be detected under the wide range of operational conditions (frequency, power, configuration) and for the different types of arcs that can appear in the feeding lines and on the antennas (vacuum arc, glow discharge, multipactor-induced discharge). For each type of arc, we analyze the evolution of the frequency spectrum relative to the evolution of other electrical parameters (reflected power, voltage)

  17. Regulation of Notch by Itch AIP4/Itch Regulates Notch Receptor Degradation in the Absence of Ligand

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Regulation of Notch by Itch 1 AIP4/Itch Regulates Notch Receptor Degradation in the AbsenceS ONE 3, 7 (2008) e2735" #12;Regulation of Notch by Itch 2 ABSTRACT Background. The regulation of Notch of ubiquitin-ligases, has been described as a negative regulator of Notch signaling, acting on the post

  18. Integrated Signal Processing and Signal Understanding1

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Integrated Signal Processing and Signal Understanding1 Victor Lesser, Hamid Nawaby, Malini Bhandaru processing and heuristic problem-solving in signal interpretation. The need for such a paradigm arises in signal understanding domains that require the processing of complicated interacting signals under

  19. Integrated Signal Processing and Signal Understanding 1

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Integrated Signal Processing and Signal Understanding 1 Victor Lesser, Hamid Nawab y , Malini processing and heuristic problem­solving in signal interpretation. The need for such a paradigm arises in signal understanding domains that require the processing of complicated interacting signals under

  20. Frequency-feedback cavity enhanced spectrometer

    DOE Patents [OSTI]

    Hovde, David Christian; Gomez, Anthony

    2015-08-18

    A spectrometer comprising an optical cavity, a light source capable of producing light at one or more wavelengths transmitted by the cavity and with the light directed at the cavity, a detector and optics positioned to collect light transmitted by the cavity, feedback electronics causing oscillation of amplitude of the optical signal on the detector at a frequency that depends on cavity losses, and a sensor measuring the oscillation frequency to determine the cavity losses.

  1. Wavelet transform techniques and signal analysis

    SciTech Connect (OSTI)

    Perez, R.B.; Mattingly, J.K. Tennessee Univ., Knoxville, TN . Dept. of Nuclear Engineering); Perez, J.S. . Facultad de Informatica)

    1993-01-01

    Traditionally, the most widely used signal analysis tool is the Fourier transform which, by producing power spectral densities (PSDs), allows time dependent signals to be studied in the frequency domain. However, the Fourier transform is global -- it extends over the entire time domain -- which makes it ill-suited to study nonstationary signals which exhibit local temporal changes in the signal's frequency content. To analyze nonstationary signals, the family of transforms commonly designated as short-time Fourier transforms (STFTs), capable of identifying temporally localized changes in the signal's frequency content, were developed by employing window functions to isolate temporal regions of the signal. For example, the Gabor STFT uses a Gaussian window. However, the applicability of STFTs is limited by various inadequacies. The Wavelet transform (NW), recently developed by Grossman and Morlet and explored in depth by Daubechies (2) and Mallat, remedies the inadequacies of STFTs. Like the Fourier transform, the WT can be implemented as a discrete transform (DWT) or as a continuous (integral) transform (CWT). This paper briefly illustrates some of the potential applications of the wavelet transform algorithms to signal analysis.

  2. Compensation of the AKT signaling by ERK signaling in transgenic mice hearts overexpressing TRIM72

    SciTech Connect (OSTI)

    Ham, Young-Mi, E-mail: youngmi_ham@hms.harvard.edu [College of Life Science and Biotechnology, Korea University, Seoul (Korea, Republic of); Department of Cell Biology, Harvard Medical School, Boston, MA 02115 (United States); Mahoney, Sarah Jane [Department of Cell Biology, Harvard Medical School, Boston, MA 02115 (United States)

    2013-06-10

    The AKT and ERK signaling pathways are known to be involved in cell hypertrophy, proliferation, survival and differentiation. Although there is evidence for crosstalk between these two signaling pathways in cellulo, there is less evidence for cross talk in vivo. Here, we show that crosstalk between AKT and ERK signaling in the hearts of TRIM72-overexpressing transgenic mice (TRIM72-Tg) with alpha-MHC promoter regulates and maintains their heart size. TRIM72, a heart- and skeletal muscle-specific protein, downregulates AKT-mTOR signaling via IRS-1 degradation and reduces the size of rat cardiomyocytes and the size of postnatal TRIM72-Tg hearts. TRIM72 expression was upregulated by hypertrophic inducers in cardiomyocytes, while IRS-1 was downregulated by IGF-1. TRIM72 specifically regulated IGF-1-dependent AKT-mTOR signaling, resulting in a reduction of the size of cardiomyocytes. Postnatal TRIM72-Tg hearts were smaller than control-treated hearts with inhibition of AKT-mTOR signaling. However, adult TRIM72-Tg hearts were larger than of control despite the suppression of AKT-mTOR signaling. Activation of ERK, PKC-?, and JNK were observed to be elevated in adult TRIM72-Tg, and these signals were mediated by ET-1 via the ET receptors A and B. Altogether, these results suggest that AKT signaling regulates cardiac hypertrophy in physiological conditions, and ERK signaling compensates for the absence of AKT signaling during TRIM72 overexpression, leading to pathological hypertrophy. -- Highlights: • TRIM72 inhibits AKT signaling through ubiquitination of IRS-1 in cardiac cells. • TRIM72 regulates the size of cardiac cells. • TRIM72 regulates size of postnatal TRIM72-overexpressing transgenic mice hearts. • Adult TRIM72-overexpressing transgenic mice hearts showed cardiac dysfunction. • Adult TRIM72 transgenic mice hearts showed higher expression of endothelin receptors.

  3. Multichannel heterodyning for wideband interferometry, correlation and signal processing

    DOE Patents [OSTI]

    Erskine, David J. (Oakland, CA)

    1999-01-01

    A method of signal processing a high bandwidth signal by coherently subdividing it into many narrow bandwidth channels which are individually processed at lower frequencies in a parallel manner. Autocorrelation and correlations can be performed using reference frequencies which may drift slowly with time, reducing cost of device. Coordinated adjustment of channel phases alters temporal and spectral behavior of net signal process more precisely than a channel used individually. This is a method of implementing precision long coherent delays, interferometers, and filters for high bandwidth optical or microwave signals using low bandwidth electronics. High bandwidth signals can be recorded, mathematically manipulated, and synthesized.

  4. Multichannel heterodyning for wideband interferometry, correlation and signal processing

    DOE Patents [OSTI]

    Erskine, D.J.

    1999-08-24

    A method is disclosed of signal processing a high bandwidth signal by coherently subdividing it into many narrow bandwidth channels which are individually processed at lower frequencies in a parallel manner. Autocorrelation and correlations can be performed using reference frequencies which may drift slowly with time, reducing cost of device. Coordinated adjustment of channel phases alters temporal and spectral behavior of net signal process more precisely than a channel used individually. This is a method of implementing precision long coherent delays, interferometers, and filters for high bandwidth optical or microwave signals using low bandwidth electronics. High bandwidth signals can be recorded, mathematically manipulated, and synthesized. 50 figs.

  5. Method of detecting system function by measuring frequency response

    DOE Patents [OSTI]

    Morrison, John L.; Morrison, William H.; Christophersen, Jon P.; Motloch, Chester G.

    2013-01-08

    Methods of rapidly measuring an impedance spectrum of an energy storage device in-situ over a limited number of logarithmically distributed frequencies are described. An energy storage device is excited with a known input signal, and a response is measured to ascertain the impedance spectrum. An excitation signal is a limited time duration sum-of-sines consisting of a select number of frequencies. In one embodiment, magnitude and phase of each frequency of interest within the sum-of-sines is identified when the selected frequencies and sample rate are logarithmic integer steps greater than two. This technique requires a measurement with a duration of one period of the lowest frequency. In another embodiment, where selected frequencies are distributed in octave steps, the impedance spectrum can be determined using a captured time record that is reduced to a half-period of the lowest frequency.

  6. Time-Frequency Analysis as Probabilistic Inference

    E-Print Network [OSTI]

    Turner, Richard E.

    2014-11-06

    ) and (19) yields: (21) 6176 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 62, NO. 23, DECEMBER 1, 2014 Fig. 1. Relationships between classical and probabilistic time-frequency anal- ysis. A complex filter bank (cFB, ) is formed from a set of filters...

  7. Oscillator Architectures and Enhanced Frequency Synthesizer 

    E-Print Network [OSTI]

    Park, Sang Wook

    2009-11-16

    A voltage controlled oscillator (VCO), that generates a periodic signal whose frequency is tuned by a voltage, is a key building block in any integrated circuit systems. A sine wave oscillator can be used for a built-in self testing where high...

  8. Linear, Low Noise Microwave Photonic Systems using Phase and Frequency Modulation

    E-Print Network [OSTI]

    Wyrwas, John Michael

    2012-01-01

    ii List of Figures Microwave photonics frequencies ofof signal propagation in a microwave photonic link. The out-optical FM-FDM Gb/s microwave PSK signals,” IEEE Photonics

  9. Scram signal generator

    DOE Patents [OSTI]

    Johanson, Edward W. (New Lenox, IL); Simms, Richard (Westmont, IL)

    1981-01-01

    A scram signal generating circuit for nuclear reactor installations monitors a flow signal representing the flow rate of the liquid sodium coolant which is circulated through the reactor, and initiates reactor shutdown for a rapid variation in the flow signal, indicative of fuel motion. The scram signal generating circuit includes a long-term drift compensation circuit which processes the flow signal and generates an output signal representing the flow rate of the coolant. The output signal remains substantially unchanged for small variations in the flow signal, attributable to long term drift in the flow rate, but a rapid change in the flow signal, indicative of a fast flow variation, causes a corresponding change in the output signal. A comparator circuit compares the output signal with a reference signal, representing a given percentage of the steady state flow rate of the coolant, and generates a scram signal to initiate reactor shutdown when the output signal equals the reference signal.

  10. Wide-frequency range, dynamic matching network and power system for the “Shoelace” radio frequency antenna on the Alcator C-Mod tokamak

    SciTech Connect (OSTI)

    Golfinopoulos, Theodore, E-mail: golfit@mit.edu; LaBombard, Brian; Burke, William; Parker, Ronald R.; Parkin, William; Woskov, Paul [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts, 02139 (United States)] [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts, 02139 (United States)

    2014-04-15

    A wide-frequency range (50–300 kHz) power system has been implemented for use with a new RF antenna – the “Shoelace” antenna – built to drive coherent plasma fluctuations in the edge of the Alcator C-Mod tokamak. A custom, dynamically tunable matching network allows two commercial 1 kW, 50-? RF amplifiers to drive the low-impedance, inductive load presented by the antenna. This is accomplished by a discretely variable L-match network, with 81 independently selected steps available for each of the series and parallel legs of the matching configuration. A compact programmable logic device provides a control system that measures the frequency with better than 1 kHz accuracy and transitions to the correct tuning state in less than 1 ms. At least 85% of source power is dissipated in the antenna across the operational frequency range, with a minimum frequency slew rate of 1 MHz/s; the best performance is achieved in the narrower band from 80 to 150 kHz which is of interest in typical experiments. The RF frequency can be run with open-loop control, following a pre-programmed analog waveform, or phase-locked to track a plasma fluctuation diagnostic signal in real time with programmable phase delay; the amplitude control is always open-loop. The control waveforms and phase delay are programmed remotely. These tools have enabled first-of-a-kind measurements of the tokamak edge plasma system response in the frequency range and at the wave number at which coherent fluctuations regulate heat and particle transport through the plasma boundary.

  11. Frequency comb swept lasers

    E-Print Network [OSTI]

    Tsai, Tsung-Han

    We demonstrate a frequency comb (FC) swept laser and a frequency comb Fourier domain mode locked (FC-FDML) laser for applications in optical coherence tomography (OCT). The fiber-based FC swept lasers operate at a sweep ...

  12. Oscillatory signals with nonlinear frequencies for control of nonholonomic systems

    E-Print Network [OSTI]

    systems focused on the drift-free case. In fact, many of the mechan- ical systems which one typically [8], a forced sphere-plate system [5], and £sh-like carangiform underwater propulsors [12, 13

  13. Continuous time very low frequency analog signal processors 

    E-Print Network [OSTI]

    Veeravalli Raghupathy, Anand

    2000-01-01

    In this work, basic analog integrated circuits such as integrators, multipliers, comparators, summers and impedance scaling networks which serve as the basic building blocks for designing complicated continuous time analog ...

  14. Eastern Frequency Response Study

    SciTech Connect (OSTI)

    Miller, N.W.; Shao, M.; Pajic, S.; D'Aquila, R.

    2013-05-01

    This study was specifically designed to investigate the frequency response of the Eastern Interconnection that results from large loss-of-generation events of the type targeted by the North American Electric Reliability Corp. Standard BAL-003 Frequency Response and Frequency Bias Setting (NERC 2012a), under possible future system conditions with high levels of wind generation.

  15. Microwave frequency measurement with improved measurement range and

    E-Print Network [OSTI]

    Yao, Jianping

    Microwave frequency measurement with improved measurement range and resolution X. Zou and J. Yao An approach is proposed and demonstrated to improve the measure- ment range and resolution of a microwave frequency measurement system. Two optical wavelengths are modulated by a microwave signal in a Mach

  16. A Digital Frequency Synthesizer Phase Locked Loop Technique

    E-Print Network [OSTI]

    Bibyk, Steven B.

    Characterization, Design with transistors and op-Amps, Digital Circuit design and non-linear circuit analysis. iii system. Some of its uses include recovering clock from digital data signals, performing frequency, phase disciplines of electrical engineering such as Communication Theory, Control Theory, Signal Analysis, Noise

  17. Noise Filtering Strategies of Adaptive Signaling Networks: The Case of E. Coli Chemotaxis

    E-Print Network [OSTI]

    Pablo Sartori; Yuhai Tu

    2011-04-20

    Two distinct mechanisms for filtering noise in an input signal are identi?ed in a class of adaptive sensory networks. We find that the high frequency noise is filtered by the output degradation process through time-averaging; while the low frequency noise is damped by adaptation through negative feedback. Both filtering processes themselves introduce intrinsic noises, which are found to be un?ltered and can thus amount to a significant internal noise floor even without signaling. These results are applied to E. coli chemotaxis. We show unambiguously that the molecular mechanism for the Berg-Purcell time-averaging scheme is the dephosphorylation of the response regulator CheY-P, not the receptor adaptation process as previously suggested. The high frequency noise due to the stochastic ligand binding-unbinding events and the random ligand molecule diffusion is averaged by the CheY-P dephosphorylation process to a negligible level in E.coli. We identify a previously unstudied noise source caused by the random motion of the cell in a ligand gradient. We show that this random walk induced signal noise has a divergent low frequency component, which is only rendered finite by the receptor adaptation process. For gradients within the E. coli sensing range, this dominant external noise can be comparable to the significant intrinsic noise in the system. The dependence of the response and its fluctuations on the key time scales of the system are studied systematically. We show that the chemotaxis pathway may have evolved to optimize gradient sensing, strong response, and noise control in di?erent time scales

  18. Laminin isoforms differentially regulate adhesion, spreading, proliferation, and ERK activation of h1 integrin-null cells

    E-Print Network [OSTI]

    Campbell, Kevin P.

    Laminin isoforms differentially regulate adhesion, spreading, proliferation, and ERK activation signal-regulated kinase (ERK) activation, whereas all these responses occurred in response to adhesion

  19. On-clip high frequency reliability and failure test structures

    DOE Patents [OSTI]

    Snyder, Eric S. (Albuquerque, NM); Campbell, David V. (Albuquerque, NM)

    1997-01-01

    Self-stressing test structures for realistic high frequency reliability characterizations. An on-chip high frequency oscillator, controlled by DC signals from off-chip, provides a range of high frequency pulses to test structures. The test structures provide information with regard to a variety of reliability failure mechanisms, including hot-carriers, electromigration, and oxide breakdown. The system is normally integrated at the wafer level to predict the failure mechanisms of the production integrated circuits on the same wafer.

  20. Communications, and Signal Processing

    E-Print Network [OSTI]

    Prodiæ, Aleksandar

    : Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical: Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical: Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical

  1. A Wnt1 Regulated Frizzled-1/beta-Catenin Signaling Pathway as a Candidate Regulatory Circuit Controlling Mesencephalic Dopaminergic Neuron-Astrocyte Crosstalk : Therapeutical Relevance for Neuron Survival and Neuroprotection

    E-Print Network [OSTI]

    L'Episcopo, Francesca; Serapide, Maria F; Tirolo, Cataldo; Testa, Nunzio; Caniglia, Salvatore; Morale, Maria C; Pluchino, Stefano; Marchetti, Bianca

    2011-07-13

    pathway [43-45]. Conversely, exogenous activation of Wnt/b-catenin signaling was carried out with the speci- fic GSK-3b antagonist, AR-AO14418 [N-(4-methoxyben- zyl)-N’-(5-nitro-1,3-thiazol-2-yl)urea] (AR, of 5 ?M, 42). Primary astrocyte cell cultures... - tions at 10 DIV. Four pulses of oligonucleotide suspen- sion was added every 6 h within a period of 24 h at a 12,5 ?M final concentration, according to the protocol described by Chacon and coworkers [51]. Control cul- tures were treated with the same...

  2. Motor monitoring method and apparatus using high frequency current components

    DOE Patents [OSTI]

    Casada, Donald A. (Knoxville, TN)

    1996-01-01

    A motor current analysis method and apparatus for monitoring electrical-motor-driven devices. The method and apparatus utilize high frequency portions of the motor current spectra to evaluate the condition of the electric motor and the device driven by the electric motor. The motor current signal produced as a result of an electric motor is monitored and the low frequency components of the signal are removed by a high-pass filter. The signal is then analyzed to determine the condition of the electrical motor and the driven device.

  3. Tone signal generator for producing multioperator tone signals using an operator circuit including a waveform generator, a selector and an enveloper

    DOE Patents [OSTI]

    Dong, Q.; Jenkins, M.V.; Bernadas, S.R.

    1997-09-09

    A frequency modulation (FM) tone signal generator for generating a FM tone signal is disclosed. The tone signal generator includes a waveform generator having a plurality of wave tables, a selector and an enveloper. The waveform generator furnishes a waveform signal in response to a phase angle address signal. Each wave table stores a different waveform. The selector selects one of the wave tables in response to a plurality of selection signals such that the selected wave table largely provides the waveform signal upon being addressed largely by the phase angle address signal. Selection of the selected wave table varies with each selection signal. The enveloper impresses an envelope signal on the waveform signal. The envelope signal is used as a carrier or modulator for generating the FM tone signal. 17 figs.

  4. 1. Idealized OFDM Model Orthogonal frequency division multiplexing (OFDM) is a specialized frequency multiplexing

    E-Print Network [OSTI]

    Yu, Chansu

    spectrum · In this experiment, the spectrum analyzer is used to display the signal spectrum: connect one VERT2450 antenna to the input of the spectrum analyzer, set the center frequency to 2.422GHz and set bins is 512. · The OFDM spectrum observed on the spectrum analyzer is shown in Figure 3, which

  5. Resonance at the Rabi frequency in a superconducting flux qubit

    SciTech Connect (OSTI)

    Greenberg, Ya. S.; Il'ichev, E.; Oelsner, G.; Shevchenko, S. N.

    2014-10-15

    We analyze a system composed of a superconducting flux qubit coupled to a transmission-line resonator driven by two signals with frequencies close to the resonator's harmonics. The first strong signal is used for exciting the system to a high energetic state while a second weak signal is applied for probing effective eigenstates of the system. In the framework of doubly dressed states we showed the possibility of amplification and attenuation of the probe signal by direct transitions at the Rabi frequency. We present a brief review of theoretical and experimental works where a direct resonance at Rabi frequency have been investigated in superconducting flux qubits. The interaction of the qubit with photons of two harmonics has prospects to be used as a quantum amplifier (microwave laser) or an attenuator.

  6. Low cost analog signal processing for massive radio telescope arrays

    E-Print Network [OSTI]

    Kunz, Eben A

    2012-01-01

    Measurement and analysis of redshifted 21cm hydrogen emissions is a developing technique for studying the early universe. The primary time of interest corresponds to a signal in the the 100-200MHz frequency band. The ...

  7. Regulation XVII: GENERAL REGULATIONS FOR FIRST DEGREES

    E-Print Network [OSTI]

    Regulation XVII: GENERAL REGULATIONS FOR FIRST DEGREES SCOPE OF THESE REGULATIONS4 1. These Regulations apply, subject to any different provision in the Regulations for a particular programme of study programme of study is designated as a non-modular programme, Regulation 14 and subsequent Regulations

  8. Government Regulation

    E-Print Network [OSTI]

    Ashford, Nicholas

    2005-01-01

    Abstract. Interest in the use of so-called voluntary approaches to supplement or replace formal environmental regulation is on the rise, both in Europe and in the United States. These approaches fall into two general ...

  9. Frequency Response Analysis Tool

    SciTech Connect (OSTI)

    Etingov, Pavel V.; Kosterev, Dmitry; Dai, T.

    2014-12-31

    Frequency response has received a lot of attention in recent years at the national level, which culminated in the development and approval of North American Electricity Reliability Corporation (NERC) BAL-003-1 Frequency Response and Frequency Bias Setting Reliability Standard. This report is prepared to describe the details of the work conducted by Pacific Northwest National Laboratory (PNNL) in collaboration with the Bonneville Power Administration and Western Electricity Coordinating Council (WECC) Joint Synchronized Information Subcommittee (JSIS) to develop a frequency response analysis tool (FRAT). The document provides the details on the methodology and main features of the FRAT. The tool manages the database of under-frequency events and calculates the frequency response baseline. Frequency response calculations are consistent with frequency response measure (FRM) in NERC BAL-003-1 for an interconnection and balancing authority. The FRAT can use both phasor measurement unit (PMU) data, where available, and supervisory control and data acquisition (SCADA) data. The tool is also capable of automatically generating NERC Frequency Response Survey (FRS) forms required by BAL-003-1 Standard.

  10. Modelling the influence of RKIP on the ERK signalling pathway using the stochastic process

    E-Print Network [OSTI]

    Gilmore, Stephen

    Modelling the influence of RKIP on the ERK signalling pathway using the stochastic process algebra) on the Extracellular signal Regulated Kinase (ERK) signalling pathway [1] through modelling in a Markovian process choices. The system which we consider is the Ras/Raf-1/MEK/ERK signalling path- way, as presented in [1

  11. Method of detecting system function by measuring frequency response

    DOE Patents [OSTI]

    Morrison, John L. (Butte, MT); Morrison, William H. (Manchester, CT); Christophersen, Jon P. (Idaho Falls, ID)

    2012-04-03

    Real-time battery impedance spectrum is acquired using a one-time record. Fast Summation Transformation (FST) is a parallel method of acquiring a real-time battery impedance spectrum using a one-time record that enables battery diagnostics. An excitation current to a battery is a sum of equal amplitude sine waves of frequencies that are octave harmonics spread over a range of interest. A sample frequency is also octave and harmonically related to all frequencies in the sum. The time profile of this signal has a duration that is a few periods of the lowest frequency. The voltage response of the battery, average deleted, is the impedance of the battery in the time domain. Since the excitation frequencies are known and octave and harmonically related, a simple algorithm, FST, processes the time record by rectifying relative to the sine and cosine of each frequency. Another algorithm yields real and imaginary components for each frequency.

  12. Distributed Frequency Control of Prosumer-Based Electric Energy Systems

    SciTech Connect (OSTI)

    Nazari, MH; Costello, Z; Feizollahi, MJ; Grijalva, S; Egerstedt, M

    2014-11-01

    In this paper, we propose a distributed frequency regulation framework for prosumer-based electric energy systems, where a prosumer (producer-consumer) is defined as an intelligent agentwhich can produce, consume, and/or store electricity. Despite the frequency regulators being distributed, stability can be ensured while avoiding inter-area oscillations using a limited control effort. To achieve this, a fully distributed one-step model-predictive control protocol is proposed and analyzed, whereby each prosumer communicates solely with its neighbors in the network. The efficacy of the proposed frequency regulation framework is shown through simulations on two real-world electric energy systems of different scale and complexity. We show that prosumers can indeed bring frequency and power deviations to their desired values after small perturbations.

  13. Stabilized radio frequency quadrupole

    DOE Patents [OSTI]

    Lancaster, Henry D. (Orinda, CA); Fugitt, Jock A. (Berkeley, CA); Howard, Donald R. (Danville, CA)

    1984-01-01

    A long-vane stabilized radio frequency resonator for accelerating charged particles and including means defining a radio frequency resonator cavity, a plurality of long vanes mounted in the defining means for dividing the cavity into sections, and means interconnecting opposing ones of the plurality of vanes for stabilizing the resonator.

  14. Systems theory of Smad signaling

    E-Print Network [OSTI]

    D. C. Clarke; M. D. Betterton; X. Liu

    2006-03-22

    Transforming Growth Factor-beta (TGF-beta) signalling is an important regulator of cellular growth and differentiation. The principal intracellular mediators of TGF-beta signalling are the Smad proteins, which upon TGF-beta stimulation accumulate in the nucleus and regulate transcription of target genes. To investigate the mechanisms of Smad nuclear accumulation, we developed a simple mathematical model of canonical Smad signalling. The model was built using both published data and our experimentally determined cellular Smad concentrations (isoforms 2, 3, and 4). We found in mink lung epithelial cells that Smad2 (8.5-12 x 10^4 molecules/cell) was present in similar amounts to Smad4 (9.3-12 x 10^4 molecules/cell), while both were in excess of Smad3 (1.1-2.0 x 10^4 molecules/cell). Variation of the model parameters and statistical analysis showed that Smad nuclear accumulation is most sensitive to parameters affecting the rates of RSmad phosphorylation and dephosphorylation and Smad complex formation/dissociation in the nucleus. Deleting Smad4 from the model revealed that rate-limiting phospho-R-Smad dephosphorylation could be an important mechanism for Smad nuclear accumulation. Furthermore, we observed that binding factors constitutively localised to the nucleus do not efficiently mediate Smad nuclear accumulation if dephosphorylation is rapid. We therefore conclude that an imbalance in the rates of R-Smad phosphorylation and dephosphorylation is likely an important mechanism of Smad nuclear accumulation during TGF-beta signalling.

  15. Ca2+ signalling and homeostasis during colony initiation in Neurospora crassa 

    E-Print Network [OSTI]

    Chu, Meiling

    2013-11-28

    Calcium is a highly versatile intracellular signal molecule that can regulate numerous different cellular functions. In filamentous fungi there is evidence for it being involved in regulating various processes, including ...

