National Library of Energy BETA

Sample records for fork flathead watershed

  1. DOE/BP-00005043-1 South Fork Flathead Watershed Westslope Cutthroat

    E-Print Network [OSTI]

    DOE/BP-00005043-1 South Fork Flathead Watershed Westslope Cutthroat Trout Conservation Program June-01903, 143 electronic pages, (BPA Report DOE/BP-00005043-1) Field37: This report was funded by the Bonneville

  2. EIS-0353: South Fork Flathead Watershed/Westlope Cutthroat Trout Conservation Project, Montana

    Broader source: Energy.gov [DOE]

    In cooperation with Montana, Fish, Wildlife, and Parks, Bonneville Power Administration is proposing to implement a conservation program to preserve the genetic purity of the westslope cutthroat trout populations in the South Fork of the Flathead River drainage.

  3. Flathead River Focus Watershed Coordinator, 2005-2006 Annual Report.

    SciTech Connect (OSTI)

    DuCharme, Lynn

    2006-05-01

    The Bonneville Power Administration (BPA) has long been involved with funding of the Cooperative Habitat Protection and Improvement with Private Landowners program in accordance with the Northwest Power Planning Council's (NPPC) Fish & Wildlife Program (Section 7.7). Section 7.7B.1 requires the establishment of ''at least one model watershed coordinator selected by each representative state''. This project was initiated in 1997 with the purpose of fulfilling the NWPCC's watershed program within the Flathead River basin in western Montana. Currently, the Flathead watershed has been radically altered by hydropower and other land uses. With the construction of Hungry Horse, Bigfork and Kerr dams, the Flathead River system has been divided into isolated populations. Bull trout have been listed as threatened by the US Fish and Wildlife Service and westslope cutthroat trout have been petitioned for listing. Many streams in the drainage have been destabilized during recent decades. Past legal and illegal species introductions are also causing problems. This project fosters in-kind, out-of-place mitigation to offset the impacts of hydroelectric power to 72 miles of the South Fork of the Flathead River and its tributaries upstream of Hungry Horse Dam. Key subbasins within the Flathead drainage, which are critical to native species restoration, are experiencing rapid changes in land ownership and management direction. Subdivision and residential development of agricultural and timber lands adjacent to waterways in the drainage pose one of the greatest threats to weak but recoverable stocks of trout species. Plum Creek Timber Company, a major landholder in the Flathead drainage is currently divesting itself of large tracks of its lakeshore and streamside holdings. Growth of small tract development throughout the area and its tributaries is occurring at a record rate. Immediate to short-term action is required to protect stream corridors through many of these areas if cost-effective recovery efforts are to be implemented. In order to adequately address the issues, other segments of society and other (non-BPA) funding sources must be incorporated into the solution. As stated in the 1994 Fish and Wildlife Program (section 7.7), ''Comprehensive watershed management should enhance and expedite implementation of actions by clearly identifying gaps in programs and knowledge, by striving over time to resolve conflicts, and by keying on activities that address priorities''. A watershed coordinator helps to initiate and facilitate efforts for addressing the issues mentioned above and pulling together a plan for mitigation. Local support is essential before local governments and individual citizens are going to allow government initiatives to be implemented.

  4. Flathead River Focus Watershed Coordinator, 2004-2005 Annual Report.

    SciTech Connect (OSTI)

    DuCharme, Lynn

    2006-06-26

    The Bonneville Power Administration (BPA) has long been involved with funding of the Cooperative Habitat Protection and Improvement with Private Landowners program in accordance with the Northwest Power Planning Council's (NPPC) Fish & Wildlife Program (Section 7.7). Section 7.7B.1 requires the establishment of ''at least one model watershed coordinator selected by each representative state''. This project was initiated in 1997 with the purpose of fulfilling the NWPCC's watershed program within the Flathead River basin in western Montana. Currently, the Flathead watershed has been radically altered by hydropower and other land uses. With the construction of Hungry Horse, Bigfork and Kerr dams, the Flathead River system has been divided into isolated populations. Bull trout have been listed as threatened by the US Fish and Wildlife Service and westslope cutthroat trout have been petitioned for listing. Many streams in the drainage have been destabilized during recent decades. Past legal and illegal species introductions are also causing problems. This project fosters in-kind, out-of-place mitigation to offset the impacts of hydroelectric power to 72 miles of the South Fork of the Flathead River and its tributaries upstream of Hungry Horse Dam. Key subbasins within the Flathead drainage, which are critical to native species restoration, are experiencing rapid changes in land ownership and management direction. Subdivision and residential development of agricultural and timber lands adjacent to waterways in the drainage pose one of the greatest threats to weak but recoverable stocks of trout species. Plum Creek Timber Company, a major landholder in the Flathead drainage is currently divesting itself of large tracks of its lakeshore and streamside holdings. Growth of small tract development throughout the area and its tributaries is occurring at a record rate. Immediate to short-term action is required to protect stream corridors through many of these areas if cost-effective recovery efforts are to be implemented. In order to adequately address the issues, other segments of society and other (non-BPA) funding sources must be incorporated into the solution. As stated in the 1994 Fish and Wildlife Program (section 7.7), ''Comprehensive watershed management should enhance and expedite implementation of actions by clearly identifying gaps in programs and knowledge, by striving over time to resolve conflicts, and by keying on activities that address priorities''. A watershed coordinator helps to initiate and facilitate efforts for addressing the issues mentioned above and pulling together a plan for mitigation. Local support is essential before local governments and individual citizens are going to allow government initiatives to be implemented.

  5. Flathead River Focus Watershed Coordinator, 2003-2004 Annual Report.

    SciTech Connect (OSTI)

    DuCharme, Lynn

    2004-06-01

    The Bonneville Power Administration (BPA) has long been involved with funding of the Cooperative Habitat Protection and Improvement with Private Landowners program in accordance with the Northwest Power Planning Council's (NPPC) Fish & Wildlife Program (Section 7.7). Section 7.7B.1 requires the establishment of ''at least one model watershed coordinator selected by each representative state''. This project was initiated in 1997 with the purpose of fulfilling the NWPCC's watershed program within the Flathead River basin in western Montana. Currently, the Flathead watershed has been radically altered by hydropower and other land uses. With the construction of Hungry Horse, Bigfork and Kerr dams, the Flathead River system has been divided into isolated populations. Bull trout have been listed as threatened by the US Fish and Wildlife Service and westslope cutthroat trout have been petitioned for listing. Many streams in the drainage have been destabilized during recent decades. Past legal and illegal species introductions are also causing problems. This project fosters in-kind, out-of-place mitigation to offset the impacts of hydroelectric power to 72 miles of the South Fork of the Flathead River and its tributaries upstream of Hungry Horse Dam. Key subbasins within the Flathead drainage, which are critical to native species restoration, are experiencing rapid changes in land ownership and management direction. Subdivision and residential development of agricultural and timber lands adjacent to waterways in the drainage pose one of the greatest threats to weak but recoverable stocks of trout species. Plum Creek Timber Company, a major landholder in the Flathead drainage is currently divesting itself of large tracks of its lakeshore and streamside holdings. Growth of small tract development throughout the area and its tributaries is occurring at a record rate. Immediate to short-term action is required to protect stream corridors through many of these areas if cost-effective recovery efforts are to be implemented. In order to adequately address the issues, other segments of society and other (non-BPA) funding sources must be incorporated into the solution. As stated in the 1994 Fish and Wildlife Program (section 7.7), ''Comprehensive watershed management should enhance and expedite implementation of actions by clearly identifying gaps in programs and knowledge, by striving over time to resolve conflicts, and by keying on activities that address priorities''. A watershed coordinator helps to initiate and facilitate efforts for addressing the issues mentioned above and pulling together a plan for mitigation. Local support is essential before local governments and individual citizens are going to allow government initiatives to be implemented.

  6. South Fork Salmon River Watershed Restoration, 2008-2009 Annual Report.

    SciTech Connect (OSTI)

    Reaney, Mark D. [Nez Perce Tribe Department of Fisheries Resource Management

    2009-04-15

    The watershed restoration work elements within the project area, the South Fork Salmon River Watershed, follow the watershed restoration approach adopted by the Nez Perce Tribe Department of Fisheries Resource Management (DFRM) - Watershed Division. The vision of the Nez Perce Tribe DFRM-Watershed Division focuses on protecting, restoring, and enhancing watersheds and treaty resources within the ceded territory of the Nez Perce Tribe under the Treaty of 1855 with the United States Federal Government. The program uses a holistic approach, which encompasses entire watersheds, ridge top to ridge top, emphasizing all cultural aspects and strategies that rely on natural fish production and healthy river ecosystems. The Nez Perce Tribe DFRM-Watershed Division strives towards maximizing historic ecosystem productivity and health for the restoration of anadromous and resident fish populations and the habitat on which all depend on for future generations Originally, this project was funded to create a step/pool stream channel that was appropriate to restore fish passage where the 'Glory Hole Cascade' is currently located at the Stibnite Mine. Due to unforeseen circumstances at the time, the project is unable to move forward as planned and a request for a change in scope of the project and an expansion of the geographic area in which to complete project work was submitted. No additional funds were being requested. The ultimate goal of this project is to work with the holistic, ridge top to ridge top approach to protect and restore the ecological and biological functions of the South Fork Salmon River Watershed to assist in the recovery of threatened and endangered anadromous and resident fish species. FY 2008 Work Elements included two aquatic organism passage (AOP) projects to restore habitat connectivity to two fish-bearing tributaries to the East Fork South Fork Salmon River, Salt and Profile Creeks. The Work Elements also included road survey and assessment activities that move toward road decommissioning to reduce sediment delivery to spawning gravels and rearing habitats by reducing sedimentation from road related, man-made sources. For FY08, the project included the design and implementation of two fish barrier replacement structures mentioned above, the Salt and Profile Creek Bridges. These work elements were to be implemented on Valley County easements within the Payette National Forest. The existing culverts are full or partial barriers to most aquatic life species and all juvenile anadromous and resident fish species. Implementation will reconnect 9.34 miles of habitat, and provide natural stream channels to facilitate complete passage for all aquatic life forms. All designs were completed and a construction subcontract was awarded to construct free span, pre-cast concrete bridges. For 2008, the project statement of work also included all the necessary work elements to manage, coordinate, plan, and develop continuing strategies for restoration and protection activities.

  7. Secure & Restore Critical Fisheries Habitat, Flathead Subbasin, FY2008 Annual Report.

    SciTech Connect (OSTI)

    DuCharme, Lynn; Tohtz, Joel

    2008-11-12

    The construction of Hungry Horse Dam inundated 125 km of adfluvial trout habitat in the South Fork of the Flathead River and its tributaries, impacting natural fish reproduction and rearing. Rapid residential and commercial growth in the Flathead Watershed now threaten the best remaining habitats and restrict our opportunities to offset natural resource losses. Hydropower development and other land disturbances caused severe declines in the range and abundance of our focal resident fish species, bull trout and westslope cutthroat trout. Bull trout were listed as threatened in 1998 under the Endangered Species Act and westslope cutthroat were petitioned for listing under ESA. Westslope cutthroat are a species of special concern in Montana and a species of special consideration by the Confederated Salish and Kootenai Tribes. The Secure & Protect Fisheries Habitat project follows the logical progression towards habitat restoration outlined in the Hungry Horse Dam Fisheries Mitigation Implementation Plan approved by the NWPPC in 1993. This project is also consistent with the 2000 Fish and Wildlife Program and the Flathead River Subbasin Plan that identifies the protection of habitats for these populations as one of the most critical needs in the subbasin and directs actions to offset habitat losses. The Flathead basin is one of the fastest growing human population centers in Montana. Riparian habitats are being rapidly developed and subdivided, causing habitat degradation and altering ecosystem functions. Remaining critical habitats in the Flathead Watershed need to be purchased or protected with conservation easements if westslope cutthroat and bull trout are to persist and expand within the subbasin. In addition, habitats degraded by past land uses need to be restored to maximize the value of remaining habitats and offset losses caused by the construction of Hungry Horse Dam. Securing and restoring remaining riparian habitat will benefit fish by shading and moderating water temperatures, stabilizing banks and protecting the integrity of channel dimension, improving woody debris recruitment for in-channel habitat features, producing terrestrial insects and leaf litter for recruitment to the stream, and helping to accommodate and attenuate flood flows. The purpose of this project is to work with willing landowners to protect the best remaining habitats in the Flathead subbasin as identified in the Flathead River Subbasin Plan. The target areas for land protection activities follow the priorities established in the Flathead subbasin plan and include: (1) Class 1 waters as identified in the Flathead River Subbasin Plan; (2) Class 2 watersheds as identified in the Flathead River Subbasin Plan; and (3) 'Offsite mitigation' defined as those Class 1 and Class 2 watersheds that lack connectivity to the mainstem Flathead River or Flathead Lake. This program focuses on conserving the highest quality or most important riparian or fisheries habitat areas consistent with program criteria. The success of our efforts is subject to a property's actual availability and individual landowner negotiations. The program is guided using biological and project-based criteria that reflect not only the priority needs established in the Flathead subbasin plan, but also such factors as cost, credits, threats, and partners. The implementation of this project requires both an expense and a capital budget to allow work to be completed. This report addresses accomplishments under both budgets during FY08 as the two budgets are interrelated. The expense budget provided pre-acquisition funding to conduct activities such as surveys, appraisals, staff support, etc. The capital budget was used to purchase the interest in each parcel including closing costs. Both the pre-acquisition contract funds and the capital funds used to purchase fee title or conservation easements were spent in accordance with the terms negotiated within the FY08 through FY09 MOA between the Tribes, State, and BPA. In FY08, the focus of this project was to pursue all possible properties

  8. Flathead Basin Commission Act of 1983 (Montana)

    Broader source: Energy.gov [DOE]

    This Act establishes the Flathead Basin Commission, the purpose of which is to protect the Flathead Lake aquatic environment, its waters, and surrounding lands and natural resources. The Commission...

  9. Flathead Electric Cooperative- Commercial Lighting Rebate Program

    Broader source: Energy.gov [DOE]

    Flathead Electric Cooperative, in conjunction with Bonneville Power Administration, encourages energy efficiency in the commercial sector by providing a commercial lighting retro-fit rebate program...

  10. Lower Flathead System Fisheries Study, 1986 Interim Report.

    SciTech Connect (OSTI)

    Bradshaw, William H.; DosSantos, Joseph M.; Darling, James M.

    1986-08-01

    We believe our results have clearly shown Kerr hydroelectric operations and operational constraints have negatively affected Flathead River trout and northern pike populations and the aquatic habitat which support them. Even so, it is possible to mitigate many of these impacts and develop a very important fishery. Trout abundance in the lower Flathead averaged only 19 fish per kilometer, the lowest abundance of trout for a river of this size in Montana. Little main channel spawning by trout was observed and most spawning probably occurs in tributaries. Lower river tributaries support resident populations of brook, rainbow, brown, and cutthroat trout; and a small resident population of bull trout is present in the South Fork of the Jocko River. Using weirs, spawning runs of rainbow and brown trout from the main river were monitored entering the Jocko River and the Post/Mission Creek system. Utilization of Crow Creek by main river trout stocks of trout was limited to the 6 km segment below Crow Dam. Evaluations of tributary spawning gravels showed high levels of silt which would suggest poor survival of trout eggs. Excessive harvest in the tributaries was indicated by analysis of age class structure and abundance of trout greater than 200 mm.

  11. Watersheds

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN AProject Assessment Customer5-25901 Docker:Watersheds

  12. APPENDIX 98 Flathead River Subbasin Planning

    E-Print Network [OSTI]

    , and fish and wildlife in the Flathead subbasin? · How will electricity-generating costs be effected? · How in defining critical issues; recommending subbasin vision and guiding principles; and identifying in the process to help identify issues, vision and guiding principles, and was re-convened near the end

  13. Effects of Water Levels on Productivity of Canada Geese in the Northern Flathead Valley, 1984 Annual Report.

    SciTech Connect (OSTI)

    Casey, Daniel

    1985-02-01

    Operation of Hungry Horse Dam on the South Fork Flathead River causes sporadic level fluctuations along the main stem Flathead River. Seasonal water level fluctuations and substantial habitat losses have occurred as a result of construction and operation of Kerr Dam, which regulates Flathead Lake. These fluctuations may impact goose populations through flooding or erosion of nesting and brood-rearing habitats, and increased susceptibility of nests and young to predation. The number, location, and success of goose nests were determined through pair surveys and nest searches. Counts of indicated pairs suggest there were 73-125 occupied nests in the study area; 44 were located in 1984. Twenty were island ground nests, 19 were tree nests, and 5 were on man-made structures. Hatching success was 76 percent. Sixty-one percent of all nests were in deciduous forest habitat; 87 percent were on riparian bench or island landforms. Seventy-four percent of all nests were within 5 m of the seasonal high water mark (HWM) and 85 percent of ground nests were 1 m or less above the HWM. Production, habitat use, and distribution of broods were documented through aerial, boat, ground, and observation tower surveys. 28 refs., 10 figs., 4 tabs.

  14. Flathead Electric Coop Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdistoWhiskey flats 100k.pdf Jump to:WindP.pdfFireFirstFlagFlathead

  15. Flathead Electric Cooperative- New and Manufactured Home Incentive Program

    Broader source: Energy.gov [DOE]

    Flathead Electric encourages its residential customers to occupy energy efficient homes. Owners and builders of new homes which meet the "Montana Homes" requirements listed on the program web site...

  16. Hungry Horse Mitigation; Flathead Lake, 2003-2004 Annual Report.

    SciTech Connect (OSTI)

    Hansen, Barry; Evarts, Les

    2005-06-01

    The Confederated Salish and Kootenai Tribes (CSKT) and Montana Fish Wildlife and Parks (MFWP) wrote the ''Fisheries Mitigation Plan for Losses Attributable to the Construction and Operation of Hungry Horse Dam'' in March 1991 to define the fisheries losses, mitigation alternatives and recommendations to protect, mitigate and enhance resident fish and aquatic habitat affected by Hungry Horse Dam. On November 12, 1991, the Northwest Power Planning Council (NPPC) approved the mitigation plan with minor modifications, called for a detailed implementation plan, and amended measures 903(h)(1) through (7). A long-term mitigation plan was submitted in August 1992, was approved by the Council in 1993, and the first contract for this project was signed on November 11, 1993. The problem this project addresses is the loss of habitat, both in quality and quantity, in the Flathead Lake and River basin resulting from the construction and operation of Hungry Horse Dam. The purpose of the project is to both implement mitigation measures and monitor the biological responses to those measures including those implemented by Project Numbers 9101903 and 9101904. Goals and objectives of the 1994 Fish and Wildlife Program (Section 10.1) addressed by this project are the rebuilding to sustainable levels weak, but recoverable, native populations injured by the hydropower system. The project mitigates the blockage of spawning runs by Hungry Horse Dam by restoring and even creating spawning habitats within direct drainages to Flathead Lake. The project also addresses the altered habitat within Flathead Lake resulting from species shifts and consequent dominance of new species that restricts the potential success of mitigation measures. Specific goals of this project are to create and restore habitat and quantitatively monitor changes in fish populations to verify the efficacy of our mitigation measures. The project consists of three components: monitoring, restoration and research. Monitoring, for example, includes a spring gillnetting series conducted annually in Flathead Lake and builds on an existing data set initiated in 1981. Monitoring of the experimental kokanee reintroduction was a primary activity of this project between 1992 and 1997. Lake trout, whose high densities have precluded successful mitigation of losses of other species in Flathead Lake, have been monitored since 1996 to measure several biological parameters. Results of this work have utility in determining the population status of this key predator in Flathead Lake. The project has also defined the baseline condition of the Flathead Lake fishery in 1992-1993 and has conducted annual lakewide surveys since 1998. The restoration component of the project has addressed several stream channel, riparian, and fish passage problems, and suppression of non-native fish. The research component of the project began in FY 2000 and measured trophic linkages between M. relicta and other species to assist in predicting the results of our efforts to suppress lake trout. Only Objective 1 in the workplan is funded entirely by Hungry Horse Mitigation funds. Additional funds are drawn from other sources to assist in completion of Objectives 2-8.

  17. Flathead County, Montana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban Transport Jump to:Flanders, New York: EnergyFlat Jump to:Flathead

  18. President's House Price's Fork Road

    E-Print Network [OSTI]

    President's House Price's Fork Road Inn at Virginia Tech and Skelton Conference Center HOKIE BIKE HUB Media Hall Fralin Biotechnology Center Greenhouses Air Conditioning Plant Southgate Center Addition Sandy South Drillfield Drive WestCampusDrive Alumni Mall Washington Street SpringRoad Sterre Perry Street Kent

  19. Electrical resistivity structure of the Flathead Basin in southeastern British Columbia, Canadal

    E-Print Network [OSTI]

    Jones, Alan G.

    Electrical resistivity structure of the Flathead Basin in southeastern British Columbia, Canadal (Kishenehn) Basin in southeastern British Columbia, Canada. These data have been modelled by both one Rocheuses. Can. J. Earth Sci. 27,1061-1073 (1990) [Traduit par la revue] 1061 Introduction The petroleum

  20. Stream periphyton and coal mining: Comparative Effects in the Elk Flathead Rivers of Southeastern British Columbia

    E-Print Network [OSTI]

    Renn, Susan C.P.

    ecosystems. Drainage from mines and mine tailings often leach acid waters, heavy metals, and dissolved drainage of Michel Creek, a tributary of the Elk River. Michel Creek receives various forms of runoff from the Coal Mountain Mine in the Elk River Basin. Compared to Flathead drainage streams, Michel Creek biomass

  1. Rehabilitate Newsome Creek Watershed, 2007-2008 Annual Report.

    SciTech Connect (OSTI)

    Bransford, Stephanie [Nez Perce Tribe Fisheries/Watershed Program

    2009-05-01

    The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridgetop approach. The Nez Perce Tribe (NPT) and the Nez Perce National Forest (NPNF) have formed a partnership in completing watershed restoration activities, and through this partnership more work is accomplished by sharing funding and resources in our effort. The Nez Perce Tribe began watershed restoration projects within the Newsome Creek watershed of the South Fork Clearwater River in 1997. Progress has been made in restoring the watershed through road decommissioning and culvert replacement. Starting in FY 2001 and continuing into the present, a major stream restoration effort on the mainstem of Newsome Creek has been pursued. From completing a watershed assessment to a feasibility study of 4 miles of mainstem rehabilitation to carrying that forward into NEPA and a final design, we will begin the effort of restoring the mainstem channel of Newsome Creek to provide spawning and rearing habitat for anadromous and resident fish species. Roads have been surveyed and prioritized for removal or improvement as well as culverts being prioritized for replacement to accommodate fish passage throughout the watershed.

  2. B Technical remarks on the ForkLight compiler package

    E-Print Network [OSTI]

    Kessler, Christoph

    B Technical remarks on the ForkLight compiler package The technical requirements to run ForkLight on your local system are an ANSI­C compiler like gcc and an installation of the P4 library. B.1 Installation The ForkLight compiler package can be obtained from the WWW page http

  3. RESERVATION OF RIGHTS A number of governments and agencies participated in the development of this Flathead Subbasin Plan, Part

    E-Print Network [OSTI]

    of this Flathead Subbasin Plan, Part I (Assessment Volume), Part II (Inventory Volume), and Part III (Management that respond to impacts from the development and operation of the Columbia River hydropower system. Nothing hydropower system. Nothing in this Plan or the participation in its development is intended to, and shall

  4. RESERVATION OF RIGHTS A number of governments and agencies participated in the development of this Flathead Subbasin Plan, Part

    E-Print Network [OSTI]

    of this Flathead Subbasin Plan, Part I (Assessment Volume), Part II (Inventory Volume), and Part III (Management the subbasin over the last five years.The Inventory also evaluates how well past and current projects have that respond to impacts from the development and operation of the Columbia River hydropower system. Nothing

  5. The Watershed Management Approach 

    E-Print Network [OSTI]

    Persyn, Russell A.; Griffin, Molly; Williams, Amy T.; Wolfe, Clint

    2008-08-11

    coordinated environmental management framework that focuses public and private efforts on a watershed?s highest- priority problems. In the past, such an approach was used more commonly in polluted watersheds or those with limited water supplies, but it also... network helps Texans meet their water needs. However, Texas surface water quality varies because of both natural processes and hu- man activities. The state of Texas also monitors and manages the Gulf of Mexico. Planning Determine the watershed planning...

  6. Spanish Fork Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEurope GmbHSoloPage Edit with form HistorySpain InstalledFork

  7. CREEL CENSUS AND EXPENDITURE STUDY, NORTH FORK SUN RIVER,

    E-Print Network [OSTI]

    CREEL CENSUS AND EXPENDITURE STUDY, NORTH FORK SUN RIVER, MONTANA, 1951 Marine Biological STUDY, NORTH FORK SUN RIVER, MONTANA, 1951 Marine Biological Laboratory JUN16 1954 WOODS HOLE, MASS MAP CREEL CENSUS SUN RIVER MONTANA DRAWN i*^ ^ TRACED- _2£jLt:l SUBMITTED . 1 V N 01 1 VN ei

  8. Chemical and biological sensing using tuning forks

    DOE Patents [OSTI]

    Tao, Nongjian; Boussaad, Salah

    2012-07-10

    A device for sensing a chemical analyte is disclosed. The device is comprised of a vibrating structure having first and second surfaces and having an associated resonant frequency and a wire coupled between the first and second surfaces of the vibrating structure, wherein the analyte interacts with the wire and causes a change in the resonant frequency of the vibrating structure. The vibrating structure can include a tuning fork. The vibrating structure can be comprised of quartz. The wire can be comprised of polymer. A plurality of vibrating structures are arranged in an array to increase confidence by promoting a redundancy of measurement or to detect a plurality of chemical analytes. A method of making a device for sensing a chemical analyte is also disclosed.

  9. Toward Strategic Watershed Management

    E-Print Network [OSTI]

    Toward Strategic Watershed Management: Lessons from the Boone River Watershed Program Evaluation Resources Ecology and Management June, 2013 #12;2 Introduction Water quality is a growing problem throughout management on private and working lands. The Iowa Soybean Association (ISA) began work in the Boone River

  10. Appendix 69 Bull Trout Draft Recovery Plan. Chapter 3: Clark Fork Recovery Unit

    E-Print Network [OSTI]

    Appendix 69 Bull Trout Draft Recovery Plan. Chapter 3: Clark Fork Recovery Unit #12;Chapter 3 State(s): Montana, Idaho, and Washington Recovery Unit Name: Clark Fork River (Including Lake Pend Oreille, Priest and Wildlife Service. 2002. Chapter 3, Clark Fork River Recovery Unit, Montana, Idaho, and Washington. 285 p. U

  11. ForkLight special program variables name meaning sharity type remark

    E-Print Network [OSTI]

    Kessler, Christoph

    ID private int automatically renumbered in fork ForkLight function (pointer) type qualifiers name on global shared heap shalloc csync char * unsigned int allocate block on automatic shared heap shavail async. unsigned int void get size of free automatic shared heap space ForkLight group structure

  12. Grand Forks, North Dakota: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County, Georgia: EnergyGorlitz AGGranby,Information ForksForks,

  13. EIS-0184: South Fork Tolt River Hydroelectric Project

    Broader source: Energy.gov [DOE]

    This EIS analyzes the Seattle City Light, a Department of the City of Seattle proposal to construct a hydroelectric project with an installed capacity of 15 MW on the South Fork Tolt River near the town of Carnation located in King County in the State of Washington.

  14. A Fork in the Road We stand at a fork in the road. Conventional oil and gas supplies are limited. We can move

    E-Print Network [OSTI]

    Hansen, James E.

    A Fork in the Road We stand at a fork in the road. Conventional oil and gas supplies are limited the dirtiest tar sands and tar shales, hydrofracking for gas, continued mountain-top removal and mechanized change. Fossil fuel moguls get richer, we get poorer. Our children are screwed. Our well-oiled coal

  15. Five Forks, South Carolina: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban Transport Jump to: navigation,FirstGeoThermtheForks, South

  16. Grand Forks County, North Dakota: Energy Resources | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County, Georgia: EnergyGorlitz AGGranby,Information Forks

  17. Depositional environment of Red Fork sandstones, deep Anadarko Basin, western Oklahoma 

    E-Print Network [OSTI]

    Whiting, Philip Howard

    1982-01-01

    of constructional channel-fill sandstones of the Red Fork, East Clinton Field. Location of cross section shown in Fig. 17. Datum level is an overlying highly conductive shale marker 51 19 Core analysis plot showing porosity, permeability, and fluid saturation...- ducers of oil and gas. Huch of the Red Fork production 'n this area has occurred while drilling for the deeper Morrow sandstones. The excellent natural gas productior. from the shallower Red Fork reservoirs has recently generated much interest...

  18. Volume II, Chapter 12 Lewis River Subbasin--Upper North Fork

    E-Print Network [OSTI]

    Volume II, Chapter 12 Lewis River Subbasin--Upper North Fork #12;TABLE OF CONTENTS TABLE OF CONTENTS.................................................................................................. 12-17 12.5.3 Water Quality

  19. Volume II, Chapter 11 Lewis River Subbasin--Lower North Fork

    E-Print Network [OSTI]

    Volume II, Chapter 11 Lewis River Subbasin--Lower North Fork #12;TABLE OF CONTENTS TABLE OF CONTENTS..................................................................................................... 11-33 11.5.3 Water Quality

  20. Watershed and Receiving Water Modeling Introduction ....................................................................................................................................843

    E-Print Network [OSTI]

    Pitt, Robert E.

    APPENDIX H Watershed and Receiving Water Modeling CONTENTS Introduction ..................................................................................................................852 Receiving Water Models ......................................................................................................................................866 INTRODUCTION Models are important tools for watershed and receiving water analyses because

  1. Southern Region Watershed Management Project

    E-Print Network [OSTI]

    and technology transfer programs. #12;Southern Region Watershed Management Project September 15, 2000 and networking both internally and with other regional water resources management programs, promoted technology1 Southern Region Watershed Management Project September 15, 2000 to September 14, 2005 Terminal

  2. Caney Fork Electric Coop, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC JumpBiossenceBrunswick,CalendarFork Electric Coop, Inc Jump to:

  3. American Fork, Utah: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5AllEnergyAmeriPower LLC JumpTechnologies Inc JumpFork,

  4. Cherry Fork, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank,CammackFLIR JumpMaine: EnergyEnergyEnergyChengduSouth Carolina:County,Fork,

  5. Asotin Creek Model Watershed Plan

    SciTech Connect (OSTI)

    Browne, D.; Holzmiller, J.; Koch, F.; Polumsky, S.; Schlee, D.; Thiessen, G.; Johnson, C.

    1995-04-01

    The Asotin Creek Model Watershed Plan is the first to be developed in Washington State which is specifically concerned with habitat protection and restoration for salmon and trout. The plan is consistent with the habitat element of the ``Strategy for Salmon``. Asotin Creek is similar in many ways to other salmon-bearing streams in the Snake River system. Its watershed has been significantly impacted by human activities and catastrophic natural events, such as floods and droughts. It supports only remnant salmon and trout populations compared to earlier years. It will require protection and restoration of its fish habitat and riparian corridor in order to increase its salmonid productivity. The watershed coordinator for the Asotin County Conservation District led a locally based process that combined local concerns and knowledge with technology from several agencies to produce the Asotin Creek Model Watershed Plan.

  6. Watershed modelling of hydrology and water quality in the Sacramento River watershed, California

    E-Print Network [OSTI]

    Zhang, Minghua

    Watershed modelling of hydrology and water quality in the Sacramento River watershed, California contamination in California's Sacramento River watershed where 8500 km2 of agricultural land influences water components were assessed for the Sacramento River watershed. To represent flood conveyance in the area

  7. EA-0956: South Fork Snake River/Palisades Wildlife Mitigation Project, Bonneville County, Idaho

    Broader source: Energy.gov [DOE]

    This EA evaluates the environmental impacts of the U.S. Department of Energy's Bonneville Power Administration proposal to fund the implementation of the South Fork Snake River Programmatic...

  8. EA-1969: Clark Fork River Delta Restoration Project, Bonner County, Idaho

    Broader source: Energy.gov [DOE]

    Bonneville Power Administration prepared an environmental assessment to analyze the potential effects of a proposal to restore wetland and riparian (riverbank) habitat and to reduce erosion in the Clark Fork River delta located in Bonner County, Idaho.

  9. Urban Retrofit: A Whole-Watershed Approach to Urban Stormwater Management

    E-Print Network [OSTI]

    Lithander, Becky

    2012-01-01

    Creek  Watershed:  Urban  Stormwater  Management  Opportuni?Creek  Watershed:  Urban  Stormwater  Management  Opportuni?Creek  Watershed:  Urban  Stormwater  Management  Opportuni?

  10. CREATING AND CELEBRATING OUR WATERSHED'S FUTURE

    E-Print Network [OSTI]

    #12;CREATING AND CELEBRATING OUR WATERSHED'S FUTURE SELECTING INDICATORS FOR A SUSTAINABLE WATERSHED FUTURE March 1 - 2,1997 Falkland, B.C. Workshop Report Prepared For: Objectives Section.M. and MacDonald, D.D. 1997. Creating and Celebrating Our Watershed's Future- Selecting Indicators

  11. Grays River Watershed Geomorphic Analysis

    SciTech Connect (OSTI)

    Geist, David R.

    2005-04-30

    This investigation, completed for the Pacific Northwest National Laboratory (PNNL), is part of the Grays River Watershed and Biological Assessment commissioned by Bonneville Power Administration under project number 2003-013-00 to assess impacts on salmon habitat in the upper Grays River watershed and present recommendations for habitat improvement. This report presents the findings of the geomorphic assessment and is intended to support the overall PNNL project by evaluating the following: 􀂃 The effects of historical and current land use practices on erosion and sedimentation within the channel network 􀂃 The ways in which these effects have influenced the sediment budget of the upper watershed 􀂃 The resulting responses in the main stem Grays River upstream of State Highway 4 􀂃 The past and future implications for salmon habi

  12. Walker Branch Watershed Ecosystems Data

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    These projects have all contributed to a more complete understanding of how forest watersheds function and have provided insights into the solution of energy-related problems associated with air pollution, contaminant transport, and forest nutrient dynamics. This is one of a few sites in the world characterized by long-term, intensive environmental studies. The Walker Branch Watershed website at http://walkerbranch.ornl.gov/ provides maps, photographs, and data on climate, precipitation, atmospheric deposition, stream discharge and runoff, stream chemistry, and vegetation. [Taken from http://walkerbranch.ornl.gov/ABOUTAAA.HTM

  13. Texas Watershed Planning Short Course Final Report 

    E-Print Network [OSTI]

    Wagner, Kevin

    2010-01-01

    , 2007 to August 31, 2008. ?e Contractor Performance Evaluation Reports for year three was submitted to TCEQ on September 17, ? 2009. Texas Watershed Planning Short Course Methods & Results 14 Objective 2: Develop Training Materials and Educational... Program for Watershed Planning Short Course Goal: To develop training materials for Watershed Planning Short Course. Task 2.1 Compiled and Summarized Existing Programs ? TWRI collected and compiled information about existing training programs. Below...

  14. WATERSHED ACADEMY WEB Introduction to Watershed Ecology http://www.epa.gov/watertrain

    E-Print Network [OSTI]

    Lawrence, Deborah

    are provided solely as a pointer to information that might be useful to EPA staff and the public. #12;WATERSHED and interrelationships occurring in watersheds, and how watershed structure and functions may vary in time and space in a system whose boundaries are determined by the cycles and flux of energy, materials and organisms

  15. Vermont Department of Environmental Conservation, Watershed Management...

    Open Energy Info (EERE)

    Vermont Department of Environmental Conservation, Watershed Management Division Surface Water Management Strategy Website Jump to: navigation, search OpenEI Reference LibraryAdd to...

  16. Vermont Department of Environmental Conservation, Watershed Management...

    Open Energy Info (EERE)

    Vermont Department of Environmental Conservation, Watershed Management Division Surface Water Management Strategy Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  17. Human HLTF mediates postreplication repair by its HIRAN domain-dependent replication fork remodelling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Achar, Yathish Jagadheesh; Balogh, David; Neculai, Dante; Juhasz, Szilvia; Morocz, Monika; Gali, Himabindu; Dhe-Paganon, Sirano; Venclovas, ?eslovas; Haracska, Lajos

    2015-09-08

    Defects in the ability to respond properly to an unrepaired DNA lesion blocking replication promote genomic instability and cancer. Human HLTF, implicated in error-free replication of damaged DNA and tumour suppression, exhibits a HIRAN domain, a RING domain, and a SWI/SNF domain facilitating DNA-binding, PCNA-polyubiquitin-ligase, and dsDNA-translocase activities, respectively. Here, we investigate the mechanism of HLTF action with emphasis on its HIRAN domain. We found that in cells HLTF promotes the filling-in of gaps left opposite damaged DNA during replication, and this postreplication repair function depends on its HIRAN domain. Our biochemical assays show that HIRAN domain mutant HLTF proteinsmore »retain their ubiquitin ligase, ATPase and dsDNA translocase activities but are impaired in binding to a model replication fork. These data and our structural study indicate that the HIRAN domain recruits HLTF to a stalled replication fork, and it also provides the direction for the movement of the dsDNA translocase motor domain for fork reversal. We suggest functional similarities between the HIRAN, the OB, the HARP2, and other domains found in certain motor proteins, which may explain why only a subset of DNA translocases can carry out fork reversal.« less

  18. Atomic force microscopy of nickel dot arrays with tuning fork and nanotube probe

    E-Print Network [OSTI]

    Chandrasekhar, Venkat

    Atomic force microscopy of nickel dot arrays with tuning fork and nanotube probe S. Rozhok,a) S microscopy are combined with the unique properties of carbon nanotubes to improve the spatial resolution of atomic force microscopy AFM images of nickel dot arrays. These arrays have high relief features

  19. Abstract--Thirty-three skipjack tuna (Katsuwonus pelamis) (53-73 cm fork

    E-Print Network [OSTI]

    379 Abstract--Thirty-three skipjack tuna (Katsuwonus pelamis) (53-73 cm fork length) were caught) Vertical movement patterns of skipjack tuna (Katsuwonus pelamis) in the eastern equatorial Pacific Ocean, California 92037-1508 Limited information on the vertical movements of skipjack tuna (Kat- suwonus pelamis

  20. Storm water control plan for the Lower East Fork Poplar Creek Operable Unit, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-04-01

    This document provides the Environmental Restoration Program with information about the erosion and sediment control, storm water management, maintenance, and reporting and record keeping practices to be employed during Phase II of the remediation project for the Lower East Fork Poplar Creek (LEFPC) Operable Unit.

