Sample records for foot miami 1a

  1. Damage Assessment from Storm Surge to Coastal Cities: Lessons from the Miami Area

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , Hurricane Andrew hit Dade County with Category 5 force, generating 17-foot (more than 5 meters) storm surges evolution of hurricane intensity and sea level rise. The area of Miami represents a clear hotspot of human sea level, considering different hurricane parameters (storm category and direction, wind speed

  2. Miami-Dade County- Sustainable Buildings Program

    Broader source: Energy.gov [DOE]

    In 2005, the Miami-Dade Board of County Commissioners passed a resolution to incorporate sustainable building measures into county facilities. In 2007, Ordinance 07-65 created the Sustainable...

  3. Miami Power Corporation | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy InformationGardens, Florida:Miami

  4. Land use and climate change in Miami-Dade County

    E-Print Network [OSTI]

    Peckett, Haley Rose

    2009-01-01T23:59:59.000Z

    Miami-Dade County, Florida, was one of the earliest jurisdictions to adopt a climate change plan in 1993. Land use features prominently in this plan as a means to reduce greenhouse gases through development patterns that ...

  5. Hurricane Modification and Adaptation in Miami-Dade County, Florida

    E-Print Network [OSTI]

    Klima, Kelly

    We investigate tropical cyclone wind and storm surge damage reduction for five areas along the Miami-Dade County coastline either by hardening buildings or by the hypothetical application of wind-wave pumps to modify storms. ...

  6. Miami-Dade County- Expedited Green Buildings Process

    Broader source: Energy.gov [DOE]

    In an effort to promote environmentally sensitive design and construction, the Miami-Dade County Commissioners passed an ordinance in June 2005 to expedite the permitting process for “green”...

  7. Cutting Electricity Costs in Miami-Dade County, Florida

    SciTech Connect (OSTI)

    Alvarez, Carlos; Oliver, LeAnn; Kronheim, Steve; Gonzalez, Jorge; Woods-Richardson, Kathleen

    2011-01-01T23:59:59.000Z

    Miami-Dade County, Florida will be piping methane gas from their regional landfill to the adjacent wastewater plant to generate a significant portion of the massive facility's future electricity needs.

  8. Cutting Electricity Costs in Miami-Dade County, Florida

    ScienceCinema (OSTI)

    Alvarez, Carlos; Oliver, LeAnn; Kronheim, Steve; Gonzalez, Jorge; Woods-Richardson, Kathleen;

    2013-05-29T23:59:59.000Z

    Miami-Dade County, Florida will be piping methane gas from their regional landfill to the adjacent wastewater plant to generate a significant portion of the massive facility's future electricity needs.

  9. Cutting Electricity Costs in Miami-Dade County, Florida

    Broader source: Energy.gov [DOE]

    Miami-Dade County, Florida will be piping methane gas from their regional landfill to the adjacent wastewater plant to generate a significant portion of the massive facility's future electricity...

  10. Impact of the Miami 21's parking requirements on the real estate developments in the city of Miami

    E-Print Network [OSTI]

    Libman, Rafael

    2014-01-01T23:59:59.000Z

    In the last years, Fort Lauderdale, West Beach, and Miami together became the 8th largest metropolitan area in the U.S. with a population of approximately 6 million people. During the last four years the population of such ...

  11. Biking to work in Miami. Final technical report

    SciTech Connect (OSTI)

    Kerr, O.

    1982-08-01T23:59:59.000Z

    The objective of the project was to produce and distribute a guide to commuting by bicycle in the Miami metropolitan area. The area is uniquely suited to bicycling because of its pleasant year-round climate and relatively flat topography. Persuading even a small percentage of automobile commuters to try biking to work could result in substantial energy savings in Miami as in most other major metropolitan areas. Seven of the largest employment centers in the area were selected as major commuter destinations suitable for bicycle commuters. Safe and scenic ways of commuting to these areas by bicycle were mapped and described in a series of short narratives. Additional material on safe riding techniques and the choice of equipment was developed. The resulting 40 page booklet, Biking to Work in Miami, was printed and distributed by the author to local cycling groups, bicycle interests, and others. Copies were also sent to interested parties outside the Miami area. The initial reception has been very encouraging and a number of favorable reply cards have been received with useful comments and suggestions. A revised version aimed at stimulating bikers to avail of the soon-to-be-opened rapid transit system is being considered. A writer for the Miami Herald is interested in using parts of the Guide for a series in the newspaper.

  12. American Statistical Association Announces 2011 Award Recipients Awards ceremony to be held at Joint Statistical Meetings in Miami Beach, FL

    E-Print Network [OSTI]

    Washington at Seattle, University of

    American Statistical Association Announces 2011 Award Recipients Awards ceremony to be held at Joint Statistical Meetings in Miami Beach, FL MIAMI BEACH, FL (PRWEB) AUGUST 1, 2011 ­ The American Statistical Association (ASA), the nation's preeminent professional statistical society, today announced

  13. Miami Modern Metropolis: Paradise and Paradox in Mid-century Architecture and Planning Edited by Allan Shulman

    E-Print Network [OSTI]

    Burga, Hector Fernando

    2010-01-01T23:59:59.000Z

    and Planning Edited by Allan Shulman Balcony Press,of Miami professor Allan Shulman, offers an unprecedented

  14. 3RD MIAMI INTERNATIONAL CONFERENCE ON ALTERNATIVE ENERGY SOURCES

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not Found Item Not Found The item youTheWSRC-TR-97-0100WHITE.3RD MIAMI INTERNATIONAL

  15. City of Miami, Oklahoma (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof EnergyInnovationin Urban TransportMartinsville, VirginiaMeade,Mesa, ArizonaMiami,

  16. Grocery 2009 TSD Miami 50% Energy Savings | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdfGetec AG ContractingGreenOrderNebraska:Gridley,Grocery 2009 TSD Miami 50%

  17. Grocery 2009 TSD Miami Baseline | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdfGetec AG ContractingGreenOrderNebraska:Gridley,Grocery 2009 TSD Miami

  18. South Miami Heights, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro Industries Pvt LtdShawangunk, NewSingaporeSonix JapanCalifornia:(RECP) inLyon, Michigan:Miami

  19. EECBG Success Story: How Miami, Florida is Turning Waste Into Cash

    Broader source: Energy.gov [DOE]

    In Miami, Florida, methane gas captured from a regional landfill will be used to provide 30 percent of the electricity used at an adjacent regional wastewater plant. Learn more.

  20. Foote Hydroelectric Plant spillway rehabilitation

    SciTech Connect (OSTI)

    Sowers, D.L. [Consumers Power Co., Jackson, MI (United States); Hasan, N.; Gertler, L.R. [Raytheon Infrastructures Services, New York, NY (United States)

    1996-10-01T23:59:59.000Z

    In 1993 the spillway of the 9 MW Foote Hydroelectric Plant located on the AuSable River, near Oscoda, Michigan was rehabilitated. The Foote Plant, built in 1917, is owned and operated by Consumers Power Company. In the 76 years of continuous operation the spillway had deteriorated such that much of the concrete and associated structure needed to be replaced to assure safety of the structure. The hydro station includes an earth embankment with concrete corewall, a concrete spillway with three tainter gates and a log chute, a penstock structure and a steel and masonry powerhouse. The electric generation is by three vertical shaft units of 3,000 KW each. A plan of the plant with spillway and an elevation of the spillway section is shown. This paper describes the evaluation and repair of the plant spillway and associated structure.

  1. Weigh-in-motion scale with foot alignment features

    DOE Patents [OSTI]

    Abercrombie, Robert Knox; Richardson, Gregory David; Scudiere, Matthew Bligh

    2013-03-05T23:59:59.000Z

    A pad is disclosed for use in a weighing system for weighing a load. The pad includes a weighing platform, load cells, and foot members. Improvements to the pad reduce or substantially eliminate rotation of one or more of the corner foot members. A flexible foot strap disposed between the corner foot members reduces rotation of the respective foot members about vertical axes through the corner foot members and couples the corner foot members such that rotation of one corner foot member results in substantially the same amount of rotation of the other corner foot member. In a strapless variant one or more fasteners prevents substantially all rotation of a foot member. In a diagonal variant, a foot strap extends between a corner foot member and the weighing platform to reduce rotation of the foot member about a vertical axis through the corner foot member.

  2. 1999 Ph.D. Chemistry University of Miami, Coral Gables, Florida 1994 M.Sc. Chemistry Sun Yat-sen University, P.R. China

    E-Print Network [OSTI]

    Leuenberger, Michael N.

    1 EDUCATION 1999 Ph.D. Chemistry University of Miami, Coral Gables, Florida 1994 M.Sc. Chemistry University of Miami, Coral Gables, Florida HONORS AND AWARDS 2008-present National Institute of Health (NIH

  3. Reference Buildings by Climate Zone and Representative City: 1A Miami,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin of ContaminationHubs+18,new2004_v1.3_5.0.zipFlorida | Department of Energy

  4. Reference Buildings by Climate Zone and Representative City: 1A Miami,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin of ContaminationHubs+18,new2004_v1.3_5.0.zipFlorida | Department of EnergyFlorida |

  5. Reference Buildings by Climate Zone and Representative City: 1A Miami,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin of ContaminationHubs+18,new2004_v1.3_5.0.zipFlorida | Department of EnergyFlorida

  6. AT-01: MMM{98 Miami, Florida, November 9-12, 1998 Selective Excitation Double Mossbauer Spectroscopy

    E-Print Network [OSTI]

    Ryan, Dominic

    AT-01: MMM{98 Miami, Florida, November 9-12, 1998 Selective Excitation Double MossbauerGill University, 3600 University Street, Montreal, Quebec H3A 2T8, Canada Abstract Selective Excitation Double Mossbauer using REVT E X 1 #12; I. INTRODUCTION Mossbauer spectra of #12;ne particle systems 1;2 and phase

  7. Sustainability of Agriculture in Miami-Dade County: Considering Water Supply1

    E-Print Network [OSTI]

    Migliaccio, Kati White

    AE429 Sustainability of Agriculture in Miami-Dade County: Considering Water Supply1 Kati W. Migliaccio2 1. This document is ABE 380, one of a series of the Department of Agricultural and Biological Engineering, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University

  8. AVI SOU PRATIK UNIVERSITY OF MIAMI HEALTH SYSTEM POU ITILIZASYON AK DIVILGASYON ENFMASYON PRIVE

    E-Print Network [OSTI]

    Shyu, Mei-Ling

    Dat avi a anvigè: 1ye desanm 2007 AVI SA A DEKRI FASON NOU KAPAB ITILIZE AK DIVILGE ENFÒMASYON MEDIKAL A APLIKE Avi sa a rezime pratik pou itilize an divilge enfòmasyon prive nan University of Miami Health ki anvigè nan moman an. FASON NOU KAPAB ITILIZE AK DIVILGE ENFÒMASYON MEDIKAL YO Lè ou resevwa sèvis

  9. DETECTING AND TRACKING OF MESOSCALE OCEANIC FEATURES IN THE MIAMI ISOPYCNIC CIRCULATION OCEAN MODEL

    E-Print Network [OSTI]

    Tandon, Amit

    DETECTING AND TRACKING OF MESOSCALE OCEANIC FEATURES IN THE MIAMI ISOPYCNIC CIRCULATION OCEAN MODEL developed to automatically detect, locate and track mesoscale eddies spatially and temporally. Using an invaluable tool to assess mesoscale oceanic features. Key Words ­ Scientific Visualization, Eddy Detection

  10. Woody and Herbaceous Plants Native to Haiti For use in Miami-Dade Landscapes1

    E-Print Network [OSTI]

    Jawitz, James W.

    Page | 1 Woody and Herbaceous Plants Native to Haiti For use in Miami-Dade Landscapes1 Haiti that of Cuba. The plants contained in this review have been recorded as native to Haiti, though some may now's original tree-cover remains. Haiti's future is critically tied to re- forestation; loss of tree cover has

  11. The US National Multi-Model Ensemble ISI Prediction System Ben Kirtman (University of Miami)

    E-Print Network [OSTI]

    Miami, University of

    The US National Multi-Model Ensemble ISI Prediction System Ben Kirtman (University of Miami) The newly emerging US National Multi-Model Ensemble (NMME) sub-seasonal to interannual (ISI) prediction includes experimental real-time ISI forecasting that leverages existing CTB partner activities. The NMME

  12. A comparative study of single family and multifamily housing recovery following 1992 Hurricane Andrew in Miami-Dade County, Florida

    E-Print Network [OSTI]

    Lu, Jing-Chein

    2009-05-15T23:59:59.000Z

    examines the recovery of single family, duplex, and apartment complex housing in south Miami-Dade County, Florida, after 1992 Hurricane Andrew to determine if there is indeed a "multifamily home lag." This research also provides a better understanding...

  13. Local lattice distortions and thermal transport in perovskite manganites Department of Physics, University of Miami, Coral Gables, Florida 33124

    E-Print Network [OSTI]

    of Physics, University of Miami, Coral Gables, Florida 33124 J. J. Neumeier Department of Physics, Florida, Coral Gables, Florida 33124 K. J. McClellan Materials Science and Technology Division, Los Alamos

  14. UniverSity of MiaMi roSenStiel SChool of Marine and atMoSpheriC SCienCe

    E-Print Network [OSTI]

    Miami, University of

    rickenbacker Causeway Miami, florida 33149 http://www.rsmas.miami.edu Carbonate Sedimentology Carbonates act research. a history of carbonate sedimentology Rosenstiel School scientists pioneered work in the comparative sedimentology of carbonate sediments in the early 1970s. This early work set the foundation

  15. DOE - Office of Legacy Management -- University of Miami - FL 0-01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling Corp -K LeDowntownUnited NuclearMiami - FL 0-01

  16. * Address for correspondence: Dr. J. C. O'Reilly, Department of Biology, University of Miami, Coral Gables, FL 33124-0421, USA. E-mail: oreilly@bio.miami.edu.

    E-Print Network [OSTI]

    Nishikawa, Kiisa

    Behavior in Adult Amphibians James C. O'Reilly 1* , Stephen M. Deban 2 & Kiisa C. Nishikawa 3 1 Department* Address for correspondence: Dr. J. C. O'Reilly, Department of Biology, University of Miami, Coral Morphology, pp. 153-190. P. Aerts, K. D'Août, A. Herrel & R. Van Damme, Eds. © Shaker Publishing 2002, ISBN

  17. GreenFoot Technologies | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, search OpenEI ReferenceJump to: navigation,IISrl Jump to:GreenFoot Technologies

  18. SmallFoot LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-f < RAPID‎ |RippeyInformation SlimSlough Heat andSmallFoot LLC Jump

  19. Brad Foote Gear Works | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof Energy 2,AUDIT REPORT Americium/CuriumAguaBBBWind- GeradoraBorealBrad Foote Gear

  20. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    parasitism and extra-pair paternity in blue- footed boobies.Microsatellites Á SSRs Á Blue-footed booby Á Sula nebouxii Ámicrosatellite loci from blue-footed boobies (Sula nebouxii)

  1. A Universal AnkleFoot Prosthesis Emulator for Human Locomotion

    E-Print Network [OSTI]

    Collins, Steven H.

    A Universal Ankle­Foot Prosthesis Emulator for Human Locomotion Experiments Joshua M. Caputo of functions. Here we describe a robotic ankle­foot prosthesis system that enables rapid exploration of a wide-board motor and con- trol hardware, a flexible Bowden cable tether, and a lightweight instrumented prosthesis

  2. Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs

    E-Print Network [OSTI]

    Sitti, Metin

    Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing Dept -- This paper proposes two different nanomolding methods to fabricate synthetic gecko foot-hair nanostructures a nano-pore membrane as a template. These templates are molded with silicone rubber, polyimide

  3. Department of Mechanical Engineering Fall 2012 The Jaipur Foot

    E-Print Network [OSTI]

    Demirel, Melik C.

    for the Jaipur Foot and in compliance with the International Organization for Standardization (ISO) standard Foot in compliance with ISO Standard 10328. Approach Gathered customer needs from sponsor Established target specifications from customer needs into measurable metrics Reviewed ISO Standard 10328

  4. Planipes: Mobile Foot Pressure Analysis Samuel Pfaffen, Philipp Sommer, Christian Stocker, Roger Wattenhofer, and Samuel Welten

    E-Print Network [OSTI]

    Planipes: Mobile Foot Pressure Analysis Samuel Pfaffen, Philipp Sommer, Christian Stocker, Roger, sommer, chstocke, wattenhofer, welten}@tik.ee.ethz.ch Abstract Analyzing foot pressure is helpful

  5. Electrofishing survey of the Great Miami River, September 1992. Annual report

    SciTech Connect (OSTI)

    Miller, M.C.; Bixby, R.; Engman, J.; Ross, L.; Stocker, L. [Cincinnati Univ., OH (United States). Dept. of Biological Sciences

    1993-03-01T23:59:59.000Z

    At the end of summer in 1992 the fishery of the Great Miami River took an unexpected deviation from the stasis of past years as an intense suspended algal bloom decreased the compositional diversity found at the lower GMR stations. Daytime supersaturation of oxygen and elevated pHs, reaching 9 by midday during the month of August, undoubtedly caused severe deficits of oxygen at night. Despite the aeration at every riffle, the intensities of the biological processes in the water were sufficient to cause very high positive and negative excursions of oxygen over the day and night cycle. This report documents a fish harvest that was conducted as part of the oxygen excess/deficit study.

  6. Distributed Explosive-Driven Six-foot Diameter by Two-Hundred Foot Long Shock Tubes

    SciTech Connect (OSTI)

    VIGIL, MANUEL G.

    2002-02-01T23:59:59.000Z

    The blast parameters for the 6-foot diameter by 200-foot long, explosively driven shock tube are presented in this report. The purpose, main characteristics, and blast simulation capabilities of this PETN Primacord, explosively driven facility are included. Experimental data are presented for air and Sulfurhexaflouride (SF6) test gases with initial pressures between 0.5 to 12.1 psia (ambient). Experimental data are presented and include shock wave time of amval at various test stations, flow duration, static or side-on overpressure, and stagnation or head-on overpressure. The blast parameters calculated from the above measured parameters and presented in this report include shock wave velocity, shock strength, shock Mach number, flow Mach Number, reflected pressure, dynamic pressure, particle velocity, density, and temperature. Graphical data for the above parameters are included. Algorithms and least squares fit equations are also included.

  7. Chamber transport of "foot" pulses for heavy-ion fusion

    E-Print Network [OSTI]

    Sharp, W.M.; Callahan-Miller, D.A.; Tabak, M.; Yu, S.S.; Peterson, P.F.

    2002-01-01T23:59:59.000Z

    Neutralization on Heavy-Ion-Fusion Chamber Transport," to beChamber transport of "foot" pulses for heavy-ion fusion W.chamber-transport effectiveness is the fraction of enclosed beam ions

  8. Powered Ankle–Foot Prosthesis Improves Walking Metabolic Economy

    E-Print Network [OSTI]

    Au, Samuel K.

    At moderate to fast walking speeds, the human ankle provides net positive work at high-mechanical-power output to propel the body upward and forward during the stance period. On the contrary, conventional ankle-foot ...

  9. The effect of foot conditions on constrained standing

    E-Print Network [OSTI]

    Barlow, Jessica Marie

    1996-01-01T23:59:59.000Z

    This study was conducted to find any differences in physiological effects, subjective rankings, or discomfort with respect to foot conditions in constrained standing. Eight healthy subjects, four female and four male, stood using four different...

  10. Mag-Foot: a steel bridge inspection robot

    E-Print Network [OSTI]

    Asada, Harry

    A legged robot that moves across a steel structure is developed for steel bridge inspection. Powerful permanent magnets imbedded in each foot allow the robot to hang from a steel ceiling powerlessly. Although the magnets ...

  11. ankle foot orthoses: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  12. ankle foot orthosis: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  13. A study conducted on laterally loaded cylindrical footings

    E-Print Network [OSTI]

    Koch, Kenneth Joseph

    1968-01-01T23:59:59.000Z

    A STUDY CONDUCTED ON LATERALLY LOADED CYLINDRICAL FOOTINGS A Thesis by Kenneth Joseph Koch Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree oi MASTER OF SCIENCE May 1968... Major Subject Civil Engineering A STUDY CONDUCTED ON LATERALLY LOADED CYLINDRICAL FOOTINGS A Thesis by Kenneth Joseph Koch Approved as to style and content by (Chairman of Committee) (Head of Department) (Member) (M ber) May 1968...

  14. Design and evaluation of a cantilever beam-type prosthetic foot for Indian persons with amputations

    E-Print Network [OSTI]

    Olesnavage, Kathryn M

    2014-01-01T23:59:59.000Z

    The goal of this work is to design a low cost, high performance prosthetic foot in collaboration with Bhagwan Mahaveer Viklang Sahayata Samiti (BMVSS), in Jaipur, India. In order to be adopted, the foot must cost less than ...

  15. Effects of different restrained foot positions on hand force exertion capability-implications for microgravity operations

    E-Print Network [OSTI]

    Whalen, Scott Allan

    1997-01-01T23:59:59.000Z

    An experiment was conducted to determine restrained foot positions that increase hand force exertion capability (HFEC) over that available under the existing restrained foot position utilized by NASA astronauts during Extra Vehicular Activity (EVA...

  16. Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy

    E-Print Network [OSTI]

    Herr, Hugh

    Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy by Samuel Kwok-Wai Au LIBRARIES #12;#12;Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy by Samuel in walking. This objective of this thesis is to evaluate the hypothesis that a powered ankle- foot prosthesis

  17. Load tests on five large spread footings on sand and evaluation of prediction methods

    E-Print Network [OSTI]

    Gibbens, Robert Melvin

    1995-01-01T23:59:59.000Z

    for the engineering profession's lack of trust in the use of spread footings. For this study, five spread footings with sizes ranging from I to 3 m square were load tested to 150 mm of penetration. The footings were all constructed and tested in a similar manner...

