Sample records for foot predominant exterior

  1. EXTERIOR POWERS KEITH CONRAD

    E-Print Network [OSTI]

    Lozano-Robledo, Alvaro

    form on a manifold is related to exterior powers of the dual space of the tangent space of a manifoldEXTERIOR POWERS KEITH CONRAD 1. Introduction Let R be a commutative ring. Unless indicated the alternating multilinear functions on Mk: the exterior power k(M). It is a certain quotient module of Mk

  2. Sunshade for building exteriors

    DOE Patents [OSTI]

    Braunstein, Richard (Atlanta, GA); McKenna, Gregory B. (Cumming, GA); Hewitt, David W. (Alpharetta, GA); Harper, Randolph S. (Keezletown, VA)

    2002-01-01T23:59:59.000Z

    A sunshade for shading window exteriors includes at least one connecting bracket for attachment to a window mullion, a blade support strut attached to the connecting bracket at a first joint, and a plurality of louvered blades supported by the blade support strut at a second joint. The pivot angle at the first joint may be varied to extend the louvered blades a desired distance from the window mullion. The louvered blades are positioned at a preselected fixed profile angle on the second joint in order to optimize shading at the latitude where the sunshade is installed. In a preferred embodiment, the louvered blades have top walls supporting photovoltaic cells and the sunshade includes electric cables for connecting the photovoltaic cells to an electric circuit.

  3. Differential Geometry: Discrete Exterior Calculus

    E-Print Network [OSTI]

    Kazhdan, Michael

    Differential Geometry: Discrete Exterior Calculus [Build Your Own DEC at Home. Elcott et al., 2006] [Discrete Differential Forms for Computational Modeling. Desbrun et al., 2005] [Discrete Exterior Calculus-simplices in : where c is a real-valued function. The space of k-chains is denoted Ck(). = k cc )( #12;Chains

  4. Exterior Rigid Insulation Best Practices - Building America Top...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Exterior Rigid Insulation Best Practices - Building America Top Innovation Exterior Rigid Insulation Best Practices - Building America Top Innovation Effec guid-exterior rigid...

  5. Initial Ideals in the Exterior Dominic Searles

    E-Print Network [OSTI]

    Slinko, Arkadii

    , and initial ideals in the exterior algebra over a vector space of dimension n. We review properties of term in the exterior algebra over a vector space of dimension n 6, and we give some illustrative examples. i #12;ii in the exterior algebra over a vector space of dimension n. For the purposes of this thesis, we will denote

  6. An algorithm for recognising the exterior square of a matrix Keywords: matrix, exterior square, algorithm

    E-Print Network [OSTI]

    Greenhill, Catherine

    vector space, with respect to a canonical basis, is called the exterior square of X. Note that all vectorAn algorithm for recognising the exterior square of a matrix Keywords: matrix, exterior square the exterior square of a matrix. The approach involves manipulation of the equations which relate the entries

  7. Evaluating an Exterior Insulation and Finish System for Deep Energy Retrofits

    SciTech Connect (OSTI)

    Dentz, J.; Podorson, D.

    2014-01-01T23:59:59.000Z

    Exterior insulation and finish systems (EIFS) are proprietary synthetic formulations that are applied to the exterior walls of buildings to serve as insulation and exterior cladding. The insulation thickness can vary from less than one inch to a foot or more. In this project the applicability of EIFS for residential deep energy retrofits was investigated through modeling and a case study home. The home was retrofitted using a site-applied four-inch-thick EIFS. Site-specific details were developed as required for the residential retrofit application. Site work and the costs of the EIFS system were documented. The demonstration home was modeled using Building Energy Optimization energy and cost analysis software to explore cost effectiveness of various EIFS insulation thicknesses in two climate locations.

  8. Boundary and Exterior of a Multiset Topology

    E-Print Network [OSTI]

    J. Mahanta; D. Das

    2015-01-26T23:59:59.000Z

    The concepts of exterior and boundary in multiset topological space are introduced. We further established few relationships between the concepts of boundary, closure, exterior and interior of an M- set. These concepts have been pigeonholed by other existing notions viz., open sets, closed sets, clopen sets and limit points. The necessary and sufficient condition for a multiset to have an empty exterior is also discussed.

  9. Exterior powers and Clifford In this chapter, various algebraic constructions (exterior products and Clifford al-

    E-Print Network [OSTI]

    Cameron, Peter

    . It is the free-est associative algebra generated by V. The exterior square of a vector space V is the free10 Exterior powers and Clifford algebras In this chapter, various algebraic constructions (exterior products and Clifford al- gebras) are used to embed some geometries related to projective and polar spaces

  10. Which Exterior Powers are Balanced? Devlin Mallory

    E-Print Network [OSTI]

    Zaslavsky, Thomas

    Which Exterior Powers are Balanced? Devlin Mallory Department of Mathematics University conjugation by a diagonal ±1 matrix. For a signed graph on n vertices, its exterior kth power, where k = 1 onto the anti-symmetric subspace of the k-fold tensor product space (Cn)k and k is the k

  11. Building America Expert Meeting: Cladding Attachment Over Exterior...

    Energy Savers [EERE]

    Expert Meeting: Cladding Attachment Over Exterior Insulation Building America Expert Meeting: Cladding Attachment Over Exterior Insulation Building Science Corporation (BSC) held...

  12. Federal Technology Deployment Pilot: Exterior Solid State Lighting...

    Energy Savers [EERE]

    Federal Technology Deployment Pilot: Exterior Solid State Lighting Federal Technology Deployment Pilot: Exterior Solid State Lighting Presentation-given at the Fall 2011 Federal...

  13. Commercial Building Energy Alliance Exterior Lighting Scoping Study

    SciTech Connect (OSTI)

    Myer, Michael

    2011-10-07T23:59:59.000Z

    This report is a scoping study about challenges and energy saving potential regarding exterior lighting.

  14. An exterior for the Gödel spacetime

    E-Print Network [OSTI]

    W. B. Bonnor; N. O. Santos; M. A. H. MacCallum

    1997-11-05T23:59:59.000Z

    We match the vacuum, stationary, cylindrically symmetric solution of Einstein's field equations with $\\Lambda$, in a form recently given by Santos, as an exterior to an infinite cylinder of dust cut out of a G\\"{o}del universe. There are three cases, depending on the radius of the cylinder. Closed timelike curves are present in the exteriors of some of the solutions. There is a considerable similarity between the spacetimes investigated here and those of van Stockum referring to an infinite cylinder of rotating dust matched to vacuum, with $\\Lambda=0$.

  15. Evaluation of commercially available exterior digital VMDs

    SciTech Connect (OSTI)

    Ringler, C.E.; Hoover, C.E.

    1995-06-01T23:59:59.000Z

    This report discusses the testing and evaluation of thirteen commercially available exterior digital video motion detection (VMD) systems. The systems were evaluated for use in a specific outdoor application. The report focuses primarily on the testing parameters, each system`s advertised features, and the nuisance alarm and detection test results.

  16. Building America Whole-House Solutions for New Homes: Exterior...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Exterior Rigid Foam Insulation at the Edge of a Slab Foundation, Fresno, California Building America Whole-House Solutions for New Homes: Exterior Rigid Foam Insulation at the Edge...

  17. EXTERIOR POWERS OF SYMMETRIC BILINEAR FORMS SE'AN MCGARRAGHY

    E-Print Network [OSTI]

    -fold exterior power of V . Then the ring of* * isomorphism classes of finite-dimensional K-vector spaces under]. 3. Exterior and symmetric powers of symmetric bilinear forms Let V be a vector space of dimension EXTERIOR POWERS OF SYMMETRIC BILINEAR FORMS SE

  18. Precise smoothing effect in the exterior of balls Oana Ivanovici

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Precise smoothing effect in the exterior of balls Oana Ivanovici Universite Paris-Sud, Orsay (and improve) such smoothing type estimates if one considers smaller space domains (whose size is the case of the exterior of a convex body (or more generally the exterior of several convex bodies

  19. Excavationless Exterior Foundation Insulation Exploratory Study

    SciTech Connect (OSTI)

    Mosiman, G.; Wagner, R.; Schirber, T.

    2013-02-01T23:59:59.000Z

    The key objective of this exploratory study was to investigate the feasibility of the development or adoption of technologies that would enable a large percentage of existing homes in cold climates to apply a combination 'excavationless' soil removal process with appropriate insulation and water management on the exterior of existing foundations at a low cost. Our approach was to explore existing excavation and material technologies and systems to discover whether potential successful combinations existed.

  20. Excavationless Exterior Foundation Insulation Field Study

    SciTech Connect (OSTI)

    Schirber, T.; Mosiman, G.; Ojczyk, C.

    2014-10-01T23:59:59.000Z

    Building science research supports installing exterior (soil side) foundation insulation as the optimal method to enhance the hygrothermal performance of new homes. With exterior foundation insulation, water management strategies are maximized while insulating the basement space and ensuring a more even temperature at the foundation wall. However, such an approach can be very costly and disruptive when applied to an existing home, requiring deep excavation around the entire house. The NorthernSTAR Building America Partnership team implemented an innovative, minimally invasive foundation insulation upgrade technique on an existing home. The approach consisted of using hydrovac excavation technology combined with a liquid insulating foam. The team was able to excavate a continuous 4" wide by 4' to 5' deep trench around the entire house, 128 linear feet, except for one small part under the stoop that was obstructed with concrete debris. The combination pressure washer and vacuum extraction technology also enabled the elimination of large trenches and soil stockpiles normally produced by backhoe excavation. The resulting trench was filled with liquid insulating foam, which also served as a water-control layer of the assembly. The insulation was brought above grade using a liquid foam/rigid foam hybrid system and terminated at the top of the rim joist. Cost savings over the traditional excavation process ranged from 23% to 50%. The excavationless process could result in even greater savings since replacement of building structures, exterior features, utility meters, and landscaping would be minimal or non-existent in an excavationless process.

  1. EXTERIOR POWERS OF SYMMETRIC BILINEAR FORMS AN MCGARRAGHY

    E-Print Network [OSTI]

    ­fold exterior power of V . Then the ring of isomorphism classes of finite­dimensional K­vector spaces under. The exterior powers and the related symmetric powers are in fact functors on the category of K­vector spaces of k­fold exterior power and symmetric power of a finite­dimensional vector space V see, for example

  2. EXTERIOR POWERS OF SYMMETRIC BILINEAR FORMS SEAN MCGARRAGHY

    E-Print Network [OSTI]

    a finite-dimensional K-vector space V and a non-negative integer k we may define k V , the k-fold exterior space V see, for example, [4] or [3]. 3. Exterior and symmetric powers of symmetric bilinear forms Let V be a vector space of dimension n over K. Recall that if k is a non-negative integer, then the k-fold exterior

  3. Cladding Attachment Over Thick Exterior Insulating Sheathing

    SciTech Connect (OSTI)

    Baker, P.; Eng, P.; Lepage, R.

    2014-01-01T23:59:59.000Z

    The addition of insulation to the exterior of buildings is an effective means of increasing the thermal resistance of both wood framed walls as well as mass masonry wall assemblies. For thick layers of exterior insulation (levels greater than 1.5 inches), the use of wood furring strips attached through the insulation back to the structure has been used by many contractors and designers as a means to provide a convenient cladding attachment location (Straube and Smegal 2009, Pettit 2009, Joyce 2009, Ueno 2010). The research presented in this report is intended to help develop a better understanding of the system mechanics involved and the potential for environmental exposure induced movement between the furring strip and the framing. BSC sought to address the following research questions: 1. What are the relative roles of the mechanisms and the magnitudes of the force that influence the vertical displacement resistance of the system? 2. Can the capacity at a specified deflection be reliably calculated using mechanics based equations? 3. What are the impacts of environmental exposure on the vertical displacement of furring strips attached directly through insulation back to a wood structure?

  4. Exterior Differential Systems for Yang-Mills Theories

    E-Print Network [OSTI]

    Frank B. Estabrook

    2008-12-05T23:59:59.000Z

    Exterior differential systems are given, and their Cartan characters calculated, for Maxwell and SU(2)-Yang-Mills equations in dimensions from three to six.

  5. Building America Whole-House Solutions for Existing Homes: Exterior...

    Broader source: Energy.gov (indexed) [DOE]

    IBACOS, in collaboration with GreenHomes America, Inc., was contracted by the New York State Energy Research and Development Authority to research exterior wall insulation...

  6. adjusting exterior magnetic: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Xavier - Institut de Mathmatiques ?lie Cartan, Universit Henri Poincar 123 Fixture Design and Installation Criteria for Interior and Exterior Lighting Applications...

  7. Exterior Differential Systems for Field Theories

    E-Print Network [OSTI]

    Estabrook, Frank B

    2014-01-01T23:59:59.000Z

    Cartan forms and Exterior Differential Systems, set in the state space of field and potential variables taken together with four space-time variables, are formulated for Maxwell, SU(2), SU(3) and SU(4) classical gauge theories minimally coupled to Dirac spinor multiplets. Their Cartan character tables are calculated, showing the EDS, and so the Euler-Lagrange partial differential equations, of the first of these to be well posed. That theory anticipates QED. In the other cases, only if the Dirac fields' conserved currents are suppressed as sources for the Yang-Mills fields is a well posed EDS found. PACS numbers: 02.30.Xx 02.40.Hw 03.50.De 03.50.-z

  8. Exterior Differential Systems for Field Theories

    E-Print Network [OSTI]

    Frank B. Estabrook

    2015-02-24T23:59:59.000Z

    Exterior Differential Systems (EDS) and Cartan forms, set in the state space of field variables taken together with four space-time variables, are formulated for classical gauge theories of Maxwell and SU(2) Yang-Mills fields minimally coupled to Dirac spinor multiplets. Cartan character tables are calculated, showing whether the EDS, and so the Euler-Lagrange partial differential equations, is well-posed. The first theory, with 22 dimensional state space (10 Maxwell field and potential components and 8 components of a Dirac field), anticipates QED. In the second, non-Abelian, case (30 Yang-Mills field components and 16 Dirac), only if three additional "ghost" fields are included (15 more scalar variables) is a well-posed EDS found. This classical formulation anticipates the need for introduction of Fadeev-Popov ghost fields in the quantum standard model.

  9. Kinodynamic Motion Planning by Interior-Exterior Cell Exploration

    E-Print Network [OSTI]

    Kavraki, Lydia E.

    Kinodynamic Motion Planning by Interior-Exterior Cell Exploration Ioan A. S¸ucan1 and Lydia E presents a kinodynamic motion planner, Kinodynamic Mo- tion Planning by Interior-Exterior Cell Exploration is necessary. A multiple-level grid-based discretization is used to estimate the coverage of the state space

  10. Generalized exterior forms, geometry and P Nurowski D C Robinson

    E-Print Network [OSTI]

    Bushnell, Colin J.

    Generalized exterior forms, geometry and space-time P Nurowski D C Robinson Instytut Fizyki of a generalized exterior algebras and calculi of p-forms, will be presented. This type of extension an abstract twistor structure with any real analytic Einstein space- time, [1-4]. However it is clear

  11. FLIPS AND THE HILBERT SCHEME OVER AN EXTERIOR ALGEBRA

    E-Print Network [OSTI]

    Peeva, Irena

    FLIPS AND THE HILBERT SCHEME OVER AN EXTERIOR ALGEBRA Irena Peeva and Mike Stillman Department of Mathematics, Cornell University, Ithaca, NY 14853, USA. Abstract: We study the tangent space at a monomial an exterior algebra. 1. Introduction Throughout the paper k stands for an infinite field. Let E

  12. Autonomous navigation for structured exterior environments

    SciTech Connect (OSTI)

    Pletta, J B

    1993-12-01T23:59:59.000Z

    The Telemanaged Mobile Security Station (TMSS) was developed at Sandia National Laboratories to investigate the role of mobile robotics in exterior perimeter security systems. A major feature of the system is its capability to perform autonomous patrols of the security site`s network of roads. Perimeter security sites are well known, structured environments; the locations of the roads, buildings, and fences are relatively static. A security robot has the advantage of being able to learn its new environment prior to autonomous travel. The TMSS robot combines information from a microwave beacon system and on-board dead reckoning sensors to determine its location within the site. The operator is required to teleoperate the robot in a teach mode over all desired paths before autonomous operations can commence. During this teach phase, TMSS stores points from its position location system at two meter intervals. This map data base is used for planning paths and for reference during path following. Details of the position location and path following systems will be described along with system performance and recommendations for future enhancements.

  13. Low-cost exterior insulation process and structure

    DOE Patents [OSTI]

    Vohra, Arun (Bethesda, MD)

    1999-01-01T23:59:59.000Z

    A low-cost exterior insulation process of stacking bags of insulating material against a wall and covering them with wire mesh and stucco provides a durable structure with good insulating value.

  14. Transverse electromagnetic horn antenna with resistively-loaded exterior surfaces

    DOE Patents [OSTI]

    Aurand, John F. (Edgewood, NM)

    1999-01-01T23:59:59.000Z

    An improved transverse electromagnetic (TEM) horn antenna comprises a resistive loading material on the exterior surfaces of the antenna plates. The resistive loading material attenuates or inhibits currents on the exterior surfaces of the TEM horn antenna. The exterior electromagnetic fields are of opposite polarity in comparison to the primary and desired interior electromagnetic field, thus inherently cause partial cancellation of the interior wave upon radiation or upon reception. Reducing the exterior fields increases the radiation efficiency of the antenna by reducing the cancellation of the primary interior field (supported by the interior surface currents). This increases the transmit gain and receive sensitivity of the TEM horn antenna, as well as improving the transient (time-domain) response.

  15. Low-cost exterior insulation process and structure

    DOE Patents [OSTI]

    Vohra, A.

    1999-03-02T23:59:59.000Z

    A low-cost exterior insulation process of stacking bags of insulating material against a wall and covering them with wire mesh and stucco provides a durable structure with good insulating value. 2 figs.

  16. A SpaceTime Finite Element Method for the Exterior Acoustics Problem

    E-Print Network [OSTI]

    Thompson, Lonny L.

    A Space­Time Finite Element Method for the Exterior Acoustics Problem by Lonny L. Thompson problem in exterior domains is discussed. The space­time formulation for the exterior acoustics problem acoustics problem. i #12; Contents 1 Introduction 1 2 The Exterior Acoustics Problem 3 3 Space­time finite

  17. Investigation about the effects of exterior surface paint color on temperature development in aboveground pipeline

    SciTech Connect (OSTI)

    Farzaneh-Gord, Mahmood; Rasekh, Alireza; Nabati, Amin; Saadat, Morteza [Faculty of Mechanical Engineering, Shahrood University of Technology, Shahrood (Iran, Islamic Republic of)

    2010-12-15T23:59:59.000Z

    A practical analytical model for predicting temperature development of incompressible flow inside an aboveground pipeline has been constructed and presented in this research work. The outer surface of the pipeline is exposed to solar radiation and wind stream. The radiation heat exchange with ambient is also taken into account. The effects of exterior surface paint color represented by emissivity and absorptivity, have been studied. The model has been developed to study crude oil flow temperature development through a specific pipeline. The results obtained by the model show that the bulk temperature inclined to a limiting value in some distance which affected mainly by Reynolds numbers. It is found that emissivity and absorptivity of surface are predominant parameters in temperature development in an aboveground pipeline flow which can increase or decrease pipe surface and fluid temperature especially for low Reynolds number flow. Based on the results which indicated significantly of exterior surface paint color, one should choose the paint color by considering its effects on temperature development. (author)

  18. Foote Hydroelectric Plant spillway rehabilitation

    SciTech Connect (OSTI)

    Sowers, D.L. [Consumers Power Co., Jackson, MI (United States); Hasan, N.; Gertler, L.R. [Raytheon Infrastructures Services, New York, NY (United States)

    1996-10-01T23:59:59.000Z

    In 1993 the spillway of the 9 MW Foote Hydroelectric Plant located on the AuSable River, near Oscoda, Michigan was rehabilitated. The Foote Plant, built in 1917, is owned and operated by Consumers Power Company. In the 76 years of continuous operation the spillway had deteriorated such that much of the concrete and associated structure needed to be replaced to assure safety of the structure. The hydro station includes an earth embankment with concrete corewall, a concrete spillway with three tainter gates and a log chute, a penstock structure and a steel and masonry powerhouse. The electric generation is by three vertical shaft units of 3,000 KW each. A plan of the plant with spillway and an elevation of the spillway section is shown. This paper describes the evaluation and repair of the plant spillway and associated structure.

  19. Weigh-in-motion scale with foot alignment features

    DOE Patents [OSTI]

    Abercrombie, Robert Knox; Richardson, Gregory David; Scudiere, Matthew Bligh

    2013-03-05T23:59:59.000Z

    A pad is disclosed for use in a weighing system for weighing a load. The pad includes a weighing platform, load cells, and foot members. Improvements to the pad reduce or substantially eliminate rotation of one or more of the corner foot members. A flexible foot strap disposed between the corner foot members reduces rotation of the respective foot members about vertical axes through the corner foot members and couples the corner foot members such that rotation of one corner foot member results in substantially the same amount of rotation of the other corner foot member. In a strapless variant one or more fasteners prevents substantially all rotation of a foot member. In a diagonal variant, a foot strap extends between a corner foot member and the weighing platform to reduce rotation of the foot member about a vertical axis through the corner foot member.

  20. A SpaceTime Finite Element Method for the Exterior Structural Acoustics Problem

    E-Print Network [OSTI]

    Thompson, Lonny L.

    A Space­Time Finite Element Method for the Exterior Structural Acoustics Problem: Time­discontinuous Galerkin space­time finite element method is formu­ lated for the exterior structural acoustics problem Introduction A space­time finite element formulation is presented for solution of the exterior struc­ tural

  1. A Space-Time Finite Element Method for the Exterior Acoustics Problem

    E-Print Network [OSTI]

    Thompson, Lonny L.

    A Space-Time Finite Element Method for the Exterior Acoustics Problem Lonny L. Thompson Department in exterior domains is discussed. The space-time formulation for the exterior acoustics problem is obtained, the development of a space-time finite element method for so- lution of the transient acoustics problem

  2. Preprint version, February 2006 to appear in Acta Numerica (2006) Finite element exterior calculus,

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    problem being solved. In the finite element exterior calculus, many finite element spaces are re- vealed-dimensional subspace of the given #12;Finite element exterior calculus 3 function space where the solution isPreprint version, February 2006 to appear in Acta Numerica (2006) Finite element exterior calculus

  3. Global Heat Kernel Estimate for Relativistic Stable Processes in Exterior Open Sets

    E-Print Network [OSTI]

    Chen, Zhen-Qing

    ,1 exterior open sets as well as for half-space-like open sets. The ideas of [8] have been adaptedGlobal Heat Kernel Estimate for Relativistic Stable Processes in Exterior Open Sets Zhen-Qing Chen for the transition densities of relativistic -stable processes with mass m (0, 1] in C1,1 exterior open sets

  4. A Space-Time Finite Element Method for the Exterior Structural Acoustics Problem

    E-Print Network [OSTI]

    Thompson, Lonny L.

    A Space-Time Finite Element Method for the Exterior Structural Acoustics Problem: Time-time finite element method is formu- lated for the exterior structural acoustics problem in two space formulation is presented for solution of the exterior struc- tural acoustics problem in two space dimensions

  5. Math 55b: Honors Advanced Calculus and Linear Algebra Introduction to exterior algebra and differential forms

    E-Print Network [OSTI]

    Elkies, Noam D.

    \\Lambda of the dual space V \\Lambda . We begin by defining the exterior powers of an arbitrary vector space W over any field F , and describing them in the finite­dimensional case. The exterior algebra of a vector space. The exterior algebra of W is the F ­ algebra V ffl W generated by W and an operation â?? : V

  6. An algorithm for recognising the exterior square of a Catherine Greenhill

    E-Print Network [OSTI]

    Greenhill, Catherine

    the motivating case of multisets of eigenvalues of matrices. 1 Introduction The exterior square of a vector space of X on the exterior square of the underlying vector space. This relationship is fully determinedAn algorithm for recognising the exterior square of a multiset Catherine Greenhill School

  7. Spray Foam Exterior Insulation with Stand-Off Furring

    SciTech Connect (OSTI)

    Herk, A.; Baker, R.; Prahl, D.

    2014-03-01T23:59:59.000Z

    IBACOS, in collaboration with GreenHomes America, was contracted by the New York State Energy Research and Development Authority to research exterior wall insulation solutions. This research investigated cost-effective deep energy retrofit (DER) solutions for improving the building shell exterior while achieving a cost-reduction goal, including reduced labor costs to reach a 50/50 split between material and labor. The strategies included exterior wall insulation plus energy upgrades as needed in the attic, mechanical and ventilation systems, and basement band joist, walls, and floors. The work can be integrated with other home improvements such as siding or window replacement. This strategy minimizes physical connections to existing wall studs, encapsulates existing siding materials (including lead paint) with spray foam, and creates a vented rain screen assembly to promote drying. GreenHomes America applied construction details created by IBACOS to a test home. 2x4 framing members were attached to the wall at band joists and top plates using 'L' clips, with spray foam insulating the wall after framing was installed. Windows were installed simultaneously with the framing, including extension jambs. The use of clips in specific areas provided the best strength potential, and 'picture framing' the spray foam held the 2x4s in place. Short-term testing was performed at this house, with monitoring equipment installed for long-term testing. Testing measurements will be provided in a later report, as well as utility impact (before and after), costs (labor and materials), construction time, standard specifications, and analysis for the exterior wall insulation strategy.

  8. Covariant Star Product for Exterior Differential Forms on Symplectic Manifolds

    SciTech Connect (OSTI)

    McCurdy, Shannon; Zumino, Bruno [Physics Department, University of California, Berkeley, CA 94720-7300 (United States); Theoretical Physics Group, Lawrence Berkeley Laboratory, Berkeley, CA 947208162 (United States)

    2010-02-10T23:59:59.000Z

    After a brief description of the Z-graded differential Poisson algebra, we introduce a covariant star product for exterior differential forms and give an explicit expression for it up to second order in the deformation parameter h, in the case of symplectic manifolds. The graded differential Poisson algebra endows the manifold with a connection, not necessarily torsion-free, and places upon the connection various constraints.

  9. Cladding Attachment Over Thick Exterior Insulating Sheathing (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2013-11-01T23:59:59.000Z

    The addition of insulation to the exterior of buildings is an effective means of increasing the thermal resistance of wood-framed walls and mass masonry wall assemblies. The location of the insulation on the exterior of the structure has many direct benefits, including better effective R-value from reduced thermal bridging, better condensation resistance, reduced thermal stress on the structure, as well as other commonly associated improvements such as increased airtightness and improved water management. For thick layers of exterior insulation (more than 1.5 in.), the use of wood furring strips attached through the insulation back to the structure has been used by many contractors and designers as a means to provide a convenient cladding attachment location. Although the approach has proven effective, there is significant resistance to its widespread implementation due to a lack of research and understanding of the mechanisms involved in the development of the vertical displacement resistance capacity. In addition, the long-term in-service performance of the system has been questioned due to potential creep effects of the assembly under the sustained dead load of the cladding and effects of varying environmental conditions. In addition, the current International Building Code (IBC) and International Residential Code (IRC) do not have a provision that specifically allows this assembly.

  10. Lighting the Great Outdoors: LEDs in Exterior Applications

    SciTech Connect (OSTI)

    Cook, Tyson D. S.; Bryan, Mary M.; Kinzey, Bruce R.; Myer, Michael

    2008-08-17T23:59:59.000Z

    Recent progress in the development of white light LEDs promises great impact by opening up the huge potential for LED illumination in new areas. One such area is general illumination for exterior applications. For example, there are an estimated combined 60.5 million roadway and parking installations in the U.S. These lights account for an estimated 53.3 TWh of electricity usage annually -- nearly 7% of all lighting. If LEDs could provide the same light performance with just 25% greater efficiency, savings of over 13 TWh could be achieved. In 2007, the authors assessed emerging LED lighting technologies in a parking garage and on a city street. The purpose of these tests was to enable a utility to determine whether energy efficiency programs promoting white light LED products might be justified. The results have supported the great promise of LEDs in exterior applications, while also highlighting the barriers that continue to hinder their widespread adoption. Such barriers include 1) inconsistent product quality across manufacturers; 2) lack of key metrics for comparing LEDs to conventional sources; and 3) high upfront cost of LED luminaires compared to conventional luminaires. This paper examines these barriers, ways in which energy-efficiency programs could help to overcome them, and the potential for energy and financial savings from LED lighting in these two exterior applications.

  11. Evaluation of Two CEDA Weatherization Pilot Implementations of an Exterior Insulation and Over-Clad Retrofit Strategy for Residential Masonry Buildings in Chicago

    SciTech Connect (OSTI)

    Neuhauser, K.

    2013-08-01T23:59:59.000Z

    This project examines the implementation of an exterior insulation and over-clad strategy for brick masonry buildings in Chicago. The strategy was implemented at a free-standing two story two-family dwelling and a larger free-standing multifamily building. The test homes selected for this research represent predominant housing types for the Chicago area. High heating energy use typical in these buildings threaten housing affordability. Uninsulated mass masonry wall assemblies also have a strongly detrimental impact on comfort. Significant changes to the performance of masonry wall assemblies is generally beyond the reach of typical weatherization (Wx) program resources. The Community and Economic Development Association of Cook County, Inc. (CEDA) has secured a Sustainable Energy Resources for Consumers (SERC) innovation grant sponsored by the United States Department of Energy (DOE). This grant provides CEDA the opportunity to pursue a pilot implementation of innovative approaches to retrofit in masonry wall enclosures. The exterior insulation and over-clad strategy implemented through this project was designed to allow implementation by contractors active in CEDA weatherization programs and using materials and methods familiar to these contractors. The retrofit measures are evaluated in terms of feasibility, cost and performance. Through observations of the strategies implemented, the research described in this report identifies measures critical to performance as well as conditions for wider adoption. The research also identifies common factors that must be considered in determining whether the exterior insulation and over-clad strategy is appropriate for the building.

  12. Meshless boundary element methods for exterior problems on spheroids E.P.Stephan1

    E-Print Network [OSTI]

    Lê Gia, Quôc Thông

    Meshless boundary element methods for exterior problems on spheroids E.P.Stephan1 , A.Costea1 ,Q and Space-Time Research), Leibniz University of Hanover, Am Welfengarten 1, 30167 Hanover, Germany. E is interested in the Neumann problem exterior to a spheroid where the orbits of satellites are located

  13. Asymptotic description of solutions of the exterior Navier Stokes problem in a half space

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Asymptotic description of solutions of the exterior Navier Stokes problem in a half space Matthieu equations in an exterior domain in a half space, with appropriate boundary conditions on the wall, the body body and the wall. Contents 1 Introduction 2 1.1 Sets and function spaces

  14. Statistical theory of interior-exterior transition and collision probabilities for

    E-Print Network [OSTI]

    Ross, Shane

    Statistical theory of interior-exterior transition and collision probabilities for minor bodies to exhibit a complicated array of behaviors such as transition between the interior and exterior Hill. The stable and unstable invariant manifold tubes associated to libration point orbits are the phase space

  15. A space-time BIE method for wave equation exterior problems. The Neumann case.

    E-Print Network [OSTI]

    Ceragioli, Francesca

    A space-time BIE method for wave equation exterior problems. The Neumann case. S. Falletta , G. Monegato , L. Scuderi§ Abstract In this paper we consider the (2D and 3D) exterior problem for the wave equation, with a Neumann boundary condition and in general with non trivial data. First we derive a space

  16. Space-time BIE methods for non homogeneous exterior wave equation problems. The Dirichlet case.

    E-Print Network [OSTI]

    Ceragioli, Francesca

    Space-time BIE methods for non homogeneous exterior wave equation problems. The Dirichlet case. S. Falletta , G. Monegato , L. Scuderi§ Abstract In this paper we consider the (2D and 3D) exterior problem; non homogeneous conditions; space-time boundary integral equations; numerical methods This work

  17. GLOBAL WELL-POSEDNESS AND SCATTERING FOR DEFOCUSING ENERGY-CRITICAL NLS IN THE EXTERIOR OF

    E-Print Network [OSTI]

    Smith, Hart F.