  1. C(re)ek-storation Community Collaboration Site: North Fork of Strawberry Creek by La Loma and Le Conte Avenues

    E-Print Network [OSTI]

    Tannenbaum, Sara Rose

    2011-01-01

    1987. Excerpts from: The Strawberry Creek Management Plan.and Vince Resh. 1992. Strawberry Creek on the University ofSite: North Fork of Strawberry Creek by La Loma and Le Conte

  2. Draft framework for watershed-based trading

    SciTech Connect (OSTI)

    1996-05-30

    Effluent trading is an innovative way for water quality agencies and community stakeholders to develop common-sense, cost-effective solutions for water quality problems in their watersheds. Trading can allow communities to grow and prosper while retaining their commitment to water quality. The bulk of this framework discusses effluent trading in watersheds. Remaining sections discuss transactions that, while not technically fulfilling the definition of `effluent` trade, do involve the exchange of valued water quality or other ecological improvements between partners responding to market initiatives. This document therefore includes activities such as trades within a facility (intra-plant trading) and wetland mitigation banking, effluent trading/watersheds/watershed management/water quality protection/water quality management.

  3. Pecos River Watershed Protection Plan Update 

    E-Print Network [OSTI]

    Gregory, L.; Hauck, L.; Blumenthal, B.; Brown, M.; Porter, A.

    2013-01-01

    not helped salinity conditions in the watershed as much lower than normal levels of fresh rainwater and snowmelt have entered the watershed. Despite adverse conditions, the need to reduce salinity levels in the river persists as the water quality needs... of constructing and operating a salt harvesting facility. When completed, the brine evaporation system will consist of four 20-acre holding ponds located 3 miles north of the well, a fiberglass distribution tank and approximately 3 miles of pipeline...

  4. Optimal Operation of Large Agricultural Watersheds with Water Quality Restraints 

    E-Print Network [OSTI]

    Williams, J. R.; Hann, R. W.

    1978-01-01

    Improved technology is needed for use in properly managing large agricultural watersheds. Proper watershed management means selecting land uses that are appropriate for each subarea, using erosion control measures where ...

  5. Wind River Watershed Restoration: 1999 Annual Report.

    SciTech Connect (OSTI)

    Connolly, Patrick J.

    2001-09-01

    This document represents work conducted as part of the Wind River Watershed Restoration Project during its first year of funding through the Bonneville Power Administration (BPA). The project is a comprehensive effort involving public and private entities seeking to restore water quality and fishery resources in the basin through cooperative actions. Project elements include coordination, watershed assessment, restoration, monitoring, and education. Entities involved with implementing project components are the Underwood Conservation District (UCD), USDA Forest Service (USFS), U.S. Geological Survey--Columbia River Research Lab (USGS-CRRL), and WA Department of Fish & Wildlife (WDFW). Following categories given in the FY1999 Statement of Work, the broad categories, the related objectives, and the entities associated with each objective (lead entity in boldface) were as follows: Coordination--Objective 1: Coordinate the Wind River watershed Action Committee (AC) and Technical Advisory Committee (TAC) to develop a prioritized list of watershed enhancement projects. Monitoring--Objective 2: Monitor natural production of juvenile, smolt, and adult steelhead in the Wind River subbasin. Objective 3: Evaluate physical habitat conditions in the Wind River subbasin. Assessment--Objective 4: Assess watershed health using an ecosystem-based diagnostic model that will provide the technical basis to prioritize out-year restoration projects. Restoration--Objective 5: Reduce road related sediment sources by reducing road densities to less than 2 miles per square mile. Objective 6: Rehabilitate riparian corridors, flood plains, and channel morphology to reduce maximum water temperatures to less than 61 F, to increase bank stability to greater than 90%, to reduce bankfull width to depth ratios to less than 30, and to provide natural levels of pools and cover for fish. Objective 7: Maintain and evaluate passage for adult and juvenile steelhead at artificial barriers. Education--Objective 8: Promote watershed stewardship among students, the community, private landowners, and local governments. Progress towards six of eight of these objectives is described within nine separate reports included in a four-volume document.

  6. Photo-thermal quartz tuning fork excitation for dynamic mode atomic force microscope

    SciTech Connect (OSTI)

    Bontempi, Alexia; Teyssieux, Damien; Thiery, Laurent; Hermelin, Damien; Vairac, Pascal; Friedt, Jean-Michel

    2014-10-13

    A photo-thermal excitation of a Quartz Tuning Fork (QTF) for topographic studies is introduced. The non-invasive photo-thermal excitation presents practical advantages compared to QTF mechanical and electrical excitations, including the absence of the anti-resonance and its associated phase rotation. Comparison between our theoretical model and experiments validate that the optical transduction mechanism is a photo-thermal rather than photo-thermoacoustic phenomenon. Topographic maps in the context of near-field microscopy distance control have been achieved to demonstrate the performance of the system.

  7. Thermoelastic investigation of a quartz tuning fork used in infrared spectroscopy

    SciTech Connect (OSTI)

    Spajer, M. Cavallier, B.; Euphrasie, S.; Matten, G.; Vacheret, X.; Vairac, P.; Vernier, D.; Jalocha, A.

    2013-11-11

    The performances of quartz tuning forks (QTF) used in infrared spectroscopy for pollutant detection are investigated. The transduction between light and QTF vibration is elucidated, thanks to QTF encapsulation under vacuum. From the sensitivity enhancement which is obtained, we conclude that their interaction is photo-thermoelastic rather than photo-thermoacoustic. A mapping of the local sensitivity of the QTF is obtained by scanning its faces with the excitation probe beam. The comparison between the signal mapping and the theoretical strain mapping indicates that the most efficient areas of the QTF correspond to the areas where the strain or stress is the highest.

  8. Integrated Outcrop and Subsurface Studies of the Interwell Environment of Carbonate Reservoirs: Clear Fork (Leonaradian Age) Reservoirs, West Texas and New Mexico

    SciTech Connect (OSTI)

    Lucia, F. Jerry; Laubach, Stephen E.

    2001-05-08

    The objective of this report is to characterize fracture porosity and distribution in the Wasson Clear Fork reservoir and to determine the effects of fractures on well performance. The approach is to measure fracture attributes in an analog outcrop, to develop models of fracture spacing and aperture, and to apply this information to the South Wasson Clear Fork reservoir.

  9. Hydrologic and Ecological Effects of Watershed Urbanization: Implication for Watershed Management in Hillslope Regions 

    E-Print Network [OSTI]

    Sung, Chan Yong

    2011-08-08

    maps extracted from remote sensing images; 2) examining the effect of urbanization on hydrologic regime; and 3) investigating a relationship between watershed urbanization and ecosystem invasibility of a riparian forest. I studied twelve riparian...

  10. Sources of Mercury to East Fork Poplar Creek Downstream from the Y-12 National Security Complex: Inventories and Export Rates

    SciTech Connect (OSTI)

    Southworth, George R [ORNL; Greeley Jr, Mark Stephen [ORNL; Peterson, Mark J [ORNL; Lowe, Kenneth Alan [ORNL; Ketelle, Richard H [ORNL; Floyd, Stephanie B [ORNL

    2010-02-01

    East Fork Poplar Creek (EFPC) in Oak Ridge, Tennessee, has been heavily contaminated with mercury (also referred to as Hg) since the 1950s as a result of historical activities at the U.S. Department of Energy (DOE) Y-12 National Security Complex (formerly the Oak Ridge Y-12 Plant and hereinafter referred to as Y-12). During the period from 1950 to 1963, spills and leaks of elemental mercury (Hg{sup 0}) contaminated soil, building foundations, and subsurface drainage pathways at the site, while intentional discharges of mercury-laden wastewater added 100 metric tons of mercury directly to the creek (Turner and Southworth 1999). The inventory of mercury estimated to be lost to soil and rock within the facility was 194 metric tons, with another estimated 70 metric tons deposited in floodplain soils along the 25 km length of EFPC (Turner and Southworth 1999). Remedial actions within the facility reduced mercury concentrations in EFPC water at the Y-12 boundary from > 2500 ng/L to about 600 ng/L by 1999 (Southworth et al. 2000). Further actions have reduced average total mercury concentration at that site to {approx}300 ng/L (2009 RER). Additional source control measures planned for future implementation within the facility include sediment/soil removal, storm drain relining, and restriction of rainfall infiltration within mercury-contaminated areas. Recent plans to demolish contaminated buildings within the former mercury-use areas provide an opportunity to reconstruct the storm drain system to prevent the entry of mercury-contaminated water into the flow of EFPC. Such actions have the potential to reduce mercury inputs from the industrial complex by perhaps as much as another 80%. The transformation and bioaccumulation of mercury in the EFPC ecosystem has been a perplexing subject since intensive investigation of the issue began in the mid 1980s. Although EFPC was highly contaminated with mercury (waterborne mercury exceeded background levels by 1000-fold, mercury in sediments by more than 2000-fold) in the 1980s, mercury concentrations in EFPC fish exceeded those in fish from regional reference sites by only a little more than 10-fold. This apparent low bioavailability of mercury in EFPC, coupled with a downstream pattern of mercury in fish in which mercury decreased in proportion to dilution of the upstream source, lead to the assumption that mercury in fish would respond to decreased inputs of dissolved mercury to the stream's headwaters. However, during the past two decades when mercury inputs were decreasing, mercury concentrations in fish in Lower EFPC (LEFPC) downstream of Y-12 increased while those in Upper EFPC (UEFPC) decreased. The key assumption of the ongoing cleanup efforts, and concentration goal for waterborne mercury were both called into question by the long-term monitoring data. The large inventory of mercury within the watershed downstream presents a concern that the successful treatment of sources in the headwaters may not be sufficient to reduce mercury bioaccumulation within the system to desired levels. The relative importance of headwater versus floodplain mercury sources in contributing to mercury bioaccumulation in EFPC is unknown. A mercury transport study conducted by the Tennessee Valley Authority (TVA) in 1984 estimated that floodplain sources contributed about 80% of the total annual mercury export from the EFPC system (ORTF 1985). Most of the floodplain inputs were associated with wet weather, high flow events, while much of the headwater flux occurred under baseflow conditions. Thus, day-to-day exposure of biota to waterborne mercury was assumed to be primarily determined by the Y-12 source. The objective of this study was to evaluate the results of recent studies and monitoring within the EFPC drainage with a focus on discerning the magnitude of floodplain mercury sources and how long these sources might continue to contaminate the system after headwater sources are eliminated or greatly reduced.

  11. Chapter 4, Section 4.2 South Fork Salmon River MPG Spg/Sum Chinook Status and Recovery (Draft describes habitat-related limiting factors, threats, strategies and actions)

    E-Print Network [OSTI]

    a largely genetically cohesive grouping of summer run Chinook returning to the South Fork Salmon RiverChapter 4, Section 4.2 South Fork Salmon River MPG Spg/Sum Chinook Status and Recovery (Draft.2 Status and Recovery of South Fork Salmon River MPG in the Snake River Spring/Summer Chinook Salmon ESU

  12. Landslides After Clearcut Logging in a Coast Redwood Forest1

    E-Print Network [OSTI]

    and Spittler (1998). The North Fork Caspar Creek watershed is underlain by marine sandstones and siltstones

  13. Wildfire, Ryegrass Seeding, and Watershed Rehabilitation1

    E-Print Network [OSTI]

    Wildfire, Ryegrass Seeding, and Watershed Rehabilitation1 R. D. Taskey, C.L. Curtis, and J. Stone2, emergency rehabilitation practice following wildfire in California. Replicated study plots on unseeded plots. These results suggest that ryegrass seeding for emergency rehabilitation of burned areas

  14. A PROPOSED INTERNATIONAL WATERSHED RESEARCH NETWORK

    E-Print Network [OSTI]

    ) specify other data sources on erosion, sediment transport, hydrology, and ancillary information and Forestry, Yangling, Shaanxi Province, China (Gray et al., in press). The Centers provide a formal mechanism and compilation of watershed information, and data access. This approach applies to the strategies of observation

  15. Optimizing Data Locality for Fork/Join Programs Using Constrained Work Stealing

    SciTech Connect (OSTI)

    Lifflander, Jonathan; Krishnamoorthy, Sriram; Kale, Laxmikant

    2014-11-16

    We present an approach to improving data locality across different phases of fork/join programs scheduled using work stealing. The approach consists of: (1) user-specified and automated approaches to constructing a steal tree, the schedule of steal operations and (2) constrained work stealing algorithms that constrain the actions of the scheduler to mirror a given steal tree. These are combined to construct work stealing schedules that maximize data locality across computation phases while ensuring load balance within each phase. These algorithms are also used to demonstrate dynamic coarsening, an optimization to improve spatial locality and sequential overheads by combining many finer-grained tasks into coarser tasks while ensuring sufficient concurrency for locality-optimized load balance. Implementation and evaluation in Cilk demonstrate performance improvements of up to 2.5x on 80 cores. We also demonstrate that dynamic coarsening can combine the performance benefits of coarse task specification with the adaptability of finer tasks.

  16. Predicting Flows in Semi-Arid Watersheds Using GIS Technologies

    E-Print Network [OSTI]

    Wright, Richard

    2002-01-01

    Semi-Arid Watersheds Using GIS Technologies Richard Wrightgeographic information system (GIS) technologies to developongoing project to create a GIS-database for the San Diego–

  17. Project Reports for Yukon River Inter-Tribal Watershed Council

    Broader source: Energy.gov [DOE]

    The Yukon River Inter-Tribal Watershed Council (YRITWC) is an international organization with 501(c)(3) nonprofit status in the United States and Societal Status in Canada.

  18. The watershed-scale optimized and rearranged landscape design...

    Office of Scientific and Technical Information (OSTI)

    The watershed-scale optimized and rearranged landscape design (WORLD) model and local biomass processing depots for sustainable biofuel production: Integrated life cycle...

  19. Coming to a watershed near you!: Texas Watershed Steward educates stakeholders across the state 

    E-Print Network [OSTI]

    Jordan, Leslie

    2009-01-01

    , assistant professor and AgriLife Extension water resources specialist. ] Story by Leslie Jordan tx H2O | pg. 12 The TWS team created the program in response to federal and state strategies regarding watersheds. According to the U.S. Environmental...

  20. Water Quality and Stormwater Contaminants in the Brunette River Watershed,

    E-Print Network [OSTI]

    #12;Water Quality and Stormwater Contaminants in the Brunette River Watershed, British Columbia in the Brunette 1994/95 Water Quality and Stormwater Contaminants in the Brunette River Watershed, British Westminster. Past and currently ongoing projects have studied the water, sediment, and biota within

  1. Bridge Creek Watershed Volunteer Lake Secchi Disk Monitoring Program

    E-Print Network [OSTI]

    #12;Bridge Creek Watershed Volunteer Lake Secchi Disk Monitoring Program 1996 DOE FRAP 1996-13 Ryan.C. December 1996 #12;ABSTRACT This document summarizes data collected during the first year of the Bridge transparency data from 22 lakes in the Bridge Creek watershed. Secchi depth readings were collected between May

  2. Bundling ecosystem services in the Panama Canal watershed

    E-Print Network [OSTI]

    regulation through carbon sequestration. The Panama Canal watershed is currently being reforested to protect not necessarily increase water sup- ply, but does increase carbon sequestration and timber production. water on dry-season water flows, timber production, and carbon sequestration across the watershed and to test

  3. REVIEW PAPER Watershed land use as a determinant of metal

    E-Print Network [OSTI]

    Mazumder, Asit

    REVIEW PAPER Watershed land use as a determinant of metal concentrations in freshwater systems- lating concentrations and behavior of metals in freshwater systems. Results from the review suggest metal­DOM­pH interactions) affect the metal concentrations in freshwater systems. Among the watershed

  4. Sources and transport of nitrogen in arid urban watersheds

    SciTech Connect (OSTI)

    Hale, Rebecca L.; Turnbull, Laura; Earl, Stevan; Grimm, Nancy B.; Riha, Krystin M.; Michalski, Greg; Lohse, Kathleen; Childers, Daniel L.

    2014-06-03

    Urban watersheds are often sources of nitrogen (N) to downstream systems, contributing to poor water quality. However, it is unknown which components (e.g., land cover and stormwater infrastructure type) of urban watersheds contribute to N export and which may be sites of retention. In this study we investigated which watershed characteristics control N sourcing, biogeochemical processing of nitrate (NO3–) during storms, and the amount of rainfall N that is retained within urban watersheds. We used triple isotopes of NO3– (?15N, ?18O, and ?17O) to identify sources and transformations of NO3– during storms from 10 nested arid urban watersheds that varied in stormwater infrastructure type and drainage area. Stormwater infrastructure and land cover—retention basins, pipes, and grass cover—dictated the sourcing of NO3– in runoff. Urban watersheds can be strong sinks or sources of N to stormwater depending on the proportion of rainfall that leaves the watershed as runoff, but we found no evidence that denitrification occurred during storms. Our results suggest that watershed characteristics control the sources and transport of inorganic N in urban stormwater but that retention of inorganic N at the timescale of individual runoff events is controlled by hydrologic, rather than biogeochemical, mechanisms.

  5. Confirmatory Sampling and Analysis Plan for the Lower East Fork Poplar Creek Operable Unit, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-12-01

    This document describes the organization, strategy, and procedures to be used to confirm that mercury concentrations in soils in the remediated areas are statistically less than, or equal to, the cleanup standard of 400 ppm. It focuses on confirming the cleanup of the stretch of the Lower East Fork Popular Creed flowing from Lake Reality at the Y-12 Plant, through the City of Oak Ridge, to Poplar Creek on the Oak Ridge Reservation and its associated flood plain.

  6. Bethel Valley Watershed | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p uBUSEnergy| DepartmentBethel Valley Watershed. Topics

  7. Community Interactions In Tropical Forest Restoration And Environmental Governance In The Panama Canal Watershed

    E-Print Network [OSTI]

    Schweizer, Daniella

    2012-01-01

    AND ENVIRONMENTAL GOVERNANCE IN THE PANAMA CANAL WATERSHED Daniella M. Schweizer ABSTRACT Increased global

  8. Grays River Watershed and Biological Assessment, 2006 Final Report.

    SciTech Connect (OSTI)

    May, Christopher; Geist, David

    2007-04-01

    The Grays River Watershed and Biological Assessment was funded to address degradation and loss of spawning habitat for chum salmon (Onchorhynchus keta) and fall Chinook salmon (Onchoryhnchus tshawytscha). In 1999, the National Marine Fisheries Service listed lower Columbia River chum salmon as a threatened Evolutionarily Significant Unit (ESU) under the Endangered Species Act of 1973 (ESA). The Grays River watershed is one of two remaining significant chum salmon spawning locations in this ESU. Runs of Grays River chum and Chinook salmon have declined significantly during the past century, largely because of damage to spawning habitat associated with timber harvest and agriculture in the watershed. In addition, approximately 20-25% of the then-remaining chum salmon spawning habitat was lost during a 1999 channel avulsion that destroyed an important artificial spawning channel operated by the Washington Department of Fish and Wildlife (WDFW). Although the lack of stable, high-quality spawning habitat is considered the primary physical limitation on Grays River chum salmon production today, few data are available to guide watershed management and channel restoration activities. The objectives of the Grays River Watershed and Biological Assessment project were to (1) perform a comprehensive watershed and biological analysis, including hydrologic, geomorphic, and ecological assessments; (2) develop a prioritized list of actions that protect and restore critical chum and Chinook salmon spawning habitat in the Grays River based on comprehensive geomorphic, hydrologic, and stream channel assessments; and (3) gain a better understanding of chum and Chinook salmon habitat requirements and survival within the lower Columbia River and the Grays River. The watershed-based approach to river ecosystem restoration relies on a conceptual framework that describes general relationships between natural landscape characteristics, watershed-scale habitat-forming processes, aquatic habitat conditions, and biological integrity. In addition, human land-use impacts are factored into the conceptual model because they can alter habitat quality and can disrupt natural habitat forming processes. In this model (Figure S.1), aquatic habitat--both instream and riparian--is viewed as the link between watershed conditions and biologic responses. Based on this conceptual model, assessment of habitat loss and the resultant declines in salmonid populations can be conducted by relating current and historical (e.g., natural) habitat conditions to salmonid utilization, diversity, and abundance. In addition, assessing disrupted ecosystem functions and processes within the watershed can aid in identifying the causes of habitat change and the associated decline in biological integrity. In this same way, restoration, enhancement, and conservation projects can be identified and prioritized. A watershed assessment is primarily a landscape-scale evaluation of current watershed conditions and the associated hydrogeomorphic riverine processes. The watershed assessment conducted for this project focused on watershed processes that form and maintain salmonid habitat. Landscape metrics describing the level of human alteration of natural ecosystem attributes were used as indicators of water quality, hydrology, channel geomorphology, instream habitat, and biotic integrity. Ecological (watershed) processes are related to and can be predicted based on specific aspects of spatial pattern. This study evaluated the hydrologic regime, sediment delivery regime, and riparian condition of the sub-watersheds that comprise the upper Grays River watershed relative to their natural range of conditions. Analyses relied primarily on available geographic information system (GIS) data describing landscape characteristics such as climate, vegetation type and maturity, geology and soils, topography, land use, and road density. In addition to watershed-scale landscape characteristics, the study area was also evaluated on the riparian scale, with appropriate landscape variables analyzed within

  9. Grays River Watershed and Biological Assessment Final Report 2006.

    SciTech Connect (OSTI)

    May, Christopher W.; McGrath, Kathleen E.; Geist, David R.; Abbe, Timothy; Barton, Chase

    2008-02-04

    The Grays River Watershed and Biological Assessment was funded to address degradation and loss of spawning habitat for chum salmon (Onchorhynchus keta) and fall Chinook salmon (Onchoryhnchus tshawytscha). In 1999, the National Marine Fisheries Service listed lower Columbia River chum salmon as a threatened Evolutionarily Significant Unit (ESU) under the Endangered Species Act of 1973 (ESA). The Grays River watershed is one of two remaining significant chum salmon spawning locations in this ESU. Runs of Grays River chum and Chinook salmon have declined significantly during the past century, largely because of damage to spawning habitat associated with timber harvest and agriculture in the watershed. In addition, approximately 20-25% of the then-remaining chum salmon spawning habitat was lost during a 1999 channel avulsion that destroyed an important artificial spawning channel operated by the Washington Department of Fish and Wildlife (WDFW). Although the lack of stable, high-quality spawning habitat is considered the primary physical limitation on Grays River chum salmon production today, few data are available to guide watershed management and channel restoration activities. The objectives of the Grays River Watershed and Biological Assessment project were to (1) perform a comprehensive watershed and biological analysis, including hydrologic, geomorphic, and ecological assessments; (2) develop a prioritized list of actions that protect and restore critical chum and Chinook salmon spawning habitat in the Grays River based on comprehensive geomorphic, hydrologic, and stream channel assessments; and (3) gain a better understanding of chum and Chinook salmon habitat requirements and survival within the lower Columbia River and the Grays River. The watershed-based approach to river ecosystem restoration relies on a conceptual framework that describes general relationships between natural landscape characteristics, watershed-scale habitat-forming processes, aquatic habitat conditions, and biological integrity. In addition, human land-use impacts are factored into the conceptual model because they can alter habitat quality and can disrupt natural habitat-forming processes. In this model (Figure S.1), aquatic habitat--both instream and riparian--is viewed as the link between watershed conditions and biologic responses. Based on this conceptual model, assessment of habitat loss and the resultant declines in salmonid populations can be conducted by relating current and historical (e.g., natural) habitat conditions to salmonid utilization, diversity, and abundance. In addition, assessing disrupted ecosystem functions and processes within the watershed can aid in identifying the causes of habitat change and the associated decline in biological integrity. In this same way, restoration, enhancement, and conservation projects can be identified and prioritized. A watershed assessment is primarily a landscape-scale evaluation of current watershed conditions and the associated hydrogeomorphic riverine processes. The watershed assessment conducted for this project focused on watershed processes that form and maintain salmonid habitat. Landscape metrics describing the level of human alteration of natural ecosystem attributes were used as indicators of water quality, hydrology, channel geomorphology, instream habitat, and biotic integrity. Ecological (watershed) processes are related to and can be predicted based on specific aspects of spatial pattern. This study evaluated the hydrologic regime, sediment delivery regime, and riparian condition of the sub-watersheds that comprise the upper Grays River watershed relative to their natural range of conditions. Analyses relied primarily on available geographic information system (GIS) data describing landscape characteristics such as climate, vegetation type and maturity, geology and soils, topography, land use, and road density. In addition to watershed-scale landscape characteristics, the study area was also evaluated on the riparian scale, with appropriate landscape variables analyzed within

  10. Kootenai River Focus Watershed Coordination, 2002-2003 Annual Report.

    SciTech Connect (OSTI)

    Munson, Bob; Munson, Vicki; Rogers, Rox

    2003-10-01

    The Kootenai River Network Inc. (KRN) was incorporated in Montana in early 1995 with a mission ''to involve stakeholders in the protection and restoration of the chemical, physical and biological integrity of the Kootenai River Basin waters''. The KRN operates with funding from donations, membership dues, private, state and federal grants, and with funding through the Bonneville Power Administration (BPA) for a Focus Watershed Coordinator Program. The Focus Watershed Program is administered to KRN as of October 2001, through a Memorandum of Understanding. Katie Randall resigned her position as Watershed Coordinator in late January 2003 and Munson Consulting was contracted to fill that position through the BPA contract period ending May 30, 2003. To improve communications with in the Kootenai River watershed, the board and staff engaged watershed stakeholders in a full day KRN watershed conference on May 15 and 16 in Bonners Ferry, Idaho. This Annual General Meeting was a tremendous success with over 75 participants representing over 40 citizen groups, tribes and state/provincial/federal agencies from throughout northern Montana and Idaho as well as British Columbia and Alberta. Membership in the KRN increased during the course of the BPA 02/03 grant period. The board of directors grew in numbers during this same time frame and an Advisory Council was formed to assist in transboundary efforts while developing two reorganized KRN committees (Habitat/Restoration/Monitoring (HRM) and Communication/Education/Outreach (CEO)). These committees will serve pivotal roles in communications, outreach, and education about watershed issues, as well as habitat restoration work being accomplished throughout the entire watershed. During this BPA grant period, the KRN has capitalized on the transboundary interest in the Kootenai River watershed. Jim and Laura Duncan of Kimberley, British Columbia, have been instrumental volunteers who have acted as Canadian liaisons to the KRN. As a result, restoration work is in the planning stages for Canadian tributaries that flow into the Moyie River in northern Idaho and the Yaak River in northwest Montana.

  11. Briefing and Ancillary Materials for Rocky Branch Watershed Tour

    E-Print Network [OSTI]

    James, L. Allan

    1 Briefing and Ancillary Materials for Rocky Branch Watershed Tour Allan James This briefing available on the Water as a Resource, Geog 347, website: http://people.cas.sc.edu/ajames/347 Go to Ancillary

  12. Modeling Onsite Wastewater Treatment Systems in the Dickinson Bayou Watershed 

    E-Print Network [OSTI]

    Forbis-Stokes, Aaron

    2012-10-19

    Onsite wastewater treatment systems (OWTSs) are a commonly used means of wastewater treatment in the Dickinson Bayou watershed which is located between Houston and Galveston. The Dickinson Bayou is classified as "impaired" by the Texas Commission...

  13. Public Service Announcements for the Arroyo Colorado Watershed 

    E-Print Network [OSTI]

    Berthold, Allen

    2011-01-01

    Institute Prepared for Texas General Land Office March 2011 Texas Water Resources Institute Technical Report No. 396 Texas A&M University System College Station, Texas 77843-2118 Public Service Announcements for the Arroyo... Colorado Watershed By T. Allen Berthold Texas Water Resources Institute Prepared for Texas General Land Office Texas Water Resources Institute Technical Report TR-396 March 2011 List of Acronyms ACWC ? Arroyo Colorad Watershed Coordinator ACWPP ? Arroyo...

  14. Department of Environmental Conservation, University of Massachusetts-Amherst Concentration in Water, Wetlands and Watersheds 1

    E-Print Network [OSTI]

    Schweik, Charles M.

    on water supply and allocation, water quality management, aquatic toxicology and bioremediation, stormwater in Water, Wetlands and Watersheds 1 Environmental Conservation Graduate Program Water, Wetlands want scientific training in the multi-disciplinary field of water, wetlands and watershed conservation

  15. Community Interactions In Tropical Forest Restoration And Environmental Governance In The Panama Canal Watershed

    E-Print Network [OSTI]

    Schweizer, Daniella

    2012-01-01

    2008. Plan de desarrollo sostenible y gestion integrada deWatershed (Plan de Desarrollo Sostenible y Gestion Integrada

  16. Fig. 1: (a) Tuning fork resonator with two electromechanical transistors on the outer tips of the nano-resonator, i.e. boxed region on the left.

    E-Print Network [OSTI]

    Ludwig-Maximilians-Universität, München

    Fig. 1: (a) Tuning fork resonator with two electromechanical transistors on the outer tips of the transistor: evaporated gold contacts on single crytalline silicon (purple) with spring constants k+/- . Nano-Electromechanical as a phase sensitive bi-polar current switch. Index Terms -- Nanotechnology, nano-electromechanical systems

  17. Sampling and analysis plan for treatment water and creek water for the Lower East Fork Poplar Creek Operable Unit, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-04-01

    This document provides the Environmental Restoration Program with information about the methodology, organizational structure, quality assurance and health and safety practices to be employed during the water sampling and analysis activities associated with the remediation of the Lower East Fork Poplar Creek Operable Unit during remediation of the National Oceanic and Atmospheric Administration and Bruner sites.

  18. Planning Grant Workshop Agenda for NSF I/UCRC on Smart Vehicle Concepts The Solitude, The Inn at Virginia Tech and Skelton Conference Center, 901 Prices Fork Road,

    E-Print Network [OSTI]

    Virginia Tech

    at Virginia Tech and Skelton Conference Center, 901 Prices Fork Road, Blacksburg, VA. 24061 540-231-8000, 877.20 ­14.40: Dr. Don Leo: VT-8. Polymer Transducers, Energy Storage Devices, and Power Sources 14.40 ­ 15

  19. USE OF A STOCHASTIC WEATHER GENERATOR IN A WATERSHED MODEL FOR STREAMFLOW SIMULATION

    E-Print Network [OSTI]

    USE OF A STOCHASTIC WEATHER GENERATOR IN A WATERSHED MODEL FOR STREAMFLOW SIMULATION by ADAM N OF A STOCHASTIC WEATHER GENERATOR IN A WATERSHED MODEL FOR STREAMFLOW SIMULATION written by Adam N. Hobson has and Architectural Engineering) Use of a Stochastic Weather Generator in a Watershed Model for Streamflow Simulation

  20. Hydrologic calibration of paired watersheds using a MOSUM approach

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ssegane, H.; Amatya, D. M.; Muwamba, A.; Chescheir, G. M.; Appelboom, T.; Tollner, E. W.; Nettles, J. E.; Youssef, M. A.; Birgand, F.; Skaggs, R. W.

    2015-01-09

    Paired watershed studies have historically been used to quantify hydrologic effects of land use and management practices by concurrently monitoring two neighboring watersheds (a control and a treatment) during the calibration (pre-treatment) and post-treatment periods. This study characterizes seasonal water table and flow response to rainfall during the calibration period and tests a change detection technique of moving sums of recursive residuals (MOSUM) to select calibration periods for each control-treatment watershed pair when the regression coefficients for daily water table elevation (WTE) were most stable to reduce regression model uncertainty. The control and treatment watersheds included 1–3 year intensively managedmore »loblolly pine (Pinus taeda L.) with natural understory, same age loblolly pine intercropped with switchgrass (Panicum virgatum), 14–15 year thinned loblolly pine with natural understory (control), and switchgrass only. Although monitoring during the calibration period spanned 2009 to 2012, silvicultural operational practices that occurred during this period such as harvesting of existing stand and site preparation for pine and switchgrass establishment may have acted as external factors, potentially shifting hydrologic calibration relationships between control and treatment watersheds. Results indicated that MOSUM was able to detect significant changes in regression parameters for WTE due to silvicultural operations. This approach also minimized uncertainty of calibration relationships which could otherwise mask marginal treatment effects. All calibration relationships developed using this MOSUM method were quantifiable, strong, and consistent with Nash–Sutcliffe Efficiency (NSE) greater than 0.97 for WTE and NSE greater than 0.92 for daily flow, indicating its applicability for choosing calibration periods of paired watershed studies.« less

  1. Supplement Analysis for the Watershed Management Program EIS - John Day Watershed Restoration Program

    SciTech Connect (OSTI)

    N /A

    2004-08-04

    The Bonneville Power Administration (BPA) is proposing to fund the John Day Watershed Restoration Program, which includes projects to improve watershed conditions, resulting in improved fish and wildlife habitat. The project was planned and coordinated by the Confederated Tribes of the Warm Springs through the John Day Basin Office in Prairie City, Oregon. A variety of activities will be implemented, described below. The project will involve the installation of four permanent lay flat diversions (structures) to replace temporary diversions. Two structures would be constructed in Beech Creek, one in Little Beech Creek and one in the John Day River. The structures will replace temporary pushup dams, which were constructed annually of various materials. Installation of the permanent diversion structures eliminates the stream-disturbing activities associated with annual installation of temporary structures. They also will enable fish passage in all flow conditions, an improvement over the temporary structures which can obstruct fish passage under some conditions. Five scour chains will be installed in six sites within the John Day River. The chains will be 3 feet long and consist of 1/4 inch chain. They will be buried within the streambed to monitor the movement of material in the streambed. Other activities that will be implemented include: Installation of off-site water systems in areas where fencing and revegetation projects are implemented, in order to restrict livestock access to waterways; construction of facilities to return irrigation flows to the Johns Day River, including the installation of pipe to replace failing drains or return ditches; installation of pumps to replace temporary diversions; and removal of junipers from approximately 500 acres per year by hand felling.

  2. Phase 2 confirmatory sampling data report, Lower East Fork Poplar Creek, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1998-01-01

    A Remedial Investigation of East Fork Poplar Creek (EFPC) concluded that mercury is the principal contaminant of concern in the EFPC floodplain. The highest concentrations of mercury were found to be in a visually distinct black layer of soil that typically lies 15 to 30 cm (6 to 12 in.) below the surface. Mercury contamination was found to be situated in distinct areas along the floodplain, and generally at depths > 20 cm (8 in.) below the surface. In accordance with Comprehensive, Environmental Response, Compensation, and Liability Act (CERCLA), a feasibility study was prepared to assess alternatives for remediation, and a proposed plan was issued to the public in which a preferred alternative was identified. In response to public input, the plan was modified and US Department of Energy (DOE) issued a Record of Decision in 1995 committing to excavating all soil in the EFPC floodplain exceeding a concentration of 400 parts per million (ppm) of mercury. The Lower East Fork Poplar Creek (LEFPC) remedial action (RA) focuses on the stretch of EFPC flowing from Lake Reality at the Y-12 Plant, through the city of Oak Ridge, to Poplar Creek on the Oak Ridge Reservation (ORR) and its associated floodplain. Specific areas were identified that required remediation at the National Oceanographic and Atmospheric Administration (NOAA) Site along Illinois Avenue and at the Bruner Site along the Oak Ridge Turnpike. The RA was conducted in two separate phases. Phase 2, conducted from February to October 1997, completed the remediation efforts at the NOAA facility and fully remediated the Bruner Site. During both phases, data were collected to show that the remedial efforts performed at the NOAA and Bruner sites were successful in implementing the Record of Decision and had no adverse impact on the creek water quality or the city of Oak Ridge publicly owned treatment works.

  3. how new hampshire's coastal watershed communities are addressing growth

    E-Print Network [OSTI]

    New Hampshire, University of

    how new hampshire's coastal watershed communities are addressing growth Setting Goals, Redefining Boundaries #12;Amanda Stone, NROC Coordinator University of New Hampshire Cooperative Extension 36 County University of New Hampshire Cooperative Extension/ New Hampshire Sea Grant Kingman Farm University of New

  4. WATERSHED MANAGEMENT PLANNING IN A MOUNTAIN RESORT COMMUNITY

    E-Print Network [OSTI]

    WATERSHED MANAGEMENT PLANNING IN A MOUNTAIN RESORT COMMUNITY: A CASE STUDY OF WHISTLER'S CRABAPPLE at local and municipal scales. As part of an overall movement towards sustainability, the mountain resort and visitors in a natural mountain environment. From a tourism perspective, Whistler faces the challenge

  5. Tidal networks 2. Watershed delineation and comparative network morphology

    E-Print Network [OSTI]

    Fagherazzi, Sergio

    of three, we quantify various tidal network properties including common power law relationships which have common power law relationships quantified for terrestrial systems to tidal systems and use these analysesTidal networks 2. Watershed delineation and comparative network morphology Andrea Rinaldo,1 Sergio

  6. Nitrogen Fluxes and Retention in Urban Watershed Ecosystems

    E-Print Network [OSTI]

    at Baltimore County, Baltimore, Maryland 21227, USA; 4 US Geological Survey, Baltimore, Maryland 21237, USA, forested, and agricultural watersheds. The work is a product of the Baltimore Ecosystem Study, a long- term of these areas (Pickett and others 2001). Two urban ecosystem research sites (Baltimore and Central Ar- izona

  7. The Institute for Water & Watersheds Annual Technical Report

    E-Print Network [OSTI]

    The Institute for Water & Watersheds Annual Technical Report FY 2011 The Institute for Water teach and conduct research in areas related to fresh water supply and quality. These faculty members, ecology, geosciences, social sciences, economics and the arts. OSU also hosts a vibrant Water Resource

  8. The Institute for Water & Watersheds (IWW) Annual Technical Report

    E-Print Network [OSTI]

    The Institute for Water & Watersheds (IWW) Annual Technical Report FY 2010 The Institute for Water faculty teach and conduct research in areas related to fresh water supply and quality. These faculty engineering, ecology, geosciences, social sciences, economics and arts. OSU also hosts a vibrant Water

  9. The Institute for Water & Watersheds (IWW) Annual Technical Report

    E-Print Network [OSTI]

    The Institute for Water & Watersheds (IWW) Annual Technical Report FY 2009 The Institute for Water the difficulties caused by water limitations. Water quantity and quality issues in the Willamette, Klamath, and Umatilla basins are the Governor's top environmental and water allocation priorities. This situation

  10. The Institute for Water & Watersheds Annual Technical Report

    E-Print Network [OSTI]

    The Institute for Water & Watersheds Annual Technical Report FY 2013 The Institute for Water caused by water limitations. Water quantity and quality issues in the Willamette, Klamath, and Umatilla Basins are the Governor's top environmental and water allocation priorities. This situation is paralleled

  11. The Institute for Water & Watersheds Annual Technical Report

    E-Print Network [OSTI]

    The Institute for Water & Watersheds Annual Technical Report FY 2012 The Institute for Water caused by water limitations. Water quantity and quality issues in the Willamette, Klamath, and Umatilla Basins are the Governor's top environmental and water allocation priorities. This situation is paralleled

  12. Cattle Production Practices in Grazed Watersheds of the Humid Region

    E-Print Network [OSTI]

    1 Cattle Production Practices in Grazed Watersheds of the Humid Region USDA Proposal Number 2001 Section 406 Integrated Research, Education, and Extension grant for a two-year period to study cattle than 600,000 cattle position points were collected over eight GPS data collection periods spanning two

  13. LINKING WATER QUALITY WITH AGRICULTURAL INTENSIFICATION IN A RURAL WATERSHED

    E-Print Network [OSTI]

    Short, Daniel

    , agricultural pollution, animal waste, land-water interactions, nitrate, nitrogen surplus, nonpoint source pollution, water pollution, watershed management 1. Background Agriculture is rapidly emerging not require extra nutrients. Animal waste is primarily applied to soils, Water, Air, and Soil Pollution 127

  14. Big Bayou Creek and Little Bayou Creek Watershed Monitoring Program

    SciTech Connect (OSTI)

    Kszos, L.A.; Peterson, M.J.; Ryon; Smith, J.G.