  18. Copyright 2006, IADC/SPE Drilling Conference This paper was prepared for presentation at the IADC/SPE Drilling Conference held in Miami,

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Copyright 2006, IADC/SPE Drilling Conference This paper was prepared for presentation at the IADC/SPE Drilling Conference held in Miami, Florida, U.S.A., 21­23 February 2006. This paper was selected of Drilling Contractors or Society of Petroleum Engineers and are subject to correction by the author

  19. Communiquer dans un monde de normes l 305 A travers cette prsentation, nous voudrions montrer la place centrale qu'occupent les industries culturelles de Miami dans la

    E-Print Network [OSTI]

    en particulier à Sony Latin Music (communément appelée Sony latino), parce que la maison de disque Sony latino, le développement et l'éclosion de ce Miami sound sur la scène musicale internationale

  20. Prediction of sinkage depth of footings on soft marine sediments

    E-Print Network [OSTI]

    Yen, Shihchieh

    1990-01-01T23:59:59.000Z

    Tempsonics Transducer? Channels ? Hgdraulic Actuator I rB I :: Mud Tank::. : Guide Rod- Clamp? ? Ram ? Load Transducer ~ Model Footing Detailed Sketch of B Figure 2. Schematic (Side View) of Displacement Controlled Test Set-up. second... generalized bearing capacity factor, versus Z/B. Typical results are presented in Figures 16, 17, 18, 19, and 20. Plots of all analyzed test data are presented in Appendix I. 41 5 G 4 V/S = IKS V/B = OPS 0 0 Figure 16. Analyzed Data for 1-inch...

  1. A study conducted on laterally loaded cylindrical footings 

    E-Print Network [OSTI]

    Koch, Kenneth Joseph

    1968-01-01T23:59:59.000Z

    studies have also been used to analyze the resistance (g) to overturning. R. C. Rutledge developed a nomograph that can be used to find the depth of embedment necessary to withstand applied loads. The chart is based on the results of a series of full... as compared to the diameters of concrete footings of comparable depth. Full-scale test results have also been reported by F. E. Behn( and by Nelson, Nahoney and Fryrear 10) Theory by Reese L. C. Reese studied the ultimate resistance againsr. a rigid (11...

  2. Prediction of sinkage depth of footings on soft marine sediments 

    E-Print Network [OSTI]

    Yen, Shihchieh

    1990-01-01T23:59:59.000Z

    91. 0 91. 0 91. 2 90. 9 90. 9 90. 9 90. 4 90. 6 90. 3 90. 8 91. 5 91. 4 91. 0 91. 3 Su was determined by a miniature vane rotating at 0. 0143 radians per second 30 Table 4. Soil Properties for 4-inch Diameter Footing Tests V/B Dia.... 7 0. 008 105. 7 34. 7 90. 9 103. 9 40. 0 91. 3 * Su was determined by a miniature vane rotating at 0. 0143 radians per second. one of these tests is shown in Figure 12. In comparison to the dead weight test results (Figure 13), the load versus...

  3. Dual Predictive Control of Electrically Stimulated Muscle using Biofeedback for Drop Foot Correction

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    artificially generate action potential in the place of central nervous system (CNS) for inducing muscle) is one of the solutions for drop foot correction. Conventional ES systems deliver prede- fined to adequately dorsiflex or lift the foot. It is associated with a variety of conditions such as stroke, spinal

  4. Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate, Germany

    E-Print Network [OSTI]

    Kammer, Thomas

    Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate.W. 2013: Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate Follmann from the Lower Devonian Hunsruck Slate of Germany. This is the first definitive proof of tube feet

  5. An Ankle-Foot Emulation System for the Study of Human Walking Biomechanics

    E-Print Network [OSTI]

    Herr, Hugh

    and a prosthesis is one of the main obstacles in the development of a biomimetic ankle-foot prosthesis that the emulator may provide a more natural gait than a conventional passive prosthesis. Index Terms ­ Below-knee prosthesis, biomechanics, force control, biomimetic, ankle-foot emulator I. INTRODUCTION Although

  6. An Ankle-Foot Prosthesis Emulator with Control of Plantarflexion and Inversion-Eversion Torques

    E-Print Network [OSTI]

    Collins, Steven H.

    An Ankle-Foot Prosthesis Emulator with Control of Plantarflexion and Inversion-Eversion Torques-foot prosthesis with two independently-actuated toes that are coordinated to provide plantarflexion and inversion prosthesis features. A similar morphology may be effective for autonomous devices. I. INTRODUCTION Robotic

  7. Development of a three-dimensional finite element model of a horse's foot

    E-Print Network [OSTI]

    Hanft, Joseph Thomas

    1995-01-01T23:59:59.000Z

    The horse's foot, defined as the hoof wall and all the structures within it, is subjected to intense load-bearing and energy-absorbing demands. The foot is actually a complex assembly of components that deform as they support loads and absorb energy...

  8. Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing

    E-Print Network [OSTI]

    Fearing, Ron

    Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing Dept- This paper proposes two different nanomolding methods to fabricate synthetic gecko foot-hair nanostructures a nano-pore membrane as a template. These templates are molded with silicone rubber, polyamide

  9. IEEE Robotics & Automation Magazine52 1070-9932/08/$25.002008 IEEE SEPTEMBER 2008 Ankle-Foot Prosthesis

    E-Print Network [OSTI]

    Herr, Hugh

    -Foot Prosthesis T he loss of a limb is a major disability. Unfortunately, today's prosthetic technol- ogy prosthesis [15], [19], [20]. With current actuator technology, it is challenging to build an ankle-foot prosthesis that matches the size and weight of the human ankle-foot complex but still provides sufficient

  10. Summary report on four foot septifoil cooling experiment

    SciTech Connect (OSTI)

    Randolph, H.W.; Collins, S.L.; Verebelyi, D.T.; Foti, D.J.

    1991-10-01T23:59:59.000Z

    Cooling parameters for some of the SRS reactor internal components are computed using the Transient Reactor Analysis Code, TRAC.'' In order to benchmark the code, the Safety Analysis Group of SRL requested an experiment to provide measurements of cooling parameters in a well defined physical system utilizing SRS reactor component(s). The experiment selected included a short length of septifoil with both top and bottom fittings containing five simulated control rods in an unseated'' configuration. Power level to be supplied to the rods was targeted at 2.5 kilowatts per foot. The septifoil segment was to be operated with no forced flow in order to evaluate thermal-hydraulic cooling. Parameters to be measured for comparison with code predictions were basic cooling phenomena, incidence of film boiling, thermal-hydraulic flow rate, pressure rise, and ratio of heat transfer through the wall of the assembly vs heat transfer to axial water flow through the assembly. Experimental apparatus was designed and assembled incorporating five simulated control rods four feet long, joule heated inside a five foot length of type Q'' septifoil. Water at 70 C was fed independently to the bottom inlet and along the outside of the septifoil. Water flowing along the outside of the septifoil was in confined flow and provided calorimetry to measure power flow through the septifoil housing. A shadowgraph technique was developed and used to monitor unforced flow of water pumped thermal-hydraulically through the septifoil. Electrical power of 10,000 to 70,000 watts was fed to the simulated rods from a dc power supply. Computer data acquisition was accomplished using LabView'' software programmed to match the configuration of the experiment along with scanning digital voltmeters and requisite signal sensors. Video camcorders were used to provide video records of six areas of the experiment.

  11. Summary report on four foot septifoil cooling experiment

    SciTech Connect (OSTI)

    Randolph, H.W.; Collins, S.L.; Verebelyi, D.T.; Foti, D.J.

    1991-10-01T23:59:59.000Z

    Cooling parameters for some of the SRS reactor internal components are computed using the Transient Reactor Analysis Code, ``TRAC.`` In order to benchmark the code, the Safety Analysis Group of SRL requested an experiment to provide measurements of cooling parameters in a well defined physical system utilizing SRS reactor component(s). The experiment selected included a short length of septifoil with both top and bottom fittings containing five simulated control rods in an ``unseated`` configuration. Power level to be supplied to the rods was targeted at 2.5 kilowatts per foot. The septifoil segment was to be operated with no forced flow in order to evaluate thermal-hydraulic cooling. Parameters to be measured for comparison with code predictions were basic cooling phenomena, incidence of film boiling, thermal-hydraulic flow rate, pressure rise, and ratio of heat transfer through the wall of the assembly vs heat transfer to axial water flow through the assembly. Experimental apparatus was designed and assembled incorporating five simulated control rods four feet long, joule heated inside a five foot length of type ``Q`` septifoil. Water at 70 C was fed independently to the bottom inlet and along the outside of the septifoil. Water flowing along the outside of the septifoil was in confined flow and provided calorimetry to measure power flow through the septifoil housing. A shadowgraph technique was developed and used to monitor unforced flow of water pumped thermal-hydraulically through the septifoil. Electrical power of 10,000 to 70,000 watts was fed to the simulated rods from a dc power supply. Computer data acquisition was accomplished using ``LabView`` software programmed to match the configuration of the experiment along with scanning digital voltmeters and requisite signal sensors. Video camcorders were used to provide video records of six areas of the experiment.

  12. Powered Ankle-Foot Prosthesis for the Improvement of Amputee Samuel K. Au, Hugh Herr, Jeff Weber, and Ernesto C. Martinez-Villalpando

    E-Print Network [OSTI]

    Herr, Hugh

    Powered Ankle-Foot Prosthesis for the Improvement of Amputee Ambulation Samuel K. Au, Hugh Herr, control scheme, and clinical evaluation of a novel, motorized ankle-foot prosthesis, called MIT Powered Ankle-Foot Prosthesis. Unlike a conventional passive-elastic ankle-foot prosthesis, this prosthesis can

  13. Powered ankle-foot prosthesis for the improvement of amputee walking economy

    E-Print Network [OSTI]

    Au, Samuel Kwok-Wai

    2007-01-01T23:59:59.000Z

    The human ankle provides a significant amount of net positive work during the stance period of walking, especially at moderate to fast walking speeds. On the contrary, conventional ankle-foot prostheses are completely ...

  14. Estimation of ground reaction force and zero moment point on a powered ankle-foot prosthesis

    E-Print Network [OSTI]

    Martinez Villalpando, Ernesto Carlos

    2006-01-01T23:59:59.000Z

    Commercially available ankle-foot prostheses are passive when in contact with the ground surface, and thus, their mechanical properties remain fixed across different terrains and walking speeds. The passive nature of these ...

  15. Informing Ankle-Foot Prosthesis Prescription through Haptic Emulation of Candidate Devices

    E-Print Network [OSTI]

    Collins, Steven H.

    Informing Ankle-Foot Prosthesis Prescription through Haptic Emulation of Candidate Devices Joshua M using a haptic prosthesis emulator while their walking performance is quantitatively assessed and results are distilled to inform device prescription. In this emulator system, prosthesis behavior

  16. Control of a Powered Ankle–Foot Prosthesis Based on a Neuromuscular Model

    E-Print Network [OSTI]

    Geyer, Hartmut

    Control schemes for powered ankle-foot prostheses rely upon fixed torque-ankle state relationships obtained from measurements of intact humans walking at target speeds and across known terrains. Although effective at their ...

  17. A neuromuscular-model based control strategy for powered ankle-foot prostheses

    E-Print Network [OSTI]

    Eilenberg, Michael Frederick

    2009-01-01T23:59:59.000Z

    In the development of a powered ankle-foot prosthesis, it is desirable to provide the prosthesis with the ability to exhibit human-like dynamics. A simple method for achieving this goal involves trajectory tracking, where ...

  18. asian foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  19. attenuated foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  20. assess foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  1. Evaluation of the Franz System Foot Control in a simulated adaptive tracking task

    E-Print Network [OSTI]

    Raab, Charles

    1982-01-01T23:59:59.000Z

    EVALUATION OF THE FRANZ SYSTEM FOOT CONTROL IN A SIMULATED ADAPTIVE TRACKING TASK A Thesis by CHARLES RAAB Submitted to the Graduate College of Texas ASM University in partial fulfillment of the requirement for the degree of MASTER... OF SCIENCE May 1982 Major Subject: Industrial Engineering EVALUATION OF THE FRANZ SYSTEM FOOT CONTROL IN A SIMULATED ADAPTIVE TRACKING TASK A Thesis by CHARLES RAAB Approved as to style and content by: (Chairman of Com ttee) (Member) (Member...

  2. Experimental study on hydrodynamic forces acting on an oscillating column with circular footing

    SciTech Connect (OSTI)

    Hoshino, Kunihiro; Sato, Hiroshi [Ministry of Transport, Mitaka (Japan). Ship Research Inst.

    1994-12-31T23:59:59.000Z

    This paper presents the results of an experimental investigation of the in-line and lift forces acting on an oscillating column with circular footing. Forced surging tests were carried out using a column with circular footing of which ratio of diameter was varied from 1.25 to 2.5. The in-line and lift force have been measured concerning both the whole model and the parts of column and footing. The drag coefficients, inertia coefficients, coefficients of root-mean-square values of the in-line force and lift force coefficients in the range of Keulegan Carpenter number from 5 to 30 have been obtained. Those results have been compared with that of a straight finite length circular cylinder.

  3. Multi-functional foot use during running in the zebra-tailed lizard (Callisaurus draconoides)

    E-Print Network [OSTI]

    Chen Li; S. Tonia Hsieh; Daniel I. Goldman

    2013-03-29T23:59:59.000Z

    A diversity of animals that run on solid, level, flat, non-slip surfaces appear to bounce on their legs; elastic elements in the limbs can store and return energy during each step. The mechanics and energetics of running in natural terrain, particularly on surfaces that can yield and flow under stress, is less understood. The zebra-tailed lizard (Callisaurus draconoides), a small desert generalist with a large, elongate, tendinous hind foot, runs rapidly across a variety of natural substrates. We use high speed video to obtain detailed three-dimensional running kinematics on solid and granular surfaces to reveal how leg, foot, and substrate mechanics contribute to its high locomotor performance. Running at ~10 body length/s (~1 m/s), the center of mass oscillates like a spring-mass system on both substrates, with only 15% reduction in stride length on the granular surface. On the solid surface, a strut-spring model of the hind limb reveals that the hind foot saves about 40% of the mechanical work needed per step, significant for the lizard's small size. On the granular surface, a penetration force model and hypothesized subsurface foot rotation indicates that the hind foot paddles through fluidized granular medium, and that the energy lost per step during irreversible deformation of the substrate does not differ from the reduction in the mechanical energy of the center of mass. The upper hind leg muscles must perform three times as much mechanical work on the granular surface as on the solid surface to compensate for the greater energy lost within the foot and to the substrate.

  4. A study of the design criteria for drilled-and-belled footings

    E-Print Network [OSTI]

    Lehmann, Clark Thomas

    1964-01-01T23:59:59.000Z

    A STUDY OF THE DESIGN CRITERIA FOR DRILLED?AND-BELLED FOOTINGS A Thesis Clark Thomas Lehmann Submitted to the Graduate College of Texas ARM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May, 1964... Major Subject: Civil Engineering A STUDY OF THE DESIGN CRITERIA FOR DRILLED-AND-BELLED FOOTINGS A Thesis By Clark Thomas Lehmann Approved as to style and content by: airman o ommittee Head ep tment Nay, 1964 4 0 0 N F 5 O ACKNOWLEDGMENTS...

  5. IEEE TRANSACTIONS ON ROBOTICS, VOL. 25, NO. 1, FEBRUARY 2009 51 Powered AnkleFoot Prosthesis Improves

    E-Print Network [OSTI]

    Herr, Hugh

    IEEE TRANSACTIONS ON ROBOTICS, VOL. 25, NO. 1, FEBRUARY 2009 51 Powered Ankle­Foot Prosthesis, we evaluate the hypothesis that a powered ankle­foot prosthesis, capa- ble of providing human to a conventional passive-elastic prosthesis. To test the hypothesis, a powered prosthesis is built that comprises

  6. IMPEE PhD Opportunity Project title: LightFoot PhD A PhD Investigation Lightning Protection of HV Overhead Lines with Non-Ideal

    E-Print Network [OSTI]

    Greenaway, Alan

    IMPEE PhD Opportunity Project title: LightFoot PhD ­ A PhD Investigation Lightning Protection of HV.swingler@hw.ac.uk Abstract LightFoot PhD ­ A PhD Investigation Lightning Protection of HV Overhead Lines with Non-Ideal Tower Footing Resistance funded by SSE. The LightFoot PhD project takes a fresh approach at adding

  7. Driving Low-Power Wearable Systems with an Adaptively-Controlled Foot-Strike Scavenging Platform

    E-Print Network [OSTI]

    Potkonjak, Miodrag

    as a means to scavenge energy from foot-strikes and power wearable systems. While they exhibit large energy densities, DEs must be closely controlled to maximize the energy they transduce. Towards this end, we propose a DE micro-generator array configuration that enhances transduc- tion efficiency, and the use

  8. Flat-Foot Dynamic Walking via Human-Inspired Controller Design

    E-Print Network [OSTI]

    Ma, Wenlong

    2014-05-05T23:59:59.000Z

    This thesis describes a torque control scheme unifying feedback PD control and feed-forward impedance control to realize human-inspired walking on a novel planar footed bipedal robot: AMBER2. It starts with high fidelity modeling of the robot...

  9. A study of factors affecting foot movement time in a braking maneuver

    E-Print Network [OSTI]

    Berman, Andrea Helene

    1994-01-01T23:59:59.000Z

    The nature of foot movement time (MT) in an actual braking maneuver and in a stationary vehicle was investigated regarding the effects of age and gender of the driver and nature of the stimulus to which the driver was responding. ANOVAs showed...

  10. The high-foot implosion campaign on the National Ignition Facility

    SciTech Connect (OSTI)

    Hurricane, O. A., E-mail: hurricane1@llnl.gov; Callahan, D. A.; Casey, D. T.; Dewald, E. L.; Dittrich, T. R.; Döppner, T.; Barrios Garcia, M. A.; Hinkel, D. E.; Berzak Hopkins, L. F.; Kervin, P.; Pape, S. Le; Ma, T.; MacPhee, A. G.; Milovich, J. L.; Moody, J.; Pak, A. E.; Patel, P. K.; Park, H.-S.; Remington, B. A.; Robey, H. F. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); and others

    2014-05-15T23:59:59.000Z

    The “High-Foot” platform manipulates the laser pulse-shape coming from the National Ignition Facility laser to create an indirect drive 3-shock implosion that is significantly more robust against instability growth involving the ablator and also modestly reduces implosion convergence ratio. This strategy gives up on theoretical high-gain in an inertial confinement fusion implosion in order to obtain better control of the implosion and bring experimental performance in-line with calculated performance, yet keeps the absolute capsule performance relatively high. In this paper, we will cover the various experimental and theoretical motivations for the high-foot drive as well as cover the experimental results that have come out of the high-foot experimental campaign. At the time of this writing, the high-foot implosion has demonstrated record total deuterium-tritium yields (9.3×10{sup 15}) with low levels of inferred mix, excellent agreement with implosion simulations, fuel energy gains exceeding unity, and evidence for the “bootstrapping” associated with alpha-particle self-heating.

  11. Comparative Cost Analysis of Alternative Animal Tracing Strategies Directed Toward Foot and Mouth Disease Outbreaks in the Texas High Plains

    E-Print Network [OSTI]

    Looney, John C.

    2010-07-14T23:59:59.000Z

    The primary objective of this study is to evaluate the industry impact of a hypothetical Foot and Mouth Disease (FMD) outbreak in the Texas High Plains using alternative animal tracing levels. To accomplish this objective, an epidemiological disease...

  12. Development of the Robotic Touch foot Sensor for 2D walking Robot, for Studying Rough Terrain Locomotion

    E-Print Network [OSTI]

    Lee, Hunwoo

    2012-08-31T23:59:59.000Z

    Development of the Robotic Touch foot Sensor for 2D walking Robot, for Studying Rough Terrain Locomotion By HUNWOO LEE Submitted to the graduate degree program in Mechanical Engineering and the Graduate Faculty of the University of Kansas... ________________________________ Professor Robert Umholtz Date Defended: June 5, 2012 ii The Thesis Committee for HUNWOO LEE certifies that this is the approved version of the following thesis: Development of the Robotic Touch Foot Sensor for 2D Walking Robot...

  13. Three-Dimensional Rotational Angiography of the Foot in Critical Limb Ischemia: A New Dimension in Revascularization Strategy

    SciTech Connect (OSTI)

    Jens, Sjoerd, E-mail: s.jens@amc.uva.nl [Academic Medical Center, Department of Radiology (Netherlands); Lucatelli, Pierleone, E-mail: pierleone.lucatelli@gmail.com ['Sapienza' University of Rome, Vascular and Interventional Radiology Unit, Department of Radiological Sciences (Italy); Koelemay, Mark J. W., E-mail: m.j.koelemaij@amc.uva.nl [Academic Medical Center, Department of Surgery (Netherlands); Marquering, Henk A., E-mail: h.a.marquering@amc.uva.nl; Reekers, Jim A., E-mail: j.a.reekers@amc.uva.nl [Academic Medical Center, Department of Radiology (Netherlands)

    2013-06-15T23:59:59.000Z

    Purpose. To evaluate the additional value of three-dimensional rotational angiography (3DRA) of the foot compared with digital subtraction angiography (DSA) in patients with critical limb ischemia (CLI). Technique. For 3DRA, the C-arm was placed in the propeller position with the foot in an isocentric position. The patient's unaffected foot was positioned in a footrest outside the field of view. For correct timing of 3DRA, the delay from contrast injection in the popliteal artery at the level of knee joint to complete pedal arterial enhancement was assessed using DSA. With this delay, 3DRA was started after injection of 15 ml contrast. Imaging of the 3DRA could directly be reconstructed and visualized.Materials and MethodsPatients undergoing 3DRA of the foot were prospectively registered. DSA and 3DRA images were scored separately for arterial patency and presence of collaterals. Treatment strategies were proposed based on DSA with and without the availability of 3DRA. Results. Eleven patients underwent 3DRA of the foot. One 3DRA was not included because the acquisition was focused on the heel instead of the entire foot. Diagnostic quality of 3DRA was good in all ten patients. 3DRA compared with DSA showed additional patent arteries in six patients, patent plantar arch in three patients, and collaterals between the pedal arteries in five patients. Additional information from 3DRA resulted in a change of treatment strategy in six patients. Conclusion, 3DRA of the foot contains valuable additional real-time information to better guide peripheral vascular interventions in patients with CLI and nonhealing tissue lesions.