    GLOBAL WELL-POSEDNESS AND SCATTERING FOR DEFOCUSING ENERGY-CRITICAL NLS IN THE EXTERIOR OF BALLS-critical NLS in the exterior of the unit ball in three dimensions. For the initial value problem with Dirichlet in the Sobolev space H1 0 . We also point out that the same strategy can be used to treat the energy

  18. Que pas este? Narrativas sobre o Brasil criadas por brasileiros residentes no exterior

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Que país é este? Narrativas sobre o Brasil criadas por brasileiros residentes no exterior Luis utilizados no Brasil, como o Orkut, existem mais de sessenta comunidades com o título "Brasileiros-representação e a imagem do Brasil e dos brasileiros no exterior ou sobre a percepção da terra de chegada. O

  19. Investigation of vessel exterior air cooling for a HLMC reactor

    SciTech Connect (OSTI)

    Sienicki, J. J.; Spencer, B. W.

    2000-01-13T23:59:59.000Z

    The Secure Transportable Autonomous Reactor (STAR) concept under development at Argonne National Laboratory provides a small (300 MWt) reactor module for steam supply that incorporates design features to attain proliferation resistance, heightened passive safety, and improved cost competitiveness through extreme simplification. Examples are the achievement of 100%+ natural circulation heat removal from the low power density/low pressure drop ultra-long lifetime core and utilization of lead-bismuth eutectic (LBE) coolant enabling elimination of main coolant pumps as well as the need for an intermediate heat transport circuit. It is required to provide a passive means of removing decay heat and effecting reactor cooldown in the event that the normal steam generator heat sink, including its normal shutdown heat removal mode, is postulated to be unavailable. In the present approach, denoted as the Reactor Exterior Cooling System (RECS), passive decay heat removal is provided by cooling the outside of the containment/guard vessel with air. RECS is similar to the Reactor Vessel Auxiliary Cooling System (RVACS) incorporated into the PRISM design. However, to enhance the heat removal, RECS incorporates fins on the containment vessel exterior to enhance heat transfer to air as well as removable steel venetian conductors that provide a conduction heat transfer path across the reactor vessel-containment vessel gap to enhance heat transfer between the vessels. The objective of the present work is to investigate the effectiveness of air cooling in removing heat from the vessel and limiting the coolant temperature increase following a sudden complete loss of the steam generator heat sink.

  20. Investigation of vessel exterior air cooling for an HLMC reactor

    SciTech Connect (OSTI)

    Sienicki, J.J.; Spencer, B.W.

    2000-07-01T23:59:59.000Z

    The secure transportable autonomous reactor (STAR) concept under development at Argonne National Laboratory provides a small [300-MW(thermal)] reactor module for steam supply that incorporates design features to attain proliferation resistance, heightened passive safety, and improved cost competitiveness through extreme simplification. Examples are the achievement of 100% + natural-circulation heat removal from the low-power-density/low-pressure-drop ultralong lifetime core and utilization of lead-bismuth eutectic (LBE) coolant enabling elimination of main coolant pumps as well as the need for an intermediate heat transport circuit. It is required to provide a passive means of removing decay heat and effecting reactor cooldown in the event that the normal steam generator heat sink, including its normal shutdown heat removal mode, is postulated to be unavailable. In the present approach, denoted as the reactor exterior cooling system (RECS), passive decay heat removal is provided by cooling the outside of the containment/guard vessel with air. RECS is similar to the reactor vessel auxiliary cooling system (RVACS) incorporated into the PRISM design. However, to enhance the heat removal, RECS incorporates fins on the containment vessel exterior to enhance heat transfer to air as well as removable steel venetian conductors that provide a conduction heat transfer path across the reactor vessel-containment vessel gap to enhance heat transfer between the vessels. The objective of the present work is to investigate the effectiveness of air cooling in removing heat from the vessel and limiting the coolant temperature increase following a sudden complete loss of the steam generator heat sink.

  1. Emergency phones, exterior residence hall phones, and pay phones Pay-by-Space Parking

    E-Print Network [OSTI]

    Emergency phones, exterior residence hall phones, and pay phones Pay-by-Space Parking Meter Parking Pay-by- Space Parking VehicleThoroughfares N Pitkin Street Lake Street College Avenue Underpass Annual

  2. Proceedings of Thermal VII, Thermal Performance of the Exterior Envelopes of Buildings,

    E-Print Network [OSTI]

    LBNL-42871 BS-400 Proceedings of Thermal VII, Thermal Performance of the Exterior Envelopes locations. The user describes the physical, thermal and optical properties of the windows in each

  3. Five-Dimensional Tangent Vectors in Space-Time: IV. Generalization of Exterior Calculus

    E-Print Network [OSTI]

    Alexander Krasulin

    1998-08-18T23:59:59.000Z

    This part of the series is devoted to the generalization of exterior differential calculus. I give definition to the integral of a five-vector form over a limited space-time volume of appropriate dimension; extend the notion of the exterior derivative to the case of five-vector forms; and formulate the corresponding analogs of the generalized Stokes theorem and of the Poincare theorem about closed forms. I then consider the five-vector generalization of the exterior derivative itself; prove a statement similar to the Poincare theorem; define the corresponding five-vector generalization of flux; and derive the analog of the formula for integration by parts. I illustrate the ideas developed in this paper by reformulating the Lagrange formalism for classical scalar fields in terms of five-vector forms. In conclusion, I briefly discuss the five-vector analog of the Levi-Civita tensor and dual forms.

  4. GreenFoot Technologies | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, search OpenEI ReferenceJump to: navigation,IISrl Jump to:GreenFoot Technologies

  5. SmallFoot LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-f < RAPID‎ |RippeyInformation SlimSlough Heat andSmallFoot LLC Jump

  6. Brad Foote Gear Works | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof Energy 2,AUDIT REPORT Americium/CuriumAguaBBBWind- GeradoraBorealBrad Foote Gear

  7. Application of exterior complex scaling to positron-hydrogencollisions including rearrangement

    SciTech Connect (OSTI)

    Bartlett, Philip L.; Stelbovics, Andris T.; Rescigno, Thomas N.; McCurdy, C. William

    2007-12-06T23:59:59.000Z

    The first application of an exterior complex scaling method to an atomic scattering problem with distinct rearrangement channels is reported. Calculations are performed for positron-hydrogen collisions in an s-wave model employing an electron-positron potential of V{sub 12} = -(8+(r{sub 1}-r{sub 2}){sup 2}){sup 1/2}, using the time-independent propagating exterior complex scaling (PECS) method. This potential has the correct long-range Coulomb tail of the full problem and the results demonstrate that ECS-based methods can accurately calculate scattering, ionization and positronium formation cross sections in this three-body rearrangement collision.

  8. Development of building-integrated PV modules using color solar cells for various exterior walls

    SciTech Connect (OSTI)

    Ishikawa, N.; Kanai, M.; Hide, I. [Daido Hoxan Inc. (Japan). Chitose Labs.] [and others

    1997-12-31T23:59:59.000Z

    The authors have been developing building-material-integrated PV modules used as exterior walls of building using color solar cells with an emphasis on design. Mainly the authors developed four types of modules, glass curtain walls, precast-concrete (PC)-incorporated-type, slanted wall-type and renovation-type modules. They constructed the demonstration test facilities of those modules and evaluated the performance of building-material-integrated modules for various types of exterior walls. No problems were observed at an outdoor demonstration test facility. The authors confirmed the color and shape of those modules can be harmonized with the design of the building.

  9. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    parasitism and extra-pair paternity in blue- footed boobies.Microsatellites Á SSRs Á Blue-footed booby Á Sula nebouxii Ámicrosatellite loci from blue-footed boobies (Sula nebouxii)

  10. A Universal AnkleFoot Prosthesis Emulator for Human Locomotion

    E-Print Network [OSTI]

    Collins, Steven H.

    A Universal Ankle­Foot Prosthesis Emulator for Human Locomotion Experiments Joshua M. Caputo of functions. Here we describe a robotic ankle­foot prosthesis system that enables rapid exploration of a wide-board motor and con- trol hardware, a flexible Bowden cable tether, and a lightweight instrumented prosthesis

  11. Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs

    E-Print Network [OSTI]

    Sitti, Metin

    Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing Dept -- This paper proposes two different nanomolding methods to fabricate synthetic gecko foot-hair nanostructures a nano-pore membrane as a template. These templates are molded with silicone rubber, polyimide

  12. Department of Mechanical Engineering Fall 2012 The Jaipur Foot

    E-Print Network [OSTI]

    Demirel, Melik C.

    for the Jaipur Foot and in compliance with the International Organization for Standardization (ISO) standard Foot in compliance with ISO Standard 10328. Approach Gathered customer needs from sponsor Established target specifications from customer needs into measurable metrics Reviewed ISO Standard 10328

  13. Problem of Vain Energy Consumption in a VAV Air Conditioning System Shared By an Inner Zone and Exterior Zone

    E-Print Network [OSTI]

    Wenji, G.; Ling, C.; Dongdong, L.; Mei, S.; Li, Z.

    2006-01-01T23:59:59.000Z

    In northern China, there are a large number of space buildings divided in inner zone and exterior zone based on usage requirements. The exterior zone needs to be heated in winter and cooled in summer, while the inner zone needs to be cooled both...

  14. Planipes: Mobile Foot Pressure Analysis Samuel Pfaffen, Philipp Sommer, Christian Stocker, Roger Wattenhofer, and Samuel Welten

    E-Print Network [OSTI]

    Planipes: Mobile Foot Pressure Analysis Samuel Pfaffen, Philipp Sommer, Christian Stocker, Roger, sommer, chstocke, wattenhofer, welten}@tik.ee.ethz.ch Abstract Analyzing foot pressure is helpful

  15. Sustainable wall construction and exterior insulation retrofit technology process and structure

    DOE Patents [OSTI]

    Vohra, Arun (Bethesda, MD)

    2000-01-01T23:59:59.000Z

    A low-cost process for exterior wall insulation retrofit, or new wall construction by stacking layers of fabric tube filled with insulating material against a wall and covering them with mesh and stucco provides a durable structure with good insulating value.

  16. A fast multipole implementation of the qualocation mixed-velocitytraction approach for exterior Stokes flows

    E-Print Network [OSTI]

    Frangi, Attilio

    A fast multipole implementation of the qualocation mixed-velocity­traction approach for exterior on both velocity and traction integral equations is employed and accelerated via a Fast Multipole Method 2005 Elsevier Ltd. All rights reserved. Keywords: Multipole accelerators; Stokes flow; Damping forces

  17. Almost global existence for nonlinear wave equations in an exterior domain in two space dimensions

    E-Print Network [OSTI]

    Hideo Kubo

    2012-05-26T23:59:59.000Z

    In this paper we deal with the exterior problem for a system of nonlinear wave equations in two space dimensions, assuming that the initial data is small and smooth. We establish the same type of lower bound of the lifespan for the problem as that for the Cauchy problem, despite of the weak decay property of the solution in two space dimensions.

  18. Model for Naturally Ventilated Cavities on the Exteriors of Opaque Building Thermal Envelopes

    SciTech Connect (OSTI)

    Griffith, B.

    2006-11-01T23:59:59.000Z

    This paper describes a model for naturally ventilated cavities on the exterior of opaque building thermal envelopes that are formed by the presence of a lightweight baffle. The model can be used for building components that are slightly detached from the main envelope (but do not connect to the interior).

  19. EXTERIOR LIGHTING CASE STUDY For more information, visit PARTNERSHIPDEMONSTRATIONS.ORG

    E-Print Network [OSTI]

    California at Davis, University of

    EXTERIOR LIGHTING CASE STUDY » For more information, visit PARTNERSHIPDEMONSTRATIONS.ORG In 2013, UC Santa Barbara partnered with the SPEED team to demonstrate network controlled LED lighting sensors. These lighting controls allowed all the units to be incorporated into an adaptive mesh network

  20. Coordenao de Aperfeioamento de Pessoal de Nvel Superior Programa Institucional de Doutorado Sanduche no Exterior PDSE

    E-Print Network [OSTI]

    Floeter, Sergio Ricardo

    Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Programa Institucional de Doutorado Aperfeiçoamento de Pessoal de Nível Superior Programa Institucional de Doutorado Sanduíche no Exterior ­ PDSE

  1. Initial and Long-Term Movement of Cladding Installed Over Exterior Rigid Insulation

    SciTech Connect (OSTI)

    Baker, P.

    2014-09-01T23:59:59.000Z

    Changes in the International Energy Conservation Code (IECC) from 2009 to 2012 have resulted in the use of exterior rigid insulation becoming part of the prescriptive code requirements. With more jurisdictions adopting the 2012 IECC builders are going to finding themselves required to incorporate exterior insulation in the construction of their exterior wall assemblies. For thick layers of exterior insulation (levels greater than 1.5 inches), the use wood furring strips attached through the insulation back to the structure has been used by many contractors and designers as a means to provide a convenient cladding attachment location. However, there has been a significant resistance to its widespread implementation due to a lack of research and understanding of the mechanisms involved and potential creep effects of the assembly under the sustained dead load of a cladding. This research was an extension on previous research conducted by BSC in 2011, and 2012. Each year the understanding of the system discrete load component interactions, as well as impacts of environmental loading has increased. The focus of the research was to examine more closely the impacts of screw fastener bending on the total system capacity, effects of thermal expansion and contraction of materials on the compressive forces in the assembly, as well as to analyze a full years worth of cladding movement data from assemblies constructed in an exposed outdoor environment.

  2. Distributed Explosive-Driven Six-foot Diameter by Two-Hundred Foot Long Shock Tubes

    SciTech Connect (OSTI)

    VIGIL, MANUEL G.

    2002-02-01T23:59:59.000Z

    The blast parameters for the 6-foot diameter by 200-foot long, explosively driven shock tube are presented in this report. The purpose, main characteristics, and blast simulation capabilities of this PETN Primacord, explosively driven facility are included. Experimental data are presented for air and Sulfurhexaflouride (SF6) test gases with initial pressures between 0.5 to 12.1 psia (ambient). Experimental data are presented and include shock wave time of amval at various test stations, flow duration, static or side-on overpressure, and stagnation or head-on overpressure. The blast parameters calculated from the above measured parameters and presented in this report include shock wave velocity, shock strength, shock Mach number, flow Mach Number, reflected pressure, dynamic pressure, particle velocity, density, and temperature. Graphical data for the above parameters are included. Algorithms and least squares fit equations are also included.

  3. Chamber transport of "foot" pulses for heavy-ion fusion

    E-Print Network [OSTI]

    Sharp, W.M.; Callahan-Miller, D.A.; Tabak, M.; Yu, S.S.; Peterson, P.F.

    2002-01-01T23:59:59.000Z

    Neutralization on Heavy-Ion-Fusion Chamber Transport," to beChamber transport of "foot" pulses for heavy-ion fusion W.chamber-transport effectiveness is the fraction of enclosed beam ions

  4. Powered Ankle–Foot Prosthesis Improves Walking Metabolic Economy

    E-Print Network [OSTI]

    Au, Samuel K.

    At moderate to fast walking speeds, the human ankle provides net positive work at high-mechanical-power output to propel the body upward and forward during the stance period. On the contrary, conventional ankle-foot ...

  5. The effect of foot conditions on constrained standing

    E-Print Network [OSTI]

    Barlow, Jessica Marie

    1996-01-01T23:59:59.000Z

    This study was conducted to find any differences in physiological effects, subjective rankings, or discomfort with respect to foot conditions in constrained standing. Eight healthy subjects, four female and four male, stood using four different...

  6. Mag-Foot: a steel bridge inspection robot

    E-Print Network [OSTI]

    Asada, Harry

    A legged robot that moves across a steel structure is developed for steel bridge inspection. Powerful permanent magnets imbedded in each foot allow the robot to hang from a steel ceiling powerlessly. Although the magnets ...

  7. ankle foot orthoses: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  8. ankle foot orthosis: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  9. A scattering theory for the wave equation on Kerr black hole exteriors

    E-Print Network [OSTI]

    Mihalis Dafermos; Igor Rodnianski; Yakov Shlapentokh-Rothman

    2014-12-29T23:59:59.000Z

    We develop a definitive physical-space scattering theory for the scalar wave equation on Kerr exterior backgrounds in the general subextremal case |a|exterior spacetimes III: the full subextremal case |a|

  10. A study conducted on laterally loaded cylindrical footings

    E-Print Network [OSTI]

    Koch, Kenneth Joseph

    1968-01-01T23:59:59.000Z

    A STUDY CONDUCTED ON LATERALLY LOADED CYLINDRICAL FOOTINGS A Thesis by Kenneth Joseph Koch Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree oi MASTER OF SCIENCE May 1968... Major Subject Civil Engineering A STUDY CONDUCTED ON LATERALLY LOADED CYLINDRICAL FOOTINGS A Thesis by Kenneth Joseph Koch Approved as to style and content by (Chairman of Committee) (Head of Department) (Member) (M ber) May 1968...

  11. LA POLTICA EXTERIOR DE ESPAA HACIA BRASIL: DE LA MUTUA IRRELEVANCIA A LA RELACIN ESTRATGICA

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LA POLÍTICA EXTERIOR DE ESPA�A HACIA BRASIL: DE LA MUTUA IRRELEVANCIA A LA RELACI�N ESTRAT�GICA. Investigador posdoctoral MEC en la Universidad de São Paulo. Brasil. brunespa@gmail.com RESUMEN: El estudio de las relaciones entre España y Brasil constituye una de las lagunas más destacadas en la historiografia

  12. Measurement of Exterior Foundation Insulation to Assess Durability in Energy-Saving Performance

    SciTech Connect (OSTI)

    Kehrer, Manfred [ORNL; Christian, Jeff [Oak Ridge National Laboratory (ORNL)

    2012-04-01T23:59:59.000Z

    The foundation of a house is a sometimes ignored component of the building because of its low visibility. It is increasingly evident, however, that attention to good foundation design and construction significantly benefits the homeowner and the builder by mitigating future problems. Good foundation design and construction practice involves not only insulating to save energy but also providing effective structural design as well as moisture, termite, and radon control techniques as appropriate. Energy efficiency in housing is augmented by use of exterior slab and basement insulation, but high moisture content in the insulation material has led to concerns about its durability. The activity under this task was to extract six different exterior insulation systems that were characterized at installation and have been in the ground for 9 months to 15 years. R-value and moisture content were measured and inspections conducted for evidence of termite intrusion or deterioration. Based on the results, the durability of the various systems has been documented and assessments made of which systems appear to be best practice. Heat flux and temperature measurement data had been archived for some of the exterior insulation tests, thereby providing a unique opportunity to assess energy-saving performance and durability over the long term. The results show that the durability of foundation insulation systems depends on insulation type as well as on foundation type and local boundary conditions, the latter of which may have a marked influence on the durability of energy-saving performance.

  13. Stable soliton resolution for exterior wave maps in all equivariance classes

    E-Print Network [OSTI]

    Carlos Kenig; Andrew Lawrie; Baoping Liu; Wilhelm Schlag

    2014-09-12T23:59:59.000Z

    In this paper we consider finite energy, \\ell-equivariant wave maps from 1+3-dimensional Minkowski space exterior to the unit ball at the origin into the 3-sphere. We impose a Dirichlet boundary condition at r=1, which in this context means that the boundary of the unit ball in the domain gets mapped to the north pole. Each such \\ell-equivariant wave map has a fixed integer-valued topological degree, and in each degree class there is a unique harmonic map, which minimizes the energy for maps of the same degree. We prove that an arbitrary \\ell-equivariant exterior wave map with finite energy scatters to the unique harmonic map in its degree class, i.e., soliton resolution. This extends the recent results of the first, second, and fourth authors on the 1-equivariant equation to higher equivariance classes, and thus completely resolves a conjecture of Bizon, Chmaj and Maliborski, who observed this asymptotic behavior numerically. The proof relies crucially on exterior energy estimates for the free radial wave equation in dimension d = 2 \\ell +3, which are established in a companion paper.

  14. Hodge-Helmholtz Decompositions of Weighted Sobolev Spaces in Irregular Exterior Domains with Inhomogeneous and Anisotropic Media

    E-Print Network [OSTI]

    Dirk Pauly

    2011-05-20T23:59:59.000Z

    We study in detail Hodge-Helmholtz decompositions in non-smooth exterior domains filled with inhomogeneous and anisotropic media. We show decompositions of alternating differential forms belonging to weighted Sobolev spaces into irrotational and solenoidal forms. These decompositions are essential tools, for example, in electro-magnetic theory for exterior domains. In the appendix we translate our results to the classical framework of vector analysis.

  15. Asymptotic description of solutions of the exterior Navier Stokes problem in a half space

    E-Print Network [OSTI]

    Matthieu Hillairet; Peter Wittwer

    2011-07-06T23:59:59.000Z

    We consider the problem of a body moving within an incompressible fluid at constant speed parallel to a wall, in an otherwise unbounded domain. This situation is modeled by the incompressible Navier-Stokes equations in an exterior domain in a half space, with appropriate boundary conditions on the wall, the body, and at infinity. We focus on the case where the size of the body is small. We prove in a very general setup that the solution of this problem is unique and we compute a sharp decay rate of the solution far from the moving body and the wall.

  16. Solution of the Schrodinger equation using exterior complex scaling and FFT

    E-Print Network [OSTI]

    Serov, Vladislav V

    2015-01-01T23:59:59.000Z

    We propose an approach for combining the exterior complex scaling (ECS) scheme with the space fast Fourier transform (FFT) for the purpose of the solution of the time-dependent Schrodinger equation (TDSE) by means of the split operator method. The approach has been tested against a model system through the evaluation of the ionization amplitudes with the help of the time-and-energy-dependent surface flux (t&E-SURFF) method. Also, we propose a fast and effective ECS-friendly FFT-based preconditioner for a solution of the stationary Schrodinger equation by means of the conjugate gradients method.

  17. Design and evaluation of a cantilever beam-type prosthetic foot for Indian persons with amputations

    E-Print Network [OSTI]

    Olesnavage, Kathryn M

    2014-01-01T23:59:59.000Z

    The goal of this work is to design a low cost, high performance prosthetic foot in collaboration with Bhagwan Mahaveer Viklang Sahayata Samiti (BMVSS), in Jaipur, India. In order to be adopted, the foot must cost less than ...

  18. Effects of different restrained foot positions on hand force exertion capability-implications for microgravity operations

    E-Print Network [OSTI]

    Whalen, Scott Allan

    1997-01-01T23:59:59.000Z

    An experiment was conducted to determine restrained foot positions that increase hand force exertion capability (HFEC) over that available under the existing restrained foot position utilized by NASA astronauts during Extra Vehicular Activity (EVA...

  19. Exterior Rigid Foam Insulation at the Edge of a Slab Foundation, Fresno, California (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2013-10-01T23:59:59.000Z

    Exterior rigid foam insulation at the edge of the slab foundation was a unique feature for this low-load, unoccupied test house in a hot-dry climate and may be more appropriate for climates with higher heating loads. U.S. Department of Energy Building America research team IBACOS worked with National Housing Quality Award winner Wathen-Castanos Hybrid Homes, Inc., to assess the performance of this feature in a single-family detached ranch house with three bedrooms and two full bathrooms constructed on a slab-on-grade foundation in Fresno, California. One challenge during installation of the system was the attachment of the butyl flashing to the open framing. To solve this constructability issue, the team added a nailer to the base of the wall to properly attach and lap the flashing. In this strategy, R-7.5, 1.5-in.-thick extruded polystyrene was installed on the exterior of the slab for a modeled savings of 4,500 Btu/h on the heating load.

  20. Proposal for the award of a contract for the renovation of all exterior wooden and structural elements of the Globe (Building 80)

    E-Print Network [OSTI]

    2015-01-01T23:59:59.000Z

    Proposal for the award of a contract for the renovation of all exterior wooden and structural elements of the Globe (Building 80)

  1. Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy

    E-Print Network [OSTI]

    Herr, Hugh

    Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy by Samuel Kwok-Wai Au LIBRARIES #12;#12;Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy by Samuel in walking. This objective of this thesis is to evaluate the hypothesis that a powered ankle- foot prosthesis

  2. Load tests on five large spread footings on sand and evaluation of prediction methods

    E-Print Network [OSTI]

    Gibbens, Robert Melvin

    1995-01-01T23:59:59.000Z

    for the engineering profession's lack of trust in the use of spread footings. For this study, five spread footings with sizes ranging from I to 3 m square were load tested to 150 mm of penetration. The footings were all constructed and tested in a similar manner...

  3. Proceedings of the ASHRAE/DOE/BTECC Conference, Thermal Performance of the Exterior Envelopes of Buildings VII, Clearwater Beach, Florida, December 7-11, 1998

    E-Print Network [OSTI]

    ;1 Proceedings of the Thermal Performance of the Exterior Envelopes of Buildings VII, December 7-11, 1998LBNL-41443 IS-390 Proceedings of the ASHRAE/DOE/BTECC Conference, Thermal Performance of the Exterior Envelopes of Buildings VII, Clearwater Beach, Florida, December 7-11, 1998 The research reported

  4. On Maximum Norm of Exterior Product and A Conjecture of C.N. Yang

    E-Print Network [OSTI]

    Zhilin Luo

    2015-01-08T23:59:59.000Z

    Let $V$ be a finite dimensional inner product space over $\\mathbb{R}$ with dimension $n$, where $n\\in \\mathbb{N}$, $\\wedge^{r}V$ be the exterior algebra of $V$, the problem is to find $\\max_{\\| \\xi \\| = 1, \\| \\eta \\| = 1}\\| \\xi \\wedge \\eta \\|$ where $k,l$ $\\in \\mathbb{N},$ $\\forall \\xi \\in \\wedge^{k}V, \\eta \\in \\wedge^{l}V.$ This is a problem suggested by the famous Nobel Prize Winner C.N. Yang. He solved this problem for $k\\leq 2$ in [1], and made the following \\textbf{conjecture} in [2] : If $n=2m$, $k=2r$, $l=2s$, then the maximum is achieved when $\\xi_{max} = \\frac{\\omega^{k}}{\\| \\omega^{k}\\|}, \\eta_{max} = \\frac{\\omega^{l}}{\\| \\omega^{l}\\|}$, where $ \\omega = \\Sigma_{i=1}^m e_{2i-1}\\wedge e_{2i}, $ and $\\{e_{k}\\}_{k=1}^{2m}$ is an orthonormal basis of V. From a physicist's point of view, this problem is just the dual version of the easier part of the well-known Beauzamy-Bombieri inequality for product of polynomials in many variables, which is discussed in [4]. Here the duality is referred as the well known Bose-Fermi correspondence, where we consider the skew-symmetric algebra(alternative forms) instead of the familiar symmetric algebra(polynomials in many variables) In this paper, for two cases we give estimations of the maximum of exterior products, and the Yang's conjecture is answered partially under some special cases.

  5. Exterior Insulation Finish System (EIFS) Walls ORNL provides the tools to enable industry to engineer durable, moisture-tolerant

    E-Print Network [OSTI]

    Oak Ridge National Laboratory

    Exterior Insulation Finish System (EIFS) Walls ORNL provides the tools to enable industry the insulating value of walls and the energy efficiency of buildings. The EIFS concept came to America from in both moisture control and insulating value. EIFS's are inherently superior on thermal performance

  6. New Extensions of the 3-Simplex for Exterior Orientation John M. Steinbis Tyrone L. Vincent William A. Hoff

    E-Print Network [OSTI]

    Hoff, William A.

    New Extensions of the 3-Simplex for Exterior Orientation John M. Steinbis Tyrone L. Vincent William to the homogeneous transformation, both algorithms uti- lize the 3-simplex as a pose parameterization. One al on the 3- simplex and a linear combination of multiple eigenvec- tors. Results showed that the eigenvector

  7. Building America Case Study: Initial and Long-Term Movement of Cladding Installed Over Exterior Rigid Insulation (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2014-10-01T23:59:59.000Z

    Changes in the International Energy Conservation Code (IECC) from 2009 to 2012 have resulted in the use of exterior rigid insulation becoming part of the prescriptive code requirements. With more jurisdictions adopting the 2012 IECC builders are going to finding themselves required to incorporate exterior insulation in the construction of their exterior wall assemblies. For thick layers of exterior insulation (levels greater than 1.5 inches), the use wood furring strips attached through the insulation back to the structure has been used by many contractors and designers as a means to provide a convenient cladding attachment location. However, there has been a significant resistance to its widespread implementation due to a lack of research and understanding of the mechanisms involved and potential creep effects of the assembly under the sustained dead load of a cladding. This research was an extension on previous research conducted by BSC in 2011, and 2012. Each year the understanding of the system discrete load component interactions, as well as impacts of environmental loading has increased. The focus of the research was to examine more closely the impacts of screw fastener bending on the total system capacity, effects of thermal expansion and contraction of materials on the compressive forces in the assembly, as well as to analyze a full years worth of cladding movement data from assemblies constructed in an exposed outdoor environment.

  8. BRAINS -the concepts behind a quick and efficient tool for prediction of exterior and interior railway vehicle

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    /3-octave band sound power and directivity. For interior noise the calculations are based on an SEA model of the complete acoustics management process. One key feature is that BRAINS handles exterior and interior noise for the interior volume into which the transmitted acoustic power is determined from source strength models

  9. Project Overcoat - An Exploration of Exterior Insulation Strategies for 1-1/2-Story Roof Applications in Cold Climates

    SciTech Connect (OSTI)

    Ojczyk, C.; Mosiman, G.; Huelman, P.; Schirber, T.; Yost, P.; Murry, T.

    2013-04-01T23:59:59.000Z

    The development of an alternative method to interior-applied insulation strategies or exterior applied 'band-aids' such as heat tapes and ice belts may help reduce energy needs of millions of 1-1/2 story homes while reducing the risk of ice dam formation. A potential strategy for energy improvement of the roof is borrowed from new construction best practices: Here an 'overcoat' of a continuous air, moisture, and thermal barrier is applied on the outside of the roof structure for improved overall performance. The continuous insulation of this approach facilitates a reduction in thermal bridging which could further reduce energy consumption and bring existing homes closer to meeting the Building America goals for energy reduction. Research favors an exterior approach to deep energy retrofits and ice dam prevention in existing homes. The greatest amount of research focuses on whole house deep energy retrofits leaving a void in roof-only applications. The research is also void of data supporting the hygrothermal performance, durability, constructability, and cost of roof-only exterior overcoat strategies. Yet, contractors interviewed for this report indicate an understanding that exterior approaches are most promising for mitigating ice dams and energy loss and are able to sell these strategies to homeowners.