    1999-03-01

    Biological monitoring of Little Bayou and Big Bayou creeks, which border the Paducah Site, has been conducted since 1987. Biological monitoring was conducted by University of Kentucky from 1987 to 1991 and by staff of the Environmental Sciences Division (ESD) at Oak Ridge National Laboratory (ORNL) from 1991 through March 1999. In March 1998, renewed Kentucky Pollutant Discharge Elimination System (KPDES) permits were issued to the US Department of Energy (DOE) and US Enrichment Corporation. The renewed DOE permit requires that a watershed monitoring program be developed for the Paducah Site within 90 days of the effective date of the renewed permit. This plan outlines the sampling and analysis that will be conducted for the watershed monitoring program. The objectives of the watershed monitoring are to (1) determine whether discharges from the Paducah Site and the Solid Waste Management Units (SWMUs) associated with the Paducah Site are adversely affecting instream fauna, (2) assess the ecological health of Little Bayou and Big Bayou creeks, (3) assess the degree to which abatement actions ecologically benefit Big Bayou Creek and Little Bayou Creek, (4) provide guidance for remediation, (5) provide an evaluation of changes in potential human health concerns, and (6) provide data which could be used to assess the impact of inadvertent spills or fish kill. According to the cleanup will result in these watersheds [Big Bayou and Little Bayou creeks] achieving compliance with the applicable water quality criteria.

  15. Stormwater Programs offered to Communities in New Hampshire's Coastal Watershed

    E-Print Network [OSTI]

    New Hampshire, University of

    Stormwater Programs offered to Communities in New Hampshire's Coastal Watershed Protecting Water Resources and Managing Stormwater: A Bird's Eye View Provides information about on-the-ground actions for communities to improve stormwater management from landscape to site level scales. Facilitated discussion helps

  16. A Scientific Basis for the Prediction of Cumulative Watershed Effects

    E-Print Network [OSTI]

    of California Committee on Cumulative Watershed Effects WILDLAND RESOURCES CENTER Division of Agriculture and Natural Resources University of California Berkeley, California 94720 Report No. 46 June 2001 #12;A CENTER Division of Agriculture and Natural Resources University of California Bekeley, California 94720

  17. Berry Brook Watershed 2011 Rain Barrel Sale for Dover Residents

    E-Print Network [OSTI]

    . Allowing rain water to soak into the soil decreases stormwater runoff and helps recharge your groundwaterBerry Brook Watershed 2011 Rain Barrel Sale for Dover Residents Order Online: www Road Dover, NH 03824 Final day to ORDER: Orders must reach SkyJuice by June 18 Pick up your Rain Barrel

  18. ABSTRACT: The ability of a watershed model to mimic specified watershed processes is assessed through the calibration and valida-

    E-Print Network [OSTI]

    Chaubey, Indrajeet

    model was implemented in the Beaver Reservoir Watershed of Northwest Arkansas. The objectives were to model; (2) conduct sensitivity analysis; and (3) perform calibration and validation at three different of the model is a key factor in reducing uncertainty and increasing user confidence in its predictive abilities

  19. An Assessment of health risk associated with mercury in soil and sediment from East Fork Poplar Creek, Oak Ridge, Tennessee. Final report

    SciTech Connect (OSTI)

    Revis, N.; Holdsworth, G.; Bingham, G.; King, A.; Elmore, J.

    1989-04-01

    This report presents results from a study conducted to determine the toxicity of Mercury in soils sediments samples. Mice were fed via diet, soils and sediment, from various locations along the East Fork Poplar creek. Tissue distribution of pollutants was determined at various intervals. The tissue level relative to toxicity was used to determine the effect of a complex matrix on the gastrointestinal absorption and tissue distribution of the pollutants (other pollutants included cadmium and selenium).

  20. A Progress Report for the Arroyo Colorado Watershed Protection Plan 

    E-Print Network [OSTI]

    Bertold, Allen; Flores, Jaime

    2011-01-01

    biological treatment projects such as reuse via irrigation, polishing ponds and constructed wetland cells. Status ? Multiple wastewater effluent limits have been reduced and this is further reported in the milestones section of this document. 6... water effluent for irrigation will increase in the next five years according to the WWTP operators. This table outlines the total list of milestones and their current status Table 7 Arroyo Colorado Watershed Milestones: Wastewater Reuse...

  1. Montana Watershed Protection Section Contacts Webpage | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation Montana Watershed Protection Section Contacts Webpage

  2. Montana Watershed Restoration Plans Wiki | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation Montana Watershed Protection Section Contacts

  3. Course helps professionals develop watershed protection plans: Texas water resources professionals gather 

    E-Print Network [OSTI]

    Jensen, Ric

    2008-01-01

    tx H2O | pg. 6 Story by Ric Jensen Course helps professionals develop watershed protection plans | pg. 6 tx H2O | pg. 7 W ater resources professionals wanting training on watershed protection plan development are benefiting from a course... AgriLife Research, the River Systems Institute at Texas State University, Texas Institute for Applied Environmental Research at Tarleton State University, and the U.S. Environmental Protection Agency (EPA) to create the Texas Watershed Planning...

  4. INTEGRATED OUTCROP AND SUBSURFACE STUDIES OF THE INTERWELL ENVIRONMENT OF CARBONATE RESERVOIRS: CLEAR FORK (LEONARDIAN-AGE) RESERVOIRS, WEST TEXAS AND NEW MEXICO

    SciTech Connect (OSTI)

    F. Jerry Lucia

    2002-01-31

    This is the final report of the project ''Integrated Outcrop and Subsurface Studies of the Interwell Environment of Carbonate Reservoirs: Clear Fork (Leonardian-Age) Reservoirs, West Texas and New Mexico'', Department of Energy contract no. DE-AC26-98BC15105 and is the third in a series of similar projects funded jointly by the U.S. Department of Energy and The University of Texas at Austin, Bureau of Economic Geology, Reservoir Characterization Research Laboratory for Carbonates. All three projects focus on the integration of outcrop and subsurface data for the purpose of developing improved methods for modeling petrophysical properties in the interwell environment. The first project, funded by contract no. DE-AC22-89BC14470, was a study of San Andres outcrops in the Algerita Escarpment, Guadalupe Mountains, Texas and New Mexico, and the Seminole San Andres reservoir, Permian Basin. This study established the basic concepts for constructing a reservoir model using sequence-stratigraphic principles and rock-fabric, petrophysical relationships. The second project, funded by contract no. DE-AC22-93BC14895, was a study of Grayburg outcrops in the Brokeoff Mountains, New Mexico, and the South Cowden Grayburg reservoir, Permian Basin. This study developed a sequence-stratigraphic succession for the Grayburg and improved methods for locating remaining hydrocarbons in carbonate ramp reservoirs. The current study is of the Clear Fork Group in Apache Canyon, Sierra Diablo Mountains, West Texas, and the South Wasson Clear Fork reservoir, Permian Basin. The focus was on scales of heterogeneity, imaging high- and low-permeability layers, and the impact of fractures on reservoir performance. In this study (1) the Clear Fork cycle stratigraphy is defined, (2) important scales of petrophysical variability are confirmed, (3) a unique rock-fabric, petrophysical relationship is defined, (4) a porosity method for correlating high-frequency cycles and defining rock-fabric flow layers is described, (5) Clear Fork fractures are described and geomechanical modeling of fractures is investigated, and (6) most importantly, new statistical methods are developed for scaleup of petrophysical properties from the core to the layer scale and for retaining stratigraphic layering in simulation models.

  5. Second report on the Oak Ridge Y-12 Plant Biological Monitoring and Abatement Program for East Fork Poplar Creek

    SciTech Connect (OSTI)

    Hinzman, R.L.; Adams, S.M.; Black, M.C.

    1993-06-01

    As stipulated in the National Pollutant Discharge Elimination System (NDPES) permit issued to the Oak Ridge Y-12 Plant on May 24, 1986, a Biological Monitoring and Abatement Program (BMAP) was developed for the receiving stream, East Fork Poplar Creek (EFPC). The objectives of BMAP are (1) to demonstrate that the current effluent limitations established for the Y-12 Plant protect the classified uses of EFPC (e.g., the growth and propagation of fish and aquatic life), as designated by the Tennessee Department of Environment and Conservation (TDEC) and (2) to document the ecological effects resulting from implementation of a Water Pollution Control Program that includes construction of several large wastewater treatment facilities. BMAP consists of four major tasks: (1) ambient toxicity testing; (2) bioaccumulation studies; (3) biological indicator studies; and (4) ecological surveys of stream communities, including periphyton (attached algae), benthic (bottom-dwelling) macroinvertebrates, and fish. This document, the second in a series of reports on the results of the Y-12 Plant BMAP, describes studies that were conducted between July 1986 and July 1988, although additional data collected outside this time period are included, as appropriate.

  6. First report on the Oak Ridge Y-12 Plant Biological Monitoring and Abatement Program for East Fork Poplar Creek

    SciTech Connect (OSTI)

    Loar, J.M.; Adams, S.M.; Allison, L.J.; Boston, H.L.; Huston, M.A.; McCarthy, J.F.; Smith, J.G.; Southworth, G.R.; Stewart, A.J. (Oak Ridge National Lab., TN (United States)); Black, M.C. (Oklahoma State Univ., Stillwater, OK (United States)); Gatz, A.J. Jr. (Ohio Wesleyan Univ., Delaware, OH (United States)); Hinzman, R.L. (Oak Ridge Research Inst., TN (United States)); Jimenez, B.D. (Puerto Rico Univ.,

    1992-07-01

    As stipulated in the National Pollutant Discharge Elimination System (NPDES) permit issued to the Oak Ridge Y-12 Plant on May 24, 1985, a Biological Monitoring and Abatement Program (BMAP) was developed for the receiving stream, East Fork Poplar Creek (EFPC). The objectives of the BMAP are (1) to demonstrate that the current effluent limitations established for the Oak Ridge Y-12 Plant protect the uses of EFPC (e.g., the growth and propagation of fish and aquatic life), as designated by the Tennessee Department of Environment and Conservation (TDEC) [formerly the Tennessee Department of Health and Environment (TDHE)], and (2) to document the ecological effects resulting from implementation of a water pollution control program that includes construction of several large wastewater treatment facilities. The BMAP consists of four major tasks: (1) ambient toxicity testing, (2) bioaccumulation studies, (3) biological indicator studies, and (4) ecological surveys of stream communities, including periphyton (attached algae), benthic macroinvertebrates, and fish. This document, the first in a series of reports on the results of the Y-12 Plant BMAP, describes studies that were conducted from May 1985 through September 1986.

  7. Asotin Creek Model Watershed Plan: Asotin County, Washington, 1995.

    SciTech Connect (OSTI)

    Browne, Dave

    1995-04-01

    The Northwest Power Planning Council completed its ``Strategy for Salmon'' in 1992. This is a plan, composed of four specific elements,designed to double the present production of 2.5 million salmon in the Columbia River watershed. These elements have been called the ``four H's'': (1) improve harvest management; (2) improve hatcheries and their production practices; (3) improve survival at hydroelectric dams; and (4) improve and protect fish habitat. The Asotin Creek Model Watershed Plan is the first to be developed in Washington State which is specifically concerned with habitat protection and restoration for salmon and trout. The plan is consistent with the habitat element of the ``Strategy for Salmon''. Asotin Creek is similar in many ways to other salmon-bearing streams in the Snake River system. Its watershed has been significantly impacted by human activities and catastrophic natural events, such as floods and droughts. It supports only remnant salmon and trout populations compared to earlier years. It will require protection and restoration of its fish habitat and riparian corridor in order to increase its salmonid productivity.

  8. EIS-0265: Watershed Management Program in Oregon, Idaho, Washington and Montana

    Broader source: Energy.gov [DOE]

    This EIS analyzes BPA's proposal to adopt a set of prescriptions (goals, strategies, and procedural requirements) that apply to future BPA-funded watershed management projects.

  9. TRACING THE CONTAMINANT HISTORY OF AN URBAN WATERSHED THROUGH AN EXAMINATION OF AQUATIC

    E-Print Network [OSTI]

    TRACING THE CONTAMINANT HISTORY OF AN URBAN WATERSHED THROUGH AN EXAMINATION OF AQUATIC SEDIMENTS DOE FRAP 1998-24 Prepared for: Environment Canada Environmental Conservation Branch Aquatic

  10. An Evaluation of the Collaboration Towards Ecosystem Objectives and a Watershed Vision

    E-Print Network [OSTI]

    #12;An Evaluation of the Collaboration Towards Ecosystem Objectives and a Watershed Vision ....................................................................................................7 3.1 Social and Economic Profile ...........................................................8 4.0 Case Study Evaluation

  11. Watershed analysis tool for environmental resources: GIS technology in the new millennium

    E-Print Network [OSTI]

    2000-01-01

    Tool for Environmental Resources: GIS Technology in the Newis using the latest in ESRI GIS to provide resource managersapplication with embedded GIS to facilitate watershed

  12. Microbial Risk Perspective on the Temporal and Spatial Variability of Indicator Bacteria in Texas Urban and Rural Watersheds 

    E-Print Network [OSTI]

    Srinivasan Ravichandran, Sriambharrish

    2012-07-16

    concentrations, spatial and temporal variability, and microbial risks were evaluated in two rural watersheds, the Bosque and Leon Rivers, and one predominantly urban watershed, the San Jacinto River, all in Texas. Human health risk was predicted from...

  13. Production of stream habitat gradients by montane watersheds: hypothesis tests based on

    E-Print Network [OSTI]

    that lotic communities are structured by the quality and quantity of energy inputs to a streamProduction of stream habitat gradients by montane watersheds: hypothesis tests based on spatially of mountain watersheds interact to cause gradients in three stream attributes: baseflow stream widths, total

  14. Simple Estimation of Prevalence of Hortonian Flow in New York City Watersheds

    E-Print Network [OSTI]

    Walter, M.Todd

    Simple Estimation of Prevalence of Hortonian Flow in New York City Watersheds M. Todd Walter, M of the prevalence of infiltration excess runoff i.e., Hortonian flow for undeveloped areas within New York City NYC of the primary controls on saturation excess runoff, especially in the New York City NYC watersheds. Saturation

  15. DEVELOPING A STRATEGY FOR BUILDING SOCIAL CAPITAL AND SUCCESSFUL WATERSHED PLANNING

    E-Print Network [OSTI]

    DEVELOPING A STRATEGY FOR BUILDING SOCIAL CAPITAL AND SUCCESSFUL WATERSHED PLANNING: A CASE STUDY planning is becoming a popular land use approach, largely in the United States, but also in Canada. Many watershed planning practitioners recommend that a representative cross-section of stakeholders be included

  16. Sediment storage and yield in an urbanized karst watershed Evan A. Harta,*, Stephen G. Schurgerb

    E-Print Network [OSTI]

    Hart, Evan

    Sediment storage and yield in an urbanized karst watershed Evan A. Harta,*, Stephen G. Schurgerb, sinkholes and other drainage features control the temporal and spatial pattern of sediment storage across the landscape. However, studies dealing with sedimentation in karst watersheds are scarce and the sediment

  17. Modeling Harry's Brook Watershed Alexandra Konings, REU 2006 Tracing the Water

    E-Print Network [OSTI]

    Petta, Jason

    of impervious cover >Reduce infiltration >Increase runoff · Existence of storm drainage networks >sewers What Influences the Water Cycle? · Topography > direction of flow > flow velocity · Infiltration: Green Watershed Alexandra Konings, REU 2006 How Do We Study This? Study Harry's Brook Watershed in Princeton EPA

  18. Bacterial Source Tracking to Support the Development and Implementation of Watershed Protection Plans for the Lampasas and Leon Rivers: Lampasas River Watershed Final Report 

    E-Print Network [OSTI]

    Gregory, L.; Casarez, E.; Truesdale, J.; Di Giovanni, G.; Owen, T.; Wolfe, J.

    2013-04-25

    The Bacterial Source Tracking to Support the Development and Implementation of Watershed Protection Plans for the Lampasas and Leon Rivers project was developed to provide supplemental information to stakeholders engaged ...

  19. Image segmentation and analysis via multiscale gradient watershed hierarchies

    E-Print Network [OSTI]

    Gauch, John M.

    1999-01-01

    . Machine Intell., vol. 9, pp. 726–741, Nov. 1987. [3] S. Buecher, “Watersheds of functions and picture segmentation,” in Proc. IEEE Int. Conf. Acoustics, Speech, and Signal Processing, Paris, France, May 1982, pp. 1928–1931. [4] S. Beucher and F. Meyer... based on morphological filtering,” IEEE Trans.Pattern Anal.Machine Intell., vol. 11, pp. 649–700, 1989. [11] J. J. Clark, “Singularities of contrast functions in scale space,” in Proc. 1st Int. Conf. Computer Vision, London, U.K., 1987, pp. 491–495. [12...

  20. Modeling nitrogen cycling in forested watersheds of Chesapeake Bay

    SciTech Connect (OSTI)

    Hunsaker, C.T.; Garten, C.T.; Mulholland, P.J.

    1995-03-01

    The Chesapeake Bay Agreement calls for a 40% reduction of controllable phosphorus and nitrogen to the tidal Bay by the year 2000. To accomplish this goal the Chesapeake Bay Program needs accurate estimates of nutrient loadings, including atmospheric deposition, from various land uses. The literature was reviewed on forest nitrogen pools and fluxes, and nitrogen data from research catchments in the Chesapeake Basin were identified. The structure of a nitrogen module for forests is recommended for the Chesapeake Bay Watershed Model along with the possible functional forms for fluxes.

  1. Twenty-Five Years of Ecological Recovery of East Fork Poplar Creek: Review of Environmental Problems and Remedial Actions

    SciTech Connect (OSTI)

    Smith, John G; Loar, James M; Stewart, Arthur J

    2011-01-01

    In May 1985, a National Pollutant Discharge Elimination System permit was issued for the Department of Energy s Y-12 National Security Complex (Y-12 Complex) in Oak Ridge, Tennessee, USA, allowing discharge of effluents to East Fork Poplar Creek (EFPC). The effluents ranged from large volumes of chlorinated oncethrough cooling water and cooling tower blow-down to smaller discharges of treated and untreated process wastewaters, which contained a mixture of heavy metals, organics, and nutrients, especially nitrates. As a condition of the permit, a Biological Monitoring and Abatement Program (BMAP) was developed to meet two major objectives: demonstrate that the established effluent limitations were protecting the classified uses of EFPC, and document the ecological effects resulting from implementing a Water Pollution Control Program at the Y-12 Complex. The second objective is the primary focus of the other papers in this special series. This paper provides a history of pollution and the remedial actions that were implemented; describes the geographic setting of the study area; and characterizes the physicochemical attributes of the sampling sites, including changes in stream flow and temperature that occurred during implementation of the BMAP. Most of the actions taken under the Water Pollution Control Program were completed between 1986 and 1998, with as many as four years elapsing between some of the most significant actions. The Water Pollution Control Program included constructing nine new wastewater treatment facilities and implementation of several other pollution-reducing measures, such as a best management practices plan; area-source pollution control management; and various spill-prevention projects. Many of the major actions had readily discernable effects on the chemical and physical conditions of EFPC. As controls on effluents entering the stream were implemented, pollutant concentrations generally declined and, at least initially, the volume of water discharged from the Y-12 Complex declined. This reduction in discharge was of ecological concern and led to implementation of a flow management program for EFPC. Implementing flow management, in turn, led to substantial changes in chemical and physical conditions of the stream: stream discharge nearly doubled and stream temperatures decreased, becoming more similar to those in reference streams. While water quality clearly improved, meeting water quality standards alone does not guarantee protection of a waterbody s biological integrity. Results from studies on the ecological changes stemming from pollution-reduction actions, such as those presented in this series, also are needed to understand how best to restore or protect biological integrity and enhance ecological recovery in stream ecosystems. With a better knowledge of the ecological consequences of their decisions, environmental managers can better evaluate alternative actions and more accurately predict their effects.

  2. Development of a quartz tuning-fork-based force sensor for measurements in the tens of nanoNewton force range during nanomanipulation experiments

    SciTech Connect (OSTI)

    Oiko, V. T. A. Rodrigues, V.; Ugarte, D.; Martins, B. V. C.; Silva, P. C.

    2014-03-15

    Understanding the mechanical properties of nanoscale systems requires new experimental and theoretical tools. In particular, force sensors compatible with nanomechanical testing experiments and with sensitivity in the nN range are required. Here, we report the development and testing of a tuning-fork-based force sensor for in situ nanomanipulation experiments inside a scanning electron microscope. The sensor uses a very simple design for the electronics and it allows the direct and quantitative force measurement in the 1–100 nN force range. The sensor response is initially calibrated against a nN range force standard, as, for example, a calibrated Atomic Force Microscopy cantilever; subsequently, applied force values can be directly derived using only the electric signals generated by the tuning fork. Using a homemade nanomanipulator, the quantitative force sensor has been used to analyze the mechanical deformation of multi-walled carbon nanotube bundles, where we analyzed forces in the 5–40 nN range, measured with an error bar of a few nN.

  3. Baseline for Climate Change: Modeling Watershed Aquatic Biodiversity Relative to Environmental and Anthropogenic Factors

    SciTech Connect (OSTI)

    Maurakis, Eugene G

    2010-10-01

    Objectives of the two-year study were to (1) establish baselines for fish and macroinvertebrate community structures in two mid-Atlantic lower Piedmont watersheds (Quantico Creek, a pristine forest watershed; and Cameron Run, an urban watershed, Virginia) that can be used to monitor changes relative to the impacts related to climate change in the future; (2) create mathematical expressions to model fish species richness and diversity, and macroinvertebrate taxa and macroinvertebrate functional feeding group taxa richness and diversity that can serve as a baseline for future comparisons in these and other watersheds in the mid-Atlantic region; and (3) heighten people’s awareness, knowledge and understanding of climate change and impacts on watersheds in a laboratory experience and interactive exhibits, through internship opportunities for undergraduate and graduate students, a week-long teacher workshop, and a website about climate change and watersheds. Mathematical expressions modeled fish and macroinvertebrate richness and diversity accurately well during most of the six thermal seasons where sample sizes were robust. Additionally, hydrologic models provide the basis for estimating flows under varying meteorological conditions and landscape changes. Continuations of long-term studies are requisite for accurately teasing local human influences (e.g. urbanization and watershed alteration) from global anthropogenic impacts (e.g. climate change) on watersheds. Effective and skillful translations (e.g. annual potential exposure of 750,000 people to our inquiry-based laboratory activities and interactive exhibits in Virginia) of results of scientific investigations are valuable ways of communicating information to the general public to enhance their understanding of climate change and its effects in watersheds.

  4. Three Forks folio, Montana 

    E-Print Network [OSTI]

    Peale, A. C. (Albert Charles), 1849-1914.

    1896-01-01

    A structural model of the central and southern Western Foothills Fold and Thrust Belt (WFFTB) was constructed from serial balanced cross sections. The cross sections are constrained by published surface and subsurface geologic data...

  5. White Oak Creek Watershed topographic map and related materials

    SciTech Connect (OSTI)

    Farrow, N.D.

    1981-04-01

    On March 22, 1978 a contract was let to Accu-Air Surveys, Inc., of Seymour, Indiana, to produce a topographic map of the White Oak Creek Watershed. Working from photography and ground control surveys, Accu-Air produced a map to ORNL's specifications. The map is in four sections (N.W., N.E., S.W., S.E.) at a scale of 1:2400. Contour intervals are 5 ft (1.5 m) with accented delineations every 25 ft (7.6 m). The scribe method was used for the finished map. Planimetric features, roads, major fence lines, drainage features, and tree lines are included. The ORNL grid is the primary coordinate system which is superimposed on the state plain coordinates.

  6. Woody vegetation of the lower Navasota River watershed 

    E-Print Network [OSTI]

    Allen, Harriet Louise Gell

    1974-01-01

    in the lower Navasota River watershed. (M~Honey Mesquite, PO Post Oak, PO-8=Post Oak-Hickory, WE=Winged Elm, OC Overcup Oak, Ha-CE Hackberry-Cedar Elm, SP Swamp Privet, WaE Water Elm) 31 cs 10 Basal ares/ha g = Basal s es/slam Q = Deearly Yl 1 r. y... hover/slam 8 10 CII I Ss yl ?0 t 1 :c M PO PO-H WE CE OC HB-CE SP WBE 32 of small individual stem size (0. 04 m ). The Water Elm type had both 2 high density and large stem size (0. 4 m ) resulting in the highest 2 total basal area (44 m...

  7. Post-closure permit application for the Upper East Fork Poplar Creek hydrogeologic regime at the Y-12 Plant: New Hope Pond and Eastern S-3 ponds plume. Revision 2

    SciTech Connect (OSTI)

    1995-02-01

    The intent of this Post-Closure, Permit Application (PCPA) is to satisfy the post-closure permitting requirements of the Tennessee Department of Environment and Conservation (TDEC) Rule 1200-1-11. This application is for the entire Upper East Fork Poplar Creek Hydrogeologic Regime (East Fork Regime), which is within the Bear Creek Valley (BCV). This PCPA has been prepared to include the entire East Fork Regime because, although there are numerous contaminant sources within the regime, the contaminant plumes throughout the East Fork Regime have coalesced and can no longer be distinguished as separate plumes. This PCPA focuses on two recognized Resource Conservation and Recovery Act (RCRA) interim status units: New Hope Pond (NHP) and the eastern S-3 Ponds plume. This PCPA presents data from groundwater assessment monitoring throughout the regime, performed since 1986. Using this data, this PCPA demonstrates that NHP is not a statistically discernible source of groundwater contaminants and that sites upgradient of NHP are the likely sources of groundwater contamination seen in the NHP vicinity. As such, this PCPA proposes a detection monitoring program to replace the current assessment monitoring program for NHP.

  8. Linking Burn Severity to Soil Infiltartion and Runoff in a Montane Watershed: Boulder, Colorado 

    E-Print Network [OSTI]

    Ahlstrom, Anna 1988-

    2012-11-28

    Forest fires have an enormous impact on biotic and abiotic variables that control runoff and soil properties in watersheds. Because wildfires do not have a uniform effect on the burned area, significant variability occurs between areas of different...

  9. Impacts of Avian Predation on Juvenile Salmonids in Central California Watersheds

    E-Print Network [OSTI]

    Frechette, Danielle

    2010-01-01

    of tags deposited on ANI by watershed of origin………23from Año Nuevo Island (ANI), a seabird breeding colonypercent of the gulls that used ANI during the 2009 breeding

  10. Restoring the Burnt Mill Creek Watershed through Stormwater Management and Community Development

    E-Print Network [OSTI]

    Mallin, Michael

    _hunt@ncsu.edu Patrick Beggs, Watershed Education for Communities and Officials, Dept. Agricultural and Resource Economics, NC State University: Patrick_beggs@ncsu.edu Dr. Michael Mallin, Center for Marine Sciences

  11. Simulating and Optimizing Storm Water Management Strategies in an Urban Watershed 

    E-Print Network [OSTI]

    Damodaram, Chandana

    2011-02-22

    . My proposed research will focus on simulating the Low Impact Development (LID) techniques like permeable pavements and rainwater harvesting on an urbanized watershed using a curve number approach to quantify the hydrologic performance...

  12. Non point source pollution modelling in the watershed managed by Integrated Conctructed Wetlands: A GIS approach. 

    E-Print Network [OSTI]

    Vyavahare, Nilesh

    2008-12-05

    The non-point source pollution has been recognised as main cause of eutrophication in Ireland (EPA Ireland, 2001). Integrated Constructed Wetland (ICW) is a management practice adopted in Annestown stream watershed, located ...

  13. Simulated watershed responses to land cover changes using the Regional Hydro-Ecological Simulation System

    E-Print Network [OSTI]

    Tarboton, David

    Simulated watershed responses to land cover changes using the Regional Hydro-Ecological Simulation Old Main Hill, Logan, UT, 84322-8200, USA Abstract: In this work, we used the Regional Hydro

  14. Hydro-Ecologic Responses to Land Use in Small Urbanizing Watersheds Within the Chesapeake Bay

    E-Print Network [OSTI]

    Gruner, Daniel S.

    Hydro-Ecologic Responses to Land Use in Small Urbanizing Watersheds Within the Chesapeake Bay. The consequences for both the hydrology and 41 #12;42 HYDRO-ECOLOGIC RESPONSES TO LAND USE IN SMALL URBANIZING

  15. Rainfall-runoff modeling in a flashy tropical watershed using the distributed HL-RDHM model

    E-Print Network [OSTI]

    Hawai'i at Manoa, University of

    -prone Hanalei watershed in Kaua`i, Hawai`i. This rural watershed is very wet and has strong spatial rainfall gra of Hawai`i-Manoa, HI, USA d University of Hawai'i-Manoa, HI, USA e Hawaii Weather Forecast Office, National Weather Service, HI, USA f North Shore Hydro Consulting, Kauai, HI, USA a r t i c l e i n f o Article

  16. USING NEXRAD AND RAIN GAUGE PRECIPITATION DATA FOR HYDROLOGIC CALIBRATION OF SWAT IN A NORTHEASTERN WATERSHED

    SciTech Connect (OSTI)

    Sexton, Aisha M.; Sadeghi, Ali M.; Zhang, Xuesong; Srinivasan, Ragahvan; Shirmohammadi, Adel

    2010-05-10

    The value of watershed?scale, hydrologic and water quality models to ecosystem management is increasingly evident as more programs adopt these tools to evaluate the effectiveness of different management scenarios and their impact on the environment. Quality of precipitation data is critical for appropriate application of watershed models. In small watersheds, where no dense rain gauge network is available, modelers are faced with a dilemma to choose between different data sets. In this study, we used the German Branch (GB) watershed (~50 km2), which is included in the USDA Conservation Effects Assessment Project (CEAP), to examine the implications of using surface rain gauge and next?generation radar (NEXRAD) precipitation data sets on the performance of the Soil and Water Assessment Tool (SWAT). The GB watershed is located in the Coastal Plain of Maryland on the eastern shore of Chesapeake Bay. Stream flow estimation results using surface rain gauge data seem to indicate the importance of using rain gauges within the same direction as the storm pattern with respect to the watershed. In the absence of a spatially representative network of rain gauges within the watershed, NEXRAD data produced good estimates of stream flow at the outlet of the watershed. Three NEXRAD datasets, including (1)*non?corrected (NC), (2) bias?corrected (BC), and (3) inverse distance weighted (IDW) corrected NEXRAD data, were produced. Nash?Sutcliffe efficiency coefficients for daily stream flow simulation using these three NEXRAD data ranged from 0.46 to 0.58 during calibration and from 0.68 to 0.76 during validation. Overall, correcting NEXRAD with rain gauge data is promising to produce better hydrologic modeling results. Given the multiple precipitation datasets and corresponding simulations, we explored the combination of the multiple simulations using Bayesian model averaging.

  17. Habitat Projects Completed within the Asotin Creek Watershed, 1999 Completion Report.

    SciTech Connect (OSTI)

    Johnson, Bradley J.

    2000-01-01

    The Asotin Creek Model Watershed Program (ACMWP) is the primary entity coordinating habitat projects on both private and public lands within the Asotin Creek watershed. The Asotin Creek watershed covers approximately 325 square miles in the Blue Mountains of southeastern Washington in WRIA 35. According to WDFW's Priority WRIA's by At-Risk Stock Significance Map, it is the highest priority in southeastern WA. Snake River spring chinook salmon, summer steelhead and bull trout, which are listed under the Endangered Species Act (ESA), are present in the watershed. The ACMWP began coordinating habitat projects in 1995. Approximately two hundred seventy-six projects have been implemented through the ACMWP as of 1999. Twenty of these projects were funded in part through Bonneville Power Administration's 1999 Columbia Basin Fish and Wildlife Program. These projects used a variety of methods to enhance and protect watershed conditions. In-stream work for fish habitat included construction of hard structures (e.g. vortex rock weirs), meander reconstruction, placement of large woody debris (LWD) and whole trees and improvements to off-channel rearing habitat; thirty-eight were created with these structures. Three miles of stream benefited from riparian improvements such as vegetative plantings (17,000 trees and shrubs) and noxious weed control. Two sediment basin constructions, 67 acres of grass seeding, and seven hundred forty-five acres of minimum till were implemented to reduce sediment production and delivery to streams in the watershed.

  18. Habitat Projects Completed within the Asotin Creek Watershed, 1998 Completion Report.

    SciTech Connect (OSTI)

    Johnson, Bradley J.

    1999-11-01

    The Asotin Creek Model Watershed Program (ACMWP) is the primary entity coordinating habitat projects on both private and public lands within the Asotin Creek watershed. The Asotin Creek watershed covers approximately 325 square miles in the Blue Mountains of southeastern Washington. Snake River spring chinook salmon, summer steelhead and bull trout, which are listed under the Endangered Species Act (ESA), are present in the watershed. The ACMWP began coordinating habitat projects in 1995. Approximately two hundred forty-six projects have been implemented through the ACMWP as of 1998. Fifty-nine of these projects were funded in part through Bonneville Power Administration's 1998 Columbia Basin Fish and Wildlife Program. These projects used a variety of methods to enhance and protect watershed conditions. In-stream work for fish habitat included construction of hard structures (e.g. vortex rock weirs), meander reconstruction, placement of large woody debris (LWD) and whole trees and improvements to off-channel rearing habitat; one hundred thirty-nine pools were created with these structures. Three miles of stream benefited from riparian improvements such as fencing, vegetative plantings, and noxious weed control. Two alternative water developments were completed, providing off-stream-watering sources for livestock. 20,500 ft of upland terrace construction, seven sediment basin construction, one hundred eighty-seven acres of grass seeding, eight hundred fifty acres of direct seeding and eighteen sediment basin cleanouts were implemented to reduce sediment production and delivery to streams in the watershed.

  19. Wildlife and Wildlife Habitat Loss Assessment at Hills Creek Dam and Reservoir Project, Middle Fork Willamette River, Oregon, 1985 Final Report.

    SciTech Connect (OSTI)

    Noyes, J.H.

    1985-09-01

    A habitat based assessment was conducted of the US Army Corps of Engineers' Hills Creek Dam and Reservoir Project on the Middle Fork Willamette River, Oregon, to determine losses or gains resulting from the development and operation of the hydroelectric related components of the project. Preconstruction, postconstruction, and recent vegetation cover types of the project site were mapped based on aerial photographs from 1944, 1964, and 1979, respectively. Vegetation cover types were identified within the affected area and acreages of each type at each period were determined. Fifteen wildlife target species were selected to represent a cross-section of species groups affected by the project. An interagency team evaluated the suitability of the habitat to support the target species at each time period. An evaluation procedure which accounted for both the quantity and quality of habitat was used to aid in assessing impacts resulting from the project. The Hills Creek Project extensively altered or affected 4662 acres of land and river in the Middle Fork Willamette River drainage. Impacts to wildlife centered around the loss of 2694 acres of old-growth forest and 207 acres of riparian habitat. Impacts resulting from the Hills Creek Project included the loss of winter range for Roosevelt elk, and the loss of year-round habitat for black-tailed deer, black bear, cougar, river otter, beaver, ruffed grouse, spotted owl, and other nongame species. Bald eagle and osprey were benefited by an increase in foraging habitat. The potential of the affected area to support wildlife was greatly altered as a result of the Hills Creek Project, losses or gains in the potential of the habitat to support wildlife will exist over the life of the project.

  20. USDA Forest Service Gen. Tech. Rep. PSW-GTR-193. 2004. 121 Aquatic Systems and Watersheds1

    E-Print Network [OSTI]

    , and pollution, connections abound with other resources within the waterways and their watersheds. Whether, ski area expansion, mining, off-highway vehicles, climate change, or overgrazing, potential impacts

  1. Water's Way at Sleepers River watershed - revisiting flow generation in a post-glacial landscape, Vermont USA

    E-Print Network [OSTI]

    Shanley, JB; Sebestyen, SD; Mcdonnell, JJ; Mcdonnell, JJ; Mcglynn, BL; Dunne, T

    2015-01-01

    production in permeable soils. Water Resources Research 6:New England watershed. Water Resources Research 6: 1296–processes during snowmelt. Water Resources Research 7: 1160–

  2. Clearwater Focus Watershed; Nez Perce Tribe, 2003-2004 Annual Report.

    SciTech Connect (OSTI)

    Jones, Ira (Nez Perce Tribe, Lapwai, ID)

    2004-06-01

    The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division, approaches watershed restoration with a goal to protect, restore, and enhance a connected network of functioning habitat types capable of supporting all fish life stages. Its goal is also to re-establish normal patterns of production, dispersal, and exchange of genetic information within the 1855 Treaty Area. The Nez Perce Tribe began watershed restoration projects within the Clearwater River Subbasin in 1996. Progress has been made in restoring the sub-basin by excluding cattle from critical riparian areas through fencing, stabilizing stream banks, decommissioning roads, and upgrading culverts. Coordination of these projects is critical to the success of the restoration of the sub-basin. Coordination activities also includes: inter and intra-department coordination, sub-basin assessment and planning, involving government and private organizations, and treaty area coordination.