  14. Impact of a 1,000-foot thermal mixing zone on the steam electric power industry

    SciTech Connect (OSTI)

    Veil, J.A.

    1994-04-01T23:59:59.000Z

    Thermal discharge requirements for power plants using once-through cooling systems are based on state water quality standards for temperatures that must be met outside of designated mixing zones. This study evaluates the impact of limiting the extent of thermal mixing zones. This study evaluates the impact of limiting the extent of thermal mixing zones to no more than 1,000 feet from the discharge point. Data were collected from 79 steam electric plants. Of the plants currently using once-through cooling systems, 74% could not meet current thermal standards at the edge of a 1,000-foot mixing zone. Of this total, 68% would retrofit cooling towers, and 6% would retrofit diffusers. The estimated nationwide capital cost for retrofitting plants that could not meet current thermal standards at the edge of a 1,000-foot mixing zone is $21.4 billion. Conversion of a plant from once-through cooling to cooling towers or addition of diffusers would result in a lower energy output from that plant. For the affected plants, the total estimated replacement cost would be $370 to $590 million per year. Some power companies would have to construct new generating capacity to meet the increased energy demand. The estimated nationwide cost of this additional capacity would be $1.2 to $4.8 billion. In addition to the direct costs associated with compliance with a 1,000-foot mixing zone limit, other secondary environmental impacts would also occur. Generation of the additional power needed would increase carbon dioxide emissions by an estimated 8.3 million tons per year. In addition, conversion from once-through cooling systems to cooling towers at affected plants would result in increased evaporation of about 2.7 million gallons of water per minute nationwide.

  15. Foot Drop after Ethanol Embolization of Calf Vascular Malformation: A Lesson on Nerve Injury

    SciTech Connect (OSTI)

    Tay, Vincent Khwee-Soon, E-mail: vincentkstay@gmail.com [Singapore General Hospital, Department of Plastic, Reconstructive, and Aesthetic Surgery (Singapore); Mohan, P. Chandra, E-mail: chandra.mohan@sgh.com.sg [Singapore General Hospital, Department of Diagnostic Radiology (Singapore); Liew, Wendy Kein Meng, E-mail: wendy.liew.km@kkh.com.sg [KK Women's and Children's Hospital, Department of Paediatrics (Neurology Service) (Singapore); Mahadev, Arjandas, E-mail: arjandas.mahadev@kkh.com.sg [KK Women's and Children's Hospital, Department of Orthopaedic Surgery (Singapore); Tay, Kiang Hiong, E-mail: tay.kiang.hiong@sgh.com.sg [Singapore General Hospital, Department of Diagnostic Radiology (Singapore)

    2013-08-01T23:59:59.000Z

    Ethanol is often used in sclerotherapy to treat vascular malformations. Nerve injury is a known complication of this procedure. However, the management of this complication is not well described in literature. This case describes a 10-year-old boy with a slow flow vascular malformation in the right calf who underwent transarterial ethanol embolization following prior unsuccessful direct percutaneous sclerotherapy. The development of a dense foot drop that subsequently recovered is described, and the management of this uncommon but distressful complication is discussed.

  16. Table 6a. Total Electricity Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet)4. U.S. Vehicle FuelFoot,

  17. U1A Complex

    ScienceCinema (OSTI)

    None

    2015-01-09T23:59:59.000Z

    Some of the most sophisticated experiments in the stockpile stewardship program are conducted in an environmentally safe manner, nearly 1000 feet below the ground at the site. The U1a complex a sprawling underground laboratory and tunnel complex is home to a number of unique capabilities.

  18. U1A Complex

    SciTech Connect (OSTI)

    None

    2014-10-28T23:59:59.000Z

    Some of the most sophisticated experiments in the stockpile stewardship program are conducted in an environmentally safe manner, nearly 1000 feet below the ground at the site. The U1a complex a sprawling underground laboratory and tunnel complex is home to a number of unique capabilities.

  19. Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

    SciTech Connect (OSTI)

    Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

    2007-06-26T23:59:59.000Z

    A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

  20. Proceedings of the 2007 IEEE 10th International Conference on Rehabilitation Robotics, June 12-15, Noordwijk, The Netherlands Biomechanical Design of a Powered Ankle-Foot Prosthesis

    E-Print Network [OSTI]

    Herr, Hugh

    -15, Noordwijk, The Netherlands Biomechanical Design of a Powered Ankle-Foot Prosthesis Samuel K. Au, Jeff Weber, and Hugh Herr Abstract-Although the potential benefits of a powered ankle- foot prosthesis have been well documented, no one has suc- cessfully developed and verified that such a prosthesis can improve amputee gait

  1. Foot & Mouth Disease & Ulcerative/Vesicular Rule-outs: Challenges Encountered in Recent Outbreaks

    SciTech Connect (OSTI)

    Hullinger, P

    2008-01-28T23:59:59.000Z

    Foot and mouth disease (FMD) is a highly infectious and contagious viral disease affecting bovidae (cattle, zebus, domestic buffaloes, yaks), sheep, goats, swine, all wild ruminants and suidae. Camelidae (camels, dromedaries, llamas, vicunas) have low susceptibility. Foot and mouth disease is caused by a RNS virus of the family Picornaviridae, genus Aphthovirus. There are seven immunologically distinct serotypes: A, O, C, SAT1, SAT2, SAT3, Asia 1. Foot and mouth disease causes significant economic loss both to countries who manage it as an endemic disease (with or without vaccination), as well as those FMD free countries which may become infected. The mortality rate is low in adult animals, but often higher in young due to myocarditis. Foot and mouth disease is endemic in parts of Asia, Africa, the Middle East and South America (sporadic outbreaks in free areas). The Office of International Epizootics (OIE), also referred to the World Organization for Animal Health maintains an official list of free countries and zones.1 The OIE Terrestrial Code (Chapter 2.2.10) provides detailed information on the categories of freedom that can be allocated to a country as well as guidelines for the surveillance for foot and mouth disease (Appendix 3.8.7). In short, countries may be completely free of FMD, free with vaccination or infected with foot and mouth disease virus (FMDV). Source of FMDV include incubating and clinically affected animals with virus present in breath, saliva, faeces, urine, milk and semen. In experimental settings virus has been detected in milk several days before the onset of clinical signs2. Additional sources of virus are meat and by-products in which pH has remained above 6.0 as well as persistently infected carrier animals. Carrier animals may include cattle and water buffalo; convalescent animals and exposed vaccinates (virus persists in the oropharynx for up to 30 months in cattle or longer in buffalo, 9 months in sheep). Pigs do not become carriers. It has been shown that the African Cape buffalo are the major maintenance host of SAT serotypes. FMDV transmission can occur by either direct or indirect contact. Indirect transmission can occur via contaminated animate vectors (humans, etc.), inanimate vectors (vehicles, implements) or airborne transmission. Indirect disease transmission via animate or inanimate vectors can play a major role in disease transmission. Good biosecurity can significantly reduce this type of transmission. Airborne transmission is often debated and is known to be serotype and species specific as well as require specific environmental conditions to occur. Airborne transmission is favored in temperate zones and has been postulated to occur over distances of up to 60 km overland and 300 km by sea. Foot and mouth disease virus is an unenveloped virus which is preserved by refrigeration and freezing and progressively inactivated by temperatures above 50 C. FMDV is highly sensitive to pH change and is inactivated by pH < 6.0 or > 9.0. There are many disinfectants which are effective against FMDV including sodium hydroxide (2%), sodium carbonate (4%), and citric acid (0.2%). FMDV is resistant to iodophores, quaternary ammonium compounds, hypochlorite and phenol, especially in the presence of organic matter. The virus can survive in lymph nodes and bone marrow at neutral pH, but is destroyed in muscle when is pH < 6.0 i.e. after rigor mortis. FMDV can persist in contaminated feed/commodities and the environment for over to 1 month, depending on the temperature and pH conditions. The incubation period for FMD is 2-14 days. Animals transition through latent (infected but not infectious), subclinically infected (infectious but lacking clinical signs) clinically infected and recovered disease states. In cattle clinical signs include pyrexia, reluctance to eat, bruxism, drooling, lameness, treading or stamping of the feet and decreased milk production. Most clinical signs are related to the development and subsequent rupturing of vesicles at the coronary band and in the oral cavity. V

  2. Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe Abstract-- Electric powered vehicles use energy stored in some form of battery for the vehicle of electric vehicles through on-road testing, user led trials and the analysis of the data collected from

  3. Stem cubic-foot volume tables for tree species in the piedmont. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 16 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Piedmont. Tables are based on form class measurement data for 2,753 trees sampled in the Piedmont and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  4. Fuel economy testing of six 40-foot transit buses. Final report Aug 82-Mar 83

    SciTech Connect (OSTI)

    Francis, G.A.; Nelson, S.R.

    1983-03-01T23:59:59.000Z

    The importance of life-cycle cost analyses in transit bus procurement is recognized by the industry and has been a Congressional requirement for grantees. This report documents a program of fuel economy testing of six standard 40-foot buses. The main purpose of this series of tests is to assist transit authorities and bus suppliers by providing accurate comparable fuel consumption data on transit buses produced by different manufacturers. Six buses were selected by the manufacturers and supplied for testing by six transit properties directly from revenue service. This report makes the data available to the industry for discretionary use in estimating life-cycle costs. A list of bus manufacturers and the supplying transit system is provided.

  5. Miami Herald January 28, 2005

    E-Print Network [OSTI]

    Columbia University

    of billions of people? Wind power : Wind power is commercially feasible, yet activists argue that the turbines development: balancing environmental, social and economic priorities. Converted to the idea that win by all the windmills in the world. As for aesthetics, wind turbines are works of art compared to some

  6. Evaluation of Multiplexed Foot-and-Mouth Disease Nonstructural Protein Antibody Assay Against Standardized Bovine Serum Panel

    SciTech Connect (OSTI)

    Perkins, J; Parida, S; Clavijo, A

    2007-05-14T23:59:59.000Z

    Liquid array technology has previously been used to show proof-of-principle of a multiplexed non structural protein serological assay to differentiate foot-and-mouth infected and vaccinated animals. The current multiplexed assay consists of synthetically produced peptide signatures 3A, 3B and 3D and recombinant protein signature 3ABC in combination with four controls. To determine diagnostic specificity of each signature in the multiplex, the assay was evaluated against a naive population (n = 104) and a vaccinated population (n = 94). Subsequently, the multiplexed assay was assessed using a panel of bovine sera generated by the World Reference Laboratory for foot-and-mouth disease in Pirbright, UK. This sera panel has been used to assess the performance of other singleplex ELISA-based non-structural protein antibody assays. The 3ABC signature in the multiplexed assay showed comparative performance to a commercially available non-structural protein 3ABC ELISA (Cedi test{reg_sign}) and additional information pertaining to the relative diagnostic sensitivity of each signature in the multiplex is acquired in one experiment. The encouraging results of the evaluation of the multiplexed assay against a panel of diagnostically relevant samples promotes further assay development and optimization to generate an assay for routine use in foot-and-mouth disease surveillance.

  7. Higher velocity, high-foot implosions on the National Ignition Facility laser

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Callahan, D. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000315498916); Hurricane, O. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hinkel, D. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Döppner, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ma, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Park, H. -S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Barrios Garcia, M. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Berzak Hopkins, L. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000291875667); Casey, D. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Cerjan, C. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000251686845); Dewald, E. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dittrich, T. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Edwards, M. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haan, S. W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000184045131); Hamza, A. V. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kline, J. L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Knauer, J. P. [Univ. of Rochester, NY (United States); Kritcher, A. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Landen, O. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); LePape, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); MacPhee, A. G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000341604479); Milovich, J. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Nikroo, A. [General Atomics, San Diego, CA (United States)] (ORCID:0000000288550378); Pak, A. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Patel, P. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rygg, J. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ralph, J. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Salmonson, J. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Spears, B. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Springer, P. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tommasini, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benedetti, L. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bionta, R. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bond, E. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bradley, D. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Caggiano, J. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Field, J. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Fittinghoff, D. N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Frenje, J. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States)] (ORCID:0000000168460378); Gatu Johnson, M. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States); Grim, G. P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hatarik, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Merrill, F. E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Nagel, S. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000277686819); Izumi, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Khan, S. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-05-01T23:59:59.000Z

    By increasing the velocity in “high foot” implosions [Dittrich et al., Phys. Rev. Lett. 112, 055002 (2014); Park et al., Phys. Rev. Lett. 112, 055001 (2014); Hurricane et al., Nature 506, 343 (2014); Hurricane et al., Phys. Plasmas 21, 056314 (2014)] on the National Ignition Facility laser, we have nearly doubled the neutron yield and the hotspot pressure as compared to the implosions reported upon last year. The implosion velocity has been increased using a combination of the laser (higher power and energy), the hohlraum (depleted uranium wall material with higher opacity and lower specific heat than gold hohlraums), and the capsule (thinner capsules with less mass). We find that the neutron yield from these experiments scales systematically with a velocity-like parameter of the square root of the laser energy divided by the ablator mass. By connecting this parameter with the inferred implosion velocity (v), we find that for shots with primary yield >1e15 neutrons, the total yield ~ v???. This increase is considerably faster than the expected dependence for implosions without alpha heating ( ~v???) and is additional evidence that these experiments have significant alpha heating.

  8. Higher velocity, high-foot implosions on the National Ignition Facility laser

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Callahan, D. A.; Hurricane, O. A.; Hinkel, D. E.; Döppner, T.; Ma, T.; Park, H. -S.; Barrios Garcia, M. A.; Berzak Hopkins, L. F.; Casey, D. T.; Cerjan, C. J.; et al

    2015-05-01T23:59:59.000Z

    By increasing the velocity in “high foot” implosions [Dittrich et al., Phys. Rev. Lett. 112, 055002 (2014); Park et al., Phys. Rev. Lett. 112, 055001 (2014); Hurricane et al., Nature 506, 343 (2014); Hurricane et al., Phys. Plasmas 21, 056314 (2014)] on the National Ignition Facility laser, we have nearly doubled the neutron yield and the hotspot pressure as compared to the implosions reported upon last year. The implosion velocity has been increased using a combination of the laser (higher power and energy), the hohlraum (depleted uranium wall material with higher opacity and lower specific heat than gold hohlraums), andmore »the capsule (thinner capsules with less mass). We find that the neutron yield from these experiments scales systematically with a velocity-like parameter of the square root of the laser energy divided by the ablator mass. By connecting this parameter with the inferred implosion velocity (v), we find that for shots with primary yield >1e15 neutrons, the total yield ~ v???. This increase is considerably faster than the expected dependence for implosions without alpha heating ( ~v???) and is additional evidence that these experiments have significant alpha heating.« less

  9. Simulation and analysis of the plutonium shipping container subject to 30-foot drops

    SciTech Connect (OSTI)

    Gong, C.; Gupta, N.K.; Gromada, R.J. [Westinghouse Savannah River Co., Aiken, SC (United States). Savannah River Technology Center

    1995-12-31T23:59:59.000Z

    The shipping container 5320 is a shipping package for radioactive materials. In order to maintain the component in this packaging within the sub-critical state when subjected to any kind of Hypothetical Accident conditions (HAC), this Type B packaging is designed with various impact limiters. The present study is to examine the energy absorbing capacity of the impact limiter design of this container subjected to a 30-foot drop onto a flat unyielding horizontal surface in each of the three critical dropping orientations. This paper presents the results of a three dimensional nonlinear dynamic impact analysis. This analysis shows the deformed configuration of the container caused by the impact and also determines the effects of different stress wave paths in three distinct drops on the stress states in the critical component. The solution to the problem was obtained using the ABAQUS (explicit) finite element computer code. The nonlinearity of this analysis involves large structural deformation, elasto-plastic materials with strain hardening as well as multiple contact interfaces. Three drop orientations were studied, namely, top down impact, bottom down impact and side impact. Results will be compared against actual drop test data.

  10. Modeling Estimated Personnel Needs for a Potential Foot and Mouth Disease Outbreak

    SciTech Connect (OSTI)

    Simmons, K; Hullinger, P

    2008-01-29T23:59:59.000Z

    Foot and Mouth disease (FMD) is a highly infectious and contagious viral disease affecting cloven-hoofed livestock that was last detected in the United States (US) in 1929. The prevalence of FMD in other countries, as well as the current potential for this virus to be used as a form of agroterrorism, has made preparations for a potential FMD outbreak a national priority. To assist in the evaluation of national preparedness, all 50 states were surveyed via e-mail, telephone and web search to obtain emergency response plans for FMD or for foreign animal diseases in general. Information from 33 states was obtained and analyzed for estimates of personnel resources needed to respond to an outbreak. These estimates were consolidated and enhanced to create a tool that could be used by individual states to better understand the personnel that would be needed to complete various tasks over time during an outbreak response. The estimates were then coupled, post-processing, to the output from FMD outbreaks simulated in California using the Multiscale Epidemiological/Economic Simulation and Analysis (MESA) model at Lawrence Livermore National Laboratory to estimate the personnel resource demands, by task, over the course of an outbreak response.

  11. Reference Buildings by Climate Zone and Representative City:...

    Energy Savers [EERE]

    1A Miami, Florida Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida In addition to the ZIP file for each building type, you can directly view the...

  12. 164 IEEE TRANSACTIONS ON NEURAL SYSTEMS AND REHABILITATION ENGINEERING, VOL. 18, NO. 2, APRIL 2010 Control of a Powered AnkleFoot Prosthesis

    E-Print Network [OSTI]

    Geyer, Hartmut

    Control of a Powered Ankle­Foot Prosthesis Based on a Neuromuscular Model Michael F. Eilenberg, Hartmut the difficulties of explicit terrain sensing. Specifically, the energy provided by the prosthesis was directly--Neuromuscular model, powered prosthesis, pros- thesis control, terrain adaptation. I. INTRODUCTION TODAY

  13. The potential role of wildlife in the spread and control of foot and mouth disease in an extensive livestock management system

    E-Print Network [OSTI]

    Highfield, Linda

    2009-05-15T23:59:59.000Z

    Foot and mouth disease (FMD) is a highly contagious viral infection that affects all Artiodactyls (cloven-hoofed) species. The United States has been free of FMD since 1929, and the entire population of cloven-hoofed species is therefore susceptible...

  14. Stem cubic-foot volume tables for tree species in the upper coastal plain. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 11 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Upper Coastal Plain. Tables are based on form class measurement data for 521 trees sampled in the Upper Coastal Plain and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  15. Stem cubic-foot volume tables for tree species in the Appalachian area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 20 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Appalachian Area. Tables are based on form class measurement data for 2,670 trees sampled in the Appalachian Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  16. Stem cubic-foot volume tables for tree species in the Gulf and Atlantic coastal plain. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 14 species and 9 species groups based on equations used to estimate timber sale volumes on national forests in the Gulf and Atlantic Coastal Plain. Tables are based on form class measurement data for 2,728 trees sampled in the Gulf and Atlantic Coastal Plain and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  17. Stem cubic-foot volume tables for tree species in the Arkansas area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 9 species and 9 species groups based on equations used to estimate timber sale volumes on national forests in the Arkansas Area. Tables are based on form class measurement data for 1,417 trees sampled in the Arkansas Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination woth total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  18. Stem cubic-foot volume tables for tree species in the Delta area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 13 species and 6 species groups based on equations used to estimate timber sale volumes on national forests in the Delta Area. Tables are based on form class measurement data for 990 trees sampled in the Delta Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on diameter outside of the bark (d.o.b.) in combination with height with to a 9-inch d.o.b. top.

  19. Atlantic Oceanographic and Meteorological LaboratoryNovember-December 2007 Volume 11, Number 6 Miami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, Florida

    E-Print Network [OSTI]

    the first Category 5 hurricane to make landfall in the Atlantic Basin since Hurricane Andrew struck South Atlantic Hurricane Season Ends But Questions Remain As the 2007 Atlantic hurricane season officially came lower- than-expected hurricane activity across theAtlantic Basin.As a result, the United States

  20. Atlantic Oceanographic and Meteorological LaboratoryMay-June 2008 Volume 12, Number 3 Miami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, FloridaMiami, Florida

    E-Print Network [OSTI]

    . Dean became the first category 5 Atlantic hurricane to make landfall since Hurricane Andrew devastated state means having a plan for each and every hurricane season. Review or complete emergency plans now "Americans in hurricane-prone states must get serious and be prepared. Government--even with the Federal

  1. Economic Impacts of Potential Foot and Mouth Disease Agro-terrorism in the United States: A Computable General Equilibrium Analysis

    SciTech Connect (OSTI)

    Oladosu, Gbadebo A [ORNL] [ORNL; Rose, Adam [University of Southern California, Los Angeles] [University of Southern California, Los Angeles; Bumsoo, Lee [University of Illinois] [University of Illinois

    2013-01-01T23:59:59.000Z

    The foot and mouth disease (FMD) virus has high agro-terrorism potential because it is contagious, can be easily transmitted via inanimate objects and can be spread by wind. An outbreak of FMD in developed countries results in massive slaughtering of animals (for disease control) and disruptions in meat supply chains and trade, with potentially large economic losses. Although the United States has been FMD-free since 1929, the potential of FMD as a deliberate terrorist weapon calls for estimates of the physical and economic damage that could result from an outbreak. This paper estimates the economic impacts of three alternative scenarios of potential FMD attacks using a computable general equilibrium (CGE) model of the US economy. The three scenarios range from a small outbreak successfully contained within a state to a large multi-state attack resulting in slaughtering of 30 percent of the national livestock. Overall, the value of total output losses in our simulations range between $37 billion (0.15% of 2006 baseline economic output) and $228 billion (0.92%). Major impacts stem from the supply constraint on livestock due to massive animal slaughtering. As expected, the economic losses are heavily concentrated in agriculture and food manufacturing sectors, with losses ranging from $23 billion to $61 billion in the two industries.

  2. Data:D7e09c30-e3e6-4f1a-b678-472937808e85 | Open Energy Information

    Open Energy Info (EERE)

    of construction (CIAC) as outlined below; i. 525 per 22 foot fiberglass pole; ii. 1,450 per 35 foot fiberglass pole; Metal Poles a.Prior to construction, the requesting party...