  10. Long-Time Asymptotics for the Navier-Stokes Equation in a Two-Dimensional Exterior Domain

    E-Print Network [OSTI]

    Gallay, Thierry

    Gallay Abstract. We study the long-time behavior of infinite-energy solutions to the incom- pressible-time behavior, exterior domain. Math. classification: 35Q30, 35B35, 76D05, 76D17. 1 #12;Th. Gallay where n

  11. Thermal Performance of Exterior Insulation and Finish Systems Containing Vacuum Insulation Panels

    SciTech Connect (OSTI)

    Childs, Kenneth W [ORNL; Stovall, Therese K [ORNL; Biswas, Kaushik [ORNL; Carbary, Lawrence D [Dow Corning Corporation, Midland, MI

    2013-01-01T23:59:59.000Z

    A high-performance wall system is under development to improve wall thermal performance to a level of U-factor of 0.19 W/(m2 K) (R-30 [h ft2 F]/Btu) in a standard wall thickness by incorporating vacuum insulation panels (VIPs) into an exterior insulation finish system (EIFS). Such a system would be applicable to new construction and will offer a solution to more challenging retrofit situations as well. Multiple design options were considered to balance the need to protect theVIPs during construction and building operation, while minimizing heat transfer through the wall system. The results reported here encompass an indepth assessment of potential system performances including thermal modeling, detailed laboratory measurements under controlled conditions on the component, and system levels according to ASTM C518 (ASTM 2010). The results demonstrate the importance of maximizing the VIP coverage over the wall face. The results also reveal the impact of both the design and execution of system details, such as the joints between adjacent VIPs. The test results include an explicit modeled evaluation of the system performance in a clear wall.

  12. Two-photon double ionization of H2 at 30 eV using Exterior Complex Scaling

    SciTech Connect (OSTI)

    Morales, Felipe; Martin, Fernando; Horner, Daniel; Rescigno, Thomas N.; McCurdy, C. William

    2009-01-20T23:59:59.000Z

    Calculations of fully differential cross sections for two-photon double ionization of the hydrogen molecule with photons of 30 eV are reported. The results have been obtained by using the method of exterior complex scaling, which allows one to construct essentially exact wave functions that describe thedouble continuum on a large, but finite, volume. The calculated cross sections are compared with those previously obtained by Colgan et al., and discrepancies are found for specific molecular orientations and electron ejection directions.

  13. Symmetrized complex amplitudes for He double photoionization from the time-dependent close coupling and exterior complex scaling methods

    SciTech Connect (OSTI)

    Horner, D.A.; Colgan, J.; Martin, F.; McCurdy, C.W.; Pindzola, M.S.; Rescigno, T.N.

    2004-06-01T23:59:59.000Z

    Symmetrized complex amplitudes for the double photoionization of helium are computed by the time-dependent close-coupling and exterior complex scaling methods, and it is demonstrated that both methods are capable of the direct calculation of these amplitudes. The results are found to be in excellent agreement with each other and in very good agreement with results of other ab initio methods and experiment.

  14. Prediction of sinkage depth of footings on soft marine sediments

    E-Print Network [OSTI]

    Yen, Shihchieh

    1990-01-01T23:59:59.000Z

    Tempsonics Transducer? Channels ? Hgdraulic Actuator I rB I :: Mud Tank::. : Guide Rod- Clamp? ? Ram ? Load Transducer ~ Model Footing Detailed Sketch of B Figure 2. Schematic (Side View) of Displacement Controlled Test Set-up. second... generalized bearing capacity factor, versus Z/B. Typical results are presented in Figures 16, 17, 18, 19, and 20. Plots of all analyzed test data are presented in Appendix I. 41 5 G 4 V/S = IKS V/B = OPS 0 0 Figure 16. Analyzed Data for 1-inch...

  15. A study conducted on laterally loaded cylindrical footings 

    E-Print Network [OSTI]

    Koch, Kenneth Joseph

    1968-01-01T23:59:59.000Z

    studies have also been used to analyze the resistance (g) to overturning. R. C. Rutledge developed a nomograph that can be used to find the depth of embedment necessary to withstand applied loads. The chart is based on the results of a series of full... as compared to the diameters of concrete footings of comparable depth. Full-scale test results have also been reported by F. E. Behn( and by Nelson, Nahoney and Fryrear 10) Theory by Reese L. C. Reese studied the ultimate resistance againsr. a rigid (11...

  16. Prediction of sinkage depth of footings on soft marine sediments 

    E-Print Network [OSTI]

    Yen, Shihchieh

    1990-01-01T23:59:59.000Z

    91. 0 91. 0 91. 2 90. 9 90. 9 90. 9 90. 4 90. 6 90. 3 90. 8 91. 5 91. 4 91. 0 91. 3 Su was determined by a miniature vane rotating at 0. 0143 radians per second 30 Table 4. Soil Properties for 4-inch Diameter Footing Tests V/B Dia.... 7 0. 008 105. 7 34. 7 90. 9 103. 9 40. 0 91. 3 * Su was determined by a miniature vane rotating at 0. 0143 radians per second. one of these tests is shown in Figure 12. In comparison to the dead weight test results (Figure 13), the load versus...

  17. Building America Case Study: Excavationless Exterior-Side Foundation Insulation for Existing Homes, Minneapolis, Minnesota (Fact Sheet)

    SciTech Connect (OSTI)

    NorthernSTAR

    2014-09-01T23:59:59.000Z

    Building science research supports installing exterior (soil side) foundation insulation as the optimal method to enhance the hygrothermal performance of new homes. With exterior foundation insulation, water management strategies are maximized while insulating the basement space and ensuring a more even temperature at the foundation wall. However, such an approach can be very costly and disruptive when applied to an existing home, requiring deep excavation around the entire house. The NorthernSTAR Building America Partnership team implemented an innovative, minimally invasive foundation insulation upgrade technique on an existing home. The approach consisted of using hydrovac excavation technology combined with a liquid insulating foam. The team was able to excavate a continuous 4" wide by 4' to 5' deep trench around the entire house, 128 linear feet, except for one small part under the stoop that was obstructed with concrete debris. The combination pressure washer and vacuum extraction technology also enabled the elimination of large trenches and soil stockpiles normally produced by backhoe excavation. The resulting trench was filled with liquid insulating foam, which also served as a water-control layer of the assembly. The insulation was brought above grade using a liquid foam/rigid foam hybrid system and terminated at the top of the rim joist. Cost savings over the traditional excavation process ranged from 23% to 50%. The excavationless process could result in even greater savings since replacement of building structures, exterior features, utility meters, and landscaping would be minimal or non-existent in an excavationless process.

  18. Photography, Filming, or Video Recording at the NIH The photography, filming, and video recording of the exterior of the NIH facilities, space, and

    E-Print Network [OSTI]

    Baker, Chris I.

    of the exterior of the NIH facilities, space, and portions of building interiors from within the confines the following activities, security equipment, facilities and space, without the written approval of the Director

  19. Proceedings of the ASHRAE/DOE/BTECC Conference, Thermal Performance of the Exterior Envelopes of Buildings VII, Clearwater Beach, Florida, December 7-11, 1998

    E-Print Network [OSTI]

    LBNL-41694 BS-384 Proceedings of the ASHRAE/DOE/BTECC Conference, Thermal Performance of the Exterior Envelopes of Buildings VII, Clearwater Beach, Florida, December 7-11, 1998 This work was supported

  20. Dual Predictive Control of Electrically Stimulated Muscle using Biofeedback for Drop Foot Correction

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    artificially generate action potential in the place of central nervous system (CNS) for inducing muscle) is one of the solutions for drop foot correction. Conventional ES systems deliver prede- fined to adequately dorsiflex or lift the foot. It is associated with a variety of conditions such as stroke, spinal

  1. Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate, Germany

    E-Print Network [OSTI]

    Kammer, Thomas

    Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate.W. 2013: Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate Follmann from the Lower Devonian Hunsruck Slate of Germany. This is the first definitive proof of tube feet

  2. An Ankle-Foot Emulation System for the Study of Human Walking Biomechanics

    E-Print Network [OSTI]

    Herr, Hugh

    and a prosthesis is one of the main obstacles in the development of a biomimetic ankle-foot prosthesis that the emulator may provide a more natural gait than a conventional passive prosthesis. Index Terms ­ Below-knee prosthesis, biomechanics, force control, biomimetic, ankle-foot emulator I. INTRODUCTION Although

  3. An Ankle-Foot Prosthesis Emulator with Control of Plantarflexion and Inversion-Eversion Torques

    E-Print Network [OSTI]

    Collins, Steven H.

    An Ankle-Foot Prosthesis Emulator with Control of Plantarflexion and Inversion-Eversion Torques-foot prosthesis with two independently-actuated toes that are coordinated to provide plantarflexion and inversion prosthesis features. A similar morphology may be effective for autonomous devices. I. INTRODUCTION Robotic

  4. Development of a three-dimensional finite element model of a horse's foot

    E-Print Network [OSTI]

    Hanft, Joseph Thomas

    1995-01-01T23:59:59.000Z

    The horse's foot, defined as the hoof wall and all the structures within it, is subjected to intense load-bearing and energy-absorbing demands. The foot is actually a complex assembly of components that deform as they support loads and absorb energy...

  5. Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing

    E-Print Network [OSTI]

    Fearing, Ron

    Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing Dept- This paper proposes two different nanomolding methods to fabricate synthetic gecko foot-hair nanostructures a nano-pore membrane as a template. These templates are molded with silicone rubber, polyamide

  6. IEEE Robotics & Automation Magazine52 1070-9932/08/$25.002008 IEEE SEPTEMBER 2008 Ankle-Foot Prosthesis

    E-Print Network [OSTI]

    Herr, Hugh

    -Foot Prosthesis T he loss of a limb is a major disability. Unfortunately, today's prosthetic technol- ogy prosthesis [15], [19], [20]. With current actuator technology, it is challenging to build an ankle-foot prosthesis that matches the size and weight of the human ankle-foot complex but still provides sufficient

  7. Summary report on four foot septifoil cooling experiment

    SciTech Connect (OSTI)

    Randolph, H.W.; Collins, S.L.; Verebelyi, D.T.; Foti, D.J.

    1991-10-01T23:59:59.000Z

    Cooling parameters for some of the SRS reactor internal components are computed using the Transient Reactor Analysis Code, TRAC.'' In order to benchmark the code, the Safety Analysis Group of SRL requested an experiment to provide measurements of cooling parameters in a well defined physical system utilizing SRS reactor component(s). The experiment selected included a short length of septifoil with both top and bottom fittings containing five simulated control rods in an unseated'' configuration. Power level to be supplied to the rods was targeted at 2.5 kilowatts per foot. The septifoil segment was to be operated with no forced flow in order to evaluate thermal-hydraulic cooling. Parameters to be measured for comparison with code predictions were basic cooling phenomena, incidence of film boiling, thermal-hydraulic flow rate, pressure rise, and ratio of heat transfer through the wall of the assembly vs heat transfer to axial water flow through the assembly. Experimental apparatus was designed and assembled incorporating five simulated control rods four feet long, joule heated inside a five foot length of type Q'' septifoil. Water at 70 C was fed independently to the bottom inlet and along the outside of the septifoil. Water flowing along the outside of the septifoil was in confined flow and provided calorimetry to measure power flow through the septifoil housing. A shadowgraph technique was developed and used to monitor unforced flow of water pumped thermal-hydraulically through the septifoil. Electrical power of 10,000 to 70,000 watts was fed to the simulated rods from a dc power supply. Computer data acquisition was accomplished using LabView'' software programmed to match the configuration of the experiment along with scanning digital voltmeters and requisite signal sensors. Video camcorders were used to provide video records of six areas of the experiment.

  8. Summary report on four foot septifoil cooling experiment

    SciTech Connect (OSTI)

    Randolph, H.W.; Collins, S.L.; Verebelyi, D.T.; Foti, D.J.

    1991-10-01T23:59:59.000Z

    Cooling parameters for some of the SRS reactor internal components are computed using the Transient Reactor Analysis Code, ``TRAC.`` In order to benchmark the code, the Safety Analysis Group of SRL requested an experiment to provide measurements of cooling parameters in a well defined physical system utilizing SRS reactor component(s). The experiment selected included a short length of septifoil with both top and bottom fittings containing five simulated control rods in an ``unseated`` configuration. Power level to be supplied to the rods was targeted at 2.5 kilowatts per foot. The septifoil segment was to be operated with no forced flow in order to evaluate thermal-hydraulic cooling. Parameters to be measured for comparison with code predictions were basic cooling phenomena, incidence of film boiling, thermal-hydraulic flow rate, pressure rise, and ratio of heat transfer through the wall of the assembly vs heat transfer to axial water flow through the assembly. Experimental apparatus was designed and assembled incorporating five simulated control rods four feet long, joule heated inside a five foot length of type ``Q`` septifoil. Water at 70 C was fed independently to the bottom inlet and along the outside of the septifoil. Water flowing along the outside of the septifoil was in confined flow and provided calorimetry to measure power flow through the septifoil housing. A shadowgraph technique was developed and used to monitor unforced flow of water pumped thermal-hydraulically through the septifoil. Electrical power of 10,000 to 70,000 watts was fed to the simulated rods from a dc power supply. Computer data acquisition was accomplished using ``LabView`` software programmed to match the configuration of the experiment along with scanning digital voltmeters and requisite signal sensors. Video camcorders were used to provide video records of six areas of the experiment.

  9. Two-photon double ionization of H2 at 30 eV using exterior complex scaling

    SciTech Connect (OSTI)

    Horner, Daniel A [Los Alamos National Laboratory; Morales, F [UNIV AUTONOMA DE MADRID; Martin, F [UNIV AUTONOMA DE MADRID; Rescigno, T N [LBNL; Mccurdy, C W [LBNL

    2009-01-01T23:59:59.000Z

    Calculations of fully differential cross sections for two-photon double ionization of the hydrogen molecule with photons of 30 eV are reported. The results have been obtained by using the method of exterior complex scaling, which allows one to construct essentially exact wave functions that describe the double continuum on a large, but finite, volume. The calculated cross sections are compared with those previously obtained by Colgan et al [1], and discrepancies are found for specific molecular orientations and electron ejection directions.

  10. Powered Ankle-Foot Prosthesis for the Improvement of Amputee Samuel K. Au, Hugh Herr, Jeff Weber, and Ernesto C. Martinez-Villalpando

    E-Print Network [OSTI]

    Herr, Hugh

    Powered Ankle-Foot Prosthesis for the Improvement of Amputee Ambulation Samuel K. Au, Hugh Herr, control scheme, and clinical evaluation of a novel, motorized ankle-foot prosthesis, called MIT Powered Ankle-Foot Prosthesis. Unlike a conventional passive-elastic ankle-foot prosthesis, this prosthesis can

  11. Powered ankle-foot prosthesis for the improvement of amputee walking economy

    E-Print Network [OSTI]

    Au, Samuel Kwok-Wai

    2007-01-01T23:59:59.000Z

    The human ankle provides a significant amount of net positive work during the stance period of walking, especially at moderate to fast walking speeds. On the contrary, conventional ankle-foot prostheses are completely ...

  12. Estimation of ground reaction force and zero moment point on a powered ankle-foot prosthesis

    E-Print Network [OSTI]

    Martinez Villalpando, Ernesto Carlos

    2006-01-01T23:59:59.000Z

    Commercially available ankle-foot prostheses are passive when in contact with the ground surface, and thus, their mechanical properties remain fixed across different terrains and walking speeds. The passive nature of these ...

  13. Informing Ankle-Foot Prosthesis Prescription through Haptic Emulation of Candidate Devices

    E-Print Network [OSTI]

    Collins, Steven H.

    Informing Ankle-Foot Prosthesis Prescription through Haptic Emulation of Candidate Devices Joshua M using a haptic prosthesis emulator while their walking performance is quantitatively assessed and results are distilled to inform device prescription. In this emulator system, prosthesis behavior

  14. Control of a Powered Ankle–Foot Prosthesis Based on a Neuromuscular Model

    E-Print Network [OSTI]

    Geyer, Hartmut

    Control schemes for powered ankle-foot prostheses rely upon fixed torque-ankle state relationships obtained from measurements of intact humans walking at target speeds and across known terrains. Although effective at their ...

  15. A neuromuscular-model based control strategy for powered ankle-foot prostheses

    E-Print Network [OSTI]

    Eilenberg, Michael Frederick

    2009-01-01T23:59:59.000Z

    In the development of a powered ankle-foot prosthesis, it is desirable to provide the prosthesis with the ability to exhibit human-like dynamics. A simple method for achieving this goal involves trajectory tracking, where ...

  16. asian foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  17. attenuated foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  18. assess foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  19. Subsurface clade of Geobacteraceae that predominates in a diversity of Fe(III)-reducing subsurface environments

    SciTech Connect (OSTI)

    Holmes, Dawn; O'Neil, Regina; Vrionis, Helen A.; N'guessan, Lucie A.; Ortiz-Bernad, Irene; Larrahondo, Maria J.; Adams, Lorrie A.; Ward, Joy A.; Nicoll, Julie S.; Nevin, Kelly P.; Chavan, Milind A.; Johnson, Jessica P.; Long, Philip E.; Lovely, Derek R.

    2007-12-01T23:59:59.000Z

    There are distinct differences in the physiology of Geobacter species available in pure culture. Therefore, to understand the ecology of Geobacter species in subsurface environments, it is important to know which species predominate. Clone libraries were assembled with 16S rRNA genes and transcripts amplified from three subsurface environments in which Geobacter species are known to be important members of the microbial community: (1) a uranium-contaminated aquifer located in Rifle, CO, USA undergoing in situ bioremediation; (2) an acetate-impacted aquifer that serves as an analog for the long-term acetate amendments proposed for in situ uranium bioremediation and (3) a petroleum-contaminated aquifer in which Geobacter species play a role in the oxidation of aromatic hydrocarbons coupled with the reduction of Fe(III). The majority of Geobacteraceae 16S rRNA sequences found in these environments clustered in a phylogenetically coherent subsurface clade, which also contains a number of Geobacter species isolated from subsurface environments. Concatamers constructed with 43 Geobacter genes amplified from these sites also clustered within this subsurface clade. 16S rRNA transcript and gene sequences in the sediments and groundwater at the Rifle site were highly similar, suggesting that sampling groundwater via monitoring wells can recover the most active Geobacter species. These results suggest that further study of Geobacter species in the subsurface clade is necessary to accurately model the behavior of Geobacter species during subsurface bioremediation of metal and organic contaminants

  20. Evaluation of the Franz System Foot Control in a simulated adaptive tracking task

    E-Print Network [OSTI]

    Raab, Charles

    1982-01-01T23:59:59.000Z

    EVALUATION OF THE FRANZ SYSTEM FOOT CONTROL IN A SIMULATED ADAPTIVE TRACKING TASK A Thesis by CHARLES RAAB Submitted to the Graduate College of Texas ASM University in partial fulfillment of the requirement for the degree of MASTER... OF SCIENCE May 1982 Major Subject: Industrial Engineering EVALUATION OF THE FRANZ SYSTEM FOOT CONTROL IN A SIMULATED ADAPTIVE TRACKING TASK A Thesis by CHARLES RAAB Approved as to style and content by: (Chairman of Com ttee) (Member) (Member...

  1. Energy-Momentum Localization for a Space-Time Geometry Exterior to a Black Hole in the Brane World

    E-Print Network [OSTI]

    Irina Radinschi; Theophanes Grammenos; Andromahi Spanou

    2012-05-20T23:59:59.000Z

    In general relativity one of the most fundamental issues consists in defining a generally acceptable definition for the energy-momentum density. As a consequence, many coordinate-dependent definitions have been presented, whereby some of them utilize appropriate energy-momentum complexes. We investigate the energy-momentum distribution for a metric exterior to a spherically symmetric black hole in the brane world by applying the Landau-Lifshitz and Weinberg prescriptions. In both the aforesaid prescriptions, the energy thus obtained depends on the radial coordinate, the mass of the black hole and a parameter $\\lambda_{0}$, while all the momenta are found to be zero. It is shown that for a special value of the parameter $\\lambda_{0}$, the Schwarzschild space-time geometry is recovered. Some particular and limiting cases are also discussed.

  2. Leray weak solutions of the Incompressible Navier Stokes system on exterior domains via the artificial compressibility method

    E-Print Network [OSTI]

    D. Donatelli; P. Marcati

    2009-02-03T23:59:59.000Z

    In this paper we study the Leray weak solutions of the incompressible Navier Stokes equation in an exterior domain.We describe, in particular, an hyperbolic version of the so called artificial compressibility method investigated by J.L.Lions and Temam. The convergence of these type of approximation show in general a lack of strong convergence due to the presence of acoustic waves. In this paper we face this difficulty by taking care of the dispersive nature of these waves by means of the Strichartz estimates or waves equations satisfied by the pressure. We actually decompose the pressure in different acoustic components, each one of them satisfies a specific initial boundary value problem. The strong convergence analysis of the velocity field will be achieved by using the associated Leray-Hodge decomposition.

  3. The secretion of prolactin (PRL) from pituitary lactotrophs of the rat is predominantly under inhibitory control exerted by

    E-Print Network [OSTI]

    Bertram, Richard

    The secretion of prolactin (PRL) from pituitary lactotrophs of the rat is predominantly under inhibitory control exerted by dopamine (DA) of hypothalamic origin (1). Other PRL-inhibit- ing substances from the Stojilkovic lab (3) and of this report. In addition to the PRL-inhibiting substances, a host

  4. Experimental study on hydrodynamic forces acting on an oscillating column with circular footing

    SciTech Connect (OSTI)

    Hoshino, Kunihiro; Sato, Hiroshi [Ministry of Transport, Mitaka (Japan). Ship Research Inst.

    1994-12-31T23:59:59.000Z

    This paper presents the results of an experimental investigation of the in-line and lift forces acting on an oscillating column with circular footing. Forced surging tests were carried out using a column with circular footing of which ratio of diameter was varied from 1.25 to 2.5. The in-line and lift force have been measured concerning both the whole model and the parts of column and footing. The drag coefficients, inertia coefficients, coefficients of root-mean-square values of the in-line force and lift force coefficients in the range of Keulegan Carpenter number from 5 to 30 have been obtained. Those results have been compared with that of a straight finite length circular cylinder.

  5. Multi-functional foot use during running in the zebra-tailed lizard (Callisaurus draconoides)

    E-Print Network [OSTI]

    Chen Li; S. Tonia Hsieh; Daniel I. Goldman

    2013-03-29T23:59:59.000Z

    A diversity of animals that run on solid, level, flat, non-slip surfaces appear to bounce on their legs; elastic elements in the limbs can store and return energy during each step. The mechanics and energetics of running in natural terrain, particularly on surfaces that can yield and flow under stress, is less understood. The zebra-tailed lizard (Callisaurus draconoides), a small desert generalist with a large, elongate, tendinous hind foot, runs rapidly across a variety of natural substrates. We use high speed video to obtain detailed three-dimensional running kinematics on solid and granular surfaces to reveal how leg, foot, and substrate mechanics contribute to its high locomotor performance. Running at ~10 body length/s (~1 m/s), the center of mass oscillates like a spring-mass system on both substrates, with only 15% reduction in stride length on the granular surface. On the solid surface, a strut-spring model of the hind limb reveals that the hind foot saves about 40% of the mechanical work needed per step, significant for the lizard's small size. On the granular surface, a penetration force model and hypothesized subsurface foot rotation indicates that the hind foot paddles through fluidized granular medium, and that the energy lost per step during irreversible deformation of the substrate does not differ from the reduction in the mechanical energy of the center of mass. The upper hind leg muscles must perform three times as much mechanical work on the granular surface as on the solid surface to compensate for the greater energy lost within the foot and to the substrate.

  6. A study of the design criteria for drilled-and-belled footings

    E-Print Network [OSTI]

    Lehmann, Clark Thomas

    1964-01-01T23:59:59.000Z

    A STUDY OF THE DESIGN CRITERIA FOR DRILLED?AND-BELLED FOOTINGS A Thesis Clark Thomas Lehmann Submitted to the Graduate College of Texas ARM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May, 1964... Major Subject: Civil Engineering A STUDY OF THE DESIGN CRITERIA FOR DRILLED-AND-BELLED FOOTINGS A Thesis By Clark Thomas Lehmann Approved as to style and content by: airman o ommittee Head ep tment Nay, 1964 4 0 0 N F 5 O ACKNOWLEDGMENTS...

  7. IEEE TRANSACTIONS ON ROBOTICS, VOL. 25, NO. 1, FEBRUARY 2009 51 Powered AnkleFoot Prosthesis Improves

    E-Print Network [OSTI]

    Herr, Hugh

    IEEE TRANSACTIONS ON ROBOTICS, VOL. 25, NO. 1, FEBRUARY 2009 51 Powered Ankle­Foot Prosthesis, we evaluate the hypothesis that a powered ankle­foot prosthesis, capa- ble of providing human to a conventional passive-elastic prosthesis. To test the hypothesis, a powered prosthesis is built that comprises

  8. Final report of the decontamination and decommissioning of the exterior land areas at the Grand Junction Projects Office facility

    SciTech Connect (OSTI)

    Widdop, M.R.

    1995-09-01T23:59:59.000Z

    The US Department of Energy (DOE) Grand Junction Projects Office (GJPO) facility occupies approximately 56.4 acres (22.8 hectares) along the Gunnison River near Grand Junction, Colorado. The site was contaminated with uranium ore and mill tailings during uranium-refining activities conducted by the Manhattan Engineer District and during pilot-milling experiments conducted for the US Atomic Energy Commission`s (AEC`s) domestic uranium procurement program. The GJPO facility was the collection and assay point for AEC uranium and vanadium oxide purchases until the early 1970s. The DOE Decontamination and Decommissioning Program sponsored the Grand Junction Projects Office Remedial Action Project (GJPORAP) to remediate the facility lands, site improvements, and the underlying aquifer. The site contractor, Rust Geotech, was the Remedial Action Contractor for GJPORAP. The exterior land areas of the facility assessed as contaminated have been remediated in accordance with identified standards and can be released for unrestricted use. Restoration of the aquifer will be accomplished through the natural flushing action of the aquifer during the next 50 to 80 years. The remediation of the DOE-GJPO facility buildings is ongoing and will be described in a separate report.

  9. IMPEE PhD Opportunity Project title: LightFoot PhD A PhD Investigation Lightning Protection of HV Overhead Lines with Non-Ideal

    E-Print Network [OSTI]

    Greenaway, Alan

    IMPEE PhD Opportunity Project title: LightFoot PhD ­ A PhD Investigation Lightning Protection of HV.swingler@hw.ac.uk Abstract LightFoot PhD ­ A PhD Investigation Lightning Protection of HV Overhead Lines with Non-Ideal Tower Footing Resistance funded by SSE. The LightFoot PhD project takes a fresh approach at adding

  10. Smooth exterior complex-scaling, full-angular-momentum, and three-dimensional finite-element method applied to doubly excited states of helium

    SciTech Connect (OSTI)

    Elander, Nils [Department of Physics, Stockholm University, Alba Nova University Center, SE-106 91 Stockholm (Sweden); Levin, Sergey [Department of Physics, Stockholm University, Alba Nova University Center, SE-106 91 Stockholm (Sweden); Institute for Physics, St. Petersburg University, Uljanovskaya 1, St. Petersburg 198904 (Russian Federation); Institute for Theoretical Atomic and Molecular Physics at Harvard University and Smithsonian Astrophysical Observatory, 60 Garden Street, MS 14 Cambridge, Massachusetts 02138 (United States); Yarevsky, Evgeny [Institute for Physics, St. Petersburg University, Uljanovskaya 1, St. Petersburg 198904 (Russian Federation); International Solvay Institutes for Physics and Chemistry, Case Postale 231, Campus Plaine ULB Boulevard du Triomphe, Brussels 1050 (Belgium)

    2003-06-01T23:59:59.000Z

    A technique based on the total-angular-momentum representation the smooth exterior complex-scaling procedure, and the three-dimensional finite-element method, is applied to calculations of S, P, and D resonant, so-called doubly excited, states of the helium atom. The resonances are calculated with an accuracy better than 10{sup -5} a.u. The applicability of an extrapolation procedure to complex energies is analyzed.

  11. Driving Low-Power Wearable Systems with an Adaptively-Controlled Foot-Strike Scavenging Platform

    E-Print Network [OSTI]

    Potkonjak, Miodrag

    as a means to scavenge energy from foot-strikes and power wearable systems. While they exhibit large energy densities, DEs must be closely controlled to maximize the energy they transduce. Towards this end, we propose a DE micro-generator array configuration that enhances transduc- tion efficiency, and the use

  12. Flat-Foot Dynamic Walking via Human-Inspired Controller Design

    E-Print Network [OSTI]

    Ma, Wenlong

    2014-05-05T23:59:59.000Z

    This thesis describes a torque control scheme unifying feedback PD control and feed-forward impedance control to realize human-inspired walking on a novel planar footed bipedal robot: AMBER2. It starts with high fidelity modeling of the robot...

  13. A study of factors affecting foot movement time in a braking maneuver

    E-Print Network [OSTI]

    Berman, Andrea Helene

    1994-01-01T23:59:59.000Z

    The nature of foot movement time (MT) in an actual braking maneuver and in a stationary vehicle was investigated regarding the effects of age and gender of the driver and nature of the stimulus to which the driver was responding. ANOVAs showed...

  14. The high-foot implosion campaign on the National Ignition Facility

    SciTech Connect (OSTI)

    Hurricane, O. A., E-mail: hurricane1@llnl.gov; Callahan, D. A.; Casey, D. T.; Dewald, E. L.; Dittrich, T. R.; Döppner, T.; Barrios Garcia, M. A.; Hinkel, D. E.; Berzak Hopkins, L. F.; Kervin, P.; Pape, S. Le; Ma, T.; MacPhee, A. G.; Milovich, J. L.; Moody, J.; Pak, A. E.; Patel, P. K.; Park, H.-S.; Remington, B. A.; Robey, H. F. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); and others

    2014-05-15T23:59:59.000Z

    The “High-Foot” platform manipulates the laser pulse-shape coming from the National Ignition Facility laser to create an indirect drive 3-shock implosion that is significantly more robust against instability growth involving the ablator and also modestly reduces implosion convergence ratio. This strategy gives up on theoretical high-gain in an inertial confinement fusion implosion in order to obtain better control of the implosion and bring experimental performance in-line with calculated performance, yet keeps the absolute capsule performance relatively high. In this paper, we will cover the various experimental and theoretical motivations for the high-foot drive as well as cover the experimental results that have come out of the high-foot experimental campaign. At the time of this writing, the high-foot implosion has demonstrated record total deuterium-tritium yields (9.3×10{sup 15}) with low levels of inferred mix, excellent agreement with implosion simulations, fuel energy gains exceeding unity, and evidence for the “bootstrapping” associated with alpha-particle self-heating.