  16. Intracellular Signaling by the Unfolded Protein

    E-Print Network [OSTI]

    Mullins, Dyche

    reticulum stress, signal transduction, organelle homeostasis, protein folding, regulated mRNA splicing triggers an exten- sive transcriptional response, which adjusts the ER protein folding capacity according to reestablish homeostasis in the cell's protein folding capacity or--if this cannot be achieved-- commit cells

  17. The design and synthesis of nuclear localization signal (NLS) mimics 

    E-Print Network [OSTI]

    Ho, Thai Huu

    2013-02-22

    Nuclear import of proteins is a carefully controlled process that is critical for cellular function and regulation. A protein is marked for nuclear entry by a nuclear localization signal (NLS), a peptide motif, which typically consists of one or two...

  18. Microfabricated ion frequency standard

    DOE Patents [OSTI]

    Schwindt, Peter (Albuquerque, NM); Biedermann, Grant (Albuquerque, NM); Blain, Matthew G. (Albuquerque, NM); Stick, Daniel L. (Albuquerque, NM); Serkland, Darwin K. (Albuquerque, NM); Olsson, III, Roy H. (Albuquerque, NM)

    2010-12-28

    A microfabricated ion frequency standard (i.e. an ion clock) is disclosed with a permanently-sealed vacuum package containing a source of ytterbium (Yb) ions and an octupole ion trap. The source of Yb ions is a micro-hotplate which generates Yb atoms which are then ionized by a ultraviolet light-emitting diode or a field-emission electron source. The octupole ion trap, which confines the Yb ions, is formed from suspended electrodes on a number of stacked-up substrates. A microwave source excites a ground-state transition frequency of the Yb ions, with a frequency-doubled vertical-external-cavity laser (VECSEL) then exciting the Yb ions up to an excited state to produce fluorescent light which is used to tune the microwave source to the ground-state transition frequency, with the microwave source providing a precise frequency output for the ion clock.

  19. Methods and apparatuses using filter banks for multi-carrier spread-spectrum signals

    DOE Patents [OSTI]

    Moradi, Hussein; Farhang, Behrouz; Kutsche, Carl A

    2014-10-14

    A transmitter includes a synthesis filter bank to spread a data symbol to a plurality of frequencies by encoding the data symbol on each frequency, apply a common pulse-shaping filter, and apply gains to the frequencies such that a power level of each frequency is less than a noise level of other communication signals within the spectrum. Each frequency is modulated onto a different evenly spaced subcarrier. A demodulator in a receiver converts a radio frequency input to a spread-spectrum signal in a baseband. A matched filter filters the spread-spectrum signal with a common filter having characteristics matched to the synthesis filter bank in the transmitter by filtering each frequency to generate a sequence of narrow pulses. A carrier recovery unit generates control signals responsive to the sequence of narrow pulses suitable for generating a phase-locked loop between the demodulator, the matched filter, and the carrier recovery unit.

  20. Methods and apparatuses using filter banks for multi-carrier spread-spectrum signals

    DOE Patents [OSTI]

    Moradi, Hussein; Farhang, Behrouz; Kutsche, Carl A

    2014-05-20

    A transmitter includes a synthesis filter bank to spread a data symbol to a plurality of frequencies by encoding the data symbol on each frequency, apply a common pulse-shaping filter, and apply gains to the frequencies such that a power level of each frequency is less than a noise level of other communication signals within the spectrum. Each frequency is modulated onto a different evenly spaced subcarrier. A demodulator in a receiver converts a radio frequency input to a spread-spectrum signal in a baseband. A matched filter filters the spread-spectrum signal with a common filter having characteristics matched to the synthesis filter bank in the transmitter by filtering each frequency to generate a sequence of narrow pulses. A carrier recovery unit generates control signals responsive to the sequence of narrow pulses suitable for generating a phase-locked loop between the demodulator, the matched filter, and the carrier recovery unit.

  1. Signal and Image Processing with Sinlets

    E-Print Network [OSTI]

    Alexander Y. Davydov

    2012-09-17

    This paper presents a new family of localized orthonormal bases - sinlets - which are well suited for both signal and image processing and analysis. One-dimensional sinlets are related to specific solutions of the time-dependent harmonic oscillator equation. By construction, each sinlet is infinitely differentiable and has a well-defined and smooth instantaneous frequency known in analytical form. For square-integrable transient signals with infinite support, one-dimensional sinlet basis provides an advantageous alternative to the Fourier transform by rendering accurate signal representation via a countable set of real-valued coefficients. The properties of sinlets make them suitable for analyzing many real-world signals whose frequency content changes with time including radar and sonar waveforms, music, speech, biological echolocation sounds, biomedical signals, seismic acoustic waves, and signals employed in wireless communication systems. One-dimensional sinlet bases can be used to construct two- and higher-dimensional bases with variety of potential applications including image analysis and representation.

  2. Ground-penetrating-radar response to fracture-fluid salinity: Why lower frequencies are favorable for resolving salinity changes

    E-Print Network [OSTI]

    Tsoflias, Georgios P.; Becker, Matthew W.

    2008-08-26

    Time-lapse ground-penetrating-radar (GPR) surveys exploit signal-amplitude changes to monitor saline tracers in fractures and to identify groundwater flow paths. However, the relationships between GPR signal amplitude, phase, and frequency...

  3. High-frequency capability of Schottky-barrier carbon nanotube FETs L.C. Castroa

    E-Print Network [OSTI]

    Pulfrey, David L.

    High-frequency capability of Schottky-barrier carbon nanotube FETs L.C. Castroa , D.L. Pulfreyb: carbon nanotube field-effect transistor, small-signal properties, high-frequency figures of merit, resonance. Abstract. The high-frequency capability of carbon nanotube field-effect transistors

  4. High-frequency waves guided by the subducted plates underneath Taiwan and their association with seismic

    E-Print Network [OSTI]

    Chen, Kate Huihsuan

    High-frequency waves guided by the subducted plates underneath Taiwan and their association traveling up a subduction zone is frequently associated with significant large-amplitude, high-frequency offshore northern Taiwan reveal wave guide behavior: large, sustained high-frequency (3­10Hz) signal in P

  5. Regulation Theory

    E-Print Network [OSTI]

    Bouvet, F

    2015-01-01

    This paper reviews the design of regulation loops for power converters. Power converter control being a vast domain, it does not aim to be exhaustive. The objective is to give a rapid overview of the main synthesis methods in both continuous- and discrete-time domains.

  6. Variable frequency photonic crystals

    E-Print Network [OSTI]

    Wu, Xiang-Yao; Liu, Xiao-Jing; Yang, Jing-Hai; Li, Hong; Chen, Wan-Jin

    2015-01-01

    In this paper, we have firstly proposed a new one-dimensional variable frequency photonic crystals (VFPCs), and calculated the transmissivity and the electronic field distribution of VFPCs with and without defect layer, and considered the effect of defect layer and variable frequency function on the transmissivity and the electronic field distribution. We have obtained some new characteristics for the VFPCs, which should be help to design a new type optical devices.

  7. Brf1 posttranscriptionally regulates pluripotency and differentiation responses downstream of Erk

    E-Print Network [OSTI]

    Elowitz, Michael

    Brf1 posttranscriptionally regulates pluripotency and differentiation responses downstream of Erk, operates downstream of FGF/Erk MAP kinase signaling to regulate pluripotency and cell fate decision making in mouse embryonic stem cells (mESCs). FGF/Erk MAP kinase signaling up-regulates Brf1, which disrupts

  8. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Verleysen, Michel

    Mechanical Systems and Signal Processing Mechanical Systems and Signal Processing 22 (2008) 155 Department of Mechanical Engineering, University of Sheffield, Mappin Street S1 3JD Sheffield, UK Received 27

  9. Regulation 29: Other Regulations concerning the University site and buildings, Computing Regulations and Miscellaneous Administrative Regulations

    E-Print Network [OSTI]

    Sussex, University of

    Regulation 29: Other Regulations concerning the University site and buildings, Computing Regulations and Miscellaneous Administrative Regulations 190 nuisance to occupants, except in designated (Vehicle Operators and Penalty Notices) Regulations; (iii) allow smoking in designated study bedrooms

  10. Method for curing polymers using variable-frequency microwave heating

    DOE Patents [OSTI]

    Lauf, R.J.; Bible, D.W.; Paulauskas, F.L.

    1998-02-24

    A method for curing polymers incorporating a variable frequency microwave furnace system designed to allow modulation of the frequency of the microwaves introduced into a furnace cavity is disclosed. By varying the frequency of the microwave signal, non-uniformities within the cavity are minimized, thereby achieving a more uniform cure throughout the workpiece. A directional coupler is provided for detecting the direction of a signal and further directing the signal depending on the detected direction. A first power meter is provided for measuring the power delivered to the microwave furnace. A second power meter detects the magnitude of reflected power. The furnace cavity may be adapted to be used to cure materials defining a continuous sheet or which require compressive forces during curing. 15 figs.

  11. Method for curing polymers using variable-frequency microwave heating

    DOE Patents [OSTI]

    Lauf, Robert J. (Oak Ridge, TN); Bible, Don W. (Clinton, TN); Paulauskas, Felix L. (Oak Ridge, TN)

    1998-01-01

    A method for curing polymers (11) incorporating a variable frequency microwave furnace system (10) designed to allow modulation of the frequency of the microwaves introduced into a furnace cavity (34). By varying the frequency of the microwave signal, non-uniformities within the cavity (34) are minimized, thereby achieving a more uniform cure throughout the workpiece (36). A directional coupler (24) is provided for detecting the direction of a signal and further directing the signal depending on the detected direction. A first power meter (30) is provided for measuring the power delivered to the microwave furnace (32). A second power meter (26) detects the magnitude of reflected power. The furnace cavity (34) may be adapted to be used to cure materials defining a continuous sheet or which require compressive forces during curing.

  12. Fact Sheet: Beacon Power 20 MW Flywheel Frequency Regulation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Beacon Power will design, build, and operate a utility-scale 20 MW flywheel energy storage plant at the Humboldt Industrial Park in Hazle Township, PA for Hazle Spindle LLC....

  13. EA-1631: Beacon Power Corporation Frequency Regulation Facility in

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8,DepartmentFinal EnvironmentalFinalMitigation

  14. Low Frequency Scattering Resonance Wave in Strong Heterogeneity

    E-Print Network [OSTI]

    Liu, Yinbin

    2015-01-01

    Multiple scattering of wave in strong heterogeneity can cause resonance-like wave phenomenon where signal exhibits low frequency, high intensity, and slowly propagating velocity. For example, long period event in volcanic seismology and surface plasmon wave and quantum Hall effect in wave-particle interactions. Collective behaviour in a many-body system is usually thought to be the source for generating the anomaly. However, the detail physical mechanism is not fully understood. Here I show by wave field modeling for microscopic bubble cloud model and 1D heterogeneity that the anomaly is related to low frequency scattering resonance happened in transient regime. This low frequency resonance is a kind of wave coherent scattering enhancement phenomenon in strongly-scattered small-scale heterogeneity. Its resonance frequency is inversely proportional to heterogeneous scale and contrast and will further shift toward lower frequency with random heterogeneous scale and velocity fluctuations. Low frequency scatterin...

  15. From Signal Information Processing

    E-Print Network [OSTI]

    From Signal to Information Processing Don H. Johnson Computer and Information Technology Institute of signals o Here, all signals are assumed to be stochastic information source information encoder Information extraction systems--determining a from X(a)--fall into two categories h Classification: Which

  16. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Ray, Asok

    Mechanical Systems and Signal Processing Mechanical Systems and Signal Processing 21 (2007) 866 and analytical models. This paper attempts to address this inadequacy by taking advantage of advanced signal processing and pattern recognition tools. Since a vast majority of structural components that are prone

  17. Regulation of Meiotic Recombination

    SciTech Connect (OSTI)

    Gregory p. Copenhaver

    2011-11-09

    Meiotic recombination results in the heritable rearrangement of DNA, primarily through reciprocal exchange between homologous chromosome or gene conversion. In plants these events are critical for ensuring proper chromosome segregation, facilitating DNA repair and providing a basis for genetic diversity. Understanding this fundamental biological mechanism will directly facilitate trait mapping, conventional plant breeding, and development of genetic engineering techniques that will help support the responsible production and conversion of renewable resources for fuels, chemicals, and the conservation of energy (1-3). Substantial progress has been made in understanding the basal recombination machinery, much of which is conserved in organisms as diverse as yeast, plants and mammals (4, 5). Significantly less is known about the factors that regulate how often and where that basal machinery acts on higher eukaryotic chromosomes. One important mechanism for regulating the frequency and distribution of meiotic recombination is crossover interference - or the ability of one recombination event to influence nearby events. The MUS81 gene is thought to play an important role in regulating the influence of interference on crossing over. The immediate goals of this project are to use reverse genetics to identify mutants in two putative MUS81 homologs in the model plant Arabidopsis thaliana, characterize those mutants and initiate a novel forward genetic screen for additional regulators of meiotic recombination. The long-term goal of the project is to understand how meiotic recombination is regulated in higher eukaryotes with an emphasis on the molecular basis of crossover interference. The ability to monitor recombination in all four meiotic products (tetrad analysis) has been a powerful tool in the arsenal of yeast geneticists. Previously, the qrt mutant of Arabidopsis, which causes the four pollen products of male meiosis to remain attached, was developed as a facile system for assaying recombination using tetrad analysis in a higher eukaryotic system (6). This system enabled the measurement of the frequency and distribution of recombination events at a genome wide level in wild type Arabidopsis (7), construction of genetic linkage maps which include positions for each centromere (8), and modeling of the strength and pattern of interference (9). This proposal extends the use of tetrad analysis in Arabidopsis by using it as the basis for assessing the phenotypes of mutants in genes important for recombination and the regulation of crossover interference and performing a novel genetic screen. In addition to broadening our knowledge of a classic genetic problem - the regulation of recombination by crossover interference - this proposal also provides broader impact by: generating pedagogical tools for use in hands-on classroom experience with genetics, building interdisciplinary collegial partnerships, and creating a platform for participation by junior scientists from underrepresented groups. There are three specific aims: (1) Isolate mutants in Arabidopsis MUS81 homologs using T-DNA and TILLING (2) Characterize recombination levels and interference in mus81 mutants (3) Execute a novel genetic screen, based on tetrad analysis, for genes that regulate meiotic recombination

  18. Apparatus for millimeter-wave signal generation

    DOE Patents [OSTI]

    Vawter, G. Allen (Albuquerque, NM); Hietala, Vincent M. (Placitas, NM); Zolper, John C. (Albuquerque, NM); Mar, Alan (Albuquerque, NM); Hohimer, John P. (Albuquerque, NM)

    1999-01-01

    An opto-electronic integrated circuit (OEIC) apparatus is disclosed for generating an electrical signal at a frequency .gtoreq.10 GHz. The apparatus, formed on a single substrate, includes a semiconductor ring laser for generating a continuous train of mode-locked lasing pulses and a high-speed photodetector for detecting the train of lasing pulses and generating the electrical signal therefrom. Embodiments of the invention are disclosed with an active waveguide amplifier coupling the semiconductor ring laser and the high-speed photodetector. The invention has applications for use in OEICs and millimeter-wave monolithic integrated circuits (MMICs).

  19. Regulation XVIII: GENERAL REGULATIONS FOR HIGHER DEGREES,

    E-Print Network [OSTI]

    Regulation XVIII: GENERAL REGULATIONS FOR HIGHER DEGREES, POSTGRADUATE DIPLOMAS AND POSTGRADUATE CERTIFICATES SCOPE OF THESE REGULATIONS 1. These Regulations apply to the Degree of PhD in all Faculties in all Faculties Postgraduate Certificates in all Faculties. 2. These Regulations are subject

  20. Regulation 28: Library REGULATION 28: LIBRARY

    E-Print Network [OSTI]

    Sussex, University of

    Regulation 28: Library 180 REGULATION 28: LIBRARY The purpose of this Regulation is to safeguard the common interests of all Library users. All persons are admitted on the understanding that they have read and agreed to observe the Library Regulations. Breach of this Regulation could result in membership being

  1. ITERATIVELY REWEIGHTED DESIGN OF OVERSAMPLING COMPLEX-MODULATED FILTER-BANKS FOR HIGH OUTPUT-SIGNAL QUALITY

    E-Print Network [OSTI]

    Göckler, Heinz G.

    of the frequency-dependent signal-to- disturbance ratio. Next, in section 3, we discuss the basic idea of the of the signal-to-disturbance ratio of the output-signal of an oversampling, complex-modulated subband-coder filter-bank pair with extensive subband-signal am- plification. The undesired non-linear disturbance

  2. Radio frequency coupling apparatus and method for measuring minority carrier lifetimes in semiconductor materials

    DOE Patents [OSTI]

    Johnston, Steven W. (Golden, CO); Ahrenkiel, Richard K. (Lakewood, CO)

    2002-01-01

    An apparatus for measuring the minority carrier lifetime of a semiconductor sample using radio-frequency coupling. The measuring apparatus includes an antenna that is positioned a coupling distance from a semiconductor sample which is exposed to light pulses from a laser during sampling operations. A signal generator is included to generate high frequency, such as 900 MHz or higher, sinusoidal waveform signals that are split into a reference signal and a sample signal. The sample signal is transmitted into a sample branch circuit where it passes through a tuning capacitor and a coaxial cable prior to reaching the antenna. The antenna is radio-frequency coupled with the adjacent sample and transmits the sample signal, or electromagnetic radiation corresponding to the sample signal, to the sample and receives reflected power or a sample-coupled-photoconductivity signal back. To lower impedance and speed system response, the impedance is controlled by limiting impedance in the coaxial cable and the antenna reactance. In one embodiment, the antenna is a waveguide/aperture hybrid antenna having a central transmission line and an adjacent ground flange. The sample-coupled-photoconductivity signal is then transmitted to a mixer which also receives the reference signal. To enhance the sensitivity of the measuring apparatus, the mixer is operated to phase match the reference signal and the sample-coupled-photoconductivity signal.

  3. Photonic Generation of Millimeter-Wave Signals With Tunable Phase Shift

    E-Print Network [OSTI]

    Yao, Jianping

    Photonic Generation of Millimeter-Wave Signals With Tunable Phase Shift Volume 4, Number 3, June.2199481 1943-0655/$31.00 ©2012 IEEE #12;Photonic Generation of Millimeter-Wave Signals With Tunable Phase Shift approach to generating a frequency-quadrupled millimeter-wave (mm-wave) signal with a tunable phase shift

  4. Segmentation and tracking of the electro-encephalogram signal using an

    E-Print Network [OSTI]

    Cichocki, Andrzej

    ®lter R. R. Gharieb1,2 A. Cichocki1,3 1 Laboratory for Advanced Brain Signal Processing, Brain Science of centre frequency of biomedical signals Med. Biol. Eng. Comput., 2001, 39, 237±248 1 Introduction COMPUTER ®lter fed by a white-noise process. Thus the EEG signal is modelled as an AR process of unknown coef

  5. Dual frequency optical cavity

    DOE Patents [OSTI]

    George, E. Victor (Livermore, CA); Schipper, John F. (Palo Alto, CA)

    1985-01-01

    Method and apparatus for generating two distinct laser frequencies in an optical cavity, using a "T" configuration laser cavity and means for intermittently increasing or decreasing the index of refraction n of an associated transmission medium in one arm of the optical cavity to enhance laser action in one arm or the second arm of the cavity.

  6. Model Predictive Control of Regulation Services from Commercial Buildings to the Smart Grid

    E-Print Network [OSTI]

    Maasoumy, Mehdi

    2014-01-01

    Services from Commercial Buildings to the Smart Grid Mehdicommercial building hvac fan as ancillary service for smartbuildings flexibility can be utilized for frequency regulation provision in the smart

  7. Regulation of gene expression and cell state in embryonic stem cells

    E-Print Network [OSTI]

    Newman, Jamie Jennifer

    2010-01-01

    Cell state is established and maintained through the combined action of transcription factors, chromatin regulators and signaling pathways, which all contribute to a transcriptional regulatory circuitry. Embryonic stem ...

  8. Regulation of Drosophila eye development by the transcription factors : eyes absent and Spenito

    E-Print Network [OSTI]

    Jemc, Jennifer Colleen

    2007-01-01

    During development of an adult organism from a fertilized embryo, signaling pathways are deployed reiteratively to regulate a variety of cellular processes, including cell proliferation, specification, differentiation, ...

  9. Multi-Frequency Resonant Clocks

    E-Print Network [OSTI]

    Guthaus, Matthew; Lacara, Benjamin; Lin, Ping-Yao

    2015-01-01

    oscillating signal is applied to this circuit, an exchange of energy occurs between the magnetic field

  10. A Robust Iterative Unfolding Method for Signal Processing

    E-Print Network [OSTI]

    András László

    2006-01-09

    There is a well-known series expansion (Neumann series) in functional analysis for perturbative inversion of specific operators on Banach spaces. However, operators that appear in signal processing (e.g. folding and convolution of probability density functions), in general, do not satisfy the usual convergence condition of that series expansion. This article provides some theorems on the convergence criteria of a similar series expansion for this more general case, which is not covered yet by the literature. The main result is that a series expansion provides a robust unbiased unfolding and deconvolution method. For the case of the deconvolution, such a series expansion can always be applied, and the method always recovers the maximum possible information about the initial probability density function, thus the method is optimal in this sense. A very significant advantage of the presented method is that one does not have to introduce ad hoc frequency regulations etc., as in the case of usual naive deconvolution methods. For the case of general unfolding problems, we present a computer-testable sufficient condition for the convergence of the series expansion in question. Some test examples and physics applications are also given. The most important physics example shall be (which originally motivated our survey on this topic) the case of pi^0 --> gamma+gamma particle decay: we show that one can recover the initial pi^0 momentum density function form the measured single gamma momentum density function by our series expansion.

  11. Charge regulation circuit

    DOE Patents [OSTI]

    Ball, Don G. (Livermore, CA)

    1992-01-01

    A charge regulation circuit provides regulation of an unregulated voltage supply in the range of 0.01%. The charge regulation circuit is utilized in a preferred embodiment in providing regulated voltage for controlling the operation of a laser.

  12. NOVEL SIGNAL PROCESSING WITH NONLINEAR TRANSMISSION LINES

    SciTech Connect (OSTI)

    D. REAGOR; ET AL

    2000-08-01

    Nonlinear dielectrics offer uniquely strong and tunable nonlinearities that make them attractive for current devices (for example, frequency-agile microwave filters) and for future signal-processing technologies. The goal of this project is to understand pulse propagation on nonlinear coplanar waveguide prototype devices. We have performed time-domain and frequency-domain experimental studies of simple waveguide structures and pursued a theoretical understanding of the propagation of signals on these nonlinear waveguides. To realistically assess the potential applications, we used a time-domain measurement and analysis technique developed during this project to perform a broadband electrodynamics characterization in terms of nonlinear, dispersive, and dissipative effects. We completed a comprehensive study of coplanar waveguides made from high-temperature superconducting thin-film YBa{sub 2}Cu{sub 3}O{sub 7{minus}{delta}} electrodes on nonlinear dielectric single-crystal SrTiO{sub 3} substrates. By using parameters determined from small-signal (linear) transmission characteristics of the waveguides, we develop a model equation that successfully predicts and describes large-signal (nonlinear) behavior.

  13. Frequency Control Performance Measurement and Requirements

    E-Print Network [OSTI]

    Illian, Howard F.

    2011-01-01

    DCS only measured low-frequency disturbances instead of bothlow- and high-frequency disturbances. The DCS requiredof the pre-disturbance frequency and the settling frequency.

  14. A high frequency resonance gravity gradiometer

    SciTech Connect (OSTI)

    Bagaev, S. N.; Kvashnin, N. L.; Skvortsov, M. N.; Bezrukov, L. B.; Krysanov, V. A.; Oreshkin, S. I.; Motylev, A. M.; Popov, S. M.; Samoilenko, A. A.; Yudin, I. S.; Rudenko, V. N.

    2014-06-15

    A new setup OGRAN—the large scale opto-acoustical gravitational detector is described. As distinguished from known gravitational bar detectors it uses the optical interferometrical readout for registering weak variations of gravity gradient at the kilohetz frequency region. At room temperature, its sensitivity is limited only by the bar Brownian noise at the bandwidth close to 100 Hz. It is destined for a search for rare events—gravitational pulses coincident with signals of neutrino scintillator (BUST) in the deep underground of Baksan Neutrino Observatory of INR RAS.

  15. Modelling the influence of RKIP on the ERK signalling pathway using the stochastic process

    E-Print Network [OSTI]

    Calder, Muffy

    Modelling the influence of RKIP on the ERK signalling pathway using the stochastic process algebra Regulated Kinase (ERK) signalling pathway [5] through modelling in a Markovian process algebra, PEPA [11 durations and probabilistic choices. The system which we consider is the Ras/Raf-1/MEK/ERK signalling

  16. Cellular/Molecular ERK1/ERK2 MAPK Signaling is Required to Increase Myelin

    E-Print Network [OSTI]

    Cellular/Molecular ERK1/ERK2 MAPK Signaling is Required to Increase Myelin Thickness Independent for two important signaling molecules, extracelluar signal-regulated protein kinases 1 and 2 (ERK1/ERK2 generated and analyzed two lines of mice lacking both ERK1/ERK2 function specifically in oligodendrocyte

  17. Theoretical and experimental analysis links isoform-specific ERK signalling to cell fate decisions

    E-Print Network [OSTI]

    Timmer, Jens

    Theoretical and experimental analysis links isoform- specific ERK signalling to cell fate decisions of signalling pathways such as the extracellular signal-regulated kinase (ERK) cascade, but contributions with mathematical modelling, we predicted and experimentally confirmed a distributive ERK phosphorylation mechanism

  18. Modelling the Influence of RKIP on the ERK Signalling Pathway Using the Stochastic Process

    E-Print Network [OSTI]

    Swain, Peter

    Modelling the Influence of RKIP on the ERK Signalling Pathway Using the Stochastic Process Algebra the influence of the Raf Kinase In- hibitor Protein (RKIP) on the Extracellular signal Regulated Kinase (ERK durations and probabilistic choices. The system which we consider is the Ras/Raf-1/MEK/ERK signalling

  19. Modelling regulations Completing an incomplete regulation

    E-Print Network [OSTI]

    van der Torre, Leon

    Objectives Modelling regulations Completing an incomplete regulation Examples Discussion Consistency and Completeness of Regulations Laurence Cholvy1 St´ephanie Roussel1,2 1ONERA Centre de Toulouse 2ISAE, Toulouse NorMAS 2008, Luxembourg, July 2008 cholvy Consistency and Completeness of Regulations

  20. Molecular Cell Frequency-Modulated Pulses of ERK Activity

    E-Print Network [OSTI]

    Albeck, John

    Molecular Cell Article Frequency-Modulated Pulses of ERK Activity Transmit Quantitative://dx.doi.org/10.1016/j.molcel.2012.11.002 SUMMARY The EGF-stimulated ERK/MAPK pathway is a key conduit and the response curve relating signal output to prolifer- ation. Under steady-state conditions, we find that ERK

  1. Digital Control of Resonant Converters: Enhancing Frequency Resolution by Dithering

    E-Print Network [OSTI]

    -resolution frequency drive when the quality factor of the network is high or to avoid limit cycle oscillations the CPU. Theoretical analysis was carried out to model the proposed dithering method when applied to drive the signal is used to drive resonant networks. The proposed approach was tested experimentally on two types

  2. High frequency reference electrode

    DOE Patents [OSTI]

    Kronberg, J.W.