  3. Calendar year 1993 groundwater quality report for the Upper East Fork Poplar Creek Hydrogeologic Regime, Y-12 Plant, Oak Ridge, Tennessee. 1993 groundwater quality data and calculated rate of contaminant migration, Part 1

    SciTech Connect (OSTI)

    Not Available

    1994-02-01

    This report contains groundwater quality data obtained during the 1993 calendar year (CY) at several waste management facilities and petroleum fuel underground storage tank (UST) sites associated with the US Department of Energy (DOE) Y-12 Plant located on the DOE Oak Ridge Reservation (ORR) southeast of Oak Ridge, Tennessee. These sites are within the Upper East Fork Poplar Creek Hydrogeologic Regime (East Fork Regime), which is one of three regimes defined for the purposes of groundwater and surface-water quality monitoring at the Y-12 Plant. The Environmental Management Department of the Y-12 Plant Health, Safety, Environment, and Accountability Organization manages the groundwater monitoring activities in each regime as part of the Y-12 Plant Groundwater Protection Program (GWPP). The annual groundwater report for the East Fork Regime is completed in two-parts; Part 1 (this report) containing the groundwater quality data and Part 2 containing a detailed evaluation of the data. The primary purpose of this report is to serve as a reference for the groundwater data obtained each year under the lead of the Y-12 Plant GWPP. However, because it contains information needed to comply with the Resource Conservation and Recovery Act (RCRA) interim status assessment monitoring reporting requirements, this report is submitted to the Tennessee Department of Health and Environment (TDEC) by the RCRA reporting deadline.

  4. Calendar year 1994 groundwater quality report for the Upper East Fork Poplar Creek Hydrogeologic Regime, Y-12 Plant, Oak Ridge, Tennessee: 1994 groundwater quality data and calculated rate of contaminant migration

    SciTech Connect (OSTI)

    NONE

    1995-02-01

    This annual groundwater quality report (GWQR) contains groundwater and surface water quality data obtained during the 1994 calendar year (CY) at several waste-management facilities and a petroleum fuel underground storage tank (UST) site associated with the US Department of Energy (DOE) Y-12 Plant located on the DOE Oak Ridge Reservation (ORR) southeast of Oak Ridge, Tennessee. The sites addressed by this document are located within the Upper East Fork Poplar Creek Hydrogeologic Regime (East Fork Regime). The East Fork Regime, which is one of three hydrogeologic regimes defined for the purposes of groundwater quality monitoring at the Y-12 Plant, encompasses the Y-12 Plant. The regime extends west from a surface water and shallow groundwater divide located near the west end of the plant to Scarboro Road (directions in this report are in reference to the Y-12 Plant grid system unless otherwise noted). The Environmental Management Department of the Y-12 Plant Health, Safety, Environment, and Accountability (HSEA) Organization manages the groundwater monitoring activities in each regime as part of the Y-12 Plant Groundwater Protection Program (GWPP). The purpose of the GWPP is to characterize the hydrogeology and to monitor groundwater quality at the Y-12 Plant and surrounding area to provide for protection of groundwater resources consistent with federal, state, and local requirements and in accordance with DOE Orders and Energy Systems corporate policy.

  5. Characterization of coastal urban watershed bacterial communities leads to alternative community-based indicators

    SciTech Connect (OSTI)

    Wu, C.H.; Sercu, B.; Van De Werhorst, L.C.; Wong, J.; DeSantis, T.Z.; Brodie, E.L.; Hazen, T.C.; Holden, P.A.; Andersen, G.L.

    2010-03-01

    Microbial communities in aquatic environments are spatially and temporally dynamic due to environmental fluctuations and varied external input sources. A large percentage of the urban watersheds in the United States are affected by fecal pollution, including human pathogens, thus warranting comprehensive monitoring. Using a high-density microarray (PhyloChip), we examined water column bacterial community DNA extracted from two connecting urban watersheds, elucidating variable and stable bacterial subpopulations over a 3-day period and community composition profiles that were distinct to fecal and non-fecal sources. Two approaches were used for indication of fecal influence. The first approach utilized similarity of 503 operational taxonomic units (OTUs) common to all fecal samples analyzed in this study with the watershed samples as an index of fecal pollution. A majority of the 503 OTUs were found in the phyla Firmicutes, Proteobacteria, Bacteroidetes, and Actinobacteria. The second approach incorporated relative richness of 4 bacterial classes (Bacilli, Bacteroidetes, Clostridia and a-proteobacteria) found to have the highest variance in fecal and non-fecal samples. The ratio of these 4 classes (BBC:A) from the watershed samples demonstrated a trend where bacterial communities from gut and sewage sources had higher ratios than from sources not impacted by fecal material. This trend was also observed in the 124 bacterial communities from previously published and unpublished sequencing or PhyloChip- analyzed studies. This study provided a detailed characterization of bacterial community variability during dry weather across a 3-day period in two urban watersheds. The comparative analysis of watershed community composition resulted in alternative community-based indicators that could be useful for assessing ecosystem health.

  6. Where does streamwater come from in low-relief forested watersheds? A dual-isotope approach

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Klaus, Julian [Luxembourg Institute of Science and Technology (LIST), Dept. Environmental Research and Innovation, Belvaux (Luxembourg)

    2015-01-01

    The time and geographic sources of streamwater in low-relief watersheds are poorly understood. This is partly due to the difficult combination of low runoff coefficients and often damped streamwater isotopic signals precluding traditional hydrograph separation and convolution integral approaches. Here we present a dual-isotope approach involving 18O and 2H of water in a low-angle forested watershed to determine streamwater source components and then build a conceptual model of streamflow generation. We focus on three headwater lowland sub-catchments draining the Savannah River Site in South Carolina, USA.

  7. Where does streamwater come from in low-relief forested watersheds? A dual-isotope approach

    SciTech Connect (OSTI)

    Klaus, Julian [Luxembourg Institute of Science and Technology (LIST), Dept. Environmental Research and Innovation, Belvaux (Luxembourg)

    2015-01-01

    The time and geographic sources of streamwater in low-relief watersheds are poorly understood. This is partly due to the difficult combination of low runoff coefficients and often damped streamwater isotopic signals precluding traditional hydrograph separation and convolution integral approaches. Here we present a dual-isotope approach involving 18O and 2H of water in a low-angle forested watershed to determine streamwater source components and then build a conceptual model of streamflow generation. We focus on three headwater lowland sub-catchments draining the Savannah River Site in South Carolina, USA.

  8. Remedial Investigation Work Plan for Upper East Fork Poplar Creek Operable Unit 3 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Environmental Restoration Program

    SciTech Connect (OSTI)

    Not Available

    1993-08-01

    Upper East Fork Popular Creek Operable Unit 3 (UEFPC OU 3) is a source term OU composed of seven sites, and is located in the western portion of the Y-12 Plant. For the most part, the UEFPC OU 3 sites served unrelated purposes and are geographically removed from one another. The seven sites include the following: Building 81-10, the S-2 Site, Salvage Yard oil storage tanks, the Salvage Yard oil/solvent drum storage area, Tank Site 2063-U, the Salvage Yard drum deheader, and the Salvage Yard scrap metal storage area. All of these sites are contaminated with at least one or more hazardous and/or radioactive chemicals. All sites have had some previous investigation under the Y-12 Plant RCRA Program. The work plan contains summaries of geographical, historical, operational, geological, and hydrological information specific to each OU 3 site. The potential for release of contaminants to receptors through various media is addressed, and a sampling and analysis plan is presented to obtain objectives for the remedial investigation. Proposed sampling activities are contingent upon the screening level risk assessment, which includes shallow soil sampling, soil borings, monitoring well installation, groundwater sampling, and surface water sampling. Data from the site characterization activities will be used to meet the above objectives. A Field Sampling Investigation Plan, Health and Safety Plan, and Waste Management Plan are also included in this work plan.

  9. Clearwater Focus Watershed; Nez Perce Tribe, 2005-2006 Annual Report.

    SciTech Connect (OSTI)

    Jones, Ira; McRoberts, Heidi (Nez Perce Tribe, Department of Fisheries Resource Management, Lapwai, ID)

    2006-12-01

    The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division, approaches watershed restoration with a goal to protect, restore, and enhance a connected network of functioning habitat types capable of supporting all fish life stages. The key objective of the Nez Perce Tribe Focus Coordinator position is to overcome fragmentation within the basin by managing communications with the subbasin, providing an overall framework and process for coordinated fisheries restoration and managing the planning, assessment, implementation, and monitoring and evaluation process. The Nez Perce Tribe began watershed restoration projects within the Clearwater River Subbasin in 1996. Progress has been made in restoring the sub-basin by excluding cattle from critical riparian areas through fencing, stabilizing stream banks, decommissioning roads, restoring fish passage, as well as other watershed restoration projects. Coordination of these projects is critical to the success of the restoration of the sub-basin. Coordination activities also includes: inter and intra-department coordination, sub-basin assessment and planning, involving government and private organizations, and treaty area coordination.

  10. Do Watershed Partnerships Enhance Beliefs Conducive to Collective Action? By Mark Lubell

    E-Print Network [OSTI]

    Lubell, Mark

    the NEP. #12;Do Watershed Partnerships Enhance Beliefs Conducive to Collective Action? Our dynamic of stakeholders participating in the USEPA National Estuary Program (NEP) to stakeholders from estuaries without the NEP, which are governed by the fragmented tapestry of traditional regulatory processes.ii The NEP

  11. Concepts in GIS NR 505 Fall 2010 Department of Forestry, Rangelands, and Watershed Stewardship

    E-Print Network [OSTI]

    Boone, Randall B.

    1 Concepts in GIS NR 505 Fall 2010 Department of Forestry, Rangelands, and Watershed Stewardship is designed to introduce graduate students to concepts in geographic information systems (GIS). The purpose of the course is threefold, to: 1) Examine the broad research context in which GIS is adopted and used through

  12. Success of the Melton Valley Watershed Remediation at the ORNL - 12351

    SciTech Connect (OSTI)

    Adler, David; Wilkerson, Laura [DOE, Oak Ridge Operations (United States); Sims, Lynn; Ketelle, Richard; Garland, Sid [Oak Ridge/Restoration Service, Inc. - UCOR/RSI (United States)

    2012-07-01

    The source remediation of the Melton Valley (MV) Watershed at the U.S. Department of Energy's (DOE's) Oak Ridge National Laboratory was completed 5 years ago (September 2006). Historic operations at the laboratory had resulted in chemical and radionuclide contaminant releases and potential risks or hazards within 175 contaminated units scattered across an area of 430 hectares (1062 acres) within the watershed. Contaminated areas included burial grounds, landfills, underground tanks, surface impoundments, liquid disposal pit/trenches, hydrofracture wells, leak and spill spites, inactive surface structures, and contaminated soil and sediments. The remediation of the watershed was detailed in the MV Interim Action Record of Decision (ROD) and included a combination of actions encompassing containment, isolation, stabilization, removal, and treatment of sources within the watershed and established the monitoring and land use controls that would result in protection of human health. The actions would take place over 5 years with an expenditure of over $340 M. The MV remedial actions left hazardous wastes in-place (e.g., buried wastes beneath hydraulic isolation caps) and cleanup at levels that do not allow for unrestricted access and unlimited exposure. The cleanup with the resultant land use would result in a comprehensive monitoring plan for groundwater, surface water, and biological media, as well as the tracking of the land use controls to assure their completion. This paper includes an overview of select performance measures and monitoring results, as detailed in the annual Remediation Effectiveness Report and the Five-Year Report. (authors)

  13. Fine Sediment Sources in Coastal Watersheds with Uplifted Marine Terraces in

    E-Print Network [OSTI]

    111 Fine Sediment Sources in Coastal Watersheds with Uplifted Marine Terraces in Northwest Humboldt by uplifted marine terraces. This study will help inform the efforts to improve water quality in these streams characteristics on these uplifted marine terraces, and that because of this Luffenholtz Creek will have higher

  14. Two-dimensional simulations of extreme floods on a large watershed

    E-Print Network [OSTI]

    Julien, Pierre Y.

    Two-dimensional simulations of extreme floods on a large watershed John F. England Jr. a,*, Mark L. Velleux b , Pierre Y. Julien c a Bureau of Reclamation, Flood Hydrology, 86-68530, Denver Federal Center September 2007; accepted 14 September 2007 KEYWORDS Flash floods; Flood design; Rainfall runoff; Extreme

  15. Distributed Modeling of Extreme Floods on Large Watersheds John F. England, Jr.1

    E-Print Network [OSTI]

    Julien, Pierre Y.

    1 Distributed Modeling of Extreme Floods on Large Watersheds John F. England, Jr.1 , Pierre Y. Julien2 , Mark L. Velleux2 , and James A. Smith3 1 Hydraulic Engineer, Bureau of Reclamation, Flood Estimates of extreme floods and probabilities are needed for hydrologic engineering and dam safety risk

  16. Hurricane Effects on Water Quality and Benthos in the Cape Fear Watershed: Natural and Anthropogenic Impacts

    E-Print Network [OSTI]

    Mallin, Michael

    Hurricane Effects on Water Quality and Benthos in the Cape Fear Watershed: Natural 1999 by the Ecolog~calSociety of America HURRICANE EFFECTS ON WATER QUALITY AND BENTHOS IN THE CAPE, southeastern North Carolina, United States, was struck by two hurricanes, with the second (Hurricane Fran

  17. Modelling changes in suspended sediment from forest road surfaces in a coastal watershed of British Columbia

    E-Print Network [OSTI]

    Venditti, Jeremy G.

    for a typical medium-size coastal watershed of British Columbia or the American Pacific Northwest-known negative impacts on the aquatic environment and are thought to produce more sediment than most other and Wondzell, 2005). The removal of forests for construction of road surfaces and their right

  18. Future runoff from a partly glacierized watershed in Central Switzerland: A two-model approach

    E-Print Network [OSTI]

    Gilli, Adrian

    Future runoff from a partly glacierized watershed in Central Switzerland: A two-model approach a , Stefano M. Bernasconi b a WSL Institute for Snow and Avalanche Research SLF, Davos, Switzerland b Geological Institute, ETH Zurich, Sonnegstrasse 5, 8092 Zürich, Switzerland c Swiss Federal Institute

  19. Minimization of cost, sediment load, and sensitivity to climate change in a watershed management application

    E-Print Network [OSTI]

    Eppstein, Margaret J.

    Minimization of cost, sediment load, and sensitivity to climate change in a watershed management solution with respect to cost of the implementation of the management plan and sediment loading predicted and transport of sediment and soil contaminants into surface water bodies. Even the relatively rural state

  20. Modeling Sediment and Wood Storage and Dynamics in Small Mountainous Watersheds

    E-Print Network [OSTI]

    85 Modeling Sediment and Wood Storage and Dynamics in Small Mountainous Watersheds Stephen T controls on supply and transport of sediment and wood in a small (approximately two square kilometers) basin in the Oregon Coast Range, typical of streams at the interface between episodic sediment and wood

  1. Short Outline of Readings for Geog. 549 Chapter 1. Introduction -Watersheds and Water: Essential Resources

    E-Print Network [OSTI]

    James, L. Allan

    Short Outline of Readings for Geog. 549 Chapter 1. Introduction - Watersheds and Water: Essential Resources PART ONE - ENVIRONMENTAL ASPECTS OF WATER RESOURCES Section I. Physical Hydrology Chapter 2. History of the Hydrologic Cycle and Water Properties (omitted) Chapter 3. Atmospheric Water and Global

  2. A stream's role in watershed nutrient export Robert O. Hall, Jr.*

    E-Print Network [OSTI]

    Hall Jr., Robert O.

    A stream's role in watershed nutrient export Robert O. Hall, Jr.* Department of Zoology of research is that element export can dramatically increase after forest removal; e.g., ni- trate of the water- shed, and any modifications to element export by the stream itself are minimal relative

  3. FISHTRAP CREEK WORKSHOP Watershed Response to the McLure Forest Fire

    E-Print Network [OSTI]

    Eaton, Brett

    FISHTRAP CREEK WORKSHOP Watershed Response to the McLure Forest Fire Date: March 6th , 2008: 8 disturbance and forest harvesting. Figure 1. Location of the McLure fire. From Phillips (2007). #12;Figure 2 and after the fire (R.D. Moore, UBC) 10:00 ­ 10:30 Refreshment break Session 2: Channel morphology

  4. Wastewater and Watershed Influences on Primary Productivity and Oxygen Dynamics in the Lower Hudson River Estuary

    E-Print Network [OSTI]

    Limburg, Karin E.

    Wastewater and Watershed Influences on Primary Productivity and Oxygen Dynamics in the Lower Hudson decreased somewhat since 1970 due to universal secondary treatment of dry-weather wastewater effluents University of New York, Syracuse, NY 13210 #12;Abstract: Primary productivity in the saline Hudson River

  5. Hydrologic assessment of an urban variable source watershed in the northeast United States

    E-Print Network [OSTI]

    Walter, M.Todd

    Hydrologic assessment of an urban variable source watershed in the northeast United States Zachary by considering the impact of impervious surfaces, hydraulic control structures (detention basins), and land use and interflows increased accordingly. Both modeled and measured distributed results indicated that the more

  6. Environmental Assessment for the Rathbun Lake Watershed: Sampling Design, Methods and Results

    E-Print Network [OSTI]

    Opsomer, Jean

    of water pollution. The most important non-point source pollution is thought to be soil loss from to water pollution in the watershed, a survey was designed to estimate the total amount of erosion water pollutants (e.g. livestock feedlots), made it possible to describe the most important impairments

  7. 73-20-1. Short title. This act may be cited as the "Watershed District Act".

    E-Print Network [OSTI]

    Johnson, Eric E.

    District Act [73-20-1 NMSA 1978] is to secure the federal assistance provided in Public Law 566 of the 83rd73-20-1. Short title. This act may be cited as the "Watershed District Act". History: 1953 Comp., § 45-5-19, enacted by Laws 1957, ch. 210, § 1. Cross references. -- For provisions of the Water Project

  8. Simulated Atmospheric Deposition of Pollutants into Watersheds in the Pacific Northwest

    E-Print Network [OSTI]

    Collins, Gary S.

    Simulated Atmospheric Deposition of Pollutants into Watersheds in the Pacific Northwest StephanieEaSM framework, allowing users to graphically display outputs from air quality models and interpolate atmospheric the Air Indicator Report for Public Access and Community Tracking (AIRPACT-3) air quality forecast system

  9. Descriptions and Expectations of Recommended BMPs for Improving the Bosque River Watershed 

    E-Print Network [OSTI]

    Meier, Megan; Gregory, Lucas

    2008-01-01

    of nutrients, especially phosphorus (P), entering surface water supplies. Several BMPs also focus on sediment control, as some of the soils in the watershed are highly erosive and pose the threat of transporting nutrients with them when they erode. Some BMPs...

  10. SOURCE AND EFFECT OF ACID ROCK DRAINAGE IN THE SNAKE RIVER WATERSHED, SUMMIT COUNTY, COLORADO

    E-Print Network [OSTI]

    SOURCE AND EFFECT OF ACID ROCK DRAINAGE IN THE SNAKE RIVER WATERSHED, SUMMIT COUNTY, COLORADO (the weathering of disseminated pyrite) sources of acid rock drainage (ARD). Stream waters and remediating the effects of acid rock drainage in the basin has given this research a real world application

  11. Incorporating Uncertainty in Watershed Management Decision-Making: A Mercury TMDL Case Study

    E-Print Network [OSTI]

    Stanford University

    Incorporating Uncertainty in Watershed Management Decision-Making: A Mercury TMDL Case Study-4020, Stanford, CA 94305-4020; email: labiosa@stanford.edu 2 Department of Management Science. Several mercury Total Maximum Daily Load regulations are currently being developed to address this problem

  12. Memo: Estimates of hydrology in small (<80 km2 urbanized watersheds under dry weather and

    E-Print Network [OSTI]

    weather and first flush flows from pump station facilities to publicly owned treatment works (POTWs questions and to help BASMAA with a preliminary ranking of pump station watersheds to focus on in response such as coldwater fish rearing and habitat for other native or endangered species Landscape irrigation (reducing

  13. Reducing Agricultural Nitrate Losses in the Embarras River Watershed through Bioreactors, Constructed Wetlands, and Outreach

    E-Print Network [OSTI]

    David, Mark B.

    , Courtney Flint, Lowell Gentry, Robert Hudson: Natural Resources & Environmental Sciences Richard Cooke concentrations and loads for this watershed and have used it for many past studies on water quality, so we have as measure wetland greenhouse gas emissions (N2O, CH4, and CO2) (research objective). 2. Determine

  14. Urbanizing Watersheds and Changing River Flood Dynamics: Implications for Urban Wetland Restoration 

    E-Print Network [OSTI]

    Simmons, M.

    2003-01-01

    -watershed located north of Dallas, Texas. Moving window and FRAGSTATS analyses calculated the degree and location of ISC throughout the basin, and U.S. Geologic Survey stream-gauge data were analyzed to determine changes in steam hydrology between the 2 time periods...

  15. REMOTE SENSING TECHNIQUES FOR LAND USE CLASSIFICATION OF RIO JAUCA WATERSHED USING IKONOS IMAGES

    E-Print Network [OSTI]

    Gilbes, Fernando

    REMOTE SENSING TECHNIQUES FOR LAND USE CLASSIFICATION OF RIO JAUCA WATERSHED USING IKONOS IMAGES-Mayagüez E-mail: edwinmm80@yahoo.com Key words: GIS, remote sensing, land use, supervised classification resource and supplies water to the metropolitan area. Remote sensing techniques can be used to assess

  16. Hydrogeochemistry and rare earth element behavior in a volcanically acidified watershed in Patagonia, Argentina

    E-Print Network [OSTI]

    Royer, Dana

    and analyzed for major ions, trace metals, and rare earth elements (REE). The concentrations of REE in the RioHydrogeochemistry and rare earth element behavior in a volcanically acidified watershed to oxidation of sulfide minerals. D 2005 Elsevier B.V. All rights reserved. Keywords: Rare earth elements

  17. Prediction of sediment-bound nutrient delivery from semi-arid California watersheds

    E-Print Network [OSTI]

    Gabet, Emmanuel "Manny"

    Prediction of sediment-bound nutrient delivery from semi-arid California watersheds Emmanuel J, University of California, Santa Barbara, California, USA Received 4 March 2005; revised 16 June 2005 in soil to account explicitly for hillslope sediment transport processes that yield sediment

  18. Estimating Nonpoint Source Pollution Loadings in the Great Lakes Watersheds Chansheng He

    E-Print Network [OSTI]

    contaminated sediments, urban runoff, storm sewers, and agriculture impairs Great Lakes shoreline waters a physically based, spatially-distributed hydrology model to simulate spatial and temporal NPS distributions in the study watershed. Soil erosion and sediment yield by both wind and water are estimated based

  19. An Analysis of Microbial Pollution in the Sinclair-Dyes Inlet Watershed

    SciTech Connect (OSTI)

    May, Christopher W.; Cullinan, Valerie I.

    2005-09-21

    This assessment of fecal coliform sources and pathways in Sinclair and Dyes Inlets is part of the Project ENVironmental InVESTment (ENVVEST) being conducted by the Navy's Puget Sound Naval Shipyard and Intermediate Maintenance Facility in cooperation with the US Environmental Protection Agency, Washington State Department of Ecology, the Suquamish Tribe, Kitsap County, the City of Bremerton, the City of Port Orchard, and other local stakeholders. The goal of this study was to identify microbial pollution problems within the Sinclair-Dyes Inlet watershed and to provide a comprehensive assessment of fecal coliform (FC) contamination from all identifiable sources in the watershed. This study quantifies levels of contamination and estimated loadings from known sources within the watersheds and describes pollutant transport mechanisms found in the study area. In addition, the effectiveness of pollution prevention and mitigation measures currently in place within the Sinclair-Dyes Inlet watershed are discussed. This comprehensive study relies on historical data collected by several cooperating agencies, in addition to data collected during the study period from spring 2001 through summer 2005. This report is intended to provide the technical information needed to continue current water quality cleanup efforts and to help implement future efforts.

  20. Couse/Tenmile Creeks Watershed Project Implementation : 2007 Conservtion Projects. [2007 Habitat Projects Completed].

    SciTech Connect (OSTI)

    Asotin County Conservation District

    2008-12-10

    The Asotin County Conservation District (ACCD) is the primary entity coordinating habitat projects on private lands within Asotin County watersheds. The Tenmile Creek watershed is a 42 square mile tributary to the Snake River, located between Asotin Creek and the Grande Ronde River. Couse Creek watershed is a 24 square mile tributary to the Snake River, located between Tenmile Creek and the Grande Ronde River. Both watersheds are almost exclusively under private ownership. The Washington Department of Fish and Wildlife has documented wild steelhead and rainbow/redband trout spawning and rearing in Tenmile Creek and Couse Creek. The project also provides Best Management Practice (BMP) implementation throughout Asotin County, but the primary focus is for the Couse and Tenmile Creek watersheds. The ACCD has been working with landowners, Bonneville Power Administration (BPA), Washington State Conservation Commission (WCC), Natural Resource Conservation Service (NRCS), Farm Service Agency (FSA), Salmon Recovery Funding Board (SRFB), Washington Department of Fish and Wildlife (WDFW), U.S. Forest Service, Pomeroy Ranger District (USFS), Nez Perce Tribe (NPT), Washington Department of Ecology (DOE), National Marine Fisheries Service (NOAA Fisheries), and U.S. Fish and Wildlife Service (USFWS) to address habitat projects in Asotin County. The Asotin Subbasin Plan identified priority areas and actions for ESA listed streams within Asotin County. Couse Creek and Tenmile Creek are identified as protection areas in the plan. The Conservation Reserve Enhancement Program (CREP) has been successful in working with landowners to protect riparian areas throughout Asotin County. Funding from BPA and other agencies has also been instrumental in protecting streams throughout Asotin County by utilizing the ridge top to ridge top approach.

  1. Site characterization summary report for dry weather surface water sampling upper East Fork Poplar Creek characterization area Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-08-01

    This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.

  2. Associations of watershed and instream environmental factors with aquatic macrofauna in tributaries of the Pedernales River, Texas 

    E-Print Network [OSTI]

    Birnbaum, Jenny Sue

    2005-08-29

    species-environment relationships in this river basin; and 4) evaluate the influence of juniper coverage in the watershed, relative tolocal and landscape-level environmental factors, on the structure of fish and benthic macroinvertebrate assemblages. A...

  3. Understanding wood-pool dynamics using long-term monitoring data from the Gualala River Watershed: What can we learn?

    E-Print Network [OSTI]

    Church, Tamara

    2012-01-01

    Channel shape explained 30% of the variation in LWD volume,while LWD length and length:channel width combined,72% of the variation in LWD density. At the Watershed Level

  4. Spatially explicit load enrichment calculation tool and cluster analysis for identification of E. coli sources in Plum Creek Watershed, Texas 

    E-Print Network [OSTI]

    Teague, Aarin Elizabeth

    2009-06-02

    . Locations of contributing non-point and point sources in the watershed were defined using Geographic Information Systems (GIS). By distributing livestock, wildlife, wastewater treatment plants, septic systems, and pet sources, the bacterial load...

  5. Comparing the Impact of Bare Ground on Runoff/Discharge, Mean Load and Sediment Exports on Two Fort Hood Watersheds 

    E-Print Network [OSTI]

    Beasley, John Paul

    2015-08-10

    One land condition shown to affect storm runoff/discharge and sediment exports is bare ground. High sediment exports in runoff indicate erosion is taking place within a watershed. Precipitation drives runoff and sediment exports, which result...

  6. Quantification of potential arsenic bioavailability in spatially varying Geologic Environments at the Watershed Scale Using Chelating Resins 

    E-Print Network [OSTI]

    Lake, Graciela Esther

    2004-09-30

    of a compound or element by organisms. The objective of this research is to quantify the potential bioavailability of arsenic in laboratory microcosms and in different geologic environments in the Nueces and San Antonio River Watersheds, Texas, using a...

  7. Changes in ecosystem services and runoff due to land use change in the watersheds of San Antonio, Texas 

    E-Print Network [OSTI]

    Harris, Heather Grace

    2000-01-01

    service valuation model to each of the land use classes over the discreet time periods. Hydrologic peak flow models using the Soil Conservation Service Curve Number Method were developed and applied to each watershed for each discreet time period...

  8. Water quality improvements in the Upper North Bosque River watershed due to phosphorous export through turfgrass sod 

    E-Print Network [OSTI]

    Stewart, George Russell

    2005-02-17

    -1 WATER QUALITY IMPROVEMENTS IN THE UPPER NORTH BOSQUE RIVER WATERSHED DUE TO PHOSPHOROUS EXPORT THROUGH TURFGRASS SOD A Thesis by GEORGE R. STEWART Submitted to the Office of Graduate Studies of Texas A&M University in partial... fulfillment of the requirements for the degree of MASTER OF SCIENCE December 2004 Major Subject: Biological and Agricultural Engineering WATER QUALITY IMPROVEMENTS IN THE UPPER NORTH BOSQUE RIVER WATERSHED DUE...

  9. A water quality assessment of the import of turfgrass sod grown with composted dairy manure into a suburban watershed 

    E-Print Network [OSTI]

    Richards, Chad Edward

    2005-02-17

    . Through the TMDLs, point sources and NPSs were encouraged to reduce SRP loadings by a watershed average of 50 percent (TNRCC, 2001). The TMDL also identified the most controllable sources of SRP to be wastewater treatment plants and WAFs (TNRCC, 2001... be applied to a variety of crops suitable for agricultural production in central Texas, but turfgrass sod has an increased potential to efficiently remove manure nutrients from the NBR watershed through harvested biomass and topsoil. Also, the dense...

  10. Brush Management/Water Yield Feasibility Study for Four Watersheds In Texas 

    E-Print Network [OSTI]

    Bednarz, Steven T.; Dybala, Tim; Amonett, Carl; Muttiah, Ranjan S.; Rosenthal, Wes; Srinivasan, Raghavan; Arnold, Jeff G.

    2003-01-01

    storage. Brush removal was simulated by converting all heavy and moderate categories of brush (except oak) to open range (native grass). Simulated changes in water yield due to brush treatment varied by subbasin, with all subbasins showing increased... on water yield in watersheds above Lake Arrowhead, Lake Brownwood, Lake Fort Phantom Hill, and Lake Palo Pinto (Figure 1-1). The hydrologic 2 “feasibility” studies were conducted by a team from the Texas Agricultural Experiment Station (TAES), U...

  11. Subtask 1.18 - A Decision Tool for Watershed-Based Effluent Trading

    SciTech Connect (OSTI)

    Xixi Wang; Bethany A. Kurz; Marc D. Kurz

    2006-11-30

    Handling produced water in an economical and environmentally sound manner is vital to coalbed methane (CBM) development, which is expected to increase up to 60% in the next 10-15 years as the demand for natural gas increases. Current produced water-handling methods (e.g., shallow reinjection and infiltration impoundments) are too costly when implemented on a well-by-well basis. A watershed-based effluent credit trading approach may be a means of managing produced water at reduced cost while meeting or surpassing water quality regulations. This market-based approach allows for improved water quality management by enabling industrial, agricultural, and municipal discharge facilities to meet water quality permit requirements by purchasing pollutant reduction credits from other entities within the same watershed. An evaluation of this concept was conducted for the Powder River Basin (PRB) of Montana and Wyoming by the Energy & Environmental Research Center (EERC). To conduct this assessment, the EERC collected and evaluated existing water quality information and developed the appropriate tools needed to assess the environmental and economic feasibility of specific trading scenarios. The accomplishments of this study include (1) an exploration of the available PRB water quantity and quality data using advanced statistical techniques, (2) development of an integrated water quality model that predicts the impacts of CBM produced water on stream salinity and sodicity, (3) development of an economic model that estimates costs and benefits from implementing potential trading options, (4) evaluation of hypothetical trading scenarios between select watersheds of the PRB, and (5) communication of the project concept and results to key state and federal agencies, industry representatives, and stakeholders of the PRB. The preliminary results of a basinwide assessment indicate that up to $684 million could be saved basinwide without compromising water quality as a result of implementing a watershed-based credit-trading approach.

  12. The long-term development of a watershed: spatial patterns, streamflow, and sustainability 

    E-Print Network [OSTI]

    DeFee, Buren Brooks, II

    2005-02-17

    (Strom and Nathan, 1998). As area size increases and patch types become more complicated, the calculations become unwieldy for obvious 9 reasons. One solution is to calculate an average ?lumped? runoff coefficient for the entire watershed. The TR-55..., the first and last bins were increased by one year to capture 1949 and 2000. Although these are not technically decades, the temporal range covered, from 1949 to 2000, is more easily subdivided as ?decades? and it is should be understood that the first...

  13. Remediation of the Melton Valley Watershed at Oak Ridge National Lab: An Accelerated Closure Success Story

    SciTech Connect (OSTI)

    Johnson, Ch.; Cange, J. [Bechtel Jacobs Company, LLC, Oak Ridge, TN (United States); Skinner, R. [U.S. DOE, Oak Ridge Operations Office, Oak Ridge, TN (United States); Adams, V. [U.S. DOE, Office of Groundwater and Soil Remediation, Washington, DC (United States)

    2008-07-01

    The Melton Valley (MV) Watershed at the U. S. Department of Energy's (DOE's) Oak Ridge National Laboratory (ORNL) encompasses approximately 430 hectares (1062 acres). Historic operations at ORNL produced a diverse legacy of contaminated facilities and waste disposal areas in the valley. In addition, from 1955 to 1963, ORNL served as a major disposal site for wastes from over 50 off-site government-sponsored installations, research institutions, and other isotope users. Contaminated areas in the watershed included burial grounds, landfills, underground tanks, surface impoundments, liquid disposal pits/trenches, hydro-fracture wells, leak and spill sites, inactive surface structures, and contaminated soil and sediment. Remediation of the watershed in accordance with the requirements specified in the Melton Valley Record of Decision (ROD) for Interim Actions in Melton Valley, which estimated that remedial actions specified in the ROD would occur over a period of 14 years, with completion by FY 2014. Under the terms of the Accelerated Closure Contract between DOE and its contractor, Bechtel Jacobs Company, LLC, the work was subdivided into 14 separate sub-projects which were completed between August 2001 and September 2006, 8 years ahead of the original schedule. (authors)

  14. Twenty-Plus Years of Environmental Change and Ecological Recovery of East Fork Poplar Creek: Background and Trends in Water Quality

    SciTech Connect (OSTI)

    Smith, John G; Stewart, Arthur J; Loar, James M

    2011-01-01

    In May 1985, a National Pollutant Discharge Elimination System permit was issued for the Department of Energy's Y-12 National Security Complex (Y-12 Complex) in Oak Ridge, Tennessee, USA, allowing discharge of effluents to East Fork Poplar Creek (EFPC). The effluents ranged from large volumes of chlorinated once-through cooling water and cooling tower blow-down to smaller discharges of treated and untreated process wastewaters, which contained a mixture of heavy metals, organics, and nutrients, especially nitrates. As a condition of the permit, a Biological Monitoring and Abatement Program (BMAP) was developed to meet two major objectives: demonstrate that the established effluent limitations were protecting the classified uses of EFPC, and document the ecological effects resulting from implementing a Water Pollution Control Program at the Y-12 Complex. The second objective is the primary focus of the other papers in this special series. This paper provides a history of pollution and the remedial actions that were implemented; describes the geographic setting of the study area; and characterizes the physicochemical attributes of the sampling sites, including changes in stream flow and temperature that occurred during implementation of the BMAP. Most of the actions taken under the Water Pollution Control Program were completed between 1986 and 1998, with as many as four years elapsing between some of the most significant actions. The Water Pollution Control Program included constructing nine new wastewater treatment facilities and implementation of several other pollution-reducing measures, such as a best management practices plan; area-source pollution control management; and various spill-prevention projects. Many of the major actions had readily discernable effects on the chemical and physical conditions of EFPC. As controls on effluents entering the stream were implemented, pollutant concentrations generally declined and, at least initially, the volume of water discharged from the Y-12 Complex declined. This reduction in discharge was of ecological concern and led to implementation of a flow management program for EFPC. Implementing flow management, in turn, led to substantial changes in chemical and physical conditions of the stream: stream discharge nearly doubled and stream temperatures decreased, becoming more similar to those in reference streams. While water quality clearly improved, meeting water quality standards alone does not guarantee protection of a waterbody's biological integrity. Results from studies on the ecological changes stemming from pollution-reduction actions, such as those presented in this series, also are needed to understand how best to restore or protect biological integrity and enhance ecological recovery in stream ecosystems. With a better knowledge of the ecological consequences of their decisions, environmental managers can better evaluate alternative actions and more accurately predict their effects.

  15. Lower East Fork Poplar Creek

    Office of Environmental Management (EM)

    is safe for limited water-contact recreational uses, such as wading in footwear. Eating fish from the creek is not recommended based upon the level of mercury in the fish. Are...

  16. Where does streamwater come from in low-relief forested watersheds? A dual-isotope approach

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Klaus, J.; McDonnell, J. J.; Jackson, C. R.; Du, E.; Griffiths, N. A.

    2015-01-08

    The time and geographic sources of streamwater in low-relief watersheds are poorly understood. This is partly due to the difficult combination of low runoff coefficients and often damped streamwater isotopic signals precluding traditional hydrograph separation and convolution integral approaches. Here we present a dual-isotope approach involving 18O and 2H of water in a low-angle forested watershed to determine streamwater source components and then build a conceptual model of streamflow generation. We focus on three headwater lowland sub-catchments draining the Savannah River Site in South Carolina, USA. Our results for a 3-year sampling period show that the slopes of the meteoricmore »water lines/evaporation water lines (MWLs/EWLs) of the catchment water sources can be used to extract information on runoff sources in ways not considered before. Our dual-isotope approach was able to identify unique hillslope, riparian and deep groundwater, and streamflow compositions. Thus, the streams showed strong evaporative enrichment compared to the local meteoric water line (?2H = 7.15 · ?18O +9.28‰) with slopes of 2.52, 2.84, and 2.86. Based on the unique and unambiguous slopes of the EWLs of the different water cycle components and the isotopic time series of the individual components, we were able to show how the riparian zone controls baseflow in this system and how the riparian zone "resets" the stable isotope composition of the observed streams in our low-angle, forested watersheds. Although this approach is limited in terms of quantifying mixing percentages between different end-members, our dual-isotope approach enabled the extraction of hydrologically useful information in a region with little change in individual isotope time series.« less

  17. Developing a Methodology to Prioritize Texas Watersheds for Environmental Restoration Efforts 

    E-Print Network [OSTI]

    Srinivasan, R.; Jacobs, Jennifer H.; Jones, C. Allan; Harris, B.L.; Jensen, Ricard W.

    2003-01-01

    that approximate conditions that existed prior to intensive human settlement in the 1800s. Interest in restoring watersheds and ecosystems has been expressed by several agencies including the U.S. EPA (2000 and 2001) and the U.S. Fish and Wildlife Service (2000... upstream of dams. However, the data on the extent to which high flow and median flow conditions had been altered was omitted from the final analyses because the hydrologic modeling upon which it is based does not cover the entire state. During...