  15. Multiphoton above-threshold detachment of Li-: Exterior-complex-scaling– generalized-pseudospectral method for calculations of complex-quasienergy resonances in Floquet formulation of time-dependent density-functional theory

    E-Print Network [OSTI]

    Telnov, Dmitry A.; Chu, Shih-I

    2002-10-25T23:59:59.000Z

    We extend the exterior-complex-scaling–generalized-pseudospectral (ECSGPS) method [D. A. Telnov and S. I. Chu, Phys. Rev. A 59, 2864 (1999)] to the nonperturbative calculations of complex-quasienergy resonances of many-electron quantum systems...

  16. Active exterior cloaking

    E-Print Network [OSTI]

    2012-06-18T23:59:59.000Z

    Jun 18, 2012 ... Schurig, Smith; Greenleaf, Kurylev, Lassas, Uhlmann; Farhat,. Enoch ... Complementary media: Lai, Chen, Zhang, Chan. • Plasmonic cloaking: ...

  17. Comparative Cost Analysis of Alternative Animal Tracing Strategies Directed Toward Foot and Mouth Disease Outbreaks in the Texas High Plains

    E-Print Network [OSTI]

    Looney, John C.

    2010-07-14T23:59:59.000Z

    The primary objective of this study is to evaluate the industry impact of a hypothetical Foot and Mouth Disease (FMD) outbreak in the Texas High Plains using alternative animal tracing levels. To accomplish this objective, an epidemiological disease...

  18. Development of the Robotic Touch foot Sensor for 2D walking Robot, for Studying Rough Terrain Locomotion

    E-Print Network [OSTI]

    Lee, Hunwoo

    2012-08-31T23:59:59.000Z

    Development of the Robotic Touch foot Sensor for 2D walking Robot, for Studying Rough Terrain Locomotion By HUNWOO LEE Submitted to the graduate degree program in Mechanical Engineering and the Graduate Faculty of the University of Kansas... ________________________________ Professor Robert Umholtz Date Defended: June 5, 2012 ii The Thesis Committee for HUNWOO LEE certifies that this is the approved version of the following thesis: Development of the Robotic Touch Foot Sensor for 2D Walking Robot...

  19. Stud Walls With Continuous Exterior Insulation for Factory Built Housing: New York, New York (Fact Sheet), NREL (National Renewable Energy Laboratory)

    SciTech Connect (OSTI)

    Not Available

    2014-01-01T23:59:59.000Z

    The Advanced Envelope Research effort will provide factory homebuilders with high performance, cost-effective alternative envelope designs. In the near term, these technologies will play a central role in meeting stringent energy code requirements. For manufactured homes, the thermal requirements, last updated by statute in 1994, will move up to the more rigorous IECC 2012 levels in 2013, the requirements of which are consistent with site built and modular housing. This places added urgency on identifying envelope technologies that the industry can implement in the short timeframe. The primary goal of this research is to develop wall designs that meet the thermal requirements based on 2012 IECC standards. Given the affordable nature of manufactured homes, impact on first cost is a major consideration in developing the new envelope technologies. This work is part of a four-phase, multi-year effort. Phase 1 identified seven envelope technologies and provided a preliminary assessment of three selected methods for building high performance wall systems. Phase 2 focused on the development of viable product designs, manufacturing strategies, addressing code and structural issues, and cost analysis of the three selected options. An industry advisory committee helped critique and select the most viable solution to move further in the research - stud walls with continuous exterior insulation. Phase 3, the subject of the current report, focused on the design development of the selected wall concept and explored variations on the use of exterior foam insulation. The scope also included material selection, manufacturing and cost analysis, and prototyping and testing.

  20. To enter and lead: renegotiating meanings of leadership and examining leadership theory of social power from the perspectives of African American women leaders in predominantly white organizations

    E-Print Network [OSTI]

    Byrd, Marilyn Yvonne

    2009-05-15T23:59:59.000Z

    This qualitative, phenomenological study examined the leadership experiences of 10 African American women (AAW)--current or former leaders in predominantly white organizations--to gain an understanding of how well, or not, AAW?s leadership...

  1. Three-Dimensional Rotational Angiography of the Foot in Critical Limb Ischemia: A New Dimension in Revascularization Strategy

    SciTech Connect (OSTI)

    Jens, Sjoerd, E-mail: s.jens@amc.uva.nl [Academic Medical Center, Department of Radiology (Netherlands); Lucatelli, Pierleone, E-mail: pierleone.lucatelli@gmail.com ['Sapienza' University of Rome, Vascular and Interventional Radiology Unit, Department of Radiological Sciences (Italy); Koelemay, Mark J. W., E-mail: m.j.koelemaij@amc.uva.nl [Academic Medical Center, Department of Surgery (Netherlands); Marquering, Henk A., E-mail: h.a.marquering@amc.uva.nl; Reekers, Jim A., E-mail: j.a.reekers@amc.uva.nl [Academic Medical Center, Department of Radiology (Netherlands)

    2013-06-15T23:59:59.000Z

    Purpose. To evaluate the additional value of three-dimensional rotational angiography (3DRA) of the foot compared with digital subtraction angiography (DSA) in patients with critical limb ischemia (CLI). Technique. For 3DRA, the C-arm was placed in the propeller position with the foot in an isocentric position. The patient's unaffected foot was positioned in a footrest outside the field of view. For correct timing of 3DRA, the delay from contrast injection in the popliteal artery at the level of knee joint to complete pedal arterial enhancement was assessed using DSA. With this delay, 3DRA was started after injection of 15 ml contrast. Imaging of the 3DRA could directly be reconstructed and visualized.Materials and MethodsPatients undergoing 3DRA of the foot were prospectively registered. DSA and 3DRA images were scored separately for arterial patency and presence of collaterals. Treatment strategies were proposed based on DSA with and without the availability of 3DRA. Results. Eleven patients underwent 3DRA of the foot. One 3DRA was not included because the acquisition was focused on the heel instead of the entire foot. Diagnostic quality of 3DRA was good in all ten patients. 3DRA compared with DSA showed additional patent arteries in six patients, patent plantar arch in three patients, and collaterals between the pedal arteries in five patients. Additional information from 3DRA resulted in a change of treatment strategy in six patients. Conclusion, 3DRA of the foot contains valuable additional real-time information to better guide peripheral vascular interventions in patients with CLI and nonhealing tissue lesions.

  2. Impact of a 1,000-foot thermal mixing zone on the steam electric power industry

    SciTech Connect (OSTI)

    Veil, J.A.

    1994-04-01T23:59:59.000Z

    Thermal discharge requirements for power plants using once-through cooling systems are based on state water quality standards for temperatures that must be met outside of designated mixing zones. This study evaluates the impact of limiting the extent of thermal mixing zones. This study evaluates the impact of limiting the extent of thermal mixing zones to no more than 1,000 feet from the discharge point. Data were collected from 79 steam electric plants. Of the plants currently using once-through cooling systems, 74% could not meet current thermal standards at the edge of a 1,000-foot mixing zone. Of this total, 68% would retrofit cooling towers, and 6% would retrofit diffusers. The estimated nationwide capital cost for retrofitting plants that could not meet current thermal standards at the edge of a 1,000-foot mixing zone is $21.4 billion. Conversion of a plant from once-through cooling to cooling towers or addition of diffusers would result in a lower energy output from that plant. For the affected plants, the total estimated replacement cost would be $370 to $590 million per year. Some power companies would have to construct new generating capacity to meet the increased energy demand. The estimated nationwide cost of this additional capacity would be $1.2 to $4.8 billion. In addition to the direct costs associated with compliance with a 1,000-foot mixing zone limit, other secondary environmental impacts would also occur. Generation of the additional power needed would increase carbon dioxide emissions by an estimated 8.3 million tons per year. In addition, conversion from once-through cooling systems to cooling towers at affected plants would result in increased evaporation of about 2.7 million gallons of water per minute nationwide.

  3. Foot Drop after Ethanol Embolization of Calf Vascular Malformation: A Lesson on Nerve Injury

    SciTech Connect (OSTI)

    Tay, Vincent Khwee-Soon, E-mail: vincentkstay@gmail.com [Singapore General Hospital, Department of Plastic, Reconstructive, and Aesthetic Surgery (Singapore); Mohan, P. Chandra, E-mail: chandra.mohan@sgh.com.sg [Singapore General Hospital, Department of Diagnostic Radiology (Singapore); Liew, Wendy Kein Meng, E-mail: wendy.liew.km@kkh.com.sg [KK Women's and Children's Hospital, Department of Paediatrics (Neurology Service) (Singapore); Mahadev, Arjandas, E-mail: arjandas.mahadev@kkh.com.sg [KK Women's and Children's Hospital, Department of Orthopaedic Surgery (Singapore); Tay, Kiang Hiong, E-mail: tay.kiang.hiong@sgh.com.sg [Singapore General Hospital, Department of Diagnostic Radiology (Singapore)

    2013-08-01T23:59:59.000Z

    Ethanol is often used in sclerotherapy to treat vascular malformations. Nerve injury is a known complication of this procedure. However, the management of this complication is not well described in literature. This case describes a 10-year-old boy with a slow flow vascular malformation in the right calf who underwent transarterial ethanol embolization following prior unsuccessful direct percutaneous sclerotherapy. The development of a dense foot drop that subsequently recovered is described, and the management of this uncommon but distressful complication is discussed.

  4. Table 6a. Total Electricity Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet)4. U.S. Vehicle FuelFoot,

  5. Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

    SciTech Connect (OSTI)

    Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

    2007-06-26T23:59:59.000Z

    A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

  6. Proceedings of the 2007 IEEE 10th International Conference on Rehabilitation Robotics, June 12-15, Noordwijk, The Netherlands Biomechanical Design of a Powered Ankle-Foot Prosthesis

    E-Print Network [OSTI]

    Herr, Hugh

    -15, Noordwijk, The Netherlands Biomechanical Design of a Powered Ankle-Foot Prosthesis Samuel K. Au, Jeff Weber, and Hugh Herr Abstract-Although the potential benefits of a powered ankle- foot prosthesis have been well documented, no one has suc- cessfully developed and verified that such a prosthesis can improve amputee gait

  7. Foot & Mouth Disease & Ulcerative/Vesicular Rule-outs: Challenges Encountered in Recent Outbreaks

    SciTech Connect (OSTI)

    Hullinger, P

    2008-01-28T23:59:59.000Z

    Foot and mouth disease (FMD) is a highly infectious and contagious viral disease affecting bovidae (cattle, zebus, domestic buffaloes, yaks), sheep, goats, swine, all wild ruminants and suidae. Camelidae (camels, dromedaries, llamas, vicunas) have low susceptibility. Foot and mouth disease is caused by a RNS virus of the family Picornaviridae, genus Aphthovirus. There are seven immunologically distinct serotypes: A, O, C, SAT1, SAT2, SAT3, Asia 1. Foot and mouth disease causes significant economic loss both to countries who manage it as an endemic disease (with or without vaccination), as well as those FMD free countries which may become infected. The mortality rate is low in adult animals, but often higher in young due to myocarditis. Foot and mouth disease is endemic in parts of Asia, Africa, the Middle East and South America (sporadic outbreaks in free areas). The Office of International Epizootics (OIE), also referred to the World Organization for Animal Health maintains an official list of free countries and zones.1 The OIE Terrestrial Code (Chapter 2.2.10) provides detailed information on the categories of freedom that can be allocated to a country as well as guidelines for the surveillance for foot and mouth disease (Appendix 3.8.7). In short, countries may be completely free of FMD, free with vaccination or infected with foot and mouth disease virus (FMDV). Source of FMDV include incubating and clinically affected animals with virus present in breath, saliva, faeces, urine, milk and semen. In experimental settings virus has been detected in milk several days before the onset of clinical signs2. Additional sources of virus are meat and by-products in which pH has remained above 6.0 as well as persistently infected carrier animals. Carrier animals may include cattle and water buffalo; convalescent animals and exposed vaccinates (virus persists in the oropharynx for up to 30 months in cattle or longer in buffalo, 9 months in sheep). Pigs do not become carriers. It has been shown that the African Cape buffalo are the major maintenance host of SAT serotypes. FMDV transmission can occur by either direct or indirect contact. Indirect transmission can occur via contaminated animate vectors (humans, etc.), inanimate vectors (vehicles, implements) or airborne transmission. Indirect disease transmission via animate or inanimate vectors can play a major role in disease transmission. Good biosecurity can significantly reduce this type of transmission. Airborne transmission is often debated and is known to be serotype and species specific as well as require specific environmental conditions to occur. Airborne transmission is favored in temperate zones and has been postulated to occur over distances of up to 60 km overland and 300 km by sea. Foot and mouth disease virus is an unenveloped virus which is preserved by refrigeration and freezing and progressively inactivated by temperatures above 50 C. FMDV is highly sensitive to pH change and is inactivated by pH < 6.0 or > 9.0. There are many disinfectants which are effective against FMDV including sodium hydroxide (2%), sodium carbonate (4%), and citric acid (0.2%). FMDV is resistant to iodophores, quaternary ammonium compounds, hypochlorite and phenol, especially in the presence of organic matter. The virus can survive in lymph nodes and bone marrow at neutral pH, but is destroyed in muscle when is pH < 6.0 i.e. after rigor mortis. FMDV can persist in contaminated feed/commodities and the environment for over to 1 month, depending on the temperature and pH conditions. The incubation period for FMD is 2-14 days. Animals transition through latent (infected but not infectious), subclinically infected (infectious but lacking clinical signs) clinically infected and recovered disease states. In cattle clinical signs include pyrexia, reluctance to eat, bruxism, drooling, lameness, treading or stamping of the feet and decreased milk production. Most clinical signs are related to the development and subsequent rupturing of vesicles at the coronary band and in the oral cavity. V

  8. Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe Abstract-- Electric powered vehicles use energy stored in some form of battery for the vehicle of electric vehicles through on-road testing, user led trials and the analysis of the data collected from

  9. Uranium-238, Thorium-230, and Radium-226 are the predominant radioactive contaminents on Formerly Utilized Sites Remedial Action Plan (FUSRAP) sites.

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Uranium-238, Thorium-230, and Radium-226 are the predominant radioactive contaminents on Formerly of time. Uranium-238 decays by alpha emission into thorium-234, which itself decays by beta emission-life* thorium-234 24.1 days protactinium-234m 1.17 minutes uranium-234 244,000 years radon-222 3.82 days

  10. | 128 | haematologica/the hematology journal | 2008; 93(1) 18-F FDG-PET in the staging of lymphocyte-predominant

    E-Print Network [OSTI]

    Boyer, Edmond

    in the staging of LPHD. Key words: 18F FDG-PET, FDG-PET/CT, lymphocyte-predominant Hodgkin's disease, staging| 128 | haematologica/the hematology journal | 2008; 93(1) 18-F FDG-PET in the staging retrospectively the usefulness of 18 F-FDG-PET in the staging of 31 patients with lymphocyte-predomi- nant Hodgkin

  11. Jordan Boyd-Graber and David M. Blei. PUTOP: Turning Predominant Senses into a Topic Model for WSD. 4th International Workshop on Semantic Evaluations, 2007.

    E-Print Network [OSTI]

    Boyd-Graber, Jordan

    Jordan Boyd-Graber and David M. Blei. PUTOP: Turning Predominant Senses into a Topic Model for WSD. 4th International Workshop on Semantic Evaluations, 2007. @inproceedings{Boyd-Graber:Blei-2007, Author = {Jordan Boyd-Graber and David M. Blei}, Booktitle = {4th International Workshop on Semantic

  12. Stem cubic-foot volume tables for tree species in the piedmont. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 16 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Piedmont. Tables are based on form class measurement data for 2,753 trees sampled in the Piedmont and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  13. Fuel economy testing of six 40-foot transit buses. Final report Aug 82-Mar 83

    SciTech Connect (OSTI)

    Francis, G.A.; Nelson, S.R.

    1983-03-01T23:59:59.000Z

    The importance of life-cycle cost analyses in transit bus procurement is recognized by the industry and has been a Congressional requirement for grantees. This report documents a program of fuel economy testing of six standard 40-foot buses. The main purpose of this series of tests is to assist transit authorities and bus suppliers by providing accurate comparable fuel consumption data on transit buses produced by different manufacturers. Six buses were selected by the manufacturers and supplied for testing by six transit properties directly from revenue service. This report makes the data available to the industry for discretionary use in estimating life-cycle costs. A list of bus manufacturers and the supplying transit system is provided.

  14. The performance check between whole building thermal performance criteria and exterior wall measured clear wall R-value, thermal bridging, thermal mass, and airtightness

    SciTech Connect (OSTI)

    Kosny, J.; Christian, J.E.; Desjarlais, A.O. [Oak Ridge National Lab., TN (United States). Buildings Technology Center; Kossecka, E. [Polish Academy of Sciences (Poland); Berrenberg, L. [American Polysteel Forms (United States)

    1998-06-01T23:59:59.000Z

    At the last IEA Annex 32 meeting it was proposed that the annex develop the links between level 1 (the whole building performance) and level 2 (the envelope system). This paper provides a case study of just that type of connection. An exterior wall mockup is hot box tested and modeled in the laboratory. Measurements of the steady state and dynamic behavior of this mockup are used as the basis to define the thermal bridging, thermal mass benefit and air tightness of the whole wall system. These level two performance characteristics are related to the whole building performance. They can be analyzed by a finite difference modeling of the wall assembly. An equivalent wall theory is used to convert three dimensional heat flow to one dimensional terms that capture thermal mass effects, which in turn are used in a common whole building simulation model. This paper illustrates a performance check between the thermal performance of a Massive ICF (Insulating Concrete Form) wall system mocked up (level 2) and Whole Building Performance criteria (level 1) such as total space heating and cooling loads (thermal comfort).

  15. Evaluation of Multiplexed Foot-and-Mouth Disease Nonstructural Protein Antibody Assay Against Standardized Bovine Serum Panel

    SciTech Connect (OSTI)

    Perkins, J; Parida, S; Clavijo, A

    2007-05-14T23:59:59.000Z

    Liquid array technology has previously been used to show proof-of-principle of a multiplexed non structural protein serological assay to differentiate foot-and-mouth infected and vaccinated animals. The current multiplexed assay consists of synthetically produced peptide signatures 3A, 3B and 3D and recombinant protein signature 3ABC in combination with four controls. To determine diagnostic specificity of each signature in the multiplex, the assay was evaluated against a naive population (n = 104) and a vaccinated population (n = 94). Subsequently, the multiplexed assay was assessed using a panel of bovine sera generated by the World Reference Laboratory for foot-and-mouth disease in Pirbright, UK. This sera panel has been used to assess the performance of other singleplex ELISA-based non-structural protein antibody assays. The 3ABC signature in the multiplexed assay showed comparative performance to a commercially available non-structural protein 3ABC ELISA (Cedi test{reg_sign}) and additional information pertaining to the relative diagnostic sensitivity of each signature in the multiplex is acquired in one experiment. The encouraging results of the evaluation of the multiplexed assay against a panel of diagnostically relevant samples promotes further assay development and optimization to generate an assay for routine use in foot-and-mouth disease surveillance.

  16. Higher velocity, high-foot implosions on the National Ignition Facility laser

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Callahan, D. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000315498916); Hurricane, O. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hinkel, D. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Döppner, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ma, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Park, H. -S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Barrios Garcia, M. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Berzak Hopkins, L. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000291875667); Casey, D. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Cerjan, C. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000251686845); Dewald, E. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dittrich, T. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Edwards, M. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haan, S. W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000184045131); Hamza, A. V. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kline, J. L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Knauer, J. P. [Univ. of Rochester, NY (United States); Kritcher, A. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Landen, O. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); LePape, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); MacPhee, A. G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000341604479); Milovich, J. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Nikroo, A. [General Atomics, San Diego, CA (United States)] (ORCID:0000000288550378); Pak, A. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Patel, P. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rygg, J. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ralph, J. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Salmonson, J. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Spears, B. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Springer, P. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tommasini, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benedetti, L. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bionta, R. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bond, E. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bradley, D. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Caggiano, J. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Field, J. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Fittinghoff, D. N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Frenje, J. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States)] (ORCID:0000000168460378); Gatu Johnson, M. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States); Grim, G. P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hatarik, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Merrill, F. E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Nagel, S. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000277686819); Izumi, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Khan, S. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-05-01T23:59:59.000Z

    By increasing the velocity in “high foot” implosions [Dittrich et al., Phys. Rev. Lett. 112, 055002 (2014); Park et al., Phys. Rev. Lett. 112, 055001 (2014); Hurricane et al., Nature 506, 343 (2014); Hurricane et al., Phys. Plasmas 21, 056314 (2014)] on the National Ignition Facility laser, we have nearly doubled the neutron yield and the hotspot pressure as compared to the implosions reported upon last year. The implosion velocity has been increased using a combination of the laser (higher power and energy), the hohlraum (depleted uranium wall material with higher opacity and lower specific heat than gold hohlraums), and the capsule (thinner capsules with less mass). We find that the neutron yield from these experiments scales systematically with a velocity-like parameter of the square root of the laser energy divided by the ablator mass. By connecting this parameter with the inferred implosion velocity (v), we find that for shots with primary yield >1e15 neutrons, the total yield ~ v???. This increase is considerably faster than the expected dependence for implosions without alpha heating ( ~v???) and is additional evidence that these experiments have significant alpha heating.

  17. Higher velocity, high-foot implosions on the National Ignition Facility laser

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Callahan, D. A.; Hurricane, O. A.; Hinkel, D. E.; Döppner, T.; Ma, T.; Park, H. -S.; Barrios Garcia, M. A.; Berzak Hopkins, L. F.; Casey, D. T.; Cerjan, C. J.; et al

    2015-05-01T23:59:59.000Z

    By increasing the velocity in “high foot” implosions [Dittrich et al., Phys. Rev. Lett. 112, 055002 (2014); Park et al., Phys. Rev. Lett. 112, 055001 (2014); Hurricane et al., Nature 506, 343 (2014); Hurricane et al., Phys. Plasmas 21, 056314 (2014)] on the National Ignition Facility laser, we have nearly doubled the neutron yield and the hotspot pressure as compared to the implosions reported upon last year. The implosion velocity has been increased using a combination of the laser (higher power and energy), the hohlraum (depleted uranium wall material with higher opacity and lower specific heat than gold hohlraums), andmore »the capsule (thinner capsules with less mass). We find that the neutron yield from these experiments scales systematically with a velocity-like parameter of the square root of the laser energy divided by the ablator mass. By connecting this parameter with the inferred implosion velocity (v), we find that for shots with primary yield >1e15 neutrons, the total yield ~ v???. This increase is considerably faster than the expected dependence for implosions without alpha heating ( ~v???) and is additional evidence that these experiments have significant alpha heating.« less

  18. Simulation and analysis of the plutonium shipping container subject to 30-foot drops

    SciTech Connect (OSTI)

    Gong, C.; Gupta, N.K.; Gromada, R.J. [Westinghouse Savannah River Co., Aiken, SC (United States). Savannah River Technology Center

    1995-12-31T23:59:59.000Z

    The shipping container 5320 is a shipping package for radioactive materials. In order to maintain the component in this packaging within the sub-critical state when subjected to any kind of Hypothetical Accident conditions (HAC), this Type B packaging is designed with various impact limiters. The present study is to examine the energy absorbing capacity of the impact limiter design of this container subjected to a 30-foot drop onto a flat unyielding horizontal surface in each of the three critical dropping orientations. This paper presents the results of a three dimensional nonlinear dynamic impact analysis. This analysis shows the deformed configuration of the container caused by the impact and also determines the effects of different stress wave paths in three distinct drops on the stress states in the critical component. The solution to the problem was obtained using the ABAQUS (explicit) finite element computer code. The nonlinearity of this analysis involves large structural deformation, elasto-plastic materials with strain hardening as well as multiple contact interfaces. Three drop orientations were studied, namely, top down impact, bottom down impact and side impact. Results will be compared against actual drop test data.

  19. Modeling Estimated Personnel Needs for a Potential Foot and Mouth Disease Outbreak

    SciTech Connect (OSTI)

    Simmons, K; Hullinger, P

    2008-01-29T23:59:59.000Z

    Foot and Mouth disease (FMD) is a highly infectious and contagious viral disease affecting cloven-hoofed livestock that was last detected in the United States (US) in 1929. The prevalence of FMD in other countries, as well as the current potential for this virus to be used as a form of agroterrorism, has made preparations for a potential FMD outbreak a national priority. To assist in the evaluation of national preparedness, all 50 states were surveyed via e-mail, telephone and web search to obtain emergency response plans for FMD or for foreign animal diseases in general. Information from 33 states was obtained and analyzed for estimates of personnel resources needed to respond to an outbreak. These estimates were consolidated and enhanced to create a tool that could be used by individual states to better understand the personnel that would be needed to complete various tasks over time during an outbreak response. The estimates were then coupled, post-processing, to the output from FMD outbreaks simulated in California using the Multiscale Epidemiological/Economic Simulation and Analysis (MESA) model at Lawrence Livermore National Laboratory to estimate the personnel resource demands, by task, over the course of an outbreak response.

  20. Exterior Wall Strategies with Exterior Insulating Sheathing- Cold Climate

    Broader source: Energy.gov [DOE]

    This presentation was given at the Summer 2012 DOE Building America meeting on July 25, 2012, and addressed the question How do we first do no harm with high-r enclosures??

  1. Predominant Occupation of the Class I MHC Molecule H-2Kwm7 with a Single Self-peptide Suggests a Mechanism for its Diabetes-protective Effect

    SciTech Connect (OSTI)

    Brims, D.; Qian, J; Jarchum, I; Mikesh, L; Palmieri, E; Ramagopal, U; Malashkevich, V; Chaparro, R; Lund, T; et. al.

    2010-01-01T23:59:59.000Z

    Type 1 diabetes (T1D) is an autoimmune disease characterized by T cell-mediated destruction of insulin-producing pancreatic {beta} cells. In both humans and the non-obese diabetic (NOD) mouse model of T1D, class II MHC alleles are the primary determinant of disease susceptibility. However, class I MHC genes also influence risk. These findings are consistent with the requirement for both CD{sup 4+} and CD{sup 8+} T cells in the pathogenesis of T1D. Although a large body of work has permitted the identification of multiple mechanisms to explain the diabetes-protective effect of particular class II MHC alleles, studies examining the protective influence of class I alleles are lacking. Here, we explored this question by performing biochemical and structural analyses of the murine class I MHC molecule H-2K{sup wm7}, which exerts a diabetes-protective effect in NOD mice. We have found that H-2K{sup wm7} molecules are predominantly occupied by the single self-peptide VNDIFERI, derived from the ubiquitous protein histone H2B. This unexpected finding suggests that the inability of H-2K{sup wm7} to support T1D development could be due, at least in part, to the failure of peptides from critical {beta}-cell antigens to adequately compete for binding and be presented to T cells. Predominant presentation of a single peptide would also be expected to influence T-cell selection, potentially leading to a reduced ability to select a diabetogenic CD{sup 8+} T-cell repertoire. The report that one of the predominant peptides bound by T1D-protective HLA-A*31 is histone derived suggests the potential translation of our findings to human diabetes-protective class I MHC molecules.

  2. Covered Product Category: Exterior Lighting

    Broader source: Energy.gov [DOE]

    The Federal Energy Management Program (FEMP) provides acquisition guidance and Federal efficiency requirements for outdoor wall-mounted light fixtures or luminaires, outdoor pole/arm-mounted area and roadway luminaires, outdoor pole/arm-mounted decorative luminaires, fuel pump canopy luminaires, bollards, and parking garage luminaires, all of which are FEMP-designated product categories.

  3. Managing nuclear predominant generating capacity

    SciTech Connect (OSTI)

    Bouget, Y.H.; Herbin, H.C.; Carbonnier, D.

    1998-07-01T23:59:59.000Z

    The most common belief, associated with nuclear power plant, leads to the conclusion that it can only operate, as a base load plant. This observation can be reversed, by just looking at large generating capacity, using an important nuclear generation mix. Nuclear plants may certainly load follow and contribute to the grid frequency control. The French example illustrates these possibilities. The reactor control of French units has been customized to accommodate the grid requests. Managing such a large nuclear plant fleet requires various actions be taken, ranging from a daily to a multi-annual perspective. The paper describes the various contributions leading to safe, reliable, well accepted and cost competitive nuclear plants in France. The combination of all aspects related to operations, maintenance scheduling, nuclear safety management, are presented. The use of PWR units carries considerable weight in economic terms, with several hundred million francs tied in with outage scheduling every year. This necessitates a global view of the entire generating system which can be mobilized to meet demand. There is considerable interaction between units as, on the one hand, they are competing to satisfy the same need, and, on the other hand, reducing maintenance costs means sharing the necessary resources, and thus a coordinated staggering of outages. In addition, nuclear fuel is an energy reserve which remains in the reactor for 3 or 4 years, with some of the fuel renewed each year. Due to the memory effect, the fuel retains a memory of past use, so that today's choices impact upon the future. A medium-term view of fuel management is also necessary.

  4. Injection of electrons with predominantly perpendicular energy into an area of toroidal field ripple in a tokamak plasma to improve plasma confinement

    DOE Patents [OSTI]

    Ono, Masayuki (Princeton Junction, NJ); Furth, Harold (Princeton, NJ)

    1993-01-01T23:59:59.000Z

    An electron injection scheme for controlling transport in a tokamak plasma. Electrons with predominantly perpendicular energy are injected into a ripple field region created by a group of localized poloidal field bending magnets. The trapped electrons then grad-B drift vertically toward the plasma interior until they are detrapped, charging the plasma negative. Calculations indicate that the highly perpendicular velocity electrons can remain stable against kinetic instabilities in the regime of interest for tokamak experiments. The penetration distance can be controlled by controlling the "ripple mirror ratio", the energy of the injected electrons, and their v.sub..perp. /v.sub.51 ratio. In this scheme, the poloidal torque due to the injected radial current is taken by the magnets and not by the plasma. Injection is accomplished by the flat cathode containing an ECH cavity to pump electrons to high v.sub..perp..

  5. The Relationship Between Principal Ethnicity and Other Chosen Demographics and Student Achievement as Measured by the Texas Education Agency's Accountability Rating System in Predominantly Hispanic Public High Schools in Texas

    E-Print Network [OSTI]

    Tresslar, Christopher A.

    2010-07-14T23:59:59.000Z

    ) and student achievement as measured by the Texas Education Agency?s (TEA?s) accountability rating system in predominantly Hispanic public high schools in Texas. The study sought to identify causal factors in relation to campus accountability rating...

  6. 164 IEEE TRANSACTIONS ON NEURAL SYSTEMS AND REHABILITATION ENGINEERING, VOL. 18, NO. 2, APRIL 2010 Control of a Powered AnkleFoot Prosthesis

    E-Print Network [OSTI]

    Geyer, Hartmut

    Control of a Powered Ankle­Foot Prosthesis Based on a Neuromuscular Model Michael F. Eilenberg, Hartmut the difficulties of explicit terrain sensing. Specifically, the energy provided by the prosthesis was directly--Neuromuscular model, powered prosthesis, pros- thesis control, terrain adaptation. I. INTRODUCTION TODAY

  7. The potential role of wildlife in the spread and control of foot and mouth disease in an extensive livestock management system

    E-Print Network [OSTI]

    Highfield, Linda

    2009-05-15T23:59:59.000Z

    Foot and mouth disease (FMD) is a highly contagious viral infection that affects all Artiodactyls (cloven-hoofed) species. The United States has been free of FMD since 1929, and the entire population of cloven-hoofed species is therefore susceptible...