    1994-05-31

    A high frequency reference electrode for electrochemical experiments comprises a mercury-calomel or silver-silver chloride reference electrode with a layer of platinum around it and a layer of a chemically and electrically resistant material such as TEFLON around the platinum covering all but a small ring or halo' at the tip of the reference electrode, adjacent to the active portion of the reference electrode. The voltage output of the platinum layer, which serves as a redox electrode, and that of the reference electrode are coupled by a capacitor or a set of capacitors and the coupled output transmitted to a standard laboratory potentiostat. The platinum may be applied by thermal decomposition to the surface of the reference electrode. The electrode provides superior high-frequency response over conventional electrodes. 4 figs.

  3. High frequency reference electrode

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1994-01-01

    A high frequency reference electrode for electrochemical experiments comprises a mercury-calomel or silver-silver chloride reference electrode with a layer of platinum around it and a layer of a chemically and electrically resistant material such as TEFLON around the platinum covering all but a small ring or "halo" at the tip of the reference electrode, adjacent to the active portion of the reference electrode. The voltage output of the platinum layer, which serves as a redox electrode, and that of the reference electrode are coupled by a capacitor or a set of capacitors and the coupled output transmitted to a standard laboratory potentiostat. The platinum may be applied by thermal decomposition to the surface of the reference electrode. The electrode provides superior high-frequency response over conventional electrodes.

  4. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Carvalho, João B.

    , Northern Illinois University, DeKalb, IL 60115, USA c Department of Mechanical Engineering & VibrationMechanical Systems and Signal Processing Mechanical Systems and Signal Processing 21 (2007) 2715 Federal de Rio Grande do Sul, Brazil b Department of Mathematical Sciences & Vibration and Acoustic Center

  5. Variable Frequency Pump Drives 

    E-Print Network [OSTI]

    Karassik, I. J.; Petraccaro, L. L.; McGuire, J. T.

    1986-01-01

    variable flow operation, Fig. 2 variable system head, the objective of the latter being to maintain pump flow within an optimum range while accommodating a wide variation in system head. VARYING OPERATING CAPACITY OPERATING CAPACITY? N, RANGE HEAD...-rotor motors and variable speed devices have slip losses that significantly reduce the savings that accrue by operating pumps at variable speed. Steam turbine drives may not always be the most practical or economic solution. The variable frequency...

  6. Cellular defense processes regulated by pathogen-elicited receptor signaling

    E-Print Network [OSTI]

    Wu, Rongcong

    Vertebrates are constantly threatened by the invasion of microorganisms and have evolved systems of immunity to eliminate infectious pathogens in the body. Initial sensing of microbial agents is mediated by the recognition ...

  7. Perlecan regulation of sonic hedgehog signaling: from drosophila to humans 

    E-Print Network [OSTI]

    Hernandez, Ana Maria

    2009-05-15

    Prostate cancer is the second leading cause of death from cancer in men in the United States. Most men will die of the advanced, metastatic form of the disease. Thus, treatment strategies targeting the metastatic form of ...

  8. Role of p24 Proteins in Regulating Reproductive Behavior 

    E-Print Network [OSTI]

    Grady, Stephanie T

    2012-07-11

    The organism Drosophila melanogaster, otherwise known as the fruit fly, has proven to be a respectable genetic model for analyzing behavior. Genes function within signaling pathways to regulate a variety of behavioral responses, such as ovulation...

  9. Design of a fast-settling OTA for high frequency switched-capacitor applications 

    E-Print Network [OSTI]

    Park, Jinki

    2002-01-01

    The ever-growing technology has enabled switched-capacitor (SC) circuits to operate at the MHz frequency range. The equally increasing demand for high speed signal processing using SC technique dictates the need of high performance operational...

  10. Method and apparatus for sensing the natural frequency of a cantilevered body

    DOE Patents [OSTI]

    Duncan, Michael G. (Clinton, TN)

    2000-01-01

    A method and apparatus for measuring the natural resonant frequency of a spring element by monitoring a phase difference between an output signal from the spring element and an input signal to the spring element and by adjusting frequency of the input signal until a detected phase difference signals that the natural resonant frequency has been reached. The method and apparatus are applied to a micro-cantilevered elements used to measure gas compositions and concentrations. Such elements are provided with coatings that absorb gas to cause deflections and changes in the mass or spring constant of the cantilevered element. These changes correspond to changes in the natural resonant frequency of the cantilevered element which are measured using the method and apparatus described herein.

  11. The S2 VLBI Correlator: A Correlator for Space VLBI and Geodetic Signal Processing

    E-Print Network [OSTI]

    B. R. Carlson; P. E. Dewdney; T. A. Burgess; R. V. Casorso; W. T. Petrachenko; W. H. Cannon

    1999-08-27

    We describe the design of a correlator system for ground and space-based VLBI. The correlator contains unique signal processing functions: flexible LO frequency switching for bandwidth synthesis; 1 ms dump intervals, multi-rate digital signal-processing techniques to allow correlation of signals at different sample rates; and a digital filter for very high resolution cross-power spectra. It also includes autocorrelation, tone extraction, pulsar gating, signal-statistics accumulation.

  12. Compensated gain control circuit for buck regulator command charge circuit

    DOE Patents [OSTI]

    Barrett, David M. (Albuquerque, NM)

    1996-01-01

    A buck regulator command charge circuit includes a compensated-gain control signal for compensating for changes in the component values in order to achieve optimal voltage regulation. The compensated-gain control circuit includes an automatic-gain control circuit for generating a variable-gain control signal. The automatic-gain control circuit is formed of a precision rectifier circuit, a filter network, an error amplifier, and an integrator circuit.

  13. Compensated gain control circuit for buck regulator command charge circuit

    DOE Patents [OSTI]

    Barrett, D.M.

    1996-11-05

    A buck regulator command charge circuit includes a compensated-gain control signal for compensating for changes in the component values in order to achieve optimal voltage regulation. The compensated-gain control circuit includes an automatic-gain control circuit for generating a variable-gain control signal. The automatic-gain control circuit is formed of a precision rectifier circuit, a filter network, an error amplifier, and an integrator circuit. 5 figs.

  14. Fractional frequency instability in the 10{sup -14} range with a thermal beam optical frequency reference

    SciTech Connect (OSTI)

    McFerran, John J.; Luiten, Andre N. [School of Physics, University of Western Australia, 35 Stirling Highway, Crawley 6009, W.A. (Australia)

    2010-02-15

    We demonstrate a means of increasing the signal-to-noise ratio in a Ramsey-Borde interferometer with spatially separated oscillatory fields on a thermal atomic beam. The {sup 1}S{sub 0}{r_reversible}{sup 3}P{sub 1} intercombination line in neutral {sup 40}Ca is used as a frequency discriminator, with an extended cavity diode laser at 423 nm probing the ground state population after a Ramsey-Borde sequence of 657 nm light-field interactions with the atoms. Evaluation of the instability of the Ca frequency reference is carried out by comparison with (i) a hydrogen-maser and (ii) a cryogenic sapphire oscillator. In the latter case the Ca reference exhibits a square-root {Lambda} variance of 9.2x10{sup -14} at 1 s and 2.0x10{sup -14} at 64 s. This is an order-of-magnitude improvement for optical beam frequency references, to our knowledge. The shot noise of the readout fluorescence produces a limiting square-root {Lambda} variance of 7x10{sup -14}/{radical}({tau}), highlighting the potential for improvement. This work demonstrates the feasibility of a portable frequency reference in the optical domain with 10{sup -14} range frequency instability.

  15. Fast radio-frequency amplitude modulation in multiple-quantum magic-angle-spinning nuclear magnetic resonance: Theory and experiments

    E-Print Network [OSTI]

    Frydman, Lucio

    Fast radio-frequency amplitude modulation in multiple-quantum magic-angle-spinning nuclear magnetic of this experiment has been the poor efficiency of the radio-frequency pulses used in converting multiple-modulated radio-frequency pulses, and which can yield substantial signal and even resolution enhancements over

  16. Radio frequency phototube

    DOE Patents [OSTI]

    Margaryan, Amur (Yerevan, AM); Gynashyan, Karlen (Yerevan, AM); Hashimoto, Osamu (Sendai, JP); Majewski, Stanislaw (Morgantown, WV); Tang, Linguang (Yorktown, VA); Marikyan, Gagik (Yerevan, AM); Marikyan, legal representative, Lia (Yerevan, AM)

    2012-03-20

    A method and apparatus of obtaining a record of repetitive optical or other phenomena having durations in the picosecond range, comprising a circular scan electron tube to receive light pulses and convert them to electron images consisting with fast nanosecond electronic signals, a continuous wave light or other particle pulses, e.g. electron picosecond pulses, and a synchronizing mechanism arranged to synchronize the deflection of the electron image (images) in the tube (tubes) with the repetition rate of the incident pulse train. There is also provided a method and apparatus for digitization of a repetitive and random optical waveform with a bandwidth higher than 10 GHz.

  17. Liquidity facilities and signaling

    E-Print Network [OSTI]

    Arregui, Nicolás

    2010-01-01

    This dissertation studies the role of signaling concerns in discouraging access to liquidity facilities like the IMF contingent credit lines (CCL) and the Discount Window (DW). In Chapter 1, I analyze the introduction of ...

  18. Diversity combining in laser Doppler vibrometry for improved signal reliability

    SciTech Connect (OSTI)

    Dräbenstedt, Alexander

    2014-05-27

    Because of the speckle nature of the light reflected from rough surfaces the signal quality of a vibrometer suffers from varying signal power. Deep signal outages manifest themselves as noise bursts and spikes in the demodulated velocity signal. Here we show that the signal quality of a single point vibrometer can be substantially improved by diversity reception. This concept is widely used in RF communication and can be transferred into optical interferometry. When two statistically independent measurement channels are available which measure the same motion on the same spot, the probability for both channels to see a signal drop-out at the same time is very low. We built a prototype instrument that uses polarization diversity to constitute two independent reception channels that are separately demodulated into velocity signals. Send and receive beams go through different parts of the aperture so that the beams can be spatially separated. The two velocity channels are mixed into one more reliable signal by a PC program in real time with the help of the signal power information. An algorithm has been developed that ensures a mixing of two or more channels with minimum resulting variance. The combination algorithm delivers also an equivalent signal power for the combined signal. The combined signal lacks the vast majority of spikes that are present in the raw signals and it extracts the true vibration information present in both channels. A statistical analysis shows that the probability for deep signal outages is largely decreased. A 60 fold improvement can be shown. The reduction of spikes and noise bursts reduces the noise in the spectral analysis of vibrations too. Over certain frequency bands a reduction of the noise density by a factor above 10 can be shown.

  19. Spread spectrum communication system with chaotic frequency A. R. Volkovskii,a

    E-Print Network [OSTI]

    Tsimring, Lev S.

    Spread spectrum communication system with chaotic frequency modulation A. R. Volkovskii,a L. Sh spread spectrum communication system utilizing chaotic frequency modulation of sinusoidal signals-based communication system. © 2005 American Institute of Physics. DOI: 10.1063/1.1942327 The ability of chaotic

  20. Damage mechanisms identification of polymer based composite materials: time-frequency investigation of

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Damage mechanisms identification of polymer based composite materials: time-frequency investigation 2012, Nantes, France 2045 #12;Presented in this paper, a time-frequency damage characterization Emission (AE) signals by the Hilbert-Huang transform (HHT). It is to be noted that the study of damage

  1. Frequency stability considerations in the design of battery-powered VHF transmitters 

    E-Print Network [OSTI]

    Klughart, Kevin Mark

    1992-01-01

    HARDWARE SETUP AUTOMATED MEASUREMENT BENEFITS SOFTWARE CONFIGURATION. OSCILLATOR TEST FIXTURE. Motivation . Example Test Setup. Design and Construction Performance. SUM1VMRY CIRCUIT DESIGN AND MEASURED RESULTS INTRODUCTION. SONY ECP OSCILLATOR... . . Oscillator Frequency Stability Test Setup. . Typical User Interface to Automated Test Software ?, Automated Signal Analysis Via HP-IB Instrumentation ??, Oscillator Frequency Shift Caused By Antenna Loading . . . . Oscillator Measurement Using Test...

  2. Frequency Synthesizers and Oscillator Architectures Based on Multi-Order Harmonic Generation 

    E-Print Network [OSTI]

    Abdul-Latif, Mohammed

    2012-02-14

    synthesizers. This architecture uses two-step multi-order harmonic generation of a low frequency phase-locked signal to generate wideband mm-wave frequencies. A prototype of the proposed system is designed and fabricated in 90nm Complementary Metal Oxide...

  3. Hierarchical classification of modulation signals 

    E-Print Network [OSTI]

    Kim, Nam Jin

    2002-01-01

    This thesis addresses the problem of classifying both analog and digital modulation signals using different kinds of classifiers. The classification of modulation signals has both civilian and military applications. A total of 31 statistical signal...

  4. Method for enhancing signals transmitted over optical fibers

    DOE Patents [OSTI]

    Ogle, James W. (Goleta, CA); Lyons, Peter B. (Whiterock, NM)

    1983-01-01

    A method for spectral equalization of high frequency spectrally broadband signals transmitted through an optical fiber. The broadband signal input is first dispersed by a grating. Narrow spectral components are collected into an array of equalizing fibers. The fibers serve as optical delay lines compensating for material dispersion of each spectral component during transmission. The relative lengths of the individual equalizing fibers are selected to compensate for such prior dispersion. The output of the equalizing fibers couple the spectrally equalized light onto a suitable detector for subsequent electronic processing of the enhanced broadband signal.

  5. Digital Signal Processing applied to Physical Signals

    E-Print Network [OSTI]

    Alberto, Diego; Musa, L

    2011-01-01

    It is well known that many of the scientific and technological discoveries of the XXI century will depend on the capability of processing and understanding a huge quantity of data. With the advent of the digital era, a fully digital and automated treatment can be designed and performed. From data mining to data compression, from signal elaboration to noise reduction, a processing is essential to manage and enhance features of interest after every data acquisition (DAQ) session. In the near future, science will go towards interdisciplinary research. In this work there will be given an example of the application of signal processing to different fields of Physics from nuclear particle detectors to biomedical examinations. In Chapter 1 a brief description of the collaborations that allowed this thesis is given, together with a list of the publications co-produced by the author in these three years. The most important notations, definitions and acronyms used in the work are also provided. In Chapter 2, the last r...

  6. Iterative receivers for OFDM systems with dispersive fading and frequency offset 

    E-Print Network [OSTI]

    Liu, Hui

    2004-09-30

    viii LIST OF FIGURES FIGURE Page 1 Block diagram of OFDM system. : : : : : : : : : : : : : : : : : : : : 3 2 ICI e ects on the amplitude of the desired signal Xk. : : : : : : : : : 7 3 ICI e ects on BER in a coded OFDM system with normalized frequency o.... : : : : : : : : : : : : 13 9 A coded OFDM system with iterative receiver. : : : : : : : : : : : : 16 10 BER in a coded OFDM system through a 4-tap frequency selective fading channel with Doppler shift fd = 50Hz. Carrier frequency o set f = 0:05=N...

  7. Frequency mixing crystal

    DOE Patents [OSTI]

    Ebbers, Christopher A. (Livermore, CA); Davis, Laura E. (Manteca, CA); Webb, Mark (Salida, CA)

    1992-01-01

    In a laser system for converting infrared laser light waves to visible light comprising a source of infrared laser light waves and means of harmoic generation associated therewith for production of light waves at integral multiples of the frequency of the original wave, the improvement of said means of harmonic generation comprising a crystal having the chemical formula X.sub.2 Y(NO.sub.3).sub.5 .multidot.2 nZ.sub.2 o wherein X is selected from the group consisting of Li, Na, K, Rb, Cs, and Tl; Y is selected from the group consisting of Sc, Y, La, Ce, Nd, Pr, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Al, Ga, and In; Z is selected from the group consisting of H and D; and n ranges from 0 to 4.

  8. Frequency doubling crystals

    DOE Patents [OSTI]

    Wang, Francis (Danville, CA); Velsko, Stephan P. (Livermore, CA)

    1989-01-01

    A systematic approach to the production of frequency conversion crystals is described in which a chiral molecule has attached to it a "harmonic generating unit" which contributes to the noncentrosymmetry of the molecule. Certain preferred embodiments of such harmonic generating units include carboxylate, guanadyly and imidazolyl units. Certain preferred crystals include L-arginine fluoride, deuterated L-arginine fluoride, L-arginine chloride monohydrate, L-arginine acetate, dithallium tartrate, ammonium N-acetyl valine, N-acetyl tyrosine and N-acetyl hydroxyproline. Chemical modifications of the chiral molecule, such as deuteration, halogenation and controlled counterion substitution are available to adapt the dispersive properties of a crystal in a particular wavelength region.

  9. Radio frequency coaxial feedthrough

    DOE Patents [OSTI]

    Owens, Thomas L. (Kingston, TN)

    1989-01-17

    An improved radio frequency coaxial transmission line vacuum feed-through provided based on the use of a half-wavelength annular dielectric pressure barrier disk, or multiple disks comprising an effective half wavelength structure to eliminate reflections from the barrier surfaces. Gas-tight seals are formed about the outer and inner diameter surfaces of the barrier disk using a sealing technique which generates radial forces sufficient to form seals by forcing the conductor walls against the surfaces of the barrier disks in a manner which does not deform the radii of the inner and outer conductors, thereby preventing enhancement of the electric field at the barrier faces which limits voltage and power handling capabilities of a feedthrough.

  10. Flying radio frequency undulator

    SciTech Connect (OSTI)

    Kuzikov, S. V.; Vikharev, A. A. [Institute of Applied Physics, Russian Academy of Sciences, 46 Ulyanov St., Nizhny Novgorod 603950 (Russian Federation); Savilov, A. V. [Institute of Applied Physics, Russian Academy of Sciences, 46 Ulyanov St., Nizhny Novgorod 603950 (Russian Federation); Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod (Russian Federation)

    2014-07-21

    A concept for the room-temperature rf undulator, designed to produce coherent X-ray radiation by means of a relatively low-energy electron beam and pulsed mm-wavelength radiation, is proposed. The “flying” undulator is a high-power short rf pulse co-propagating together with a relativistic electron bunch in a helically corrugated waveguide. The electrons wiggle in the rf field of the ?1st spatial harmonic with the phase velocity directed in the opposite direction in respect to the bunch velocity, so that particles can irradiate high-frequency Compton's photons. A high group velocity (close to the speed of light) ensures long cooperative motion of the particles and the co-propagating rf pulse.

  11. High frequency nanotube oscillator

    DOE Patents [OSTI]

    Peng, Haibing (Houston, TX); Zettl, Alexander K. (Kensington, TX)

    2012-02-21

    A tunable nanostructure such as a nanotube is used to make an electromechanical oscillator. The mechanically oscillating nanotube can be provided with inertial clamps in the form of metal beads. The metal beads serve to clamp the nanotube so that the fundamental resonance frequency is in the microwave range, i.e., greater than at least 1 GHz, and up to 4 GHz and beyond. An electric current can be run through the nanotube to cause the metal beads to move along the nanotube and changing the length of the intervening nanotube segments. The oscillator can operate at ambient temperature and in air without significant loss of resonance quality. The nanotube is can be fabricated in a semiconductor style process and the device can be provided with source, drain, and gate electrodes, which may be connected to appropriate circuitry for driving and measuring the oscillation. Novel driving and measuring circuits are also disclosed.

  12. System and method for detection of dispersed broadband signals

    DOE Patents [OSTI]

    Qian, Shie (Austin, TX); Dunham, Mark E. (Los Alamos, NM)

    1999-06-08

    A system and method for detecting the presence of dispersed broadband signals in real time. The present invention utilizes a bank of matched filters for detecting the received dispersed broadband signals. Each matched filter uses a respective robust time template that has been designed to approximate the dispersed broadband signals of interest, and each time template varies across a spectrum of possible dispersed broadband signal time templates. The received dispersed broadband signal x(t) is received by each of the matched filters, and if one or more matches occurs, then the received data is determined to have signal data of interest. This signal data can then be analyzed and/or transmitted to Earth for analysis, as desired. The system and method of the present invention will prove extremely useful in many fields, including satellite communications, plasma physics, and interstellar research. The varying time templates used in the bank of matched filters are determined as follows. The robust time domain template is assumed to take the form w(t)=A(t)cos{2.phi.(t)}. Since the instantaneous frequency f(t) is known to be equal to the derivative of the phase .phi.(t), the trajectory of a joint time-frequency representation of x(t) is used as an approximation of .phi.'(t).

  13. System and method for detection of dispersed broadband signals

    DOE Patents [OSTI]

    Qian, S.; Dunham, M.E.

    1999-06-08

    A system and method for detecting the presence of dispersed broadband signals in real time are disclosed. The present invention utilizes a bank of matched filters for detecting the received dispersed broadband signals. Each matched filter uses a respective robust time template that has been designed to approximate the dispersed broadband signals of interest, and each time template varies across a spectrum of possible dispersed broadband signal time templates. The received dispersed broadband signal x(t) is received by each of the matched filters, and if one or more matches occurs, then the received data is determined to have signal data of interest. This signal data can then be analyzed and/or transmitted to Earth for analysis, as desired. The system and method of the present invention will prove extremely useful in many fields, including satellite communications, plasma physics, and interstellar research. The varying time templates used in the bank of matched filters are determined as follows. The robust time domain template is assumed to take the form w(t)=A(t)cos[l brace]2[phi](t)[r brace]. Since the instantaneous frequency f(t) is known to be equal to the derivative of the phase [phi](t), the trajectory of a joint time-frequency representation of x(t) is used as an approximation of [phi][prime](t). 10 figs.

  14. Regulators, Requirements, Statutes

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Regulations and the New Mexico Administrative Code. Federal Requirements The Environmental Protection Agency (EPA) enforces the federal regulations. Code of Federal...

  15. High Power Millimeter-Wave Signal Generation in Advanced SiGe and CMOS Process

    E-Print Network [OSTI]

    Lin, Hsin-Chang

    2015-01-01

    1.1 Millimeter-Wave Applications . . . 1.2 PowerTechniques . . . 1.3 Millimeter-Wave Signal Generation 1.4High-Power Millimeter-Wave Frequency Multipliers in Advance

  16. ADAPTIVE OPTICAL SIGNAL PROCESSING FOR MICROWAVE-CARRIER BROADBAND SIGNALS

    E-Print Network [OSTI]

    Popovic, Zoya

    ADAPTIVE OPTICAL SIGNAL PROCESSING FOR MICROWAVE-CARRIER BROADBAND SIGNALS Paul Smith, Zoya Popovic antenna array in which adaptive processing of the received signals is performed by dynamic holographic to other signal-processing algorithms is also discussed. 1. INTRODUCTION A key challenge to present

  17. Digitally-Assisted Mixed-Signal Wideband Compressive Sensing 

    E-Print Network [OSTI]

    Yu, Zhuizhuan

    2012-07-16

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114 VITA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128 x LIST OF TABLES TABLE Page I Relationship of the SFDR and the frequency span of two-tone test sig- nals, where the signal has a sparsity of 2....01. . . . . . . . . . . . . . . . . . . . 59 III Testing results of the prototype . . . . . . . . . . . . . . . . . . . . . . 69 IV Testing results of the prototype. . . . . . . . . . . . . . . . . . . . . . . 82 V Design specifications of the CS front...

  18. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  19. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  20. Effective switching frequency multiplier inverter

    DOE Patents [OSTI]

    Su, Gui-Jia (Oak Ridge, TN); Peng, Fang Z. (Okemos, MI)

    2007-08-07

    A switching frequency multiplier inverter for low inductance machines that uses parallel connection of switches and each switch is independently controlled according to a pulse width modulation scheme. The effective switching frequency is multiplied by the number of switches connected in parallel while each individual switch operates within its limit of switching frequency. This technique can also be used for other power converters such as DC/DC, AC/DC converters.

  1. SILICON PHOTONICS Signal regeneration

    E-Print Network [OSTI]

    Braun, Paul

    of three-dimensional (3D) systems containing defined defect structures has presented a difficult set of fabrication and materials challenges. A review of the recent efforts to introduce defects in 3D PhCs operating at optical frequencies is presented in ref. 12. Previous attempts to define defects in 3D PhCs have been

  2. Aural perception of NDE signals

    SciTech Connect (OSTI)

    Light, G.M.; Holt, A.E.; Polk, K.D.; Godwin, J.G.; Clayton, W.T.

    1994-12-31

    During nondestructive evaluation (NDE) of a material, the inspection signals are received typically by an NDE instrument. These signals usually are displayed electronically for visual interpretation. Work has been done to convert these signals into aural (audible) signals with the intent to enhance the accuracy of evaluation through the use of two senses (ears and eyes) instead of one. This paper describes auralization of ultrasonic NDE testing signals to improve characterization and evaluation of materials.

  3. An Oxysterol-derived Positive Signal for 3-Hydroxy-3-methylglutaryl-CoA Reductase Degradation in Yeast*

    E-Print Network [OSTI]

    Gardner, Rich

    An Oxysterol-derived Positive Signal for 3-Hydroxy- 3-methylglutaryl-CoA Reductase Degradation-methylglutaryl-CoA reductase (HMGR). In mammals, both a non-sterol isoprenoid signal derived from farnesyl diphosphate (FPP) and a sterol-derived signal appear to act together to positively regulate the rate of HMGR

  4. Note: On-line weak signal detection via adaptive stochastic resonance

    SciTech Connect (OSTI)

    Lu, Siliang; He, Qingbo Kong, Fanrang

    2014-06-15

    We design an instrument with a novel embedded adaptive stochastic resonance (SR) algorithm that consists of a SR module and a digital zero crossing detection module for on-line weak signal detection in digital signal processing applications. The two modules are responsible for noise filtering and adaptive parameter configuration, respectively. The on-line weak signal detection can be stably achieved in seconds. The prototype instrument exhibits an advance of 20 dB averaged signal-to-noise ratio and 5 times averaged adjust R-square as compared to the input noisy signal, in considering different driving frequencies and noise levels.