  18. Appendix 58 Flathead Forest Plan Amendment 21, Appendix IV

    E-Print Network [OSTI]

    . CHARACTERISTICS OF THE SUBBASIN The Swan Subbasin is bounded by the Swan Range to the east, the Mission Mountains. Mountain hemlock are also found at higher elevations in the southern part of the Mission Range. Drier a well developed shrub layer, e.g., menziesia, alder, mountain maple, huckleberry, etc. The wetland

  19. Flathead Electric Cooperative Facility Geothermal Heat Pump System Upgrade

    Broader source: Energy.gov [DOE]

    Project Will Take Advantage of Abundant Water in Shallow Aquifer. Demonstrate Low Temperature GSHP System Design. Provides a Baseline for Local Industrial Geothermal Project Costs and Benefits.

  20. Appendix 28 Geomorphology of the Lower Flathead River

    E-Print Network [OSTI]

    of tree or shrub species such as Populius trichocarpa (black cottonwood) and Salix exigua (sandbar willow

  1. Flathead Electric Cooperative Facility Geothermal Heat Pump System Upgrade

    SciTech Connect (OSTI)

    Liu, Xiaobing

    2014-06-01

    High initial cost and lack of public awareness of ground source heat pump (GSHP) technology are the two major barriers preventing rapid deployment of this energy saving technology in the United States. Under the American Recovery and Reinvestment Act (ARRA), 26 GSHP projects have been competitively selected and carried out to demonstrate the benefits of GSHP systems and innovative technologies for cost reduction and/or performance improvement. This paper highlights findings of a case study of one of the ARRA-funded GSHP demonstration projects, which is a heating only central GSHP system using shallow aquifer as heat source and installed at a warehouse and truck bay at Kalispell, MT. This case study is based on the analysis of measured performance data, utility bills, and calculations of energy consumptions of conventional central heating systems for providing the same heat outputs as the central GSHP system did. The evaluated performance metrics include energy efficiency of the heat pump equipment and the overall GSHP system, pumping performance, energy savings, carbon emission reductions, and cost-effectiveness of GSHP system compared with conventional heating systems. This case study also identified areas for reducing uncertainties in performance evaluation, improving operational efficiency, and reducing installed cost of similar GSHP systems in the future. Publication of ASHRAE at the annual conference in Seattle.

  2. Proposed modifications to the RCRA post-closure permit for the Upper East Fork Poplar Creek Hydrogeologic Regime at the U.S. Department of Energy Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1997-05-01

    This report presents proposed modifications to the Resource Conservation and Recovery Act (RCRA) Post-Closure Permit (PCP) for the Upper East Fork Poplar Creek Hydrogeologic Regime (permit number TNHW-088, EPA ID No. TN3 89 009 0001). The modifications are proposed to: (1) revise the current text for two of the Permit Conditions included in Permit Section II - General Facility Conditions, and (2) update the PCP with revised versions of the Y-12 Plant Groundwater Protection Program (GWPP) technical field procedures included in several of the Permit Attachments. The updated field procedures and editorial revisions are Class 1 permit modifications, as specified in Title 40, Code of Federal Regulations (CFR) {section}270.42; Appendix I - Classification of Permit Modifications. These modifications are summarized below.

  3. Restoring Anadromous Fish Habitat in the Lapwai Creek Watershed, Technical Report 2003-2006.

    SciTech Connect (OSTI)

    Rasmussen, Lynn

    2007-02-01

    The Restoring Anadromous Fish Habitat in the Lapwai Creek Watershed is a multi-phase project to enhance steelhead trout in the Lapwai Creek watershed by improving salmonid spawning and rearing habitat. Habitat is limited by extreme high runoff events, low summer flows, high water temperatures, poor instream cover, spawning gravel siltation, and sediment, nutrient and bacteria loading. Funded by the Bonneville Power Administration (BPA) as part of the Northwest Power Planning Council's Fish and Wildlife Program, the project assists in mitigating damage to steelhead runs caused by the Columbia River hydroelectric dams. The project is sponsored by the Nez Perce Soil and Water Conservation District (District). Target fish species include steelhead trout (Oncorhynchus mykiss). Steelhead trout within the Snake River Basin were listed in 1997 as threatened under the Endangered Species Act. Accomplishments for the contract period December 1, 2003 through February 28, 2004 include; seven grade stabilization structures, 0.67 acres of wetland plantings, ten acres tree planting, 500 linear feet streambank erosion control, two acres grass seeding, and 120 acres weed control.

  4. Restoring Anadromous Fish Habitat in Big Canyon Creek Watershed, 2004-2005 Annual Report.

    SciTech Connect (OSTI)

    Rasmussen, Lynn

    2006-07-01

    The ''Restoring Anadromous Fish Habitat in the Big Canyon Creek Watershed'' is a multi-phase project to enhance steelhead trout in the Big Canyon Creek watershed by improving salmonid spawning and rearing habitat. Habitat is limited by extreme high runoff events, low summer flows, high water temperatures, poor instream cover, spawning gravel siltation, and sediment, nutrient and bacteria loading. Funded by the Bonneville Power Administration (BPA) as part of the Northwest Power Planning Council's Fish and Wildlife Program, the project assists in mitigating damage to steelhead runs caused by the Columbia River hydroelectric dams. The project is sponsored by the Nez Perce Soil and Water Conservation District. Target fish species include steelhead trout (Oncorhynchus mykiss). Steelhead trout within the Snake River Basin were listed in 1997 as threatened under the Endangered Species Act. Accomplishments for the contract period September 1, 2004 through October 31, 2005 include; 2.7 riparian miles treated, 3.0 wetland acres treated, 5,263.3 upland acres treated, 106.5 riparian acres treated, 76,285 general public reached, 3,000 students reached, 40 teachers reached, 18 maintenance plans completed, temperature data collected at 6 sites, 8 landowner applications received and processed, 14 land inventories completed, 58 habitat improvement project designs completed, 5 newsletters published, 6 habitat plans completed, 34 projects installed, 2 educational workshops, 6 displays, 1 television segment, 2 public service announcements, a noxious weed GIS coverage, and completion of NEPA, ESA, and cultural resources requirements.

  5. Water chemistry-based classification of streams and implications for restoring mined Appalachian watersheds

    SciTech Connect (OSTI)

    Merovich, G.T.; Stiles, J.M.; Petty, J.T.; Ziemkiewicz, P.F.; Fulton, J.B. [West Virginia University, Morgantown, WV (United States)

    2007-07-15

    We analyzed seasonal water samples from the Cheat and Tygart Valley river basins, West Virginia, USA, in an attempt to classify streams based on water chemistry in this coal-mining region. We also examined temporal variability among water samples. Principal component analysis identified two important dimensions of variation in water chemistry. This variation was determined largely by mining-related factors (elevated metals, sulfates, and conductivity) and an alkalinity-hardness gradient. Cluster analysis grouped water samples into six types that we described as reference, soft, hard, transitional, moderate acid mine drainage, and severe acid mine drainage. These types were statistically distinguishable in multidimensional space. Classification tree analysis confirmed that chemical constituents related to acid mine drainage and acid rain distinguished these six groups. Hard, soft, and severe acid mine drainage type streams were temporally constant compared to streams identified as reference, transitional, and moderate acid mine drainage type, which had a greater tendency to shift to a different water type between seasons. Our research is the first to establish a statistically supported stream classification system in mined watersheds. The results suggest that human-related stressors superimposed on geology are responsible for producing distinct water quality types in this region as opposed to more continuous variation in chemistry that would be expected in an unimpacted setting. These findings provide a basis for simplifying stream monitoring efforts, developing generalized remediation strategies, and identifying specific remediation priorities in mined Appalachian watersheds.

  6. Sources of large wood in the main stem of a fourth-order watershed in coastal Oregon1

    E-Print Network [OSTI]

    Sources of large wood in the main stem of a fourth-order watershed in coastal Oregon1 Gordon H. Reeves, Kelly M. Burnett, and Edward V. McGarry Abstract: We compared the contribution of large wood from different sources and wood distributions among channel zones of influence in a relatively pristine fourth

  7. The efficacy of salmon carcass analogs for enhancing stream and fish production in the Wind River watershed

    E-Print Network [OSTI]

    The efficacy of salmon carcass analogs for enhancing stream and fish production in the Wind River watershed, Washington, to evaluate the effects of nutrient enhancement on measures of stream and fish production. We compared low level water chemistry, water quality, and periphyton, insect, and fish production

  8. QUANTIFICATION OF POTENTIAL ARSENIC BIOAVAILABILITY IN SPATIALLY VARYING GEOLOGIC ENVIRONMENTS AT THE WATERSHED SCALE USING CHELATING RESINS 

    E-Print Network [OSTI]

    LAKE, GRACIELA ESTHER

    2002-01-01

    or element by organisms. The objective of this research is to quantify the potential bioavailability of arsenic in laboratory microcosms and in different geologic environments in the Nueces and San Antonio River Watersheds, Texas, using a chelating resin... Stripping……………………………………………………….. 19 Anion Competition..……………….…………………………………. 20 Soil Microcosms…...…………………………………………………. 20 Sediment Sample and Collection Site Descriptions……………… 21 Sediment Characterization…………………………………………. 22 Arsenic Analysis...

  9. USDA Forest Service Gen. Tech. Rep. PSW-GTR-168. 1998. 117 Cumulative Watershed Effects: Caspar Creek and Beyond1

    E-Print Network [OSTI]

    impacts are influenced by multiple activities, so almost all impacts must be evaluated as cumulative impacts rather than as individual impacts. Existing definitions suggest that to be significant, an impact and managing cumulative watershed impacts have not yet proved successful for averting these impacts, so

  10. Deep groundwater flow as the main pathway for chemical outputs in a small headwater watershed (Mule Hole, South India)

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Deep groundwater flow as the main pathway for chemical outputs in a small headwater watershed (Mule of a groundwater baseflow located into the active zone of the crystalline aquifer, below the weir. These findings indicate that groundwater contributes to a large part of chemical outputs at the catchment scale

  11. Point-nonpoint effluent trading in watersheds: A review and critique

    SciTech Connect (OSTI)

    Jarvie, M.; Solomon, B.

    1998-03-01

    The 1990s have been characterized as the decade of market incentives in US environmental policy-making. Not only is their use expanding for air pollution control, but the US Environmental Protection Agency is now also encouraging the use of market instruments for control of effluents within watersheds. After reviewing general guidelines and principles for effluent trading, this study considers the special problems of point-nonpoint (p-n) sources, the most common focus of effluent trading to date. Four case studies of p-n trading are discussed, which illustrate the promise of the policy. Although only two of these four case study programs have involved actual effluent trades thus far, they all have resulted in more cost-effective reductions of water pollution. Overall use of effluent trading to date has been modest, and suggestions are made for improvement of this innovative policy.

  12. Evaluation of CALPUFF nitrogen deposition modeling in the Chesapeake Bay Watershed Area using NADP data

    SciTech Connect (OSTI)

    Garrison, M.; Mayes, P.; Sherwell, J.

    1998-12-31

    The CALMET/CALPUFF modeling system has been used to estimate nitrogen deposition in an area surrounding Baltimore and the northern portion of the Chesapeake Bay. Comprehensive NO{sub x} emissions inventories and meteorological data bases have been developed to conduct the modeling. This paper discusses the results of an evaluation of predicted nitrogen wet deposition rates compared to measured rates at two NADP/NTN sites in Maryland, Wye and White Rock. Underprediction of wet deposition rates is investigated through the use of sensitivity and diagnostic evaluations of model performance. A suggested change to the calculation of NO{sub x} transformation rates involving an alternative specification of minimum NO{sub x} concentrations was made to CALPUFF and the performance evaluation was re-done. Results of the new evaluation show significantly improved model performance, and therefore the modification is tentatively proposed for use in further applications of CALPUFF to the assessment of nitrogen deposition in the Chesapeake Bay watershed.

  13. Inorganic Carbon Isotopes and Chemical Characterization of Watershed Drainages, Barrow, Alaska, 2013

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Throckmorton, Heather M.; Heikoop, Jeffrey H.; Newman, Brent D.; Wilson, Cathy J.

    Arctic soils contain a large pool of terrestrial C and are of interest due to their potential for releasing significant carbon dioxide (CO2) and methane (CH4) to the atmosphere. Due to substantial landscape heterogeneity, predicting ecosystem-scale CH4 and CO2 production is challenging. This study assessed dissolved inorganic carbon (DIC = Sigma (total) dissolved CO2) and CH4 in watershed drainages in Barrow, Alaska as critical convergent zones of regional geochemistry, substrates, and nutrients. In July and September of 2013, surface waters and saturated subsurface pore waters were collected from 17 drainages. Based on simultaneous DIC and CH4 cycling, we synthesized isotopic and geochemical methods to develop a subsurface CH4 and DIC balance by estimating mechanisms of CH4 and DIC production and transport pathways and oxidation of subsurface CH4. We observed a shift from acetoclastic (July) towards hydrogenotropic (September) methanogenesis at sites located towards the end of major freshwater drainages, adjacent to salty estuarine waters, suggesting an interesting landscape-scale effect on CH4 production mechanism. The majority of subsurface CH4 was transported upward by plant-mediated transport and ebullition, predominantly bypassing the potential for CH4 oxidation. Thus, surprisingly CH4 oxidation only consumed approximately 2.51 +/- 0.82% (July) and 0.79 +/- 0.79% (September) of CH4 produced at the frost table, contributing to less than 0.1% of DIC production. DIC was primarily produced from respiration, with iron and organic matter serving as likely e- acceptors. This work highlights the importance of spatial and temporal variability of CH4 production at the watershed scale, and suggests broad scale investigations are required to build better regional or pan-Arctic representations of CH4 and CO2 production.

  14. Inorganic Carbon Isotopes and Chemical Characterization of Watershed Drainages, Barrow, Alaska, 2013

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Heikoop, Jeffrey H.; Throckmorton, Heather M.; Wilson, Cathy J.; Newman, Brent D.

    2015-09-25

    Arctic soils contain a large pool of terrestrial C and are of interest due to their potential for releasing significant carbon dioxide (CO2) and methane (CH4) to the atmosphere. Due to substantial landscape heterogeneity, predicting ecosystem-scale CH4 and CO2 production is challenging. This study assessed dissolved inorganic carbon (DIC = Sigma (total) dissolved CO2) and CH4 in watershed drainages in Barrow, Alaska as critical convergent zones of regional geochemistry, substrates, and nutrients. In July and September of 2013, surface waters and saturated subsurface pore waters were collected from 17 drainages. Based on simultaneous DIC and CH4 cycling, we synthesized isotopic and geochemical methods to develop a subsurface CH4 and DIC balance by estimating mechanisms of CH4 and DIC production and transport pathways and oxidation of subsurface CH4. We observed a shift from acetoclastic (July) towards hydrogenotropic (September) methanogenesis at sites located towards the end of major freshwater drainages, adjacent to salty estuarine waters, suggesting an interesting landscape-scale effect on CH4 production mechanism. The majority of subsurface CH4 was transported upward by plant-mediated transport and ebullition, predominantly bypassing the potential for CH4 oxidation. Thus, surprisingly CH4 oxidation only consumed approximately 2.51 +/- 0.82% (July) and 0.79 +/- 0.79% (September) of CH4 produced at the frost table, contributing to less than 0.1% of DIC production. DIC was primarily produced from respiration, with iron and organic matter serving as likely e- acceptors. This work highlights the importance of spatial and temporal variability of CH4 production at the watershed scale, and suggests broad scale investigations are required to build better regional or pan-Arctic representations of CH4 and CO2 production.

  15. Implementing the Pecos River Watershed Protection Plan through Invasive Species Control and by Providing Technical and Financial Assistance to Reduce Agricultural Nonpoint Source Pollution 

    E-Print Network [OSTI]

    Gregory, L.; Porter, A.; Knutson, A.; Muegge, M.

    2013-01-01

    the use of biological saltcedar controls across the watershed, and conducting prescribed burning on saltcedar stands in areas previously treated with aerially applied chemicals. Additional activity included in this project was administration and reporting...

  16. Remedial investigation report on the Melton Valley watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Volume 3: Appendix C

    SciTech Connect (OSTI)

    1997-05-01

    The Melton Valley watershed presents a multifaceted management and decision-making challenge because of the very heterogeneous conditions that exist with respect to contaminant type, disposal unit age, mode of disposal, release mechanism, and potential risk-producing pathways. The investigation presented here has assembled relevant site data in the geographic context with the intent of enabling program managers and decision-makers to understand site conditions and evaluate the necessity, relative priority, and scope of potential remedial actions. The industrial and recreational exposure scenarios are used to provide a risk assessment reference context to evaluate levels of contamination in surface water, groundwater, soil, and sediment within each subbasin of the Melton Valley watershed. All available analytical results for the media of interest that could be qualified for use in the risk assessment were screened to determine carcinogenic risk values and noncarcinogenic hazard indexes and to identify the chemicals of concern (COCs) for each evaluated media in each subbasin.

  17. Hydrologic data summary for the White Oak Watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee, October 1990--December 1991

    SciTech Connect (OSTI)

    Borders, D.M.; Gregory, S.M.; Clapp, R.B.; Frederick, B.J.; Watts, J.A.

    1992-06-01

    This report summarizes for the 15-month period of October 1990-- December 1991 the available dynamic hydrologic data collected, primarily on the White Oak Creek (WOC) watershed, along with information collected on the surface flow systems that affect the quality or quantity of surface water. The collection of hydrologic data is one component of numerous, ongoing Oak Ridge National Laboratory (ORNL) environmental studies and monitoring programs and is intended to: (1) characterize the quantity and quality of water in the flow systems; (2) assist with the planning and assessment of remedial action activities; and, (3) provide long-term availability of data and quality assurance. Characterization of the hydrology of the WOC watershed is critical for understanding the processes that drive contaminant transport in the watershed. Identification of spatial and temporal trends in hydrologic parameters and mechanisms that affect the movement of contaminants supports the development of interim corrective measures and remedial restoration alternatives. In addition, hydrologic monitoring supports long-term assessment of the effectiveness of remedial actions in limiting the transport of contaminants across Waste Area Grouping (WAG) boundaries and ultimately to the off-site environment. For these reasons, it is of paramount importance to the Environmental Restoration Program (ERP) to collect and report hydrologic data activities that contribute to the Site Investigations component of the ERP. (White Oak Creek is also referred to as ``Whiteoak`` Creek).

  18. Hydrologic data summary for the White Oak Watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee, October 1990--December 1991

    SciTech Connect (OSTI)

    Borders, D.M.; Gregory, S.M.; Clapp, R.B.; Frederick, B.J.; Watts, J.A.

    1992-06-01

    This report summarizes for the 15-month period of October 1990-- December 1991 the available dynamic hydrologic data collected, primarily on the White Oak Creek (WOC) watershed, along with information collected on the surface flow systems that affect the quality or quantity of surface water. The collection of hydrologic data is one component of numerous, ongoing Oak Ridge National Laboratory (ORNL) environmental studies and monitoring programs and is intended to: (1) characterize the quantity and quality of water in the flow systems; (2) assist with the planning and assessment of remedial action activities; and, (3) provide long-term availability of data and quality assurance. Characterization of the hydrology of the WOC watershed is critical for understanding the processes that drive contaminant transport in the watershed. Identification of spatial and temporal trends in hydrologic parameters and mechanisms that affect the movement of contaminants supports the development of interim corrective measures and remedial restoration alternatives. In addition, hydrologic monitoring supports long-term assessment of the effectiveness of remedial actions in limiting the transport of contaminants across Waste Area Grouping (WAG) boundaries and ultimately to the off-site environment. For these reasons, it is of paramount importance to the Environmental Restoration Program (ERP) to collect and report hydrologic data activities that contribute to the Site Investigations component of the ERP. (White Oak Creek is also referred to as Whiteoak'' Creek).

  19. Impact of Resolution on Simulation of Closed Mesoscale Cellular Convection Identified by Dynamically Guided Watershed Segmentation

    SciTech Connect (OSTI)

    Martini, Matus; Gustafson, William I.; Yang, Qing; Xiao, Heng

    2014-11-27

    Organized mesoscale cellular convection (MCC) is a common feature of marine stratocumulus that forms in response to a balance between mesoscale dynamics and smaller scale processes such as cloud radiative cooling and microphysics. We use the Weather Research and Forecasting model with chemistry (WRF-Chem) and fully coupled cloud-aerosol interactions to simulate marine low clouds during the VOCALS-REx campaign over the southeast Pacific. A suite of experiments with 3- and 9-km grid spacing indicates resolution-dependent behavior. The simulations with finer grid spacing have smaller liquid water paths and cloud fractions, while cloud tops are higher. The observed diurnal cycle is reasonably well simulated. To isolate organized MCC characteristics we develop a new automated method, which uses a variation of the watershed segmentation technique that combines the detection of cloud boundaries with a test for coincident vertical velocity characteristics. This ensures that the detected cloud fields are dynamically consistent for closed MCC, the most common MCC type over the VOCALS-REx region. We demonstrate that the 3-km simulation is able to reproduce the scaling between horizontal cell size and boundary layer height seen in satellite observations. However, the 9-km simulation is unable to resolve smaller circulations corresponding to shallower boundary layers, instead producing invariant MCC horizontal scale for all simulated boundary layers depths. The results imply that climate models with grid spacing of roughly 3 km or smaller may be needed to properly simulate the MCC structure in the marine stratocumulus regions.

  20. CTUIR Grande Ronde River Watershed Restoration Program McCoy Creek/McIntyre Creek Road Crossing, 1995-1999 Progress Report.

    SciTech Connect (OSTI)

    Childs, Allen B.

    2000-08-01

    The Confederated Tribes of the Umatilla Indian Reservation (CTUIR) and Bonneville Power Administration (BPA) entered into a contract agreement beginning in 1996 to fund watershed restoration and enhancement actions and contribute to recovery of fish and wildlife resources and water quality in the Grande Ronde River Basin. The CTUIR's habitat program is closely coordinated with the Grande Ronde Model Watershed Program and multiple agencies and organizations within the basin. The CTUIR has focused during the past 4 years in the upper portions of the Grande Ronde Subbasin (upstream of LaGrande, Oregon) on several major project areas in the Meadow, McCoy, and McIntyre Creek watersheds and along the mainstem Grande Ronde River. This Annual Report provides an overview of individual projects and accomplishments.

  1. Hydrologic data summary for the White Oak Creek watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee, January--December 1994

    SciTech Connect (OSTI)

    Borders, D.M.; Ziegler, K.S.; Reece, D.K.; Watts, J.A.; Frederick, B.J.; McCalla, W.L.; Pridmore, D.J.

    1995-08-01

    This report summarizes, for the 12-month period January through December 1994, the available dynamic hydrologic data collected on the White Oak Creek (WOC) watershed as well as information collected on surface flow systems in the surrounding vicinity that may affect the quality or quantity of surface water in the watershed. The collection of hydrologic data is one component of numerous, ongoing Oak Ridge National Laboratory (ORNL) environmental studies and monitoring programs and is intended to characterize the quantity and quality of water in the surface flow system, assist with the planning and assessment of remedial action activities, provide long-term availability of data and quality assurance of these data, and support long-term measures of contaminant fluxes at a spatial scale to provide a comprehensive picture of watershed performance that is commensurate with future remedial actions.

  2. EFFECT OF CLIMATE CHANGE ON WATERSHED RUNOFF FLOW - UPPER COOSA RIVER BASIN UPSTREAM FROM PLANT HAMMOND

    SciTech Connect (OSTI)

    Chen, K.

    2011-10-24

    The ability of water managers to maintain adequate supplies in the coming decades depends on future weather conditions, as climate change has the potential to reduce stream flows from their current values due to potentially less precipitation and higher temperatures, and possibly rendering them unable to meet demand. The upper Coosa River basin, located in northwest Georgia, plays an important role in supplying water for industry and domestic use in northern Georgia, and has been involved in water disputes in recent times. The seven-day ten-year low flow (7Q10 flow) is the lowest average flow for seven consecutive days that has an average recurrence interval of 10 years. The 7Q10 flow is statistically derived from the observed historical flow data, and represents the low flow (drought) condition for a basin. The upper Coosa River basin also supplies cooling water for the 935MW coal-fired Hammond plant, which draws about 65% of the 7Q10 flow of the upper Coosa River to dissipate waste heat. The water is drawn through once and returned to the river directly from the generator (i.e., no cooling tower is used). Record low flows in 2007 led to use of portable cooling towers to meet temperature limits. Disruption of the Plant Hammond operation may trigger closure of area industrial facilities (e.g. paper mill). The population in Georgia is expected to double from 9 million to 18 million residents in the next 25 years, mostly in the metropolitan Atlanta area. Therefore, there will be an even greater demand for potable water and for waste assimilation. Climate change in the form of persistent droughts (causing low flows) and high ambient temperatures create regulatory compliance challenges for Plant Hammond operating with a once-through cooling system. Therefore, the Upper Coosa River basin was selected to study the effect of potential future weather change on the watershed runoff flow.

  3. Natural Recharge to the Unconfined Aquifer System on the Hanford Site from the Greater Cold Creek Watershed: Progress Report 2004

    SciTech Connect (OSTI)

    Waichler, Scott R.; Wigmosta, Mark S.; Coleman, Andre M.

    2004-09-14

    Movement of contaminants in groundwater at the Hanford Site is heavily dependent on recharge to the unconfined aquifer. As the effects of past artificial discharges dissipate, the water table is expected to return to more natural conditions, and natural recharge will become the driving force when evaluating future groundwater flow conditions and related contaminant transport. Previous work on the relationship of natural recharge to groundwater movement at the Hanford Site has focused on direct recharge from infiltrating rainfall and snowmelt within the area represented by the Sitewide Groundwater Model (SGM) domain. However, part of the groundwater recharge at Hanford is provided by flow from Greater Cold Creek watershed (GCC), a large drainage area on the western boundary of the Hanford Site that includes Cold Creek Valley, Dry Creek Valley, and the Hanford side of Rattlesnake Mountain. This study was undertaken to estimate the recharge from GCC, which is believed to enter the unconfined aquifer as both infiltrating streamflow and shallow subsurface flow. To estimate recharge, the Distributed Hydrology-Soil-Vegetation Model (DHSVM) was used to simulate a detailed water balance of GCC from 1956 to 2001 at a spatial resolution of 200~m and a temporal resolution of one hour. For estimating natural recharge to Hanford from watersheds along its western and southwestern boundaries, the most important aspects that need to be considered are 1)~distribution and relative magnitude of precipitation and evapotranspiration over the watershed, 2)~streamflow generation at upper elevations and infiltration at lower elevations during rare runoff events, and 3)~permeability of the basalt bedrock surface underlying the soil mantle.

  4. Annual hydrologic data summary for the White Oak Creek Watershed: Water Year 1990 (October 1989--September 1990)

    SciTech Connect (OSTI)

    Borders, D.M.; Gregory, S.M.; Clapp, R.B.; Frederick, B.J.; Moore, G.K.; Watts, J.A.; Broders, C.C.; Bednarek, A.T.

    1991-09-01

    This report summarizes, for the Water Year 1990 (October 1989-- September 1990), the dynamic hydrologic data collected on the Whiteoak Creek (WOC) Watershed's surface and subsurface flow systems. These systems affect the quality or quantity of surface water and groundwater. The collection of hydrologic data is one component of numerous, ongoing Oak Ridge National Laboratory (ORNL) environmental studies and monitoring programs and is intended to 1. characterize the quantity and quality of water in the flow system, 2. plan and assess remedial action activities, and 3. provide long-term availability of data and assure quality. Characterizing the hydrology of the WOC watershed provides a better understanding of the processes which drive contaminant transport in the watershed. Identifying of spatial and temporal trends in hydrologic parameters and mechanisms that affect the movement of contaminants supports the development of interim corrective measures and remedial restoration alternatives. Hydrologic monitoring supports long-term assessment of the effectiveness of remedial actions in limiting the transport of contaminants across Waste Area Grouping boundaries and ultimately to the off-site environment. The majority of the data summarized in this report are available from the Remedial Action Programs Data and Information Management System data base. Surface water data available within the WOC flow system include discharge and runoff, surface water quality, radiological and chemical contamination of sediments, and descriptions of the outfalls to the WOC flow system. Climatological data available for the Oak Ridge area include precipitation, temperature, humidity, wind speed, and wind direction. Information on groundwater levels, aquifer characteristics, and groundwater quality are presented. Anomalies in the data and problems with monitoring and accuracy are discussed. 58 refs., 54 figs., 15 tabs.

  5. Analysis Of Leakage In Carbon Sequestration Projects In Forestry:A Case Study Of Upper Magat Watershed, Philippines

    SciTech Connect (OSTI)

    Lasco, Rodel D.; Pulhin, Florencia B.; Sales, Renezita F.

    2007-06-01

    The role of forestry projects in carbon conservation andsequestration is receiving much attention because of their role in themitigation of climate change. The main objective of the study is toanalyze the potential of the Upper Magat Watershed for a carbonsequestration project. The three main development components of theproject are forest conservation, tree plantations, and agroforestry farmdevelopment. At Year 30, the watershed can attain a net carbon benefit of19.5 M tC at a cost of US$ 34.5 M. The potential leakage of the projectis estimated using historical experience in technology adoption inwatershed areas in the Philippines and a high adoption rate. Two leakagescenarios were used: baseline and project leakage scenarios. Most of theleakage occurs in the first 10 years of the project as displacement oflivelihood occurs during this time. The carbon lost via leakage isestimated to be 3.7 M tC in the historical adoption scenario, and 8.1 MtC under the enhanced adoption scenario.

  6. The development of an aquatic spill model for the White Oak Creek watershed, Oak Ridge National Laboratory, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Johnson, R.O.

    1996-05-01

    This study develops an aquatic spill model applicable to the White Oak Creek watershed draining the Oak Ridge National Laboratory. Hazardous, toxic, and radioactive chemicals are handled and stored on the laboratory reservation. An accidental spill into the White Oak Creek watershed could contaminate downstream water supplies if insufficient dilution did not occur. White Oak Creek empties into the Clinch River, which flows into the Tennessee River. Both rivers serve as municipal water supplies. The aquatic spill model provides estimates of the dilution at sequential downstream locations along White Oak creek and the Clinch River after an accidental spill of a liquid containing a radioactively decaying constituent. The location of the spill on the laboratory is arbitrary, while hydrologic conditions range from drought to extreme flood are simulated. The aquatic spill model provides quantitative estimates with which to assess water quality downstream from the site of the accidental spill, allowing an informed decision to be made whether to perform mitigating measures so that the integrity of affected water supplies is not jeopardized.

  7. Test of APEX for Nine Forested Watersheds in East Texas X. Wang,* A. Saleh, M. W. McBroom, J. R. Williams, and L. Yin

    E-Print Network [OSTI]

    .58 to 2.74 ha) forested watersheds located in southwest Cherokee County in East Texas. Simulated annual. Contemporary silvicultural practices increasingly involve the use of herbicides for site preparation and weed sustainability, erosion (water and wind), water sup- ply and quality, soil quality, plant competition, weather

  8. Impacts of Sedimentation from Oil and Gas Development on Stream Macroinvertebrates in Two Adjacent Watersheds of the Allegheny National Forest of Northwestern Pennsylvania

    SciTech Connect (OSTI)

    Fritz, K.; Harris, S.; Edenborn, H.M.; Sams, J.

    2011-01-01

    Fritz, Kelley'*, Steven Harris', Harry Edenborn2, and James Sams2. 'Clarion University of Pennsylvania, Clarion, PA 16214, 2National Energy Technology Laboratory, U.S. Dept. Energy, Pittsburgh, PA 15236. Impacts a/Sedimentation/rom Oil and Gas Development on Stream Macroinvertebrates in Two Adjacent Watersheds a/the Allegheny National Forest a/Northwestern Pennsylvania - The Allegheny National Forest (ANF), located in northwestern Pennsy Ivania, is a multiuse forest combining commercial development with recreational and conservation activities. As such, portions of the ANF have been heavily logged and are now the subject of widespread oil and gas development. This rapid increase in oil and gas development has led to concerns about sediment runoff from the dirt and gravel roads associated with development and the potential impact on the aquatic biota of the receiving streams. We examined and compared the benthic macroinvertebrate communities in two adjacent watersheds of similar size and topography in the ANF; the Hedgehog Run watershed has no oil and gas development, while the adjacent Grunder Run watershed has extensive oil and gas development. In Hedgehog and Grunder Run, we collected monthly kicknet samples from riffles and glides at two sites from April to October 2010. At the same intervals, we measured standard water quality parameters, including conductivity and turbidity. Preliminary results have indicated much higher turbidity in Grunder Run, but little difference in the diversity and abundance of benthic macro invertebrates inhabiting the two streams.

  9. The loss of mature pine trees to mountain pine beetles in sensitive watersheds raised fears that influxes of nutrients and sediment might threaten key sources of drinking water.

    E-Print Network [OSTI]

    1 The loss of mature pine trees to mountain pine beetles in sensitive watersheds raised fears) From Death Comes Life: Recovery and Revolution in the Wake of Epidemic Outbreaks of Mountain Pine Beetle To stand witness to a wave of mountain pine beetles sweeping across a favorite western landscape

  10. A GIS-based Estimate of Net Erosion Rate for Semi-arid Watersheds in New Mexico Richardson, C.P.1

    E-Print Network [OSTI]

    Cal, Mark P.

    A GIS-based Estimate of Net Erosion Rate for Semi-arid Watersheds in New Mexico Richardson, C.P.1 subsequent management for beneficial use. GIS-based modeling and evaluation is another tool to evaluate-basin of the Rio Puerco basin to the Rio Grande. Objective The objective of this work is to utilize a GIS platform

  11. Erosion and sediment transport in a temperate forested watershed are predicted with a new sediment module linked to the Distributed Hydrology-Soil-Vegetation Model (DHSVM). The

    E-Print Network [OSTI]

    Eberhard, Marc O.

    #12;#12;ABSTRACT Erosion and sediment transport in a temperate forested watershed are predicted with a new sediment module linked to the Distributed Hydrology-Soil-Vegetation Model (DHSVM). The DHSVM sediment module represents the main sources of sediment generation in forested environments: mass wasting

  12. White Oak Creek Watershed: Melton Valley Area Remedial Investigation Report, Oak Ridge National Laboratory, Oak Ridge, Tennessee: Volume 3 Appendix C

    SciTech Connect (OSTI)

    1996-11-01

    This report provides details on the baseline ecological risk assessment conducted in support of the Remedial Investigation (RI) Report for the Melton Valley areas of the White Oak Creek watershed (WOCW). The RI presents an analysis meant to enable the US Department of Energy (DOE) to pursue a series of remedial actions resulting in site cleanup and stabilization. The ecological risk assessment builds off of the WOCW screening ecological risk assessment. All information available for contaminated sites under the jurisdiction of the US Department of Energy`s Comprehensive Environmental Response, Compensation, and Liability Act Federal Facilities Agreement within the White Oak Creek (WOC) RI area has been used to identify areas of potential concern with respect to the presence of contamination posing a potential risk to ecological receptors within the Melton Valley area of the White Oak Creek watershed. The risk assessment report evaluates the potential risks to receptors within each subbasin of the watershed as well as at a watershed-wide scale. The WOC system has been exposed to contaminant releases from Oak Ridge National Laboratory and associated operations since 1943 and continues to receive contaminants from adjacent waste area groupings.

  13. Solar Energy for Charging Fork Truck Batteries 

    E-Print Network [OSTI]

    Viljoen, T. A.; Turner, W. C.

    1980-01-01

    The demand for renewable energy sources has stimulated technological advances in solar cell development. Initially, development and fabrication were extremely costly and no encouragement for use in industrial applications was made. Today, evidence...

  14. East Fork Biodiesel LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH Jump to: navigation,Foothills, California: Energy Resources Jump

  15. Reducing methylmercury accumulation in the food webs of San Francisco Bay and its local watersheds

    SciTech Connect (OSTI)

    Davis, J.A., E-mail: jay@sfei.org [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States); Looker, R.E. [San Francisco Bay Regional Water Quality Control Board, 1515 Clay Street, Suite 1400, Oakland, CA 94612 (United States)] [San Francisco Bay Regional Water Quality Control Board, 1515 Clay Street, Suite 1400, Oakland, CA 94612 (United States); Yee, D. [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States)] [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States); Marvin-Di Pasquale, M. [U.S. Geological Survey, Water Resources Division/MS 480, 345 Middlefield Road, Menlo Park, CA 94025 (United States)] [U.S. Geological Survey, Water Resources Division/MS 480, 345 Middlefield Road, Menlo Park, CA 94025 (United States); Grenier, J.L. [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States)] [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States); Austin, C.M. [San Francisco Bay Regional Water Quality Control Board, 1515 Clay Street, Suite 1400, Oakland, CA 94612 (United States)] [San Francisco Bay Regional Water Quality Control Board, 1515 Clay Street, Suite 1400, Oakland, CA 94612 (United States); McKee, L.J.; Greenfield, B.K. [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States)] [San Francisco Estuary Institute, 4911 Central Avenue, Richmond, CA 94804 (United States); Brodberg, R. [California Office of Environmental Health Hazard Assessment, California Environmental Protection Agency, 1001 I Street, Sacramento, CA 95812 (United States)] [California Office of Environmental Health Hazard Assessment, California Environmental Protection Agency, 1001 I Street, Sacramento, CA 95812 (United States); Blum, J.D. [Department of Geological Sciences, University of Michigan, 1100 North University Avenue, Ann Arbor, MI 48109 (United States)] [Department of Geological Sciences, University of Michigan, 1100 North University Avenue, Ann Arbor, MI 48109 (United States)

    2012-11-15

    San Francisco Bay (California, USA) and its local watersheds present an interesting case study in estuarine mercury (Hg) contamination. This review focuses on the most promising avenues for attempting to reduce methylmercury (MeHg) contamination in Bay Area aquatic food webs and identifying the scientific information that is most urgently needed to support these efforts. Concern for human exposure to MeHg in the region has led to advisories for consumption of sport fish. Striped bass from the Bay have the highest average Hg concentration measured for this species in USA estuaries, and this degree of contamination has been constant for the past 40 years. Similarly, largemouth bass in some Bay Area reservoirs have some of the highest Hg concentrations observed in the entire US. Bay Area wildlife, particularly birds, face potential impacts to reproduction based on Hg concentrations in the tissues of several Bay species. Source control of Hg is one of the primary possible approaches for reducing MeHg accumulation in Bay Area aquatic food webs. Recent findings (particularly Hg isotope measurements) indicate that the decades-long residence time of particle-associated Hg in the Bay is sufficient to allow significant conversion of even the insoluble forms of Hg into MeHg. Past inputs have been thoroughly mixed throughout this shallow and dynamic estuary. The large pool of Hg already present in the ecosystem dominates the fraction converted to MeHg and accumulating in the food web. Consequently, decreasing external Hg inputs can be expected to reduce MeHg in the food web, but it will likely take many decades to centuries before those reductions are achieved. Extensive efforts to reduce loads from the largest Hg mining source (the historic New Almaden mining district) are underway. Hg is spread widely across the urban landscape, but there are a number of key sources, source areas, and pathways that provide opportunities to capture larger quantities of Hg and reduce loads from urban runoff. Atmospheric deposition is a lower priority for source control in the Bay Area due to a combination of a lack of major local sources. Internal net production of MeHg is the dominant source of MeHg that enters the food web. Controlling internal net production is the second primary management approach, and has the potential to reduce food web MeHg in some habitats more effectively and within a much shorter time-frame. Controlling net MeHg production and accumulation in the food web of upstream reservoirs and ponds is very promising due to the many features of these ecosystems that can be manipulated. The most feasible control options in tidal marshes relate to the design of flow patterns and subhabitats in restoration projects. Options for controlling MeHg production in open Bay habitat are limited due primarily to the highly dispersed distribution of Hg throughout the ecosystem. Other changes in these habitats may also have a large influence on food web MeHg, including temperature changes due to global warming, sea level rise, food web alterations due to introduced species and other causes, and changes in sediment supply. Other options for reducing or mitigating exposure and risk include controlling bioaccumulation, cleanup of contaminated sites, and reducing other factors (e.g., habitat availability) that limit at-risk wildlife populations.