  8. Stem cubic-foot volume tables for tree species in the upper coastal plain. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 11 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Upper Coastal Plain. Tables are based on form class measurement data for 521 trees sampled in the Upper Coastal Plain and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  9. Stem cubic-foot volume tables for tree species in the Appalachian area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 20 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Appalachian Area. Tables are based on form class measurement data for 2,670 trees sampled in the Appalachian Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  10. Stem cubic-foot volume tables for tree species in the Gulf and Atlantic coastal plain. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 14 species and 9 species groups based on equations used to estimate timber sale volumes on national forests in the Gulf and Atlantic Coastal Plain. Tables are based on form class measurement data for 2,728 trees sampled in the Gulf and Atlantic Coastal Plain and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  11. Stem cubic-foot volume tables for tree species in the Arkansas area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 9 species and 9 species groups based on equations used to estimate timber sale volumes on national forests in the Arkansas Area. Tables are based on form class measurement data for 1,417 trees sampled in the Arkansas Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination woth total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  12. Stem cubic-foot volume tables for tree species in the Delta area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 13 species and 6 species groups based on equations used to estimate timber sale volumes on national forests in the Delta Area. Tables are based on form class measurement data for 990 trees sampled in the Delta Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on diameter outside of the bark (d.o.b.) in combination with height with to a 9-inch d.o.b. top.

  13. Economic Impacts of Potential Foot and Mouth Disease Agro-terrorism in the United States: A Computable General Equilibrium Analysis

    SciTech Connect (OSTI)

    Oladosu, Gbadebo A [ORNL] [ORNL; Rose, Adam [University of Southern California, Los Angeles] [University of Southern California, Los Angeles; Bumsoo, Lee [University of Illinois] [University of Illinois

    2013-01-01T23:59:59.000Z

    The foot and mouth disease (FMD) virus has high agro-terrorism potential because it is contagious, can be easily transmitted via inanimate objects and can be spread by wind. An outbreak of FMD in developed countries results in massive slaughtering of animals (for disease control) and disruptions in meat supply chains and trade, with potentially large economic losses. Although the United States has been FMD-free since 1929, the potential of FMD as a deliberate terrorist weapon calls for estimates of the physical and economic damage that could result from an outbreak. This paper estimates the economic impacts of three alternative scenarios of potential FMD attacks using a computable general equilibrium (CGE) model of the US economy. The three scenarios range from a small outbreak successfully contained within a state to a large multi-state attack resulting in slaughtering of 30 percent of the national livestock. Overall, the value of total output losses in our simulations range between $37 billion (0.15% of 2006 baseline economic output) and $228 billion (0.92%). Major impacts stem from the supply constraint on livestock due to massive animal slaughtering. As expected, the economic losses are heavily concentrated in agriculture and food manufacturing sectors, with losses ranging from $23 billion to $61 billion in the two industries.

  14. foote-98.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron4 Self-Scrubbing:,, , ., December 8,John Wagoner,, 2012Temperature

  15. Superconformal quantum mechanics and the exterior algebra

    E-Print Network [OSTI]

    Andrew Singleton

    2014-09-11T23:59:59.000Z

    We extend the differential form representation of N = (n,n) supersymmetric quantum mechanics to the superconformal case. We identify the superalgebras occurring for n = 1,2,4, give necessary and sufficient conditions for their existence, and give explicit geometric constructions of their generators and commutation relations. Quantum mechanics on the moduli space of instantons is considered as an example.

  16. Exterior Exposed Ductwork: Delivery Effectiveness and Efficiency*

    E-Print Network [OSTI]

    temperature environments, such as on a roof during cooling conditions, the supply air can experience%(with a supply side effectiveness of 78% and return effectiveness of 92%). This is due to the losses of 89% (with a supply side effectiveness of 90% and return effectiveness of 99%), reducing the average

  17. Excavationless Exterior Foundation Insulation Exploratory | Department of

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2: Final EnvironmentalCounties,UnitedCommunication,

  18. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    SciTech Connect (OSTI)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26T23:59:59.000Z

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  19. ORISE: Completion of environmental characterization at ORNL a...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ORISE's completion of environmental characterization at ORNL is a Recovery Act success Exterior of K-33 superstructure at ORNL This 2.8 million-square-foot facility known as K-33...

  20. Comparing resolved-sideband cooling and measurement-based feedback cooling on an equal footing: analytical results in the regime of ground-state cooling

    E-Print Network [OSTI]

    Kurt Jacobs; Hendra I. Nurdin; Frederick W. Strauch; Matthew James

    2015-03-19T23:59:59.000Z

    We show that in the regime of ground-state cooling, simple expressions can be derived for the performance of resolved-sideband cooling --- an example of coherent feedback control --- and optimal linear measurement-based feedback cooling for a harmonic oscillator. These results are valid to leading order in the small parameters that define this regime. They provide insight into the origins of the limitations of coherent and measurement-based feedback for linear systems, and the relationship between them. These limitations are not fundamental bounds imposed by quantum mechanics, but are due to the fact that both cooling methods are restricted to use only a linear interaction with the resonator. We compare the performance of the two methods on an equal footing --- that is, for the same interaction strength --- and confirm that coherent feedback is able to make much better use of the linear interaction than measurement-based feedback. We find that this performance gap is caused not by the back-action noise of the measurement but by the projection noise. We also obtain simple expressions for the maximal cooling that can be obtained by both methods in this regime, optimized over the interaction strength.

  1. The tale of a modern animal plague: Tracing the evolutionary history and determining the time-scale for foot and mouth disease virus

    SciTech Connect (OSTI)

    Tully, Damien C. [Smurfit Institute of Genetics, Trinity College Dublin (Ireland)], E-mail: dtully@tcd.ie; Fares, Mario A. [Smurfit Institute of Genetics, Trinity College Dublin (Ireland)], E-mail: faresm@tcd.ie

    2008-12-20T23:59:59.000Z

    Despite significant advances made in the understanding of its epidemiology, foot and mouth disease virus (FMDV) is among the most unexpected agricultural devastating plagues. While the disease manifests itself as seven immunologically distinct strains their origin, population dynamics, migration patterns and divergence times remain unknown. Herein we have assembled a comprehensive data set of gene sequences representing the global diversity of the disease and inferred the time-scale and evolutionary history for FMDV. Serotype-specific rates of evolution and divergence times were estimated using a Bayesian coalescent framework. We report that an ancient precursor FMDV gave rise to two major diversification events spanning a relatively short interval of time. This radiation event is estimated to have taken place towards the end of the 17th and the beginning of the 18th century giving us the present circulating Euro-Asiatic and South African viral strains. Furthermore our results hint that Europe acted as a possible hub for the disease from where it successfully dispersed elsewhere via exploration and trading routes.

  2. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    SciTech Connect (OSTI)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06T23:59:59.000Z

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses (which are of two bovine types) bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). A timeline for this development is presented in Table 1. The development of the Version 1.0 panel for FMDV rule-out and the most current efforts aimed to designed species specific panels has spanned over 2 1/2 years with multiple collaborative partnerships. This document provides a summary of the development, testing and performance data at OIE Stage 1 Feasibility into Stage 2 Assay Development and Standardization1 (see Table 2), gathered as of June 30th, 2007 for the porcine and bovine MUX assay panels. We present an overview of the identification and selection of candidate genetic signatures, the assay development process, and preliminary performance data for each of the individual signatures as characterized in the multiplexed format for the porcine and bovine panels. The Stage 1 Feasibility data of the multiplexed panels is presented in this report also includes relevant data acquired from the Version 1.0 panel as supporting information where appropriate. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must precede efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available. As a summary report, this document does not provide the details of signature generation, evaluation, and testing, nor does it provide spec

  3. Enhancing the conceptual design process of automotive exterior systems

    E-Print Network [OSTI]

    Diaz Dominguez, David

    2011-01-01T23:59:59.000Z

    Product development cycles in the automotive industry are being reduced and competition is more demanding than ever before. To be successful in this environment, Original Equipment Manufacturers need a product development ...

  4. MSTER EN COMERCIO EXTERIOR 2012-2013 FECHAS Y HORARIOS

    E-Print Network [OSTI]

    Rey Juan Carlos, Universidad

    HORARIOS El presente máster aportará al alumno una vi- sión global socio-económica y política de la mundial. Evolución y tendencias. · Bloques económicos y mercados emergentes. · Seguridad internacional

  5. Building America Case Study: Excavationless Exterior-Side Foundation...

    Broader source: Energy.gov (indexed) [DOE]

    Homeworks, urbanhomeworks.org BASF, basf.us American Environmental, LLC NorthernSTAR Building America Partnership Building Component: Foundation insulation Application: Retrofit;...

  6. Symmetry in exterior boundary value problems for quasilinear ...

    E-Print Network [OSTI]

    symmetry for the solution u and for the condenser ?i when the overdetermined boundary condition |Du| = c > 0 on d?i is imposed. This provides a new proof of a

  7. Many exterior entry and walkway lights in residential and commercial

    E-Print Network [OSTI]

    be difficult since retail stocking is inconsistent. The Light-Emitting Diode (LED) Hybrid Outdoor Fixture

  8. Numerical experiments with an interior-exterior point method for ...

    E-Print Network [OSTI]

    2004-06-30T23:59:59.000Z

    The latter converges due to the information car- ried by the vector of the Lagrange multipliers y. The interior point method, which has global convergence

  9. 2278 -XIV Encuentro de Latinoamericanistas Espaoles POLTICA EXTERIOR COMO

    E-Print Network [OSTI]

    Boyer, Edmond

    internacionais. E foi nos governos de Fernando Henrique Cardoso (1995 a 2002) e de Luiz Inácio Lula da Silva governo Cardoso. Em terceiro lugar, será feita uma análise da questão da política externa no governo Lula através de comparações com o governo anterior. E, por último, o artigo analisará qualitativamente um caso

  10. Cladding Attachment Over Thick Exterior Sheathing | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T, Inc.'sEnergyTexas1. Feedstock &EnergyDepartmentCity ofCladding

  11. Building America Expert Meeting: Cladding Attachment Over Exterior

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJune 2,The Big Green372 Roomfor Humanity

  12. Building America Whole-House Solutions for Existing Homes: Exterior

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJune 2,The BigSiding Retrofit in aDepartment ofAMissedInsulation

  13. Building America Expert Meeting: Cladding Attachment Over Exterior

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof Energy Future ofHydronic Heating in Multifamily Buildings

  14. Buildings of the Future and Health - Exterior Considerations | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy:WhetherNovember 13,NationalPhoto courtesy of the PacificJune 2015A1of

  15. FEMP Exterior Solid-State Lighting Technology Pilot

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,OfficeEnd of Year 2010SaltInstrumentation andFE DOCKET NO.FEDERAL ENERGY

  16. Federal Technology Deployment Pilot: Exterior Solid State Lighting |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2: FinalOffers New Training on Energy6 Federal Energy1999;FederalJanurary 5,CoalDepartment

  17. Expert Meeting Report: Cladding Attachment Over Exterior Insulation

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2: Final EnvironmentalCounties,UnitedCommunication,1] U.S.EducationalJanuary -

  18. Exterior Rigid Insulation Best Practices - Building America Top Innovation

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube|6721 FederalTexas EnergyofIdahoExceptions toPhotovoltaics (9ExploringExtend|

  19. Covered Product Category: Exterior Lighting | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"Wave theJuly 30, 2013DepartmentEnterprise Servers Covered

  20. 5-Hydroxymethylcytosine is a predominantly stable DNA modification

    E-Print Network [OSTI]

    Bachman, Martin; Uribe-Lewis, Santiago; Yang, Xiaoping; Williams, Michael; Murrell, Adele; Balasubramanian, Shankar

    2014-09-21T23:59:59.000Z

    in the CRUK Cambridge Institute from a C57BL/6 mouse and cultured on a gelatin-coated plate in a DMEM-KO medium (Invitrogen) supplemented with 10% FCS, MEM non-essential amino acids, glutamine, sodium pyruvate, penicillin, streptomycin, mouse leukemia... global hmC levels in cells treated with either thymidine (Supplementary Fig. S3 and Otani et al.24) or a high dose of ascorbic acid (Supplementary Fig S17, Minor et al.35 and Blaschke et al.36), the high hmC level found in ‘immortal’ DNA strands37...

  1. MEETING ABSTRACT Open Access Predominant role of Tax sumoylation in

    E-Print Network [OSTI]

    Boyer, Edmond

    the NF-kB pathway by acting both at cytoplasmic and nuclear levels. In the cytoplasm, Tax binds to and activates the IkB Kinase (IKK) complex while in the nucleus, Tax assembles tran- scriptional active nuclear bodies. Others and we have previously demonstrated that the cytoplasmic/nuclear partition and NF

  2. assessing hemispheric predominance: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    set provides the first profile Thompson, Anne 15 Simulation of Recent Southern Hemisphere Climate Change Environmental Management and Restoration Websites Summary: Simulation of...

  3. antigens predominant involvement: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    GEOSYNTHETICS Engineering Websites Summary: failure involving a reinforced geosynthetic clay liner in a sedimentation pond at a waste containment liners to hydrate during on-site...

  4. amazon predominantly targets: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    about a quarter of all global biodiversity. It acts as one of the major flywheels of global climate, transpiring water and generating clouds, affecting atmospheric circulation...

  5. Photographs of the Exterior and Interior of the Lab Homes Appendix B -Photographs of the Exterior and Interior of the

    E-Print Network [OSTI]

    Complete with Disconnect and Utility-Provided Smart Meter #12;B.4 Figure B.1. Window on West End of Home B

  6. Exterior algebra, ODEs and geometric integration [1] A. Adrover, S. Cerbelli & M. Giona. Exterior algebra-based algorithms to es-

    E-Print Network [OSTI]

    Bridges, Tom

    with a compliant surface: stabi- lizing the attachment line boundary layer, Stud. Appl. Math. 110, 333­349 (2003). [5] L. Allen & T.J. Bridges. Hydrodynamic stability of the Ekman boundary layer including interaction­15 (2002). [8] I.V. Barashenkov & E.V. Zemlyanaya. Oscillatory instabilities of gap solitons: a numerical

  7. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    SciTech Connect (OSTI)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06T23:59:59.000Z

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  8. Foot-conditioned phonotactics and prosodic constituency

    E-Print Network [OSTI]

    Bennett, Ryan Thomas

    2012-01-01T23:59:59.000Z

    constituency by Ryan T. Bennett There has been a recurrentin LINGUISTICS by Ryan T. Bennett September 2012 TheDissertation of Ryan T. Bennett is approved: Professor Junko

  9. Evaluation of environmental foot printing techniques

    E-Print Network [OSTI]

    Conway, John J., M.B.A. Massachusetts Institute of Technology

    2012-01-01T23:59:59.000Z

    With a growing focus on sustainability many companies are proactively assessing their product and supply chain footprints. Cisco is a leader in the ICT (Information and Communications Technology) industry and is working ...

  10. LittleFoot Energy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |Jilin ZhongdiantouLichuan CityLiqcrytech LLC JumpListLittle Sioux

  11. U.S. Nominal Cost per Foot of Crude Oil Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)Oil Wells

  12. U.S. Nominal Cost per Foot of Dry Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)OilDry Wells

  13. U.S. Nominal Cost per Foot of Natural Gas Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)OilDry

  14. Performance of Exterior Envelopes of Whole Buildings VIII: Integration of Building Envelopes Proceedings

    E-Print Network [OSTI]

    Envelopes Proceedings This work was supported by the Assistant Secretary for Energy Efficiency and Renewable.34 and 0.37 quads are required for heating and cooling respectively (DOE Core Data Book, 2000 Improving Information Technology to Maximize Fenestration Energy Efficiency Dariush Arasteh, Robin Mitchell

  15. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    blind systems were always lowered and seasonally adjusted (continued on next page) MS Thesis,Thesis, Dept. of Architecture, UC Berkeley 2011 http://escholarship.org/uc/item/1mq5k9mw blinds,blinds frequently enough to take advantage of daylighting. 14 While MS Thesis,

  16. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    lighting energy use The reference case for comparisonsin comparison with the variations in electrical lighting

  17. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    lighting for work. Applied Ergonomics, 37(4), 461-466. doi:in Buildings. ” Applied Ergonomics, 3(4), 206-215. 29.in Occupational Ergonomics and Safety I: Proceedings of the

  18. Many exterior entry lights in residential and commercial applications use two-

    E-Print Network [OSTI]

    , and replacement CFLs are not widely stocked. The Light-Emitting Diode (LED) Hybrid Security Fixture combines

  19. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    performance indicators uc/item/1mq5k9mw performance indicators. Many of the visual2.5. D AYLIGHT PERFORMANCE INDICATORS While attaining a

  20. Confined disclinations: exterior vs material constraints in developable thin elastic sheets

    E-Print Network [OSTI]

    Efi Efrati; Luka Pocivavsek; Ruben Meza; Ka Yee C. Lee; Thomas A. Witten

    2014-10-13T23:59:59.000Z

    We examine the shape change of a thin disk with an inserted wedge of material when it is pushed against a plane, using analytical, numerical and experimental methods. Such sheets occur in packaging, surgery and nanotechnology. We approximate the sheet as having vanishing strain, so that it takes a conical form in which straight generators converge to a disclination singularity. Then its shape is that which minimizes elastic bending energy alone. Real sheets are expected to approach this limiting shape as their thickness approaches zero. The planar constraint forces a sector of the sheet to buckle into the third dimension. We find that the unbuckled sector is precisely semicircular, independent of the angle $\\delta$ of the inserted wedge. We generalize the analysis to include conical as well as planar constraints and thereby establish a law of corresponding states for shallow cones of slope $\\epsilon$ and thin wedges. In this regime the single parameter $\\delta/\\epsilon^2$ determines the shape. We discuss the singular limit in which the cone becomes a plane. We discuss the unexpected slow convergence to the semicircular buckling seen experimentally.

  1. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    passive design strategies, including proper building massing and solarbuilding massing and solar orientation, a number of other passive design

  2. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    passive design strategies, including proper building massing and solarand solar orientation, a number of other passive design

  3. A TRANSMISSION PROBLEM FOR FLUID-STRUCTURE INTERACTION IN THE EXTERIOR OF A THIN DOMAIN

    E-Print Network [OSTI]

    between a in#12;nitely long cylinder coated with a sheath of an elastic material and a compressible. It was shown in (26) that for certain frequencies, the inviscid uid-structure in- teraction problem does of uid-structure problems. Moreover, these Jones frequencies form a discrete spectrum. If the structure

  4. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    for the clear day. The sky luminance of an overcast sky isthe Perez sky model to calculate the luminance distribution

  5. Impact of Fixed Exterior Shading on Daylighting: A Case Study of the David Brower Center

    E-Print Network [OSTI]

    Zelenay, Krystyna

    2011-01-01T23:59:59.000Z

    to-wall ratio, electrochromic glazing, etc. considered? 5.shading systems, switchable electrochromic and thermochromic

  6. Long-time asymptotics for two-dimensional exterior flows with small circulation at infinity

    E-Print Network [OSTI]

    Gallay, Thierry

    Gallay Institut Fourier UMR CNRS 5582 Universit´e de Grenoble I BP 74 38402 Saint-Martin-d'H`eres, France Thierry.Gallay@ujf-grenoble.fr Yasunori Maekawa Department of Mathematics Graduate School of Science Kobe

  7. Longtime asymptotics for twodimensional exterior flows with small circulation at infinity

    E-Print Network [OSTI]

    Gallay, Thierry

    Gallay Institut Fourier UMR CNRS 5582 Universitâ??e de Grenoble I BP 74 38402 Saint­Martin­d'Hâ??eres, France Thierry.Gallay@ujf­grenoble.fr Yasunori Maekawa Department of Mathematics Graduate School of Science Kobe

  8. Exact metric for the exterior of a global string in the Brans-Dicke theory

    E-Print Network [OSTI]

    B. Boisseau; B. Linet

    1998-02-03T23:59:59.000Z

    We determine in closed form the general static solution with cylindrical symmetry to the Brans-Dicke equations for an energy-momentum tensor corresponding to the one of the straight U(1) global string outside the core radius assuming that the Goldstone boson field takes its asymptotic value

  9. Polychlorinated biphenyls in the exterior caulk of San Francisco Bay Area buildings, California, USA

    E-Print Network [OSTI]

    -ray fluorescence (XRF). PCBs were detected in 88% of the caulk samples collected from the study area buildings in concrete and masonry buildings built between 1950 and 1980. Portable XRF was not a good predictor of the PCB content in caulk and the results indicate that portable XRF analysis may only be useful

  10. Downstream asymptotics in exterior domains: from stationary wakes to time periodic flows

    E-Print Network [OSTI]

    G. van Baalen

    2004-11-04T23:59:59.000Z

    We consider the time-dependent Navier-Stokes equations in a half-space with boundary data on the line $(x,y)=(x_0,y)$ assumed to be time-periodic (or stationary) with a fixed asymptotic velocity ${\\bf u}_{\\infty}=(1,0)$ at infinity. We show that there exist (locally) unique solutions for all data satisfying a compatibility condition in a certain class of fuctions. Furthermore, we prove that asymptotically the vorticity decompose itself in a dominant stationary part on the parabolic scale $y\\sim\\sqrt{x}$ and corrections of order $x^{-{3/2}+\\epsilon}$, while the velocity field decompose itself in a dominant stationary part in form of an explicit multiscale expansion on the scales $y\\sim\\sqrt{x}$ and $y\\sim x$ and corrections decaying at least like $x^{-{9/8}+\\epsilon}$. The asymptotic fields are made of linear combinations of universal functions with coefficients depending mildly on the boundary data. The asymptotic expansion for the component parallel to ${\\bf u}_{\\infty}$ contains `non-trivial' terms in the parabolic scale with amplitude $\\ln(x)x^{-1}$ and $x^{-1}$. To first order, our results also imply that time-periodic wakes behave like stationary ones as $x\\to\\infty$. The class of functions used is `natural' in the sense that `Physically Reasonable' (in the sense of Finn & Smith) stationary solutions of the N.-S. equations around an obstacle are covered if the half-space is choosen sufficiently far downstream. The coefficients appearing in the asymptotics may then be linearly related to the net force acting on the obstacle. To our knowledge, it is the first time that estimates uncovering the $\\ln(x)x^{-1}$ correction are proved in this setting.

  11. Highly damped quasinormal modes and the small scale structure of quantum corrected black hole exteriors

    SciTech Connect (OSTI)

    Babb, James; Kunstatter, Gabor [Department of Physics, The University of Winnipeg, 515 Portage Avenue, Winnipeg, Manitoba, R3B 2E9 (Canada); Daghigh, Ramin [Natural Sciences Department, Metropolitan State University, 700 East Seventh Street, Saint Paul, Minnesota, 55106 (United States)

    2011-10-15T23:59:59.000Z

    Quasinormal modes provide valuable information about the structure of spacetime outside a black hole. There is also a conjectured relationship between the highly damped quasinormal modes and the semiclassical spectrum of the horizon area/entropy. In this paper, we show that for spacetimes characterized by more than one scale, the 'infinitely damped' modes in principle probe the structure of spacetime outside the horizon at the shortest length scales. We demonstrate this with the calculation of the highly damped quasinormal modes of the nonsingular, single-horizon, quantum corrected black hole derived in [A. Peltola and G. Kunstatter, Phys. Rev. D 79, 061501 (2009); ].

  12. Building America Whole-House Solutions for New Homes: Exterior Rigid Foam

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJune 2,The BigSiding Retrofit inDemonstrationHouston,Insulation at

  13. Building America Top Innovations 2013 Profile … Exterior Rigid Insulation Best Practices

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof Energy Future ofHydronic HeatingManagement of High-R Walls

  14. Leray weak solutions of the Incompressible Navier Stokes system on exterior

    E-Print Network [OSTI]

    this difficulty by taking care of the dispersive nature of these waves by means of the Strichartz estimates of domains arises from many phenomena in physics and applications in engineering models (see [48 at the bubbles in the ocean) and the sedimentation of particles. In these cases it is important to determine

  15. FEMP Exterior Solid-State Lighting Technology Pilot | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,OfficeEnd of Year 2010SaltInstrumentation andFE DOCKET NO.FEDERAL ENERGYFEMP

  16. FEMP Exterior Solid-State Lighting Technology Pilot | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of Energy 088:EnergyFAR27.pdfFE

  17. Savings Project: Install Exterior Storm Windows With Low-E Coating |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del Sol HomeFacebook Twitter Principal InvestigatorsSave Energy on

  18. Savings Project: Install Exterior Storm Windows With Low-E Coating |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative JC3 RSS September 9,AwardGrads & Researchers STEMSarah EchoHawk

  19. Stenolobulites n. gen., Early Permian ancestor of predominantly Late Permian Paragastrioceratid subfamily Pseudogastrioceratinae

    E-Print Network [OSTI]

    Mikesh, D. L.; Glenister, B. F.; Furnish, W. M.

    1988-12-30T23:59:59.000Z

    .75-1.0). Figure 3,4 [Daubichites brevicostatus (Miller and Cline, 1934), Roadian of Idaho] is illustrated as an example of an Early Permian derivative of Stenolobulites, and Figure 7 ,5a,b (Strigogoniati tes kingi Miller, 1944, Capitanian of Mexico) repre- sents...- ments from the Road Canyon Formation (type Roadian) and one additional specimen from the upper Bone Spring Limestone, both of West Texas. In general, the specimens are well pre- served; however, those individuals preserved in shale as limonitic internal...

  20. Characterization in cochlea of KCTD12/PFET1, an intronless gene with predominant fetal expression

    E-Print Network [OSTI]

    Kuo, Sharon Fan

    2006-01-01T23:59:59.000Z

    The prevalence of severe to profound bilateral congenital hearing loss is estimated at 1 in 1000 births, at least half of which can be attributed to a genetic cause. To date, mutations in at least 67 genes have been ...

  1. Examining the Under-Represnetation of Deaf Administrators and Coaches at Predominately Hearing Sport Organizations

    E-Print Network [OSTI]

    Hooks, Tiffany

    2013-05-30T23:59:59.000Z

    providing sport management practitioners and scholars with a better understanding of the discrimination Deaf individuals face....

  2. 3-Adrenoceptor Is the Predominant -Adrenoceptor Subtype in Human Myometrium and Its Expression Is

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Hospital, 75014 Paris, France; Department of Gynecology (C.L.), Centre Hospitalier Universitaire du Bocage management of preterm labor. (J Clin Endocrinol Metab 90: 1644­1650, 2005) THE INCIDENCE OF premature birth

  3. alters foot mobility: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ja (more) Nousiainen, Sari 2013-01-01 57 Theoretical Mobility Analysis of Ion Mobility Spectrometry Physics Websites Summary: Results Theoretical Mobility Analysis of Ion...

  4. Successful treatment of hand and foot psoriasis with infliximab

    E-Print Network [OSTI]

    Lernia, Vito Di; Guareschi, Elisa

    2010-01-01T23:59:59.000Z

    pustular psoriasis (PPP) may be a distinct entity inmay be successful in PPP [ 9 , 10 , 11 ]. Infliximab hasin localized recalcitrant PPP [ 14 ]. Here we present four

  5. american orthopaedic foot: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Berdichevsky, Victor 12 Orthopaedic Health, Conformation and Longevity in Riding Horses Multidisciplinary Databases and Resources Websites Summary: Orthopaedic Health,...

  6. ames 11-foot transonic: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Congress and Exposition (IMECE), IMECE Combustion System for a Silicon Micro Gas Turbine Engine," Journal of Microelectromechanical Systems, Volume 432 Leopold Center...

  7. Passive dynamic walking with knees : a point foot model

    E-Print Network [OSTI]

    Hsu Chen, Vanessa F. (Vanessa Fang)

    2007-01-01T23:59:59.000Z

    In this thesis, a hybrid model for a passive 2D walker with knees and point feet is presented. The step cycle of the model has two phases of continuous dynamics: one with an unlocked knee configuration and a second one ...

  8. Foote Creek Rim I Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources JumpI

  9. Foote Creek Rim II Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources JumpIII

  10. Foote Creek Rim III Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources

  11. Foote Creek Rim IV Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy ResourcesIV Wind

  12. DOE - Office of Legacy Management -- Foote Mineral Co - PA 27

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTable ofArizonaBuffalo -Elk River ReactorProject

  13. Foote Creek Rim Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump to:ar-80m.pdfFillmoreGabbs Valley Area(Sasada, 1988)PevafersaType

  14. Hand, Foot, and Mouth Disease Hand, Foot, and Mouth Disease (HFMD) is an illness caused by a virus. It is

    E-Print Network [OSTI]

    through bodily fluids, which include: nose secretions (coughs, sneezes, runny nose, contaminated surfaces), saliva (coughs, sneezes, drool, mouthing toys, contaminated surfaces), blister fluids (blisters drain

  15. Second order adaptive boundary conditions for exterior flow problems: non-symmetric stationary flows in two dimensions

    E-Print Network [OSTI]

    called "artificial boundary conditions" to replace the boundary conditions at infinity. To solve this problem we construct -- by combining results from dynamical systems theory with matched asymptotic field depending explicitly on drag and lift and describing the solution to second and dominant third

  16. Prepared by: BMP Interior & Exterior Weed Control Audit Subcommittee 4/20/07 Best Management Practices Guide for Reducing Risk

    E-Print Network [OSTI]

    Keinan, Alon

    -target exposure? Turn on ventilation fans Wash down growing areas and benches to avoid residues (after REI) Wash

  17. Confirmatory radiological survey of the Grand Junction Projects Office Remedial Action Project exterior portions, 1989-1995

    SciTech Connect (OSTI)

    Forbes, G.H.; Egidi, P.V.

    1997-04-01T23:59:59.000Z

    The purpose of this independent assessment was to provide the U.S. Department of Energy (DOE) with an independent verification (IV) that the soil at the Grand Junction Projects Office (GJPO) complies with applicable DOE guidelines. Oak Ridge National Laboratory/ Environmental Technology Section (ORNL/ETS) which is also located at the GJPO, was assigned by DOE as the Independent Verification Contractor (IVC). The assessment included reviews of the decontamination and decommissioning plan, annual environmental monitoring reports, data in the pre- and post-remedial action reports, reassessment reports and IV surveys. Procedures and field methods used during the remediation were reviewed, commented on, and amended as needed. The IV surveys included beta-gamma and gamma radiation scans, soil sampling and analyses. Based on the data presented in the post-remedial action report and the results of the IV surveys, the remediation of the outdoor portions of the GJPO has achieved the objectives. Residual deposits of uranium contamination may exist under asphalt because the original characterization was not designed to identify uranium and subsequent investigations were limited. The IVC recommends that this be addressed with the additional remediation. The IVC is working with the remedial action contractor (RAC) to assure that final documentation WM be sufficient for certification. The IVC will address additional remediation of buildings, associated utilities, and groundwater in separate reports. Therefore, this is considered a partial verification.