  5. Identification of cell density signal molecule

    DOE Patents [OSTI]

    Schwarz, R.I.

    1998-04-21

    Disclosed herein is a novel proteinaceous cell density signal molecule (CDS) between 25 and 35 kD, which is secreted by fibroblastic primary avian tendon cells in culture, and causes the cells to self-regulate their proliferation and the expression of differentiated function. It effects an increase of procollagen production in avian tendon cell cultures of ten fold while proliferation rates are decreased. CDS, and the antibodies which recognize them, are important for the development of diagnostics and treatments for injuries and diseases involving connective tissues, particularly tendon. Also disclosed are methods of production and use. 2 figs.

  6. Identification of cell density signal molecule

    DOE Patents [OSTI]

    Schwarz, Richard I. (Oakland, CA)

    1998-01-01

    Disclosed herein is a novel proteinaceous cell density signal molecule (CDS) between 25 and 35 kD, which is secreted by fibroblastic primary avian tendon cells in culture, and causes the cells to self-regulate their proliferation and the expression of differentiated function. It effects an increase of procollagen production in avian tendon cell cultures of ten fold while proliferation rates are decreased. CDS, and the antibodies which recognize them, are important for the development of diagnostics and treatments for injuries and diseases involving connective tissues, particularly tendon. Also disclosed are methods of production and use.

  7. Manipulation of Host Signaling by Vector-Borne and Non-Vector-Borne Pathogens

    E-Print Network [OSTI]

    Sakhon, Olivia S.

    2013-01-01

    Aedes spp. , Mansonia spp. Nod-like receptor NLRP3 Nod1 Nod22009) Short Report?: Disruption of Nod-like Receptors Altersal. (2008) Caspase-12 modulates NOD signaling and regulates

  8. Lysophosphatidic acid (LPA) signaling in neuropathic pain development and Schwann cell biology

    E-Print Network [OSTI]

    Lin, Mu-En

    2012-01-01

    the effects of LPA on migration of primary mouse SCs using aprimary culture, we showed that S1P signaling can regulate cell migrationmigration suggested that this response is receptor-mediated. Indeed, primary

  9. Operating Regimes of Signaling Cycles: Statics, Dynamics, and Noise Filtering

    E-Print Network [OSTI]

    Carlos Gomez-Uribe; George C. Verghese; Leonid A. Mirny

    2007-12-18

    A ubiquitous building block of signaling pathways is a cycle of covalent modification (e.g., phosphorylation and dephosphorylation in MAPK cascades). Our paper explores the kind of information processing and filtering that can be accomplished by this simple biochemical circuit. Signaling cycles are particularly known for exhibiting a highly sigmoidal (ultrasensitive) input-output characteristic in a certain steady-state regime. Here we systematically study the cycle's steady-state behavior and its response to time-varying stimuli. We demonstrate that the cycle can actually operate in four different regimes, each with its specific input-output characteristics. These results are obtained using the total quasi-steady-state approximation, which is more generally valid than the typically used Michaelis-Menten approximation for enzymatic reactions. We invoke experimental data that suggests the possibility of signaling cycles operating in one of the new regimes. We then consider the cycle's dynamic behavior, which has so far been relatively neglected. We demonstrate that the intrinsic architecture of the cycles makes them act - in all four regimes - as tunable low-pass filters, filtering out high-frequency fluctuations or noise in signals and environmental cues. Moreover, the cutoff frequency can be adjusted by the cell. Numerical simulations show that our analytical results hold well even for noise of large amplitude. We suggest that noise filtering and tunability make signaling cycles versatile components of more elaborate cell signaling pathways.

  10. FOURIER-BASED METHOD FOR ESTIMATING SIGNAL PERTURBATIONS IN LINEARLY-CORRELATED NOISE

    E-Print Network [OSTI]

    Gorodnitsky, Irina

    1 FOURIER-BASED METHOD FOR ESTIMATING SIGNAL PERTURBATIONS IN LINEARLY-CORRELATED NOISE Irina the true signal )(tx from )(* tx . Let's denote the coefficients of the respective Fourier decomposition = = , where indicates the chosen frequency resolution of the Fourier decomposition. The DC-term exist, Eq. (2

  11. Regulation of flowering time in Arabidopsis by K homology domain proteins

    E-Print Network [OSTI]

    Lin, Chentao

    Regulation of flowering time in Arabidopsis by K homology domain proteins Todd C. Mockler* , Xuhong to reproductive develop- ment in Arabidopsis is regulated by multiple floral induction pathways, including to regulate the expression of a small set of genes critical for floral initiation and different signal

  12. Acoustic resonance frequency locked photoacoustic spectrometer

    DOE Patents [OSTI]

    Pilgrim, Jeffrey S.; Bomse, David S.; Silver, Joel A.

    2003-09-09

    A photoacoustic spectroscopy method and apparatus for maintaining an acoustic source frequency on a sample cell resonance frequency comprising: providing an acoustic source to the sample cell, the acoustic source having a source frequency; repeatedly and continuously sweeping the source frequency across the resonance frequency at a sweep rate; and employing an odd-harmonic of the source frequency sweep rate to maintain the source frequency sweep centered on the resonance frequency.

  13. Signal quality of the LHC AC dipoles and its impact on beam dynamics

    SciTech Connect (OSTI)

    Miyamoto, R.; Cattin, M.; Serrano, J.; Tomas, R.

    2010-05-23

    The adiabaticity of the AC dipole might be compromised by noise or unwanted frequency components in its signal. An effort has been put to characterize and optimize the signal quality of the LHC AC dipoles. The measured signal is used in realistic simulations in order to evaluate its impact on beam dynamics and to ultimately establish safe margins for the operation of the LHC AC dipoles.

  14. Tailpulse signal generator

    DOE Patents [OSTI]

    Baker, John (Walnut Creek, CA); Archer, Daniel E. (Knoxville, TN); Luke, Stanley John (Pleasanton, CA); Decman, Daniel J. (Livermore, CA); White, Gregory K. (Livermore, CA)

    2009-06-23

    A tailpulse signal generating/simulating apparatus, system, and method designed to produce electronic pulses which simulate tailpulses produced by a gamma radiation detector, including the pileup effect caused by the characteristic exponential decay of the detector pulses, and the random Poisson distribution pulse timing for radioactive materials. A digital signal process (DSP) is programmed and configured to produce digital values corresponding to pseudo-randomly selected pulse amplitudes and pseudo-randomly selected Poisson timing intervals of the tailpulses. Pulse amplitude values are exponentially decayed while outputting the digital value to a digital to analog converter (DAC). And pulse amplitudes of new pulses are added to decaying pulses to simulate the pileup effect for enhanced realism in the simulation.

  15. Dual-etalon, cavity-ring-down, frequency comb spectroscopy.

    SciTech Connect (OSTI)

    Strecker, Kevin E.; Chandler, David W.

    2010-10-01

    The 'dual etalon frequency comb spectrometer' is a novel low cost spectometer with limited moving parts. A broad band light source (pulsed laser, LED, lamp ...) is split into two beam paths. One travels through an etalon and a sample gas, while the second arm is just an etalon cavity, and the two beams are recombined onto a single detector. If the free spectral ranges (FSR) of the two cavities are not identical, the intensity pattern at the detector with consist of a series of heterodyne frequencies. Each mode out of the sample arm etalon with have a unique frequency in RF (radio-frequency) range, where modern electronics can easily record the signals. By monitoring these RF beat frequencies we can then determine when an optical frequencies is absorbed. The resolution is set by the FSR of the cavity, typically 10 MHz, with a bandwidth up to 100s of cm{sup -1}. In this report, the new spectrometer is described in detail and demonstration experiments on Iodine absorption are carried out. Further we discuss powerful potential next generation steps to developing this into a point sensor for monitoring combustion by-products, environmental pollutants, and warfare agents.

  16. Hydraulic impulse generator and frequency sweep mechanism for borehole applications

    DOE Patents [OSTI]

    Kolle, Jack J.; Marvin, Mark H.; Theimer, Kenneth J.

    2006-11-21

    This invention discloses a valve that generates a hydraulic negative pressure pulse and a frequency modulator for the creation of a powerful, broadband swept impulse seismic signal at the drill bit during drilling operations. The signal can be received at monitoring points on the surface or underground locations using geophones. The time required for the seismic signal to travel from the source to the receiver directly and via reflections is used to calculate seismic velocity and other formation properties near the source and between the source and receiver. This information can be used for vertical seismic profiling of formations drilled, to check the location of the bit, or to detect the presence of abnormal pore pressure ahead of the bit. The hydraulic negative pressure pulse can also be used to enhance drilling and production of wells.

  17. Searches for High Frequency Variations in the $^8$B Solar Neutrino Flux at the Sudbury Neutrino Observatory

    E-Print Network [OSTI]

    SNO Collaboration

    2009-10-13

    We have performed three searches for high-frequency signals in the solar neutrino flux measured by the Sudbury Neutrino Observatory (SNO), motivated by the possibility that solar $g$-mode oscillations could affect the production or propagation of solar $^8$B neutrinos. The first search looked for any significant peak in the frequency range 1/day to 144/day, with a sensitivity to sinusoidal signals with amplitudes of 12% or greater. The second search focused on regions in which $g$-mode signals have been claimed by experiments aboard the SoHO satellite, and was sensitive to signals with amplitudes of 10% or greater. The third search looked for extra power across the entire frequency band. No statistically significant signal was detected in any of the three searches.

  18. Intrinsic Disorder in Cell-signaling and Cancer-associated Proteins

    E-Print Network [OSTI]

    Obradovic, Zoran

    Intrinsic Disorder in Cell-signaling and Cancer-associated Proteins Lilia M. Iakoucheva1 , Celeste of intrinsically disordered proteins known to be involved in cell-signaling and regulation is growing rapidly network predictor of natural disordered regions (PONDR VL-XT) to four protein datasets: human cancer

  19. miR-143 Interferes with ERK5 Signaling, and Abrogates Prostate Cancer Progression in Mice

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    miR-143 Interferes with ERK5 Signaling, and Abrogates Prostate Cancer Progression in Mice Cyrielle-regulated kinase-5 (ERK5) activity. We show here that ERK5 is a miR-143 target in prostate cancer. Conclusions: mi, Apparailly F, Fernandez PL, et al. (2009) miR-143 Interferes with ERK5 Signaling, and Abrogates Prostate

  20. Epitope-Guided Engineering of Monobody Binders for in Vivo Inhibition of Erk2 Signaling

    E-Print Network [OSTI]

    Ferkey, Denise

    Epitope-Guided Engineering of Monobody Binders for in Vivo Inhibition of Erk2 Signaling Jasdeep K a defined surface patch on the mitogen activated protein kinase (MAPK) Erk-2. The targeted area ("CD" domain be useful for regulating Erk- 2 signaling in vivo. Although the CD domain constitutes only a small

  1. Mathematical Modeling of the Influence of RKIP on the ERK Signaling Pathway

    E-Print Network [OSTI]

    Rostock, Universität

    Mathematical Modeling of the Influence of RKIP on the ERK Signaling Pathway Kwang-Hyun Cho1*, Sung the influence of the Raf Kinase Inhibitor Pro- tein (RKIP) on the Extracellular signal Regulated Kinase (ERK the simulation the sensitivity of the ERK pathway to variations of initial RKIP and ERK-PP (phosphorylated ERK

  2. Development/Plasticity/Repair Disrupted ERK Signaling during Cortical Development Leads

    E-Print Network [OSTI]

    disorders arising from copy number variations in the ERK (extracellular signal-regulated kinase) MAP protein) kinases, ERK1 and ERK2, are the central ele- ments of a prominent signaling pathway governing related disorders termed neuro-cardio-facial-cutaneous (NCFC) syndromes (Tidyman and Rauen, 2008

  3. Natural Gas Regulations (Kentucky)

    Broader source: Energy.gov [DOE]

    Kentucky Administrative Regulation title 805 promulgates the rules and regulations pertaining to natural gas production in Kentucky. In addition to KAR title 405, chapter 30, which pertains to any...

  4. Radar transponder apparatus and signal processing technique

    DOE Patents [OSTI]

    Axline, Jr., Robert M. (Albuquerque, NM); Sloan, George R. (Albuquerque, NM); Spalding, Richard E. (Albuquerque, NM)

    1996-01-01

    An active, phase-coded, time-grating transponder and a synthetic-aperture radar (SAR) and signal processor means, in combination, allow the recognition and location of the transponder (tag) in the SAR image and allow communication of information messages from the transponder to the SAR. The SAR is an illuminating radar having special processing modifications in an image-formation processor to receive an echo from a remote transponder, after the transponder receives and retransmits the SAR illuminations, and to enhance the transponder's echo relative to surrounding ground clutter by recognizing special transponder modulations from phase-shifted from the transponder retransmissions. The remote radio-frequency tag also transmits information to the SAR through a single antenna that also serves to receive the SAR illuminations. Unique tag-modulation and SAR signal processing techniques, in combination, allow the detection and precise geographical location of the tag through the reduction of interfering signals from ground clutter, and allow communication of environmental and status information from said tag to be communicated to said SAR.

  5. Radar transponder apparatus and signal processing technique

    DOE Patents [OSTI]

    Axline, R.M. Jr.; Sloan, G.R.; Spalding, R.E.

    1996-01-23

    An active, phase-coded, time-grating transponder and a synthetic-aperture radar (SAR) and signal processor means, in combination, allow the recognition and location of the transponder (tag) in the SAR image and allow communication of information messages from the transponder to the SAR. The SAR is an illuminating radar having special processing modifications in an image-formation processor to receive an echo from a remote transponder, after the transponder receives and retransmits the SAR illuminations, and to enhance the transponder`s echo relative to surrounding ground clutter by recognizing special transponder modulations from phase-shifted from the transponder retransmissions. The remote radio-frequency tag also transmits information to the SAR through a single antenna that also serves to receive the SAR illuminations. Unique tag-modulation and SAR signal processing techniques, in combination, allow the detection and precise geographical location of the tag through the reduction of interfering signals from ground clutter, and allow communication of environmental and status information from said tag to be communicated to said SAR. 4 figs.

  6. Spectral Decomposition of Signaling Networks

    E-Print Network [OSTI]

    2006-01-01

    expressed. Signaling networks modeled as Petri nets are onenetwork. Although the results are limited to the Petri net

  7. Emotion Regulation CONCEPTUAL FOUNDATIONS

    E-Print Network [OSTI]

    Gross, James J.

    CHAPTER 1 Emotion Regulation CONCEPTUAL FOUNDATIONS JAMES J. GROSS ROSS A. THOMPSON Standing, paper or plastic are made. Quotidian acts of emotion regulation such as this constitute one important- changes that require us to regulate how emotions are experienced and expressed. But what do people do

  8. 3 Library Regulations Definitions

    E-Print Network [OSTI]

    Mottram, Nigel

    3 Library Regulations Definitions In Regulation 3: 'Library' means the University Library as defined in Regulation 3.1; 'Library staff' means the staff of the University Library; 'Librarian' means the University Librarian and Head of Information Resources Directorate or nominee; `Library Committee' means

  9. MARQUETTE UNIVERSITY Speech Signal Enhancement

    E-Print Network [OSTI]

    Johnson, Michael T.

    in a multiple source environment. The goal of the system is to improve the quality of the primary speech signal techniques to improve those estimates while improving the signal to noise ratio of the primary source. #12;iv utilizing signal information rather than physically moving the array. They accomplish this through

  10. AUTO ID FUTURE - FREQUENCY AGNOSTIC

    E-Print Network [OSTI]

    DATTA, SHOUMEN

    Identification of information is one key to the development of intelligent decision systems of the future. Frequency agnostic automatic identification is only one step in the physical world to make physical objects identify ...

  11. Microwave and Radio Frequency Workshop

    Broader source: Energy.gov [DOE]

    At the Microwave and Radio Frequency Workshop (held in Long Beach, CA, on July 25, 2012), academic and industry experts discussed the existing and emerging electrotechnologies – such as microwave ...

  12. Load regulating expansion fixture

    DOE Patents [OSTI]

    Wagner, L.M.; Strum, M.J.

    1998-12-15

    A free standing self contained device for bonding ultra thin metallic films, such as 0.001 inch beryllium foils is disclosed. The device will regulate to a predetermined load for solid state bonding when heated to a bonding temperature. The device includes a load regulating feature, whereby the expansion stresses generated for bonding are regulated and self adjusting. The load regulator comprises a pair of friction isolators with a plurality of annealed copper members located therebetween. The device, with the load regulator, will adjust to and maintain a stress level needed to successfully and economically complete a leak tight bond without damaging thin foils or other delicate components. 1 fig.

  13. Load regulating expansion fixture

    DOE Patents [OSTI]

    Wagner, Lawrence M. (San Jose, CA); Strum, Michael J. (San Jose, CA)

    1998-01-01

    A free standing self contained device for bonding ultra thin metallic films, such as 0.001 inch beryllium foils. The device will regulate to a predetermined load for solid state bonding when heated to a bonding temperature. The device includes a load regulating feature, whereby the expansion stresses generated for bonding are regulated and self adjusting. The load regulator comprises a pair of friction isolators with a plurality of annealed copper members located therebetween. The device, with the load regulator, will adjust to and maintain a stress level needed to successfully and economically complete a leak tight bond without damaging thin foils or other delicate components.

  14. Systems for low frequency seismic and infrasound detection of geo-pressure transition zones

    DOE Patents [OSTI]

    Shook, G. Michael (Idaho Falls, ID); LeRoy, Samuel D. (Houston, TX); Benzing, William M. (Tulsa, OK)

    2007-10-16

    Methods for determining the existence and characteristics of a gradational pressurized zone within a subterranean formation are disclosed. One embodiment involves employing an attenuation relationship between a seismic response signal and increasing wavelet wavelength, which relationship may be used to detect a gradational pressurized zone and/or determine characteristics thereof. In another embodiment, a method for analyzing data contained within a response signal for signal characteristics that may change in relation to the distance between an input signal source and the gradational pressurized zone is disclosed. In a further embodiment, the relationship between response signal wavelet frequency and comparative amplitude may be used to estimate an optimal wavelet wavelength or range of wavelengths used for data processing or input signal selection. Systems for seismic exploration and data analysis for practicing the above-mentioned method embodiments are also disclosed.

  15. Methods and systems for low frequency seismic and infrasound detection of geo-pressure transition zones

    DOE Patents [OSTI]

    Shook, G. Michael; LeRoy, Samuel D.; Benzing, William M.

    2006-07-18

    Methods for determining the existence and characteristics of a gradational pressurized zone within a subterranean formation are disclosed. One embodiment involves employing an attenuation relationship between a seismic response signal and increasing wavelet wavelength, which relationship may be used to detect a gradational pressurized zone and/or determine characteristics thereof. In another embodiment, a method for analyzing data contained within a response signal for signal characteristics that may change in relation to the distance between an input signal source and the gradational pressurized zone is disclosed. In a further embodiment, the relationship between response signal wavelet frequency and comparative amplitude may be used to estimate an optimal wavelet wavelength or range of wavelengths used for data processing or input signal selection. Systems for seismic exploration and data analysis for practicing the above-mentioned method embodiments are also disclosed.

  16. A CMOS Fractional Frequency Synthesizer for a Fully Integrated S-Band Extravehicular Activity (EVA) Radio Transceiver 

    E-Print Network [OSTI]

    Foli, Eugene B

    2014-04-28

    ............................................................................................................... 8 2.1.1 Reference Signal ........................................................................................... 9 2.1.2 Phase Frequency Detector (PFD) ................................................................ 10 2.1.3 Charge Pump... and Charge Pump ............................................. 16 2.2.2 Dual Path Loop Filter (DPLF) .................................................................... 17 2.2.3 Frequency Divider...

  17. IEEE PHOTONICS TECHNOLOGY LETTERS, VOL. 20, NO. 23, DECEMBER 1, 2008 1989 An Optical Approach to Microwave Frequency

    E-Print Network [OSTI]

    Yao, Jianping

    to Microwave Frequency Measurement With Adjustable Measurement Range and Resolution Xihua Zou and Jianping Yao, Senior Member, IEEE Abstract--We propose an approach for the measurement of microwave frequency wavelengths with a large wavelength spacing are modulated by an unknown microwave signal in a Mach

  18. IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 61, NO. 9, SEPTEMBER 2013 3479 Frequency-Multiplying Optoelectronic Oscillator

    E-Print Network [OSTI]

    Yao, Jianping

    IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 61, NO. 9, SEPTEMBER 2013 3479 Frequency-quadrupled, sextupled, or octupled microwave signal without using an optical filter is proposed and experimentally­Zehnder modulator (MZM). Microwave oscillation is achieved in the OEO by feedbacking the intensity-modulated signal

  19. Time-frequency analysis and Harmonic Gaussian Functions

    E-Print Network [OSTI]

    Tokiniaina Ranaivoson; Raoelina Andriambololona; Rakotoson Hanitriarivo

    2013-08-08

    A method for time-frequency analysis is given. The approach utilizes properties of Gaussian distribution, properties of Hermite polynomials and Fourier analysis. We begin by the definitions of a set of functions called harmonic Gaussian functions. Then these functions are used to define a set of transformations,noted T_n, which associate to a function {\\psi},of the time variable t, a set of functions {\\Psi}_n which depend on time, frequency and frequency (or time) standard deviation. Some properties of the transformations T_n and the functions {\\Psi}_n are given. It is proved in particular that the square of the modulus of each function {\\Psi}_n can be interpreted as a representation of the energy distribution of the signal, represented by the function {\\psi}, in the time-frequency plane for a given value of the frequency (or time) standard deviation. It is also shown that the function {\\psi}, can be recovered from the functions{\\Psi}_n.

  20. A Platform for Collaborative Acoustic Signal Processing

    E-Print Network [OSTI]

    Hanbiao Wang; Lewis Girod; Nithya Ramanathan

    2005-01-01

    Graphic ori- ented signal processing language - gospl,” incollaborative acoustic signal processing, and demonstrateembedded system for signal processing and the recent work on

  1. An in situ measurement of the radio-frequency attenuation in ice at Summit Station, Greenland

    E-Print Network [OSTI]

    J. Avva; J. M. Kovac; C. Miki; D. Saltzberg; A. G. Vieregg

    2015-12-02

    We report an in situ measurement of the electric field attenuation length at radio frequencies for the bulk ice at Summit Station, Greenland, made by broadcasting radio-frequency signals vertically through the ice and measuring the relative power in the return ground bounce signal. We find the depth-averaged field attenuation length to be 947 +92/-85 meters at 75 MHz. While this measurement has clear radioglaciological applications, the radio clarity of the ice also has implications for the detection of ultra-high energy (UHE) astrophysical particles via their radio emission in dielectric media such as ice. Assuming a reliable extrapolation to higher frequencies, the measured attenuation length at Summit Station is comparable to previously measured radio-frequency attenuation lengths at candidate particle detector sites around the world, and strengthens the case for Summit Station as a promising northern site for UHE neutrino detection.

  2. High-resolution optical frequency dissemination on a telecommunication network with data traffic

    E-Print Network [OSTI]

    Fabien Kéfélian; Olivier Lopez; Haifeng Jiang; Christian Chardonnet; Anne Amy-Klein; Georgio Santarelli

    2009-02-12

    We transferred the frequency of an ultra-stable laser over a 108 km urban fiber link comprising 22 km of optical communications network fiber simultaneously carrying Internet data traffic. The metrological signal and the digital data signal are transferred on two different frequency channels in a dense wavelength division multiplexing scheme. The metrological signal is inserted into and extracted from the communications network by using bidirectional off-the-shelf optical add-drop multiplexers. The link-induced phase noise is measured and cancelled with round-trip technique using an all-fiber-based interferometer. The compensated link shows an Allan deviation of a few 10-16 at one second and below 10-19 at 10,000 seconds. This opens the way to a wide dissemination of ultra stable optical clock signals between distant laboratories via the Internet network.

  3. System and method for investigating sub-surface features of a rock formation with acoustic sources generating coded signals

    DOE Patents [OSTI]

    Vu, Cung Khac; Nihei, Kurt; Johnson, Paul A; Guyer, Robert; Ten Cate, James A; Le Bas, Pierre-Yves; Larmat, Carene S

    2014-12-30

    A system and a method for investigating rock formations includes generating, by a first acoustic source, a first acoustic signal comprising a first plurality of pulses, each pulse including a first modulated signal at a central frequency; and generating, by a second acoustic source, a second acoustic signal comprising a second plurality of pulses. A receiver arranged within the borehole receives a detected signal including a signal being generated by a non-linear mixing process from the first-and-second acoustic signal in a non-linear mixing zone within the intersection volume. The method also includes-processing the received signal to extract the signal generated by the non-linear mixing process over noise or over signals generated by a linear interaction process, or both.

  4. Frequency Stability of Atomic Frequency Standards beyond Quantum Projection Noise

    E-Print Network [OSTI]

    G. M. Saxena

    2011-04-07

    In this paper we describe that the optically pumped frequency standards can have frequency stability beyond the quantum noise limit by detecting the Ramsey resonance through the squeezed light. In this paper we report that instead of considering the interaction of entangled atoms in the microwave region, it will be more practical to create the entanglement of the atoms in the detection region using the squeezed light, which is also used for the detection of the Ramsey resonance. The advantage of squeezing can be derived when the technical noises have been removed.

  5. Pulsar timing signal from ultralight scalar dark matter

    SciTech Connect (OSTI)

    Khmelnitsky, Andrei; Rubakov, Valery E-mail: rubakov@ms2.inr.ac.ru

    2014-02-01

    An ultralight free scalar field with mass around 10{sup ?23}?10{sup ?22} eV is a viable dark mater candidate, which can help to resolve some of the issues of the cold dark matter on sub-galactic scales. We consider the gravitational field of the galactic halo composed out of such dark matter. The scalar field has oscillating in time pressure, which induces oscillations of gravitational potential with amplitude of the order of 10{sup ?15} and frequency in the nanohertz range. This frequency is in the range of pulsar timing array observations. We estimate the magnitude of the pulse arrival time residuals induced by the oscillating gravitational potential. We find that for a range of dark matter masses, the scalar field dark matter signal is comparable to the stochastic gravitational wave signal and can be detected by the planned SKA pulsar timing array experiment.