  16. Feasibility Study of Carbon Sequestration Through Reforestation in the Chesapeake Bay Watershed of Virginia

    SciTech Connect (OSTI)

    Andy Lacatell; David Shoch; Bill Stanley; Zoe Kant

    2007-03-01

    The Chesapeake Rivers conservation area encompasses approximately 2,000 square miles of agricultural and forest lands in four Virginia watersheds that drain to the Chesapeake Bay. Consulting a time series of classified Landsat imagery for the Chesapeake Rivers conservation area, the project team developed a GIS-based protocol for identifying agricultural lands that could be reforested, specifically agricultural lands that had been without forest since 1990. Subsequent filters were applied to the initial candidate reforestation sites, including individual sites > 100 acres and sites falling within TNC priority conservation areas. The same data were also used to produce an analysis of baseline changes in forest cover within the study period. The Nature Conservancy and the Virginia Department of Forestry identified three reforestation/management models: (1) hardwood planting to establish old-growth forest, (2) loblolly pine planting to establish working forest buffer with hardwood planting to establish an old-growth core, and (3) loblolly pine planting to establish a working forest. To assess the relative carbon sequestration potential of these different strategies, an accounting of carbon and total project costs was completed for each model. Reforestation/management models produced from 151 to 171 tons carbon dioxide equivalent per acre over 100 years, with present value costs of from $2.61 to $13.28 per ton carbon dioxide equivalent. The outcome of the financial analysis was especially sensitive to the land acquisition/conservation easement cost, which represented the most significant, and also most highly variable, single cost involved. The reforestation/management models explored all require a substantial upfront investment prior to the generation of carbon benefits. Specifically, high land values represent a significant barrier to reforestation projects in the study area, and it is precisely these economic constraints that demonstrate the economic additionality of any carbon benefits produced via reforestation--these are outcomes over and above what is currently possible given existing market opportunities. This is reflected and further substantiated in the results of the forest cover change analysis, which demonstrated a decline in area of land in forest use in the study area for the 1987/88-2001 period. The project team collected data necessary to identify sites for reforestation in the study area, environmental data for the determining site suitability for a range of reforestation alternatives and has identified and addressed potential leakage and additionality issues associated with implementing a carbon sequestration project in the Chesapeake Rivers Conservation Area. Furthermore, carbon emissions reductions generated would have strong potential for recognition in existing reporting systems such as the U.S. Department of Energy 1605(b) voluntary reporting requirements and the Chicago Climate Exchange. The study identified 384,398 acres on which reforestation activities could potentially be sited. Of these candidate sites, sites totaling 26,105 acres are an appropriate size for management (> 100 acres) and located in priority conservation areas identified by The Nature Conservancy. Total carbon sequestration potential of reforestation in the study area, realized over a 100 year timeframe, ranges from 58 to 66 million tons of carbon dioxide equivalent, and on the priority sites alone, potential for carbon sequestration approaches or exceeds 4 million tons of carbon dioxide equivalent. In the absence of concerted reforestation efforts, coupled with policy strategies, the region will likely face continued declines in forest land.

  17. Impact of nutrient loading from point and non-point sources on water quality and lotic ecosystem health in Texas' north-Bosque watershed using a bio-indicator response approach 

    E-Print Network [OSTI]

    Rodriguez, Angela Dean

    2001-01-01

    and trophic status of stream sites within the Lake Waco/Bosque watershed and to examine various experimental parameters of the Matlock Periphytometer method. Periphytometric assays were conducted at eight stream sites during the period from April 1998 through...

  18. Remedial investigation report on the Melton Valley watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Volume 2: Appendixes A and B

    SciTech Connect (OSTI)

    NONE

    1997-05-01

    The Melton Valley watershed presents a multifaceted management and decision-making challenge because of the very heterogeneous conditions that exist with respect to contaminant type, disposal unit age, mode of disposal, release mechanism, and potential risk-producing pathways. The investigation presented here has assembled relevant site data in the geographic context with the intent of enabling program managers and decision-makers to understand site conditions and evaluate the necessity, relative priority, and scope of potential remedial actions. The industrial and recreational exposure scenarios are used to provide a risk assessment reference context to evaluate levels of contamination in surface water, groundwater, soil, and sediment within each subbasin of the Melton Valley watershed. All available analytical results for the media of interest that could be qualified for use in the risk assessment were screened to determine carcinogenic risk values and noncarcinogenic hazard indexes and to identify the chemicals of concern (COCs) for each evaluated media in each subbasin.

  19. Remedial investigation report on the Melton Valley Watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Volume 1: Evaluation, interpretation, and data summary

    SciTech Connect (OSTI)

    NONE

    1997-05-01

    The Melton Valley watershed presents a multifaceted management and decision-making challenge because of the very heterogeneous conditions that exist with respect to contaminant type, disposal unit age, mode of disposal, release mechanism, and potential risk-producing pathways. The investigation presented here has assembled relevant site data in the geographic context with the intent of enabling program managers and decision-makers to understand site conditions and evaluate the necessity, relative priority, and scope of potential remedial actions.

  20. 1. Go on top of the check-dam and survey the water-shed, i.e., the upstream part from which water ows into the storage.

    E-Print Network [OSTI]

    Sohoni, Milind

    TD 603 1. Go on top of the check-dam and survey the water-shed, i.e., the upstream part from which water ows into the storage. 2. What is the storage in the dam (in cu.m.)? 3. What is the length and depth of the dam? What is its structure and cost? How much time did it take to build the dam? 4. Where

  1. In Situ Stabilization of Inactive Low Level Waste Pipelines in the Melton Valley Watershed at Oak Ridge National Laboratory

    SciTech Connect (OSTI)

    Cange, J.; Cox, J. [Bechtel Jacobs Company, LLC, Oak Ridge, TN (United States); Coye, St. [Sevenson Environmental Services, Inc., Niagara Falls, NY (United States); Skinner, R. [US DOE Oak Ridge Operations, Oak Ridge, TN (United States); Shaw, K. [Restoration Services, Inc., Oak Ridge, TN (United States); McGinley, S. [Pro2Serve, Oak Ridge, TN (United States)

    2008-07-01

    The Melton Valley watershed at Oak Ridge National Laboratory (ORNL) contained an inactive waste pipeline system consisting of approximately 12 kilometers of buried waste pipelines and over 142 m{sup 3} in surface/subsurface appurtenances (e.g., vents, valve pits, pump vaults, etc.). Historically, the system was used to transport liquid low level and process waste between generator facilities in Melton Valley, storage and disposal sites in Melton Valley, and storage/treatment facilities in Bethel Valley. The selected remedy in the Melton Valley Record of Decision (ROD) for inactive pipelines was isolation, removal, or stabilization. Pipeline remediation activities began in the summer of 2005 and were completed in the spring of 2006. The task entailed an iterative process of selecting pipeline access points, excavating and exposing pipelines, performing tapping, draining and cutting activities, either installing fittings for grouting or plugging and capping the lines. Grouting was accomplished using paired access points, with one location serving as the grout injection point and the other as vent/drain and grout confirmation point. Grouting was conducted by pumping a cement-bentonite grout into the specially installed fittings and typically proceeded from a low point to a high point to ensure complete filling of the pipeline (i.e., no void space). The project successfully grouted a total of 8,454 meters (linear distance) of pipeline; another 3,573 meters of pipeline was stabilized through isolation. (authors)

  2. Structural geology of the Irons Fork - North Fork Creek area, Lake Ouachita, Arkansas 

    E-Print Network [OSTI]

    White, Marjorie Ann

    1980-01-01

    flexural slip folding, whereas recrystall- ization is active during flexural flow folding. The S cleavage 3 which is best developed in the shaly units of all formations, is developed by the bending or "kinking" of mica grains into micro- folds. D... ) Kink folds with north trending axes formed during tne fourth deformation event. Macroscopic, northwest trending cross folds form at the same time, or slightly later than, the kink folds. Interlayer slip along SO/SI surfaces accomplished most...

  3. A Multiple Watershed Approach to Assessing the Effects of Habitat Restoration Actions on Anadromous and Resident Fish Populations, Technical Report 2003-2004.

    SciTech Connect (OSTI)

    Marmorek, David

    2004-03-01

    Habitat protection and restoration is a cornerstone of current strategies to restore ecosystems, recover endangered fish species, and rebuild fish stocks within the Columbia River Basin. Strategies featuring habitat restoration include the 2000 Biological Opinion on operation of the Federal Columbia River Power System (FCRPS BiOp) developed by the National Marine Fisheries Service (NMFS), the 2000 Biological Opinion on Bull Trout developed by the US Fish and Wildlife Service (USFWS), and Sub-Basin Plans developed under the Fish and Wildlife Program of the Northwest Power and Conservation Council (NWPCC). There is however little quantitative information about the effectiveness of different habitat restoration techniques. Such information is crucial for helping scientists and program managers allocate limited funds towards the greatest benefits for fish populations. Therefore, it is critical to systematically test the hypotheses underlying habitat restoration actions for both anadromous and resident fish populations. This pilot project was developed through a proposal to the Innovative Projects fund of the NWPCC (ESSA 2002). It was funded by the Bonneville Power Administration (BPA) following reviews by the Independent Scientific Review Panel (ISRP 2002), the Columbia Basin Fish and Wildlife Authority (CBFWA 2002), the NWPCC and BPA. The study was designed to respond directly to the above described needs for information on the effectiveness of habitat restoration actions, including legal measures specified in the 2000 FCRPS BiOp (RPA 183, pg. 9-133, NMFS 2000). Due to the urgency of addressing these measures, the timeline of the project was accelerated from a duration of 18 months to 14 months. The purpose of this pilot project was to explore methods for evaluating past habitat restoration actions and their effects on fish populations. By doing so, the project will provide a foundation of retrospective analyses, on which to build prospective, multi-watershed designs for future habitat restoration actions. Such designs are being developed concurrently with this project by several other groups in the Columbia Basin (RME Workgroup 2003, NMFS 2003, Hillman and Paulsen 2002, Hillman 2003). By addressing questions about habitat restoration and monitoring (in coordination with other related efforts), we hope that this project will catalyze a shift in the Basin's paradigm of habitat restoration, moving from implementation of individual watershed projects towards rigorously designed and monitored, multiwatershed, adaptive management experiments. The project involved three phases of work, which were closely integrated with various related and ongoing efforts in the region: (1) Scoping - We met with a Core Group of habitat experts and managers to scope out a set of testable habitat restoration hypotheses, identify candidate watersheds and recommend participants for a data evaluation workshop. (2) Data Assembly - We contacted over 80 scientists and managers to help evaluate the suitability of each candidate watershed's historical data for assessing the effectiveness of past restoration actions. We eventually settled on the Yakima, Wenatchee, Clearwater, and Salmon subbasins, and began gathering relevant data for these watersheds at a workshop with habitat experts and managers. Data assembly continued for several months after the workshop. (3) Data Analysis and Synthesis - We explored statistical approaches towards retrospectively analyzing the effects of restoration 'treatments' at nested spatial scales across multiple watersheds (Chapters 2-5 of this report). These analyses provided a foundation for identifying existing constraints to testing restoration hypotheses, and opportunities to overcome these constraints through improved experimental designs, monitoring protocols and project selection strategies (Chapters 6 and 7 of this report). Finally, we developed a set of recommendations to improve the design, implementation, and monitoring of prospective habitat restoration programs in the Columbia River Basin (Chapter 8).

  4. Project Reports for Salish and Kootenai Tribes, Confederated Tribes of the Flathead Reservation- 2012 Project

    Office of Energy Efficiency and Renewable Energy (EERE)

    Under this project, the Confederated Salish and Kootenai Tribes (CSKT) will determine technical and economic feasibility of a woody-biomass-fueled co-generation plant that would utilize fuels generated by tribal forest management activities to provide electricity and heat to tribal buildings at the tribal headquarters in Pablo, Montana, and/or generate electricity for the wholesale market.

  5. Project Reports for Salish and Kootenai Tribes, Confederated Tribes of the Flathead Reservation- 2011 Project

    Office of Energy Efficiency and Renewable Energy (EERE)

    This project is aimed at supporting one key component of a major multi-step undertaking on the part of the Confederated Salish and Kootenai Tribes (CSKT): the acquisition of the Kerr Hydroelectric project and its subsequent operation as a wholesale power generation facility.

  6. Salish and Kootenai Tribes, Confederated Tribes of the Flathead Reservation- 2011 Project

    Broader source: Energy.gov [DOE]

    Under this project, the Confederated Salish and Kootenai Tribes (CSKT) will assess the technical and economic feasibility of energy efficiency improvements to existing tribally owned buildings.

  7. Salish and Kootenai Tribes, Confederated Tribes of the Flathead Reservation- 2012 Project

    Broader source: Energy.gov [DOE]

    Under this project, the Confederated Salish and Kootenai Tribes (CSKT) will determine technical and economic feasibility of a woody-biomass-fueled co-generation plant that would utilize fuels generated by tribal forest management activities to provide electricity and heat to tribal buildings at the tribal headquarters in Pablo, Montana, and/or generate electricity for the wholesale market.

  8. Appendix 13 Aquatic and Terrestrial Vertebrate Species Occurrences for the Flathead

    E-Print Network [OSTI]

    Largemouth Bass I Largescale Sucker N Longnose Sucker N Mountain Whitefish N Northern Pike I Northern 1 Big Brown Bat 1 1 Bighorn Sheep 1 1 Black Bear 1 1 Black Rosy-finch 1 Black Swift 1 1 Black Tern 1

  9. Salish and Kootenai Tribes, Confederated Tribes of the Flathead Reservation- 2011 Project

    Office of Energy Efficiency and Renewable Energy (EERE)

    This project is aimed at supporting one key component of a major multi-step undertaking on the part of the Confederated Salish and Kootenai Tribes (CSKT): the acquisition of the Kerr Hydroelectric project and its subsequent operation as a wholesale power generation facility.

  10. General Descriptions of Major Wetland Plant Communities in the upper portion of the Flathead Subbasin

    E-Print Network [OSTI]

    ponds, and on the edge of marshes, potholes, and lakes. Drummond's willow (Salix drummondiana in wet meadow complexes (which often have some beaver influence). Bebb's willow (Salix bebbiana) and Geyer's willow (Salix geyeriana) are much less common as dominant species. Sandbar willow (Salix exigua

  11. Project Reports for Salish and Kootenai Tribes, Confederated Tribes of the Flathead Reservation- 2011 Project

    Office of Energy Efficiency and Renewable Energy (EERE)

    Under this project, the Confederated Salish and Kootenai Tribes (CSKT) will assess the technical and economic feasibility of energy efficiency improvements to existing tribally owned buildings.

  12. Watershed Assessment Program Team

    E-Print Network [OSTI]

    _F 0.0589 T TAUCSS 0.1996 T N1 0.0767 IRC 0.0575 T TAUCSC 0.1996 INFILT_P 0.0752 INFILT_F 0.0494 T KSAND 0.0645 LZETP_P 0.0605 LZSN 0.0377 T TAUCDS 0.0344 T K1 0.0605 T LZETP_P 0.0298 T M 0.0197 T IRC 0.0161 UZSN 0.0138 AGWRC 0.0276 DEEPFR 0.0079 IRC 0.0118 BRPO

  13. Fourth report on the Oak Ridge National Laboratory Biological Monitoring and Abatement Program for White Oak Creek Watershed and the Clinch River

    SciTech Connect (OSTI)

    Loar, J.M. [ed.] [ed.

    1994-04-01

    In response to a condition of the National Pollutant Discharge Elimination System (NPDES) permit issued to Oak Ridge National Laboratory (ORNL) on April 1, 1986, a Biological Monitoring and Abatement Program (BMAP) was developed for White Oak Creek (WOC) and selected tributaries. BMAP currently consists of six major tasks that address both radiological and nonradiological contaminants in the aquatic and terrestrial environs on-site and the aquatic environs off-site. These tasks are (1) toxicity monitoring, (2) bioaccumulation monitoring of nonradiological contaminants in aquatic biota, (3) biological indicator studies, (4) instream ecological monitoring, (5) assessment of contaminants in the terrestrial environment, and (6) radioecology of WOC and White Oak Lake. The ecological characterization of the WOC watershed will provide baseline data that can be used to document the ecological effects of the water pollution control program and the remedial action program. The long-term nature of BMAP ensures that the effectiveness of remedial measures will be properly evaluated.

  14. Biomonitoring of fish communities, using the index of Biotic Integrity, as an indicator of the success of soil conservation measures in the Rabbit Creek and Middle Creek watersheds, Macon County, North Carolina

    SciTech Connect (OSTI)

    Not Available

    1993-08-01

    Fish communities in two upper Little Tennessee River tributaries, Rabbit Creek and Middle Creek, both located in Macon County, North Carolina, were monitored using IBI methods in 1990 and again in 1992. A single site, each on the lower reaches of its respective creek, was chosen to reflect the influence of conditions throughout the watershed and to provide a measure of water quality exiting the watershed. The Rabbit Creek watershed (Holly Springs community) has a long history of settlement and agricultural use. Dominant land uses today are pasture in the bottom lands and residential development at higher elevations. Much of the upper portion of the Middle Creek watershed on the slopes of Scaly Mountain is devoted to cabbage farming, often on steep slopes and highly erodible soils. From the cabbage growing area, the creek drops 400 feet to the lower valley. Other common land uses include residential, livestock, and forest. Both streams are characterized by heavy sedimentation and frequent high turbidity. Both streams showed marked improvement between 1990 and 1992. In 1990, Rabbit Creek`s IBI score was 31.0, for a bioclass rating of ``poor.`` In 1992, the IBI score was 42.1 for a bioclass rating of ``fair.`` For Middle Creek, the corresponding figures and ratings are 42.1 (fair) and 54.5 (good). Examination of the data for Rabbit Creek shows a reduction in the proportion of pollution-tolerant species, a higher proportion of specialized insectivores, a higher catch rate (reflecting higher total numbers of fish), and an additional intolerant species. In both cases, the data (supported by visual observation) suggests the causative factor is reduced sedimentation.

  15. Waste area grouping 2 Phase I task data report: Ecological risk assessment and White Oak Creek watershed screening ecological risk assessment

    SciTech Connect (OSTI)

    Efroymson, R.A.; Jackson, B.L.; Jones, D.S. [and others] [and others

    1996-05-01

    This report presents an ecological risk assessment for Waste Area Grouping (WAG) 2 based on the data collected in the Phase I remedial investigation (RI). It serves as an update to the WAG 2 screening ecological risk assessment that was performed using historic data. In addition to identifying potential ecological risks in WAG 2 that may require additional data collection, this report serves to determine whether there are ecological risks of sufficient magnitude to require a removal action or some other expedited remedial process. WAG 2 consists of White Oak Creek (WOC) and its tributaries downstream of the Oak Ridge National Laboratory (ORNL) main plant area, White Oak Lake (WOL), the White Oak Creek Embayment of the Clinch River, associated flood plains, and the associated groundwater. The WOC system drains the WOC watershed, an area of approximately 16.8 km{sup 2} that includes ORNL and associated WAGs. The WOC system has been exposed to contaminants released from ORNL and associated operations since 1943 and continues to receive contaminants from adjacent WAGs.

  16. Hydrologic data summary for the White Oak Creek watershed at Oak Ridge National Laboratory, Oak Ridge, Tennessee (January--December 1993)

    SciTech Connect (OSTI)

    Borders, D.M.; Frederick, B.J.; Reece, D.K.; McCalla, W.L.; Watts, J.A.; Ziegler, K.S.

    1994-10-01

    This report summarizes, for the 12-month period (January through December 1993), the available dynamic hydrologic data collected, primarily, on the White Oak Creek (WOC) watershed along with information collected on the surface flow systems which affect the quality or quantity of surface water. Identification of spatial and temporal trends in hydrologic parameters and mechanisms that affect the movement of contaminants supports the development of interim corrective measures and remedial restoration alternatives. In addition, hydrologic monitoring supports long-term assessment of the effectiveness of remedial actions in limiting the transport of contaminants across Waste Area Grouping (WAG) boundaries and ultimately to the off-site environment. For these reasons, it is of paramount importance to the Environmental Restoration Program (ERP) to collect and report hydrologic data, an activity that contributes to the Site Investigations (SI) component of the ERP. This report provides and describes sources of hydrologic data for Environmental Restoration activities that use monitoring data to quantify and assess the impact from releases of contaminants from ORNL WAGs.

  17. White Oak Creek Watershed: Melton Valley Area Remedial Investigation Report, Oak Ridge National Laboratory, Oak Ridge, Tennessee: Volume 1 Main Text

    SciTech Connect (OSTI)

    NONE

    1996-11-01

    The purpose of this Remedial Investigation (RI) report is to present an analysis of the Melton Valley portion of the White Oak Creek (WOC) watershed, which will enable the US Department of Energy (DOE) to pursue a series of cost-effective remedial actions resulting in site cleanup and stabilization. In this RI existing levels of contamination and radiological exposure are compared to levels acceptable for future industrial and potential recreational use levels at the site. This comparison provides a perspective for the magnitude of remedial actions required to achieve a site condition compatible with relaxed access restrictions over existing conditions. Ecological risk will be assessed to evaluate measures required for ecological receptor protection. For each subbasin, this report will provide site-specific analyses of the physical setting including identification of contaminant source areas, description of contaminant transport pathways, identification of release mechanisms, analysis of contaminant source interactions with groundwater, identification of secondary contaminated media associated with the source and seepage pathways, assessment of potential human health and ecological risks from exposure to contaminants, ranking of each source area within the subwatershed, and outline the conditions that remedial technologies must address to stop present and future contaminant releases, prevent the spread of contamination and achieve the goal of limiting environmental contamination to be consistent with a potential recreational use of the site.

  18. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Flathead Electric Cooperative- Residential Energy Efficiency Rebate Program Flathead Electric offers incentives for residential customers to increase energy efficiency in homes...

  19. Three Forks, Montana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009)Thonotosassa,Thornwood,

  20. Chemical Sensor Based on Microfabricated Wristwatch Tuning Forks

    E-Print Network [OSTI]

    Zhang, Yanchao

    made of different conducting polymers or composites in combination with multivariate statistical tech-7 single-walled carbon nanotubes,8,9 polyaniline micro/ nanostructures, 10-12 and carbon-polymer composites the mechanical response of a thin (10-µm) polymer wire stretched across the two prongs of a wristwatch quartz

  1. Clark Fork River Delta Restoration Project Draft Environmental...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    until September. The lowest lake levels are reached during the winter. Additional information on Lake Pend Oreille operations is available in the Albeni Falls Dam Flexible...

  2. Roaring Fork Valley - Energy Smart Colorado Energy Efficiency Rebate

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAandSummary From: v2.7|EnergyandEnergy| DepartmentRoadmapProgram |

  3. Roaring Fork Valley - Energy Smart Colorado Renewable Energy Rebate Program

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAandSummary From: v2.7|EnergyandEnergy| DepartmentRoadmapProgram ||

  4. Forked River, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable Urban Transport JumpFlowood,Pevafersa JVOhio:River, New Jersey: Energy

  5. City of East Grand Forks, Minnesota (Utility Company) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLCLtd JumpGeorgiaBurley,ColumbusDurant, MississippiInformation

  6. Forked Deer Electric Coop, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to:ofEnia SpAFlex Fuels Energy JumpVynckeForests

  7. Spanish Fork, Utah: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfin JumpOpenColorado) JumpSoyminas

  8. Spanish Fork City Corporation (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEurope GmbHSoloPage Edit with form HistorySpain Installed

  9. Ash Fork, Arizona: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpen EnergyInformation AscensionAscot Renewco Jump

  10. Coal Fork, West Virginia: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company) JumpIowa: Energy ResourcesCreek, Colorado: Energy

  11. Lower East Fork Poplar Creek | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPA PublicLED1,400 Jobs |Inc. | DepartmentModeling

  12. Upper East Fork Poplar Creek | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment of EnergyEducation | Department

  13. Mapping intra-field yield variation using high resolution satellite imagery to integrate bioenergy and environmental stewardship in an agricultural watershed

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hamada, Yuki; Ssegane, Herbert; Negri, Maria Cristina

    2015-07-31

    Biofuels are important alternatives for meeting our future energy needs. Successful bioenergy crop production requires maintaining environmental sustainability and minimum impacts on current net annual food, feed, and fiber production. The objectives of this study were to: (1) determine under-productive areas within an agricultural field in a watershed using a single date; high resolution remote sensing and (2) examine impacts of growing bioenergy crops in the under-productive areas using hydrologic modeling in order to facilitate sustainable landscape design. Normalized difference indices (NDIs) were computed based on the ratio of all possible two-band combinations using the RapidEye and the National Agriculturalmore »Imagery Program images collected in summer 2011. A multiple regression analysis was performed using 10 NDIs and five RapidEye spectral bands. The regression analysis suggested that the red and near infrared bands and NDI using red-edge and near infrared that is known as the red-edge normalized difference vegetation index (RENDVI) had the highest correlation (R2 = 0.524) with the reference yield. Although predictive yield map showed striking similarity to the reference yield map, the model had modest correlation; thus, further research is needed to improve predictive capability for absolute yields. Forecasted impact using the Soil and Water Assessment Tool model of growing switchgrass (Panicum virgatum) on under-productive areas based on corn yield thresholds of 3.1, 4.7, and 6.3 Mg·ha-1 showed reduction of tile NO3-N and sediment exports by 15.9%–25.9% and 25%–39%, respectively. Corresponding reductions in water yields ranged from 0.9% to 2.5%. While further research is warranted, the study demonstrated the integration of remote sensing and hydrologic modeling to quantify the multifunctional value of projected future landscape patterns in a context of sustainable bioenergy crop production.« less

  14. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.

    2010-01-01

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  15. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.

    2010-08-09

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  16. Wetlands mitigation issues related to reconstruction of U.S. Highway 93 on the Flathead Indian Reservation, Montana

    E-Print Network [OSTI]

    Price, Mary B.

    2003-01-01

    resulting from the Kerr Hydro Power project on Flatheadfor highway construction and hydro power projects. She has a

  17. Vermont Department of Environmental Conservation, Watershed Management

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas: EnergyVentnor City,Act|

  18. Vermont Department of Environmental Conservation, Watershed Management

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas: EnergyVentnor City,Act|Division Surface Water

  19. Watershed Academy Webcast on Climate Resilience

    Broader source: Energy.gov [DOE]

    "Climate Resilience: What to Expect, How to Prepare, and  What you can Learn from Others." This webcast will share findings from the most recent National Climate Assessment report concerning...

  20. November, 2014 Beyond Pipes to Watersheds

    E-Print Network [OSTI]

    Wetland Surface WetlandStormwater Wetland Constructed WetlandPorous AsphaltPervious Concrete Permeable Interlocking Concrete Pavers Permeable Interlocking Concrete Pavers Permeable Interlocking Concrete Pavers Permeable Interlocking Concrete Pavers Permeable Interlocking Concrete Pavers Permeable Interlocking

  1. The Regional Watershed Spreadsheet Model (RWSM)

    E-Print Network [OSTI]

    ) Metals Recycling 11) Auto Recycling 12) Old Industrial Areas 13) Power Plants Land Use Mean Concentration created 1) Electrical Transformers 2) Military Areas 3) Drum Recycling 4) Cement Production 5) Crematoria 6) Oil Refineries/petrochemicals 7) Metals manufacture 8) Rail Transport 9) Shipping Transport 10

  2. Watershed, Climate, Hydrology Modeling Joint Projects of

    E-Print Network [OSTI]

    monitoring Agricultural productionAgricultural production Battlefield environmentBattlefield environment for Applied Remote Sensing in Agriculture, Meteorology, and Environment #12;Purpose A cooperative effort Grant Consortium US Army Research LaboratoryUS Army Research Laboratory ­­ Battlefield Environment

  3. The Regional Watershed Spreadsheet Model (RWSM)

    E-Print Network [OSTI]

    WI Presenting on work developed by: The Small Tributaries Loading Strategy Workgroup BASMAA * SFEI Estimates #12;10. Improved Loads Estimates Small Tribs Small Tribs In-Bay Erosion Large Rivers PCBs Loads of this plan... Hydro Sed Cu Hg PCB Se Diox PBDE OC Pest Hydro Sed Cu Hg PCB Se Diox PBDE OC PestStep 1 2 3 4 5

  4. Bacterial Monitoring for the Buck Creek Watershed 

    E-Print Network [OSTI]

    2008-01-01

    personnel to conduct this study. With the help and cooperation of the Texas AgriLife Research and Extension Center at Vernon, a work plan was developed to collect water samples and conduct water quality monitoring every other week at 13 different sites along...

  5. DISSERTATION Spatially Distributed Model to Assess Watershed

    E-Print Network [OSTI]

    Julien, Pierre Y.

    . Thank you also to my committee: Dr. Brian Bledsoe, Dr. Ken Carlson, and Dr. Bill Sanford. Your input group of fellow students. Not least among them were Bill Annable, Bret Jordan, Mike Sixta, Jason Albert have left anyone off this list it was unintentional. Many thanks go to Jenifer Davis, Gloria Garza

  6. A watershed blueprint: Partners work together 

    E-Print Network [OSTI]

    Wythe, Kathy

    2011-01-01

    , Hidalgo, and Willacy counties; and nonpoint source pollution and how it occurs. The Nueces River Authority funded the construction of the model through the Clean Rivers Program. The ACWP and member cities of the Lower Rio Grande Valley Texas... source pollution. Wetlands serve as a habitat for fish and other aquatic animals, stabilize streambeds and banks, and filter and process wastewater contaminants in the water. TCEQ and EPA fund a three-city wetland project as part of a Clean Water...

  7. Agriculture and Natural Resources Arkansas Watersheds

    E-Print Network [OSTI]

    or more nutrients is so high or the physical characteris tics of the soil or area is such that con tinued

  8. Montana Watershed Coordination Council | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: Energy

  9. Bear Creek Valley Watershed | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p uBUS SERVICE SUBSIDIESDepartment of585Bear Creek Valley

  10. Melton Valley Watershed | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May 28 Webinar toMeeting theMegan Slack AboutMelton

  11. FORK-DECOMPOSITIONS OF MATROIDS RHIANNON HALL, JAMES OXLEY, CHARLES SEMPLE, AND GEOFF WHITTLE

    E-Print Network [OSTI]

    Semple, Charles

    , while true for q = 5, is false for all larger fields [21]. This failure has prompted the search for an appropriate strengthening of 3­connectivity that will not only regain control of the number of inequivalent definition to allow further progress in matroid representation theory. Let M be a matroid with ground set E.

  12. STRATAL PATTERNS OF THE WILLIAMS FORK (HUNTER CANYON) FORMATION, PICEANCE BASIN, COLORADO

    E-Print Network [OSTI]

    Ost, Rebekah Corrie

    2010-12-31

    highstand systems tracts. Units 2 and 3 both contain stacked, repetitive stratal packages interpreted as depositional sequences. Depositional sequences contain lowstand, transgressive and highstand systems tracts. A complicated interplay between eustatic...

  13. RIPARIAN PLANT WATER RELATIONS ALONG THE NORTH FORK KINGS RIVER, CALIFORNIA1

    E-Print Network [OSTI]

    averaged 1.41 m3/s (50 cfs), however they were notably lower in 1987 at 0.7 m3/s (25 cfs). Riparian systems

  14. Diagenesis of the Clear Fork Formation (Leonardian) in the Monahans field, west Texas 

    E-Print Network [OSTI]

    Hedrick, Carroll Lee

    1993-01-01

    2 15 15 15 18 Stratigraphic Distribution of Porosity and Permeability. . . . . 19 Pore Types. GEOCHEMICAL DATA. Trace Elements: General Stratigraphic Trends. . . . Trace Elements: Intracrystalline Variation. . . . . Carbon and Oxygen... Isotopes. . DISCUSSION Early Syndepositional Diagenesis. Fracturing, , . . . 23 25 25 27 . . . 30 . . . 34 . . . 36 Mechanical and Chemical Compaction Fabrics. . . . . Cathodoluminescence. Carbon and Oxygen Isotopes. . Porosity...

  15. MetaFork: A Compilation Framework for Concurrency Models Targeting Hardware

    E-Print Network [OSTI]

    Moreno Maza, Marc

    to CUDA In automatic generation of GPU code from C code, it is desirable that the generated GPU code[i]; } Original C code. int ub_v = (N - 2) / B; meta_schedule { for (int t = 0; t int v = 0MemcpyHostToDevice)); } for (int c0 = 0; c0 c0 += 1) { { dim3 k0_dimBlock(B); dim3 k0_dimGrid(ub_v

  16. Borehole seismic monitoring of seismic stimulation at Occidental Permian Ltd's -- South Wason Clear Fork Unit

    E-Print Network [OSTI]

    Daley, Tom; Majer, Ernie

    2007-01-01

    the distribution of seismic energy within the reservoir.Field Monitoring of ASR Seismic Stimulation Source at LostField Results from Seismic Stimulation, 17th International

  17. Clark Fork River Delta Restoration Project 1 Finding of No Significant Impact for Final Environmental Assessment

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p aDepartment of Energy <ofEnergy Today, the| DepartmentClark

  18. Site Environmental Report for 2005 Volume I and Volume II

    E-Print Network [OSTI]

    Ruggieri, Michael

    2006-01-01

    Chicken Creek Upstream N. Fork Strawberry Creek N.Fork Strawberry Creek Downstream N.Fork Strawberry Creek Upstream No Name Creek Ravine Creek

  19. From Watersheds to Waterfalls andFrom Watersheds to Waterfalls and BeyondBeyond

    E-Print Network [OSTI]

    Beucher, Serge

    minimum generates aEach minimum generates a catchment basin in the WTS.catchment basin in the WTS minimum generates aEach minimum generates a catchment basin in the WTS.catchment basin in the WTS. Coping

  20. Iskuulpa Watershed ProjectIskuulpa Watershed Project BPA Project # 199506001BPA Project # 199506001

    E-Print Network [OSTI]

    Basin Fish and Wildlife Mitigation ProjectMitigation Project Established by the CTUIR in 1995Established by the CTUIR in 1995 Provides dual benefit to fish and wildlifeProvides dual benefit to fish and wildlife while

  1. Water Quality Monitoring in the Buck Creek Watershed and Facilitation of Buck Creek Watershed Partnership 

    E-Print Network [OSTI]

    Gregory, L.; Dyer, P.

    2013-01-01

    & 20376); two are in AU 0207A_02 (stations 20365 & 20368) and one is located on a tributary of the creek (station 20367). Building on this recommendation, two additional sites were included in the Interim Monitoring project. These added stations... the Interim Monitoring project Table 1. Water quality monitoring station descriptions Project? Site?No.?? TCEQ? Monitoring? Station?No.? General?Station?Location?&?Description? County? TCEQ Assessment Unit Station is Located In BC 03 20365 Buck...

  2. DEFINING PERCEPTIONS OF WATERSHED MANAGEMENT IN A GREAT PLAINS AND IN AN ANDEAN WATERSHED

    E-Print Network [OSTI]

    Restrepo-Osorio, Diana L

    2014-08-31

    of the program regarding some practices, and the lack of awareness about the program and its benefits, have been shown to prevent farmers from participating. Finances Large operations often focus on optimizing their yields to obtain the maximum amount...

  3. Rangeland Watershed Management for Texans: Know Your Plants to Protect Your Watershed 

    E-Print Network [OSTI]

    Rector, Barron S.

    2000-10-30

    ,? ?Texas virgins-bower,? ?old man?s beard,? ?love in the mist,? ?goat beard,? ?bar- bas de chivato,? and other common names in different parts of Texas. Some native plants have dozens of com- mon names. When you use common names, be sure they are accurate...-rooted perennial grasses create a more stable environment than do short- rooted grasses. Without good litter cover on the soil, the soil surface is exposed to full sunlight, higher temperatures, and higher soil water evaporation rates. Fewer plants can com- pete...

  4. Federal Facility Agreement Annual Progress Report for Fiscal Year 1999 Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Bechtel Jacobs Company LLC

    2000-01-01

    The U.S. Department of Energy-Oak Ridge Operations (DOE-ORO) EM Program adopted a watershed approach for performing Remedial Investigations (RIs) and characterizations for ORR because it is an effective system for determining the best methods for protecting and restoring aquatic ecosystems and protecting human health. The basic concept is that water quality and ecosystem problems are best solved at the watershed level rather than at the individual water-body or discharger level. The watershed approach requires consideration of all environmental concerns, including needs to protect public health, critical habitats such as wetlands, biological integrity, and surface and ground waters. The watershed approach provides an improved basis for management decisions concerning contaminant sources and containment. It allows more direct focus by stakeholders on achieving ecological goals and water quality standards rather than a measurement of program activities based on numbers of permits or samples. The watershed approach allows better management strategies for investigations, therefore maximizing the utilization of scarce resources. Feasibility studies (FSs) evaluate various alternatives in terms of environmental standards, the protection of human health and the environment, and the costs of implementation to find the optimum solution among them. Society has to decide how much it is willing to spend to meet the standards and to be protective. Conducting FSs is the process of trading off those criteria to pick that optimum point that society wants to achieve. Performing this analysis at the watershed scale allows those trade-offs to be made meaningfully. In addition, a Land Use Control Assurance Plan for the ORR was prepared to identify the strategy for assuring the long-term effectiveness of land use controls. These land use controls will be relied upon to protect human health and the environment at areas of the ORR undergoing remediation pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act and/or the Resource Conservation and Recovery Act. This plan will be implemented by means of a Memorandum of Understanding (MOU) incorporating its terms with the United States EPA and TDEC. The majority of projects described in this report are grouped into five watersheds. They are the East Tennessee Technical Park (ETTP) Watershed (formerly the K-25 Site), the Melton Valley (MV) and Bethel Valley (BV) Watersheds at the Oak Ridge National Laboratory (ORNL), and the Bear Creek Valley (BCV) and Upper East Fork Poplar Creek (UEFPC) Watersheds at the Y-12 Plant.