  3. ARM - Campaign Instrument - mmcr94miami

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492air Comments? We would love to hear from you! SendgovInstrumentslmwrr-airmiami Comments? We would love to

  4. Miami Gasoline and Diesel Retail Prices

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 3400,Information Administration (EIA)011 3.012 2.997 3.001

  5. Miami, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy InformationGardens,Springs,

  6. Miami, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |JilinLu an GroupInformationMexico CentralEnergyMexico)Focus

  7. Miami2010_miniboone_hray.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals fromprocess used in mining -MODERN GRID S T R A TMiami

  8. Category:Miami, FL | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty EditCalifornia:Power LPInformationCashtonGo Back toFL" The following 16 files

  9. foote-98.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron4 Self-Scrubbing:,, , ., December 8,John Wagoner,, 2012Temperature

  10. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    SciTech Connect (OSTI)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26T23:59:59.000Z

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  11. Comparing resolved-sideband cooling and measurement-based feedback cooling on an equal footing: analytical results in the regime of ground-state cooling

    E-Print Network [OSTI]

    Kurt Jacobs; Hendra I. Nurdin; Frederick W. Strauch; Matthew James

    2015-03-19T23:59:59.000Z

    We show that in the regime of ground-state cooling, simple expressions can be derived for the performance of resolved-sideband cooling --- an example of coherent feedback control --- and optimal linear measurement-based feedback cooling for a harmonic oscillator. These results are valid to leading order in the small parameters that define this regime. They provide insight into the origins of the limitations of coherent and measurement-based feedback for linear systems, and the relationship between them. These limitations are not fundamental bounds imposed by quantum mechanics, but are due to the fact that both cooling methods are restricted to use only a linear interaction with the resonator. We compare the performance of the two methods on an equal footing --- that is, for the same interaction strength --- and confirm that coherent feedback is able to make much better use of the linear interaction than measurement-based feedback. We find that this performance gap is caused not by the back-action noise of the measurement but by the projection noise. We also obtain simple expressions for the maximal cooling that can be obtained by both methods in this regime, optimized over the interaction strength.

  12. The tale of a modern animal plague: Tracing the evolutionary history and determining the time-scale for foot and mouth disease virus

    SciTech Connect (OSTI)

    Tully, Damien C. [Smurfit Institute of Genetics, Trinity College Dublin (Ireland)], E-mail: dtully@tcd.ie; Fares, Mario A. [Smurfit Institute of Genetics, Trinity College Dublin (Ireland)], E-mail: faresm@tcd.ie

    2008-12-20T23:59:59.000Z

    Despite significant advances made in the understanding of its epidemiology, foot and mouth disease virus (FMDV) is among the most unexpected agricultural devastating plagues. While the disease manifests itself as seven immunologically distinct strains their origin, population dynamics, migration patterns and divergence times remain unknown. Herein we have assembled a comprehensive data set of gene sequences representing the global diversity of the disease and inferred the time-scale and evolutionary history for FMDV. Serotype-specific rates of evolution and divergence times were estimated using a Bayesian coalescent framework. We report that an ancient precursor FMDV gave rise to two major diversification events spanning a relatively short interval of time. This radiation event is estimated to have taken place towards the end of the 17th and the beginning of the 18th century giving us the present circulating Euro-Asiatic and South African viral strains. Furthermore our results hint that Europe acted as a possible hub for the disease from where it successfully dispersed elsewhere via exploration and trading routes.

  13. Course Syllabus: Chem W1A General Chemistry Course Information

    E-Print Network [OSTI]

    Alvarez-Cohen, Lisa

    Course Syllabus: Chem W1A General Chemistry Course Information Course Number Chemistry W1A Course) Themed Problems.3. Participation in the discussion forums.4. Chem W1A General Chemistry Syllabus https Syllabus https://elearning.berkeley.edu/AngelUploads/Content/2013SUC... 2 of 10 5/28/13 10:13 AM #12;We

  14. Cancellation of DOE G 440.2B-1A

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-02-15T23:59:59.000Z

    Cancels DOE G 440.2B-1A, Implementation Guide - Performance Indicators (Metrics) for Use with Doe O 440.2B, Aviation Management and Safety.

  15. Aquaculture University of MiAMi rosenstiel school

    E-Print Network [OSTI]

    Miami, University of

    , non-governmental organization, and the general public's environmental and regulatory concerns in unprotected areas offshore. And, they are constantly monitoring environmental impacts and exploring ways is effective in preventing impact on the surrounding environ- ment. the future Remarkably, cobia growth rates

  16. Miami Students' Solar Decathlon Design Focused on Sustainability...

    Broader source: Energy.gov (indexed) [DOE]

    Communications Specialist, Office of Public Affairs How can I participate? The next Solar Decathlon will be held Sept. 23-Oct. 2, 2011, at the National Mall's West Potomac Park...

  17. COMMON TREES ON THE FIU CAMPUS AND IN MIAMI

    E-Print Network [OSTI]

    Koptur, Suzanne

    , but are not woody. Other plants may grow as shrubs or as low trees, as the Surinam cherry (left out of this key published the name, and can ultimately be traced back to the publication and the population of plants

  18. 3RD MIAMI INTERNATIONAL CONFERENCE ON ALTERNATIVE ENERGY SOURCES

    Office of Scientific and Technical Information (OSTI)

    M.F. Arthur BatteHe Columbus Laboratories Columbus, Ohio 43201, USA POTENTIAL OF ENERGY FARMS IN THE DOMINICAN REPUBLIC 298 R.K. Trehan, L. Newman and W.R. Park The MITRE...

  19. MIAMI: A Framework for Application Performance Diagnosis Gabriel Marin

    E-Print Network [OSTI]

    Marin, Gabriel

    Fleischmann, qui rend toujours de si grands services dans l'analyse industrielle du lait et dans les analyses

  20. University of Miami Rosenstiel School of Marine & Atmospheric Science

    E-Print Network [OSTI]

    Miami, University of

    papers, chaired sessions or gave talks at the annual Fall Meeting of the American Geophysical Union being, white tips, and marble rays at a level of intimacy generally not available without a scuba rebreather

  1. Miami-Dade County- Targeted Jobs Incentive Fund

    Broader source: Energy.gov [DOE]

    The Targeted Jobs Incentive Fund (TJIF) provides financial incentives for select industries, including solar thermal and photovoltaic manufacturing, installation and repair companies that are...

  2. El VII Festival de Teatro Hispano (Miami, 1992)

    E-Print Network [OSTI]

    Escarpanter, José A.

    1992-10-01T23:59:59.000Z

    . La presencia de este grupo resultó un brillante cierre para las jornadas de este festival, que año tras año ha ido ganando en calidad, proyección internacional y, afortunadamente, público interesado en él. Auburn University ...

  3. University of Miami Cooperative Institute for Marine and Atmospheric Studies

    E-Print Network [OSTI]

    -observation comparison and model validation is a plus. Interest in working with all the different data sets collected for an Associate Scientist position in Climate/Physical Oceanography. The incumbent will work with scientists experience, and interest and experience in one of the following areas: 1. Demonstrated interest and ability

  4. Breaking Ground in Miami-Dade | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: The FutureCommentsEnergyandapproximatelyBoostingandDOE

  5. EECBG Success Story: Keeping Sustainability on Track in Miami | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S.ContaminationJulySavannah River SiteDepartment of Energy Members ofof

  6. Keeping Sustainability on Track in Miami | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment ofLetter Report: I11IG002RTC3WASTE-TO-ENERGY: WASTEKeepingDesign

  7. West Miami, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown ofNationwideWTED JumpHills, New York: Energy Resources

  8. Miami County, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose Bend <StevensMcClellan,IIMettler,Information081473°,

  9. Miami-Dade County, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose Bend

  10. South Miami, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro Industries Pvt LtdShawangunk, NewSingaporeSonix JapanCalifornia:(RECP) inLyon,

  11. North Miami Beach, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer PlantMunhall,Missouri: Energy ResourcesGranby, Connecticut: EnergyLaurel,Little9331488°,

  12. North Miami, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer PlantMunhall,Missouri: Energy ResourcesGranby, Connecticut:

  13. Miami Beach, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy Information TopicsMexicoMi GmbH

  14. Miami County, Indiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy Information TopicsMexicoMi

  15. Miami County, Kansas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy Information TopicsMexicoMiCounty,

  16. Miami Dade County Resource Recovery Fac Biomass Facility | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy Information

  17. Miami Gardens, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy InformationGardens, Florida: Energy

  18. Miami Lakes, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy InformationGardens, Florida:

  19. Miami Shores, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy InformationGardens,

  20. Miami Springs, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy InformationGardens,Springs, Florida:

  1. New Miami, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer PlantMunhall, Pennsylvania:Information Operating Permit ListFacility |

  2. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    SciTech Connect (OSTI)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06T23:59:59.000Z

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses (which are of two bovine types) bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). A timeline for this development is presented in Table 1. The development of the Version 1.0 panel for FMDV rule-out and the most current efforts aimed to designed species specific panels has spanned over 2 1/2 years with multiple collaborative partnerships. This document provides a summary of the development, testing and performance data at OIE Stage 1 Feasibility into Stage 2 Assay Development and Standardization1 (see Table 2), gathered as of June 30th, 2007 for the porcine and bovine MUX assay panels. We present an overview of the identification and selection of candidate genetic signatures, the assay development process, and preliminary performance data for each of the individual signatures as characterized in the multiplexed format for the porcine and bovine panels. The Stage 1 Feasibility data of the multiplexed panels is presented in this report also includes relevant data acquired from the Version 1.0 panel as supporting information where appropriate. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must precede efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available. As a summary report, this document does not provide the details of signature generation, evaluation, and testing, nor does it provide spec

  3. CHARACTERIZATION OF ORGANIC ANION TRANSPORTING POLYPEPTIDE 1A1 (OATP1A1) IN THE BILE ACID HOMEOSTASIS OF MICE

    E-Print Network [OSTI]

    Zhang, Youcai

    2011-04-20T23:59:59.000Z

    metabolomic profiling of WT and Oatp1a1-null mice…………………….......133 xiii 2.13 Urinary excretion of riboflavin in WT and Oatp1a1-null mice………………………..137 III. Discussion………………………………………………………………………………………...137 Chapter 6 The Critic Role of Mouse Oatp1a1...) glucuronidated-indole-3-carboxylic acid, (b) hippuric acid, (c) glucuronidated-daidzein, and (d) daidzein in the urine samples by comparison their retention time with authentic standards. ……………………………………………………..136 Figure 5-17. Urinary excretion of riboflavin...

  4. Chaotic Dynamics in Multidimensional Transition States Ali Allahem1, a)

    E-Print Network [OSTI]

    Chaotic Dynamics in Multidimensional Transition States Ali Allahem1, a) and Thomas Bartsch1, b consequences of normal hyperbolicity20,21 : a)Electronic mail: a.allahem@lboro.ac.uk b)Electronic mail: t.bartsch

  5. Safeguards for Uranium Extraction (UREX) +1a Process

    E-Print Network [OSTI]

    Feener, Jessica S.

    2011-08-08T23:59:59.000Z

    of nuclear material accountancy (MA), containment and surveillance (C/S) and solution monitoring (SM). Facility information was developed for a hypothesized UREX+1a plant with a throughput of 1000 Metric Tons Heavy Metal (MTHM) per year. Safeguard goals...

  6. Safeguards for Uranium Extraction (UREX) +1a Process 

    E-Print Network [OSTI]

    Feener, Jessica S.

    2011-08-08T23:59:59.000Z

    safeguards approach is needed to show that a commercially sized UREX+ facility can be safeguarded to current international standards. A detailed safeguards approach for a UREX+1a reprocessing facility has been developed. The approach includes the use...

  7. The fundamental theorem of Galois theory Definition 1. A polynomial ...

    E-Print Network [OSTI]

    2011-11-14T23:59:59.000Z

    The fundamental theorem of Galois theory. Definition 1. A polynomial in K[X] (K a field) is separable if it has no multiple roots in any field containing K. An ...

  8. MA10209 Algebra 1A Counting Partitions: GCS

    E-Print Network [OSTI]

    Smith, Geoff

    a slightly different question. How many ways are there to partition five people into three teams, one of sizeMA10209 Algebra 1A Counting Partitions: GCS 30-x-11 The course website is http://people on enumerating partitions. Suppose that you have five people, and you wish to put them into three teams: a blue

  9. Modeling of Coal Drying before Pyrolysis Damintode Kolani1, a

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Modeling of Coal Drying before Pyrolysis Damintode Kolani1, a , Eric Blond1, b , Alain Gasser1 Forbach, France a damintode.kolani@univ-orleans.fr, b eric.blond@univ-orleans.fr Keywords: coal, drying: drying process and pyrolysis of coal. A heat and mass transfer model was developed to simulate the drying

  10. Microstructure through an ice sheet Tobias Binder1, a

    E-Print Network [OSTI]

    Garbe, Christoph S.

    Microstructure through an ice sheet Tobias Binder1, a , Ilka Weikusat2, b , Johannes Freitag2, c.Garbe@iwr.uni-heidelberg.de, e Dietmar.Wagenbach@iup.uni-heidelberg.de, f Sepp.Kipfstuhl@awi.de Keywords: Ice, microstructure characterization, grain boundary curvature, image processing Abstract. Ice cores through an ice sheet can

  11. Evolution of isolated turbulent trailing vortices Karthik Duraisamy1,a

    E-Print Network [OSTI]

    Alonso, Juan J.

    Evolution of isolated turbulent trailing vortices Karthik Duraisamy1,a and Sanjiva K. Lele2,b 1 evolution of a low swirl-number turbulent Batchelor vortex is studied using pseudospectral direct numerical application of boundary conditions. The physics of the evolution is investigated with an emphasis

  12. Bioinformatics Workshop #1 A Brief Introduction to Multiple Sequence

    E-Print Network [OSTI]

    Ronquist, Fredrik

    Bioinformatics Workshop #1 A Brief Introduction to Multiple Sequence Analysis through GCG's SeqLab The SeqLab Graphical User Interface (GUI) is a `front-end' to the Wisconsin Sequence Analysis Package GCG programs and is a great way to develop, refine, and analyze multiple sequence alignments. So what

  13. The Plumber's Nightmare:1 A New Morphology in Block

    E-Print Network [OSTI]

    Gruner, Sol M.

    The Plumber's Nightmare:1 A New Morphology in Block Copolymer-Ceramic Nanocomposites and Mesoporous-ceramic nanocomposites and mesoporous aluminosilicates that are derived by an amphiphilic diblock copolymer, poly-copolymer-derived hybrid morphology is discussed in the context of a pseudo-ternary morphology diagram and compared

  14. 1 A Grid based distributed simulation of Plasma Turbulence

    E-Print Network [OSTI]

    Vlad, Gregorio

    1 A Grid based distributed simulation of Plasma Turbulence Beniamino Di Martino and Salvatore- cati, Rome, Italy Grid technology is widespreading, but most grid-enabled applications just exploit of Grid platforms. In this paper the porting on a Globus equipped platform of a hierarchically distributed

  15. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    new2004v1.35.0.zip refbldg1ausaflmiaminew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida...

  16. CV-1a: Magmatic - Extrusive | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:EzfeedflagBiomassSustainableCSL Gas Recovery Biomass Facility Jump to:ROW FormsNetwork)CV-1a:

  17. Pump-1-A Wholesale Power Rate Schedule | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo. 195 -Pueblo de San Ildefonso Pueblo1-A

  18. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    SciTech Connect (OSTI)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06T23:59:59.000Z

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  19. Roles of EEF1A2 & PTK6 in breast cancer 

    E-Print Network [OSTI]

    Fida, Mariam

    2011-07-05T23:59:59.000Z

    Eukaryotic Translation Elongation Factor 1 Alpha (EEF1A) exists as two forms with different tissue specificities and encoded by separate loci: eEF1A1 on 6q13 and eEF1A2 on 20q13.3. eEF1A1 is ubiquitously expressed whereas ...

  20. Foot-conditioned phonotactics and prosodic constituency

    E-Print Network [OSTI]

    Bennett, Ryan Thomas

    2012-01-01T23:59:59.000Z

    constituency by Ryan T. Bennett There has been a recurrentin LINGUISTICS by Ryan T. Bennett September 2012 TheDissertation of Ryan T. Bennett is approved: Professor Junko

  1. Evaluation of environmental foot printing techniques

    E-Print Network [OSTI]

    Conway, John J., M.B.A. Massachusetts Institute of Technology

    2012-01-01T23:59:59.000Z

    With a growing focus on sustainability many companies are proactively assessing their product and supply chain footprints. Cisco is a leader in the ICT (Information and Communications Technology) industry and is working ...

  2. LittleFoot Energy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |Jilin ZhongdiantouLichuan CityLiqcrytech LLC JumpListLittle Sioux

  3. Induction of cytochromes P450 1A1 and 1A2 by tanshinones in human HepG2 hepatoma cell line

    SciTech Connect (OSTI)

    Zhang Rong [Key Laboratory of Drug Metabolism and Pharmacokinetics, Key Unit of SATCM for Pharmacokinetics Methodology of TCM Complex Prescription, China Pharmaceutical University, Nanjing (China); Sun Jianguo, E-mail: jgsun_cpucn@yahoo.com.cn [Key Laboratory of Drug Metabolism and Pharmacokinetics, Key Unit of SATCM for Pharmacokinetics Methodology of TCM Complex Prescription, China Pharmaceutical University, Nanjing (China); Ma Liping; Wu Xiaolan [Key Laboratory of Drug Metabolism and Pharmacokinetics, Key Unit of SATCM for Pharmacokinetics Methodology of TCM Complex Prescription, China Pharmaceutical University, Nanjing (China); Pan Guoyu [Metabolism and Pharmacokinetics (MAP), Novartis Institute of Biomedical Research (NIBR), 250 Massachusetts Avenue, Cambridge, Massachusetts (United States); Hao Haiping; Zhou Fang; Jiye, A; Liu Changhui; Ai Hua; Shang Lili; Gao Haiyan; Peng Ying; Wan Ping; Wu Hui [Key Laboratory of Drug Metabolism and Pharmacokinetics, Key Unit of SATCM for Pharmacokinetics Methodology of TCM Complex Prescription, China Pharmaceutical University, Nanjing (China); Wang Guangji, E-mail: guangjiwang@hotmail.com [Key Laboratory of Drug Metabolism and Pharmacokinetics, Key Unit of SATCM for Pharmacokinetics Methodology of TCM Complex Prescription, China Pharmaceutical University, Nanjing (China)

    2011-04-01T23:59:59.000Z

    Diterpenoid tanshinones including tanshinone IIA (TIIA), cryptotanshinone (CTS), tanshinone I (TI) and dihydrotanshinone I (DHTI) are the major bioactive components from Danshen. The major aim of our present study was to investigate the induction potential of these four main components of tanshinones (TIIA, CTS, TI, and DHTI) on the expression of CYP1A1 and CYP1A2 in HepG2 cells. Our results showed that all of these four tanshinones caused a significant time- and concentration-dependent increase in the amount of CYP1A1/2 expression in HepG2 cells. These induction effects were further characterized through transcriptional regulation: the induction of CYP1A1/2 mRNA level by tanshinones was completely blocked by the transcription inhibitor actinomycin D; the expression of CYP1A1/2 heterogeneous nuclear RNA was induced by tanshinone treatment; and CYP1A1 mRNA stability was not influenced by these tanshinones. Interestingly, tanshinones plus B[a]P produced additive/synergistic effect on CYP1A1/2 induction. In addition, the tanshinone-induced CYP1A1/2 expression was abolished by the aryl hydrocarbon receptor (AhR) antagonist resveratrol, suggesting an AhR dependent transcription mechanism. In the reporter gene assay, while TI and DHTI significantly induced AhR-dependent luciferase activity, TIIA and CTS failed to induce this activity. Collectively, the tanshinones could induce CYP1A1 and CYP1A2 expression through transcriptional activation mechanism and exert differential effects on activating AhR in HepG2 cells. Our findings suggest that rational administration of tanshinones should be considered with respect to their effect on AhR and CYP1A1/2 expression.

  4. Attachment B Applicants must submit properly completed 1(A/B), S1(A/B), and S5(A/B) forms to certify or precertify

    E-Print Network [OSTI]

    1 Attachment B Applicants must submit properly completed 1(A/B), S1(A/B), and S5(A/B) forms of the facility · Specific fuel type · Source of the fuel (onsite, delivered, etc.) #12;2 The S5 form and they each have 3 delivery entities, then 15 S5 form "packets" are required, all with all three sections

  5. Policy Flash 2014-40 Implementation of DOE O 580.1A, DOE Energy...

    Energy Savers [EERE]

    4-40 Implementation of DOE O 580.1A, DOE Energy Personal Property Management Policy Flash 2014-40 Implementation of DOE O 580.1A, DOE Energy Personal Property Management Questions...

  6. Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System...

    Broader source: Energy.gov (indexed) [DOE]

    0 DOE Order 412.1a, Work Authorization System Administrative Change Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System Administrative Change Questions concerning this...

  7. Performance analysis of HD1: a 16 Tesla Nb3Sn dipole Magnet

    E-Print Network [OSTI]

    Mattafirri, S.

    2009-01-01T23:59:59.000Z

    Analysis of HD1: A 16 Tesla Nb 3 Sn Dipole Magnet S.of HD1b, an Upgraded 16 Tesla Nb 3 Sn Dipole Magnet”, This

  8. Evaluation of the Cask Transportation Facility Modifications (CTFM) compliance to DOE order 6430.1A

    SciTech Connect (OSTI)

    ARD, K.E.

    1999-07-14T23:59:59.000Z

    This report was prepared to evaluate the compliance of Cask Transportation Facility Modifications (CTFM) to DOE Order 6430.1A.

  9. Extension of DOE O 311.1A, Equal Employment Opportunity and Diversity Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-12-21T23:59:59.000Z

    This Notice extends DOE O 311.1A, Equal Employment Opportunity and Diversity Program, dated 12-30-96 until 12-30-01, unless sooner rescinded.