  18. Two-photon double ionization of H2 at 30 eV using Exterior Complex Scaling

    E-Print Network [OSTI]

    Morales, Felipe

    2009-01-01T23:59:59.000Z

    A, 75(5):051402, 2007. [22] Rudenko A, Foucar L, Kurka M,Y H, Moshammer R, Foucar L, Rudenko A, Kurka M, Schr¨ ter,

  19. Economic Analysis and Optimization of Exterior Insulation Requirements for Ventilated Buildings at Power Generation Facilities with High Internal Heat Gain

    E-Print Network [OSTI]

    Hughes, Douglas E.

    2010-12-17T23:59:59.000Z

    Industrial buildings require a large amount of heating and ventilation equipment to maintain the indoor environment within acceptable levels for personnel protection and equipment protection. The required heating and ventilation equipment...

  20. Visual Comfort Analysis of Innovative Interior and Exterior Shading Systems for Commercial Buildings using High Resolution Luminance Images

    E-Print Network [OSTI]

    Konis, Kyle

    2011-01-01T23:59:59.000Z

    Society of North America. Luminance ratio limits; ch. 11,range photography as a luminance mapping Technique. Lawrenceusing High Resolution Luminance Images Kyle Konis Lawrence

  1. Visual Comfort Analysis of Innovative Interior and Exterior Shading Systems for Commercial Buildings using High Resolution Luminance Images

    E-Print Network [OSTI]

    Konis, Kyle

    2011-01-01T23:59:59.000Z

    accuracy of luminance maps under dynamic sky conditions. TheSummary of luminance values during clear sky conditions forluminance maps versus a shielded illuminance sensor under dynamic sky

  2. PHYSICAL REVIEW A 87, 053406 (2013) Exterior complex scaling method in time-dependent density-functional theory

    E-Print Network [OSTI]

    Chu, Shih-I

    2013-01-01T23:59:59.000Z

    -correlation potential which proved accurate in calculations of unperturbed electronic structure of Ar. Calculations is, not including dynamic response of the electron density) differ significantly from those obtained [2­4]. Electronic structure of atoms and molecules can be encoded in the HHG signal; the latter may

  3. LongTime Asymptotics for the NavierStokes Equation in a TwoDimensional Exterior Domain

    E-Print Network [OSTI]

    Gallay, Thierry

    Gallay Abstract. We study the long­time behavior of infinite­energy solutions to the incom­ pressible, 76D17. 1 #12; Th. Gallay where n denotes the interior unit normal on # # we have the following

  4. 5^ EDITION september 2014 O.C. OPEN CITY -From landscape to exterior design POLITECNICO DI MILANO

    E-Print Network [OSTI]

    Picasso, Marco

    , since 2007, the Architecture Master course (Sustainable Architecture of Multi - Scale Project to environmental architecture issues while the two final years are devoted to sustainable design projects, the Piacenza Campus of the Politecnico di Milano hosts the three-year Environmental Architecture course and

  5. African American Student Athletes at Predominately White Institutions and Motivational Factors That Influence Graduate and Professional Degrees 

    E-Print Network [OSTI]

    Rutledge, Michael E

    2015-01-22T23:59:59.000Z

    This study highlights African American male student athletes at PWI’s, and their motivational factors that influenced persistence into graduate school. The following research questions guided this study: (a) How do African ...

  6. Risk Analysis DOI: 10.1111/j.1539-6924.2011.01600.x Influenza Infection Risk and Predominate Exposure Route

    E-Print Network [OSTI]

    Adida, Elodie

    to infection risk increases with cough frequency, and decreases with virus concentration in cough particles. We

  7. DUSTY OB STARS IN THE SMALL MAGELLANIC CLOUD. I. OPTICAL SPECTROSCOPY REVEALS PREDOMINANTLY MAIN-SEQUENCE OB STARS

    SciTech Connect (OSTI)

    Sheets, Holly A.; Bolatto, Alberto D. [Department of Astronomy, University of Maryland, College Park, MD 20742-2421 (United States); Van Loon, Jacco Th.; Oliveira, Joana M. [Lennard-Jones Laboratories, Keele University, Staffordshire ST5 5BG (United Kingdom); Sandstrom, Karin [Max-Planck Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany); Simon, Joshua D. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Barba, Rodolfo H., E-mail: bolatto@astro.umd.edu [Departamento de Fisica, Universidad de La Serena, Cisternas 1200 Norte, La Serena (Chile)

    2013-07-10T23:59:59.000Z

    We present the results of optical spectroscopic follow-up of 125 candidate main sequence OB stars in the Small Magellanic Cloud (SMC) that were originally identified in the S{sup 3}MC infrared imaging survey as showing an excess of emission at 24 {mu}m indicative of warm dust, such as that associated with a transitional or debris disks. We use these long-slit spectra to investigate the origin of the 24 {mu}m emission and the nature of these stars. A possible explanation for the observed 24 {mu}m excess, that these are emission line stars with dusty excretion disks, is disproven for the majority of our sources. We find that 88 of these objects are normal stars without line emission, with spectral types mostly ranging from late-O to early-B; luminosity classes from the literature for a sub-set of our sample indicate that most are main-sequence stars. We further identify 17 emission-line stars, 7 possible emission-line stars, and 5 other objects with forbidden-line emission in our sample. We discover a new O6 Iaf star; it exhibits strong He II 4686 A emission but relatively weak N III 4640 A emission which we attribute to the lower nitrogen abundance in the SMC. Two other objects are identified with planetary nebulae, one with a young stellar object, and two with X-ray binaries. To shed additional light on the nature of the observed 24 {mu}m excess we use optical and infrared photometry to estimate the dust properties of the objects with normal O and B star spectra and compare these properties to those of a sample of hot spots in the Galactic interstellar medium (ISM). We find that the dust properties of the dusty OB star sample resemble the properties of the Galactic sample of hot spots. Some may be runaway systems with bow-shocks resulting from a large velocity difference between star and ISM. We further investigate the nature of these dusty OB stars in a companion paper presenting mid-infrared spectroscopy and additional imaging.

  8. Tall fescue (Festuca arundinacea Schreb.) is the pre-dominant forage species on over one million acres of

    E-Print Network [OSTI]

    Liskiewicz, Maciej

    Fungal Endophyte While occasional negative responses of animals con- suming tall fescue were observed an endophyte because it is found within tissue and does not affect the outward appear- ance of the grass. In the scientific community, the tall fescue fungal endophyte was formerly known as Acremonium coenophialum, but has

  9. Reflective Practice of a Hispanic Chief Financial Officer and Interim Superintendent in a Predominantly Hispanic South Texas School District

    E-Print Network [OSTI]

    Amezcua, Jesus J.

    2014-12-10T23:59:59.000Z

    ................................................ 81 “Nadie Es Profeta Es Su Misma Tierra” (Dichos Frases y Refranes Mexicanos [Dichos], 2008): My First Disorienting Dilemma ................................................................ 83 After a Game Loss: Rotary Enters Into My Life...

  10. Hypogenic contribution to speleogenesis in a predominant epigenic karst system: A case study from the Venetian Alps, Italy

    E-Print Network [OSTI]

    Gilli, Adrian

    the Venetian Alps, Italy Nicola Tisato a, , Francesco Sauro b , Stefano M. Bernasconi a , Rolf H.C. Bruijn Frasassi, Monte Cucco and Acqua santa Terme caves (Galdenzi and Menichetti, 1995; Galdenzi, 1997

  11. Consumption habits of pregnant women and implications for developmental biology: a survey of predominantly Hispanic women in California

    E-Print Network [OSTI]

    Santiago, Sarah E; Park, Grace H; Huffman, Kelly J

    2013-01-01T23:59:59.000Z

    of bisphenol A from plastic baby bottles, baby bottle linersthe plastic additive in sippy cups and baby bottles [49,50].

  12. Refiguring the Wordscape: Merleau-Ponty, Beckett and the Body

    E-Print Network [OSTI]

    Dennis, Amanda Margaret

    2011-01-01T23:59:59.000Z

    between corporeal and exterior space in his chapter “Lasame as intelligible or exterior space. Merleau-Ponty citesof space: one is geometric, homogenous and exterior (

  13. Distributed Knowledge Management (and

    E-Print Network [OSTI]

    Christian, Eric

    .92 · · · · · exterior> · :LinearRing> · exterior> · · (GeoRSS Simple maps directly onto GeoRSS GML) 4:Point> · · · · exterior> · · · 45

  14. The Affordance of Online Multiuser Virtual Environments for Creative Collaboration

    E-Print Network [OSTI]

    HONG, SEUNG WAN

    2013-01-01T23:59:59.000Z

    and organizing interior and exterior spaces. Besides, theand organizing interior and exterior spaces. Such immersiveand organizing interior and exterior space. Except it, other

  15. The Architecture of Information at Plateau Beaubourg

    E-Print Network [OSTI]

    Branda, Ewan

    2012-01-01T23:59:59.000Z

    the reception areas, exterior space in the brief is treatedrequirements of these exterior spaces. The brief, forpiazza and its adjunct exterior spaces (Figures 2.4-2.6).

  16. Machine for Shopping: American Postwar Malls, Culture, and the Consumption of Commercial Urbanism

    E-Print Network [OSTI]

    Siegel, Robyn Schwartz

    2011-01-01T23:59:59.000Z

    inside the private space, the exterior is not as visuallythe transition from exterior into interior space. SinceThe interior spaces are separate from the ersatz exterior

  17. Paradigms and Syntagms of Ethnobotanical Practice in Pre-Hispanic Northwestern Honduras

    E-Print Network [OSTI]

    Morell-Hart, Shanti

    2011-01-01T23:59:59.000Z

    generally cleaner. Spaces exterior to structures but insidein only two types of exterior spaces: adjacent to structureshouse walls in the exterior yard space, and reused storage

  18. Dislocations of the Brain: Subjectivity and Cerebral Topology from Descartes to Nineteenth-Century Neuroscience

    E-Print Network [OSTI]

    Bassiri, Nima Rad

    2010-01-01T23:59:59.000Z

    with the continuity of exterior space…. There is, in Sigmundtwo- dimensional space of the gland’s exterior surface thatinterior space is actively present in the exterior world. ”

  19. Urban Microclimate, a Study of Energy Balance and Fluid Dynamics /

    E-Print Network [OSTI]

    Yaghoobian, Neda

    2013-01-01T23:59:59.000Z

    for building load calculations; Exterior heat balance (CD-for building load calculations; Exterior heat balance (CD-for Building Load Calculations; Exterior Heat Balance (CD-

  20. Plasma Structure and Behavior of Miniature Ring-Cusp Discharges

    E-Print Network [OSTI]

    Mao, Hann-Shin

    2013-01-01T23:59:59.000Z

    ?) Normalized density Vel. space (Exterior) x Position alongfrom the velocity space vol- ume exterior to the loss cone.

  1. Manifolds and Transformation Groups WS 05 --Technische Universitat Darmstadt

    E-Print Network [OSTI]

    Sanderson, Yasmine

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .42 III.2. The exterior product . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 III.3. Orientations on vector space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58 IV.3. The exterior differential

  2. Using EnergyPlus for California Title-24 compliance calculations

    E-Print Network [OSTI]

    Huang, Joe; Bourassa, Norman; Buhl, Fred; Erdem, Ender; Hitchcock, Rob

    2006-01-01T23:59:59.000Z

    1. A2 Series Exterior Opaque Envelope Tests Space Cooling2. A2 Series Exterior Opaque Envelope Tests Space Heating

  3. "Against the real dangers of modern life the home is no safeguard": Examining Spheres of Affect and Coercion in the Home in Nineteenth Century California Literature

    E-Print Network [OSTI]

    Tejeda, Carla Alicia

    2010-01-01T23:59:59.000Z

    interior, or home space, and exterior, or public space. Theinterior and exterior parts of domestic spaces, the private

  4. Daylight metrics and energy savings

    E-Print Network [OSTI]

    Mardaljevic, John

    2011-01-01T23:59:59.000Z

    properties of the space, the exterior context, and interiorand exterior shading devices. In the short term, evaluation of spaces

  5. Tacoma Power Weatherization

    E-Print Network [OSTI]

    II.C. Installation Requirements for Roofs ­ Exterior Space ..................................16 II ­ Exterior Perimeter Insulation .................................................21 II.F. Installation

  6. CHECK-IN CONDITION REPORT CONDITION UPON ENTERING

    E-Print Network [OSTI]

    Karonis, Nicholas T.

    & exterior 18. Oven 19. Broiler pan & broiler 20. Refrigerator - exterior 21. Refrigerator - interior 22. Refrigerator - shelves 23. Exhaust fan ____________________ ____________________ ____________________ Bathroom

  7. ORIGINAL ARTICLE The Effect of Foot and Ankle Prosthetic Components on

    E-Print Network [OSTI]

    -9. Objective: To assess the influence of energy storage and return (ESAR) prosthetic feet and multi-axis ankles on ground reaction forces and loading asymmetry between lower limbs in transtibial amputees. Design: The anteroposterior ground re- action force impulse, peak ground reaction forces, and braking and propulsion impulse

  8. Foot Tapping for Mobile Interaction Andrew Crossan, Stephen Brewster, Alexander Ng

    E-Print Network [OSTI]

    Williamson, John

    become a standard part of mobile interfaces. Touch screens allow a user to quickly and easily perform

  9. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    abalone shell. Materials Science and Engineering A 2005;390:comparative study. Materials Science and Engineering C 2006;21. xxii VITA Materials Science and Engineering Program,

  10. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    CT)^8 A Range Repeat HO HE PIC Locus Sequence BOOB-RM2-F07U GTTTGCTAATCCCCTGGTGCAAGTG BOOB-RM2-F07 LAAAG)^35… (AAAG) ^5 BOOB-RM3-D07 U GTTTGGCCTACTGCCATCCAGGG

  11. he town of Herculaneum, lying at the foot of Mount Vesuvius on a cliff over-

    E-Print Network [OSTI]

    Jellinek, Mark

    advanced as a deflating current with low momentum until it reached the 20-metre cliff drop, when its basal, denser component emplaced abruptly on the beach, halted probably by hydraulic-jump effects, bursting. Some of the skeletons have articulated fractures, as seen in incinerated bodies3,4 , and the inner

  12. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    inorganic materials could lead to significant advances in materials science, opening the door to novel synthesis

  13. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    relative position of calcium and carbonate ions creating ascaffolding. The calcium and carbonate ions can penetratewith surrounding calcium and carbonate ions. Since these

  14. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    of microfabricated polyimide hairs in a 1cm2 array, (b) re-et al. [135] microfabricated polyimide hairs (Figure 2.35 a)of microfabricated polyimide hairs in a 1cm 2 array, (b) re-

  15. Design and fabrication of force sensing robotic foot utilizing the volumetric displacement of a hyperelastic polymer

    E-Print Network [OSTI]

    Estrada, Matthew A

    2012-01-01T23:59:59.000Z

    This thesis illustrates the fabrication and characterization of a footpad based on an original principle of volumetric displacement sensing. It is intended for use in detecting ground reaction forces in a running quadrupedal ...

  16. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  17. A study of the design criteria for drilled-and-belled footings 

    E-Print Network [OSTI]

    Lehmann, Clark Thomas

    1964-01-01T23:59:59.000Z

    Drilling Machine . . ~ . ~ . 44 14. Shelby Tube Sampler . . . . ~ . ~ ~ ~ ~ . ~ ~ ~ . 44 15. Dri. lling Machine in Operation ~ ~ ~ ~ ~ ~ 46 16. Sample Data Sheet for Triaxial Compression Test . . 49 17. Stress-Strain Curve for Triaxial Test Specimen... to Pascal~s Law Now, the active pressure~ G~, on surface AC is 5 A. R Jumikis, ~o . cit. , pp. 618-624. Pd 11 B A 45 P/2 B Pp 4So + p/2 C I v/1+8 (a) Forces in Prandtl's System (b) Mohr Stress Diagram for Compression Test FIGURB 3. Prandtl...

  18. Ground Covers for northern ArizonA Above 6,000 foot elevAtions

    E-Print Network [OSTI]

    Sanderson, Mike

    or the use of fabric or plastic mulch may be required. Most Northern Arizona soils are limited in the amount to turf, bare ground, and rock mulches. Ground covers fill a number of important design needs. They can or even highway embankments. They can soften and add a touch of greenery to the large rock-mulched areas

  19. Department of Mechanical Engineering Spring 2012 IMPROVING THE TRANSMISSION OF A12FOOT DANCE VEHICLE

    E-Print Network [OSTI]

    Demirel, Melik C.

    DANCE VEHICLE Overview A Penn State Creative Campus collaborative project called the "Secret Life of Public Spaces" (SLoPS) prompted the creative idea of a mobile dance vehicle. This vehicle would be used system for this vehicle, which was discovered after they built an initial prototype that didn't function

  20. Procedures employed in the verification of postings, footings, and ledger balances

    E-Print Network [OSTI]

    Sain, Carl

    1939-01-01T23:59:59.000Z

    app??oint ion 989 &414& 55 115&54f &5? $5&lid& ae 15 & fs'F. BO 108 & $15& 04 1& $08& 48 $&944, 15 ?5&4$4, 05 e&?95&000&00 I&140&gg, oo? f 05 & 000& 00 I, 180 & 000& 00 4 8&9$5&455&95 4 sde&ff1&vo 4 sgesa&aod. ds l&odf &8$9&59 114&fde&04... Sd&i'd, oa 4{1) 159&40? 59, 4dl. ee 4&155&000&00 8&8?5&000, 00 (5) 958&dls&50 l&odf &889&58 je) 58, 44f, dd 114&fde&04 (F) 58&9?0. 00 $5 &905& BI s9. 411. 55 &e) sd, eef. s9? 4&154&000&00 I & 885 & 000& 00 10&954& 00 948&515& 50 1 & 155...

  1. Literature Cited FIGURE 3.-Respiratory demand (Gooding and Neill see foot-

    E-Print Network [OSTI]

    ventilation by increasing gape rather than simply swimming faster. fairly rapid rise in the water column is possible, it does not appear to be a significant problem. Ofthe last 10 cetaceans that I have captured. Analysis ofram ventilation offish gills with applica- tion to skipjack tuna (Katsuwonus pelamis). J. Fish

  2. Factors associated with spatial clustering of foot-and-mouth disease in Nepal

    E-Print Network [OSTI]

    Chhetri, Bimal K.; Perez, Andres M.; Thurmond, Mark C.

    2010-01-01T23:59:59.000Z

    control and eradication in Nepal, Bulletin of VeterinaryScience and Animal Husbandry, Nepal,Nepal Veterinary Association, 26, 18–26. Grubman, M. J. ,

  3. Table 3a. Total Natural Gas Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet) DecadeV49 155 181 177391.070.51992

  4. Table 4a. Total Fuel Oil Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet) DecadeV493,552.13,846.302.8

  5. U.S. Total Consumption of Heat Content of Natural Gas (BTU per Cubic Foot)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 34 44Year Jan Feb MarDecade Year-0Sales (Billion CubicConsumption

  6. Type B Accident Investigation Board Report BNFL, Inc. Employee Foot Injury

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssuesEnergyTransportation WorkDecember 28,Injury at

  7. U.S. Nominal Cost per Foot of Crude Oil, Natural Gas, and Dry Wells Drilled

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)Oil

  8. U.S. Real Cost per Foot of Crude Oil, Natural Gas, and Dry Wells Drilled

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb MarRevision2009 2010(Million(Dollars

  9. Field studies of exterior-only applications with fipronil (Termidor SC) for the post-construction control of interior populations of subterranean termites (Isoptera: Rhinotermitidae)

    E-Print Network [OSTI]

    Waite, Troy David

    2005-02-17T23:59:59.000Z

    and when termites will infest them. I apologize again for any extra expenses caused to the company as a result of my lack of experience. I express gratitude to Dr. Bob Davis and BASF Corporation for their financial contributions... been registered in a termiticide formulation as Termidor? by BASF Corporation (Mount Olive, NJ). It has also been registered for the protection of corn, rice, and cotton against orthopteran, lepidopteran, homopteran, and coleopteran pests...

  10. Multiphoton detachment of H- near the one-photon threshold: Exterior complex-scaling–generalized pseudospectral method for complex quasienergy resonances

    E-Print Network [OSTI]

    Chu, Shih-I; Telnov, Dmitry A.

    1999-04-01T23:59:59.000Z

    We perform a nonperturbative study of the multiphoton above-threshold detachment of H- in the presence of 1.640??m and 1.908??m laser fields by means of the non-Hermitian Floquet formalism. The laser parameters used are related to the recent...

  11. EXTERIOR LIGHTING CASE STUDY CALIFORNIA LIGHTING TECHNOLOGY CENTER, UC DAVIS PHONE: (530) 747-3838 FAX: (530) 747-3812 CLTC.UCDAVIS.EDU

    E-Print Network [OSTI]

    California at Davis, University of

    . This energy waste can easily be averted by implementing energy-efficient light sources and lighting controls.S. health care facilities to install an energy-efficient, ultra-smart outdoor LED lighting system. The award schedules, light levels and time-out settings, monitor the system's energy use, and receive automated alerts

  12. Cladding Attachment Over Thick Exterior Insulating Sheathing (Fact Sheet), Building America Case Study: Technology Solutions for New and Existing Homes, Building Technologies Office (BTO)

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO OverviewAttachments4 Chairs Meeting - April 2014Christopher SmithWin"City 25

  13. "When you want to give up, you want to give in": Mentoring perceptions of African American women doctoral students at a predominately White institution

    E-Print Network [OSTI]

    Fowler, Rhonda Michelle

    2013-08-08T23:59:59.000Z

    Mentoring in graduate education is considered an important and essential part of graduate education. The journey to the doctorate for African American students, especially for African American women, comes with many hurdles and obstacles. Mentorship...

  14. Middle class African American mothers' perceptions of White teachers' interactions with their African American children in predominately White suburban junior high schools

    E-Print Network [OSTI]

    Williams, Twyla Jeanette

    2009-05-15T23:59:59.000Z

    to maintain a role of advocacy, (f) the need to maintain a role of visibility, and (g) the need to maintain a role of proactive parenting....

  15. Obama's Second Chance on the Predominant Moral Issue of this Century President Obama, finally, took a get-involved get-tough approach to negotiations on health care

    E-Print Network [OSTI]

    Hansen, James E.

    's future, fossil fuels will remain the cheapest energy and we will squeeze every drop from tar sands, oil shale, pristine lands, and offshore areas. An essential corollary to the rising carbon price is 100

  16. Thermal and moisture problems in existing basements create a unique challenge as the exterior face of the wall is not easily or inexpensively accessible. This approach addresses thermal and moisture management from the interior face of the wall without disturbing the exterior soil and landscaping. It is effective at reducing energy loss through the wall principally during the heating season.

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreakingMayDepartmentTest for PumpingThe Facts onDepartmentTheofDurable Interior

  17. Health hazard evaluation report HETA 91-209-2249, Seaway Painting, Inc. , Annapolis, Maryland

    SciTech Connect (OSTI)

    Sussell, A.; Mickelsen, R.L.; Rubin, C.; Freund, E.

    1992-08-01T23:59:59.000Z

    In response to a request received from an engineering consultant, an evaluation was undertaken of health hazards at an elevated water storage tank in Annapolis, Maryland where exterior repainting was being carried out by Seaway Painting, Inc. The requestor was concerned about possible hazardous exposures to lead. The 135 foot high elevated water storage tank had an estimated exterior surface area of 35,000 square feet. It had been painted with a red lead primer, and an alkyd lead based paint. During moving and set up of a primary containment structure, personal airborne lead exposures were below the OSHA Permissible Exposure Limit (PEL) of 50 micrograms/cubic meter (microg/cu m). During abrasive blasting operations, levels outside the containment approached the PEL. Airborne lead concentrations in the con tainment ranged from 620 to 3000 microg/cu m. No workers had increased blood lead levels during the job. The authors conclude that a potential health hazard due to lead exposures existed during repainting of the structure; however, the worker protection program in place at the time of the study appeared to adequately protect the workers from the lead. The protection program was a comprehensive one which was in compliance with Maryland requirements.

  18. The New Suburbs: Evolving travel behavior, the built environment, and subway investments in Mexico City

    E-Print Network [OSTI]

    Guerra, Erick

    2013-01-01T23:59:59.000Z

    come with a single exterior parking space. Households oftenEach has a single exterior parking space on the narrow frontEXTERIOR, LOS HÉROES ECATEPEC 74 FIGURE 4.13 REUSE OF PARKING SPACE

  19. 2.1E BDL Summary

    E-Print Network [OSTI]

    Winkelmann, F.C.

    2010-01-01T23:59:59.000Z

    PARAMETERS SPACE-CONDITIONS SPACE EXTERIOR-WALL or - R O O FBUELDING(or BLDG),SPACE,EXTERIOR-WALL(or E-W), UNDERGROUND-PROJECT DETAILS OF SPACE DETAILS OF EXTERIOR SURFACES IN THE

  20. DOE-1 USERS GUIDE

    E-Print Network [OSTI]

    Authors, Various

    2011-01-01T23:59:59.000Z

    following format: SPACE EXTERIOR-WALL (if any) WINDOW's (ifWall dimensions per space [EXTERIOR-WALL] Glass dimensionsRoof dimensions per space [EXTERIOR-WALL] o o o o SYSTEMS o

  1. Demonstrating Modernism: Richard Neutra's Early Model Houses

    E-Print Network [OSTI]

    Peltakian, Danielle

    2012-01-01T23:59:59.000Z

    overlook the interior and exterior spaces of the home (Fig.the Beard House the exterior space is located on the roofthe two figures in the exterior space. The doll located in

  2. The New Suburbs: Evolving travel behavior, the built environment, and subway investment in Mexico City

    E-Print Network [OSTI]

    Guerra, Erick Strom

    2013-01-01T23:59:59.000Z

    come with a single exterior parking space. Households oftenEach has a single exterior parking space on the narrow frontEXTERIOR, LOS HÉROES ECATEPEC 74 FIGURE 4.13 REUSE OF PARKING SPACE

  3. 2.1E Sample Run Book

    E-Print Network [OSTI]

    Winkelmann, F.C.

    2010-01-01T23:59:59.000Z

    CHICAOO ItUt(BEROF SPACES EXTERIOR INTERIOR SPACE _IGHTINOWALL WINDOW ROOF =SPACE EXTERIOR-WALL WINDOW ROOF =SPACE =WALL =INTERIOR-WALL =SPACE EXTERIOR-WALL WINDOW =SPACE

  4. Daylighting Calculation in DOE-2

    E-Print Network [OSTI]

    Winkelmann, F.C

    2013-01-01T23:59:59.000Z

    the sequence: d. space reference point exterior wall windowsystem (BCS). space system to Begin Exterior Wall Loop (1)least one daylit space. 3.2.1 Exterior Daylight Availability

  5. Building America Technology Solutions for New and Existing Homes...

    Energy Savers [EERE]

    Excavationless: Exterior-Side Foundation Insulation for Existing Homes (Fact Sheet) Building America Technology Solutions for New and Existing Homes: Excavationless: Exterior-Side...

  6. Buoyancy and stratification in Boussinesq flow with applications to natural ventilation and intrusive gravity currents

    E-Print Network [OSTI]

    Flynn, Morris R.

    2006-01-01T23:59:59.000Z

    between the interior and exterior spaces, we assume q s 0exterior openings and the upper interconnecting opening ‘t’ to optimize the depth of each space

  7. Experiencing Maya Palaces: Royal Power, Space, and Architecture at Holmul, Guatemala

    E-Print Network [OSTI]

    Mongelluzzo, Ryan

    2011-01-01T23:59:59.000Z

    tied with that space and the exterior panting is betterspace. The southwestern room possessed a western exteriorspace somewhat. The southern room was accessible through three exterior

  8. Sound art and spatial practices : situating sound installation art since 1958

    E-Print Network [OSTI]

    Ouzounian, Gascia

    2008-01-01T23:59:59.000Z

    the interior and exterior spaces as well as visuallydo not represent exterior space, but were conceived andexterior architecture. Varèse claimed that: Densil Cabrera, “Sound Space and

  9. A Unified Approach for Integrated Computer-Aided Design and Manufacturing

    E-Print Network [OSTI]

    Huang, Bin

    2013-01-01T23:59:59.000Z

    by a set of bounding faces that divide and exterior space.space into domains of interior Face applied to the surfaces identifies the interior and exterior

  10. Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings

    E-Print Network [OSTI]

    Price, P.N.

    2011-01-01T23:59:59.000Z

    Building Environment and Thermal Envelope Council (BETEC)of Thermal Performance of the Exterior Envelopes ofof the Thermal Performance of the Exterior Envelopes of

  11. ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980

    E-Print Network [OSTI]

    Authors, Various

    2010-01-01T23:59:59.000Z

    well-insulated thermal envelope (exterior walls, windows,testing project is the Envelope Thermal Test Unit (ETTU). >DOE Conf. on Thermal Performance of Exterior Envelopes of

  12. Building the urban river edge : proposed connections to the water at the foot of Boston's Beacon Hill

    E-Print Network [OSTI]

    Gorini, Daniel

    1994-01-01T23:59:59.000Z

    The core of this investigation is based on the design of built form at the public urban river edge. It proposes the transformation of a portion of public park edge into public built edge. The Esplanade embankment at the ...

  13. Technical and economic evaluation of selected compact drill rigs for drilling 10,000 foot geothermal production wells

    SciTech Connect (OSTI)

    Huttrer, G.W. [Geothermal Management Company, Inc., Frisco, CO (United States)

    1997-11-01T23:59:59.000Z

    This report summarizes the investigation and evaluation of several {open_quotes}compact{close_quotes} drill rigs which could be used for drilling geothermal production wells. Use of these smaller rigs would save money by reducing mobilization costs, fuel consumption, crew sizes, and environmental impact. Advantages and disadvantages of currently-manufactured rigs are identified, and desirable characteristics for the {open_quotes}ideal{close_quotes} compact rig are defined. The report includes a detailed cost estimate of a specific rig, and an evaluation of the cost/benefit ratio of using this rig. Industry contacts for further information are given.

  14. SHASTA COUNTY The Shasta County Jail is a 115,035 square-foot facility located in Redding. Built in

    E-Print Network [OSTI]

    identified ways to improve the comfort and reduce operating costs of the jail through energy efficiency by 1997. PROJECTS IMPLEMENTED The County Jail received a comprehensive efficiency makeover that included: · Replacing the electric boiler with a natural gas-fired boiler to provide hot water for domestic, kitchen

  15. Recovery Act Weekly Video: 200 Area Asbestos Removal, U-Ancillary Demolition, 200 West Transfer Building Footings

    ScienceCinema (OSTI)

    None

    2012-06-14T23:59:59.000Z

    A weekly update of the Recovery Act at work. Demolition of U-Ancillary that was contaminated with uranium and asbestos as well as removing asbestos from the Steam Generation Plant in the 200 East Area.

  16. Report on the LOTS cruise to map foot of the slope and 2500-m isobath of Bowers Ridge

    E-Print Network [OSTI]

    New Hampshire, University of

    for Coastal and Ocean Mapping/Joint Hydrographic Center University of New Hampshire Durham, NH 03824 August 1 block 01..................................................38 Shaded-relief map of Bowers Ridge block 02..................................................39 Shaded-relief map of Bowers Ridge block 03..................................................40 Shaded

  17. Recovery Act Weekly Video: 200 Area Asbestos Removal, U-Ancillary Demolition, 200 West Transfer Building Footings

    SciTech Connect (OSTI)

    None

    2010-01-01T23:59:59.000Z

    A weekly update of the Recovery Act at work. Demolition of U-Ancillary that was contaminated with uranium and asbestos as well as removing asbestos from the Steam Generation Plant in the 200 East Area.