  6. First event signalling correlations

    E-Print Network [OSTI]

    Debashis Saha; Marcin Paw?owski

    2015-04-20

    This work introduces the notion of First Event Signalling (FES) correlations in multipartite scenario where the first measurement on one subsystem influences the measurement outcomes of all the other local subsystems. It is shown that these correlations are related to bilocal ones but stronger than their variations proposed earlier. We propose a new Bell inequality which is satisfied by all FES models. Then we show quantum mechanical violation of this inequality, which can be regarded as an alternative definition of a stronger type of genuine multipartite nonlocality and a proof that quantum mechanics exhibits even more powerful correlations than these already known. We also introduce another Bell inequality which is satisfied by all bilocal correlations but violated by FES. The study of our new inequalities and the ones introduced previously allows us to analyze the relation between different types of tripartite nonlocality which reveals a very complex and interesting structure.

  7. Method and apparatus for powering an electrodeless lamp with reduced radio frequency interference

    DOE Patents [OSTI]

    Simpson, James E. (Gaithersburg, MD)

    1999-01-01

    An electrodeless lamp waveguide structure includes tuned absorbers for spurious RF signals. A lamp waveguide with an integral frequency selective attenuation includes resonant absorbers positioned within the waveguide to absorb spurious out-of-band RF energy. The absorbers have a negligible effect on energy at the selected frequency used to excite plasma in the lamp. In a first embodiment, one or more thin slabs of lossy magnetic material are affixed to the sidewalls of the waveguide at approximately one quarter wavelength of the spurious signal from an end wall of the waveguide. The positioning of the lossy material optimizes absorption of power from the spurious signal. In a second embodiment, one or more thin slabs of lossy magnetic material are used in conjunction with band rejection waveguide filter elements. In a third embodiment, one or more microstrip filter elements are tuned to the frequency of the spurious signal and positioned within the waveguide to couple and absorb the spurious signal's energy. All three embodiments absorb negligible energy at the selected frequency and so do not significantly diminish the energy efficiency of the lamp.

  8. Method and apparatus for powering an electrodeless lamp with reduced radio frequency interference

    DOE Patents [OSTI]

    Simpson, J.E.

    1999-06-08

    An electrodeless lamp waveguide structure includes tuned absorbers for spurious RF signals. A lamp waveguide with an integral frequency selective attenuation includes resonant absorbers positioned within the waveguide to absorb spurious out-of-band RF energy. The absorbers have a negligible effect on energy at the selected frequency used to excite plasma in the lamp. In a first embodiment, one or more thin slabs of lossy magnetic material are affixed to the sidewalls of the waveguide at approximately one quarter wavelength of the spurious signal from an end wall of the waveguide. The positioning of the lossy material optimizes absorption of power from the spurious signal. In a second embodiment, one or more thin slabs of lossy magnetic material are used in conjunction with band rejection waveguide filter elements. In a third embodiment, one or more microstrip filter elements are tuned to the frequency of the spurious signal and positioned within the waveguide to couple and absorb the spurious signal's energy. All three embodiments absorb negligible energy at the selected frequency and so do not significantly diminish the energy efficiency of the lamp. 18 figs.

  9. Single-sideband hybrid AM-PM signal models 

    E-Print Network [OSTI]

    Painter, John H.

    1966-01-01

    /or frequency diversity and occupy essentially the same transmission bandwidth as double sideband phase-modu- lated signals. JOHN H. PAINTER Motorola, Inc. Military Electronics Div. Scottsdale, Ariz. An Improved Telemetry Encoding Circuit... with Square Loop Cores and SCR's In a recent correspondence,' the author described a new magnetic amplifier telemetry encoder circuit which is suitable for application in artificial satellites and rockets. The encoder circuit, though it gives excellent...

  10. Decentralized customerlevel under frequency load shedding in...

    Open Energy Info (EERE)

    Decentralized customerlevel under frequency load shedding in Switzerland (Smart Grid Project) Jump to: navigation, search Project Name Decentralized customerlevel under frequency...

  11. Pressure reducing regulator

    DOE Patents [OSTI]

    Whitehead, John C. (Davis, CA); Dilgard, Lemoyne W. (Willits, CA)

    1995-01-01

    A pressure reducing regulator that controls its downstream or outlet pressure to a fixed fraction of its upstream or inlet pressure. The regulator includes a housing which may be of a titanium alloy, within which is located a seal or gasket at the outlet end which may be made of annealed copper, a rod, and piston, each of which may be made of high density graphite. The regulator is insensitive to temperature by virtue of being without a spring or gas sealed behind a diaphragm, and provides a reference for a system in which it is being used. The rod and piston of the regulator are constructed, for example, to have a 1/20 ratio such that when the downstream pressure is less than 1/20 of the upstream pressure the regulator opens and when the downstream pressure exceeds 1/20 of the upstream pressure the regulator closes.

  12. Pressure reducing regulator

    DOE Patents [OSTI]

    Whitehead, J.C.; Dilgard, L.W.

    1995-10-10

    A pressure reducing regulator that controls its downstream or outlet pressure to a fixed fraction of its upstream or inlet pressure is disclosed. The regulator includes a housing which may be of a titanium alloy, within which is located a seal or gasket at the outlet end which may be made of annealed copper, a rod, and piston, each of which may be made of high density graphite. The regulator is insensitive to temperature by virtue of being without a spring or gas sealed behind a diaphragm, and provides a reference for a system in which it is being used. The rod and piston of the regulator are constructed, for example, to have a 1/20 ratio such that when the downstream pressure is less than 1/20 of the upstream pressure the regulator opens and when the downstream pressure exceeds 1/20 of the upstream pressure the regulator closes. 10 figs.

  13. Two-frequency Ramsey interferometry

    SciTech Connect (OSTI)

    Seidel, D.; Muga, J. G. [Departmento de Quimica-Fisica, Universidad del Pais Vasco, Apartado Postal 644, 48080 Bilbao (Spain)

    2007-02-15

    We investigate Ramsey interferometry for two separated fields oscillating with different frequencies. It is shown that the interplay between average and relative detuning leads to interference effects not present in the standard, single-frequency setup. For a large free-flight time of ground-state atoms before entering the first field region, the Ramsey fringes with respect to the relative detuning become much narrower than the usual ones. The stability of these effects with respect to phase or velocity fluctuations is discussed.

  14. Radio-frequency power generation

    E-Print Network [OSTI]

    Carter, Richard G

    2013-01-01

    This paper reviews the main types of radio-frequency power amplifiers which are, or may be, used for high-power hadron accelerators. It covers tetrodes, inductive output tubes, klystrons and magnetrons with power outputs greater than 10 kW continuous wave or 100 kW pulsed at frequencies from 50 MHz to 30 GHz. Factors affecting the satisfactory operation of amplifiers include cooling, matching and protection circuits are discussed. The paper concludes with a summary of the state of the art for the different technologies.

  15. Signal Processing Techniques EnablingWideband A/D Converters

    E-Print Network [OSTI]

    Ghosh, Abhishek

    2013-01-01

    Signal processing . . . . . . . . . . . . . . . . . . . . .signal processing . . . . . . . . . . . . . . . . . . . . .prescribed filter . . 28 Signal processing model of total

  16. Resources for Utility Regulators

    SciTech Connect (OSTI)

    SEE Action

    2012-06-01

    Provides a summary of State and Local Energy Efficiency Action Network (SEE Action) information resources available to utility regulators, organized by topic.

  17. The Role of Docosahexaenoic Acid in Regulation of Epidermal Growth Factor Receptor Activation and Function 

    E-Print Network [OSTI]

    Turk, Harmony 1985-

    2012-08-30

    The epidermal growth factor receptor (EGFR) is a transmembrane receptor tyrosine kinase integral in regulating cell growth, survival, and migration. EGFR signaling, which is dependent on localization of the receptor within ...

  18. Cholinergic neurons in the dorsomedial hypothalamus regulate mouse brown adipose tissue metabolism

    E-Print Network [OSTI]

    Jeong, Jae Hoon; Lee, Dong Kun; Blouet, Clémence; Ruiz, Henry H.; Buettner, Christoph; Chua, Streamson Jr; Schwartz, Gary J.; Jo, Young-Hwan

    2015-04-11

    Objective: Brown adipose tissue (BAT) thermogenesis is critical in maintaining body temperature. The dorsomedial hypothalamus (DMH) integrates cutaneous thermosensory signals and regulates adaptive thermogenesis. Here, we study the function...

  19. Regulation of the mTOR Complex 1 Pathway by Nutrients, Growth Factors, and Stress

    E-Print Network [OSTI]

    Sengupta, Shomit

    The large serine/threonine protein kinase mTOR regulates cellular and organismal homeostasis by coordinating anabolic and catabolic processes with nutrient, energy, and oxygen availability and growth factor signaling. Cells ...

  20. Electromagnetic field effects on cells of the immune system: The role of calcium signalling

    SciTech Connect (OSTI)

    Walleczek, J.

    1991-07-01

    During the past decade considerable evidence has accumulated demonstrating the exposures of cells of the immune system to relatively weak extremely-low-frequency (ELF) electromagnetic fields (< 300 Hz) can elicit cellular changes which might be relevant to in-vivo immune activity. However, knowledge about the underlying biological mechanisms by which weak fields induce cellular changes is still very limited. It is generally believed that the cell membrane and Ca{sup 2+} regulated activity is involved in bioactive ELF field-coupling to living systems. This article begins with a short review of the current state of knowledge concerning the effects of nonthermal levels of ELF electromagnetic fields on the biochemistry and activity of immune cells, and then closely examines new results which suggest a role for Ca{sup 2+} in the induction of these cellular field effects. Based on these findings it is proposed that membrane-mediated Ca{sup 2+} signalling processes are involved in the mediation of field effects on the immune system. 64 refs., 2 tabs.

  1. Signal optimization at isolated intersections using pre-signals 

    E-Print Network [OSTI]

    Palekar, Trishul Ajit

    2006-10-30

    This research proposes a new signal operation strategy aimed at efficient utilization of green time by cutting down on the start up and response loss times. The idea is to have a "pre-signal" on each main approach a few ...

  2. Extracting HI cosmological signal with Generalized Needlet Internal Linear Combination

    E-Print Network [OSTI]

    Olivari, L C; Dickinson, C

    2015-01-01

    HI intensity mapping is a new observational technique to map fluctuations in the large-scale structure of matter using the 21 cm emission line of atomic hydrogen (HI). Sensitive radio surveys have the potential to detect Baryon Acoustic Oscillations (BAO) at low redshifts (z HI signal will be contaminated by instrumental noise and, more significantly, by astrophysical foregrounds, such as Galactic synchrotron emission, which is at least four orders of magnitude brighter than the HI signal. Foreground cleaning is recognised as one of the key challenges for future radio astronomy surveys. We study the ability of the Generalized Needlet Internal Linear Combination (GNILC) method to subtract radio foregrounds and to recover the cosmological HI signal for a general HI intensity mapping experiment. The GNILC method is a new technique that uses both frequency and spatial information to separate the components of the observed data. Our r...

  3. Frequency agile optical parametric oscillator

    DOE Patents [OSTI]

    Velsko, S.P.

    1998-11-24

    The frequency agile OPO device converts a fixed wavelength pump laser beam to arbitrary wavelengths within a specified range with pulse to pulse agility, at a rate limited only by the repetition rate of the pump laser. Uses of this invention include Laser radar, LIDAR, active remote sensing of effluents/pollutants, environmental monitoring, antisensor lasers, and spectroscopy. 14 figs.

  4. Frequency agile optical parametric oscillator

    DOE Patents [OSTI]

    Velsko, Stephan P. (Livermore, CA)

    1998-01-01

    The frequency agile OPO device converts a fixed wavelength pump laser beam to arbitrary wavelengths within a specified range with pulse to pulse agility, at a rate limited only by the repetition rate of the pump laser. Uses of this invention include Laser radar, LIDAR, active remote sensing of effluents/pollutants, environmental monitoring, antisensor lasers, and spectroscopy.

  5. Academic Regulations Academic Regulations and University Policies

    E-Print Network [OSTI]

    Fletcher, Robin

    dignity of all persons" depends on an adherence to academic integrity in all its actions. In support An academic community of integrity upholds personal accountability and depends upon action in the face of the Academic Regulations with references to University Policies: 1 Academic Integrity 2 Enrolment

  6. Phosphoinositide 3-kinase: a critical signalling event in pulmonary cells

    E-Print Network [OSTI]

    2000-06-08

    ISSN 1465-9921; Online ISSN 1465-993X) ARDS = acute respiratory distress syndrome; ASM = airways smooth muscle; ERK = extracellular signal-regulated protein kinase; PDGF = platelet- derived growth factor; PDK1 = phosphoinositide-dependent kinase-1; PI-3... with structural changes within the airway wall. The most prominent feature of the remodelled airway is an increase in airways smooth muscle (ASM). Heard and Hossain [2] demonstrated a threefold increase in both the cross-sectional area and number of smooth...

  7. A Frequency Analysis of Light Transport

    E-Print Network [OSTI]

    Durand, Frédo

    #12;A Frequency Analysis of Light Transport F. Durand, MIT CSAIL N. Holzschuch, C. Soler, ARTIS lighting onlyDirect lighting only #12;Frequency aspects of light transport · Blurriness = frequency content ­ From equations of light transport #12;Unified framework: · Spatial frequency (e.g. shadows, textures

  8. Adaptive Signal Processing Course Information

    E-Print Network [OSTI]

    Tsakalides, Panagiotis

    of the theory to a variety of practical problems such as interference and echo cancellation, signal and system least squares adaptive algorithms 2 Properties of RLS 2 Applications: ADPCM speech encoding Non-Linear. Understanding of the theoretical foundations of adaptive signal processing theory will be achieved through

  9. REGULATION I: Responsibility for Creation and Amendment of Regulations

    E-Print Network [OSTI]

    REGULATION I: Responsibility for Creation and Amendment of Regulations 1. In accordance with Article 14 of the Charter, the Council shall have the power to make, amend or repeal Regulations. 2 of the Regulations and the delegation of such power pursuant to Regulation II (7.2) by the Council to Senate

  10. Autonomous regulation of the anaphase-promoting complex couples

    E-Print Network [OSTI]

    Kirschner, Marc W.

    ........................................................................................................................................................................................................................... Oscillations in cyclin-dependent kinase (CDK) activity drive the somatic cell cycle. After entry into mitosis cycle could be described as a self-perpetuating but highly regulated oscillator composed of alternating CDK and APC activities. The machinery of the somatic cell cycle integrates external signals

  11. Frequency-dependent electrostatic actuation in microfluidic MEMS.

    SciTech Connect (OSTI)

    Zavadil, Kevin Robert; Michalske, Terry A.; Sounart, Thomas L.

    2003-09-01

    Electrostatic actuators exhibit fast response times and are easily integrated into microsystems because they can be fabricated with standard IC micromachining processes and materials. Although electrostatic actuators have been used extensively in 'dry' MEMS, they have received less attention in microfluidic systems probably because of challenges such as electrolysis, anodization, and electrode polarization. Here we demonstrate that ac drive signals can be used to prevent electrode polarization, and thus enable electrostatic actuation in many liquids, at potentials low enough to avoid electrochemistry. We measure the frequency response of an interdigitated silicon comb-drive actuator in liquids spanning a decade of dielectric permittivities and four decades of conductivity, and present a simple theory that predicts the characteristic actuation frequency. The analysis demonstrates the importance of the native oxide on silicon actuator response, and suggests that the actuation frequency can be shifted by controlling the thickness of the oxide. For native silicon devices, actuation is predicted at frequencies less than 10 MHz, in electrolytes of ionic strength up to 100 mmol/L, and thus electrostatic actuation may be feasible in many bioMEMS and other microfluidic applications.

  12. Nonlinear Biochemical Signal Processing via Noise Propagation

    E-Print Network [OSTI]

    Kyung Hyuk Kim; Hong Qian; Herbert M. Sauro

    2013-09-10

    Single-cell studies often show significant phenotypic variability due to the stochastic nature of intra-cellular biochemical reactions. When the numbers of molecules, e.g., transcription factors and regulatory enzymes, are in low abundance, fluctuations in biochemical activities become significant and such "noise" can propagate through regulatory cascades in terms of biochemical reaction networks. Here we develop an intuitive, yet fully quantitative method for analyzing how noise affects cellular phenotypes based on identifying a system's nonlinearities and noise propagations. We observe that such noise can simultaneously enhance sensitivities in one behavioral region while reducing sensitivities in another. Employing this novel phenomenon we designed three biochemical signal processing modules: (a) A gene regulatory network that acts as a concentration detector with both enhanced amplitude and sensitivity. (b) A non-cooperative positive feedback system, with a graded dose-response in the deterministic case, that serves as a bistable switch due to noise-induced bimodality. (c) A noise-induced linear amplifier for gene regulation that requires no feedback. The methods developed in the present work allow one to understand and engineer nonlinear biochemical signal processors based on fluctuation-induced phenotypes.

  13. Regulation of Xylella fastidiosa virulence factors by c-di-GMP phosphodiesterases 

    E-Print Network [OSTI]

    Ancona-Contreras, Veronica

    2012-10-19

    polysaccharides and the formation of a biofilm. These traits are mediated in a cell-density manner by a cell-to-cell signaling system that transduces a diffusible signaling factor (DSF). This dissertation demonstrates that PD1994, PD1617 and RpfG regulate...

  14. High-resolution frequency-domain second-harmonic optical coherence tomography

    E-Print Network [OSTI]

    Chen, Zhongping

    capability for high-resolution optical 3D sec- tioning of samples because signals only arise from the focal structure of the specimen and its orientation relative to the laser beam. In biological materials, collagenHigh-resolution frequency-domain second-harmonic optical coherence tomography Jianping Su, Ivan V

  15. A Comparative Study of Time-Frequency Representations for Fault Detection in Wind Turbine

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A Comparative Study of Time-Frequency Representations for Fault Detection in Wind Turbine El of wind energy, minimization and prediction of maintenance operations in wind turbine is of key importance. In variable speed turbine generator, advanced signal processing tools are required to detect and diagnose

  16. A New Frequency Domain Method for Blind Source Separation of Convolutive Audio

    E-Print Network [OSTI]

    Reilly, James P.

    of Electrical & Computer Engineering McMaster University, 1280 Main St. W, Hamilton, Ontario, Canada L8S 4K11 A New Frequency Domain Method for Blind Source Separation of Convolutive Audio Mixtures Kamran to blind source separation (BSS) of audio signals mixed in a reverberant environment. It is first shown

  17. Detection of interproximal demineralized lesions on human teeth in vitro using frequency-domain infrared

    E-Print Network [OSTI]

    Mandelis, Andreas

    Detection of interproximal demineralized lesions on human teeth in vitro using frequency mechanical holes and demineralized enamel in the interproximal contact area of extracted human teeth. Thirty differences in the signal. Interproximal contact areas are demineral- ized by using a partially saturated

  18. Marine algae and land plants share conserved phytochrome signaling systems

    SciTech Connect (OSTI)

    Duanmu, Deqiang; Bachy, Charles; Sudek, Sebastian; Wong, Chee -Hong; Jimenez, Valeria; Rockwell, Nathan C.; Martin, Shelley S.; Ngan, Chew Yee; Reistetter, Emily N.; van Baren, Marijke J.; Price, Dana C.; Wei, Chia -Lin; Reyes-Prieto, Adrian; Lagarias, J. Clark; Worden, Alexandra Z.

    2014-09-29

    Phytochrome photosensors control a vast gene network in streptophyte plants, acting as master regulators of diverse growth and developmental processes throughout the life cycle. In contrast with their absence in known chlorophyte algal genomes and most sequenced prasinophyte algal genomes, a phytochrome is found in Micromonas pusilla, a widely distributed marine picoprasinophyte (<2 µm cell diameter). Together with phytochromes identified from other prasinophyte lineages, we establish that prasinophyte and streptophyte phytochromes share core light-input and signaling-output domain architectures except for the loss of C-terminal response regulator receiver domains in the streptophyte phytochrome lineage. Phylogenetic reconstructions robustly support the presence of phytochrome in the common progenitor of green algae and land plants. These analyses reveal a monophyletic clade containing streptophyte, prasinophyte, cryptophyte, and glaucophyte phytochromes implying an origin in the eukaryotic ancestor of the Archaeplastida. Transcriptomic measurements reveal diurnal regulation of phytochrome and bilin chromophore biosynthetic genes in Micromonas. The expression of these genes precedes both light-mediated phytochrome redistribution from the cytoplasm to the nucleus and increased expression of photosynthesis-associated genes. Prasinophyte phytochromes perceive wavelengths of light transmitted farther through seawater than the red/far-red light sensed by land plant phytochromes. Prasinophyte phytochromes also retain light-regulated histidine kinase activity lost in the streptophyte phytochrome lineage. Our studies demonstrate that light-mediated nuclear translocation of phytochrome predates the emergence of land plants and likely represents a widespread signaling mechanism in unicellular algae.

  19. Post-translational regulation enables robust p53 regulation

    E-Print Network [OSTI]

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-01-01

    PS, Elowitz MB: Gene regulation at the single-cell level.JC, Song B, Kudo K, Chu E: Regulation of p53 expression inChen L, Li Z, et al: Regulation of MDM2 E3 ligase activity

  20. Development/Plasticity/Repair The ERK2 Mitogen-Activated Protein Kinase Regulates the

    E-Print Network [OSTI]

    Development/Plasticity/Repair The ERK2 Mitogen-Activated Protein Kinase Regulates the Timing Oligodendrocytedevelopmentistightlycontrolledbyavarietyofextracellulargrowthanddifferentiationfactors.Themitogen-activated protein kinases (MAPKs), ERK1 and ERK2, are critical intracellular signaling (ERKs) are ubiquitously expressed, coordinately regulated, and highly similar, but Erk2 deletion in mice

  1. Terminality implies non-signalling

    E-Print Network [OSTI]

    Bob Coecke

    2014-12-30

    A 'process theory' is any theory of systems and processes which admits sequential and parallel composition. `Terminality' unifies normalisation of pure states, trace-preservation of CP-maps, and adding up to identity of positive operators in quantum theory, and generalises this to arbitrary process theories. We show that terminality and non-signalling coincide in any process theory, provided one makes causal structure explicit. In fact, making causal structure explicit is necessary to even make sense of non-signalling in process theories. We conclude that because of its much simpler mathematical form, terminality should be taken to be a more fundamental notion than non-signalling.

  2. Signal Flows in Non-Markovian Linear Quantum Feedback Networks

    E-Print Network [OSTI]

    Re-Bing Wu; Jing Zhang; Yu-xi Liu; Tzyh-Jong Tarn

    2014-12-17

    Enabled by rapidly developing quantum technologies, it is possible to network quantum systems at a much larger scale in the near future. To deal with non-Markovian dynamics that is prevalent in solid-state devices, we propose a general transfer function based framework for modeling linear quantum networks, in which signal flow graphs are applied to characterize the network topology by flow of quantum signals. We define a noncommutative ring $\\mathbb{D}$ and use its elements to construct Hamiltonians, transformations and transfer functions for both active and passive systems. The signal flow graph obtained for direct and indirect coherent quantum feedback systems clearly show the feedback loop via bidirectional signal flows. Importantly, the transfer function from input to output field is derived for non-Markovian quantum systems with colored inputs, from which the Markovian input-output relation can be easily obtained as a limiting case. Moreover, the transfer function possesses a symmetry structure that is analogous to the well-know scattering transformation in \\sd picture. Finally, we show that these transfer functions can be integrated to build complex feedback networks via interconnections, serial products and feedback, which may include either direct or indirect coherent feedback loops, and transfer functions between quantum signal nodes can be calculated by the Riegle's matrix gain rule. The theory paves the way for modeling, analyzing and synthesizing non-Markovian linear quantum feedback networks in the frequency-domain.

  3. Diffusion, dimensionality and noise in transcriptional regulation

    E-Print Network [OSTI]

    Gasper Tkacik; William Bialek

    2007-12-12

    The precision of biochemical signaling is limited by randomness in the diffusive arrival of molecules at their targets. For proteins binding to the specific sites on the DNA and regulating transcription, the ability of the proteins to diffuse in one dimension by sliding along the length of the DNA, in addition to their diffusion in bulk solution, would seem to generate a larger target for DNA binding, consequently reducing the noise in the occupancy of the regulatory site. Here we show that this effect is largely cancelled by the enhanced temporal correlations in one dimensional diffusion. With realistic parameters, sliding along DNA has surprisingly little effect on the physical limits to the precision of transcriptional regulation.

  4. Square Kilometer Array Telescope - Precision Reference Frequency Synchronisation via 1f-2f Dissemination

    E-Print Network [OSTI]

    Wang, B; Gao, C; Bai, Y; Dong, J W; Wang, L J

    2015-01-01

    The Square Kilometer Array (SKA) is an international effort to build the world's largest radio telescope, with one square kilometer collecting area. Besides its ambitious scientific objectives, such as probing the cosmic dawn and cradle of life, SKA also demands several revolutionary technological breakthroughs, with ultra-high precision synchronisation of the frequency references for thousands of antennas being one of them. In this report, aimed at applications to SKA, we demonstrate a frequency reference synchronization and dissemination scheme with the phase noise compensation function placed at the client site. Hence, one central hub can be linked to a large number of client sites, forming a star-shaped topology. As a performance test, the 100 MHz reference signal from a Hydrogen maser clock is disseminated and recovered at two remote sites. Phase noise characteristics of the recovered reference frequency signal coincides with that of the hydrogen-maser source and satisfies SKA requirement.

  5. An in situ measurement of the radio-frequency attenuation in ice at Summit Station, Greenland

    E-Print Network [OSTI]

    J. Avva; J. M. Kovac; C. Miki; D. Saltzberg; A. G. Vieregg

    2014-09-30

    We report an in situ measurement of the electric field attenuation length at radio frequencies for the bulk ice at Summit Station, Greenland, made by broadcasting radio-frequency signals vertically through the ice and measuring the relative power in the return ground bounce signal. We find the depth-averaged field attenuation length to be 947 +92/-85 meters at 75 MHz. While this measurement has clear radioglaciological applications, the radio clarity of the ice also has implications for the detection of ultra-high energy (UHE) astrophysical particles via their radio emission in dielectric media such as ice. The measured attenuation length at Summit Station is comparable to previously measured radio-frequency attenuation lengths at candidate particle detector sites around the world, and strengthens the case for Summit Station as the most promising northern site for UHE neutrino detection.

  6. Design and initial characterization of a compact, ultra high vacuum compatible, low frequency, tilt accelerometer

    SciTech Connect (OSTI)

    O’Toole, A. E-mail: riccardo.desalvo@gmail.com; Peña Arellano, F. E.; Rodionov, A. V.; Kim, C.; Shaner, M.; Asadoor, M.; Sobacchi, E.; Dergachev, V.; DeSalvo, R. E-mail: riccardo.desalvo@gmail.com; Bhawal, A.; Gong, P.; Lottarini, A.; Minenkov, Y.; Murphy, C.