  10. DON eBUSOPSOFFINST 4650.1A DEPARTMENT OF THE NAVY

    E-Print Network [OSTI]

    DON eBUSOPSOFFINST 4650.1A DEPARTMENT OF THE NAVY eBUSINESS OPERATIONS OFFICE 5450 CARLISLE PIKE PO DON eBUSINESS OPERATIONS OFFICE INSTRUCTION 4650.1A Subj: POLICIES AND PROCEDURES Apr 03 (l) OSD Memo of 10 Jun 03 (m) Civilian Human Resources Manual Sub-Chapter 762 (n) IG Memo of 25

  11. Specification No. 203-HJT-9000R09000R1a Specification for a Pump System for

    E-Print Network [OSTI]

    McDonald, Kirk

    Specification No. 203-HJT-9000R09000R1a Specification for a Pump System for the High Power Mercury-Jet Target Experiment August 24Nov 1, 2005 #12;Specification for Syringe Pump System High Power Mercury Target Experiment 203-HJT-9000R09000R1a ii SPECIFICATION FOR A PUMP SYSTEM FOR THE HIGH POWER MERCURY

  12. U.S. Nominal Cost per Foot of Crude Oil Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)Oil Wells

  13. U.S. Nominal Cost per Foot of Dry Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)OilDry Wells

  14. U.S. Nominal Cost per Foot of Natural Gas Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)OilDry

  15. Negative feedback regulation of Homer 1a on norepinephrine-dependent cardiac hypertrophy

    SciTech Connect (OSTI)

    Chiarello, Carmelina; Bortoloso, Elena; Carpi, Andrea; Furlan, Sandra; Volpe, Pompeo, E-mail: pompeo.volpe@unipd.it

    2013-07-15T23:59:59.000Z

    Homers are scaffolding proteins that modulate diverse cell functions being able to assemble signalling complexes. In this study, the presence, sub-cellular distribution and function of Homer 1 was investigated. Homer 1a and Homer 1b/c are constitutively expressed in cardiac muscle of both mouse and rat and in HL-1 cells, a cardiac cell line. As judged by confocal immunofluorescence microscopy, Homer 1a displays sarcomeric and peri-nuclear localization. In cardiomyocytes and cultured HL-1 cells, the hypertrophic agonist norepinephrine (NE) induces ?{sub 1}-adrenergic specific Homer 1a over-expression, with a two-to-three-fold increase within 1 h, and no up-regulation of Homer 1b/c, as judged by Western blot and qPCR. In HL-1 cells, plasmid-driven over-expression of Homer 1a partially antagonizes activation of ERK phosphorylation and ANF up-regulation, two well-established, early markers of hypertrophy. At the morphometric level, NE-induced increase of cell size is likewise and partially counteracted by exogenous Homer 1a. Under the same experimental conditions, Homer 1b/c does not have any effect on ANF up-regulation nor on cell hypertrophy. Thus, Homer 1a up-regulation is associated to early stages of cardiac hypertrophy and appears to play a negative feedback regulation on molecular transducers of hypertrophy. -- Highlights: • Homer 1a is constitutively expressed in cardiac tissue. • In HL-1 cells, norepinephrine activates signaling pathways leading to hypertrophy. • Homer 1a up-regulation is an early event of norepinephrine-induced hypertrophy. • Homer 1a plays a negative feedback regulation modulating pathological hypertrophy. • Over-expression of Homer 1a per se does not induce hypertrophy.

  16. antidepressants 5-ht1a 5-ht2a: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    antagonists, which when labeled with carbon-11 (b with positron emission tomogra- phy (PET). In a search for new 5-HT1A antagonists with different pharmacokinetic than 1. On the...

  17. Deep Blue No. 1-A Slimhole Geothermal Discovery at Blue Mountain...

    Open Energy Info (EERE)

    at Blue Mountain, Humboldt County, Nevada Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Deep Blue No. 1-A Slimhole Geothermal Discovery at...

  18. Deep Blue No.1-A Slimhole Geothermal Discovery At Blue Mountain...

    Open Energy Info (EERE)

    At Blue Mountain, Humboldt County, Nevada Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Deep Blue No.1-A Slimhole Geothermal Discovery At...

  19. Test Results for HD1, a 16 Tesla Nb3Sn Dipole Magnet

    E-Print Network [OSTI]

    Lietzke, A.F.

    2011-01-01T23:59:59.000Z

    Design and Fabrication ofa 16 Tesla Nb 3 Sn Dipole Magnet",Test Results for HD 1, a 16 Tesla Nb 3 Sn Dipole Magnet A.F.and bore fields above 16 Tesla. II. MAGNET FEATURES AND TEST

  20. Interactive Multimedia and Historical Chronology Page 1 A FRAMEWORK FOR DESIGNING INTERACTIVE MULTIMEDIA TO

    E-Print Network [OSTI]

    Rogers, Yvonne

    Interactive Multimedia and Historical Chronology Page 1 A FRAMEWORK FOR DESIGNING INTERACTIVE MULTIMEDIA TO SCAFFOLD YOUNG CHILDREN'S UNDERSTANDING OF HISTORICAL CHRONOLOGY ELIZABETH MASTERMAN (Kodak/Royal Academy of Engineering Educational Technology Research Group, School of Electronic and Electrical

  1. Insurance & Indemnification-Form 1A UT-Battelle Contracts Page 1 of 2

    E-Print Network [OSTI]

    Pennycook, Steve

    Insurance & Indemnification-Form 1A UT-Battelle Contracts March 2011 Page 1 of 2 insurance forth below, and shall immediately notify UT-Battelle, LLC, in writing of any notice of cancellation

  2. Terahertz radiation detection by field effect transistor in magnetic field S. Boubanga-Tombet,1,a

    E-Print Network [OSTI]

    Levelut, Claire

    Terahertz radiation detection by field effect transistor in magnetic field S. Boubanga-Tombet,1,a M; accepted 30 July 2009; published online 19 August 2009 We report on terahertz radiation detection with In

  3. P. Organizational Profile P.1.a(1) Honeywell Federal Manufacturing & Technologies

    E-Print Network [OSTI]

    Magee, Joseph W.

    1 #12;2 P. Organizational Profile P.1.a(1) Honeywell Federal Manufacturing & Technologies (FM are reflected in the Purpose. FM&T Values are the twelve Honeywell behaviors. FM&T's core competency enables

  4. A polymorphism in metallothionein 1A (MT1A) is associated with cadmium-related excretion of urinary beta 2?microglobulin

    SciTech Connect (OSTI)

    Lei, Lijian [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China) [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China); Department of Epidemiology, School of Public Health, Shanxi Medical University, Shanxi (China); Chang, Xiuli [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China)] [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China); Rentschler, Gerda [Department of Occupational and Environmental Medicine, Lund University, SE-22185, Lund (Sweden)] [Department of Occupational and Environmental Medicine, Lund University, SE-22185, Lund (Sweden); Tian, Liting [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China)] [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China); Zhu, Guoying; Chen, Xiao [Department of Bone Metabolism, Institute of Radiation Medicine, Fudan University, Shanghai (China)] [Department of Bone Metabolism, Institute of Radiation Medicine, Fudan University, Shanghai (China); Jin, Taiyi, E-mail: tyjinster@gmail.com [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China)] [Department of Occupational Health, School of Public Health, Fudan University, Shanghai (China); Broberg, Karin, E-mail: karin.broberg_palmgren@med.lu.se [Department of Occupational and Environmental Medicine, Lund University, SE-22185, Lund (Sweden)] [Department of Occupational and Environmental Medicine, Lund University, SE-22185, Lund (Sweden)

    2012-12-15T23:59:59.000Z

    Objectives: Cadmium (Cd) toxicity of the kidney varies between individuals despite similar exposure levels. In humans Cd is mainly bound to metallothioneins (MT), which scavenge its toxic effects. Here we analyzed whether polymorphisms in MT genes MT1A and MT2A influence Cd-related kidney damage. Methods: In a cross-sectional study N = 512 volunteers were selected from three areas in South-Eastern China, which to varying degree were Cd-polluted from a smelter (control area [median Cd in urine U-Cd = 2.67 ?g/L], moderately [U-Cd = 4.23 ?g/L] and highly [U-Cd = 9.13 ?g/L] polluted areas). U-Cd and blood Cd (B-Cd) concentrations were measured by graphite-furnace atomic absorption spectrometry. MT1A rs11076161 (G/A), MT2A rs10636 (G/C) and MT2A rs28366003 (A/G) were determined by Taqman assays; urinary N-Acetyl-beta-(D)-Glucosaminidase (UNAG) by spectrometry, and urinary ?2-microglobulin (UB2M) by ELISA. Results: Higher B-Cd (natural log-transformed) with increasing number of MT1A rs11076161 A-alleles was found in the highly polluted group (p-value trend = 0.033; all p-values adjusted for age, sex, and smoking). In a linear model a significant interaction between rs11076161 genotype and B-Cd was found for UNAG (p = 0.001) and UB2M concentrations (p = 0.001). Carriers of the rs11076161 AA genotype showed steeper slopes for the associations between Cd in blood and natural log-transformed UB2M (? = 1.2, 95% CI 0.72–1.6) compared to GG carriers (? = 0.30, 95% CI 0.15–0.45). Also for UNAG (natural log-transformed) carriers of the AA genotype had steeper slopes (? = 0.55, 95% CI 0.27–0.84) compared to GG carriers (? = 0.018, 95% CI ? 0.79–0.11). Conclusions: MT1A rs11076161 was associated with B-Cd concentrations and Cd-induced kidney toxicity at high exposure levels. -- Highlights: ? Cadmium is toxic to the kidney but the susceptibility differs between individuals. ? The toxic effect of cadmium is scavenged by metallothioneins. ? A common variant of metallothionein 1A was genotyped in 512 cadmium exposed humans. ? Variant carriers of this polymorphism showed more kidney damage from cadmium. ? The frequency of these variants needs to be taken into account in risk assessment.

  5. what to use when installing trees and shrubs in Miami-Dade

    E-Print Network [OSTI]

    Jawitz, James W.

    underground storage cistern ­ shade? Time to explore the Acanthaceae don't forget our local butterflies. Plus shaped). If planting on limestone, especially for a large container or a field grown #12;tree, dig 3 by incorporating sufficient of a 1:2 mix of compost and coarse builders sand. On limestone, especially for a field

  6. tiontionXX tensiontension UF/IFAS Miami-Dade County Extension, 18710 SW 288th

    E-Print Network [OSTI]

    Watson, Craig A.

    of Hurricane Andrew, I can still remember being huddled in the bathroom of my parent's home and hearing of Hurricane Andrew in 1992 and the heavy damage caused by 2005's Katrina and Wilma, most residents of South. And at the beginning of the season, stock up on canned goods and water that will last you through the hurricane prone

  7. UNIVERSITY OF MIAMI HEALTH SYSTEM NOTICE OF PRIVACY PRACTICES EFFECTIVE DATE: SEPTEMBER 20, 2013

    E-Print Network [OSTI]

    Shyu, Mei-Ling

    health care professionals who provide you with treatment and health care services at such locations that portions of this notice may not apply. If you receive alcohol or substance abuse services or treatment from our substance abuse treatment program, you will receive a separate notice describing how we may use

  8. Miami-Dade County- Voluntary Energy Efficiency and Renewable Energy Program

    Broader source: Energy.gov [DOE]

    Applications must be submitted to the county and must include a cost estimate for the installations completed by a certified contractor. The property owner must agree to a non-ad valorem assessme...

  9. Understanding Elián : the politics of childhood in Miami and Havana, 1959-1962

    E-Print Network [OSTI]

    Casavantes Bradford, Anita

    2011-01-01T23:59:59.000Z

    Pérez Cruz, Felipe de J. La Alfabetización en Cuba: Lecturain La Campaña de Alfabetización, which mobilized and trainedof Education, the Campaña de Alfabetización also sought to

  10. UniversiTy of MiAMi rosensTiel school of MArine And ATMospheric science

    E-Print Network [OSTI]

    Miami, University of

    . While this scenario seems to doom polar ice caps, nature has a way to possibly slow ice melt and ocean, average temperatures in the United States' most northern city have risen 10 degrees, melting snow and ice freezing, sea ice, glaciers, permafrost, and snow melt, increasing the fresh water in the world's oceans

  11. Modeling single family housing recovery after Hurricane Andrew in Miami-Dade County, FL

    E-Print Network [OSTI]

    Zhang, Yang

    2009-06-02T23:59:59.000Z

    -Hispanic Black) recovered more slowly than homes in majority populated areas (non-Hispanic White). When considering Cuban- Hispanics and non-Cuban Hispanics as two separate groups, neighborhoods with a higher concentration of Cuban-Hispanics, while having...

  12. EECBG Success Story: Breaking Ground in Miami-Dade | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S.ContaminationJulySavannah River Site forCommunity' | Department ofSensors

  13. David A. Katz $ Comparative Sedimen-tology Laboratory, University of Miami, 4600

    E-Print Network [OSTI]

    Swart, Peter K.

    Sedimentology Laboratory. His research investigates the earliest diagenesis and geochemistry of modern Sedimentology Laboratory. He received his Ph.D. from the Swiss Institute of Technology (Eidgeno¨ssische Technische Hochschule) in Zurich, Switzerland. His field research focuses on sedimentology and se- quence

  14. President Highlights Smart Energy Training at U. of Miami | Department of

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammieReserve | Department of

  15. President Highlights Smart Energy Training at U. of Miami | Department of

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked QuestionsDepartmentGasInformation Resources » PresentationsDepartmentEnergy

  16. Miami-Cass County Rural E M C | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |JilinLu an GroupInformationMexico

  17. General Merchandise 2009 TSD Miami High Plug Load 50% Energy Savings | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump1946865°,Park, Texas:Webinars/Puesta enOpen EnergyOpenEnergy

  18. General Merchandise 2009 TSD Miami High Plug Load Baseline | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump1946865°,Park, Texas:Webinars/Puesta enOpen

  19. General Merchandise 2009 TSD Miami Low Plug Load 50% Energy Savings | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump1946865°,Park, Texas:Webinars/Puesta enOpenEnergy Information General

  20. General Merchandise 2009 TSD Miami Low Plug Load Baseline | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump1946865°,Park, Texas:Webinars/Puesta enOpenEnergy Information

  1. Supplemental Reactor Physics Calculations and Analysis of ELF Mk 1A Fuel

    SciTech Connect (OSTI)

    Michael A. Pope

    2014-10-01T23:59:59.000Z

    These calculations supplement previous the reactor physics work evaluating the Enhanced Low Enriched Uranium (LEU) Fuel (ELF) Mk 1A element. This includes various additional comparisons between the current Highly Enriched Uranium (HEU) and LEU along with further characterization of the performance of the ELF fuel. The excess reactivity to be held down at BOC for ELF Mk 1A fuel is estimated to be approximately $2.75 greater than with HEU for a typical cycle. This is a combined effect of the absence of burnable poison in the ELF fuel and the reduced neck shim worth in LEU fuel compared to HEU. Burnable poison rods were conceptualized for use in the small B positions containing Gd2O3 absorber. These were shown to provide $2.37 of negative reactivity at BOC and to burn out in less than half of a cycle. The worth of OSCCs is approximately the same between HEU and ELF Mk 1A (LEU) fuels in the representative loading evaluated. This was evaluated by rotating all banks simultaneously. The safety rod worth is relatively unchanged between HEU and ELF Mk 1A (LEU) fuels in the representative loading evaluated. However, this should be reevaluated with different loadings. Neutron flux, both total and fast (>1 MeV), is either the same or reduced upon changing from HEU to ELF Mk 1A (LEU) fuels in the representative loading evaluated. This is consistent with the well-established trend of lower neutron fluxes for a given power in LEU than HEU.The IPT loop void reactivity is approximately the same or less positive with ELF Mk 1A (LEU) fuel than HEU in the representative loading evaluated.

  2. Compositions and methods related to serotonin 5-HT1A receptors

    DOE Patents [OSTI]

    Mukherjee, Jogeshwar; Saigal, Neil; Saigal leg, Harsh

    2012-09-25T23:59:59.000Z

    Contemplated substituted arylpiperazinyl compounds, and most preferably 18F-Mefway, exhibit desirable in vitro and in vivo binding characteristics to the 5-HT1A receptor. Among other advantageous parameters, contemplated compounds retain high binding affinity, display optimal lipophilicity, and are radiolabeled efficiently with 18F-fluorine in a single step. Still further, contemplated compounds exhibit high target to non-target ratios in receptor-rich regions both in vitro and in vivo, and selected compounds can be effectively and sensitively displaced by serotonin, thus providing a quantitative tool for measuring 5-HT1A receptors and serotonin concentration changes in the living brain.

  3. Compositions and methods related to serotonin 5-HT1A receptors

    DOE Patents [OSTI]

    Mukherjee, Jogeshwar; Saigal, Neil

    2010-06-08T23:59:59.000Z

    Contemplated substituted arylpiperazinyl compounds, and most preferably 18F-Mefway, exhibit desirable in vitro and in vivo binding characteristics to the 5-HT1A receptor. Among other advantageous parameters, contemplated compounds retain high binding affinity, display optimal lipophilicity, and are radiolabeled efficiently with 18F-fluorine in a single step. Still further, contemplated compounds exhibit high target to non-target ratios in receptor-rich regions both in vitro and in vivo, and selected compounds can be effectively and sensitively displaced by serotonin, thus providing a quantitative tool for measuring 5-HT1A receptors and serotonin concentration changes in the living brain.

  4. The infrared spectrum of cyclic-N3: Theoretical prediction Dmitri Babikov1,a

    E-Print Network [OSTI]

    Reid, Scott A.

    The infrared spectrum of cyclic-N3: Theoretical prediction Dmitri Babikov1,a and Brian K. Kendrick2 the first calculations of the infrared absorption spectrum of cyclic-N3. Accurate vibrational energies in the 10­25 mD range. The most intense part of the infrared absorption spectrum is observed in the deep

  5. Pulsed infrared laser annealing of gold nanoparticles embedded in a silica A. Halabica,1,a

    E-Print Network [OSTI]

    Pennycook, Steve

    Pulsed infrared laser annealing of gold nanoparticles embedded in a silica matrix A. Halabica,1,a J; published online 28 April 2008 Pulsed infrared laser irradiation was used to modify the optical and physical in a fused-silica matrix. The experiments demonstrate the unique effects of fast thermal heating

  6. IEEE TRANSACTIONS ON AUTOMATION SCIENCE AND ENGINEERING 1 A Survey of Research on

    E-Print Network [OSTI]

    Abbeel, Pieter

    IEEE TRANSACTIONS ON AUTOMATION SCIENCE AND ENGINEERING 1 A Survey of Research on Cloud Robotics and Automation Ben Kehoe Student Member, IEEE, Sachin Patil Member, IEEE, Pieter Abbeel Senior Member, IEEE, Ken-accessible resources, has potential to provide significant benefits to robots and automation systems. This survey

  7. Dynamic behavior analysis for a six axis industrial machining BISU Claudiu1,a

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    .). In the aerospace industry, robot starts to be used for complex applications such as drilling, riveting, fiberDynamic behavior analysis for a six axis industrial machining robot BISU Claudiu1,a , CHERIF Mehdi2-yves.knevez@u-bordeaux1.fr Abstract The six axis robots are widely used in automotive industry for their good

  8. Plasmonic and bolometric terahertz detection by graphene field-effect A. V. Muraviev,1,a)

    E-Print Network [OSTI]

    dependence analysis of back-gated graphene field-effect transistor terahertz responsivity at frequencies 0.003 X cm covered with 300-nm thermally grown SiO2 served as a substrate and back source and drain contacts were depos- ited on graphene by the electron beam evaporation. Fig. 1(a) shows

  9. Molecular Dynamics Simulations of Shock-Induced Thermite Reaction Vikas Tomar1,a

    E-Print Network [OSTI]

    Tomar, Vikas

    Molecular Dynamics Simulations of Shock-Induced Thermite Reaction Vikas Tomar1,a and Min Zhou1,b 1 Dynamics, Thermite Mixture Abstract. A computational framework for molecular dynamics (MD) simulations of shock-induced reactions in thermite mixtures is developed. The system under study is an Fe2O3+Al

  10. IESE'2008 Defeng Sun 1 A Newton-CG Augmented Lagrangian Method

    E-Print Network [OSTI]

    Sun, Defeng

    IESE'2008 Defeng Sun 1 ' & $ % A Newton-CG Augmented Lagrangian Method for Large Scale Semidefinite Programming Defeng Sun Department of Mathematics National University of Singapore October 2, 2008 Joint work with Kim Chuan Toh and Xin-Yuan Zhao #12;IESE'2008 Defeng Sun 2 ' & $ % Let Sn be the set of all real

  11. WCOM'2009/MATH Defeng Sun/NUS 1 A Proximal Point Method for Matrix Least Squares

    E-Print Network [OSTI]

    Sun, Defeng

    WCOM'2009/MATH Defeng Sun/NUS 1 ' & $ % A Proximal Point Method for Matrix Least Squares Problem with Nuclear Norm Regularization Defeng Sun Department of Mathematics National University of Singapore May 2, 2009 Joint work with Kaifeng Jiang and Kim Chuan Toh #12;WCOM'2009/MATH Defeng Sun/NUS 2 ' & $ % Let Sn

  12. SFU'2009/MATH Defeng Sun/NUS 1 A Newton-CG Augmented Lagrangian Method

    E-Print Network [OSTI]

    Sun, Defeng

    SFU'2009/MATH Defeng Sun/NUS 1 ' & $ % A Newton-CG Augmented Lagrangian Method for Large Scale Semidefinite Programming Defeng Sun Department of Mathematics National University of Singapore March 12, 2009 Joint work with Kim Chuan Toh and Xin-Yuan Zhao #12;SFU'2009/MATH Defeng Sun/NUS 2 ' & $ % Let Sn

  13. Notice of Intent to Revise DOE O 200.1A, Information Technology Management--Withdrawn

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-12-15T23:59:59.000Z

    Withdrawn 3-24-14. Although DOE O 200.1A was revised in December 2008, there have been significant changes in IT governance processes and Departmental use of new technologies such as Web 2.0 technologies since that time.