  5. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Incentive Program Flathead Electric encourages its residential customers to occupy energy efficient homes. Owners and builders of new homes which meet the "Montana Homes"...

  6. Microsoft Word - Draft Amendment to CFAC block power sales agreement...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Contract No. 06PB-11745 AMENDMENT executed by the BONNEVILLE POWER ADMINISTRATION and COLUMBIA FALLS ALUMINUM COMPANY, LLC and FLATHEAD ELECTRIC COOPERATIVE, INC This AMENDMENT to...

  7. Microsoft Word - Draft Amendment to CFAC block power sales agreement...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Amendment No. 1 Contract No. 06PB-11745 AMENDMENT executed by the BONNEVILLE POWER ADMINISTRATION and COLUMBIA FALLS ALUMINUM COMPANY, LLC and FLATHEAD ELECTRIC COOPERATIVE, INC...

  8. K-AR DATING OF AUTHIGENIC ILLITES: INTEGRATING THE DIAGENETIC HISTORY OF THE FLUVIAL WILLIAMS FORK FORMATION, MESAVERDE

    E-Print Network [OSTI]

    The ability to date diagenetic reactions in tight gas reservoirs that significantly influence reservoir quality will enhance our ability to characterize and produce these fields. Although diagenetic clays form only a small percent of the sandstone, they have a disproportionately large impact on reservoir

  9. ALDER ESTABLISHMENT AND CHANNEL DYNAMICS IN A TRIBUTARY OF THE SOUTH FORK EEL RIVER, MENDOCINO COUNTY, CALIFORNIA1

    E-Print Network [OSTI]

    , and Professor, Department of Land, Air, and Water Resources, University of California, Davis. 14 USDA Forest and Hedman (1977) call this inner region the "active channel." They de- scribe the active channel

  10. Population Recovery and Conservation Habitat Restoration Water Use and Hydropower Forests and Fish EAST FORK OWYHEE RIVER SALMON AND

    E-Print Network [OSTI]

    Population Recovery and Conservation · Habitat Restoration · Water Use and Hydropower · Forests........................................................................................................................................... 18 Water Quality Analysis ....................................................................................................................... 18 Nevada Division of Environmental Protection Water Quality Sampling

  11. FINAL TECHNICAL REPORT AMERICAN RECOVERY AND REINVESTMENT ACT NORTH FORK SKOKOMISH POWERHOUSE AT CUSHMAN NO. 2 DAM

    SciTech Connect (OSTI)

    Fischer, Steve; Wilson, Matthew

    2013-09-30

    The objective of this project was to add generating capacity on an in-stream flow release at Tacoma Power's Cushman hydroelectric project, Cushman No. 2 Dam, FERC Project P-460. The flow that is being used to generate additional electricity was being discharged from a valve at the base of the dam without recovery of the energy. A second objective to the project was to incorporate upstream fish passage by use of a fish collection structure attached to the draft tubes of the hydroelectric units. This will enable reintroduction of native anadromous fish above the dams which have blocked fish passage since the late 1920's. The project was funded in part by the American Recovery and Reinvestment Act through the Department of Energy, Office of Energy, Efficiency and Renewable Energy, Wind and Water Power Program.

  12. Basement/cover rock relations of the Dry Fork Ridge Anticline termination, northeastern Bighorn Mountains, Wyoming and Montana 

    E-Print Network [OSTI]

    Hennings, Peter Hill

    1986-01-01

    their equivalents in the western geosynclinal basins (e. g. , 2 to 5 km vs. 8 to 11 km). The structural style of Laramide deformation in the Wyoming Province is dominated by high angle faulting in the basement, whereas the style on the west side... on a scale of I: 12, 000 over the entire area and at a scale of I:6, 000 in structura11y complex portions. The map base consists of U. S. G. S. 7. 5 minute topographic quadrangles that were enlarged. Aerial photographs on a scale of appr oximate1y I...

  13. Confirmatory Sampling and Analysis Plan for the Lower East Fork Poplar Creek operable unit, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-04-01

    On December 21, 1989, the EPA placed the US Department of Energy`s (DOE`s) Oak Ridge Reservation (ORR) on the National Priorities List (NPL). On January 1, 1992, a Federal Facilities Agreement (FFA) between the DOE Field Office in Oak Ridge (DOE-OR), EPA Region IV, and the Tennessee Department of Environment and Conservation (TDEC) went into effect. This FFA establishes the procedural framework and schedule by which DOE-OR will develop, coordinate, implement and monitor environmental restoration activities on the ORR in accordance with applicable federal and state environmental regulations. The DOE-OR Environmental Restoration Program for the ORR addresses the remediation of areas both within and outside the ORR boundaries. This sampling and analysis plan focuses on confirming the cleanup of the stretch of EFPC flowing from Lake Reality at the Y-12 Plant through the City of Oak Ridge, to Poplar Creek on the ORR and its associated floodplain. Both EFPC and its floodplain have been contaminated by releases from the Y-12 Plant since the mid-1950s. Because the EFPC site-designated as an ORR operable unit (OU) under the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) is included on the NPL, its remediation must follow the specific procedures mandated by CERCLA, as amended by the Superfund Amendments and Reauthorization Act in 1986.

  14. Distribution and movement of domestic rainbow trout, Oncorhynchus mykiss, during pulsed flows in the South Fork American River, California

    E-Print Network [OSTI]

    2010-01-01

    Upper American River Hydroelectric Project, FERC Project No.California, Chili Bar Hydroelectric Project, FERC Projectthe night, as part of hydroelectric power generation by the

  15. Distribution and movement of domestic rainbow trout, Oncorhynchus mykiss, during pulsed flows in the South Fork American River, California

    E-Print Network [OSTI]

    2010-01-01

    the night, as part of hydroelectric power generation by theto manage water for hydroelectric power generation. There

  16. Use of BasinTemp to Model Summer Stream Temperatures in the South Fork of Ten Mile

    E-Print Network [OSTI]

    in basins where the data inputs are scarce. It assumes that direct solar radiation is the chief mechanism solar radiation and stream temperatures and that discharge has a growing effect in water temperatures that in mid-latitude regions, direct solar radiation is the most important mechanism driving summer stream

  17. Vermont Watershed Management Rivers Program Website | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards Jump to: navigation, search

  18. Water Rights Challenges to Coho Recovery in Coastal California Watersheds

    E-Print Network [OSTI]

    Alford, Chris

    2009-01-01

    related to land-use and water extraction can have a greatwater resources, water extraction is likely to shift from

  19. AIR-DEPOSITED POLLUTION IN THE ANACOSTIA RIVER WATERSHED

    E-Print Network [OSTI]

    District of Columbia, University of the

    study of recent works related to the health of the Anacostia River as well as government policies: The Importance of Population Susceptibility for Air Pollution Risk Assessment, Association of Particulate Matter and its estuaries. Literature survey revealed that considerable work has been done on the definition

  20. Jennifer Karps Portland Environmental Services, Watershed Revegetation Program

    E-Print Network [OSTI]

    Brown, Sally

    Preparation: Priority Climate Risks #12;· Quality, quantity, and availability of water resources · Disruption of energy, economic, and food systems · Increased fire, flood, and landslide risk · Habitat loss, erosion Science School (2012) UTCP: Novel Species Pilot #12;Continue the good work Seek out an opportunity to do

  1. Paso del Norte Watershed Council Coordinated Water Resources Database Project 

    E-Print Network [OSTI]

    Brown, Christopher; Sheng, Zhuping; Rich, Matt

    2004-01-01

    that we have gained in this pilot effort, 4) Specific recommendations for new water quality monitoring sites and equipment, and 5) An outline of tasks that should be undertaken in future phases of the project. All deliverables specified..., ? Installation of new monitoring stations and equipment as detailed above, and inclusion of these monitoring sites in future ArcIMS map products, ? Enhanced levels of funding to be directed to support more active participation of regional volunteer data...

  2. Watershed Analysis Results for Mendocino Redwood Company Lands in Coastal

    E-Print Network [OSTI]

    woody debris (LWD) condition is mainly marginal and deficient with few streams being on target: one marginal, 13 percent deficient, 48 percent no data). Generally speaking low LWD levels and high sediment for improvement of riparian conditions for long term LWD recruitment needs of stream habitat. In the short term

  3. TECHNICAL REPORTS The study area (Alegria watershed, Basque Country, Northern

    E-Print Network [OSTI]

    here is influenced by an important alluvial aquifer that plays a significant role in nitrate pollution from agricultural land use and management practices. Nitrates are transported primarily from the soil in a nitrate-vulnerable zone. The main objective of the study was to find land management options for water

  4. Developing a Watershed Characteristics Database to Improve Low Streamflow Prediction

    E-Print Network [OSTI]

    Vogel, Richard M.

    extreme hydrologic events. Regional hydrologic models of low-flow processes often produce estimators with unacceptably large errors. Using a continuous digital elevation model DEM of the conterminous United States statistics over traditional manual processing approaches. Low-flow regional regression models were developed

  5. The prediction of sediment yields from small blackland watersheds 

    E-Print Network [OSTI]

    Williams, Jimmy Ray

    1969-01-01

    the total expected gross erosion in the drainage basin is concuted and modified by a delivery ratio. The other category includes statistical relationships that have incorporated reservoir, matershed& and hydrologic variables to explain and predict... net drainage area, in square miles, age of reservoir in years, rate of gross erosion, in tons p r square mile per year, and CT III = capacity ? uatershed ratio, in acre-feet of total storage capacity per square mile of drainage area, In 1961...

  6. Future Climate Variability and Watershed Response in Southern California

    E-Print Network [OSTI]

    Lopez, Sonya Rita

    2012-01-01

    2004. Guidelines for use of climate scenarios developed fromIntergovernmental Panel on Climate Change, available fromNearing MA .2005. Impact of climate change on soil erosion,

  7. Evaluating Regional Patterns in Nitrate Sources to Watersheds in

    E-Print Network [OSTI]

    Elliott, Emily M.

    ) and NH3 (ammonia) from energy generation activities, transportation, industry, and agricul- tural Mountains in recent years for a variety of reasons (4­6), including increases in motor vehicle emissions which have offset reductions in NOx emissions from fossil-fuel burning industries (7) and regional

  8. Eagle Mountain Watershed: Calibration, Validation, and Best Management Practices 

    E-Print Network [OSTI]

    Lee, Taesoo; Narasimhan, Balaji; Srinivasan, Raqhavan

    2011-01-01

    ) from each WWTP. Figure 6. Waste Water Treatment Plants (WWTPs) Table 1. Daily discharge from WWTP of Alvord Daily Loads Flow (m3) TN (kg) TP (kg) Jan-02 230.90 1.83 0.53 Feb-02 204.40 1.90 0.44 Mar-02 234.68 3.17 0.30 Apr-02 200.61 1... of Azle Daily Loads Flow (m3) TN (kg) TP (kg) Jan-02 2882.03 15.10 2.01 Feb-02 2654.35 6.19 1.24 Mar-02 2916.47 10.63 1.00 Apr-02 3536.10 8.08 3.13 May-02 3443.56 3.97 0.86 Jun-02 2428.19 13.26 0.61 Jul-02 1631.41 17.87 0.81 Aug-02 2250.28 3...

  9. Directions in Watershed modelling Modelling of temporary streams

    E-Print Network [OSTI]

    accumulation sediment related quality dynamics: resuspension transport ·accumulation ·build up of organic and test hydrological modules · To develop and adjust sediment modules to assess accumulation, resuspension

  10. Kumeyaay Cultural Landscapes of Baja California's Tijuana River Watershed

    E-Print Network [OSTI]

    Gamble, Lynn H.; Wilken-Robertson, Michael

    2008-01-01

    who at times hved at El Alamo or Ha 'a, a remote canyon ofby non-Indians as El Alamo (the Cottonwood). In addition,Populus fremontii), or el alamo in Spanish, a large number

  11. Senator George J. Mitchell Center for Environmental & Watershed Research

    E-Print Network [OSTI]

    organic carbon flux from wetland sediments using a novel technique; (2) Permaculture-design research

  12. Characterization of watershed model behavior across a hydroclimatic gradient

    E-Print Network [OSTI]

    Wagener, Thorsten

    potential for overparameterization. This study uses global sensitivity analysis to investigate how, hydropower operations, etc. [Singh and Frevert, 2006]. The extensive array of models that have been developed. The potential for equifinality and overparamete- rization thus also increases for complex models, resulting

  13. Sumas and North Matsqui Watersheds -1997 Farm Practices Survey

    E-Print Network [OSTI]

    a scoring system called and Environmental Sustainability Parameter (ESP). A follow up survey was conducted was 30,500. Eighty two percent of farms reported shipping some or all of their manure off the farm. Fifty

  14. Education of Best Management Practices in the Arroyo Colorado Watershed 

    E-Print Network [OSTI]

    2009-01-01

    for development of the report. Allen Berthold, Texas Water Resources Institute, assisted with compiling the information used in the appendices. Dr. Allan Jones, Texas AgriLife Research, and Dr. Ruben Saldana, Texas AgriLife Extension Service, served... Casebolt and Aaron Wendt from the Texas State Soil and Water Conservation Board Statewide Resource Management group for their help, oversight and management of the project. Thank you to Enrique Perez and Luis Saldana, Texas AgriLife Extension Service...

  15. ForestRangelandandWatershedStewardship 1472CampusDelivery

    E-Print Network [OSTI]

    Lessons From 35 Years of Research on Oil Shale Lands in the Piceance Basin Fort Collins Fort Collins with oil shale extraction. The project involved approximately ten independent field studies, which were established on a 20-ha site located near what was then the focal point of oil shale activity in the Piceance

  16. Shale Oil and Gas, Frac Sand, and Watershed

    E-Print Network [OSTI]

    Minnesota, University of

    ;Bakken Oil Shale scope · Light, Sweet crude ­ ideal for automotive fuels and mid-size refineries (Midwest

  17. Shallow infiltration processes in arid watersheds at Yucca Mountain, Nevada

    SciTech Connect (OSTI)

    Flint, L.E.; Flint, A.L. Hevesi, J.A. [Geological Survey, Mercury, NV (United States)

    1994-12-31

    A conceptual model of shallow infiltration processes at Yucca Mountain, Nevada, was developed for use in hydrologic flow models to characterize net infiltration (the penetration of the wetting front below the zone influenced by evapotranspiration). The model categorizes the surface of the site into four infiltration zones. These zones were identified as ridgetops, sideslopes, terraces, and active channels on the basis of water-content changes with depth and time. The maximum depth of measured water-content change at a specific site is a function of surface storage capacity, the timing and magnitude of precipitation, evapotranspiration, and the degree of saturation of surficial materials overlying fractured bedrock. Measured water-content profiles for the four zones indicated that the potential for net infiltration is higher when evapotranspiration is low (i.e winter, cloudy periods), where surface concentration of water is likely to occur (i.e. depressions, channels), where surface storage capacity is low, and where fractured bedrock is close to the surface.

  18. University of Maryland's "WaterShed" Wins 2011 Solar Decathlon...

    Broader source: Energy.gov (indexed) [DOE]

    each team for the competitions. The other half of the 1,000 total points were awarded for energy balance, energy measurements and student tasks. Though the students didn't stay in...

  19. Rangeland Watershed Management for Texans: Are Your Pastures Healthy? 

    E-Print Network [OSTI]

    White, Larry D.; Rector, Barron S.; Hays, K. Brian

    2000-10-30

    The productivity of rangeland is closely tied to the amount of moisture captured when it rains and the presence of desirable plant species to use that moisture. Learn where your rainfall goes, how to determine pasture health, and how to maintain...

  20. Rangeland Watershed Management for Texans: Are Your Streams Healthy? 

    E-Print Network [OSTI]

    White, Larry D.; Rector, Barron S.; Hays, K. Brian

    2000-10-30

    It is important to monitor the health of the streams on your property. A photo guide in this publication helps you determine the stability of stream banks and spot problems that might cause erosion and other water quality problems....

  1. Arroyo Colorado Watershed Protection Plan Implementation Project Final Report 

    E-Print Network [OSTI]

    Berthold, T. Allen; Flores, Jaime

    2011-01-01

    /industrial wastewater discharges and irrigation return flows, recreation, and environmental uses and presents a detailed strategy to restore and protect these uses. Furthermore, the plan describes the institutional framework for current management programs... treatment levels, and enhanced biological treatment projects such as reuse via irrigation, polishing ponds and constructed wetland cells. Status ? Multiple wastewater effluent limits have been reduced and this is further reported in the milestones...

  2. Soil Hydraulic Characteristics of a Small Southwest Oregon Watershed Following

    E-Print Network [OSTI]

    --------------------------------------------- Soil Hydraulic Characteristics of a Small Southwest by a high-intensity burn over areas of steep topography. The areal distribution of soil hydraulic of infiltration capacity, saturated hydraulic conductivity, and soil moisture characteristics. Also, measures

  3. Texas connects watershed protection and erosion through compost

    E-Print Network [OSTI]

    Cogburn, Barrie; McCoy, Scott

    2003-01-01

    AND EROSION THROUGH COMPOST Barrie Cogburn (Phone: 512-416-saw the benefits of utilizing compost as an erosion-controltool. The compost alternative, which is comparable in cost

  4. Leslie Roche and Ken Tate Rangeland Watershed Lab UC Davis

    E-Print Network [OSTI]

    Tate, Kenneth

    regulations/environmental policy 43% Economic viability 21% Succession planning 21% Water/rainfall/weather­security Participation · Williamson Act most critical conservation program for ranchers (>75%) · ~40% of ranchers of water supply #12;Adaptive Rangeland Decision-Making: Surviving Drought #12;Drought Adaptation Strategies

  5. Frequency of Floods from a Burned Chaparral Watershed1

    E-Print Network [OSTI]

    produces moderate surface runoff. The vegetation promotes infiltration by retarding the runoff the ground surface. This layer greatly decreases infiltration rates and reduces the hydrologically active storms may occur following a brush fire. The study showed that the moderate storms may produce floods

  6. Water Rights Challenges to Coho Recovery in Coastal California Watersheds

    E-Print Network [OSTI]

    Alford, Chris

    2009-01-01

    2004. California State Water Resources Control Board (April 2009. Electronic Water Rights Information ManagementPress. Fullerton v. State Water Resources Control Board 90

  7. Habitat Conservation Plan for the Upper Etowah River Watershed

    E-Print Network [OSTI]

    Radcliffe, David

    in the United States is greatly impacted by man-made alterations of channels (e.g. dams, water diversion) that fragment these networks, and as a result, 47 percent of all federally listed endangered animals, such as construction, or other land development, that could lead to the `incidental take' of federally listed species

  8. Establishment of the Northeast Coastal Watershed Geospatial Data Network (NECWGDN)

    SciTech Connect (OSTI)

    Hannigan, Robyn

    2014-02-17

    The goals of NECWGDN were to establish integrated geospatial databases that interfaced with existing open-source (water.html) environmental data server technologies (e.g., HydroDesktop) and included ecological and human data to enable evaluation, prediction, and adaptation in coastal environments to climate- and human-induced threats to the coastal marine resources within the Gulf of Maine. We have completed the development and testing of a "test bed" architecture that is compatible with HydroDesktop and have identified key metadata structures that will enable seamless integration and delivery of environmental, ecological, and human data as well as models to predict threats to end-users. Uniquely this database integrates point as well as model data and so offers capacities to end-users that are unique among databases. Future efforts will focus on the development of integrated environmental-human dimension models that can serve, in near real time, visualizations of threats to coastal resources and habitats.

  9. Granger Lake Sedimentation and Watershed Conservation Implementation Assessment 

    E-Print Network [OSTI]

    McAlister, Jason

    2012-02-14

    existing reservoir data and validate historic sedimentation rate estimates. To demonstrate application of this technology and value of its data derivatives, a multi-year, multi-frequency acoustic survey of Granger Lake, located in Williamson County, Texas...

  10. Introduction Fluvial Processes in Small Southeastern Watersheds L. Allan James

    E-Print Network [OSTI]

    James, L. Allan

    surfaces, so they drive runoff genera- tion, sediment production, and the cycling of organic materials study along these lines of research. #12;394 james et al. papers in this issue This issue is divided erosion and historical sedimentation, and Part Three has one pa- per on automated mapping of headwater

  11. Watershed Scale Optimization to Meet Sustainable Cellulosic Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Water Composition in Agro-ecosystems Purdue University Task A. 2 Perennial grasses had lower sediment losses * Greater loss of soil following rain events from poplar, maize, and...

  12. Integration of stream and watershed data for hydrologic modeling 

    E-Print Network [OSTI]

    Koka, Srikanth

    2004-09-30

    ....................................................................................45 4.9 Rank Attribute .....................................................................................................51 4.10 Outlet Segments...- dimensional diffusion wave model. Though this model offers a strong physical base for hydrologic modeling, can be applied only to areas where runoff production mainly assumes Hortonian patterns. A model which is based on 1 dimensional kinematic...

  13. Watershed Scale Evaluation of the Sustainability and Productivity...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    after site preparation. Annual load <40 kgha Bennett et al. in revision, Biomass and Bioenergy Muwamba et al. in revision, Journal of Environmental Qual. Documented impacts of...

  14. Water Rights Challenges to Coho Recovery in Coastal California Watersheds

    E-Print Network [OSTI]

    Alford, Chris

    2009-01-01

    innovative instream flow dedication programs, their effortsthe existing 1707 dedication process must be simplified.so that instream flow dedications are effectively protected

  15. Idaho Watershed Advisory Groups Webpage | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy Resources JumpNewTexas:HydrothermallyIFB Agro|How18

  16. EPA Catalog of Federal Funding Sources for Watershed Protection | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsAreaforInformation ECrNEPAState NPDES401

  17. Environmental Protection Agency: Handbook for Developing Watershed Plans to

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH JumpEllenville,Power Corp Jump to: navigation, search Name:Restore and

  18. FSM 2500 Watershed and Air Management | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH JumpEllenville,PowerEvaporative| OpenEnergyFHAFRPEnvironmental|FSM

  19. Colorado Department of Public Health and Environment: Watershed 319 Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open Energy Information ColoradoEnergy| Open Energy

  20. Low-impact development in the Assabet River Watershed : site hydrologic design and watershed-scal implications

    E-Print Network [OSTI]

    Friedlich, Brian J. (Brian Joseph), 1982-

    2005-01-01

    Low-Impact Development (LID) is a relatively new approach to stormwater management. It aims to mimic natural hydrology through increased recharge and decreased runoff. LID technologies focus on distributed treatment of ...

  1. Sustainability of the Arroyo Colorado Watershed Partnership and Continued Implementation of the Arroyo Colorado Watershed Protection Plan Final Report 

    E-Print Network [OSTI]

    Flores, J.; Berthold, A.

    2014-01-01

    Saldana, Texas AgriLife Extension Service, served as the principal investigators for this project. We would like to extend a special thanks to Kathy Wythe, Texas Water Resources Institute, who has been instrumental in producing newsletters, press...

  2. Onondaga Creek Watershed Synoptic Survey, September 2007 Sampling and nomenclature: Watershed is divided into 10 "units" out of convenience

    E-Print Network [OSTI]

    Limburg, Karin E.

    Park) Unit B ­ Furnace Brook and Kirk Park B-1: Kirk Park near Kirk St. B-2: Bridge (?) in Kirk Park B

  3. Landsat image of the lower part of the Rio Grande de Aasco watershed. The watershed has gone

    E-Print Network [OSTI]

    Gilbes, Fernando

    , and Guam/Federated States of Micronesia. Established in 1964 by the Water Resources Research Act of research results to water managers, professionals, and the public. The Water Resources Research Act) as presented in the Food Security Act Manual (USDA, 1994). · Highly Erodible Lands (HEL) are those with a EI

  4. Site Environmental Report for 2008, Volume II

    E-Print Network [OSTI]

    Lackner, Regina

    2009-01-01

    Date East Canyon N. Fork Strawberry Creek pH 69-Storm DrainEast Canyon N. Fork Strawberry Creek Specific ConductanceCreek East Canyon N. Fork Strawberry Creek Total suspended

  5. Site Environmental Report for 2012, Volumes 1 & 2

    E-Print Network [OSTI]

    Pauer, Ron

    2013-01-01

    Sample Sample N. Fork Strawberry Creek Wildcat Creek WinterCreek pH N. Fork Strawberry Creek Winter Creek SpecificConductance N. Fork Strawberry Creek Result µmhos/cm No Name

  6. Site Environmental Report for 2009, Volume 2

    E-Print Network [OSTI]

    Xu, Suying

    2010-01-01

    Chicken Creek N. Fork Strawberry Creek Wildcat Creek CesiumChicken Creek N. Fork Strawberry Creek Wildcat Creek GrossChicken Creek N. Fork Strawberry Creek Wildcat Creek Gross

  7. Site Environmental Report for 2007 Volume II

    E-Print Network [OSTI]

    Lackner, Regina E

    2008-01-01

    East Canyon N. Fork Strawberry Creek Collection Date ResultChicken Creek N. Fork Strawberry Creek Cesium 137 ChickenCreek N. Fork Strawberry Creek Gross alpha Chicken Creek N.

  8. Site Environmental Report for 2007 Volume II

    E-Print Network [OSTI]

    Lackner, Regina E

    2008-01-01

    Chicken Creek Downstream Chicken Creek Upstream FIELD BLANKChicken Creek Downstream Chicken Creek Upstream N. ForkChicken Creek Downstream Chicken Creek Upstream N. Fork

  9. Field sampling and analysis plan for the removal action at the former YS-860 Firing Ranges, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1998-03-01

    The former YS-860 Firing Ranges are located at the eastern end of the Oak Ridge Y-12 Plant outside the primary facility fence line and west of Scarboro Road within the Upper East Fork Poplar Creek watershed in Oak Ridge, Tennessee. A decision has been made by the US Department of Energy to conduct a removal action of lead-contaminated soils at this site as part of early source actions within the Upper East Fork Poplar Creek watershed. This non-time critical removal action of bullets and lead-contaminated soil from the YS-860 Firing Ranges is being conducted as a Comprehensive Environmental Response, Compensation, and Liability Act of 1980 action. These actions are consistent with the Oak Ridge Reservation Environmental Restoration Program. The removal action will focus on the excavation of bullets and lead-contaminated soil from the shooting range berms, transportation of the material to a permitted treatment facility for disposal, demolition and land filling of a concrete trench and asphalt pathways at the site, and grading and revegetating of the entire site. This report is the field sampling and analysis plan for the removal action at the former YS-860 Firing Ranges. The field sampling and analysis plan addresses environmental sampling for lead after the removal of lead-contaminated soil from the target berm area. The objective of this sampling plan is to obtain sufficient analytical data to confirm that the removal action excavation has successfully reduced lead levels in soil to below the action level of 1,400 micrograms/g.

  10. Design of non-serial, non-parallel flexural transmissions as applied to a micro-machined MEMS tuning fork gyroscope

    E-Print Network [OSTI]

    Thomas, Marcel A. C. (Marcel Adam Craig)

    2014-01-01

    The purpose of this work is to develop and implement design rules for flexures that emphasize directionality. This work is important for flexure designs that cannot be broken down into equivalent series or parallel components. ...

  11. The garden of forking paths: Why multiple comparisons can be a problem, even when there is no "fishing expedition" or "p-hacking" and the research

    E-Print Network [OSTI]

    Gelman, Andrew

    there is no "fishing expedition" or "p-hacking" and the research hypothesis was posited ahead of time Andrew Gelman of fishing or examining multiple p-values. We discuss in the context of several examples of published papers. Multiple comparisons doesn't have to feel like fishing 1.1. Background There is a growing realization

  12. Nonnative Lizards Nile Monitor 4 to 6 ft. Brown/yellow body bands; forked black/blue tongue; long sharp claws

    E-Print Network [OSTI]

    Mazzotti, Frank

    beneath the eye Reticulated Python 14 to 18 ft. Distinct reddish eyes; tan body with dark brown net dull with age. Males have larger spikes along back. Black and White Tegu 2 to 3 ft. Dark bands. Yellowish-tan to dark brown; red dewlap with yellow border Ianaré Sévi NATIVE Look-a-Likes David Barkasy

  13. Work plan for support to Upper East Fork Poplar Creek east end VOC plumes well installation project at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1998-03-01

    Under the Resource Conservation and Recovery Act of 1976 guidelines and requirements from the Tennessee Department of Environment and Conservation (TDEC), the Y-12 Plant initiated investigation and monitoring of various sites within its boundaries in the mid-1980s. The entire Oak Ridge Reservation (ORR) was placed on the National Priorities List of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) sites in November 1989. Following CERCLA guidelines, sites within the ORR require a remedial investigation (RI) to define the nature and extent of contamination, evaluate the risks to public health and the environment, and determine the goals for a feasibility study (FS) or an engineering evaluation/cost analysis (EE/CA) of potential remedial actions. Data from monitoring wells at the east end of the Y-12 Plant have identified an area of groundwater contamination dominated by the volatile organic compound (VOC) carbon tetrachloride; other VOCs include chloroform, tetrachloroethene, and trichloroethene.

  14. MEMS Resonant Strain Sensor Integration

    E-Print Network [OSTI]

    Myers, David Richard

    2010-01-01

    MEMS Capacitive BasedStrain Gauges MEMS Double-Ended Tuning Fork Strainand MEMS Potential . . . . . . . . . . . . . . . . . . . .

  15. FIELD CAMP EQUIPMENT LIST SUMMER 2015

    E-Print Network [OSTI]

    Fay, Noah

    ), knife, fork, spoon, bowl ____ Sunscreen (SPF 15 or greater) and protective lip balm ____ Toiletries

  16. Collaboration for Community and Forest Well-Being in the

    E-Print Network [OSTI]

    Belsky, Jill M.

    bears, mountain lion, elk, moose, deer, coyote, and cold-water fLh describe something of the ruggedness. The Mission Mountain and the Bob ikfarshall WiIdernessAreas, the Flathead National Forest, the PLum Creek

  17. CX-006574: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Purchase of the Diamond B Conservation EasementCX(s) Applied: B1.25Date: 08/16/2011Location(s): Flathead County, MontanaOffice(s): Bonneville Power Administration

  18. Pacific Northwest Smart Grid Demonstration Project SUCCESS STORIES

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    about what we were trying to do as a cooperative," says Teri Rayome-Kelly, Flathead's demand response coordinator. "And we also stressed what was in it for them - what they...

  19. Table 3. Top five retailers of electricity, with end use sectors...

    U.S. Energy Information Administration (EIA) Indexed Site

    Energy LLC - (MT)","Investor-Owned",5964495,2409714,3095129,459652,0 2,"PPL EnergyPlus LLC","Investor-Owned",2219237,0,125451,2093786,0 3,"Flathead Electric Coop...

  20. Simulating and evaluating best management practices for integrated landscape management scenarios in biofuel feedstock production

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ha, Miae; Wu, May

    2015-09-08

    Sound crop and land management strategies can maintain land productivity and improve the environmental sustainability of agricultural crop and feedstock production. With this study, it evaluates a strategy of incorporating landscape design and management concepts into bioenergy feedstock production. It examines the effect of land conversion and agricultural best management practices (BMPs) on water quality (nutrients and suspended sediments) and hydrology. The strategy was applied to the watershed of the South Fork Iowa River in Iowa, where the focus was on converting low-productivity land to provide cellulosic biomass and implementing riparian buffers. The Soil and Water Assessment Tool (SWAT) wasmore »employed to simulate the impact at watershed and sub-basin scales. The study compared the representation of buffers by using trapping efficiency and area ratio methods in SWAT. Landscape design and management scenarios were developed to quantify water quality under (i) current land use, (ii) partial land conversion to switchgrass, and (iii) riparian buffer implementation. Results show that implementation of vegetative barriers and riparian buffer can trap the loss of total nitrogen, total phosphorus, and sediment significantly. The effect increases with the increase of buffer area coverage. Implementing riparian buffer at 30 m width is able to produce 4 million liters of biofuels. When low-productivity land (15.2% of total watershed land area) is converted to grow switchgrass, suspended sediment, total nitrogen, total phosphorus, and nitrate loadings are reduced by 69.3%, 55.5%, 46.1%, and 13.4%, respectively. The results highlight the significant role of lower-productivity land and buffers in cellulosic biomass and provide insights into the design of an integrated landscape with a conservation buffer for future bioenergy feedstock production.« less

  1. Unpaving the Way to Creek Restoration in Lower Sausal Creek Watershed: Applying the EU Water Framework Directive to a US Urban Watershed

    E-Print Network [OSTI]

    Li, Hong; Wardani, Jane

    2008-01-01

    Management Plan addresses stormwater pollution and detentionpoint source pollution. As well, the management of urbanmanagement problems in urban areas including flashy runoff and water pollution

  2. Unpaving the Way to Creek Restoration in Lower Sausal Creek Watershed: Applying the EU Water Framework Directive to a US Urban Watershed

    E-Print Network [OSTI]

    Li, Hong; Wardani, Jane

    2008-01-01

    can detain and filter storm water, and provide quality- of-and at least partially filter storm water runoff pollution.

  3. Bacterial Source Tracking to Support the Development and Implementation of Watershed Protection Plans for the Lampasas and Leon Rivers: Lampasas River Watershed Final Report 

    E-Print Network [OSTI]

    Gregory, L.; Casarez, E.; Truesdale, J.; Di Giovanni, G.; Owen, T; Wolfe, J.

    2013-04-25

    . iv Acronyms ADCM Acoustic Doppler Current Meter ARCC Average Rate of Correct Classification AgriLife-TP Blackland Research and Extension Center in Temple BST Bacterial Source Tracking CAFO Concentrated Animal Feeding Operation CFS...&M AgriLife Research?s - Water Science Laboratory located at the Blackland Research and Extension Center in Temple (AgriLife-TP) cooperated with the University of Texas Health Science Center at Houston School of Public Health, El Paso Regional Campus...

  4. Assessment of Water Resources in A Humid Watershed and A Semi-arid Watershed; Neches River Basin, TX and Canadian River Basin, NM 

    E-Print Network [OSTI]

    Heo, Joonghyeok

    2013-07-16

    Water is the most important resource on Earth. Climate and land cover changes are two important factors that directly influenced water resources. This research provides important information for water resources management and contributes...

  5. Bechtel Jacobs Company LLC Sampling and Analysis Plan for the Water Resources Restoration Program for Fiscal Year 2009, Oak Ridge Reservation, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Ketelle R.H.

    2008-09-25

    The Oak Ridge Reservation (ORR) Water Resources Restoration Program (WRRP) was established by the U. S. Department of Energy (DOE) in 1996 to implement a consistent approach to long-term environmental monitoring across the ORR. The WRRP has four principal objectives: (1) to provide the data and technical analysis necessary to assess the performance of completed Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) actions on the ORR; (2) to perform monitoring to establish a baseline against which the performance of future actions will be gauged and to support watershed management decisions; (3) to perform interim-status and post-closure permit monitoring and reporting to comply with Resource Conservation and Recovery Act of 1976 (RCRA) requirements; and (4) to support ongoing waste management activities associated with WRRP activities. Water quality projects were established for each of the major facilities on the ORR: East Tennessee Technology Park (ETTP); Oak Ridge National Laboratory (ORNL), including Bethel Valley and Melton Valley; and the Y-12 National Security Complex (Y-12 Complex or Y-12), including Bear Creek Valley (BCV), Upper East Fork Poplar Creek (UEFPC), and Chestnut Ridge. Off-site (i.e., located beyond the ORR boundary) sampling requirements are also managed as part of the Y-12 Water Quality Project (YWQP). Offsite locations include those at Lower East Fork Poplar Creek (LEFPC), the Clinch River/Poplar Creek (CR/PC), and Lower Watts Bar Reservoir (LWBR). The Oak Ridge Associated Universities (ORAU) South Campus Facility (SCF) is also included as an 'off-site' location, although it is actually situated on property owned by DOE. The administrative watersheds are shown in Fig. A.l (Appendix A). The WRRP provides a central administrative and reporting function that integrates and coordinates the activities of the water quality projects, including preparation and administration of the WRRP Sampling and Analysis Plan (SAP). A brief summary is given of the organization of the SAP appendices, which provide the monitoring specifics and details of sampling and analytical requirements for each of the water quality programs on the ORR. Section 2 of this SAP provides a brief overview and monitoring strategy for the ETTP. Section 3 discusses monitoring strategy for Bethel Valley, and Melton Valley background information and monitoring strategy is provided in Section 4. BCV and UEFPC monitoring strategies are presented in Sect. 5 and 6, respectively. Section 7 provides background information and monitoring strategy for all off-site locations.

  6. Impacts of Avian Predation on Juvenile Salmonids in Central California Watersheds

    E-Print Network [OSTI]

    Frechette, Danielle

    2010-01-01

    endangered species using a bioenergetics approach: Caspianendangered species using a bioenergetics approach: Caspianendangered species using a bioenergetics approach: Caspian

  7. Response of discharge, TSS, and E. coli to rainfall events in urban, suburban, and rural watersheds

    E-Print Network [OSTI]

    Zhang, Minghua

    H. J. Chena and H. Chang*b Understanding dominant processes influencing microorganism responses to storm events aids in the development of effective management controls on pathogen contamination events. Introduction Pathogens are the number one cause of impairment for Clean Water Act (CWA) Section

  8. Sources and Fates of Dissolved Organic Carbon in Rural and Urban Watersheds in Brazos County, Texas 

    E-Print Network [OSTI]

    Cioce, Danielle

    2012-10-19

    The Bryan/College Station (B/CS) region has been reported to have elevated concentrations of dissolved organic carbon (DOC) in surface water. Increased DOC concentrations are worrisome as DOC has been shown to be an energy source for the recovery...

  9. Managing watershed services of tropical forests and plantations: can meta-analyses help?

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    is also relevant to reservoirs for drinking water or hydroelectricity production (Guo et al., 2000). Over

  10. A distributed converging overland flow model: 3. Application to Natural Watersheds 

    E-Print Network [OSTI]

    Singh, Vijay P.

    1976-01-01

    I we noted that analytical solutions are not feasible for time-varying (complex) rainfall input. The most practical method is to utilize hybrid solutions. For a complete dis- cussion on hybrid solutions, see the work by Singh [1974, 1975a]. We... will only give numerical solutions here. The cou- pling of the continuity equation and the kinematic approxima- tion to the momentum equation [Singh, 1974] yields Oh _3_ na(x)h _ Oh h, Oo (x) a(x)h\\" ot + Ox - q(x' t) + ( ? - x) ( ) where h...