    2014-07-15

    A compact tilt accelerometer with high sensitivity at low frequency was designed to provide low frequency corrections for the feedback signal of the Advanced Laser Interferometer Gravitational Wave Observatory active seismic attenuation system. It has been developed using a Tungsten Carbide ceramic knife-edge hinge designed to avoid the mechanical 1/f noise believed to be intrinsic in polycrystalline metallic flexures. Design and construction details are presented; prototype data acquisition and control limitations are discussed. The instrument's characterization reported here shows that the hinge is compatible with being metal-hysteresis-free, and therefore also free of the 1/f noise generated by the dislocation Self-Organized Criticality in the metal. A tiltmeter of this kind will be effective to separate the ground tilt component from the signal of horizontal low frequency seismometers, and to correct the ill effects of microseismic tilt in advanced seismic attenuation systems.

  7. The advanced system for the electromagnetic response of high-frequency gravitational waves

    E-Print Network [OSTI]

    Jin Li; Lu Zhang; Kai Lin; Hao Wen

    2014-11-20

    Based on the electromagnetic (EM) response system of high frequency gravitational waves (HFGWs) in GHz band, we mainly discuss the EM response to the relic HFGWs, which are predicted by quintessential and ordinary inflationary models, and the braneworld HFGWs from braneworld scenarios. Both of them would generate detectable transverse perturbative photon fluxes (PPFs) thought to be the signal. Through resetting the magnetic component of Gaussian Beam to be in the standard gaussian form, the signal strength would be enhanced theoretically. Under the typical conditions, the analysis of background noise (background photon fluxes) and shot noise provides the possible transverse detection width for these HFGWs, meanwhile the standard quantum limit estimation proves our detection is possible. Finally according to the principle of maximum signal to noise ratio, we find some optimal system parameters and the relationship between effective width for energy fluxes accumulation and frequency.

  8. Army Regulation 690600 Civilian Personnel

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Army Regulation 690­600 Civilian Personnel Equal Employment Opportunity Discrimination Complaints Civilian Personnel Equal Employment Opportunity Discrimination Complaints *Army Regulation 690­600 Effective 9 March 2004 History. This publication is a major revision. Summary. This regulation establishes

  9. Multi-frequency imaging in VLBI

    E-Print Network [OSTI]

    S. Likhachev

    2004-12-17

    The new technique, multi-frequency imaging (MFI) is developed. In VLBI, Multi-Frequency Imaging (MFI) consists of multi-frequency synthesis (MFS) and multi-frequency analysis (MFA) of the VLBI data obtained from observations on various frequencies. A set of linear deconvolution MFI algorithms is described. The algorithms make it possible to obtain high quality images interpolated on any given frequency inside any given bandwidth, and to derive reliable estimates of spectral indexes for radio sources with continuum spectrum. Thus MFI approach makes it is possible not only to improve the quality and fidelity of the images and also essentially to derive the morphology of the observed radio sources.

  10. ECE 468 Digital Signal Processing 1. History

    E-Print Network [OSTI]

    Chen, Ying "Ada"

    , digital image processing, signal processing for communications, biomedical signal processing, seismic dataECE 468 Digital Signal Processing 1. History: · Digital signal processing has its roots in 17th and Gauss and as new as digital computers and integrated circuits 2. Definition: · Digital signal processing

  11. Signal focusing through active transport

    E-Print Network [OSTI]

    Aljaz Godec; Ralf Metzler

    2015-01-13

    In biological cells and novel diagnostic devices biochemical receptors need to be sensitive to extremely small concentration changes of signaling molecules. The accuracy of such molecular signaling is ultimately limited by the counting noise imposed by the thermal diffusion of molecules. Many macromolecules and organelles transiently bind to molecular motors and are then actively transported. We here show that a random albeit directed delivery of signaling molecules to within a typical diffusion distance to the receptor reduces the correlation time of the counting noise, effecting an improved sensing precision. The conditions for this active focusing are indeed compatible with observations in living cells. Our results are relevant for a better understanding of molecular cellular signaling and the design of novel diagnostic devices.

  12. Robust Congestion Signaling , Neil Spring

    E-Print Network [OSTI]

    Spring, Neil

    ], with active queue management in the form of RED gateways [10], has been proposed as a standard mechanism IPSEC tun- nels because congestion signals may be inadvertently lost at the tunnel endpoint when one

  13. Radiolocation using AM broadcast signals

    E-Print Network [OSTI]

    Hall, Timothy Douglas, 1970-

    2002-01-01

    (cont.) Previous attempts at signal-of-opportunity navigation using carrier phase sidestepped the ambiguity problem by requiring that the initial position of the rover be known and that phase variations be tracked without ...

  14. Automated classification of power signals

    E-Print Network [OSTI]

    Proper, Ethan R. (Ethan Richard)

    2008-01-01

    The Non-Intrusive Load Monitor (NILM) is a device that utilizes voltage and current measurements to monitor an entire system from a single reference point. The NILM and associated software convert the V/I signal to spectral ...

  15. Receptor for advanced glycation end products inhibits proliferation in osteoblast through suppression of Wnt, PI3K and ERK signaling

    SciTech Connect (OSTI)

    Li, Guofeng [Department of Emergency Surgery, East Hospital, Tongji University School of Medicine, Shanghai 200120 (China)] [Department of Emergency Surgery, East Hospital, Tongji University School of Medicine, Shanghai 200120 (China); Xu, Jingren [Department of Traditional Chinese Orthopaedics, East Hospital, Tongji University School of Medicine, Shanghai 200120 (China)] [Department of Traditional Chinese Orthopaedics, East Hospital, Tongji University School of Medicine, Shanghai 200120 (China); Li, Zengchun, E-mail: lizc.2007@yahoo.com.cn [Department of Emergency Surgery, East Hospital, Tongji University School of Medicine, Shanghai 200120 (China)] [Department of Emergency Surgery, East Hospital, Tongji University School of Medicine, Shanghai 200120 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer RAGE overexpression suppresses cell proliferation in MC3T3-E1 cells. Black-Right-Pointing-Pointer RAGE overexpression decreases Wnt/{beta}-catenin signaling. Black-Right-Pointing-Pointer RAGE overexpression decreases ERK and PI3K signaling. Black-Right-Pointing-Pointer Inhibition of Wnt signaling abolishes PI3K signaling restored by RAGE blockade. Black-Right-Pointing-Pointer Inhibition of Wnt signaling abolishes ERK signaling restored by RAGE blockade. -- Abstract: Expression of receptor for advanced glycation end products (RAGE) plays a crucial role in bone metabolism. However, the role of RAGE in the control of osteoblast proliferation is not yet evaluated. In the present study, we demonstrate that RAGE overexpression inhibits osteoblast proliferation in vitro. The negative regulation of RAGE on cell proliferation results from suppression of Wnt, PI3K and ERK signaling, and is restored by RAGE neutralizing antibody. Prevention of Wnt signaling using Sfrp1 or DKK1 rescues RAGE-decreased PI3K and ERK signaling and cell proliferation, indicating that the altered cell growth in RAGE overexpressing cells is in part secondary to alterations in Wnt signaling. Consistently, RAGE overexpression inhibits the expression of Wnt targets cyclin D1 and c-myc, which is partially reversed by RAGE blockade. Overall, these results suggest that RAGE inhibits osteoblast proliferation via suppression of Wnt, PI3K and ERK signaling, which provides novel mechanisms by which RAGE regulates osteoblast growth.

  16. Coordination of Voltage and Frequency Feedback in Load-Frequency Control Capability of Wind Turbine

    E-Print Network [OSTI]

    Silva, Filipe Faria Da

    Coordination of Voltage and Frequency Feedback in Load-Frequency Control Capability of Wind Turbine-Frequency Control (LFC) is gradually shifted to Variable Speed Wind Turbines (VSWTs). In order to equip VSWT

  17. Unique Auxin Regulation Mechanism Discovered

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Unique Auxin Regulation Mechanism Discovered Print The plant hormone auxin regulates many plant growth and development processes, including shoot growth, root branching, fruit...

  18. A Double-Balanced Injection-Locked Frequency Divider for Tunable Dual-Phase Signal Generation

    E-Print Network [OSTI]

    Wu, Hui

    with a single- balanced mixer and an LC tank filter (Fig. 1-b,c) . At large oscillation amplitude, assuming-in mixer and filter [5], [11], [12]. For example, a M1 M2 2@iv ddV @ov Mtail + - (a) )(Z M1 M2 tII injbias 2cos+ + -ov 1i 2i 21 iii -= (b) tII injbias 2cos+ )cos( += tVv oo )(Z- Nonlinearity LC tank ov i i

  19. Distortion of low-frequency acoustic signals by interaction with the moving ocean surface

    E-Print Network [OSTI]

    Lynch, Stephen Dennis

    2008-01-01

    foundation of acoustic wave equation solution techniques,transformed acoustic wave equation with delta function-range-independent acoustic wave equation with point-source

  20. Time-varying frequency analysis of bat echolocation signals using Monte Carlo methods 

    E-Print Network [OSTI]

    Nagappa, Sharad

    2010-01-01

    Echolocation in bats is a subject that has received much attention over the last few decades. Bat echolocation calls have evolved over millions of years and can be regarded as well suited to the task of active target-detection. ...

  1. A quasi periodic signal with ultra low frequency discovered in V0332+53?

    E-Print Network [OSTI]

    Shu Zhang; Diego F. Torres; JinLu Qu

    2006-08-18

    The reported likely QPO is found to be an instrumental effect, which was never clarified in any INTEGRAL related literatures. The paper should therfore be withdrawn.

  2. TIME-FREQUENCY-MODULATION REPRESENTATION OF STOCHASTIC SIGNALS Philip J.B. Jackson

    E-Print Network [OSTI]

    Jackson, Philip JB

    - sive underwater sonar, turbine condition monitoring, or road noise in a car. The author's interest

  3. High-frequency signal transmission through single-atom contacts of Au and

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journal Article)lasers (Journal Article)SciTechHigh-contrast imaging| SciTech|

  4. Federal Acquisition Regulation; Federal Acquisition Circular...

    Energy Savers [EERE]

    Federal Acquisition Regulation; Federal Acquisition Circular Federal Acquisition Regulation; Federal Acquisition Circular Federal Acquisition Regulation; Federal Acquisition...

  5. North America: Regulation of International Electricity Trade...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    North America: Regulation of International Electricity Trade North America: Regulation of International Electricity Trade North America: Regulation of International Electricity...

  6. Federal Acquisition Regulation; Federal Acquisition Circular...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Regulation; Federal Acquisition Circular Federal Acquisition Regulation; Federal Acquisition Circular Federal Acquisition Regulation; Federal Acquisition Circular More Documents &...

  7. Frequency selective surfaces for Terahertz applications 

    E-Print Network [OSTI]

    Sanz Fernandez, Juan Jose; Fernandez, Juan Jose Sanz

    2012-11-29

    This thesis presents both theoretical and experimental investigations of the performance and capabilities of frequency selective surfaces (FSS) applied at THz frequencies. The aim is to explore and extend the use of FSS, ...

  8. REGULAR ARTICLE Warming and increased precipitation frequency

    E-Print Network [OSTI]

    Neher, Deborah A.

    REGULAR ARTICLE Warming and increased precipitation frequency on the Colorado Plateau: implications in temperature and precipitation are expected to influence ecosystem processes worldwide. Despite their globally how increased temperature and frequency of summertime precipitation affect the contributions of crust

  9. Regulation 2: Student Discipline REGULATION 2: STUDENT DISCIPLINE

    E-Print Network [OSTI]

    Sussex, University of

    Regulation 2: Student Discipline 6 REGULATION 2: STUDENT DISCIPLINE 1. Definitions In this Regulation: The University means the University of Sussex. Council means Council of the University. Senate to the regulations of the affiliated institution, and excluding students in attendance at the Brighton and Sussex

  10. Dependence of the colored frequency noise in spin torque oscillators on current and magnetic field

    SciTech Connect (OSTI)

    Eklund, Anders Sani, Sohrab R.; Chung, Sunjae; Amir Hossein Banuazizi, S.; Östling, Mikael; Gunnar Malm, B.; Bonetti, Stefano; Majid Mohseni, S.; Persson, Johan; Iacocca, Ezio; Åkerman, Johan

    2014-03-03

    The nano-scale spin torque oscillator (STO) is a compelling device for on-chip, highly tunable microwave frequency signal generation. Currently, one of the most important challenges for the STO is to increase its longer-time frequency stability by decreasing the 1/f frequency noise, but its high level makes even its measurement impossible using the phase noise mode of spectrum analyzers. Here, we present a custom made time-domain measurement system with 150?MHz measurement bandwidth making possible the investigation of the variation of the 1/f as well as the white frequency noise in a STO over a large set of operating points covering 18–25?GHz. The 1/f level is found to be highly dependent on the oscillation amplitude-frequency non-linearity and the vicinity of unexcited oscillation modes. These findings elucidate the need for a quantitative theoretical treatment of the low-frequency, colored frequency noise in STOs. Based on the results, we suggest that the 1/f frequency noise possibly can be decreased by improving the microstructural quality of the metallic thin films.

  11. Low frequency AC waveform generator

    DOE Patents [OSTI]

    Bilharz, Oscar W. (Scotia, NY)

    1986-01-01

    Low frequency sine, cosine, triangle and square waves are synthesized in circuitry which allows variation in the waveform amplitude and frequency while exhibiting good stability and without requiring significant stabilization time. A triangle waveform is formed by a ramped integration process controlled by a saturation amplifier circuit which produces the necessary hysteresis for the triangle waveform. The output of the saturation circuit is tapped to produce the square waveform. The sine waveform is synthesized by taking the absolute value of the triangular waveform, raising this absolute value to a predetermined power, multiplying the raised absolute value of the triangle wave with the triangle wave itself and properly scaling the resultant waveform and subtracting it from the triangular waveform itself. The cosine is synthesized by squaring the triangular waveform, raising the triangular waveform to a predetermined power and adding the squared waveform raised to the predetermined power with a DC reference and subtracting the squared waveform therefrom, with all waveforms properly scaled. The resultant waveform is then multiplied with a square wave in order to correct the polarity and produce the resultant cosine waveform.

  12. Cost and Capacity of Signaling in the Escherichia coli Protein Reaction Network

    E-Print Network [OSTI]

    Jacob Bock Axelsen; Sandeep Krishna; Kim Sneppen

    2007-11-03

    In systems biology new ways are required to analyze the large amount of existing data on regulation of cellular processes. Recent work can be roughly classified into either dynamical models of well-described subsystems, or coarse-grained descriptions of the topology of the molecular networks at the scale of the whole organism. In order to bridge these two disparate approaches one needs to develop simplified descriptions of dynamics and topological measures which address the propagation of signals in molecular networks. Here, we consider the directed network of protein regulation in E. coli, characterizing its modularity in terms of its potential to transmit signals. We demonstrate that the simplest measure based on identifying sub-networks of strong components, within which each node could send a signal to every other node, indeed partitions the network into functional modules. We then suggest measures to quantify the cost and spread associated with sending a signal between any particular pair of proteins. Thereby, we address the signalling specificity within and between modules, and show that in the regulation of E.coli there is a systematic reduction of the cost and spread for signals traveling over more than two intermediate reactions.

  13. METHODS OF RADIO-FREQUENCY CURRENT DRIVE

    E-Print Network [OSTI]

    -670 Radio-frequency waves can penetrate thermonuclear plasmas, depositing momentum and energy with great. INTRODUCTION Using radio-frequency (rf) waves to drive the toroidal current in tokamak reactors is attractiveMETHODS OF RADIO-FREQUENCY CURRENT DRIVE N. J. FISCH* Princeton Plasma Physics Laboratory

  14. Introduction Final Cooling Channel -High Frequency RF

    E-Print Network [OSTI]

    McDonald, Kirk

    Outline Introduction Final Cooling Channel - High Frequency RF Muon Collider Final Cooling Hisham Sayed February 27, 2014 1 / 10 #12;Outline Introduction Final Cooling Channel - High Frequency RF Table of Contents 1 Introduction 2 Final Cooling Channel - High Frequency RF 2 / 10 #12;Outline Introduction Final

  15. 300 Area signal cable study

    SciTech Connect (OSTI)

    Whattam, J.W.

    1994-09-15

    This report was prepared to discuss the alternatives available for removing the 300 Area overhead signal cable system. This system, installed in 1969, has been used for various monitoring and communication signaling needs throughout the 300 Area. Over the years this cabling system has deteriorated, has been continually reconfigured, and has been poorly documented to the point of nonreliability. The first step was to look at the systems utilizing the overhead signal cable that are still required for operation. Of the ten systems that once operated via the signal cable, only five are still required; the civil defense evacuation alarms, the public address (PA) system, the criticality alarms, the Pacific Northwest Laboratory Facilities Management Control System (FMCS), and the 384 annunciator panel. Of these five, the criticality alarms and the FMCS have been dealt with under other proposals. Therefore, this study focused on the alternatives available for the remaining three systems (evacuation alarms, PA system, and 384 panel) plus the accountability aid phones. Once the systems to be discussed were determined, then three alternatives for providing the signaling pathway were examined for each system: (1) re-wire using underground communication ducts, (2) use the Integrated Voice/Data Telecommunications System (IVDTS) already installed and operated by US West, and (3) use radio control. Each alternative was developed with an estimated cost, advantages, and disadvantages. Finally, a recommendation was provided for the best alternative for each system.

  16. Multiple frequency method for operating electrochemical sensors

    DOE Patents [OSTI]

    Martin, Louis P. (San Ramon, CA)

    2012-05-15

    A multiple frequency method for the operation of a sensor to measure a parameter of interest using calibration information including the steps of exciting the sensor at a first frequency providing a first sensor response, exciting the sensor at a second frequency providing a second sensor response, using the second sensor response at the second frequency and the calibration information to produce a calculated concentration of the interfering parameters, using the first sensor response at the first frequency, the calculated concentration of the interfering parameters, and the calibration information to measure the parameter of interest.

  17. Wide tracking range, auto ranging, low jitter phase lock loop for swept and fixed frequency systems

    DOE Patents [OSTI]

    Kerner, Thomas M. (Manorville, NY)

    2001-01-01

    The present invention provides a wide tracking range phase locked loop (PLL) circuit that achieves minimal jitter in a recovered clock signal, regardless of the source of the jitter (i.e. whether it is in the source or the transmission media). The present invention PLL has automatic harmonic lockout detection circuitry via a novel lock and seek control logic in electrical communication with a programmable frequency discriminator and a code balance detector. (The frequency discriminator enables preset of a frequency window of upper and lower frequency limits to derive a programmable range within which signal acquisition is effected. The discriminator works in combination with the code balance detector circuit to minimize the sensitivity of the PLL circuit to random data in the data stream). In addition, the combination of a differential loop integrator with the lock and seek control logic obviates a code preamble and guarantees signal acquisition without harmonic lockup. An adaptive cable equalizer is desirably used in combination with the present invention PLL to recover encoded transmissions containing a clock and/or data. The equalizer automatically adapts to equalize short haul cable lengths of coaxial and twisted pair cables or wires and provides superior jitter performance itself. The combination of the equalizer with the present invention PLL is desirable in that such combination permits the use of short haul wires without significant jitter.

  18. Multi-carrier Signal Transmission through HVAC Ducts: Experimental Results for Channel Capacity

    E-Print Network [OSTI]

    Stancil, Daniel D.

    Multi-carrier Signal Transmission through HVAC Ducts: Experimental Results for Channel Capacity) ducts based on multi-carrier transmission technique and mea- sured channel frequency responses in the 2 through a building HVAC duct system demonstrate the ability to transmit with a spectral efficiency of 3

  19. CMOS-MEMS Resonator as a Signal Generator for Fully-Adiabatic Logic Circuits

    E-Print Network [OSTI]

    Frank, Michael P.

    logic design. To maximize the system power-performance of an adiabatic circuit requires an ultra low the whole system's power dissipation and cost at a given frequency. A resonator design with a 100 k of the driving signals should also dissipate little power, i.e., a very high Q (quality factor) resonator

  20. PHYSICAL REVIEW A 91, 052501 (2015) Evaluation of optical probe signals from nonequilibrium systems

    E-Print Network [OSTI]

    Mukamel, Shaul

    2015-01-01

    by impulsive optical excitations. The linear response depends on the phase of the electric field even by the transmission of a weak probe shows many interesting effects, including electromagnetically induced transparency on two independent frequencies. The linear signal now depends on the phase of the electric field, even

  1. Space-frequency correlation of classical waves in disordered media: High-frequency and

    E-Print Network [OSTI]

    Fannjiang, Albert

    OFFPRINT Space-frequency correlation of classical waves in disordered media: High-frequency in disordered media: High-frequency and small-scale asymptotics A. C. Fannjiang Department of Mathematics-band high- frequency fields can be appreciably affected by small random changes of the medium parameters

  2. Large Volatility Matrix Inference via Combining Low-Frequency and High-Frequency Approaches

    E-Print Network [OSTI]

    Wang, Yazhen

    Large Volatility Matrix Inference via Combining Low-Frequency and High-Frequency Approaches Minjing adequate estimates and forecasts. Furthermore, since high-frequency financial data for different assets applicable. To overcome those difficulties we explore a novel approach that combines high-frequency

  3. Large-Scale Discovery of ERK2 Substrates Identifies ERK-Mediated Transcriptional Regulation by ETV3

    E-Print Network [OSTI]

    Carlson, Scott M.

    The mitogen-activated protein kinase (MAPK) extracellular signal–regulated kinase 2 (ERK2) is ubiquitously expressed in mammalian tissues and is involved in a wide range of biological processes. Although MAPKs have been ...

  4. Plasma relativistic microwave amplifier with smooth frequency tuning from 2.4 to 3.2 GHz

    SciTech Connect (OSTI)

    Strelkov, P. S.; Ivanov, I. E.; Shumeiko, D. V. [Russian Academy of Sciences, Prokhorov General Physics Institute (Russian Federation)

    2012-06-15

    Earlier, it was shown that the plasma relativistic microwave amplifier can operate at two frequencies, 2 and 3.2 GHz. In the present work, it is shown that, by varying the plasma density from one microwave pulse to another, it is possible to amplify the input signals to a power of 50-80 MW at any frequency in the range 2.4-3.2 GHz.

  5. Signal Processing System for the CASA Integrated Project I Radars

    SciTech Connect (OSTI)

    Bharadwaj, Nitin; Chandrasekar, V.; Junyent, Francesc

    2010-09-01

    This paper describes the waveform design space and signal processing system for dual-polarization Doppler weather radar operating at X band. The performance of the waveforms is presented with ground clutter suppression capability and mitigation of range velocity ambiguity. The operational waveform is designed based on operational requirements and system/hardware requirements. A dual Pulse Repetition Frequency (PRF) waveform was developed and implemented for the first generation X-band radars deployed by the Center for Collaborative Adaptive Sensing of the Atmosphere (CASA). This paper presents an evaluation of the performance of the waveforms based on simulations and data collected by the first-generation CASA radars during operations.

  6. Design of Optimal Regulators

    E-Print Network [OSTI]

    Alexander Bolonkin; Robert Sierakowski

    2007-01-19

    Current research suggests the use of a liner quadratic performance index for optimal control of regulators in various applications. Some examples include correcting the trajectory of rocket and air vehicles, vibration suppression of flexible structures, and airplane stability. In all these cases, the focus is in suppressing/decreasing system deviations rapidly. However, if one compares the Linear Quadratic Regulator (LQR) solution with optimal solutions (minimum time), it is seen that the LQR solution is less than optimal in some cases indeed (3-6) times that obtained using a minimum time solution. Moreover, the LQR solution is sometimes unacceptable in practice due to the fact that values of control extend beyond admissible limits and thus the designer must choose coefficients in the linear quadratic form, which are unknown. The authors suggest methods which allow finding a quasi-optimal LQR solution with bounded control which is closed to the minimum time solution. They also remand the process of the minimum time decision. Keywords: Optimal regulator, minimum time controller, Linear Quadratic Regulator (LQR). -- This paper is declared a work of the U.S. Government and not subject to copyright protection in the USA. The manuscript is accepted as paper AIAA-2003-6638 by 2nd AIAA Unmanned Unlimited Systems, Technologies, and Operations-Aerospace, Land, and See Conference and Workshop - Exhibit, San Diego, California, USA, 15-18 Sep. 2003.

  7. Statistical Signal Processing Debasis Kundu 1

    E-Print Network [OSTI]

    Kundu, Debasis

    Statistical Signal Processing Debasis Kundu 1 Signal processing may broadly be considered, statistical techniques play an important role in signal processing. Statistics is used in the formulation for estimation of model parameters, and the assessment of model performances. Statistical Signal Processing

  8. Adaptive Fuzzy Systems for Multichannel Signal Processing

    E-Print Network [OSTI]

    Plataniotis, Konstantinos N.

    Adaptive Fuzzy Systems for Multichannel Signal Processing KONSTANTINOS N. PLATANIOTIS, MEMBER, IEEE Processing multichannel signals using digital signal process- ing techniques has received increased attention beginning in this area and 2) to provide a review for the reader who may be well versed in signal processing

  9. Computational Aspects in Statistical Signal Processing

    E-Print Network [OSTI]

    Kundu, Debasis

    14 Computational Aspects in Statistical Signal Processing D. Kundu 14.1 Introduction Signal such as communi- cations, radio location of objects, seismic signal processing and computer assisted medical diagnosis. Statistical signal processing is also used in many physical science applications

  10. Dynamic models for nonstationary signal segmentation

    E-Print Network [OSTI]

    Penny, Will

    Dynamic models for nonstationary signal segmentation William D. Penny and Stephen J. Roberts w.penny

  11. Digital-photonic synthesis of ultra-low noise tunable signals from RF to 100 GHz

    E-Print Network [OSTI]

    Fortier, T M; Quinlan, F; Baynes, F N; Metcalf, A J; Hati, A; Ludlow, A; Hinkley, N; Shimizu, M; Ishibashi, T; Campbell, J C; Diddams, S A

    2015-01-01

    The demand for higher data rates and better synchronization in communication and navigation systems necessitates the development of new wideband and tunable sources with noise performance exceeding that provided by traditional oscillators and synthesizers. Precision synthesis is paramount for providing frequency references and timing in a broad range of applications including next-generation telecommunications, high precision measurement, and radar and sensing. Here we describe a digital-photonic synthesizer (DPS) based on optical frequency division that enables the generation of widely tunable signals from near DC to 100 GHz with a fractional frequency instability of 1 part in 10^15. The spectral purity of the DPS derived signals represents an improvement in close-to-carrier noise performance over the current state-of-the-art of nearly 7 orders of magnitude in the W-band (100 GHz), and up to 5 orders of magnitude in the X-band (10 GHz).