  14. II MODEL AND FEEDBACK LINEARIZING CONTROLLER 1 A Multilayer Perceptron Replaces a Feedback

    E-Print Network [OSTI]

    Amaral, José Nelson

    II MODEL AND FEEDBACK LINEARIZING CONTROLLER 1 A Multilayer Perceptron Replaces a Feedback Linearization Controller in a Nonlinear Servomechanism Jos'e F. Haffner, Ney T. Meyrer, Jos'e N. Amaral and Lu'is F. A. Pereira Abstract--- A Feedback Linearizing Controller (FLC) is used to train a multilayer

  15. IEEE TRANSACTIONS ON GEOSCIENCE AND REMOTE SENSING, TO APPEAR. 1 A Hybrid Conditional Random Field for

    E-Print Network [OSTI]

    Murphy, Kevin Patrick

    IEEE TRANSACTIONS ON GEOSCIENCE AND REMOTE SENSING, TO APPEAR. 1 A Hybrid Conditional Random Field of buildings, vegetations, cars, and natural terrain features over large regions. However, in many applications generative) probabilistic model, we call it a hybrid Conditional Random Field. We show that a MAP estimate

  16. CALCOLO 1 -Test 1 A 26 ottobre 2004 Cognome: Nome: Matricola

    E-Print Network [OSTI]

    Serapioni, Raul

    CALCOLO 1 - Test 1 A 26 ottobre 2004 Cognome: Nome: Matricola: · Una ed una sola delle quattro affermazioni `e corretta. Indicarla con una croce. · `E consentita una sola correzione per ogni domanda: per ottobre 2004 Cognome: Nome: Matricola: · Una ed una sola delle quattro affermazioni `e corretta. Indicarla

  17. Magnetic Resonance Imaging 1 A new global optimization algorithm and its application to a

    E-Print Network [OSTI]

    Neumaier, Arnold

    Magnetic Resonance Imaging 1 A new global optimization algorithm and its application to a Magnetic-cost, low-field multipolar magnet for Magnetic Resonance Imaging with a high field uniformity, the proposed method em- ploys, as local search engine, a derivative free procedure. Under reasonable

  18. LabFlow1: a Database Benchmark for HighThroughput Workflow Management \\Lambda

    E-Print Network [OSTI]

    Bonner, Anthony

    University of Toronto Department of Computer Science 10 King's College Rd Toronto, ON, Canada M5S 1A4 2 track of workflow activity. This DBMS maintains an audit trail, or event history, that records number P50 HG00098, and from the U.S. Department of Energy under contract DE­FG02­95ER62101. #12

  19. WWW.THEEIR.COM THE EUROPEAN INVESTMENT REVIEW 1 A RATING-BASED

    E-Print Network [OSTI]

    Jeanblanc, Monique

    WWW.THEEIR.COM THE EUROPEAN INVESTMENT REVIEW 1 A RATING-BASED MODEL FOR CREDIT DERIVATIVES not sustained by itself derivative-linked liabilities on oil and elec- tricitycontracts INVESTMENT REVIEW WWW.THEEIR.COM is a positive random function of the two vari- ables x and R, which

  20. Phase stability of carbon clathrates at high pressure Jian-Tao Wang,1,a

    E-Print Network [OSTI]

    Wang, Wei Hua

    Phase stability of carbon clathrates at high pressure Jian-Tao Wang,1,a Changfeng Chen,2 Ding, Institute of Physics, Chinese Academy of Sciences, Beijing 100080, China 2 Department of Physics and Hi an ab initio study on the structural stability of carbon clathrates at high pressure and identify fcc

  1. Internal wave energy radiated from a turbulent mixed layer James R. Munroe1, a)

    E-Print Network [OSTI]

    Sutherland, Bruce

    Internal wave energy radiated from a turbulent mixed layer James R. Munroe1, a) and Bruce R in the shear layer is characterized using particle image velocimetry to measure the kinetic energy den- sity, and energy density. We also perform fully nonlinear numer- ical simulations restricted to two dimensions

  2. Version complte 1a / avril 2011 Conservatoire botanique national du Bassin parisien

    E-Print Network [OSTI]

    , protections, menaces et statuts) Version complète 1a / avril 2011 Auteurs de la notice : Sébastien Filoche@mnhn.fr Sébastien Filoche, responsable de la délégation Île-de-France Conservatoire botanique national du Bassin 56 47 - Fax : 01 40 79 35 53 E-mail : filoche@mnhn.fr Coordination scientifique : Sébastien Filoche

  3. Version simplifie 1a / avril 2011 Conservatoire botanique national du Bassin parisien

    E-Print Network [OSTI]

    , protections, menaces et statuts) Version simplifiée 1a / avril 2011 Auteurs de la notice : Sébastien Filoche@mnhn.fr Sébastien Filoche, responsable de la délégation Île-de-France Conservatoire botanique national du Bassin 56 47 - Fax : 01 40 79 35 53 E-mail : filoche@mnhn.fr Coordination scientifique : Sébastien Filoche

  4. Thermal conductivity of nitrogenated ultrananocrystalline diamond films M. Shamsa,1,a

    E-Print Network [OSTI]

    , polycrystalline diamond PCD , diamondlike carbon DLC , carbon nanotubes, and single-layer graphene, have recentlyThermal conductivity of nitrogenated ultrananocrystalline diamond films on silicon M. Shamsa,1,a S of nitrogenated ultrananocrystalline diamond UNCD films on silicon. For better accuracy, the thermal conductivity

  5. Characterization of surface and nonlinear elasticity in wurtzite ZnO nanowires J. Yvonnet,1, a)

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Characterization of surface and nonlinear elasticity in wurtzite ZnO nanowires J. Yvonnet,1, a) A­25 . Several first-principles studies have been conducted on wurtzite ZnO surfaces26­32 . Marana et al.33 have effects and their relation to size-dependent effective properties of ZnO wurtzite nanowires, by means

  6. Mirror Advanced Reactor Study (MARS). Final report. Volume 1-A. Commercial fusion electric plant

    SciTech Connect (OSTI)

    Donohue, M.L.; Price, M.E. (eds.)

    1984-07-01T23:59:59.000Z

    Volume 1-A contains the following chapters: (1) plasma engineering, (2) magnets, (3) ecr heating systems, (4) anchor ion-cyclotron resonance heating system, (5) sloshing ion neutral beam, (6) end cell structure, (7) end plasma technology, (8) fueling, (9) startup ion cyclotron resonant heating systems, and (10) end cell radiation analysis. (MOW)

  7. Barnes Thompson -Krizek 1 A LONGITUDINAL ANALYSIS OF THE EFFECT OF BICYCLE

    E-Print Network [OSTI]

    Levinson, David M.

    Barnes ­ Thompson - Krizek 1 A LONGITUDINAL ANALYSIS OF THE EFFECT OF BICYCLE FACILITIES ON COMMUTE. Minneapolis, MN 55455 Tel: 612 626 9865 Fax: 612 626 9833 gbarnes@hhh.umn.edu Kristin Thompson Humphrey@tc.umn.edu Submitted July 28, 2005 4765 words plus 6 tables and 1 figure = 6515 word equivalent #12;Barnes ­ Thompson

  8. WHERE ARE THE ELECTRIC VEHICLES?1 A SPATIAL MODEL FOR VEHICLE-CHOICE COUNT DATA2

    E-Print Network [OSTI]

    Kockelman, Kara M.

    1 WHERE ARE THE ELECTRIC VEHICLES?1 A SPATIAL MODEL FOR VEHICLE-CHOICE COUNT DATA2 3 T. Donna Chen4 ABSTRACT29 30 Electric vehicles (EVs) are predicted to increase in market share as auto manufacturers: Electric vehicles, spatial count modeling, vehicle choice, vehicle ownership,1 consumer behavior

  9. Atomistic Models of Long-Term Hydrogen Diffusion in Metals M. P. Ariza1,a

    E-Print Network [OSTI]

    Ortiz, Michael

    and efficient storage of hydrogen is one of the key challenges in developing a hydrogen economy. RecentlyAtomistic Models of Long-Term Hydrogen Diffusion in Metals M. P. Ariza1,a , K. G. Wang,2,b , and M-speed, high-capacity, reversible hydrogen storage applications. Notably, the absorption and desorption

  10. Transition paths in molecules at finite temperature F. J. Pinski1,a

    E-Print Network [OSTI]

    Stuart, Andrew

    Transition paths in molecules at finite temperature F. J. Pinski1,a and A. M. Stuart2,b 1 evolving via Brownian dynamics, the most likely transition path between reactant and product may be found as a minimizer of the Freidlin­Wentzell action functional. An analog for finite temperature transitions is given

  11. Canister storage building compliance assessment DOE Order 6430.1A, General Design Criteria

    SciTech Connect (OSTI)

    BLACK, D.M.

    1999-08-12T23:59:59.000Z

    This document presents the Project's position on compliance with DOE Order 6430.1A ''General Design Criteria.'' No non-compliances are shown. The compliance statements have been reviewed and approved by DOE. Open items are scheduled to be closed prior to project completion.

  12. Giprokoks proposals for improvement in air quality at coke battery 1A of Radlin coke plant

    SciTech Connect (OSTI)

    T.F. Trembach; A.G. Klimenko [Giprokoks, the State Institute for the Design of Coke-Industry Enterprises, Kharkov (Ukraine)

    2009-07-15T23:59:59.000Z

    Coke battery 1A, which uses rammed batch, has gone into production at Radlin coke plant (Poland), on the basis of Giprokoks designs. Up-to-date dust-trapping methods are used for the first time within the aspiration systems in the coal-preparation shop and in improving dust collection within the production buildings.

  13. Design and construction of coke battery 1A at Radlin coke plant, Poland

    SciTech Connect (OSTI)

    A.M. Kravchenko; D.P. Yarmoshik; V.B. Kamenyuka; G.E. Kos'kova; N.I. Shkol'naya; V.V. Derevich; A.S. Grankin [Giprokoks, the State Institute for the Design of Coke-Industry Enterprises, Kharkov (Ukraine)

    2009-07-15T23:59:59.000Z

    In the design and construction of coke battery 1A at Radlin coke plant (Poland), coking of rammed coke with a stationary system was employed for the first time. The coke batteries are grouped in blocks. Safety railings are provided on the coke and machine sides of the maintenance areas.

  14. A Graph-based Approach to API Usage Adaptation Hoan Anh Nguyen,1a

    E-Print Network [OSTI]

    Kim, Miryung

    to accommodate new feature requests, to fix bugs, and to meet new standards, changes in API declarationsA Graph-based Approach to API Usage Adaptation Hoan Anh Nguyen,1a Tung Thanh Nguyen,1b Gary Wilson standards, the clients of software libraries often need to make correspond- ing changes to correctly use

  15. PetrovGalerkin Spectral Elements 1 A PetrovGalerkin Spectral Element Technique for Heterogeneous Porous

    E-Print Network [OSTI]

    in spirit to a mixed finite element method or a Petrov­Galerkin scheme. If the sequence of orthogonal commonly used for finite element approximations [14]. The technique proceeds by integrating against ``testPetrov­Galerkin Spectral Elements 1 A Petrov­Galerkin Spectral Element Technique for Heterogeneous

  16. Ductile rupture of prestrained X100 pipeline steel sheets Jacques Besson1, a

    E-Print Network [OSTI]

    Boyer, Edmond

    (TMCP process). The resulting microstructure is mainly a dual phase structure consisting of fineDuctile rupture of prestrained X100 pipeline steel sheets Jacques Besson1, a , Yasuhiro Shinohara,1.morgeneyer@ensmp.fr, d yazid.madi@mat.ensmp.fr Keywords: Prestrain, X100 steel, ductile rupture, anisotropy, toughness

  17. Field emission cooling of thermoelectric semiconductor PbTe M. S. Chung,1,a

    E-Print Network [OSTI]

    Mayer, Alexandre

    Field emission cooling of thermoelectric semiconductor PbTe M. S. Chung,1,a A. Mayer,2 B. L. Weiss due to field emission from n-type PbTe, a typical thermoelectric material. We show that, by calculating the average energies of field and replacement electrons, the energy exchange in field emission

  18. Thermoelectric power factor enhancement by ionized nanoparticle scattering Je-Hyeong Bahk,1,a)

    E-Print Network [OSTI]

    Thermoelectric power factor enhancement by ionized nanoparticle scattering Je-Hyeong Bahk,1,a theoretically that the thermoelectric power factor can be enhanced in degenerate semiconductors when embedded intact. We find that the thermoelectric power factor of In0.53Ga0.47As from 300 K to 800 K is enhanced

  19. Volume XIX, No. 1 A publication of the U.S. Army Installation Management Command

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Volume XIX, No. 1 A publication of the U.S. Army Installation Management Command January -- the New Landscape #12;Public Works Digest · January/February 2007 Public Works Digest is an unofficial publication of the U.S. Army Installation Management Command, under AR 360-1, The Army Public Affairs Program

  20. Assessing Non-Normal Effects in Thermoacoustic Systems with Mean Flow. K. Wieczorek,1, a)

    E-Print Network [OSTI]

    Nicoud, Franck

    Assessing Non-Normal Effects in Thermoacoustic Systems with Mean Flow. K. Wieczorek,1, a) C this paper, non-normal interactions in a thermoacoustic system are studied, using a low-order expansion. INTRODUCTION Over the last decades, thermoacoustic instabilities have been the subject of intense re- search

  1. Assessing Non-Normal Effects in Thermoacoustic Systems with Mean Flow. K. Wieczorek,1, a)

    E-Print Network [OSTI]

    Boyer, Edmond

    Assessing Non-Normal Effects in Thermoacoustic Systems with Mean Flow. K. Wieczorek,1, a) C.1063/1.3650418 #12;In this paper, non-normal interactions in a thermoacoustic system are studied, using a low,version1-19Mar2013 #12;I. INTRODUCTION Over the last decades, thermoacoustic instabilities have been

  2. RESEARCH Open Access Hypoxia-inducible factor (HIF1a) gene expression

    E-Print Network [OSTI]

    Boyer, Edmond

    with outcome. Our findings reinforce the value of monitoring plasma lactate levels to guide the treatment and intense tissue hypoxia that may lead to death. Tissue hypoxia is accompanied by a decreased production and accumulates in the cellular nucleus [5]. The effects of HIF1a are stimulation of erythropoi- esis, glycolysis

  3. Microstructure and mechanical behavior of ultrafine-grained titanium J. Gubicza1,a

    E-Print Network [OSTI]

    Gubicza, Jenõ

    Microstructure and mechanical behavior of ultrafine-grained titanium J. Gubicza1,a , Zs. Fogarassy1@yahoo.com Keywords: Titanium, Equal Channel Angular Pressing (ECAP), radial forging, drawing, microstructure, mechanical properties. Abstract. Ultrafine-grained titanium was processed by severe plastic deformation (SPD

  4. IEEE TRANSACTIONS ON ANTENNAS AND PROPAGATION 1 A Rigorous and Efficient Analysis of 3D Printed

    E-Print Network [OSTI]

    Aksun, M. Irsadi

    IEEE TRANSACTIONS ON ANTENNAS AND PROPAGATION 1 A Rigorous and Efficient Analysis of 3D Printed of structures with multiple vertical strips running in multilayer environment. Index Terms-- Multilayered 3D is developed to accurately simulate 3D structures in multilayer environment [1], and to simultaneously simulate

  5. A Variational Formulation of Kinematic Waves 1 A VARIATIONAL FORMULATION OF

    E-Print Network [OSTI]

    Daganzo, Carlos F.

    A Variational Formulation of Kinematic Waves 1 A VARIATIONAL FORMULATION OF KINEMATIC WAVES proposes two algorithms that, based on a variational version of kinematic wave (KW) theory (Daganzo, 2003, University of California, Berkeley, California, USA ABSTRACT It has been recently shown that all kinematic

  6. Stable spheromak formation by merging in an oblate flux conserver T. Gray,1,a

    E-Print Network [OSTI]

    Brown, Michael R.

    Stable spheromak formation by merging in an oblate flux conserver T. Gray,1,a M. R. Brown,1 C. D; accepted 4 February 2010; published online 29 March 2010 An axisymmetric spheromak formed by the dynamic merging of two smaller spheromaks of the same magnetic helicity in the Swarthmore Spheromak Experiment SSX

  7. Sputtered TiN films for superconducting coplanar waveguide resonators S. Ohya,1, a)

    E-Print Network [OSTI]

    Martinis, John M.

    Sputtered TiN films for superconducting coplanar waveguide resonators S. Ohya,1, a) B. Chiaro,2 A of the properties of TiN films by varying the deposition conditions in an ultra-high-vacuum reactive magnetron changes to weak tensile in-plane strain. The TiN films absorb a high concentration of contaminants

  8. Crossflow instability of finite Bdewadt flows: Transients and spiral waves Juan M. Lopez,1,a

    E-Print Network [OSTI]

    Lopez, John M.

    Crossflow instability of finite Bödewadt flows: Transients and spiral waves Juan M. Lopez,1,a is not robust, suffering crossflow instability to multiarmed spiral waves via a supercritical Hopf bifurcation as a canonical three- dimensional flow which exemplifies the crossflow instability.1­4 In this flow

  9. Elastic Lennard-Jones polymers meet clusters: Differences and similarities Stefan Schnabel,1,a

    E-Print Network [OSTI]

    Bachmann, Michael

    Elastic Lennard-Jones polymers meet clusters: Differences and similarities Stefan Schnabel,1,a of elastic flexible off-lattice polymers with Lennard-Jones monomer-monomer interaction and anharmonic and nonicosahedral low-energy polymer morphologies. © 2009 American Institute of Physics. doi:10.1063/1.3223720 I

  10. Sediment resuspension and erosion by vortex rings R. J. Munro,1,a

    E-Print Network [OSTI]

    Dalziel, Stuart

    Sediment resuspension and erosion by vortex rings R. J. Munro,1,a N. Bethke,2 and S. B. Dalziel2 1; accepted 26 January 2009; published online 8 April 2009 Particle resuspension and erosion induced-ring propagation speed. The critical conditions for resuspension whereby particles are only just resuspended were

  11. Cmo completar el Formulario de Solicitud de Beneficios Continuos 1a Parte del Video

    E-Print Network [OSTI]

    Cómo completar el Formulario de Solicitud de Beneficios Continuos 1a Parte del Video Bienvenidos al formulario de solicitud de beneficios, favor de ver la segunda parte de este video titulado "Como Completar el Formulario de Solicitud de Beneficios Continuos." El video esta disponible en el sitio de Internet

  12. Zfh1, a somatic motor neuron transcription factor, regulates axon exit from the CNS

    E-Print Network [OSTI]

    Oregon, University of

    Zfh1, a somatic motor neuron transcription factor, regulates axon exit from the CNS Michael J 2006 Abstract Motor neurons are defined by their axon projections, which exit the CNS to innervate somatic or visceral musculature, yet remarkably little is known about how motor axons are programmed

  13. Single-layer graphene cathodes for organic photovoltaics Marshall Cox,1,a

    E-Print Network [OSTI]

    Kim, Philip

    Single-layer graphene cathodes for organic photovoltaics Marshall Cox,1,a Alon Gorodetsky,2 Bumjung single-layer graphene is demonstrated as a cathode for organic photovoltaic devices. The measured properties indicate that graphene offers two potential advantages over conventional photovoltaic electrode

  14. Nature 442, 657-659 (10 August 2006) 1 A probable stellar solution

    E-Print Network [OSTI]

    Korn, Andreas

    Nature 442, 657-659 (10 August 2006) 1 A probable stellar solution to the cosmological lithium- sity, Box 515, 75120 Uppsala, Sweden. 2Department of Physics and Astronomy, University of °Arhus, Ny to the composition of the gas from which the stars originated. Giant stars, however, have deep surface convection

  15. Cavitation-induced ignition of cryogenic hydrogen-oxygen fluids V. V. Osipov,1,a

    E-Print Network [OSTI]

    Muratov, Cyrill

    Cavitation-induced ignition of cryogenic hydrogen-oxygen fluids V. V. Osipov,1,a C. B. Muratov,2 E-ignite in the process of their sudden mixing. Here, we propose a cavitation-induced self-ignition mechanism that may a cavitation-induced self- ignition mechanism of cryogenic H2/Ox fluids. Cavitation is the formation

  16. Electrical properties of GaN/poly,,3-hexylthiophene... interfaces B.-N. Park,1,a

    E-Print Network [OSTI]

    Evans, Paul G.

    Electrical properties of GaN/poly,,3-hexylthiophene... interfaces B.-N. Park,1,a J. J. Uhlrich,2 T. The wide-bandgap semiconductor GaN is readily available with well-defined electronic and structural as the inorganic side of the model system. Electron transport through a GaN/poly 3-hexylthiophene P3HT

  17. Vertical design of cubic GaN-based high electron mobility transistors R. Granzner,1,a)

    E-Print Network [OSTI]

    As, Donat Josef

    Vertical design of cubic GaN-based high electron mobility transistors R. Granzner,1,a) E. Tschumak 2011; accepted 24 October 2011; published online 1 December 2011) Cubic (zinc blende) AlGaN=GaN heterostructures for application in GaN-based high electron mobility transistors are investigated theoretically

  18. Anti-phase domains in cubic GaN Ricarda Maria Kemper,1,a)

    E-Print Network [OSTI]

    As, Donat Josef

    ) substrate morphology is studied with emphasis on the anti-phase domains (APDs). The GaN nucleation are the substrate of choice. There are three types of basic defects in epitaxial c-GaN thin films grown on 3CAnti-phase domains in cubic GaN Ricarda Maria Kemper,1,a) Thorsten Schupp,1 Maik Ha¨berlen,1 Thomas

  19. Experimental investigation of nanofluid shear and longitudinal viscosities Aaron J. Schmidt,1,a

    E-Print Network [OSTI]

    Experimental investigation of nanofluid shear and longitudinal viscosities Aaron J. Schmidt,1,a. The measurements indicate that for the decane-based nanofluids the nanoparticles do not form clusters. In the case of PAO nanofluids, the measurements of longitudinal viscosity and the corresponding values

  20. Mathematical Model of an Air-Filled Alpha Stirling Refrigerator Patrick McFarlane,1, a)

    E-Print Network [OSTI]

    Sen, Mihir

    Mathematical Model of an Air-Filled Alpha Stirling Refrigerator Patrick McFarlane,1, a) Fabio for an alpha Stirling refrigerator with air as the working fluid and will be useful in optimizing Stirling refrigeration systems. a) Electronic mail: pmcfarla@nd.edu b) Electronic mail: Fabio.Semperlotti.1

  1. ISI-reduced Modulation Over a Fading Multipath channel1 A. K. Khandani' and P. Kabal'.'

    E-Print Network [OSTI]

    Kabal, Peter

    ISI-reduced Modulation Over a Fading Multipath channel1 A. K. Khandani' and P. Kabal'.' 'Dept the preceding blocks (intra-block ISI) is modeled by an additive Gaussian noise. To reduce the effect of the intra-block ISI, a number of zeros are transmitted between successive blocks. The number of zeros

  2. 1 A MAXIMUM ENTROPY METHOD FOR SUBNETWORK ORIGIN-DESTINATION 2 TRIP MATRIX ESTIMATION

    E-Print Network [OSTI]

    Kockelman, Kara M.