  11. Physically-based extreme flood frequency with stochastic storm transposition and paleoflood data on large watersheds

    E-Print Network [OSTI]

    Julien, Pierre Y.

    Physically-based extreme flood frequency with stochastic storm transposition and paleoflood data, Flood Hydrology, 86-68250, Denver Federal Ctr., Denver, CO 80225, USA b Department of Civil Engineering, Editor-in-Chief, with the assistance of Ezio Todini, Associate Editor Keywords: Extreme floods Flood

  12. Understanding the Occurrence and Transport of Current-use Pesticides in the San Francisco Estuary Watershed

    E-Print Network [OSTI]

    Kuivila, Kathryn; Hladik, Michelle

    2008-01-01

    events. Environmental Toxicology and Chemistry Wolfe NL,Toxicological and Environmental Chemistry 69:305–319.USA. Environmental Toxicology and Chemistry 19(1):82–87.

  13. Characterization of coastal urban watershed bacterial communities leads to alternative community-based indicators

    E-Print Network [OSTI]

    Wu, C.H.

    2010-01-01

    bowel [67] and anaerobic digesters [72]. Therefore, the dataanalysis of an anaerobic sludge digester. Environ Microbiolwithin a municipal anaerobic sludge digester. Appl Environ

  14. Assessment of intensive silvicultural practices and livestock grazing on watershed parameters, Kisatchie National Forest, Louisiana 

    E-Print Network [OSTI]

    Hunter, Thomas Kenneth

    1985-01-01

    associated with soils (bulk density, antecedent soil mois- ture, organic matter) and standing crop were the most important influen- c1ng infiltration rates and sediment production. Mean infiltration rates after 30 minutes for each sample date were similar.... and Mrs. Tom Hunter, and my in-laws, Dr. and Mrs. Joe1 Worley for the1r constant support and encouragement during this study. INTRODUCTION LITERATURE REVIEW TABLE OF CONTENTS Page Grazing Vegetation Parameters Infiltration and Runoff Water...

  15. From Watersheds to the Web: Online Tools for Modeling Forest Soil Erosion

    E-Print Network [OSTI]

    one cause of land degradation worldwide. The most famous example of wind erosion in the SUMMARY Forest outcomes. US is the Dust Bowl of the 1930s, when extended drought combined with poor farming practices and road construction are the main agents of surface erosion in the Rockies, with activities such as forest

  16. Attachment B: Jamaica Bay Watershed Protection Plan Update 1. WATER QUALITY

    E-Print Network [OSTI]

    Columbia University

    Bay. Ongoing NYCDEP continues to limit shipments. NA NA DEP See attached status report. Upgrade will accommodate daily transshipments instead of a few times a week to ensure all Jamaica sludge is treated via excess algae and sea lettuce to reduce nitrogen and produce biodiesel fuels. Design anticipated to begin

  17. Urban Retrofit: A Whole-Watershed Approach to Urban Stormwater Management

    E-Print Network [OSTI]

    Lithander, Becky

    2012-01-01

    use  reduction  and   heat  island  mitigation.  These  providing  urban  heat-­?island   mitigation  which  

  18. Large Woody Debris Budgets in the Caspar Creek Experimental Watersheds1

    E-Print Network [OSTI]

    Monitoring of large woody debris (LWD) in the two mainstem channels of the Caspar Creek Experimental debris (LWD) in stream channels. Because LWD inputs are often episodic and pieces can persist for decades in the channel, an LWD budgeting approach can be a useful tool to estimate long-term effects of management

  19. Characterization of Coastal Urban Watershed Bacterial Communities Leads to Alternative Community-Based

    E-Print Network [OSTI]

    Hazen, Terry

    B funding, the California State Water Resources Control Board Prop. 50 Clean Beaches Initiative Berkeley National Laboratory under Department of Energy contract number DE-AC02-05CH11231 and funded by the Rathmann Family Foundation and the California State Water Resources Control Board Prop. 50 Clean Beaches

  20. Exploratory categorization of watersheds for potential stormwater monitoring in San Francisco Bay.

    E-Print Network [OSTI]

    ; historic and current land use, cover (i.e., imperviousness), and activities (e.g., auto dismantling

  1. VEGETATED ROOFS FOR URBAN ECOSYSTEM REMEDIATION: PERFORMANCE AND POLICY IN THE TANYARD BRANCH WATERSHED

    E-Print Network [OSTI]

    Rosemond, Amy Daum

    VEGETATED ROOFS FOR URBAN ECOSYSTEM REMEDIATION: PERFORMANCE AND POLICY IN THE TANYARD BRANCH the urbanization process. This study evaluated the performance and feasibility of using vegetated or green roof systems for urban ecosystem remediation. The stormwater retention performance of a thin-layer green roof

  2. Evaluation of water quality in an agricultural watershed as affected by almond pest management practices

    E-Print Network [OSTI]

    Zhang, Minghua

    management practices (PMPs) on water quality. The Soil and Water Assessment Tool (SWAT) model was employed orchard use. This paper presented a novel method of studying the environmental impacts of different prac- tices (PMPs), such as the application of organophosphate (OP) pesticides and oil mixtures during

  3. Community Interactions In Tropical Forest Restoration And Environmental Governance In The Panama Canal Watershed

    E-Print Network [OSTI]

    Schweizer, Daniella

    2012-01-01

    politics and economics as the core of environmental issues (environmental degradation, with the role that politics and economics play on those issues.

  4. A Multivariate Water Quality Investigation of Select Drainage Ditches in the Arroyo Colorado River Watershed, Texas 

    E-Print Network [OSTI]

    Uddameri, V.; Singaraju, S.

    2012-01-01

    Drainage ditches are widely used for agricultural water management to help remove excess water from fields, which mitigates the effects of water logging and salinization. These ditches act as a direct hydraulic link between the agricultural field...

  5. Modeling the Effects of Low Impact Development Practices on Streams at the Watershed Scale 

    E-Print Network [OSTI]

    Shannak, Sa'D A

    2014-04-28

    of dilution which in its turn negatively reflects on aquatic life health. DeGaspari et al. (2009) utilized hydrologic modeling to emulate hydrologic metrics for different 7 development scenarios. The aim of the study was to determine which development...

  6. Kinetics and Modeling of Dissolved PhosphorusExport from a Tile-Drained Agricultural Watershed

    E-Print Network [OSTI]

    David, Mark B.

    of these parameters include humidity, slope, peat area percentage, minor till plain area, carbonate till area, exposed of pollutants such as chemical oxygen demand Y. Xue, M.B. David, and L.E. Gentry, Dep. of Natural Resources

  7. WATERSHED RESTORATION IN THE NORTHERN SIERRA NEVADA: A BIOTECHNICAL APPROACH1

    E-Print Network [OSTI]

    Pollution Control Act, and the amended Clean Water Act of 1987. Califor- nia is presently developing to this legislation (State Water Resources Control Board 1988). In addition, the State Water Re- sources Control Board climate regarding water quality control at both the fed- eral and state level. Since degraded riparian

  8. Pesticide Education in the Coastal Zone of the Arroyo Colorado Watershed Final Report 

    E-Print Network [OSTI]

    Berthold, Allen

    2011-01-01

    into the Laguna Madre near the Cameron-Willacy County line. The tidal segment of the Arroyo Colorado, as classified by the Texas Commission on Environmental Quality (TCEQ), is between the confluence with Laguna Madre in Cameron/Willacy County to a point 100 meters...

  9. Investigation of Coupled Hydrologic and Geochemical Impacts of Wildfire on Southern California Watersheds

    E-Print Network [OSTI]

    Burke, Megan Patricia

    2012-01-01

    mercury from Rocky Mountain forest fires, Global Biogeochem.Potential effects of forest fire and storm flow on totalChristmas 2001 Sydney Forest Fires. Australian Geographer;

  10. Investigation of Coupled Hydrologic and Geochemical Impacts of Wildfire on Southern California Watersheds

    E-Print Network [OSTI]

    Burke, Megan Patricia

    2012-01-01

    recession coefficient (IRC), groundwater recession (AGWRC),Figures 16, 17). INTFW, LZETP, IRC, AGWRC, and DEEPFR arerange from 0.60 to 0.80. IRC controls the rate at which

  11. Parallel passageways: An assessment of salmon migration in the San Gregorio watershed

    E-Print Network [OSTI]

    Alford, Chris

    2008-01-01

    with both the upstream and downstream channel bed surfaces.with areas immediately upstream and downstream. 5.adequate water depth upstream and downstream to support fish

  12. Economic Incentives and Policies to Improve Quality in a Binational Coastal Watershed

    E-Print Network [OSTI]

    Fernandez, Linda M

    2007-01-01

    management of upstream and downstream countries in a sharedprevention in both upstream and downstream areas of themovement between upstream and downstream is governed by a

  13. Dealing with uncertainty in estimating average annual flood damage for ungaged watersheds 

    E-Print Network [OSTI]

    Toneatti, Silvana Victoria

    1996-01-01

    decades. A new risk-based analysis approach, currently being adopted in the United States, is based on modifying the conventional procedures to explicitly model the uncertainties involved in developing the required hydrologic, hydraulic, and economic...

  14. Urban Retrofit: A Whole-Watershed Approach to Urban Stormwater Management

    E-Print Network [OSTI]

    Lithander, Becky

    2012-01-01

    to  elevated  flood  risks,  and  greater  concentrations  reduces  the  risk  of  flood  (until  the  system  is  

  15. A simple framework for assessing the sensitivity of mountain watersheds to warming-driven

    E-Print Network [OSTI]

    Crosby, Benjamin T.

    balance, are useful for evaluating how changes in local-scale energy budgets affect snowpack dynamics. Introduction Throughout the world, communities living in dry low-elevation valleys depend on water from high at different spatial and temporal scales. Small-scale models, which retain the detailed physics of the energy

  16. Soil erosion and conservation as affcted by land use and land tenure, El Pital Watershed, Nicaragua 

    E-Print Network [OSTI]

    Somarriba-Chang, Matilde de los Angeles

    1997-01-01

    . This trend is associated with increased fragmentation of farms associated with the agrarian reform activities of the 1980's, during which many of the large land-holdings were confiscated and redistributed to many peasant families. Also the increasing...

  17. Characterization of Section 404 Permit Mitigation Plans, Coastal Margin and Associated Watersheds, Upper Texas Coast 

    E-Print Network [OSTI]

    Conkey, April A.

    2010-01-14

    A predicted loss of agricultural rice-wetlands and increasing urbanization and development threatens the remaining freshwater wetlands along the upper Texas coast. To avoid, minimize, and mitigate wetland loss, the U.S. Army Corps of Engineers...

  18. Water Pollution from Urban Stormwater Runoff in the Brunette River Watershed, B.C.

    E-Print Network [OSTI]

    Valley of British Columbia. Dry weather base flow monitoring detected fecal coliforms, far in excess sampling program and L. Bily and L. Belanger conducted preliminary data analysis as part of their MEng surveillance du débit d'étiage de base a permis de mettre en évidence la présence de concentrations de

  19. Comparative analyses for the prediction of streamflow from small watershed by use of digitized radar data 

    E-Print Network [OSTI]

    Braatz, Dean Thomas

    1973-01-01

    , 1972. 6. CONCLUSIONS AND RECOMMENDATIONS. 57 61 81 92 95 a. Conclusions. 95 b. Recommendations 97 APPENDIX A. . . 99 LIST OF REFERENCES. 101 VITA. 106 LIST OF TABLES Table Page Streamflow statistics for the Delaware Creek and Little... relationship of Miller (1972) for the sub-basins of the Delaware Creek and the Little Washita River. 52 Basin average of actual rainfall compared to 0-deg and tilt, digital-radar, estimated rainfall for May 31, 1971, for the periods when radar data were...

  20. Modeling Low Impact Development at the Small-Watershed Scale: Implications for the Decision Making Process 

    E-Print Network [OSTI]

    Seo, Mijin

    2014-12-03

    in order to identify their performance on improving stormwater runoff and water quality under such conditions. Rain gardens, rainwater harvesting systems, and permeable pavements, commonly used in urban areas, were selected. The Soil and Water Assessment...

  1. An Economic Analysis of Erosion and Sedimentation in Lavon Reservoir Watershed 

    E-Print Network [OSTI]

    Taylor, C. R.; Reneau, D. R.; Harris, B. L.

    1978-01-01

    Public Law 92-500 - the 1972 Federal Water Pollution Control Act Amendments - mandates the analysis of agricultural non-point source (NPS) pollution controls. This report presents the results of a study of the economic ...

  2. Partnering with watershed organizations to produce tributary-specific report cards

    E-Print Network [OSTI]

    Boynton, Walter R.

    in part by the Chesapeake Bay Trust Thank you: Caroline Wicks, Heath Kelsey, Bill Dennison, Jana Davis

  3. Risk assessment of runoff on a range watershed in Brazos County, Texas 

    E-Print Network [OSTI]

    Gwaltney, Tracy Marie

    2004-09-30

    completed by Giordanengo (2001). A strong positive correlation between total runoff and increased soil moisture was reported by Toy et al. (2002) and Meyles et al. (2003). Tromble et al. (1974) found that infiltration on pre-wetted plots was less than...

  4. An Economic Analysis of Erosion and Sediment Damage in the Duck Creek Watershed, Dickens County, Texas 

    E-Print Network [OSTI]

    Reneau, D. R.; Taylor, C. R.; Harris, B. L.; Lacewell, R.D.; Mueller, P. E.

    1978-01-01

    The Federal Water Pollution Control Act Amendments of 1972, Public Law 92-500, established a national goal of eliminating the discharge of pollutants into the nation's waterways by 1985. As a step toward that goal an interim water quality standard...

  5. An Economic Analysis of Erosion and Sediment Damage in the Lower Running Draw Watershed 

    E-Print Network [OSTI]

    Reneau, D. R.; Taylor, C. R.; Harris, B. L.; Lacewell, R. D.; Mueller, P. E.

    1978-01-01

    The development and implementation of agricultural non-point source (NPS) pollution control plans was mandated by the 1972 Federal Pollution Control Act Amendments, Public Law 92-500. The purpose of this particular report is to present the results...

  6. Watershed response and land energy feedbacks under climate change depend upon groundwater.

    SciTech Connect (OSTI)

    Maxwell, R M; Kollet, S J

    2008-06-10

    Human induced climate change will have a significant impact on the hydrologic cycle, creating changes in fresh water resources, land cover, and feedbacks that are difficult to characterize, which makes it an issue of global importance. Previous studies have not included subsurface storage in climate change simulations and feedbacks. A variably-saturated groundwater flow model with integrated overland flow and land surface model processes is used to examine the interplay between coupled water and energy processes under climate change conditions. A case study from the Southern Great Plains (SGP) USA, an important agricultural region that is susceptible to drought, is used as the basis for three scenarios simulations using a modified atmospheric forcing dataset to reflect predicted effects due to human-induced climate change. These scenarios include an increase in the atmospheric temperature and variations in rainfall amount and are compared to the present-day climate case. Changes in shallow soil saturation and groundwater levels are quantified as well as the corresponding energy fluxes at the land surface. Here we show that groundwater and subsurface lateral flow processes are critical in understanding hydrologic response and energy feedbacks to climate change and that certain regions are more susceptible to changes in temperature, while others to changes in precipitation. This groundwater control is critical for understanding recharge and drought processes, possible under future climate conditions.

  7. 4. Lower Oregon Columbia Gorge Tributaries Watershed 4.1 Subbasin Overview

    E-Print Network [OSTI]

    habitats interspersed within coniferous forest. Forest communities include riparian hardwoods including red, wet meadows, dryland balds, riparian woodlands, and subalpine communities on the higher peaks, industrial, rural residential, forestry, agriculture, and shallow draft marinas. Economy Outdoor recreatio

  8. Determining watershed response in data poor environments with remotely sensed small reservoirs

    E-Print Network [OSTI]

    Walter, M.Todd

    water for the major hydroelectric generating plant in Ghana. [4] In order to improve our understanding

  9. Implementing the Pecos River Watershed Protection Plan through a Heliborne Electromagnetic (EM) Survey: Final Report 

    E-Print Network [OSTI]

    Gregory, L.; Sheng, Z.; Hassan, A.; McDonald, A.; Porter, A.

    2014-01-01

    Heliborne Electromagnetic (EM) Survey Final Report Lucas Gregory, Zhuping Sheng, Almoutaz El Hassan, Alyson K. McDonald, Amy Porter Texas Water Resources Institute TR-470 March 2014 Implementing the Pecos River WPP through a Heliborne Electromagnetic... (EM) Survey Final Report TSSWCB Project 12-11 Funding provided through a Clean Water Act, Section 319(h) Nonpoint Source Grant from the Texas State Soil & Water Conservation Board and the U.S. Environmental Protection Agency Authors...

  10. The Effect of Wildfire on Soil Mercury Concentrations in Southern California Watersheds

    E-Print Network [OSTI]

    2010-01-01

    from Rocky Mountain forest fires. Global Biogeochemicalestimated in a prescribed forest-fire experiment in Florida,B. , & Vladicka, K. E. (2006). Forest fire increases mercury

  11. Brush types of the Nueces River watershed as related to soil, climatic and geological factors 

    E-Print Network [OSTI]

    Huss, Donald Lee

    1959-01-01

    Savanna . 21 3. Mesquite-Chaparral 23 4. Mesquite Woodland 28 5. Switch Mesquite 29 6. Running Mesquite 30 7. Scrub Mesquite 31 Communities with Live oak dominant 32 8. Live oak-Mesquite Savanna 32 9. Mesquite-Live oak-Chaparral 33 10. Live oak...-Guajillo Chaparral 34 11. Live oak-Post oak-Mesquite Woodland 35 Communities with Post oak dominant 35 12. Post oak-Blackjack oak Woodland 37 CHAPARRAL SHRUB COMMUNITIES 37 13. Guajillo Chaparral 39 14. Blackbrush Chaparral 39 SUFFRUTESCENT VEGETATIONAL TYPES...

  12. Landowner survey of a cost-share brush management program in two Texas watersheds 

    E-Print Network [OSTI]

    Narayanan, Christopher Ram

    2004-11-15

    : _________________________ ________________________ Urs P. Kreuter J. Richard Conner (Chairman of Committee) (Member) ________________________ ________________________ M. Edward Rister Robert Whitson (Member) (Head... of Advisory Committee: Dr. Urs P. Kreuter With the expanding population of Texas and the resulting increase in demand for water, the scarcity of water is becoming an increasingly urgent issue and research is being conducted to find ways to improve water...

  13. Quantifying E. coli Discharge from Failing Onsite Sewage Facilities in the Dickinson Bayou Watershed, Texas 

    E-Print Network [OSTI]

    Morrison, Derek

    2014-07-24

    tires typically surround the distribution pipes, while a geotextile membrane is set on top of this layer to separate it from a layer of loamy soil placed near the surface (TAMAE, 2008). Native soil is added on top of the layer of loamy soil, a typical...

  14. http://srwqis.tamu.edu/program-watershededucation.aspx watershed education networkwatershed education network

    E-Print Network [OSTI]

    partnership with Georgia Extension's Environmental Education Program since they are the nation's largest provider of residential environmental education. The Research-based curriculum correlates to Georgia of Education and in compliance with the time-on-task ruling, the Georgia 4-H Environmental Education Program

  15. Impacts of Avian Predation on Juvenile Salmonids in Central California Watersheds

    E-Print Network [OSTI]

    Frechette, Danielle

    2010-01-01

    access to food subsidies in the form of human waste. Theseadapt to new food sources (e.g. human waste, fishing offal)food supply in the form of subsidies from local landfills and other sources of human waste (

  16. Scales of Sovereignty: the Search for Watershed Democracy in the Klamath Basin

    E-Print Network [OSTI]

    Sarna-Wojcicki, Daniel Reid

    2015-01-01

    water! uses! such! as! hydropower! generation! on! the!for! the! generation! of! hydropower 439 . ! McGee! saw! in!water! uses! such! as! hydropower! generation! on! the!

  17. Occurrence and Fate of Escherichia Coli from Non-Point Sources in Cedar Creek Watershed, Texas 

    E-Print Network [OSTI]

    Padia, Reema

    2011-08-08

    +0 0 2. 20 E + 05 2. 56 E + 09 0. 00 E + 00 2. 73 E + 05 1. 68 E + 06 1. 40 E + 09 0. 00 E + 00 9. 80 E + 05 1. 68 E + 09 0. 00 E + 00 3. 48 E + 05 6. 20 E + 04 1.00E+00 1.00E+01 1.00E+02... to determine the fecal contamination of a water body. Fecal coliforms were a common indicator of fecal contamination until it was found that they can survive outside the gut of warm blooded organism (Sherer et al., 1992). Henceforth, Escherichia coli (E...

  18. Economic Incentives and Policies to Improve Quality in a Binational Coastal Watershed

    E-Print Network [OSTI]

    Fernandez, Linda M

    2007-01-01

    and Risk Analysis’, Water Pollution Control FederationRecreational Coastal Water Pollution- A Case Study in Orangethe two countries in water pollution stock, flow, cost,

  19. Land Use Impacts in the Chesapeake Bay Watershed, by Patrick Felling 1

    E-Print Network [OSTI]

    Lawrence, Deborah

    water pollution Source:http://2.bp.blogspot.comSource:http://www.srh.noaa.gov Source: http://stormwater.safl.umn.edu Water Pollution: Point Source vs. Nonpoint Source Point Sources Usually a discharge point Regulated (or: Intro TMDL stands for "Total Maximum Daily Load" (i.e. how much pollution can the water handle before

  20. Nitrogen and Phosphorus Biogeochemistry of Watersheds Along the Western Slope of the Sierra Nevada

    E-Print Network [OSTI]

    Homyak, Peter Michael

    2012-01-01

    pathways for P transport to aquatic environments. At EML, summer rainfall transferred sufficient terrestrial

  1. A watershed blueprint: Partners work together to restore Arroyo Colorado's health 

    E-Print Network [OSTI]

    Wythe, Kathy

    2010-01-01

    , Hidalgo, and Willacy counties; and nonpoint source pollution and how it occurs. The Nueces River Authority funded the construction of the model through the Clean Rivers Program. The ACWP and member cities of the Lower Rio Grande Valley Texas... source pollution. Wetlands serve as a habitat for fish and other aquatic animals, stabilize streambeds and banks, and filter and process wastewater contaminants in the water. TCEQ and EPA fund a three-city wetland project as part of a Clean Water...

  2. A watershed blueprint: partners work together to restore Arroyo Colorado's health 

    E-Print Network [OSTI]

    Wythe, K.

    2010-01-01

    , Hidalgo, and Willacy counties; and nonpoint source pollution and how it occurs. The Nueces River Authority funded the construction of the model through the Clean Rivers Program. The ACWP and member cities of the Lower Rio Grande Valley Texas... source pollution. Wetlands serve as a habitat for fish and other aquatic animals, stabilize streambeds and banks, and filter and process wastewater contaminants in the water. TCEQ and EPA fund a three-city wetland project as part of a Clean Water...

  3. THE H.T. ODUM SYNTHESIS ESSAY Reforming Watershed Restoration: Science in Need

    E-Print Network [OSTI]

    Palmer, Margaret A.

    ;increase in water extractions or diversions (Postel and Richter 2003; Walsh et al. 2005). Over-harvesting waters are continuing to decline in many parts of the world despite major efforts made to restore them of the world, people have relied on the network of freshwater tributaries and tidal waters for recreation

  4. Potential Stream Density in Mid-Atlantic U.S. Watersheds Andrew J. Elmore1*

    E-Print Network [OSTI]

    Boynton, Walter R.

    the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution was prepared under award (NA05OAR4171042) from Maryland Sea Grant, National Oceanic and Atmospheric

  5. Flood forecasting with the A&M watershed model: a hydrometeorological study 

    E-Print Network [OSTI]

    Robinson, Cedric Glynn

    1990-01-01

    Nonorographic, Monsoon rains ( One day, probably warm rain One day continuous rain Air mass showers Prewarm fromal rain ( Thunderstorms Steady rains Warm rains Showers and steady rains { Continuous rain Rainshowers Thunderstorms Spring Summer...

  6. IMPACT OF MINE DRAINAGE AND DISTRIBUTION OF METAL LOADING SOURCES IN THE JAMES CREEK WATERSHED

    E-Print Network [OSTI]

    Ryan, Joe

    on the environment. These effects are felt particularly in the form of water contamination from acid mine drainage mined areas is significantly threatened by the process of acid mine drainage and the resulting water contamination poses a problem for both aquatic life and human drinking water. Acid mine drainage occurs when

  7. A Geographical Approach to Tracking Escherichia coli and Nutrients in a Texas Coastal Plains Watershed 

    E-Print Network [OSTI]

    Harclerode, Cara

    2011-02-22

    Carters Creek in Brazos County, Texas, like many surface water reaches in the Texas Gulf Coast region, has been identified for bacteria and nutrient impairment on the Texas Commission on Environmental Quality (TCEQ) 303(d) ...

  8. Sources and Fate of Chromophoric Dissolved Organic Matter in the Arctic Ocean and Surrounding Watersheds 

    E-Print Network [OSTI]

    Walker, Sally Annette

    2012-10-19

    of the Canadian Archipelago, 17 % of the DOM pool is of terrestrial origin, even though waters are diluted with sea ice melt, suggesting the likelihood of a subsurface plume of tDOM entrained within river runoff from Arctic Rivers. In the interior Arctic...

  9. Evaluation of shrub encroachment and brush control on water availability in the Upper Guadalupe River watershed 

    E-Print Network [OSTI]

    Afinowicz, Jason David

    2004-09-30

    Wooded plant encroachment has dramatically changed the composition of rangelands in the arid and semiarid rangelands of the southwestern United States and may have significantly affected hydrologic and biogeochemical process in these environments...

  10. Habitat relationships of seven breeding bird species in the Leon River Watershed investigated at local scales 

    E-Print Network [OSTI]

    Juarez Berrios, Edwin Alfredo

    2005-02-17

    Over the past 100?150 years Texas rangelands have dramatically changed from native open savannahs to dense woodlands. On the Edwards plateau, a major management concern is the increasing encroachment of Ashe juniper (Juniperus ashei). Preceding...

  11. Effects of Small Impoundments on Total Watershed Sediment Yield in Northeast Kansas, April through August 2011

    E-Print Network [OSTI]

    Foster, Guy M.

    2011-12-31

    .......................................................................................................................33 Storms ......................................................................................................................................33 Little Delaware Mission Dam 5... ...............................................................................................34 Little Delaware Mission Dam 17 .............................................................................................36 Flow and Loads at Clear Creek at Decatur Rd. .......................................................................38...

  12. Sensitivity of Watershed Runoff under Humid Conditions to Potential Climate Variations

    E-Print Network [OSTI]

    Szilagyi, Jozsef

    by the U.S. National Research Council NRC 2000 states that the Earth's surface temperature has risen by 0, in turn, will affect soil erosion rates, pollution by industrial and wastewater effluents, and pathogen outbreaks in the United Kingdom U.K. Dept. of the Environment 1990 , Montana Weni- ger et al. 1983 , and

  13. A generalized land use study of the San Jacinto River watershed of Texas 

    E-Print Network [OSTI]

    Buckley, Frank A.

    1951-01-01

    .H U o CO -* i>> -P nrt Pi Pi ? CS O w CM 0 , ? j i -p o 1 M H?H P I 03 X ) Pi 05 m g 6 u PQ CM . . LO CM CO CT5 ?i CD CM CM ? Pi !>s ?H 'a ; L GS ? CQ CO O "d O ? 1--1 O UD r~! o o w -P 1 r... s? erf O ca 24 S i O -P ? ?Sa? n > aS ? ^4T aS CO i?i 1?1 X5 ?H O X i CQ ? rO 0 ?rH C0 CO cS nL 0 rH W rH 10 03 > )H d > r *h w Fl O ctf CO fci?) CO pQ Pi 0 ?H rd ca 'd ? 0 U ? rH O CO o ? Pi O ? ?H O...

  14. An Economic Analysis of Stream Restoration in an Urban Watershed: Austin, Texas. 

    E-Print Network [OSTI]

    Huang, Chi-Ying

    2012-07-16

    associated with housing and environmental characteristics. Repeat ground photography was utilized to assess stream restoration activities at spatial and temporal scales. Our results suggest that the stream restoration project resulted in significant positive...

  15. Effect of watershed parameters on mercury distribution in different environmental compartments in the

    E-Print Network [OSTI]

    Roden, Eric E.

    the Mobile Alabama River Basin (MARB). Aqueous THg was positively associated with iron-rich suspended with sediment organic mater and iron content, with the highest levels observed in smaller catchments influenced sediment THg levels were observed in main river channels, except for reaches impacted by coal mining

  16. Final Independent External Peer Review Report Leon Creek Watershed Feasibility Study, San Antonio,

    E-Print Network [OSTI]

    US Army Corps of Engineers

    of interest in combination with the buyout in another area of interest. The Plan includes mitigation

  17. Assessing Avian Contribution of Escherichia coli and Nutrient Loads to Watersheds 

    E-Print Network [OSTI]

    Telesford-Checkley, Judlyn Merium

    2014-11-19

    the sampling period. However, about a quarter of the water surface was covered with duckweed (Lemna sp.). Figure 3: Map and photographs showing the locations of Richland Creek and Richland Creek Ref. Aerial photographs were obtained from ArcMap 10...

  18. Forecasting land use change and its environmental impact at a watershed scale

    E-Print Network [OSTI]

    , but significantly increase losses of oil and grease and certain heavy metals in runoff. The spatial variation, heavy metals, sediment, oil and grease, pesticides, and fecal coliform bacteria. These pollutants

  19. The Effect of Wildfire on Soil Mercury Concentrations in Southern California Watersheds

    E-Print Network [OSTI]

    2010-01-01

    Tests (WDPT) and infiltration studies were conducted inat all three study areas. Infiltration rates measured using

  20. Urban Influences on Stream Chemistry and Biology in the Big Brushy Creek Watershed, South Carolina

    E-Print Network [OSTI]

    , and buildings). As ISC increases in urban areas, the infiltration of precipitation into soils Water Air Soil under baseflow conditions (Hoare, 1984; Smart, Jones, & Sebaugh, 1985; Wahl, McKellar, & Williams, 1997

  1. Promoting Successful Restoration through Effective Monitoring in the Chesapeake Bay Watershed

    E-Print Network [OSTI]

    Gruner, Daniel S.

    Contributors: Laura Craig Catherine Febria Jake Hosen Kristin Fisheries (IGB), Brian Laub (University of Maryland) and Jerry Miller (Western and functions (e.g., nutrient cycling or

  2. Development of an Urban Watershed Rehabilitation Method Using Stakeholder Feedback to Direct Investigation and Restoration Planning 

    E-Print Network [OSTI]

    Samuelson; Charles D.; Matlock, Marty D.; Kenimer, Ann L.; Neill, William H.; Peterson, Tarla Rai; Whitten, Guy D.; Vedlitz, Arnold; Alston, Letitia T.

    2003-01-01

    George Bush School of Government and Public Service ? Texas A&M University ? College Station, TX 77843-4350 phone: (979) 862-8855 fax: (979) 862-8856 avedlitz@bushschool.tamu.edu Science, Technology and Public Policy a nonpartisan, interdisciplinary...-01-0 Institute for Science, Technology and Public Policy, George Bush School of Government and Public Service Texas A&M University Research Support This research was supported by the U.S.-EPA Science to Achieve Results (STAR) Program under Grant No. R-827147...

  3. Regional regression models of watershed suspended-sediment discharge for the eastern United States

    E-Print Network [OSTI]

    Vogel, Richard M.

    suspended-sediment discharges, which often occur downstream of river modifications such as dams, can result Inventory Reports to Congress, sediment/siltation was listed among the top five leading causes of impairment

  4. Ecological Impacts of Contaminants in an Urban Watershed DOE FRAP 1998-25

    E-Print Network [OSTI]

    , and Jacqueline A. Smith 1 , and Patricia Keen 2 1 Dept. of Forest Sciences, Institute for Resources support of this work by Environment Canada's Fraser River Action Plan, the Natural Sciences, patterns of benthic invertebrate community structure, and then experimentally tested the direct effects

  5. The Effect of Wildfire on Soil Mercury Concentrations in Southern California Watersheds

    E-Print Network [OSTI]

    2010-01-01

    mercury measured in the leachate (liquid, leachate, hence 2.07%(±0.34%) Hgin the equivalent leachate, resulting in only 0.58% (±0.07%)

  6. Tile Drainage Modifications to Reduce Nitrate Losses in an Agricultural Watershed: Integration of Biophysical and Social

    E-Print Network [OSTI]

    David, Mark B.

    as knowledge of stakeholder acceptance and barriers (and what incentives might overcome the barriers (research objective). 3. Demonstrate how modified drainage systems can improve local water quality to water quality and acceptance of modified drainage systems, leading to better targeted extension

  7. Characterization of coastal urban watershed bacterial communities leads to alternative community-based indicators

    E-Print Network [OSTI]

    Wu, C.H.

    2010-01-01

    wastewater treatment and sludge composting, as revealed byanalysis of an anaerobic sludge digester. Environ Microbiolwithin a municipal anaerobic sludge digester. Appl Environ

  8. Use of in-stream reservoirs to reduce bacterial contamination of rural watersheds

    E-Print Network [OSTI]

    Johnson, Dan L.

    of Prince Edward Island, Department of Health Management, 550 University Avenue, Charlottetown, PEI, Canada

  9. Texas Watershed Planning Short Course Participant List June 2 6, 2008

    E-Print Network [OSTI]

    @ag.tamu.edu Vanessa Escobar Water Conservation Planner Texas Water Development Board PO Box 13231 Austin, TX78711

  10. Reducing Methylmercury Accumulation in the Food Webs of San Francisco Bay and Its Local Watershed

    E-Print Network [OSTI]

    -DiPasquale U.S. Geological Survey Robert Brodberg California Office of Environmental Health Hazard Assessment Case Study: Atypical Features · Mining legacy · Lack of local atmospheric sources · Unusual speciation · Erosional sediment regime · Extensive wetland restoration · Not eutrophic · Thorough monitoring #12;Mining

  11. Application of the Recovery Potential Screening Tool in the Matagorda Bay Watershed 

    E-Print Network [OSTI]

    Gregory, L.; Brown, M.; Skow, K.; Engling, A.; Wagner, K.; Berthold, A.

    2014-01-01

    intensive, thus prioritizing future water quality restoration efforts is a means to efficiently allocate available resources and achieve timely restoration results. The U.S. Environmental Protection Agency (EPA) developed the Recovery Potential Screening...

  12. Impacts of Avian Predation on Juvenile Salmonids in Central California Watersheds

    E-Print Network [OSTI]

    Frechette, Danielle

    2010-01-01

    routes because of Hydroelectric power, Habitat degradation,routes because of Hydroelectric power, Habitat degradation,

  13. From waterfront to watershed : mapping a big idea in the Greater Toronto Region

    E-Print Network [OSTI]

    Ciesielski, Linda C. (Linda Claire)

    2011-01-01

    Today, Toronto is revered among Great Lakes' and waterfront cities for its environmental planning: its massive re-investment in water and stormwater infrastructure; protected headwaters of the region's rivers; realized ...

  14. The watershed-scale optimized and rearranged landscape design (WORLD) model

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference)FeedbackPropertiesfullyarchitectures andchemistry study.and local

  15. Hotel Room Reservations for September 2015 The University of Winnipeg Alumni Affairs has arranged for a block of hotel rooms at

    E-Print Network [OSTI]

    Martin, Jeff

    . #12;Sparrow Hotels Inn at the Forks Standard Queen Guestroom $189 75 Forks Market Road Superior King applicable taxes Depending on availability Net non-commissionable rates Not a group block Individual

  16. The Department of the Interior's Bureau of Commercial Fisheries and the dom es-tic fishing industry, especially that part of the industry located in New England,

    E-Print Network [OSTI]

    . Cover and simmer 5 to 10 minutes or until fish flakes easily when tested with a fork. Remove fish from

  17. "Woody biomass" is all the buzz around the

    E-Print Network [OSTI]

    Brown, Sally

    energy works; the recent ground breaking for the new woody biomass fired boiler at Forks High School

  18. the American lobster (JIomaros americanus). J. Fish. Res. Board Can. 30:1337-1344.

    E-Print Network [OSTI]

    jaw to the posterior end of the vertebral column (Hubbs and Lagler 1970:25); fork length was measured

  19. Umatilla River Basin Anadromous Fish Habitat Enhancement Project : 1995 Annual Report.

    SciTech Connect (OSTI)

    Shaw, R.Todd

    1996-05-01

    During the 1995 - 96 project period, four new habitat enhancement projects were implemented under the Umatilla River Basin Anadromous Fish Habitat Enhancement Project by the Confederated Tribes of the Umatilla Indian Reservation (CTUIR) in the upper Umatilla River Basin. A total of 38,644 feet of high tensile smooth wire fencing was constructed along 3.6 miles of riparian corridor in the Meacham Creek, Wildhorse Creek, Greasewood Creek, West Fork of Greasewood Creek and Mission Creek watersheds. Additional enhancements on Wildhorse Creek and the lower Greasewood Creek System included: (1) installation of 0.43 miles of smooth wire between river mile (RM) 10.25 and RM 10.5 Wildhorse Creek (fence posts and structures had been previously placed on this property during the 1994 - 95 project period), (2) construction of 46 sediment retention structures in stream channels and maintenance to 18 existing sediment retention structures between RM 9.5 and RM 10.25 Wildhorse Creek, and (3) revegetation of stream corridor areas and adjacent terraces with 500 pounds of native grass seed or close species equivalents and 5,000 native riparian shrub/tree species to assist in floodplain recovery, stream channel stability and filtering of sediments during high flow periods. U.S. Fish and Wildlife Service (USFWS), Bureau of Indian Affairs (BIA) and Environmental Protection Agency (EPA) funds were cost shared with Bonneville Power Administration (BPA) funds, provided under this project, to accomplish habitat enhancements. Water quality monitoring continued and was expanded for temperature and turbidity throughout the upper Umatilla River Watershed. Physical habitat surveys were conducted on the lower 13 river miles of Wildhorse Creek and within the Greasewood Creek Project Area to characterize habitat quality and to quantify various habitat types by area.

  20. Site Environmental Report for 2010, Volumes 1 & 2

    E-Print Network [OSTI]

    Baskin, David

    2012-01-01

    Sample S.U. Dup N. Fork Strawberry Creek S.U. Sample S.U.Sample umhos/cm Dup N. Fork Strawberry Creek umhos/cm SampleL Sample mg/L Dup N. Fork Strawberry Creek mg/L Sample mg/L