  12. Optically isolated signal coupler with linear response

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1994-01-01

    An optocoupler for isolating electrical signals that translates an electrical input signal linearly to an electrical output signal. The optocoupler comprises a light emitter, a light receiver, and a light transmitting medium. The light emitter, preferably a blue, silicon carbide LED, is of the type that provides linear, electro-optical conversion of electrical signals within a narrow wavelength range. Correspondingly, the light receiver, which converts light signals to electrical signals and is preferably a cadmium sulfide photoconductor, is linearly responsive to light signals within substantially the same wavelength range as the blue LED.

  13. Journal club Multivariate Signal integration

    E-Print Network [OSTI]

    Journal club Multivariate Signal integration A fundamental aspect of biological systems is that they are multivariate: cells receive, integrate and respond to hundreds or thousands of concurrent environmental cues in the context of the cell's multivariate network state. Because this depends on cues in the environment

  14. Signals & Systems Prof. Mark Fowler

    E-Print Network [OSTI]

    Fowler, Mark

    = 2f0 ) AM Radio: around 1 MHz FM Radio: around 100 MHz Cell Phones: around 900 MHz, around 1.8 GHz Transmitter (Tx) Modulator )(X FT of Message Signal Choose f0 > 10 kHz to enable efficient radiation (with 0

  15. Retinoid receptor signaling and autophagy in acute promyelocytic leukemia

    SciTech Connect (OSTI)

    Orfali, Nina; McKenna, Sharon L.; Cahill, Mary R.; Gudas, Lorraine J.; Mongan, Nigel P.

    2014-05-15

    Retinoids are a family of signaling molecules derived from vitamin A with well established roles in cellular differentiation. Physiologically active retinoids mediate transcriptional effects on cells through interactions with retinoic acid (RARs) and retinoid-X (RXR) receptors. Chromosomal translocations involving the RAR? gene, which lead to impaired retinoid signaling, are implicated in acute promyelocytic leukemia (APL). All-trans-retinoic acid (ATRA), alone and in combination with arsenic trioxide (ATO), restores differentiation in APL cells and promotes degradation of the abnormal oncogenic fusion protein through several proteolytic mechanisms. RAR? fusion-protein elimination is emerging as critical to obtaining sustained remission and long-term cure in APL. Autophagy is a degradative cellular pathway involved in protein turnover. Both ATRA and ATO also induce autophagy in APL cells. Enhancing autophagy may therefore be of therapeutic benefit in resistant APL and could broaden the application of differentiation therapy to other cancers. Here we discuss retinoid signaling in hematopoiesis, leukemogenesis, and APL treatment. We highlight autophagy as a potential important regulator in anti-leukemic strategies. - Highlights: • Normal and aberrant retinoid signaling in hematopoiesis and leukemia is reviewed. • We suggest a novel role for RAR? in the development of X-RAR? gene fusions in APL. • ATRA therapy in APL activates transcription and promotes onco-protein degradation. • Autophagy may be involved in both onco-protein degradation and differentiation. • Pharmacologic autophagy induction may potentiate ATRA's therapeutic effects.

  16. Low temperature laser scanning microscopy of a superconducting radio-frequency cavity

    SciTech Connect (OSTI)

    Ciovati, Gianluigi; Baldwin, Charles; Cheng, Guangfeng; Flood, Roger; Jordan, Kevin; Kneisel, Peter; Morrone, Michael; Nemes, George; Turlington, Larry; Wang, Haipeng; Wilson, Katherine

    2012-03-16

    An apparatus was developed to obtain, for the first time, 2D maps of the surface resistance of the inner surface of an operating superconducting radio-frequency niobium cavity by a low-temperature laser scanning microscopy technique. This allows identifying non-uniformities of the surface resistance with a spatial resolution of about one order of magnitude better than with earlier methods. A signal-to-noise ratio of about 10 dB was obtained with 240 mW laser power and 1 Hz modulation frequency. The various components of the apparatus, the experimental procedure and results are discussed in details in this contribution.

  17. Energy-time and frequency-time uncertainty relations: exact inequalities

    E-Print Network [OSTI]

    V. V. Dodonov; A. V. Dodonov

    2015-04-03

    We give a short review of known exact inequalities that can be interpreted as "energy-time" and "frequency-time" uncertainty relations. In particular we discuss a precise form of signals minimizing the physical frequency-time uncertainty product. Also, we calculate the "stationarity time" for mixed Gaussian states of a quantum harmonic oscillator, showing explicitly that pure quantum states are "more fragile" than mixed ones with the same value of the energy dispersion. The problems of quantum evolution speed limits, time operators and measurements of energy and time are briefly discussed, too.

  18. Low temperature laser scanning microscopy of a superconducting radio-frequency cavity

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ciovati, G.; Anlage, Steven M.; Baldwin, C.; Cheng, G.; Flood, R.; Jordan, K.; Kneisel, P.; Morrone, M.; Nemes, G.; Turlington, L.; et al

    2012-03-16

    An apparatus was created to obtain, for the first time, 2D maps of the surface resistance of the inner surface of an operating superconducting radio-frequency niobium cavity by a low-temperature laser scanning microscopy technique. This allows identifying non-uniformities of the surface resistance with a spatial resolution of about one order of magnitude better than with earlier methods. A signal-to-noise ratio of about 10 dB was obtained with 240 mW laser power and 1 Hz modulation frequency. The various components of the apparatus, the experimental procedure and results are discussed in details in this contribution.

  19. Spectral characterization of a frequency comb based on cascaded quadratic nonlinearities inside an optical parametric oscillator

    E-Print Network [OSTI]

    Ulvila, Ville; Halonen, Lauri; Vainio, Markku

    2015-01-01

    We present an experimental study of optical frequency comb generation based on cascaded quadratic nonlinearities inside a continuous-wave-pumped optical parametric oscillator. We demonstrate comb states which produce narrow-linewidth intermode beat note signals, and we verify the mode spacing uniformity of the comb at the Hz level. We also show that spectral quality of the comb can be improved by modulating the parametric gain at a frequency that corresponds to the comb mode spacing. We have reached a high average output power of over 4 W in the near-infrared region, at ~2 {\\mu}m.

  20. Zero field high frequency oscillations in dual free layer spin torque oscillators

    SciTech Connect (OSTI)

    Braganca, P. M., E-mail: patrick.braganca@hgst.com; Pi, K.; Zakai, R.; Childress, J. R.; Gurney, B. A. [HGST, 3404 Yerba Buena Rd., San Jose, California 95135 (United States)] [HGST, 3404 Yerba Buena Rd., San Jose, California 95135 (United States)

    2013-12-02

    We observe microwave oscillations in relatively simple spin valve spin torque oscillators consisting of two in-plane free layers without spin polarizing layers. These devices exhibit two distinct modes which can reach frequencies >25?GHz in the absence of an applied magnetic field. Macrospin simulations identify these two modes as optical and acoustic modes excited by the coupling of the two layers through dipole field and spin torque effects. These results demonstrate the potential of this system as a large output power, ultrahigh frequency signal generator that can operate without magnetic field.

  1. Integrally formed radio frequency quadrupole

    SciTech Connect (OSTI)

    Abbott, Steven R.

    1989-01-01

    An improved radio frequency quadrupole (10) is provided having an elongate housing (11) with an elongate central axis (12) and top, bottom and two side walls (13a-d) symmetrically disposed about the axis, and vanes (14a-d) formed integrally with the walls (13a-d), the vanes (14a-d) each having a cross-section at right angles to the central axis (12) which tapers inwardly toward the axis to form electrode tips (15a-d) spaced from each other by predetermined distances. Each of the four walls (13a-d), and the vanes (14a-d) integral therewith, is a separate structural element having a central lengthwise plane (16) passing through the tip of the vane, the walls (13a-d) having flat mounting surfaces (17, 18) at right angles to and parallel to the control plane (16), respectively, which are butted together to position the walls and vane tips relative to each other.

  2. Molecular controls of the plant cell cycle must integrate environmental signals within developmental contexts. Recent

    E-Print Network [OSTI]

    Murray, J.A.H.

    440 Molecular controls of the plant cell cycle must integrate environmental signals within mechanisms between animals and plants, overlaid by a rich molecular and regulatory diversity that is specific to plant systems. Here we review plant cell cycle regulators and their control. Addresses Institute

  3. A central integrator of transcription networks in plant stress and energy signalling

    E-Print Network [OSTI]

    Sheen, Jen

    LETTERS A central integrator of transcription networks in plant stress and energy signalling Elena are the principal solar energy converter sustaining life on Earth. Despite its fundamental importance, little to globally regulate plant metabolism, energy balance, growth and survival. In con- trast to the prevailing

  4. TGF-b activates Erk MAP kinase signalling through direct phosphorylation of ShcA

    E-Print Network [OSTI]

    Derynck, Rik

    TGF-b activates Erk MAP kinase signalling through direct phosphorylation of ShcA Matt K Lee1, *, Ce Hospital Los Angeles, University of Southern California, CA, USA Erk1/Erk2 MAP kinases are key regulators, TGF-b stimulation also activates Erk MAP kinases through an undefined mechanism, albeit to a much

  5. Phosphate stimulates Matrix Gla Protein expression in chondrocytes through the ERK signaling pathway

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Phosphate stimulates Matrix Gla Protein expression in chondrocytes through the ERK signaling. Email: Jerome.guicheux@nantes.inserm.fr Short title Phosphate stimulates MGP expression via ERK-regulated kinase 1 and 2 (ERK1/2) was performed in rib organ cultures from newborn mice. Results indicated that Pi

  6. ERK Signaling in the Pituitary Is Required for Female But Not Male Fertility

    E-Print Network [OSTI]

    ERK Signaling in the Pituitary Is Required for Female But Not Male Fertility Stuart P. Bliss. Several studies suggest that ERK1 and -2 are essential modulators of hypothalamic GnRH-mediated regulation-specific depletion of ERK1 and 2 and examined a range of physiological parameters including fertility. We find

  7. Evolving a robust signal transduction pathway from weak cross-talk

    E-Print Network [OSTI]

    Siryaporn, Albert

    We have evolved a robust two-component signal transduction pathway from a sensor kinase (SK) and non-partner response regulator (RR) that show weak cross-talk in vitro and no detectable cross-talk in vivo in wild-type ...

  8. Evolving a robust signal transduction pathway from weak cross-talk

    E-Print Network [OSTI]

    Siryaporn, Albert

    We have evolved a robust two?component signal transduction pathway from a sensor kinase (SK) and non?partner response regulator (RR) that show weak cross?talk in vitro and no detectable cross?talk in vivo in wild?type ...

  9. ANRV288-CB22-19 ARI 25 June 2006 14:55 Intracellular Signaling

    E-Print Network [OSTI]

    Walter, Peter

    reticulum stress, signal transduction, organelle homeostasis, protein folding, regulated mRNA splicing triggers an exten- sive transcriptional response, which adjusts the ER protein folding capacity according to reestablish homeostasis in the cell's protein folding capacity or--if this cannot be achieved-- commit cells

  10. Development of mass spectrometry based technologies for quantitative cell signaling phosphoproteomics : the epidermal growth factor receptor family as a model system

    E-Print Network [OSTI]

    Wolf Yadlin, Alejandro

    2007-01-01

    Ligand binding to cell surface receptors initiates a cascade of signaling events regulated by dynamic phosphorylation on a multitude of pathway proteins. Quantitative features, including intensity, timing, and duration of ...

  11. Frequency Control Performance Measurement and Requirements

    SciTech Connect (OSTI)

    Illian, Howard F.

    2010-12-20

    Frequency control is an essential requirement of reliable electric power system operations. Determination of frequency control depends on frequency measurement and the practices based on these measurements that dictate acceptable frequency management. This report chronicles the evolution of these measurements and practices. As technology progresses from analog to digital for calculation, communication, and control, the technical basis for frequency control measurement and practices to determine acceptable performance continues to improve. Before the introduction of digital computing, practices were determined largely by prior experience. In anticipation of mandatory reliability rules, practices evolved from a focus primarily on commercial and equity issues to an increased focus on reliability. This evolution is expected to continue and place increased requirements for more precise measurements and a stronger scientific basis for future frequency management practices in support of reliability.

  12. Frequency modulation drive for a piezoelectric motor

    DOE Patents [OSTI]

    Mittas, Anthony (Albuquerque, NM)

    2001-01-01

    A piezoelectric motor has peak performance at a specific frequency f.sub.1 that may vary over a range of frequencies. A drive system is disclosed for operating such a motor at peak performance without feedback. The drive system consists of the motor and an ac source connected to power the motor, the ac source repeatedly generating a frequency over a range from f.sub.1 -.DELTA.x to f.sub.1 +.DELTA.y.

  13. Calpain-mediated proteolysis of polycystin-1 C-terminus induces JAK2 and ERK signal alterations

    SciTech Connect (OSTI)

    Kim, Hyunho [Transplantation Research Institute, Seoul National University Medical Research Center, Seoul (Korea, Republic of); Department of Medicine, University of Maryland, Baltimore, MD (United States); Kang, Ah-Young [Transplantation Research Institute, Seoul National University Medical Research Center, Seoul (Korea, Republic of); Department of Medicine, Program of Immunology, Graduate School, Seoul National University, Seoul (Korea, Republic of); Ko, Ah-ra [Clinical Research Center, Samsung Biomedical Research Institute, Seoul (Korea, Republic of); Park, Hayne Cho [Transplantation Research Institute, Seoul National University Medical Research Center, Seoul (Korea, Republic of); Research Coordination Center for Rare Diseases, Seoul National University Hospital, Seoul (Korea, Republic of); So, Insuk [Department of Physiology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Park, Jong Hoon [Department of Biological Science, Sookmyung Women’s University, Seoul (Korea, Republic of); Cheong, Hae Il [Research Coordination Center for Rare Diseases, Seoul National University Hospital, Seoul (Korea, Republic of); Department of Pediatrics, Seoul National University Children’s Hospital, Seoul (Korea, Republic of); Kidney Research Institute, Medical Research Center, Seoul National University College of Medicine, Seoul (Korea, Republic of); Hwang, Young-Hwan [Research Coordination Center for Rare Diseases, Seoul National University Hospital, Seoul (Korea, Republic of); Department of Internal Medicine, Eulji General Hospital, Eulji University College of Medicine, Seoul (Korea, Republic of); and others

    2014-01-01

    Autosomal dominant polycystic kidney disease (ADPKD), a hereditary renal disease caused by mutations in PKD1 (85%) or PKD2 (15%), is characterized by the development of gradually enlarging multiple renal cysts and progressive renal failure. Polycystin-1 (PC1), PKD1 gene product, is an integral membrane glycoprotein which regulates a number of different biological processes including cell proliferation, apoptosis, cell polarity, and tubulogenesis. PC1 is a target of various proteolytic cleavages and proteosomal degradations, but its role in intracellular signaling pathways remains poorly understood. Herein, we demonstrated that PC1 is a novel substrate for ?- and m-calpains, which are calcium-dependent cysteine proteases. Overexpression of PC1 altered both Janus-activated kinase 2 (JAK2) and extracellular signal-regulated kinase (ERK) signals, which were independently regulated by calpain-mediated PC1 degradation. They suggest that the PC1 function on JAK2 and ERK signaling pathways might be regulated by calpains in response to the changes in intracellular calcium concentration. - Highlights: • Polycystin-1 is a target of ubiquitin-independent degradation by calpains. • The PEST domain is required for calpain-mediated degradation of polycystin-1. • Polycystin-1 may independently regulate JAK2 and ERK signaling pathways.

  14. Multiple-frequency acoustic wave devices for chemical sensing and materials characterization in both gas and liquid phase

    DOE Patents [OSTI]

    Martin, S.J.; Ricco, A.J.

    1993-08-10

    A chemical or intrinsic physical property sensor is described comprising: (a) a substrate; (b) an interaction region of said substrate where the presence of a chemical or physical stimulus causes a detectable change in the velocity and/or an attenuation of an acoustic wave traversing said region; and (c) a plurality of paired input and output interdigitated electrodes patterned on the surface of said substrate where each of said paired electrodes has a distinct periodicity, where each of said paired electrodes is comprised of an input and an output electrode; (d) an input signal generation means for transmitting an input signal having a distinct frequency to a specified input interdigitated electrode of said plurality so that each input electrode receives a unique input signal, whereby said electrode responds to said input signal by generating an acoustic wave of a specified frequency, thus, said plurality responds by generating a plurality of acoustic waves of different frequencies; (e) an output signal receiving means for determining an acoustic wave velocity and an amplitude of said acoustic waves at several frequencies after said waves transverses said interaction region and comparing these values to an input acoustic wave velocity and an input acoustic wave amplitude to produce values for perturbations in acoustic wave velocities and for acoustic wave attenuation as a function of frequency, where said output receiving means is individually coupled to each of said output interdigitated electrode; (f) a computer means for analyzing a data stream comprising information from said output receiving means and from said input signal generation means to differentiate a specified response due to a perturbation from a subsequent specified response due to a subsequent perturbation to determine the chemical or intrinsic physical properties desired.

  15. Sub-kHz linewidth narrowing of a mid-infrared OPO idler frequency by direct cavity stabilization

    E-Print Network [OSTI]

    Ricciardi, I; Parisi, M; Maddaloni, P; Santamaria, L; De Natale, P; De Rosa, M

    2015-01-01

    We stabilize the idler frequency of a singly-resonant optical parametric oscillator directly to the resonance of a mid-infrared Fabry-P\\'erot reference cavity. This is accomplished by the Pound-Drever-Hall locking scheme, controlling either the pump laser or the resonant signal frequency. A residual relative frequency noise power spectral density below 10$^3$ Hz$^2$/Hz is reached, with a Gaussian linewidth of 920 Hz over 100 ms, which demonstrates the potential for reaching spectral purity down to the Hz level by locking the optical parametric oscillator against a mid-infrared cavity with state-of-the-art superior performance.

  16. Interrelationship of Program Regulations and Financial Assistance Regulations

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1980-04-24

    The purpose of this Order is to set forth the interrelationship between all program regulations which will result in assistance awards (Program Regulations) and the Department of Energy Assistance Regulations (DOE-AR, 10 CRF Part 600), including procedures for exceptions, deviations or waivers.

  17. Electromagnetics-Related Aspects of Signaling and Signal Processing for UWB Short Range Radios*

    E-Print Network [OSTI]

    Southern California, University of

    Electromagnetics-Related Aspects of Signaling and Signal Processing for UWB Short Range Radios* A in electromagnetic-related aspects of UWB signaling schemas and signal processing. First, pulse shaping is developed in both the transmitter and receiver, and signal processing at the receiver end. To create efficient

  18. 3572 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 56, NO. 8, AUGUST 2008 Algebraic Signal Processing Theory

    E-Print Network [OSTI]

    Moura, José

    3572 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 56, NO. 8, AUGUST 2008 Algebraic Signal, IEEE Abstract--This paper introduces a general and axiomatic ap- proach to linear signal processing (SP) that we refer to as the al- gebraic signal processing theory (ASP). Basic to ASP is the linear signal

  19. Multiple frequency printed slot and dipole antennas 

    E-Print Network [OSTI]

    Kolsrud, Arild

    1997-01-01

    frequencies. Adding one varactor diode to the slot antenna or two diodes to the dipole either switching or tuning of the antenna could be achieved....

  20. REVIEW OF INDUCTION LINACS

    E-Print Network [OSTI]

    Faltens, A.

    2010-01-01

    generator small-signal impedance can be kept small at low frequencies by regulating the output voltage; at high

  1. Improving CS regulations.

    SciTech Connect (OSTI)

    Nesse, R.J.; Scheer, R.M.; Marasco, A.L.; Furey, R.

    1980-10-01

    President Carter issued Executive Order 12044 (3/28/78) that required all Federal agencies to distinguish between significant and insignificant regulations, and to determine whether a regulation will result in major impacts. This study gathered information on the impact of the order and the guidelines on the Office of Conservation and Solar Energy (CS) regulatory practices, investigated problems encountered by the CS staff when implementing the order and guidelines, and recommended solutions to resolve these problems. Major tasks accomplished and discussed are: (1) legislation, Executive Orders, and DOE Memoranda concerning Federal administrative procedures relevant to the development and analysis of regulations within CS reviewed; (2) relevant DOE Orders and Memoranda analyzed and key DOE and CS staff interviewed in order to accurately describe the current CS regulatory process; (3) DOE staff from the Office of the General Counsel, the Office of Policy and Evaluation, the Office of the Environment, and the Office of the Secretary interviewed to explore issues and problems encountered with current CS regulatory practices; (4) the regulatory processes at five other Federal agencies reviewed in order to see how other agencies have approached the regulatory process, dealt with specific regulatory problems, and responded to the Executive Order; and (5) based on the results of the preceding four tasks, recommendations for potential solutions to the CS regulatory problems developed. (MCW)

  2. Regulation 8: Responsibility for Creation and Amendment of Regulations: REGULATION 8: RESPONSIBILITY FOR CREATION AND AMENDMENT OF

    E-Print Network [OSTI]

    Sussex, University of

    Regulation 8: Responsibility for Creation and Amendment of Regulations: 36 REGULATION 8: RESPONSIBILITY FOR CREATION AND AMENDMENT OF REGULATIONS This Regulation may only be amended at a meeting and revoke Regulations. Regulations may be created, amended and revoked at any meeting of Council. 2

  3. Low-frequency quantitative ultrasound imaging of cell death in vivo

    SciTech Connect (OSTI)

    Sadeghi-Naini, Ali; Falou, Omar; Czarnota, Gregory J.; Department of Radiation Oncology, Odette Cancer Centre, Sunnybrook Health Sciences Centre, Toronto, Ontario M4N 3M5; Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, Ontario M4N 3M5; Department of Radiation Oncology, Faculty of Medicine, University of Toronto, Toronto, Ontario M4N 3M5 ; Papanicolau, Naum; Tadayyon, Hadi; Lee, Justin; Zubovits, Judit; Sadeghian, Alireza; Karshafian, Raffi; Al-Mahrouki, Azza; Giles, Anoja; Kolios, Michael C.

    2013-08-15

    Purpose: Currently, no clinical imaging modality is used routinely to assess tumor response to cancer therapies within hours to days of the delivery of treatment. Here, the authors demonstrate the efficacy of ultrasound at a clinically relevant frequency to quantitatively detect changes in tumors in response to cancer therapies using preclinical mouse models.Methods: Conventional low-frequency and corresponding high-frequency ultrasound (ranging from 4 to 28 MHz) were used along with quantitative spectroscopic and signal envelope statistical analyses on data obtained from xenograft tumors treated with chemotherapy, x-ray radiation, as well as a novel vascular targeting microbubble therapy.Results: Ultrasound-based spectroscopic biomarkers indicated significant changes in cell-death associated parameters in responsive tumors. Specifically changes in the midband fit, spectral slope, and 0-MHz intercept biomarkers were investigated for different types of treatment and demonstrated cell-death related changes. The midband fit and 0-MHz intercept biomarker derived from low-frequency data demonstrated increases ranging approximately from 0 to 6 dBr and 0 to 8 dBr, respectively, depending on treatments administrated. These data paralleled results observed for high-frequency ultrasound data. Statistical analysis of ultrasound signal envelope was performed as an alternative method to obtain histogram-based biomarkers and provided confirmatory results. Histological analysis of tumor specimens indicated up to 61% cell death present in the tumors depending on treatments administered, consistent with quantitative ultrasound findings indicating cell death. Ultrasound-based spectroscopic biomarkers demonstrated a good correlation with histological morphological findings indicative of cell death (r{sup 2}= 0.71, 0.82; p < 0.001).Conclusions: In summary, the results provide preclinical evidence, for the first time, that quantitative ultrasound used at a clinically relevant frequency, in addition to high-frequency ultrasound, can detect tissue changes associated with cell death in vivo in response to cancer treatments.

  4. A precision millimeter-wave measurement of the Rydberg frequency

    E-Print Network [OSTI]

    De Vries, Joel Christopher, 1971-

    2001-01-01

    The Rydberg frequency, cR[infinity], sets the frequency scale for the spectrum of hydrogen atoms. From a frequency measurement of one transition in hydrogen, cR[infinity] can be extracted and the frequency of any other ...

  5. Agile high resolution arbitrary waveform generator with jitterless frequency stepping

    DOE Patents [OSTI]

    Reilly, Peter T. A.; Koizumi, Hideya

    2010-05-11

    Jitterless transition of the programmable clock waveform is generated employing a set of two coupled direct digital synthesis (DDS) circuits. The first phase accumulator in the first DDS circuit runs at least one cycle of a common reference clock for the DDS circuits ahead of the second phase accumulator in the second DDS circuit. As a phase transition through the beginning of a phase cycle is detected from the first phase accumulator, a first phase offset word and a second phase offset word for the first and second phase accumulators are calculated and loaded into the first and second DDS circuits. The programmable clock waveform is employed as a clock input for the RAM address controller. A well defined jitterless transition in frequency of the arbitrary waveform is provided which coincides with the beginning of the phase cycle of the DDS output signal from the second DDS circuit.

  6. Measurements of ionospheric effects on wideband signals at VHF

    SciTech Connect (OSTI)

    Fitzgerald, T.J.

    1998-08-17

    Radars operating at very high frequency (VHF) have enhanced foliage and ground penetration compared to radars operated at higher frequencies. For example, VHF systems operated from airplanes have been used as synthetic aperture radars (SAR); a satellite-borne VHF SAR would have considerable utility. In order to operate with high resolution it would have to use both a large relative bandwidth and a large aperture. A satellite-borne radar would likely have to operate at altitudes above the maximum density of the ionosphere; the presence of the ionosphere in the propagation path of the radar will cause a deterioration of the performance because of dispersion over the bandwidth. The author presents measurements of the effects of the ionosphere on radar signals propagated from a source on the surface of the Earth and received by instruments on the FORTE satellite at altitudes of 800 km. The author employs signals with a 90 MHz bandwidth centered at 240 MHz with a continuous digital recording period of 0.6 s.

  7. A Hybrid Analog/Digital Phase-Locked Loop for Frequency Mode Non-contact Scanning Probe Microscopy

    E-Print Network [OSTI]

    Mehta, Manan

    2013-01-01

    Non-contact scanning probe microscopy (SPM) has developed into a powerful technique to image many different properties of samples. The conventional method involves monitoring the amplitude, phase or frequency of a cantilever oscillating at or near its resonant frequency as it is scanned across the surface of a sample. For high Q factor cantilevers, monitoring the resonant frequency is the preferred method in order to obtain reasonable scan times. This can be done by using a phase-locked-loop (PLL). PLLs can be obtained as commercial integrated circuits, but these do not have the frequency resolution required for SPM. To increase the resolution, all-digital PLLs requiring sophisticated digital signal processors or field programmable gate arrays have also been implemented. We describe here a hybrid analog/digital PLL where most of the components are implemented using discrete analog integrated circuits, but the frequency resolution is provided by a direct digital synthesis chip controlled by a simple PIC microc...