  18. Comparative Cost Analysis of Alternative Animal Tracing Strategies Directed Toward Foot and Mouth Disease Outbreaks in the Texas High Plains 

    E-Print Network [OSTI]

    Looney, John C.

    2010-07-14T23:59:59.000Z

    to Garner and Lack (1995) was used to carry out the research. Five health states were installed in the model including susceptible, latent, infected, immune, and depopulated. The economic model connected to the disease spread model was comprised of three... sections. The first dealt with the direct costs of depopulation, disinfection, and enforcing the quarantine zone. The second of the economic model used an input-output model to calculate the direct, indirect, and induced losses for California. The final...

  19. The Social Context of Foot-and-Mouth Disease Control in Texas: Foundations for Effective Risk Communication 

    E-Print Network [OSTI]

    Delgado, Amy Haley

    2012-02-14T23:59:59.000Z

    and at-risk animals means that animals must be gathered and held by their owners for testing and depopulation, while strict movement bans designed to slow disease spread are essentially unenforceable without the cooperation of livestock producers..., whose animals were exposed either directly or indirectly to animals, animal products, materials, people, or aerosol from the infected premises, will be quarantined, tested for FMD, and possibly depopulated. Vaccination with or without the subsequent...

  20. Party Platter $38.00 (serves 5-9) Three-Foot Sub $48.00 (serves 10-12)

    E-Print Network [OSTI]

    Milchberg, Howard

    .50 Pepsi, Diet Pepsi, Sierra Mist Bottled Water $1.65 ea Traditional Flavors Half-gallon $5.79 Three, soft tacos or bean burritos $10.99: ten piece, $44.99: fifty piece Pick-up ONLY, no delivery for Taco.65 Beverages Gallon Lemonade $10.50 Gallon Strawberry Lemonade Mixer $10.50 Six-pack Soda $4.50 Bottled Water

  1. An investigation of the bearing capacity of footings under eccentric and inclined loading on sand in a geotechnical centrifuge

    E-Print Network [OSTI]

    James, R.G.; Tanaka, H.

    1984-01-01T23:59:59.000Z

    The application of centrifuge modelling to geotechnicalADVANCES IN GEOTECHNICAL CENTRIFUGE MODELING A symposium onAdvances in Geotechnical Centrifuge Modeling was held on

  2. Low magnitude high frequency vibrations applied to the foot through the pedal of a human powered artificial gravity (HPAG) cycle

    E-Print Network [OSTI]

    Webster, Bruce Naakaii Ts'oh

    2006-01-01T23:59:59.000Z

    Astronauts are exposed to hazards unique to space travel. These hazards include radiation exposure and adaptation of the human body to the microgravity environment. For lunar and low earth orbital missions, the exposure ...

  3. Ecological evaluation of proposed discharge of dredged material from Oakland Harbor into ocean waters (Phase 2 of -42-foot project)

    SciTech Connect (OSTI)

    Word, J.Q.; Ward, J.A.; Strand, J.A.; Kohn, N.P.; Squires, A.L. (Battelle Marine Research Lab., Sequim, WA (USA))

    1990-09-01T23:59:59.000Z

    The US Army Corps of Engineers (USACE), San Francisco District, was authorized by the Water Resources Development Act of 1986 to deepen and widen the navigation channels of Inner and Outer Oakland Harbor, California, to accommodate modern deep-draft vessels. The recommended plan consists of deepening the harbor channels from the presently authorized water depth of {minus}35 ft mean lower low water (MLLW) to {minus}42 ft MLLW and supplying the harbor with adequate turning basins and berthing areas. Offshore ocean disposal of the dredged sediment is being considered, provided there is no evident of harmful ecological effects. It harmful ecological effects are not evident then the appropriate certifications from state environmental quality agencies and concurrence from the Environmental Protection Agency can be obtained to allow disposal of sediment. To help provide the scientific basis for determining whether Oakland Harbor sediments are suitable for offshore disposal, the Battelle/Marine Sciences Laboratory (MSL) collected sediment cores from 23 stations in Inner and Outer Oakland Harbor, evaluated these sediment cores geologically, performed chemical analyses for selected contaminants in sediments, conducted a series of solid phase toxicity tests with four sensitive marine invertebrates and assessed the bioaccumulation potential of sediment-associated contaminants in the tissues of Macoma Nasuta. 43 refs., 26 figs., 61 tabs.

  4. Interactions of foot-and-mouth disease virus with cells in organised lymphoid tissue influence innate and adaptive immune responses 

    E-Print Network [OSTI]

    Juleff, Nicholas Dylan

    2009-01-01T23:59:59.000Z

    to that in the controls, including rapid isotype switching to IgG antibody. These data suggest that antibody responses to sites on the surface of the virus capsid are T cell-independent whereas those directed against the non-structural proteins are T cell-dependent. CD4...

  5. Special Problem for Chapter 4: Compare the Lower Heating Values of different fuel gases per Standard Cubic Foot, recalling that

    E-Print Network [OSTI]

    2 + 3.76N2) - 1H2Ovapor + 1.88N2 0 = 1 lbmolH2 O lbmolfuel � 18.016 lbmH2 O lbmolH2 O µ -5774.6 BTU lbmH2 0 ¶ + Qout 0 = -104040 BTU/lbmolfuel + Qout Qout = 104040 BTU/lbmolfuel = 51607 BTU/lbmfuel = 266 BTU/ft3 fuel [274 BTU/SCF] For 16.043 lbm of Methane CH4 + 2 (O2 + 3.76N2) - 2H2O + CO2 + 7.52N2

  6. Microsoft Word - Chemetall Foote_Kings Mountain and Silver Peak Final EA 9-15-10-1 _3_

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE SWPAURTeC:8 3.After-Hours PolicycalciumDOE 27-15

  7. Forty-Six-Foot Tall Needle Sculpture Rises Over Arts Quad > EMC2 News > The

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8,Dist.Newof Energy Forrestal Garage Parking Procedures,

  8. D i i f S t i bilit i th B ilt E i tDesigning for Sustainability in the Built Environment Exterior Facade Design for Maximum Daylighting and Solar Power

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Facade Design for Maximum Daylighting and Solar Power GenerationGeneration A frank assessment of issues "...the art and science of daylighting is not so much about how to provide enough daylighting as how to do LIGHTING CHARACTER DUE TO DAYLIGHT VARIABILITY · PSYCHOLOGICAL BENEFITS OF· PSYCHOLOGICAL BENEFITS

  9. Building America Case Study: Excavationless Exterior-Side Foundation Insulation for Existing Homes, Minneapolis, Minnesota (Fact Sheet), Technology Solutions for New and Existing Homes, Energy Efficiency & Renewable Energy (EERE)

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJune 2,The Big Green372 Room 4F-033Whole-House

  10. Building America Case Study: Exterior Insulation Pre- and Post-Retrofit, Syracuse, New York (Fact Sheet), Whole-House Solutions for Existing Homes, Energy Efficiency & Renewable Energy (EERE)

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof Energy Future of CSP:Brookhaven TeachingCommunity-ScaleTotal Heating and

  11. Building America Case Study: Initial and Long Term Movement of Cladding Installed Over Exterior Rigid Insulation (Fact Sheet), Technology Solutions for New and Existing Homes, Energy Efficiency & Renewable Energy (EERE)

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof Energy Future of CSP:BrookhavenHygrothermal Performance of a

  12. Exterior Rigid Foam Insulation at the Edge of a Slab Foundation, Fresno, California (Fact Sheet), Building America Case Study: Efficient Solutions for New and Existing Homes, Building Technologies Office (BTO)

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2: Final EnvironmentalCounties,UnitedCommunication,1] Windows212-2012 June 2012and

  13. Stud Walls With Continuous Exterior Insulation for Factory Built Housing: New York, New York (Fact Sheet), NREL (National Renewable Energy Laboratory), Building America Case Study Technology Solutions for New and Existing Homes, Building Technologies Office (BTO)

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Site EnvironmentalEnergySafelyVirtualStephanie PriceStrategicCoordinationStrom Inc,Stud

  14. Building America Case Study: Exterior Insulation Pre- and Post-Retrofit, Syracuse, New York (Fact Sheet), Whole-House Solutions for Existing Homes, Energy Efficiency & Renewable Energy (EERE)

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube platform isEnergyMeeting |Resources »Climate RegionsCold Test House 1: *

  15. For: Delegates predominantly from business but a few places will be reserved for senior repre-sentatives from the public sector and NGOs. Business delegates are typically senior execu-

    E-Print Network [OSTI]

    Talbot, James P.

    - sentatives from the public sector and NGOs. Business delegates are typically senior execu- tives and maintain a Pro- gramme which brings together business leaders and key public sector and civil society global trends and challenges: energy and natural resource security, cities, consumption, emerging

  16. Community College Student First Year Fall to Fall Persistence: Experiences of Successful First-Time-In-College Hispanics at a Predominately Hispanic Student Community College in the South Texas/Mexico Border Region

    E-Print Network [OSTI]

    Canales, Luzelma

    2012-02-14T23:59:59.000Z

    ........................................................................... 26 Assumptions ............................................................................................ 27 Delimitations and Limitations ................................................................. 28 Significance of the Study... ....................................... 130 Table 25 Barrier Subcategories for Developmental Studies/College Readiness ........................................................................................... 133 Table 26 Knowledge and Actions for Transition from High School...

  17. AET's new energy-efficient facility gears up for production

    SciTech Connect (OSTI)

    Pucci, A.

    1993-01-01T23:59:59.000Z

    American Energy Technologies, Inc. (AET), a company based just north of Green Cove Springs, Florida, has become the largest manufacturer of solar thermal products in the U.S. Phase 1 of the construction of AET's new manufacturing facility, which commenced in October 1992, was completed in April 1993. It houses high-output tooling designed by AET to ensure affordable, high-quality solar thermal hardware which is rated among the most efficient in the world today. The AET facility has integrated a number of energy-efficient design considerations and conservation measures. The passive-solar design of the building minimizes direct solar gain in the summer and maximizes tropical winds for passive cooling. Strategically placed native landscaping requires minimal maintenance, thus reducing water consumption, and provides natural shading for the offices. The exterior walls are constructed of Poly Steel hollow-core styrofoam forms filled with pumped concrete. This design provides an insulation rate of R-22, a wind load of 160 mph, and a two-hour fire rating. The light-colored office and the plant's exterior skin assist in reducing the cooling load with the protection of Lomit, a spray-applied radiant barrier manufactured by SOLEC Corporation, which coats the office roof decks. Climate control for the manufacturing area is provided by an AET solar heating system which works in tandem with two LPG Amana Command Aire 80s for back up. Office space heating is supplied by a warm forced-air system by US Solar Corporation which utilizes a 320-square-foot solar array with a 1,000-gallon storage tank. Circulation is powered by a Siemens Solar Pro photovoltaic array and the thermal system also provides solar hot water for the manufacturing process.

  18. Demonstration Assessment of Light Emitting Diode (LED) Walkway Lighting at the Federal Aviation Administration William J. Hughes Technical Center, in Atlantic City, New Jersey

    SciTech Connect (OSTI)

    Kinzey, Bruce R.; Myer, Michael

    2008-03-18T23:59:59.000Z

    This report documents the results of a collaborative project to demonstrate a solid state lighting (SSL) general illumination product in an outdoor area walkway application. In the project, six light-emitting diode (LED) luminaires were installed to replace six existing high pressure sodium (HPS) luminaires mounted on 14-foot poles on a set of exterior walkways and stairs at the Federal Aviation Administration (FAA) William J. Hughes Technical Center in Atlantic City, New Jersey, during December, 2007. The effort was a U.S. Department of Energy (DOE) SSL Technology Gateway Demonstration that involved a collaborative teaming agreement between DOE, FAA and Ruud Lighting (and their wholly owned division, Beta LED). Pre- and post-installation power and illumination measurements were taken and used in calculations of energy savings and related economic payback, while personnel impacted by the new lights were provided questionnaires to gauge their perceptions and feedback. The SSL product demonstrated energy savings of over 25% while maintaining illuminance levels and improving illuminance uniformity. PNNL's economic analysis yielded a variety of potential payback results depending on the assumptions used. In the best case, replacing HPS with the LED luminaire can yield a payback as low as 3 years. The new lamps were quite popular with the affected personnel, who gave the lighting an average score of 4.46 out of 5 for improvement.

  19. Solar heating system at Quitman County Bank, Marks, Mississippi. Final report

    SciTech Connect (OSTI)

    None

    1980-06-01T23:59:59.000Z

    Information is provided on the solar heating system installed in a single story wood frame, cedar exterior, sloped roof building, the Quitman County Bank, a branch of the First National Bank of Clarksdale, Mississippi. It is the first solar system in the geographical area and has promoted much interest. The system has on-site temperature and power measurements readouts. The 468 square feet of Solaron air flat plate collectors provide for 2000 square feet of space heating, an estimated 60% of the heating load. Solar heated air is distributed to the 235 cubic foot rock storage box or to the load (space heating) by a 960 cubic feet per minute air handler unit. A 7.5 ton Carrier air-to-air heat pump with 15 kilowatts of electric booster strips serve as a back-up (auxiliary) to the solar system. Motorized dampers control the direction of airflow and back draft dampers prevent thermal siphoning of conditioned air. The system was turned on in September 1979, and acceptance testing completed in February 1980. This is a Pon Cycle 3 Project with the Government sharing $13,445.00 of the $24,921 Solar Energy System installation cost.

  20. MILLER FREEMAN MILLER FREEMAN is a 215-foot fisheries and oceanographic research vessel and is one of the largest research trawlers

    E-Print Network [OSTI]

    3208, 185 HP engine (21 kts) · Zodiac 15' inflatable o 25 hp Outboard motor Engineering General Manufacturer: General Motors o Rated power: 2,200 hp · Propeller o Type: Controllable Pitch o Quantity: 1 o Freeman Complement · Commissioned officers: 7 · Licensed Engineers: 4 · Crew: 23 · Scientists: 11 (max

  1. Endovascular Treatment of Diabetic Foot in a Selected Population of Patients with Below-the-Knee Disease: Is the Angiosome Model Effective?

    SciTech Connect (OSTI)

    Fossaceca, Rita, E-mail: rfossaceca@hotmail.com; Guzzardi, Giuseppe, E-mail: guz@libero.it; Cerini, Paolo, E-mail: cerini84@hotmail.it ['Maggiore della Carita' Hospital, University of Eastern Piedmont 'Amedeo Avogadro', Department of Diagnostic and Interventional Radiology (Italy); Cusaro, Claudio, E-mail: claudio.cusaro@libero.it ['Maggiore della Carita' Hospital, Department of Diabetic Complications (Italy); Stecco, Alessandro, E-mail: a.stecco@libero.it; Parziale, Giuseppe, E-mail: giuseppeparziale@gmail.com; Perchinunno, Marco, E-mail: marcoperchinunno@gmail.com; Bonis, Marco De, E-mail: marco_deb@hotmail.it; Carriero, Alessandro, E-mail: profcarriero@virgilio.it ['Maggiore della Carita' Hospital, University of Eastern Piedmont 'Amedeo Avogadro', Department of Diagnostic and Interventional Radiology (Italy)

    2013-06-15T23:59:59.000Z

    Purpose. To evaluate the efficacy of percutaneous transluminal angioplasty (PTA) in a selected population of diabetic patients with below-the-knee (BTK) disease and to analyze the reliability of the angiosome model. Methods. We made a retrospective analysis of the results of PTA performed in 201 diabetic patients with BTK-only disease treated at our institute from January 2005 to December 2011. We evaluated the postoperative technical success, and at 1, 6, and 12 months' follow-up, we assessed the rates and values of partial and complete ulcer healing, restenosis, major and minor amputation, limb salvage, and percutaneous oximetry (TcPO{sub 2}) (Student's t test). We used the angiosome model to compare different clinicolaboratory outcomes in patients treated by direct revascularization (DR) from patients treated with indirect revascularization (IR) technique by Student's t test and the {chi}{sup 2} test. Results. At a mean {+-} standard deviation follow-up of 17.5 {+-} 12 months, we observed a mortality rate of 3.5 %, a major amputation rate of 9.4 %, and a limb salvage rate of 87 % with a statistically significant increase of TcPO{sub 2} values at follow-up compared to baseline (p < 0.05). In 34 patients, treatment was performed with the IR technique and in 167 by DR; in both groups, there was a statistically significant increase of TcPO{sub 2} values at follow-up compared to baseline (p < 0.05), without statistically significant differences in therapeutic efficacy. Conclusion. PTA of the BTK-only disease is a safe and effective option. The DR technique is the first treatment option; we believe, however, that IR is similarly effective, with good results over time.

  2. The potential role of wildlife in the spread and control of foot and mouth disease in an extensive livestock management system 

    E-Print Network [OSTI]

    Highfield, Linda

    2009-05-15T23:59:59.000Z

    and in the context of political, economic and social pressures. Disease spread models can be used to evaluate the design of optimal control strategies, for policy formulation, for gap analysis and to develop and refine research agendas when disease is not present...

  3. June 25, 2004 Original Article Submission to Journal of Biomechanics 1 An ankle-foot orthosis powered by artificial pneumatic muscles

    E-Print Network [OSTI]

    America. The Lokomat uses four electrical motors to assist hip and knee movement as the patient steps the consistency of locomotor training. One device that is commercially available, the Lokomat (Colombo et al

  4. Do it yourself lighting power survey: lighting power audit for use with the Massachusetts type watts per square foot method of calculating a building's lighting power budget

    SciTech Connect (OSTI)

    Not Available

    1980-06-01T23:59:59.000Z

    Advantages of the self-audit approach to energy conservation are presented. These are that it is cheaper to do it yourself; the employees become part of the corporate conservation effect; and no one knows the building and its needs better than the occupant. Steps described in the lighting survey procedure are: (1) divide the building into categories; (2) determine the total square footage for each category; (3) assign a power allowance for each category; (4) multiply the total square footage for each category by the respective power allowances; (5) add the budget sub-totals for each category to determine total building budget; and (6) walk through the building room-by-room and calculate the connected lighting load fixture-by-fixture. Some worksheets are provided. (MCW)

  5. SOLAR MERIDIONAL CIRCULATION FROM DOPPLER SHIFTS OF THE Fe I LINE AT 5250 A AS MEASURED BY THE 150-FOOT SOLAR TOWER TELESCOPE AT THE MT. WILSON OBSERVATORY

    SciTech Connect (OSTI)

    Ulrich, Roger K. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095-1562 (United States)

    2010-12-10T23:59:59.000Z

    Doppler shifts of the Fe I spectral line at 5250 A from the full solar disk obtained over the period 1986 to 2009 are analyzed to determine the circulation velocity of the solar surface along meridional planes. Simultaneous measurements of the Zeeman splitting of this line are used to obtain measurements of the solar magnetic field that are used to select low field points and impose corrections for the magnetically induced Doppler shift. The data utilized is from a new reduction that preserves the full spatial resolution of the original observations so that the circulation flow can be followed to latitudes of 80{sup 0} N/S. The deduced meridional flow is shown to differ from the circulation velocities derived from magnetic pattern movements. A reversed circulation pattern is seen in polar regions for three successive solar minima. A surge in circulation velocity at low latitudes is seen during the rising phases of cycles 22 and 23.

  6. 1. Challenge Problems 1.1. Magic Worms. A magic worm is an adult if it is one foot long; if it is less

    E-Print Network [OSTI]

    Kierstead, Hal

    ? arbitrarily many? How do these answers change if you are given two days? 1.2. Treasure Island. Hunting through

  7. We are on a two-acre site near the CSU campus in Fort Collins. We have a 40-foot climbing tower and

    E-Print Network [OSTI]

    tower and several high elements set on poles up to 40 feet in the air. But our Challenge course is more

  8. Bio-inspired Active Soft Orthotic Device for Ankle Foot Pathologies Yong-Lae Park, Bor-rong Chen, Diana Young, Leia Stirling,

    E-Print Network [OSTI]

    Napp, Nils

    , Diana Young, Leia Stirling, Robert J. Wood, Eugene Goldfield, and Radhika Nagpal Abstract-- We describe of the NSF. Y.-L. Park, D. Young, and L. Stirling are with the Wyss Institute, Harvard University, Boston, MA 02115. {ylpark, diana.young, leia.stirling}@wyss.harvard.edu B. Chen is with the School of Engineering

  9. Calibration of Cotton Planting Mechanisms.

    E-Print Network [OSTI]

    Smith, H. P. (Harris Pearson); Byrom, Mills H. (Mills Herbert)

    1936-01-01T23:59:59.000Z

    per foot. To obtain a perfect stand of one plant to Foot, a minimum of 1 to a maximum of 11 plants per foot wonld have to be thinned out. The number for picker wheel- drop planting mechanisms ranged from a minimum of 2 to a maxi- mum of 27 plants... per foot, requiring the removal of from 1 to 26 nlants per foot to leave one plant per foot. CONTENTS Introduction History of cotton planter development ------------.---------------------------------- Cottonseed planting mechanisms Requirements...

  10. Moisture Durability of Vapor Permeable Insulating Sheathing (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2013-10-01T23:59:59.000Z

    In this project, Building America team Building Science Corporation researched some of the ramifications of using exterior, vapor permeable insulation on retrofit walls with vapor permeable cavity insulation. Retrofit strategies are a key factor in reducing exterior building stock consumption.

  11. CX-005557: Categorical Exclusion Determination | Department of...

    Broader source: Energy.gov (indexed) [DOE]

    Services Building, and Village Hall; 3) convert exterior lighting wall packs to light emitting diode (LED) at Village Hall; 4) convert exterior lighting to LED at Village Hall; 5)...

  12. Laplacian Growth: Random Matrices and singularities of growing

    E-Print Network [OSTI]

    Fominov, Yakov

    (exterior)-incompressible liquid with high viscosity Oil (exterior)-incompressible liquid with high fronts 2007 #12;#12;#12;Growing branches as Stokes lines Stochastic geometry: measure on a space

  13. MATH 136: DIFFERENTIAL GEOMETRY Fall 2013 Syllabus

    E-Print Network [OSTI]

    Lau, Siu-Cheong

    -space and to various notions of curvature using exterior differential calculus. It also gives fields along a curve Exterior differential calculus Regular surfaces in 3-space Area and orientation

  14. CAMPUS INFRASTRUCTURE & SERVICES CIS-Standard-Lighting

    E-Print Network [OSTI]

    Viglas, Anastasios

    ...........................................................................................................5 5.6 Light fittings and lux performance requirements for various University space types.....5 5...........................................................................12 5.8 EXTERIOR LIGHTING.......................................................................................................12 5.8.2 Exterior Light Poles, Fixings and Wiring

  15. Joint Health and Safety Committee Faculty of Applied Science and Engineering

    E-Print Network [OSTI]

    .3 Lack of feedback from 8-3000 discussed at February meeting of Faculty Space Co-ordinators' Group alarm strobe light (exterior) and automatic unlocking of exterior doors implemented 6 Materials Science

  16. THERMAL PERFORMANCE OF MANAGED WINDOW SYSTEMS

    E-Print Network [OSTI]

    Selkowitz, S. E.

    2011-01-01T23:59:59.000Z

    on Thermal Performance of the Exterior Envelopes ofof thermal loads resulting from the building envelope areThermal Test Facility, LhL-9653, prepared for the ASHRAE/DOE Conference-on"t:heThermal Performance the Exterior Envelope

  17. UNIVERSIDAD SIMN BOLVAR Grfico 1Distribucin de aspirantes preinscritos segn proceso y tipo de carrera. Procesos 2001-2014

    E-Print Network [OSTI]

    Vásquez, Carlos

    y tipo de carrera. Procesos 2001-2014 Fuente: Dirección de Admisión y Control de Estudios, informes Turismo Administración Hotelera Comercio Exterior Mantenimiento Aeronáutico Organización Empresarial Tecnología Eléctrica Tecnología Electrónica Tecnología Mecánica Subtotal Litoral Comercio Exterior

  18. Improving access to care by determining key elements of culturally and linguistically appropriate healthcare interventions for Hispanic populations in Texas using a Delphi technique

    E-Print Network [OSTI]

    Ponder, Linda Milam

    2007-04-25T23:59:59.000Z

    , PhD, MSc, BSc Executive Director, Centro Comunitario Mexicano DFW Secretaria, Comisi?n de Salud, Consejo Consultivo del Instituto de los Mexicanos en el Exterior IME/Secretaria de Relaciones Exteriores Dallas Vicky Contreras, MSW, LCSW...

  19. Building envelope membrane as flexible formwork for concrete panels

    E-Print Network [OSTI]

    Sprague, Chelsea Lynn

    2014-01-01T23:59:59.000Z

    This thesis investigates the use of a building envelope membrane as fabric-like formwork for exterior cladding systems in buildings. The exterior wall system (i.e., fagade) has evolved to meet the demands of the built ...

  20. c37a.xls

    Gasoline and Diesel Fuel Update (EIA)

    2 per Building (million Btu) per Square Foot (thousand Btu) per Building (thousand dollars) per Square Foot (dollars) per Thousand Pounds (dollars) All Buildings...

  1. c33a.xls

    Gasoline and Diesel Fuel Update (EIA)

    2 per Building (gallons) per Square Foot (gallons) per Building (thousand dollars) per Square Foot (dollars) per Gallon (dollars) All Buildings ......

  2. Domain-specific translator and optimizer for massive on- chip parallelism

    E-Print Network [OSTI]

    Unat, Didem

    2012-01-01T23:59:59.000Z

    of the engine block and around the joints in the foot imageof the engine block and around the joints in the foot image

  3. Washington County- Solar Ordinance

    Broader source: Energy.gov [DOE]

    Provides for zoning restrictions on solar energy systems, including (1) six foot setbacks; (2) 20 foot height limitations on freestanding systems; (3) limitations on square feet of freestanding...

  4. Feasibility of Achieving a Zero-Net-Energy, Zero-Net-Cost Homes

    E-Print Network [OSTI]

    Al-Beaini, S.

    2010-01-01T23:59:59.000Z

    coating, and argon?filled cavities.  Exterior Doors: Kevlar reinforced door shell with vacuum?sealed  aerogel 

  5. Daylighting Calculation in DOE-2

    E-Print Network [OSTI]

    Winkelmann, F.C

    2013-01-01T23:59:59.000Z

    4 2.3 Daylight46 3.2.1 Exterior Daylight Availabilityof Interior Daylight Illuminance . . . . . . . . . . ..21

  6. Hydrophilic structures for condensation management in refrigerator appliances

    DOE Patents [OSTI]

    Kuehl, Steven John; Vonderhaar, John J; Wu, Guolian; Wu, Mianxue

    2014-10-21T23:59:59.000Z

    A refrigerator appliance that includes a freezer compartment having a freezer compartment door, and a refrigeration compartment having at least one refrigeration compartment door. The appliance further includes a mullion with an exterior surface. The mullion divides the compartments and the exterior surface directs condensation toward a transfer point. The appliance may also include a cabinet that houses the compartments and has two sides, each with an exterior surface. Further, at least one exterior surface directs condensation toward a transfer point.

  7. Molten metal reactors

    DOE Patents [OSTI]

    Bingham, Dennis N; Klingler, Kerry M; Turner, Terry D; Wilding, Bruce M

    2013-11-05T23:59:59.000Z

    A molten metal reactor for converting a carbon material and steam into a gas comprising hydrogen, carbon monoxide, and carbon dioxide is disclosed. The reactor includes an interior crucible having a portion contained within an exterior crucible. The interior crucible includes an inlet and an outlet; the outlet leads to the exterior crucible and may comprise a diffuser. The exterior crucible may contain a molten alkaline metal compound. Contained between the exterior crucible and the interior crucible is at least one baffle.

  8. Molten metal reactor and method of forming hydrogen, carbon monoxide and carbon dioxide using the molten alkaline metal reactor

    DOE Patents [OSTI]

    Bingham, Dennis N.; Klingler, Kerry M.; Turner, Terry D.; Wilding, Bruce M.

    2012-11-13T23:59:59.000Z

    A molten metal reactor for converting a carbon material and steam into a gas comprising hydrogen, carbon monoxide, and carbon dioxide is disclosed. The reactor includes an interior crucible having a portion contained within an exterior crucible. The interior crucible includes an inlet and an outlet; the outlet leads to the exterior crucible and may comprise a diffuser. The exterior crucible may contain a molten alkaline metal compound. Contained between the exterior crucible and the interior crucible is at least one baffle.

  9. Chemical vapor deposited diamond-on-diamond powder composites (LDRD final report)

    SciTech Connect (OSTI)

    Panitz, J.K.; Hsu, W.L.; Tallant, D.R.; McMaster, M.; Fox, C.; Staley, D.

    1995-12-01T23:59:59.000Z

    Densifying non-mined diamond powder precursors with diamond produced by chemical vapor infiltration (CVI) is an attractive approach for forming thick diamond deposits that avoids many potential manufacturability problems associated with predominantly chemical vapor deposition (CVD) processes. The authors developed techniques for forming diamond powder precursors and densified these precursors in a hot filament-assisted reactor and a microwave plasma-assisted reactor. Densification conditions were varied following a fractional factorial statistical design. A number of conclusions can be drawn as a result of this study. High density diamond powder green bodies that contain a mixture of particle sizes solidify more readily than more porous diamond powder green bodies with narrow distributions of particle sizes. No composite was completely densified although all of the deposits were densified to some degree. The hot filament-assisted reactor deposited more material below the exterior surface, in the interior of the powder deposits; in contrast, the microwave-assisted reactor tended to deposit a CVD diamond skin over the top of the powder precursors which inhibited vapor phase diamond growth in the interior of the powder deposits. There were subtle variations in diamond quality as a function of the CVI process parameters. Diamond and glassy carbon tended to form at the exterior surface of the composites directly exposed to either the hot filament or the microwave plasma. However, in the interior, e.g. the powder/substrate interface, diamond plus diamond-like-carbon formed. All of the diamond composites produced were grey and relatively opaque because they contained flawed diamond, diamond-like-carbon and glassy carbon. A large amount of flawed and non-diamond material could be removed by post-CVI oxygen heat treatments. Heat treatments in oxygen changed the color of the composites to white.

  10. Heat pump having improved defrost system

    DOE Patents [OSTI]

    Chen, Fang C. (Knoxville, TN); Mei, Viung C. (Oak Ridge, TN); Murphy, Richard W. (Knoxville, TN)

    1998-01-01T23:59:59.000Z

    A heat pump system includes, in an operable relationship for transferring heat between an exterior atmosphere and an interior atmosphere via a fluid refrigerant: a compressor; an interior heat exchanger; an exterior heat exchanger; an accumulator; and means for heating the accumulator in order to defrost the exterior heat exchanger.

  11. Heat pump having improved defrost system

    DOE Patents [OSTI]

    Chen, F.C.; Mei, V.C.; Murphy, R.W.