  8. Nuclear sensor signal processing circuit

    DOE Patents [OSTI]

    Kallenbach, Gene A. (Bosque Farms, NM); Noda, Frank T. (Albuquerque, NM); Mitchell, Dean J. (Tijeras, NM); Etzkin, Joshua L. (Albuquerque, NM)

    2007-02-20

    An apparatus and method are disclosed for a compact and temperature-insensitive nuclear sensor that can be calibrated with a non-hazardous radioactive sample. The nuclear sensor includes a gamma ray sensor that generates tail pulses from radioactive samples. An analog conditioning circuit conditions the tail-pulse signals from the gamma ray sensor, and a tail-pulse simulator circuit generates a plurality of simulated tail-pulse signals. A computer system processes the tail pulses from the gamma ray sensor and the simulated tail pulses from the tail-pulse simulator circuit. The nuclear sensor is calibrated under the control of the computer. The offset is adjusted using the simulated tail pulses. Since the offset is set to zero or near zero, the sensor gain can be adjusted with a non-hazardous radioactive source such as, for example, naturally occurring radiation and potassium chloride.

  9. Physiology and Regulation of Calcium Channels in Stomatal Guard Cells

    SciTech Connect (OSTI)

    Schroeder, Julian I.

    2007-05-02

    Stomatal pores in the epidermis of leaves regulate the diffusion of CO2 into leaves for photosynthetic carbon fixation and control water loss of plants during drought periods. Guard cells sense CO2, water status, light and other environmental conditions to regulate stomatal apertures for optimization of CO2 intake and plant growth under drought stress. The cytosolic second messenger calcium contributes to stomatal movements by transducing signals and regulating ion channels in guard cells. Studies suggest that both plasma membrane Ca2+ influx channels and vacuolar/organellar Ca2+ release channels contribute to ABA-induced Ca2+ elevations in guard cells. Recent research in the P.I.'s laboratory has led to identification of a novel major cation-selective Ca2+-permeable influx channel (Ica) in the plasma membrane of Arabidopsis guard cells. These advances will allow detailed characterization of Ica plasma membrane Ca2+ influx channels in guard cells. The long term goal of this research project is to gain a first detailed characterization of these novel plasma membrane Ca2+-permeable channel currents in Arabidopsis guard cells. The proposed research will investigate the hypothesis that Ica represents an important Ca2+ influx pathway for ABA and CO2 signal transduction in Arabidopsis guard cells. These studies will lead to elucidation of key signal transduction mechanisms by which plants balance CO2 influx into leaves and transpirational water loss and may contribute to future strategies for manipulating gas exchange for improved growth of crop plants and for biomass production.

  10. Spatiotemporal regulation of protein kinase C signaling : control of normal cellular dynamics and mis-regulation in cancer

    E-Print Network [OSTI]

    Gallegos, Lisa Leon

    2009-01-01

    preparation and migration assay—Primary astrocyte culturesrearrangements during migration of primary astrocytes. Inand contributes to migration of primary mouse astrocytes.

  11. Emotion Regulation JAMES J. GROSS

    E-Print Network [OSTI]

    Gross, James J.

    CHAPTER 31 ·Emotion Regulation JAMES J. GROSS Have you ever gotten so angry that you've done). Although the topic of emotion regulation is a relatively late addition to the field of emotion, a concern with emotion regulation is anything but new. Emotion regu lation has been a focus in the study of psycho

  12. Army Regulation 2001 Environmental Quality

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Army Regulation 200­1 Environmental Quality Environmental Protection and Enhancement Headquarters Environmental Protection and Enhancement *Army Regulation 200­1 Effective 27 December 2007 History in the summary of change. Summary. This regulation covers envi- ronmental protection and enhancement and provides

  13. REGULATION AND DISTRUST Philippe AGHION

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    REGULATION AND DISTRUST Philippe AGHION Yann ALGAN Pierre CAHUC Andrei SHLEIFER January 2009 Cahier://www.enseignement.polytechnique.fr/economie/ mailto:chantal.poujouly@polytechnique.edu hal-00396268,version1-17Jun2009 #12;REGULATION AND DISTRUST1: In a cross-section of countries, government regulation is strongly negatively correlated with social capital

  14. COVARIANCE PLASTICITY AND REGULATED CRITICALITY

    E-Print Network [OSTI]

    Lehmann, Daniel

    COVARIANCE PLASTICITY AND REGULATED CRITICALITY Elie Bienenstock Division of Applied Mathematics plasticity may cause the brain to operate near criticality. We analyze the effect of such a regulation of Hebbian covariance plasticity. Such a regulation may bring the system near criticality. We suggest

  15. Temperature controlled high voltage regulator

    DOE Patents [OSTI]

    Chiaro, Jr., Peter J. (Clinton, TN); Schulze, Gerald K. (Knoxville, TN)

    2004-04-20

    A temperature controlled high voltage regulator for automatically adjusting the high voltage applied to a radiation detector is described. The regulator is a solid state device that is independent of the attached radiation detector, enabling the regulator to be used by various models of radiation detectors, such as gas flow proportional radiation detectors.

  16. A signal oriented stream processing system for pipeline monitoring

    E-Print Network [OSTI]

    Tokmouline, Timur

    2006-01-01

    In this thesis, we develop SignalDB, a framework for composing signal processing applications from primitive stream and signal processing operators. SignalDB allows the user to focus on the signal processing task and avoid ...

  17. Low frequency noise in superconducting qubits

    E-Print Network [OSTI]

    Fominov, Yakov

    Low frequency noise in superconducting qubits Lara Faoro and Lev Ioffe Rutgers University (USA) Exp-traps Faoro and Ioffe, PRL 96, 47001 (2006) · a discussion on the mysterious and puzzling flux noise at low... IN PROGRESS WITH EXPERIMENTALISTS! 4. Origin of low frequency flux noise at low temperature ? WHAT THE HELL

  18. Low Frequency Transmission Final Project Report

    E-Print Network [OSTI]

    Low Frequency Transmission Final Project Report Power Systems Engineering Research Center Empowering Minds to Engineer the Future Electric Energy System #12;Low Frequency Transmission Final Project This is the final report for the Power Systems Engineering Research Center (PSERC) research project S-42 titled "Low

  19. Employing Symmetry Constraints for Improved Frequency Estimation

    E-Print Network [OSTI]

    Smyth, Gordon K.

    process control, communications, radio location of objects, seismic signal processing and computer, especially in areas such as geophysics, speech recogni- tion and electronic signal processing. A traditional an error process with mean zero and constant variance. The sum of sinusoids model is said to have

  20. Multi-dimensional ultra-high frequency passive radio frequency identification tag antenna designs

    E-Print Network [OSTI]

    Delichatsios, Stefanie Alkistis

    2006-01-01

    In this thesis, we present the design, simulation, and empirical evaluation of two novel multi-dimensional ultra-high frequency (UHF) passive radio frequency identification (RFID) tag antennas, the Albano-Dipole antenna ...

  1. Application of wave-shape functions and Synchrosqueezing transform to pulse signal analysis

    E-Print Network [OSTI]

    Wu, Hau-tieng; Wu, Han-Kuei; Wang, Chun-Li; Yang, Yueh-Lung; Wu, Wen-Hsiang

    2015-01-01

    We apply the recently developed adaptive non-harmonic model based on the wave-shape function, as well as the time-frequency analysis tool called synchrosqueezing transform (SST) to model and study the pulse wave signal. Based on the wave shape function model and SST, we extract features, called the spectral pulse signature, based on the functional regression technique, to characterize the hemodynamics from the pulse wave signals. To demonstrate how the algorithm and the extracted features work, we study the radial pulse wave signal recorded by the sphygmomanometer from normal subjects and patients with congestive heart failure. The analysis results suggest the potential of the proposed signal processing approach to extract health-related hemodynamics features. In addition, it shows that different positions of the radial artery contain significant different information, which is compatible with the empirical conclusion of the pulse diagnosis in the traditional Chinese medicine.

  2. FREQUENCY-DEPENDENT NATURE OF Pn IN WESTERN CHINA: GAUSSIAN BEAM MODELING OF DATA FROM THE HI-CLIMB EXPERIMENT

    E-Print Network [OSTI]

    Nowack, Robert L.

    -Tibetan Continental Lithosphere during Mountain Building). This experiment is one of the largest broadband seismic wave-trains, including arrival times, amplitudes of signal-envelopes, and instantaneous pulse results should advance efforts in isolating effects of frequency-dependent propagation from those of pure

  3. Abstract--Time-frequency analysis of heart rate variability (HRV) makes it easier to evaluate how the balance

    E-Print Network [OSTI]

    Carvalho, João Luiz

    Abstract--Time-frequency analysis of heart rate variability (HRV) makes it easier to evaluate how-regressive model can be used to calculate the Power Spectrum Density of HRV and to create an auto of optimal orders for different interpolation rates of the HRV signal are presented. Keywords--AR model order

  4. Stimulation of CD107 affects LPS-induced cytokine secretion and cellular adhesion through the ERK signaling pathway in the human macrophage-like

    E-Print Network [OSTI]

    Lee, Won-Ha

    Stimulation of CD107 affects LPS-induced cytokine secretion and cellular adhesion through the ERK107 ERK Inflammation Signal transduction a b s t r a c t Lysosome-associated membrane proteins (LAMPs that extracellular signal-regulated kinase (ERK) mediates the regulatory action of CD107. These results suggest

  5. Land Use Regulation with Durable Capital

    E-Print Network [OSTI]

    Quigley, John M.; Swoboda, Aaron

    2009-01-01

    Manhattan so expensive? Regulation and the rise of housingmotive for restrictive regulation by local home owners.the impacts of these regulations vary across owner- occupied

  6. Prenatal maternal stress programs infant stress regulation.

    E-Print Network [OSTI]

    Davis, Elysia Poggi; Glynn, Laura M; Waffarn, Feizal; Sandman, Curt A

    2011-01-01

    Programs Infant Stress Regulation Elysia Poggi Davis, PhDglucocorticoids disrupts the regulation of physiological andstress alters circadian regulation and laboratory levels of

  7. Price regulation for waste hauling franchises in California: an examination of how regulators regulate pricing and the effects of competition on regulated markets

    E-Print Network [OSTI]

    Seltzer, Steven A.

    2011-01-01

    Thomadakis, Stavros. “Price Regulation Under Uncertainty inin the Theory of Regulation. ” Handbook of IndustrialMark and David Sappington. “Regulation, Competition and

  8. Essays on the politics of regulation

    E-Print Network [OSTI]

    Weymouth, Stephen

    2010-01-01

    F. , 2002: Does entry regulation hinder job creation? evi-Macroeconomic effects of regulation and dereg- ulation inand Shleifer, A. , 2004: The regulation of labor. Quarterly

  9. Nanotechnology Regulation: A Study in Claims Making

    E-Print Network [OSTI]

    Malloy, Timothy F.

    2011-01-01

    Nanomaterials: Principles, Regulation, and Renegotiating theJoseph Rees, Industry Self-Regulation: An InstitutionalDarren Sinclair, Self-Regulation Versus Command and Control?

  10. Regulation, Unemployment, and Cost-Benefit Analysis

    E-Print Network [OSTI]

    Posner, Eric; Masur, Jonathan S.

    2011-01-01

    and Eric A. Posner, Regulation, Unemployment, and Cost-effects of environmental regulations for other industries.Paper Collection.   Regulation, Unemployment, and Cost-

  11. Self-regulating valve

    DOE Patents [OSTI]

    Humphreys, D.A.

    1982-07-20

    A variable, self-regulating valve having a hydraulic loss coefficient proportional to a positive exponential power of the flow rate. The device includes two objects in a flow channel and structure which assures that the distance between the two objects is an increasing function of the flow rate. The range of spacing between the objects is such that the hydraulic resistance of the valve is an increasing function of the distance between the two objects so that the desired hydraulic loss coefficient as a function of flow rate is obtained without variation in the flow area.

  12. Interviewee Travel Regulations Scope

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLANIsProcessRegulationRadiative Transfer Model3/2012

  13. Sum-Frequency Generation from Chiral Media and Interfaces

    SciTech Connect (OSTI)

    Ji, Na

    2006-02-13

    Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers.

  14. System and method for regulating resonant inverters

    DOE Patents [OSTI]

    Stevanovic, Ljubisa Dragoljub (Clifton Park, NY); Zane, Regan Andrew (Superior, CO)

    2007-08-28

    A technique is provided for direct digital phase control of resonant inverters based on sensing of one or more parameters of the resonant inverter. The resonant inverter control system includes a switching circuit for applying power signals to the resonant inverter and a sensor for sensing one or more parameters of the resonant inverter. The one or more parameters are representative of a phase angle. The resonant inverter control system also includes a comparator for comparing the one or more parameters to a reference value and a digital controller for determining timing of the one or more parameters and for regulating operation of the switching circuit based upon the timing of the one or more parameters.

  15. Digital slip frequency generator and method for determining the desired slip frequency

    DOE Patents [OSTI]

    Klein, Frederick F. (Monroeville, PA)

    1989-01-01

    The output frequency of an electric power generator is kept constant with variable rotor speed by automatic adjustment of the excitation slip frequency. The invention features a digital slip frequency generator which provides sine and cosine waveforms from a look-up table, which are combined with real and reactive power output of the power generator.

  16. Fact Sheet: Beacon Power 20 MW Flywheel Frequency Regulation Plant (August

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRD Report to Congress MoreHyd rog enOffice| Department of2013) |

  17. Hazle Spindle, LLC Beacon Power 20 MW Flywheel Frequency Regulation Plant

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12,ExecutiveFinancing ProgramsDepartment of¡ ¢ £ ¤ ¤Communication Hazle

  18. Phase Analysis for Frequency Standards in the Microwave and Optical Domains

    E-Print Network [OSTI]

    Kazda, M; Huntemann, N; Lipphardt, B; Weyers, S

    2015-01-01

    Coherent manipulation of atomic states is a key concept in high-precision spectroscopy and used in atomic fountain clocks and a number of optical frequency standards. Operation of these standards can involve a number of cyclic switching processes, which may induce cycle synchronous phase excursions of the interrogation signal and thus lead to shifts in the output of the frequency standard. We have built a FPGA-based phase analyzer to investigate these effects and conducted measurements on two frequency standards. For the caesium fountain PTB-CSF2 we were able to exclude phase variations of the microwave source at the level of a few $\\mu$rad, corresponding to relative frequency shifts of less than 10$^{-16}$. In the optical domain, we investigated phase variations in PTB's Yb$^+$ optical frequency standard and made detailed measurements of AOM chirps and their scaling with duty cycle and driving power. We ascertained that cycle-synchronous as well as long-term phase excursion do not cause frequency shifts larg...

  19. Long Signaling Cascades Tend to Attenuate Retroactivity

    E-Print Network [OSTI]

    Ossareh, Hamid R.

    Signaling pathways consisting of phosphorylation/dephosphorylation cycles with no explicit feedback allow signals to propagate not only from upstream to downstream but also from downstream to upstream due to retroactivity ...

  20. Legibility of freeway Lane Control Signals 

    E-Print Network [OSTI]

    Tallamraju, Satya S

    1994-01-01

    This thesis documents the results of a laboratory study designed to evaluate and compare the glance legibility distance of commercially available freeway Lane Control Signals (LCS). Two prototype fiber-optic lane control signals were evaluated...

  1. MICROFLUIDIC CONTROL OF STEM CELL DIFFUSIBLE SIGNALING

    E-Print Network [OSTI]

    Voldman, Joel

    MICROFLUIDIC CONTROL OF STEM CELL DIFFUSIBLE SIGNALING Katarina Blagovi, Lily Y. Kim, Alison M cell differentiation. KEYWORDS: Embryonic stem cells, microfluidic perfusion, diffusible signaling; they secrete molecules to which they respond. Microfluidics offers a potential solution to this challenge

  2. Passive, Noiseless, Intensity Amplification of Repetitive Signals

    E-Print Network [OSTI]

    Maram, R; Li, M; Azaña, J

    2014-01-01

    Amplification of signal intensity is essential for initiating physical processes, diagnostics, sensing, communications, and scientific measurement. During traditional amplification, the signal is amplified by multiplying the signal carriers through an active gain process using an external power source. However, for repetitive waveforms, sufficient energy for amplification often resides in the signal itself. In such cases, the unneeded external power is wasted, and the signal is additionally degraded by noise and distortions that accompany active gain processes. We show noiseless, intensity amplification of repetitive optical pulse waveforms with a gain from 2 to ~20 without using active gain, by recycling energy already stored in the input repetitive signal. This "green" method uses dispersion-induced self-imaging (Talbot) effects to precisely re-distribute the original signal energy into fewer replica waveforms. This approach simply requires a suitable manipulation of the input signal's phase profile along t...

  3. Innovative Methodology Decomposition of Surface EMG Signals

    E-Print Network [OSTI]

    De Luca, Carlo J.

    for decomposing surface electromyographic (sEMG) signals into the constituent motor unit (MU) action potential limb muscles. I N T R O D U C T I O N The electromyographic (EMG) signal is composed of the action

  4. Seven Traffic Signals in Two Minutes

    Broader source: Energy.gov [DOE]

    Topeka, Kansas has activated the first of three key traffic corridors to receive a "green light tunnel," a real-time adaptive traffic signal system that synchronizes signals to create a series of...

  5. Evaluation of traffic signal controller transition methods 

    E-Print Network [OSTI]

    Hamilton, Curtis Lloyd

    2000-01-01

    A coordinated signal system achieves the best traffic progression when the signal plans are optimized at the correct offsets and intervals. When traffic conditions change and a transition to a new timing plan is warranted, it is important to reach...

  6. Bayesian network models of biological signaling pathways

    E-Print Network [OSTI]

    Sachs, Karen, Ph. D. Massachusetts Institute of Technology

    2006-01-01

    Cells communicate with other cells, and process cues from their environment, via signaling pathways, in which extracellular cues trigger a cascade of information flow, causing signaling molecules to become chemically, ...

  7. Optimal coherent control of CARS: signal enhancement and background elimination

    E-Print Network [OSTI]

    Fang Gao; Feng Shuang; JunHui Shi; Herschel Rabitz; HaiFeng Wang; JiXin Cheng

    2012-03-28

    The ability to enhance resonant signals and eliminate the non-resonant background is analyzed for Coherent Anti-Stokes Raman Scattering (CARS). The analysis is done at a specific frequency as well as for broadband excitation using femtosecond pulse-shaping techniques. An appropriate objective functional is employed to balance resonant signal enhancement against non-resonant background suppression. Optimal enhancement of the signal and minimization of the background can be achieved by shaping the probe pulse alone while keeping the pump and Stokes pulses in transform-limited-form (TLF). In some cases analytical forms for the probe pulse can be found, and numerical simulations are carried out for other circumstances. It is found that a good approximate solution for the optimal pulse in the two-pulse CARS is a superposition of linear and arctangent type phases for the pump. The well-known probe delay method is shown to be a quasi-optimal scheme for background suppression. The results should provide a basis to improve the performance of CARS spectroscopy and microscopy.

  8. Processing of acoustical signals via a wavelet-based analysis

    E-Print Network [OSTI]

    Matsinos, Evangelos

    2015-01-01

    In the present paper, details are given on the implementation of a wavelet-based analysis tailored to the processing of acoustical signals. The family of the suitable wavelets (`Reimann wavelets') are obtained in the time domain from a Fourier transform, extracted in Ref.~\\cite{r1} after invoking theoretical principles and time-frequency localisation constraints. A scheme is set forth to determine the optimal values of the parameters of this type of wavelet on the basis of the goodness of the reproduction of a $30$-s audio file containing harmonic signals corresponding to six successive $A$ notes of the chromatic musical scale, from $A_2$ to $A_7$. The quality of the reproduction over about six and a half octaves is investigated. Finally, details are given on the incorporation of the re-assignment method in the analysis framework, as the means a) to determine the important contributions of the wavelet transforms and b) to suppress noise present in the signal.

  9. Digital signal generation for wireless communication systems

    E-Print Network [OSTI]

    Rode, Jeremy

    2010-01-01

    MHz would require a synchronous PWM generator to be clockedof signal generators have a synchronous output, time-

  10. Signal Processing for Neural Spike Trains

    E-Print Network [OSTI]

    Berger, Theodore W.

    Editorial: Signal processing and statistics have been playing a pivotal role in computational neuroscience and neural engineering research.

  11. Relative stereociliary motion in a hair bundle opposes amplification at distortion frequencies

    E-Print Network [OSTI]

    Andrei S. Kozlov; Thomas Risler; Armin J. Hinterwirth; A. J. Hudspeth

    2012-03-08

    Direct gating of mechanoelectrical-transduction channels by mechanical force is a basic feature of hair cells that assures fast transduction and underpins the mechanical amplification of acoustic inputs. But the associated nonlinearity - the gating compliance - inevitably distorts signals. Because reducing distortion would make the ear a better detector, we sought mechanisms with that effect. Mimicking in vivo stimulation, we used stiff probes to displace individual hair bundles at physiological amplitudes and measured the coherence and phase of the relative stereociliary motions with a dual-beam differential interferometer. Although stereocilia moved coherently and in phase at the stimulus frequencies, large phase lags at the frequencies of the internally generated distortion products indicated dissipative relative motions. Tip links engaged these relative modes and decreased the coherence in both stimulated and free hair bundles. These results show that a hair bundle breaks into a highly dissipative serial arrangement of stereocilia at distortion frequencies, precluding their amplification.

  12. UTag: Long-range Ultra-wideband Passive Radio Frequency Tags

    SciTech Connect (OSTI)

    Dowla, F

    2007-03-14

    Long-range, ultra-wideband (UWB), passive radio frequency (RF) tags are key components in Radio Frequency IDentification (RFID) system that will revolutionize inventory control and tracking applications. Unlike conventional, battery-operated (active) RFID tags, LLNL's small UWB tags, called 'UTag', operate at long range (up to 20 meters) in harsh, cluttered environments. Because they are battery-less (that is, passive), they have practically infinite lifetimes without human intervention, and they are lower in cost to manufacture and maintain than active RFID tags. These robust, energy-efficient passive tags are remotely powered by UWB radio signals, which are much more difficult to detect, intercept, and jam than conventional narrowband frequencies. The features of long range, battery-less, and low cost give UTag significant advantage over other existing RFID tags.

  13. The Response of Long-Span Bridges to Low Frequency, Near-Fault Earthquake Ground Motions

    SciTech Connect (OSTI)

    McCallen, David; Astaneh-Asl, A.; Larsen, S.C.; Hutchings, Larry

    2009-02-27

    Historical seismic hazard characterizations did not include earthquake ground motion waveforms at frequencies below approximately 0.2 Hz (5 seconds period). This resulted from limitations in early strong motion instrumentation and signal processing techniques, a lack of measurements in the near-field of major earthquakes and therefore no observational awareness, and a delayed understanding in the engineering community of the potential significance of these types of motions. In recent years, there is a growing recognition of the relevance of near-fault, low frequency motions, particularly for long-period structures such as large bridges. This paper describes a computationally based study of the effects of low frequency (long-period) near-fault motions on long-span bridge response. The importance of inclusion of these types of motions for long span cable supported bridges is demonstrated using actual measured broad-band, near-fault motions from large earthquakes.

  14. Activin/Nodal signalling in stem cells

    E-Print Network [OSTI]

    Pauklin, Siim; Vallier, Ludovic

    2015-02-15

      1       Activin/Nodal  Signaling  in  Stem  Cells       Siim  Pauklin1  and  Ludovic  Vallier1,*     1  Anne  McLaren  Laboratory  For  Regenerative  Medicine,  West  Forvie  Building... ESC   pluripotency  does  not  require  an  inductive  signalling  pathway  but  rather,  that  it  is  the   result   of   a   passive   balance   between   different   signalling   pathways   repressing...

  15. Stochastic Search for Signal Processing Algorithm Optimization

    E-Print Network [OSTI]

    Stochastic Search for Signal Processing Algorithm Optimization Bryan Singer Manuela Veloso May address the complex task of signal processing optimization. We first introduce and discuss the complexities of this domain. In general, a single signal processing algorithm can be represented by a very

  16. Wavelets and Signal Processing John E. Gilbert

    E-Print Network [OSTI]

    Knopf, Dan

    Wavelets and Signal Processing John E. Gilbert Mathematics in Science Lecture April 30, 2002. #12 of wavelets came from seismology, physics, and signal process- ing as much as from mathematics itself. In turn will describe some basic wave- let ideas and how they can be used in signal analysis and data detection

  17. Wideband Array Signal Processing Using MCMC Methods

    E-Print Network [OSTI]

    Reilly, James P.

    1 Wideband Array Signal Processing Using MCMC Methods William Ng, James P. Reilly*, Thia structure for array signal processing. A new interpolation model is formed where the observations are linear processing, a mature and specialized branch of signal processing, has found use in radar, sonar

  18. BIOSIGNAL 2002 A Biomedical Signal Processing Toolbox

    E-Print Network [OSTI]

    BIOSIGNAL 2002 A Biomedical Signal Processing Toolbox Mateo Aboy1 , Cristina Crespo1 , James McNames1 , Jules Bassale1 , Laura Jenkins1 , Brahm Goldstein2 1 Biomedical Signal Processing Laboratory@pdx.edu Abstract. This paper describes a biomedical signal processing (BSP) toolbox for the analysis of physiologic

  19. The frequency spectrum of the Casimir effect

    SciTech Connect (OSTI)

    Lang, Andrew S.I.D. [Computer Science and Mathematics Department, Oral Roberts University, Tulsa, Oklahoma 74171 (United States)

    2005-10-01

    The frequency spectrum of the Casimir effect between parallel plates is studied. Calculations are performed for both the massless scalar field and the electromagnetic field cases, first using a spectral weight function, and then via the Fourier transform of the renormalized expectation of the Casimir energy-momentum operator. The Casimir force is calculated using the spectrum for two plates which are perfectly transparent in a frequency band. The result of this calculation suggests a way to detect the frequency spectrum of the Casimir effect.

  20. High power radio frequency attenuation device

    DOE Patents [OSTI]

    Kerns, Quentin A. (Bloomingdale, IL); Miller, Harold W. (Winfield, IL)

    1984-01-01

    A resistor device for attenuating radio frequency power includes a radio frequency conductor connected to a series of fins formed of high relative magnetic permeability material. The fins are dimensional to accommodate the skin depth of the current conduction therethrough, as well as an inner heat conducting portion where current does not travel. Thermal connections for air or water cooling are provided for the inner heat conducting portions of each fin. Also disclosed is a resistor device to selectively alternate unwanted radio frequency energy in a resonant cavity.