    1998-12-08T23:59:59.000Z

    A heat pump system includes, in an operable relationship for transferring heat between an exterior atmosphere and an interior atmosphere via a fluid refrigerant: a compressor; an interior heat exchanger; an exterior heat exchanger; an accumulator; and means for heating the accumulator in order to defrost the exterior heat exchanger. 2 figs.

  12. ENERGY PARTITION FOR THE LINEAR RADIAL WAVE RAPHAL CTE, CARLOS E. KENIG, AND WILHELM SCHLAG

    E-Print Network [OSTI]

    Côte, Raphaël

    formulas for the space partition of the energy, as time goes to innity. We show that the exterior energy (f, g) at time 0. The origin of our work lies in the exterior energy estimates obtained by Duyckaerts inequality will hold for all (f, g). This will be based on a computation of the asymptotic exterior energy

  13. GLOBAL EXISTENCE RESULTS AND UNIQUENESS FOR DISLOCATION EQUATIONS

    E-Print Network [OSTI]

    Recanati, Catherine

    is the force created by ev- erything exterior to the dislocation line, like the exterior stress applied on the time variable. Here ? denotes the convolution is space, namely (2) (c 0 (#1;; t) ? 11 t )(x) = Z R N c exterior to the dislocation line. We refer to Alvarez et al. [3] for a detailed presentation

  14. ANNUAL HEATING AND COOLING REQUIREMENTS AND DESIGN DAY PERFORMANCE FOR A RESIDENTIAL MODEL IN SIX CLIMATES: A COMPARISON OF NBSLD, BLAST 2, AND DOE-2.1

    E-Print Network [OSTI]

    Carroll, William L.

    2011-01-01T23:59:59.000Z

    OCCUPIED-SPACE EAST-CAVITY'" EXTERIOR-WALL HEIGHT"" 8.0SPACE-CONDITIONS =OCCUPIED-SPACr EAST-CAVITY "" EXTERIOR-SPACE AREA'" 1200 VOLUHE '" 2250 ZONE-TYPE '" UNCONDITIONED WEIGHTING-FACTOR '" WF-ATTIC FURN-FRACTION LIGHTING-TYPE "" INCAND Z "" 8.0 EXTERIOR-\\

  15. Resonance and Capture of Jupiter Comets , J.E. Marsden

    E-Print Network [OSTI]

    Koon, Wang Sang

    , are phase space conduits transporting material to and from Jupiter and between the interior and exterior while the exterior heliocentric orbit is near the 2:3 resonance. An important feature of the dynamics of trans- port between resonances interior and exterior to Jupiter's orbit is covered, following

  16. A completely iterative method for the infinite domain electrostatic problem with nonlinear dielectric media

    E-Print Network [OSTI]

    Dayal, Kaushik

    coupling a b s t r a c t We present an iterative method for the solution of the exterior all-space the device over all space, thus leading to an exterior electrostatic problem. In addition to this complexity in revised form 16 June 2011 Accepted 4 July 2011 Available online 20 July 2011 Keywords: Exterior

  17. To appear in: S eminaire de Probabilit es, XXXVI Lecture Notes in Mathematics

    E-Print Network [OSTI]

    Arnaudon, Marc

    to Exterior Bundles 27 8. Complete Lifts to Dirac Bundles 31 9. Martingales in the Tangent Space Related under taking derivatives (or exterior derivatives) of families of martingales and is inher­ ited to diffusions on the exterior cotangent bundle with the de Rham­Hodge Laplacian as generator. Moreover

  18. Self-similar asymptotics of solutions to the Navier-Stokes system

    E-Print Network [OSTI]

    Iftimie, Dragoº

    for the Navier-Stokes equations considered either in the whole space Rn , n 2, or in an exterior domain dependsSelf-similar asymptotics of solutions to the Navier-Stokes system in two dimensional exterior Navier-Stokes equations with Dirichlet boundary con- dition in the exterior of one obstacle. Assuming

  19. A Crossing-Sensitive Third-Order Factorization for Dependency Parsing Emily Pitler

    E-Print Network [OSTI]

    Tomkins, Andrew

    in Pitler et al. (2013) have some similarities: both use O(n4) time and O(n3) space, using sub-problems over intervals with one exterior vertex, which are constructed using one free split point. The two parsers differ in how the exterior vertex is used: Koo and Collins (2010) use the exterior vertex to store a grandparent

  20. ISOVECTOR FIELDS AND SIMILARITY SOLUTIONS FOR 1-D LINEAR POROELASTICITY

    E-Print Network [OSTI]

    )). Let {x1 , x2 , ..., xn } be a coordinate cover of the vector space En. The exterior algebra (En real-valued C functions on En and k (En), 1 k n is the vector space of all exterior forms of degree k poroelasticity is calculated in this paper by using exterior calculus. Similarity solutions for some special

  1. To appear in: Seminaire de Probabilites, XXXVI Lecture Notes in Mathematics

    E-Print Network [OSTI]

    Thalmaier, Anton

    . Martingales in the Tangent Space Related to Harmonic Maps 33 10. Martingales in the Exterior Tangent Bundle, the martingale property is preserved under taking derivatives (or exterior derivatives) of families of martingales and is inher- ited to diffusions on the exterior cotangent bundle with the de Rham-Hodge Laplacian

  2. Key Request (Last) (First)

    E-Print Network [OSTI]

    Carrington, Emily

    will be accessing. For Johnson Hall exterior door access bring a copy of this form to the Earth & Space SciencesKey Request Form Name: (Last) (First) Contact Info Keys Cardswipe UW Email: Hitchcock Exterior Door Room:_________ Room:_________ Johnson Room:_________ Room:_________ Kincaid Exterior Door Room

  3. hard copy ISSN 1974-3041 on-line ISSN 1974-305X

    E-Print Network [OSTI]

    Ceragioli, Francesca

    A space-time BIE method for wave equation exterior problems. The Neumann case. S. Falletta, G. Monegato, L accettato nel mese di Settembre 2010 #12;A space-time BIE method for wave equation exterior problems problems, in particular the exterior one, in the next section we derive a space-time hypersingular boundary

  4. SYMMETRIC POWERS OF SYMMETRIC BILINEAR FORMS SE'AN MCGARRAGHY

    E-Print Network [OSTI]

    -dimensional K-vect* *or spaces under direct sum and tensor product is a ~-ring, with the exterior powers actinVn-dimensional vector space V overVK. B* *ourbaki (see [1, Ch. 9, eqn. (37)]) defined on kV the k-fold exterior properties and compute their classical invariants. We relate these to ea* *rlier results on exterior

  5. Hypoelliptic vector fields, cohomology of groups, Diophantine approximation...

    E-Print Network [OSTI]

    El Kacimi, Aziz

    with fibre C, E is the space of functions M - C of class C. ii) If E is the rth exterior power. ii) If E is the rth exterior power of the cotangent bundle TM, E is the space of differential forms with fibre C, E is the space of functions M - C of class C. ii) If E is the rth exterior power

  6. TRANSACTIONS OF THE AMERICAN MATHEMATICAL SOCIETY

    E-Print Network [OSTI]

    Eisenbud, David

    space and minimal doubly infinite free resolutions over its "Koszul dual" exterior algebra. Among the exterior algebra E = V and their relation to modules over S = sym W and sheaves on projective space P-9947(03)03291-4 Article electronically published on July 10, 2003 SHEAF COHOMOLOGY AND FREE RESOLUTIONS OVER EXTERIOR

  7. MANDATORY MEASURES OUTDOOR LIGHTING CONTROLS

    E-Print Network [OSTI]

    California at Davis, University of

    EXTERIOR SPACES COMPLY WITH TITLE 24 There are two major steps for exterior spaces to comply with Title 24 for exterior space. A space complies with these requirements if the actual lighting power used in the space. Backlight Backlight includes all illumination that is in the space between the ground and 80 degrees above

  8. 2.1E Supplement

    E-Print Network [OSTI]

    Winkelmann, F.C.

    2010-01-01T23:59:59.000Z

    BUILDING-LOCATION, SPACE, EXTERIOR-WALL, DOOR, WINDOW,N M E OF SPACES U B R SPACE EXTERIOR SPACE*FLO0R MULTIPLIERd i t i o n s = space_cond exterior-wall x = 0 y = 0 azimuth

  9. Dipartimento di Matematica J. DAVILA, M. DEL PINO, M. MUSSO

    E-Print Network [OSTI]

    Ceragioli, Francesca

    , 1 space or in a exterior domain. We refer the reader for instance to [2, 3-EMDEN-FOWLER EQUATION IN EXTERIOR DOMAINS Rapporto interno N. 3, febbraio 2006 Politecnico di Torino Corso Duca degli Abruzzi, 24-10129 Torino-Italia #12;THE SUPERCRITICAL LANE-EMDEN-FOWLER EQUATION IN EXTERIOR DOMAINS JUAN

  10. CONCEPT LABORATORY HUMAN TESTING APPROVAL &

    E-Print Network [OSTI]

    Prosthesis RF Ablation Probe Diabetes Matrices 3D-Printed Soy Scaffolds Flexible Prosthetic Foot Adaptable

  11. Controlling Coyotes With Snares

    E-Print Network [OSTI]

    Texas Wildlife Services

    2008-04-15T23:59:59.000Z

    , the swivelandlockingdevicecanberemovedandused on another snare. For more information and assistance, contact the nearest office of the Texas AgriLife Extension Service?Wildlife Services. Figure 3. Figure 2. front foot hind foot front foot hind foot Coyote Tracks Dog Tracks 2 1 ? 2 i n c h e...

  12. The development of MRI for the determination of porosity distribution in reservoir core samples

    E-Print Network [OSTI]

    Shivers, Jon Blake

    1991-01-01T23:59:59.000Z

    Sandstone appeared to be very isotropic while the Austin Chalk exhibited varying degrees of correlation in the directions considered. A comparison between the correlation of MRI derived core plug size porosity distributions and foot by foot whole core.... . Spatial Correlation of Porosity Data. . . . . . . . . . . . . . . . . . . . . . Comparison with Foot by Foot Vertical Data. . Composite Sample Distribution. . Reproducibility. . 22 , 25 . . . . 30 . . . . . 4 2 . 44 . 47 CHAPTER V ? CONCLUSIONS...

  13. Last Updated: 3/25/2014 WHIFFLEBALL

    E-Print Network [OSTI]

    Ginzel, Matthew

    , or synthetic) which covers the foot attached to a composition bottom. iii. Shoes with rubber cleats

  14. Last Updated: 8/3/2010 ULTIMATE FRISBEE

    E-Print Network [OSTI]

    Ginzel, Matthew

    , or synthetic) which covers the foot attached to a composition bottom. iii. Shoes with rubber cleats

  15. Last Updated: 8/3/2010 OUTDOOR 3V3 SOCCER

    E-Print Network [OSTI]

    Ginzel, Matthew

    , or synthetic) which covers the foot attached to a composition bottom. iii. Shoes with rubber cleats

  16. Last Updated: 4/11/2013 WHIFFLEBALL

    E-Print Network [OSTI]

    Holland, Jeffrey

    , or synthetic) which covers the foot attached to a composition bottom. iii. Shoes with rubber cleats

  17. Last Updated: 6/3/2011 3V3 OUTDOOR SOCCER

    E-Print Network [OSTI]

    Fernández-Juricic, Esteban

    , or synthetic) which covers the foot attached to a composition bottom. iii. Shoes with rubber cleats

  18. 4 JULY 2003, GSA TODAY Atmospheric levels of CO2 are com-

    E-Print Network [OSTI]

    Catling, David C.

    by predominantly colder or predominantly warmer episodes, called icehouses and green- houses (Frakes et al., 1992

  19. Control of edge effects of oxidant electrode

    DOE Patents [OSTI]

    Carr, Peter (Utica, MI); Chi, Chen H. (Sterling Heights, MI)

    1981-09-08T23:59:59.000Z

    Described is an electrode assembly comprising; a. a porous electrode having a first and second exterior face with a cavity formed in the interior between said exterior faces thereby having first and second interior faces positioned opposite the first and second exterior faces; b. a counter electrode positioned facing each of the first and second exterior faces of the porous electrode; c. means for passing an oxidant through said porous electrode; and d. screening means for blocking the interior face of the porous electrode a greater amount than the blocking of the respective exterior face of the porous electrode, thereby maintaining a differential of oxidant electrode surface between the interior face and the exterior face. The electrode assembly is useful in a metal, halogen, halogen hydrate electrical energy storage device.

  20. Method for control of edge effects of oxidant electrode

    DOE Patents [OSTI]

    Carr, Peter (Utica, MI); Chi, Chen H. (Sterling Heights, MI)

    1980-12-23T23:59:59.000Z

    Described is an electrode assembly comprising; a. a porous electrode having a first and second exterior face with a cavity formed in the interior between said exterior faces thereby having first and second interior faces positioned opposite the first and second exterior faces; b. a counter electrode positioned facing each of the first and second exterior faces of the porous electrode; c. means for passing an oxidant through said porous electrode; and d. screening means for blocking the interior face of the porous electrode a greater amount than the blocking of the respective exterior face of the porous electrode, thereby maintaining a differential of oxidant electrode surface between the interior face and the exterior face. The electrode assembly is useful in a metal, halogen, halogen hydrate electrical energy storage device.

  1. Boundary Integral Equations and the Method of Boundary Elements

    E-Print Network [OSTI]

    Tsynkov, Semyon V.

    to consider the interior and exterior Dirichlet and Neumann boundary value problems for the Laplace equation: u 2u x2 1 + 2u x2 2 + 2u x2 3 = 0. Let be a bounded domain of the three-dimensional space R3 and exterior Dirichlet problems, respectively, and problems (13.1b) and (13.1d) are the interior and exterior

  2. SYMMETRIC POWERS OF SYMMETRIC BILINEAR FORMS AN MCGARRAGHY

    E-Print Network [OSTI]

    ­dimensional vector space V over K. Bourbaki (see [1, Ch. 9, eqn. (37)]) defined on V k V the k­fold exterior power V these to earlier results on exterior powers of such forms. 1991 AMS Subject Classification: 11E04, 11E81 Keywords: exterior power, symmetric power, pre­#­ring, #­ring, #­ring­augmentation, symmetric bilinear form, Witt

  3. INTRODUCTION TO DE RHAM COHOMOLOGY REDMOND MCNAMARA

    E-Print Network [OSTI]

    May, J. Peter

    bundle, (TM) T M. Definition 1.10. Define the kth exterior power of a vector space F with itself k F k.11. For a vector bundle E over the base space B with fiber F we define the kth exterior power k E pB k -1 (p) p, vector-space sense. Remark 1.12. The dual and the exterior product not only define new objects

  4. Relations between Points and Subsets Assume given a metric or topological space X and any subset A X. We discuss

    E-Print Network [OSTI]

    Boardman, J. Michael

    Relations between Points and Subsets Assume given a metric or topological space X and any subset - A of A. We call x an exterior point of A. Since x N, these points never lie in A. They form the exterior exterior 2. x has a neighborhood N with x A Int limit non-empty N - x A. x A Fr limit 3. x has

  5. Veterinary Medicine Research Facility 3B Sustainability Features Veterinary Medicine 3B is a four-story, 76,000 assignable square foot research building dedicated to protecting and

    E-Print Network [OSTI]

    Schladow, S. Geoffrey

    ; faucets are activated by automatic sensors, powered by batteries recharged by small turbines receiving, prompting photo sensors to turn off electric lights when enough natural light is available. Strategic

  6. COVER: The first building constructed completely under the auspices of the UCONN 2000 program, the 199,000-square-foot chemistry building has won prizes for its architects and praise from students and faculty alike.

    E-Print Network [OSTI]

    Holsinger, Kent

    the violations, the estimated costs and proposed funding sources. As review and re-inspection activities proceed and manage its capital resources most effectively. The Master Plan informs and adjusts the planning buildings, identifying deferred maintenance needs and their approximate costs, and an accounting of all

  7. Building America Webinar: High Performance Enclosure Strategies...

    Energy Savers [EERE]

    Webinar: High Performance Enclosure Strategies: Part II, New Construction - August 13, 2014 - Cladding Attachment Over Thick Exterior Rigid Insulation Building America Webinar:...

  8. Building America Technology Solutions for New and Existing Homes...

    Broader source: Energy.gov (indexed) [DOE]

    and field evaluations of in-service residential roofs. Application of Spray Foam Insulation Under Plywood and OSB Roof Sheathing More Documents & Publications Exterior Rigid...

  9. Building America Technology Solutions for New and Existing Homes...

    Broader source: Energy.gov (indexed) [DOE]

    investigated issues to better understand the mechanics behind the addition of insulation to the exterior of buildings to increase the thermal resistance of wood-framed walls...

  10. artificial compressibility method: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    solutions of the Incompressible Navier Stokes system on exterior domains via the artificial compressibility method Mathematical Physics (arXiv) Summary: In this paper we study...

  11. artificial length scales: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wingspan in birds is constrained close to mass (M 13) because of optimisation for lift production, which limits opportunities for exterior morphological change. Within the...

  12. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    pump, treat, LEED, Gold, treatment, facility, 200 West Groundwater Treatment Facility Area: 200 West Description: Exterior of the facility's other process building,...

  13. CX-000200: Categorical Exclusion Determination | Department of...

    Broader source: Energy.gov (indexed) [DOE]

    the Chandler Municipal Court with high efficiency windows, Installation of LED (light-emitting diode) Exterior Parking Lot, Walkilowattay and Area Lighting, Install kilovolt AR...

  14. CX-001756: Categorical Exclusion Determination | Department of...

    Broader source: Energy.gov (indexed) [DOE]

    3) retrofit of city traffic signals and pedestrian crossing signals with light-emitting diode lighting, 4) retrofit of exterior security and parking lot lighting for city...

  15. U.S. Department of Energy NEPA Categorical Exclusion Determination...

    Broader source: Energy.gov (indexed) [DOE]

    3) retrofit of city traffic signals and pedestrian crossing signals with light-emitting diode lighting, 4) retrofit of exterior security and parking lot lighting for city...

  16. CARTOON REASEARCH LIBRARY COST ESTIMATE STUDY SULLIVANT HALL

    E-Print Network [OSTI]

    Exterior Stairs Existing Toilet Rooms Vertical Circulation Structure Natural Gas Water System Sanitary physical presence on campus · Create collection identity · Provide collection security · Provide

  17. Tax Deduction Qualified Software: EnergyPlus version 7.0.0.036

    Broader source: Energy.gov (indexed) [DOE]

    exterior lighting controls." (ix) Daylighting (sidelighting, skylights, or tubular daylight devices). "The EnergyPlus software models sidelighting, skylights, and tubular...

  18. Tax Deduction Qualified Software: EnergyPlus version 5.0.0.031

    Broader source: Energy.gov (indexed) [DOE]

    exterior lighting controls." (ix) Daylighting (sidelighting, skylights, or tubular daylight devices). "The EnergyPlus software models sidelighting, skylights, and tubular...

  19. Tax Deduction Qualified Software - EnergyPlus version 3.0.0.028

    Broader source: Energy.gov (indexed) [DOE]

    exterior lighting controls." (ix) Daylighting (sidelighting, skylights, or tubular daylight devices). "The EnergyPlus software models sidelighting, skylights, and tubular...

  20. BUILDING TECHNOLOGIES PROGRAM Tax Deduction Qualified Software

    Broader source: Energy.gov (indexed) [DOE]

    interior and exterior lighting controls, such as occupancy sensors, time-clocks, and daylight-sensitive photocells for stepped or continuous dimming of electric lighting and the...

  1. Tax Deduction Qualified Software: EnergyPlus version 6.0.0.023

    Broader source: Energy.gov (indexed) [DOE]

    exterior lighting controls." (ix) Daylighting (sidelighting, skylights, or tubular daylight devices). "The EnergyPlus software models sidelighting, skylights, and tubular...

  2. Tax Deduction Qualified Software - EnergyPlus version 3.1.0.027

    Broader source: Energy.gov (indexed) [DOE]

    exterior lighting controls." (ix) Daylighting (sidelighting, skylights, or tubular daylight devices). "The EnergyPlus software models sidelighting, skylights, and tubular...

  3. 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    air-cooled chillers, thermal storage systems and variable frequency drives for compressors, fans and pumps; * Energy efficient lighting for interiors, exteriors, process...

  4. Newest Los Alamos facility receives LEED® Gold certification

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    air-cooled chillers, thermal storage systems and variable frequency drives for compressors, fans and pumps; Energy efficient lighting for interiors, exteriors, process glove...

  5. LOS ALAMOS, New Mexico, June 13, 2012-Los Alamos National Laboratory...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    air-cooled chillers, thermal storage systems and variable frequency drives for compressors, fans and pumps; * Energy efficient lighting for interiors, exteriors, process...

  6. 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    air-cooled chillers, thermal storage systems and variable frequency drives for compressors, fans and pumps * Energy efficient lighting for interiors, exteriors, process glove...

  7. Better building: LEEDing new facilities

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    air-cooled chillers, thermal storage systems and variable frequency drives for compressors, fans and pumps Energy efficient lighting for interiors, exteriors, process glove...

  8. Energy Sources | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    energy, a growing source of clean, renewable American power. October 17, 2014 Passive solar design uses carefully designed overhangs and reflective coatings on windows, exterior...

  9. Sabios, super-crips y escucha profunda: Representaciones de la discapacidad como otredad en la banda experimental argentina Reynols

    E-Print Network [OSTI]

    Aguiló, Ignacio

    2013-01-01T23:59:59.000Z

    en la banda experimental argentina Reynols I GNACIO A GUILÓbanda de música experimental argentina Reynols. Para ello,culto no solamente en Argentina sino también en el exterior,

  10. Building America Whole-House Solutions for Existing Homes: Passive...

    Broader source: Energy.gov (indexed) [DOE]

    Fans, Pittburgh, Pennsylvania Building America Whole-House Solutions for New Homes: Exterior Rigid Foam Insulation at the Edge of a Slab Foundation, Fresno, California...

  11. A second-order sequential optimality condition for nonlinear ...

    E-Print Network [OSTI]

    2015-04-29T23:59:59.000Z

    Apr 29, 2015 ... The following lemma is an adaptation of the exterior penalty method [30]. ...... A review of constraint qualifications in finite-dimensional spaces.

  12. --No Title--

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    or carbon fiber composite exterior which will provide the strength for the high pressure hydrogen as it moves down the pipe," Armstrong says. Armstrong says the pipeline would...

  13. Contaminants in Buildings and Occupied Spaces as Risk Factors for Occupant Symptoms in U.S.

    E-Print Network [OSTI]

    Mendell, M.J.; Mirer, A.; Lei-Gomez, Q.

    2008-01-01T23:59:59.000Z

    masonry exterior walls (cough, eye symptoms, and fatigue/upper respiratory symptoms, cough, eye symptoms, fatigue/or chest tightness), cough, upper respiratory (stuffy or

  14. Energy Efficiency and Conservation Block Grant Program

    Broader source: Energy.gov (indexed) [DOE]

    at Village Hall; 4) convert exterior lighting to LED at Village Hall; 5) install building automation system at the Vehicle Maintenance Building; 6) reconstruct and install a new...

  15. Simulating Complex Window Systems using BSDF Data

    E-Print Network [OSTI]

    Konstantoglou, Maria

    2011-01-01T23:59:59.000Z

    BSDF simulated values, due to differences in sky luminancesky distribution, modelled interior and exterior conditions, and slight differences in location of view. Still, the luminance

  16. arizona cloud-seeding experiment: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Extension exterior 1. Roof Ziurys, Lucy M. 13 ARIZONA COOPERATIVE ARIZONA AND THE NORTH AMERICAN Environmental Sciences and Ecology Websites Summary: , but from convective...

  17. Integrated Performance Testing Workshop, Modules 6 - 11

    SciTech Connect (OSTI)

    Leach, Janice; Torres, Teresa M.

    2012-10-01T23:59:59.000Z

    These modules cover performance testing of: Interior Detection Systems; Access Controls; Exterior Detection Systems; Video Assessment Systems; SNM / Contraband Detection Systems; Access Delay Elements

  18. TEXT-ALTERNATIVE VERSION: LEDs GO IVY LEAGUE

    Broader source: Energy.gov [DOE]

    Narrator: A typical university campus resembles a mini city, with wide ranging interior and exterior lighting applications, making a college or university an ideal testing ground when considering...

  19. Fenestration of Today and Tomorrow: A State-of-the-Art Review and Future Research Opportunities

    E-Print Network [OSTI]

    Petter Jelle, Bjorn

    2013-01-01T23:59:59.000Z

    interesting for the thermal building envelope and may thuspart of the thermal and solar building envelope. The phasethe Thermal Performance of the Exterior Envelopes of Whole

  20. UNIVERSIDAD SIMON BOLIVAR Decanato de Estudios Profesionales

    E-Print Network [OSTI]

    Vásquez, Carlos

    Pinho (Coordinadora Encargada de Comercio Exterior y Licenciatura en Comercio Internacional), René.2013. 3.- Informe del Decano El Decano continuó con la presentación de su informe, comunicando lo

  1. UNIVERSIDAD SIMN BOLVAR VICERRECTORADO ACADMICO

    E-Print Network [OSTI]

    Vásquez, Carlos

    toda la comunidad universitaria. 2.- Aprobación de la Agenda del día 3.- Informe de la decana -Informó TSU: organización empresarial, comercio exterior, t

  2. An in-depth Analysis of Space Heating Energy Use in Office Buildings

    E-Print Network [OSTI]

    Lin, Hung-Wen

    2013-01-01T23:59:59.000Z

    USA.119-123. S.J. Emmerich, T. McDowell, W. Anis. 2005.gross exterior wall area [Emmerich 2005, Persily 2008]. For

  3. Lower Dimensional Black Holes: Inside and Out

    E-Print Network [OSTI]

    R. B. Mann

    1995-01-27T23:59:59.000Z

    I survey the physics of black holes in two and three spacetime dimensions, with special attention given to an understanding of their exterior and interior properties.

  4. Global compactness for a class of quasi-linear elliptic problems

    E-Print Network [OSTI]

    Mercuri, Carlo

    2011-01-01T23:59:59.000Z

    We prove a global compactness result for Palais-Smale sequences associated with a class of quasi-linear elliptic equations on exterior domains.

  5. SNAP telescope

    E-Print Network [OSTI]

    2002-01-01T23:59:59.000Z

    several ways. First, the solar panels can be rigidly body-carrying the exterior solar panels and extensive thermalcommissioning begins. Solar panels are fixed, not deployed.

  6. CENTER FOR U.S. AND MEXICAN LAW UNIVERSITY OF HOUSTON LAW CENTER

    E-Print Network [OSTI]

    Azevedo, Ricardo

    of internships with Pemex and with the Mexican Foreign Ministry (Secretaría de Relaciones Exteriores to applicants available for the full summer): 2. Internship Preference (Pemex or Foreign Ministry

  7. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    exterior with tanks 12-10-10.jpg Gallery: Groundwater Treatment Resin Title: Groundwater Treatment Facility Groundwater Treatment Facility Name: Groundwater Treatment Facility...

  8. act rcra contingency: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    An empirical example is elaborated. Leydesdorff, Loet 2010-01-01 185 Emitting Diode (LED) Fixture Design and Installation Criteria for Exterior Lighting Applications in Contingency...

  9. Chapter 7: Landscape Design and Management

    Energy Savers [EERE]

    7: Landscape Design and Management Landscape Issues at LANL Stormwater Management Using Water Outdoors Parking Pavement Landscape Vegetation Exterior Lighting LANL | Chapter 7...

  10. REPORT OF SURVEY OF THE LOS ALAMOS TRITIUM SYSTEMS TEST ASSEMBLY...

    Broader source: Energy.gov (indexed) [DOE]

    connection, exterior to the facility. The main experimental area contains tritium and depleted uranium (the latter in hydride storage beds). There are 15 glove boxes in which...

  11. Doing Well by Doing Good? Green Office Buildings

    E-Print Network [OSTI]

    Eichholtz, Piet; Kok, Nils; Quigley, John M.

    2009-01-01T23:59:59.000Z

    estimated for a green building, or to Energy Star. 2008. “square foot) Green rating (1 = yes) Energy Star (1 = yes)square foot) Green rating (1 = yes) Energy Star (1 = yes)

  12. EA-0575: Fundamental Fluidization Research Project, Morgantown, West Virginia

    Broader source: Energy.gov [DOE]

    This EA evaluates the environmental impacts of a proposal to design, construct, and operate a 2-foot diameter, 50-foot high pressurized fluidization with particular emphasis on operation in the...

  13. AIMR (Azimuth and Inclination Modeling in Realtime): A Method for Prediction of Dog-Leg Severity based on Mechanical Specific Energy 

    E-Print Network [OSTI]

    Noynaert, Samuel F

    2013-08-13T23:59:59.000Z

    foot by foot basis while accurately predicting the effects of each parameter is impossible for the human brain alone. Given current rig rates, any amount of increased slide time and its reduced ROP which occurred due to poorly predicted directional...

  14. ankle plantar flexors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    pedal and quadrupedal locomotion (N 146). Functional foot length, degree of hallux abduction, and total D'Aot, Kristiaan 50 CONTROL SYSTEM FOR ACTIVE ANKLE-FOOT ORTHOSIS AND...

  15. LITHIUM--1999 46.1 By Joyce A. Ober

    E-Print Network [OSTI]

    data (table 1). Chemetall Foote Corp., a subsidiary of the German company, Chemetall GmbH, produced in Kings Mountain, NC. Chemetall Foote also produced lithium carbonate at a brine deposit in Chile. FMC

  16. LITHIUM--2002 46.1 By Joyce A. Ober

    E-Print Network [OSTI]

    domestic producer of lithium carbonate from brine is Chemetall Foote's operation in Nevada. Nevada brines enriched in lithium chloride, which averaged about 300 parts per million (ppm) when Foote Mineral Co. (the

  17. Office Building Uses Ice Storage, Heat Recovery, and Cold-Air Distribution

    E-Print Network [OSTI]

    Tackett, R. K.

    1989-01-01T23:59:59.000Z

    1-1/2 year simple payback. The system reduces operating costs by over $0.16 per square foot each year, yet it increased the net HVAC budget by only $0.22 per square foot....

  18. Maps of sky luminance at various altitudes

    E-Print Network [OSTI]

    Duntley, Seibert Q; Bioleau, A R; Harris, J L; Gordon, J

    1960-01-01T23:59:59.000Z

    expressed in foot-lamberts. Luminance SID REFERENCE 60-12 214. Upper hemisphere luminance distribution. is expressedin foot-lamberts. Luminance SIO REFERENCE 60-12 21 SEPTEMBER

  19. Data:De5f1698-c1ab-4218-9c64-19a2bd89857a | Open Energy Information

    Open Energy Info (EERE)

    of construction (CIAC) as outlined below; i. 525 per 22 foot fiberglass pole; ii. 1,450 per 35 foot fiberglass pole; Metal Poles a.Prior to construction, the requesting party...

  20. Data:5333f944-5bcf-4d4d-83da-78f7ef0b79f6 | Open Energy Information

    Open Energy Info (EERE)

    of construction (CIAC) as outlined below; i. 525 per 22 foot fiberglass pole; ii. 1,450 per 35 foot fiberglass pole; Metal Poles a.Prior to construction, the requesting party...