    1 A MAXIMUM ENTROPY METHOD FOR SUBNETWORK ORIGIN-DESTINATION 2 TRIP MATRIX ESTIMATION 3 4 Chi Xie 5, maximum entropy, linearization 36 algorithm, column generation 37 #12;C. Xie, K.M. Kockelman and S is the trip matrix of the simplified network. This paper discusses a5 maximum entropy method

  3. Cellular/Molecular Nociceptor and Hair Cell Transducer Properties of TRPA1, a

    E-Print Network [OSTI]

    Alford, Simon

    Cellular/Molecular Nociceptor and Hair Cell Transducer Properties of TRPA1, a Channel for Pain)channelisactivatedbypain-producingchemicals,anditsinhibitionimpairshaircellmechanotrans- duction. As shown here and previously, TRPA1 is expressed by hair cells as well as by most nociceptors to mediate transduction in both hair cells and nociceptors. Accordingly, we find that heterologouslyexpressed

  4. IEEE TRANSACTIONS ON COMMUNICATIONS, ACCEPTED FOR PUBLICATION 1 A Blind Likelihood-Based Approach for OFDM

    E-Print Network [OSTI]

    Al-Dhahir, Naofal

    - tion to the spectrum under-utilization problem inherent in static spectrum allocations [1]. A CR and Q branches of the mixer should have equal amplitude and 90o phase shift. However, in practice, AFE components (such as mixers, phase shifters, analog filters, and amplifiers) suffer from imperfections due

  5. Criticality assessment of basket designs for use in the MH-1A shipping cask

    SciTech Connect (OSTI)

    Thomas, J.T.

    1982-04-01T23:59:59.000Z

    An analytical study is made of a proposed stainless steel basket to be used in the MH-1A cask for the shipment of National Bureau of Standards reactor fuel elements. The use of B/sub 4/C in the basket as a primary control for the prevention of criticality is shown to be effective but not necessary. A basket fabricated of 0.635-cm-thick stainless steel provides a sufficient margin of subcriticality.

  6. APOLLO 15 24 j A~1~ A. D. Little LRRR Contractor Parts List !

    E-Print Network [OSTI]

    Rathbun, Julie A.

    l ' 0 ~ R!V. N APOLLO 15 24 j A~1~ A. D. Little LRRR Contractor Parts List ! IPAGE 1 OF L ~TE~3 are as follows: (1) EASEP, Apollo 11, EATM-51, 29 January 1969. (2) ALSEP, Apollo 14, A TM 869A, 20 August 1970. (3) ALSEP, Apollo 15, A TM 924, 24 November 1970. Prepared by: F .... well ALSEP Reliability #12

  7. EGR Control for Emisson Reduction Using Fast Response Sensors - Phase 1A

    SciTech Connect (OSTI)

    Gravel, Roland; Conley, Jason; Kittelson, David

    2008-09-30T23:59:59.000Z

    The overall objective of this project was to develop exhaust gas recirculation (EGR) control strategies using fast-response Particulate Matter (PM) sensors and NOx sensors to improve the quality of particulate and gaseous emissions from diesel engines. This project initially comprised three phases: (1) Phase IA - sensor requirements to meet PM sensor specifications, NOx sensor assessment, and initial model development for EGR control; (2) Phase IB - continue development on PM and NOx sensors, integrate the sensor signals into the control simulations, and finalize model development for control strategies; and (3) Phase II - validation testing of the control strategies. Only Phase 1A was funded by DOE and executed by Honeywell. The major objectives of Phase 1A of the project included: (1) Sensor validation and operation of fast-response PM and NOx sensors; (2) Control system modeling of low-pressure EGR controls, development of control strategies, and initial evaluation of these models and strategies for EGR control in diesel engines; (3) Sensor testing to understand applicability of fast-response PM sensors in determining loading rates of the particle trap; and (4) Model validation and sensor testing under steady-state and transient operational conditions of actual engines. In particular, specific objectives included demonstration of: (1) A PM sensor response time constant (T10 - T90) of better than 100 milliseconds (msec); (2) The ability to detect PM at concentrations from 0.2 to 2 Bosch smoke number (BSN) or equivalent; (3) PM sensor accuracy to within 20% BSN over the entire range of operation; and (4) PM sensor repeatability to within 10% over the PM entire sensor range equivalent to a BSN of 0.2 to 2.

  8. Synthesis of heterocycles: Indolo (2,1-a) isoquinolines, renewables, and aptamer ligands for cellular imaging

    SciTech Connect (OSTI)

    Beasley, Jonathan [Ames Laboratory

    2013-05-07T23:59:59.000Z

    In this thesis, we explore both total syntheses and methodologies of several aromatic heterocyclic molecules. Extensions of the Kraus indole synthesis toward 2-substituted and 2,3-disubstituted indoles, as well as biologically attractive indolo[2,1-a]isoquinolines are described. Recent renewable efforts directed to commodity maleic acid and the first reported furan-based ionic liquids are described. Our total synthesis of mRNA aptamer ligand PDC-Gly, and its dye coupled forms, plus aminoglycoside dye coupled ligands used in molecular imaging, are described.

  9. Evidence of former higher temperatures from alteration minerals, Bostic 1-A well, Mountain Home, Idaho

    SciTech Connect (OSTI)

    Arney, B.

    1982-01-01T23:59:59.000Z

    Cuttings from the silicic volcanics in the Bostic 1-A well near Mountain Home, Idaho have been examined petrographically with the assistance of x-ray diffraction and electron microprobe analyses. Results indicate that these rocks have been subjected to much higher temperatures than were observed in the well in 1974, when a static temperature log was run. It is not known to what extent the alternation may be due to greater depth of burial in the past, or whether it resulted from an early hydrothermal system of higher temperature than the one now observed.

  10. Table HC1-1a. Housing Unit Characteristics by Climate Zone,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17questionnairesU.S. Weekly Download:Stocks by TypeWeekly1a.2a.a.

  11. A GUIDE TO HELP CHILDREN COPE WITH THE PSYCHOLOGICAL EFFECTS OF A HURRICANE

    E-Print Network [OSTI]

    Shyu, Mei-Ling

    1 A GUIDE TO HELP CHILDREN COPE WITH THE PSYCHOLOGICAL EFFECTS OF A HURRICANE Annette M. La Greca by the deadly hurricane season of 2004 by Annette La Greca (www.psy.miami/faculty/alagreca) and Scott Sevin and staff at the National Hurricane Center for your hard work and selfless devotion to saving lives

  12. CCM0128 -Computac~ao II -2012 Exercicio Programa 1a -Subsequ^encia de Soma Maxima

    E-Print Network [OSTI]

    Mascarenhas, Walter Figueiredo

    CCM0128 - Computa¸c~ao II - 2012 Exerc´icio Programa 1a - Subsequ^encia de Soma M´axima E-mail do

  13. IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

    SciTech Connect (OSTI)

    Kwasnicka-Crawford, Dorota A. [Department of Genetics and Genomic Biology, Hospital for Sick Children, Toronto, Ont. (Canada) and Department of Kinesiology and Health Science, Faculty of Health, York University, 346 Norman Bethune College, 4700 Keele Street, Ont., Canada M3J-1P3 (Canada)]. E-mail: dakc@yorku.ca; Carson, Andrew R. [Department of Genetics and Genomic Biology, Hospital for Sick Children, Toronto, Ont. (Canada); Scherer, Stephen W. [Department of Genetics and Genomic Biology, Hospital for Sick Children, Toronto, Ont. (Canada); Department of Molecular and Medical Genetics, University of Toronto, Ont. (Canada)

    2006-12-01T23:59:59.000Z

    The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions.

  14. Requirements formulation Subtask 1. A of the major item system mapping (MISM) project

    SciTech Connect (OSTI)

    Bengtson, P.Y.; Clark, P.A.; Hadder, G.R.; Stevens, M.M.; Thomas, B. Jr.; Vineyard, T.A.

    1984-01-01T23:59:59.000Z

    The following tasks are necessary for the completion of Subtask 1A of the MISM project: (1) development of specific descriptions of functional capabilities; (2) review of user requirements and objectives; (3) cataloging of requirements for standard and special reports and what if reports; (4) definition and classification of information systems for MICOM, TSARCOM, TACOM, CECOM, AMCCOM, Medical, Security, development commands, and project monitors; (5) definition of the scope and the level of detail for the MISM proces to include BOIP production requirements; (6) identification of source files and system and organization interfaces for establishment of the MISM data base (DB); (7) definition of the data interchange requirements; (8) definition of the communications requirements; (9) definition of standard retrieval requirements; (10) definition of applications for standard and special reports and for potential what if questions; and (11) definition of standard graphics capabilities.

  15. Genetic polymorphisms of NQO1, CYP1A1 and TPMT and susceptibility to acute lymphoblastic leukemia

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Genetic polymorphisms of NQO1, CYP1A1 and TPMT and susceptibility to acute lymphoblastic leukemia Acute lymphoblastic leukemia (ALL) is the major pediatric cancer in developed countries. The etiology related to environmental exposures. Keywords Leukemia Á Tunisia Á TPMT Á NQO1 Á CYP1A1 Introduction Acute

  16. A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

    SciTech Connect (OSTI)

    Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko; Ishikawa, Osamu [Department of Dermatology, Gunma University Graduate School of Medicine, 3-39-22, Showa, Maebashi, Gunma 371-8511 (Japan)] [Department of Dermatology, Gunma University Graduate School of Medicine, 3-39-22, Showa, Maebashi, Gunma 371-8511 (Japan); Motegi, Sei-ichiro, E-mail: smotegi@gunma-u.ac.jp [Department of Dermatology, Gunma University Graduate School of Medicine, 3-39-22, Showa, Maebashi, Gunma 371-8511 (Japan)] [Department of Dermatology, Gunma University Graduate School of Medicine, 3-39-22, Showa, Maebashi, Gunma 371-8511 (Japan)

    2012-08-24T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primers from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.

  17. TANK 18 AND 19-F TIER 1A EQUIPMENT FILL MOCK UP TEST SUMMARY

    SciTech Connect (OSTI)

    Stefanko, D.; Langton, C.

    2011-11-04T23:59:59.000Z

    The United States Department of Energy (US DOE) has determined that Tanks 18-F and 19-F have met the F-Tank Farm (FTF) General Closure Plan Requirements and are ready to be permanently closed. The high-level waste (HLW) tanks have been isolated from FTF facilities. To complete operational closure they will be filled with grout for the purpose of: (1) physically stabilizing the tanks, (2) limiting/eliminating vertical pathways to residual waste, (3) discouraging future intrusion, and (4) providing an alkaline, chemical reducing environment within the closure boundary to control speciation and solubility of select radionuclides. Bulk waste removal and heel removal equipment remain in Tanks 18-F and 19-F. This equipment includes the Advance Design Mixer Pump (ADMP), transfer pumps, transfer jets, standard slurry mixer pumps, equipment-support masts, sampling masts, dip tube assemblies and robotic crawlers. The present Tank 18 and 19-F closure strategy is to grout the equipment in place and eliminate vertical pathways by filling voids in the equipment to vertical fast pathways and water infiltration. The mock-up tests described in this report were intended to address placement issues identified for grouting the equipment that will be left in Tank 18-F and Tank 19-F. The Tank 18-F and 19-F closure strategy document states that one of the Performance Assessment (PA) requirements for a closed tank is that equipment remaining in the tank be filled to the extent practical and that vertical flow paths 1 inch and larger be grouted. The specific objectives of the Tier 1A equipment grout mock-up testing include: (1) Identifying the most limiting equipment configurations with respect to internal void space filling; (2) Specifying and constructing initial test geometries and forms that represent scaled boundary conditions; (3) Identifying a target grout rheology for evaluation in the scaled mock-up configurations; (4) Scaling-up production of a grout mix with the target rheology (16 second flow cone value) from 0.25 cubic feet to 4.3 cubic feet. (Ten 0.43 cubic batches were produced because full-scale equipment was not available for the Tier 1A test.); (5) Demonstrating continuous gravity filling of the ADMP mock up test form; (6) Demonstrating continuous gravity filling of 1 inch and 2 inch schedule 40 pipe; and (7) Demonstrating filling of 1 inch and 2 inch schedule 40 pipe from the bottom up by discharging through a tube inserted into the pipes. The Tier 1A mock-up test focused on the ADMP and pipes at least one inch in diameter. The ADMP which is located in center riser of Tank 18-F is a concern because the column for this long-shaft (55 ft) pump is unique and modification to the pump prior to placing it in service limited the flow path options for filling by creating a single flow path for filling and venting the ADMP support column. The large size, vertical orientation, and complicated flow path in the ADMP warrants a detailed description of this piece of ancillary equipment.

  18. R CrA SMM 1A: FRAGMENTATION IN A PRESTELLAR CORE

    SciTech Connect (OSTI)

    Chen Xuepeng; Arce, Hector G. [Department of Astronomy, Yale University, Box 208101, New Haven, CT 06520-8101 (United States)

    2010-09-10T23:59:59.000Z

    We report the discovery of multiple condensations in the prestellar core candidate SMM 1A in the R Corona Australis cloud, which may represent the earliest phase of core fragmentation observed thus far. The separation between the condensations is between 1000 and 2100 AU, and their masses range from about 0.1 to 0.2 M {sub sun}. We find that the three condensations have extremely low bolometric luminosities (<0.1 L {sub sun}) and temperatures (<20 K), indicating that these are young sources that have yet to form protostars. We suggest that these sources were formed through the fragmentation of an elongated prestellar core. Our results, in concert with other observed protostellar binary systems with separations in the scale of 1000 AU, support the scenario that prompt fragmentation in the isothermal collapse phase is an efficient mechanism for wide binary star formation, while the fragmentation in the subsequent adiabatic phase may be an additional mechanism for close ({<=}100 AU) binary star formation.

  19. alters foot mobility: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ja (more) Nousiainen, Sari 2013-01-01 57 Theoretical Mobility Analysis of Ion Mobility Spectrometry Physics Websites Summary: Results Theoretical Mobility Analysis of Ion...

  20. Successful treatment of hand and foot psoriasis with infliximab

    E-Print Network [OSTI]

    Lernia, Vito Di; Guareschi, Elisa

    2010-01-01T23:59:59.000Z

    pustular psoriasis (PPP) may be a distinct entity inmay be successful in PPP [ 9 , 10 , 11 ]. Infliximab hasin localized recalcitrant PPP [ 14 ]. Here we present four

  1. american orthopaedic foot: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Berdichevsky, Victor 12 Orthopaedic Health, Conformation and Longevity in Riding Horses Multidisciplinary Databases and Resources Websites Summary: Orthopaedic Health,...

  2. ames 11-foot transonic: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Congress and Exposition (IMECE), IMECE Combustion System for a Silicon Micro Gas Turbine Engine," Journal of Microelectromechanical Systems, Volume 432 Leopold Center...

  3. Passive dynamic walking with knees : a point foot model

    E-Print Network [OSTI]

    Hsu Chen, Vanessa F. (Vanessa Fang)

    2007-01-01T23:59:59.000Z

    In this thesis, a hybrid model for a passive 2D walker with knees and point feet is presented. The step cycle of the model has two phases of continuous dynamics: one with an unlocked knee configuration and a second one ...

  4. Foote Creek Rim I Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources JumpI

  5. Foote Creek Rim II Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources JumpIII

  6. Foote Creek Rim III Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources

  7. Foote Creek Rim IV Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy ResourcesIV Wind

  8. DOE - Office of Legacy Management -- Foote Mineral Co - PA 27

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTable ofArizonaBuffalo -Elk River ReactorProject

  9. Foote Creek Rim Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump to:ar-80m.pdfFillmoreGabbs Valley Area(Sasada, 1988)PevafersaType

  10. Data:A43fadcb-6be4-4217-abf1-a187a8780fca | Open Energy Information

    Open Energy Info (EERE)

    fadcb-6be4-4217-abf1-a187a8780fca No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1....

  11. Bibliography [1] A Abramovici, T T Lyons, and F J Raab. Measured limits to contamination of optical surfaces

    E-Print Network [OSTI]

    Winfree, Erik

    244 Bibliography [1] A Abramovici, T T Lyons, and F J Raab. Measured limits to contamination dipole polarizability of cesium. Physical Review Letters, 91(15):153001, October 2003. [7] M Antezza, L P

  12. Hand, Foot, and Mouth Disease Hand, Foot, and Mouth Disease (HFMD) is an illness caused by a virus. It is

    E-Print Network [OSTI]

    through bodily fluids, which include: nose secretions (coughs, sneezes, runny nose, contaminated surfaces), saliva (coughs, sneezes, drool, mouthing toys, contaminated surfaces), blister fluids (blisters drain

  13. PET Imaging of Brain 5-HT1A Receptors in Rat In Vivo with 18F-FCWAY and Improvement by

    E-Print Network [OSTI]

    Shen, Jun

    PET Imaging of Brain 5-HT1A Receptors in Rat In Vivo with 18F-FCWAY and Improvement by Successful)cyclohexanecarboxamide) is useful in clinical research with PET for measuring serotonin 1A (5-HT1A) re- ceptor densities in brain applicability to measuring brain regional 5-HT1A receptor densities. Methods: PET of rat head after

  14. Numerical Simulation of PulseTube Refrigerators: 1D model I.A. Lyulina 1 , R.M.M. Mattheij 1 , A.S. Tijsseling 1 , A.T.A.M. de Waele 2

    E-Print Network [OSTI]

    Eindhoven, Technische Universiteit

    Numerical Simulation of Pulse­Tube Refrigerators: 1D model I.A. Lyulina 1 , R.M.M. Mattheij 1 , A of a pulse­tube refrigerator. Conservation equations describing compressible gas flow in the tube are solved, calculate the average enthalpy flow and estimate the refrigeration power. Keywords: pulse­tube refrigerator

  15. UniverSity of MiaMi roSenStiel School of Marine and atMoSpheric Science

    E-Print Network [OSTI]

    Miami, University of

    . While it may ultimately make its way into swim gear, he sees it more as a way to deter sharks from unsafe environments. If the product is effective as a fishing net coating, it may significantly reduce

  16. MAC581 Inductively Coupled Plasma Mass Spectrometry (http://www.rsmas.miami.edu/grad-studies/fall2010.html)

    E-Print Network [OSTI]

    Miami, University of

    nebulization, dissolvation, laser ablation, B. Tuning dry and wet plasma, sensitivity, stability, oxide, normal ICP torch and shield torch, cool plasma, RF generators, load coil and chiller, membrane cones, interface housing and cooling, slide valves, expansion chamber vacuum and pumps, ion kinetic

  17. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    Jones, H. Eden W. Crampton-Platt, Alexandra Crawford, Andrew2,3,4 , Alexandra Crampton-Platt 2,3 , Johannes Bergsten

  18. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    network study from the Canary Islands (K. Trøjelsgaard,food web study from the Canary Islands (J. Hemdorff, unpubl.Cape Verde, and Canary Islands and some others regions that

  19. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    sembles to estimate species’ extinction risks due to climatemodel ensembles to estimate species’ extinction risks due toand to predict species extinctions as a consequence of

  20. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    Aurelia labiata within Puget Sound, Washington: a repeatedsabboud@ucmerced.edu In Puget Sound, Washington, the waterand Aurelia labiata). Puget Sound therefore provides a

  1. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    to assess the value of citizen science programs in providingfrom a large-scale citizen-science monitoring program.climate, butterfly, citizen science 107B Comparing past and

  2. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    Krzysztof Tuanmu, Mao-Ning Speer, Kelly A. Tubaro, PabloOrder: Chiroptera) Kelly A. Speer, J. Angel Soto-Centeno and

  3. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    Greater Antilles, Cuba-Hispaniola- Puerto Rico. Keywords:of Puerto Rico, Mona, and Hispaniola. Phylogenetic and

  4. 18th AIAA Computational Fluid Dynamics Conference, June 2528, 2007, Miami, FL Petaflops Opportunities for the NASA Fundamental

    E-Print Network [OSTI]

    Peraire, Jaime

    in high performance computing at the national level. Advocacy for high performance computing has role as a leading advocate for high performance computational engi- neering at the national level. We in formulating the case for increased investment in high performance computing activities, and that a similar

  5. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    Auchenorrhyncha (Insecta: Hemiptera) Therese A. Catanach 1,2in the genus Hyalopterus (Hemiptera) on plants in the genus

  6. How can social compact's neighborhood drilldown data spur more retail development in Miami's difficult to develop neighborhoods?

    E-Print Network [OSTI]

    Power, Dickson Benjamin

    2009-01-01T23:59:59.000Z

    The inner-city neighborhoods of America continue to struggle with the economic blight they have faced ever since American urban growth began to abandon the urban city core fifty years ago. One of the most salient characteristics ...

  7. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    experiments” to expand the scope of studies beyond terrestrial animals and plants to microbes, marine organ- isms, and human

  8. UniversiTy of MiaMi rosensTiel school of Marine and aTMospheric science

    E-Print Network [OSTI]

    Miami, University of

    perspective on natural disasters: sometimes science isn't enough. At the cutting-edge of a new trend researchers are, in fact, developing wave models that factor in a variety of environmental indicators

  9. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    land cover, climate change, oceans, agriculture, forests andhighly threatened by climate change, mining, agriculture andagriculture, biogeography, distributions, climate change 97B

  10. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    climate change, climate velocity, Holocene, paleoecology, Pleistocene, pollen, Quaternary, species distributions 132B The palaeobiogeographical history of the Western Mediterranean

  11. This article was downloaded by: [University of Miami], [Tamay Ozgokmen] On: 21 May 2012, At: 12:02

    E-Print Network [OSTI]

    Ozgökmen, Tamay M.

    Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK International Journal using passive scalars and particles, given a subset of realistic constraints on these resources in field experiments. The results emphasise the effectiveness of Lagrangian platforms, in particular passive particles

  12. Conference program and abstracts. International Biogeography Society 6th Biennial Meeting – 9-13 January 2013, Miami, Florida, USA

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    Andes, northern Venezuela, Bolivia, and Argentina. Time-from c. 80 lakes from Bolivia to Columbia (20°S - 5°N)

  13. Export Control Certification Form H-1B, H-1B1, L-1, or O-1A Visas

    E-Print Network [OSTI]

    Howitt, Ivan

    Export Control Certification Form H-1B, H-1B1, L-1, or O-1A Visas Page 1 of 2 Export Control and certification relative to export controlled technology or technical data released to a prospective employee of Commerce or the U.S. Department of State, completing the form means that basic export control issues must

  14. GENERIC FEEDBACK: 2014 MATH 34032 EXAM (1) (a) Not very many people managed to find the correct adjoint boundary condition

    E-Print Network [OSTI]

    Sidorov, Nikita

    GENERIC FEEDBACK: 2014 MATH 34032 EXAM (1) (a) Not very many people managed to find the correct. (2) (a) Many people tried to introduce both c1 and c2. Since the degenerate kernel in this case has know what the adjoint problem is. Not very many people seemed to realise this. (c) Very few people

  15. e-mail: huscap@lib.hokudai.ac.jp : 4025 1. A Composite Construction Material that Solidifies in

    E-Print Network [OSTI]

    Ishii, Hitoshi

    in asphalt mixtures during the wheel tracking test at high temperatures, Construction and Building Materials pavements due to exposure to organic compounds in a cold region, Construction and Building Materials, vol-mail: huscap@lib.hokudai.ac.jp : 4025 #12;HUSCAP 1. A Composite Construction Material that Solidifies in Water

  16. PATENT/DISCLOSURE LIST (1) A. Bindal, "Sidewall Lithography for Growing Horizontal Carbon Nano Tubes and a

    E-Print Network [OSTI]

    Eirinaki, Magdalini

    Tubes and a Process Flow for Complementary Carbon Nano Tube Field Effect Transistor (CCFET) FabricationPATENT/DISCLOSURE LIST (1) A. Bindal, "Sidewall Lithography for Growing Horizontal Carbon Nano for Manufacturing Nano-Interconnects and Catalyst Islands for Growing Carbon Nano Tubes", provisional patent

  17. Design and Test of a Vertical-Axis Wind Turbine with Pitch Control J. J. Miau1,a

    E-Print Network [OSTI]

    Leu, Tzong-Shyng "Jeremy"

    Design and Test of a Vertical-Axis Wind Turbine with Pitch Control J. J. Miau1,a , S. Y. Liang2 , R, USA a jjmiau@mail.ncku.edu.tw Keywords: vertical-axis wind turbine, pitch control, wind of a small vertical-axis wind turbine. Benefits gained can be shown by the experimental and numerical results

  18. 1 a publication of the National High Magnetic Field Laboratory1111111 a pa pa pa pa pa pa pppublublubublublublblublblblblbllblbblblbblbbbbbbbbbbbbbblbbbbblubbbbbbbbbbbbblllbbbbbblblbbbbbbbbbbbbbllbbbb icaicaicacicicaicciicicicciiciciciccciciccccciiiiciiii

    E-Print Network [OSTI]

    Weston, Ken

    related research in all areas of science and engineering.The Magnet Lab is supported by the National1 a publication of the National High Magnetic Field Laboratory1111111 a pa pa pa pa pa pa magnet lab packs a big punch. InThisIssue VOLUME 3: ISSUE 2 F E A T U R E S Flux is a twice

  19. A genetic algorithm for use in creative design processes 1 A Genetic Algorithm for use in Creative Design Processes

    E-Print Network [OSTI]

    Boyer, Edmond

    is evaluated by means of environmental parameters, passive solar qualities and the designer's individual is John Frazer, who has been involved in the use of genetic techniques for building envelope designs sinceA genetic algorithm for use in creative design processes 1 A Genetic Algorithm for use in Creative

  20. Universality of non-Ohmic shunt leakage in thin-film solar cells S. Dongaonkar,1,a

    E-Print Network [OSTI]

    Alam, Muhammad A.

    Universality of non-Ohmic shunt leakage in thin-film solar cells S. Dongaonkar,1,a J. D. Servaites thin-film solar cell types: hydrogenated amorphous silicon a-Si:H p-i-n cells, organic bulk heterojunction BHJ cells, and Cu In,Ga Se2 CIGS cells. All three device types exhibit a significant shunt leakage

  1. Induction heating of FeCo nanoparticles for rapid rf curing of epoxy K. J. Miller,1,a

    E-Print Network [OSTI]

    McHenry, Michael E.

    , and cracking of the polymer. An alternative curing process involves remote, noncontact rf heating of MNP loadedInduction heating of FeCo nanoparticles for rapid rf curing of epoxy composites K. J. Miller,1,a K epoxy composites through radio-frequency rf heating. The rf response of functionalized FeCo MNPs

  2. Project Webpage: http://www.engr.colostate.edu/~jwv/hurricane-Katrina-woodframe/ (Beginning Nov. 1) A Preliminary Report

    E-Print Network [OSTI]

    Gupta, Rakesh

    Project Webpage: http://www.engr.colostate.edu/~jwv/hurricane-Katrina-woodframe/ (Beginning Nov. 1) A Preliminary Report Damage Assessment of Woodframe Residential Structures in the Wake of Hurricane Katrina John W. van de Lindt, Colorado State University Andrew J. Graettinger, University of Alabama Rakesh Gupta

  3. Appendix S1 -A greener Greenland? Normand et al. Appendix S1: Study species and species occurrence data

    E-Print Network [OSTI]

    Zimmermann, Niklaus E.

    Appendix S1 - A greener Greenland? Normand et al. 1 Appendix S1: Study species and species as in one or several of the floristic provinces bordering Greenland (Fig. S1.1). The selection were based subspecies) was considered. The selected species were assigned maximum heights and Greenlandic species

  4. Scheduling Saves in FaultTolerant Computations E. G. Coffman, Jr. 1 , Leopold Flatto 1 , A. Y. Kreinin 2

    E-Print Network [OSTI]

    Coffman Jr., E. G.

    Scheduling Saves in Fault­Tolerant Computations E. G. Coffman, Jr. 1 , Leopold Flatto 1 , A. Y here, a program protects itself against undue losses resulting from machine failures by saving its state at certain intervals on a reliable storage device. Failures may occur during saves, but a state

  5. Heat Transfer -1 A satellite in space orbits the sun. The satellite can be approximated as a flat plate with

    E-Print Network [OSTI]

    Virginia Tech

    Heat Transfer - 1 A satellite in space orbits the sun. The satellite can be approximated as a flat plate with dimensions and properties given below. (a) Calculate the solar heat flux (W/m2 is at a distance where the solar heat flux (as defined above) is 500 W/m2 , and the flat plate is oriented

  6. All-electric detection of the polarization state of terahertz laser radiation S. D. Ganichev,1,a

    E-Print Network [OSTI]

    Ganichev, Sergey

    All-electric detection of the polarization state of terahertz laser radiation S. D. Ganichev,1,a W online 6 June 2008 Two types of room-temperature detectors of terahertz laser radiation have been developed which allow, in an all-electric manner, the determination of the plane of polarization of linearly

  7. Electronic structure of benzene adsorbed on single-domain Si,,001...-,,2 1...: A combined experimental and theoretical study

    E-Print Network [OSTI]

    Birkenheuer, Uwe

    Electronic structure of benzene adsorbed on single-domain Si,,001...-,,2 1...: A combined Received 20 October 1997; accepted 31 December 1997 Benzene adsorption on a single-domain Si 001 -(2 1 for the saturated benzene layer exhibit well-defined polarization and azimuthal dependencies compatible with a flat

  8. Spot size dependence of laser accelerated protons in thin multi-ion foils Tung-Chang Liu,1,a)

    E-Print Network [OSTI]

    polarized laser beam irradiates an ultra-thin foil and accelerates nearly the whole foil by the radiationSpot size dependence of laser accelerated protons in thin multi-ion foils Tung-Chang Liu,1,a) Xi of the effect of the laser spot size of a circularly polarized laser beam on the energy of quasi

  9. ALUMINUM--2002 5.1 A reference that includes a section mark () is found in the Internet

    E-Print Network [OSTI]

    ALUMINUM--2002 5.1 1 A reference that includes a section mark (§) is found in the Internet Reference Cited section. ALUMINUM By Patricia A. Plunkert Domestic survey data and tables were prepared, international data coordinator. In 2002, 7 domestic companies operated 16 primary aluminum reduction plants

  10. NSTX S.A.Sabbagh IEA Workshop 59 02/15/05 S. A. Sabbagh1, A.C. Sontag1, R. E. Bell2, J. Bialek1, A. Garofalo1, D.A. Gates2,

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    NSTX S.A.Sabbagh ­ IEA Workshop 59 ­ 02/15/05 S. A. Sabbagh1, A.C. Sontag1, R. E. Bell2, J. Bialek1 IPP, Garching U Quebec IEA Workshop 59: Shape and Aspect Ratio Optimization for High Beta, Steady of Sciences, Hefei, China #12;NSTX S.A.Sabbagh ­ IEA Workshop 59 ­ 02/15/05 Physics study of global MHD mode

  11. Ocean color and atmospheric dimethyl sulfide: On their mesoscale variability

    E-Print Network [OSTI]

    Matrai, Patricia A; Balch, William M; Cooper, David J; Saltzman, Eric S

    1993-01-01T23:59:59.000Z

    periods of' time, covering mesoscale Campbell, J. W. and W.Dimethyl Sulfide' On Their Mesoscale Variability PATRICIA A.Miami, Miami, Florida The mesoscale variability of dimethyl

  12. Persistence and global attractivity in the model $A_{n+1}=A_nF(A_{n-m})$

    E-Print Network [OSTI]

    Dang Vu Giang

    2010-03-26T23:59:59.000Z

    First, we systemize ealier results the uniform persistence for discrete model $A_{n+1}=A_nF(A_{n-m})$ of population growth, where $F:(0,\\infty)\\to(0,\\infty)$ is continuous and strictly decreasing. Second, we investigation the effect of delay $m$ when $F$ is not monotone. We are mainly using $\\omega$-limit set of persistent solution, which is discussed in more general by P. Walters, 1982.

  13. Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a

    E-Print Network [OSTI]

    Ariza Moreno, Pilar

    Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a , H descubrimientos s/n 41092 Seville (Spain) a jsanz@us.es, b helgaem@gmail.com, c mpariza@us.es Keywords: Bone-cement of the last XX century. Normally, implant is fixed to bone by means of a polymer material known as bone cement

  14. Wide-band-gap InAlAs solar cell for an alternative multijunction approach Marina S. Leite,1,a

    E-Print Network [OSTI]

    Atwater, Harry

    Wide-band-gap InAlAs solar cell for an alternative multijunction approach Marina S. Leite,1,a Robyn; published online 28 February 2011 We have fabricated an In0.52Al0.48As solar cell lattice-matched to In-free InxAl1-xAs alloyed layers were used to fabricate the single junction solar cell. Photoluminescence

  15. The Mechanics of Materials in Contact Problems Georges Cailletaud1,a , Stphanie Basseville2,b , Julian Durand1,c ,

    E-Print Network [OSTI]

    Boyer, Edmond

    Georges.Cailletaud@mines-paristech.fr, bStephanie.Basseville@usvq.fr, cJulian.Durand@mines-paristech.fr, dfeyel@onera.fr, eThe Mechanics of Materials in Contact Problems Georges Cailletaud1,a , Stéphanie Basseville2,b , Julian Durand1,c , Frédéric Feyel3,d , Henry Proudhon1,e , Lingtao Sun1,f, Vladislav Yastrebov1,g 1MINES

  16. Low gap amorphous GaN1-xAsx alloys grown on glass substrate K. M. Yu,1,a

    E-Print Network [OSTI]

    Wu, Junqiao

    Low gap amorphous GaN1-xAsx alloys grown on glass substrate K. M. Yu,1,a S. V. Novikov,2 R September 2010 Amorphous GaN1-xAsx layers with As content in the range of x=0.1 to 0.6 were grown defined optical absorption edges. The measured band gap values for the crystalline and amorphous GaN1-x

  17. Hydrostatic pressure and strain effects in short period InN/GaN superlattices I. Gorczyca,1,a)

    E-Print Network [OSTI]

    Svane, Axel Torstein

    N MLs and up to 13 GaN layers assumed matched to a GaN substrate are investigated, but we also includeHydrostatic pressure and strain effects in short period InN/GaN superlattices I. Gorczyca,1,a) T structures of short-period pseudomorphically grown superlattices (SLs) of the form mInN/nGaN are calculated

  18. Copyright 2006, USC/ISI. All rights reserved.2/7/2011 11:52 AM 1 A Recursive

    E-Print Network [OSTI]

    Touch, Joe

    Copyright 2006, USC/ISI. All rights reserved.2/7/2011 11:52 AM 1 A Recursive Network Architecture Joe Touch, Yu-Shun Wang, Venkata Pingali USC/ISI #12;Copyright 2006, USC/ISI. All rights reserved.2 more than a coding artifact? #12;Copyright 2006, USC/ISI. All rights reserved.2/7/2011 11:52 AM 3

  19. Work plan for phase 1A paleochannel studies at the Cheney disposal cell, Grand Junction, Colorado: Draft

    SciTech Connect (OSTI)

    NONE

    1996-11-01T23:59:59.000Z

    This document will serve as a Work Plan for continuing paleochannel characterization activities at the Cheney disposal site near Grand Junction, Colorado. Elevated levels of nitrate were encountered in ground water from two monitor wells installed in alluvial paleochannels near the Cheney disposal cell in 1994. This triggered a series of investigations (Phase 1) designed to determine the source of nitrate and other chemical constituents in ground water at the site. A comprehensive summary of the Phase 1 field investigations (limited to passive monitoring and modeling studies) conducted by the Remedial Action Contractor (RAC) and Technical Assistance Contractor (TAC) to date is provided in Section 2.0 of this document. Results of Phase 1 were inconclusive regarding the potential interaction between the disposal cell and the paleochannels, so additional Phase 1A investigations are planned. Recommendations for Phase 1A tasks and possible future activities are discussed in Section 3.0. Detailed information on the implementation of the proposed Phase 1A tasks appears in Section 4.0 and will provide the basis for Statements of Work (SOW) for each of these tasks. A detailed sampling plan is provided to ensure quality and a consistency with previous data collection efforts.

  20. file://C:\Documents%20and%20Settings\VM3\My%20Documents\hc6-1a_

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million8a.Table HC6-1a. Usage

  1. The eukaryotic translation elongation factor eEF1A2 induces neoplastic properties and mediates tumorigenic effects of ZNF217 in precursor cells of human ovarian carcinomas

    SciTech Connect (OSTI)

    Sun, Yu; Wong, Nicholas; Guan, Yinghui; Salamanca, Clara M.; Cheng, Jung Chien; Lee, Jonathan M.; Gray, Joe W.; Auersperg, Nelly

    2008-04-25T23:59:59.000Z

    Ovarian epithelial carcinomas (OEC) frequently exhibit amplifications at the 20q13 locus which is the site of several oncogenes, including the eukaryotic elongation factor EEF1A2 and the transcription factor ZNF217. We reported previously that overexpressed ZNF217 induces neoplastic characteristics in precursor cells of OEC. Unexpectedly, ZNF217, which is a transcriptional repressor, enhanced expression of eEF1A2. In this study, array comparative genomic hybridization, single nucleotide polymorphism and Affymetrix analysis of ZNF217-overexpressing cell lines confirmed consistently increased expression of eEF1A2 but not of other oncogenes, and revealed early changes in EEF1A2 gene copy numbers and increased expression at crisis during immortalization. We defined the influence of eEF1A2 overexpression on immortalized ovarian surface epithelial cells, and investigated interrelationships between effects of ZNF217 and eEF1A2 on cellular phenotypes. Lentivirally induced eEF1A2 overexpression caused delayed crisis, apoptosis resistance and increases in serum-independence, saturation densities, and anchorage independence. siRNA to eEF1A2 reversed apoptosis resistance and reduced anchorage independence in eEF1A2-overexpressing lines. Remarkably, siRNA to eEF1A2 was equally efficient in inhibiting both anchorage independence and resistance to apoptosis conferred by ZNF217 overexpression. Our data define neoplastic properties that are caused by eEF1A2 in nontumorigenic ovarian cancer precursor cells, and suggest that eEF1A2 plays a role in mediating ZNF217-induced neoplastic progression.

  2. Structure of the retinoblastoma protein bound to adenovirus E1A reveals the molecular basis for viral oncoprotein inactivation of a tumor suppressor

    SciTech Connect (OSTI)

    Liu, Xin; Marmorstein, Ronen (UPENN)

    2008-04-02T23:59:59.000Z

    The adenovirus (Ad) E1A (Ad-E1A) oncoprotein mediates cell transformation, in part, by displacing E2F transcription factors from the retinoblastoma protein (pRb) tumor suppressor. In this study we determined the crystal structure of the pRb pocket domain in complex with conserved region 1 (CR1) of Ad5-E1A. The structure and accompanying biochemical studies reveal that E1A-CR1 binds at the interface of the A and B cyclin folds of the pRb pocket domain, and that both E1A-CR1 and the E2F transactivation domain use similar conserved nonpolar residues to engage overlapping sites on pRb, implicating a novel molecular mechanism for pRb inactivation by a viral oncoprotein.

  3. A Fresh Look at Weather Impact on Peak Electricity Demand and Energy Use of Buildings Using 30-Year Actual Weather Data

    E-Print Network [OSTI]

    Hong, Tianzhen

    2014-01-01T23:59:59.000Z

    criteria, and representative cities for the 17 climates –non-refrigerated) Representative city Miami, USA Riyadh,

  4. Criticality Analysis for Proposed Maximum Fuel Loading in a Standardized SNF Canister with Type 1a Baskets

    SciTech Connect (OSTI)

    Chad Pope; Larry L. Taylor; Soon Sam Kim

    2007-02-01T23:59:59.000Z

    This document represents a summary version of the criticality analysis done to support loading SNF in a Type 1a basket/standard canister combination. Specifically, this engineering design file (EDF) captures the information pertinent to the intact condition of four fuel types with different fissile loads and their calculated reactivities. These fuels are then degraded into various configurations inside a canister without the presence of significant moderation. The important aspect of this study is the portrayal of the fuel degradation and its effect on the reactivity of a single canister given the supposition there will be continued moderation exclusion from the canister. Subsequent analyses also investigate the most reactive ‘dry’ canister in a nine canister array inside a hypothetical transport cask, both dry and partial to complete flooding inside the transport cask. The analyses also includes a comparison of the most reactive configuration to other benchmarked fuels using a software package called TSUNAMI, which is part of the SCALE 5.0 suite of software.

  5. The number fraction of discs around brown dwarfs in Orion OB1a and the 25 Orionis group

    E-Print Network [OSTI]

    Downes, Juan José; Ballesteros-Paredes, Javier; Mateu, Cecilia; Briceño, César; Hernández, Jesús; Petr-Gotzens, Monika G; Calvet, Nuria; Hartmann, Lee; Mauco, Karina

    2015-01-01T23:59:59.000Z

    We present a study of 15 new brown dwarfs belonging to the $\\sim7$ Myr old 25 Orionis group and Orion OB1a sub-association with spectral types between M6 and M9 and estimated masses between $\\sim0.07$M$_\\odot$ and $\\sim0.01$ M$_\\odot$. By comparing them through a Bayesian method with low mass stars ($0.8\\lesssim$ M/M$_\\odot\\lesssim0.1$) from previous works in the 25 Orionis group, we found statistically significant differences in the number fraction of classical T Tauri stars, weak T Tauri stars, class II, evolved discs and purely photospheric emitters at both sides of the sub-stellar mass limit. Particularly we found a fraction of $3.9^{+2.4}_{-1.6}~\\%$ low mass stars classified as CTTS and class II or evolved discs, against a fraction of $33.3^{+10.8}_{-9.8}~\\%$ in the sub-stellar mass domain. Our results support the suggested scenario in which the dissipation of discs is less efficient for decreasing mass of the central object.

  6. Data:F927d1cd-b127-45b9-9215-9eb1a7ee28a0 | Open Energy Information

    Open Energy Info (EERE)

    5-9eb1a7ee28a0 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information...

  7. Synthetic Studies of Iriomoteolide-1A Total Synthesis of Alotaketal A and an Antifungal O-Hydroxy-P-Quinone Methide Diterpenoid

    E-Print Network [OSTI]

    Huang, Jinhua

    2013-11-07T23:59:59.000Z

    structure. As part of our effort toward this goal, we finished the total synthesis of a diastereomer of iriomoteolide-1a. Our total synthesis featured a lithium acetylide-chloroformate coupling to assemble the alkyne and chloroformate fragments, the ring...

  8. IMPROVING DESIGN FOR RECYCLING -APPLICATION TO COMPOSITES N.Perry1, A.Bernard2 (1), F.Laroche2, S.Pompidou3

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    IMPROVING DESIGN FOR RECYCLING - APPLICATION TO COMPOSITES N.Perry1, A engineers about their potential use. Innovative recycling solutions arise that recover efficiently carbon fibres. This paper explores the design for composites recycling issue

  9. Data:E2902411-45a4-475d-813b-4e4b1a7d74f7 | Open Energy Information

    Open Energy Info (EERE)

    13b-4e4b1a7d74f7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic...

  10. Data:C3f8bd7c-0ecc-4c94-b533-c435f8f1a86b | Open Energy Information

    Open Energy Info (EERE)

    c435f8f1a86b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2....

  11. Data:1a3263cc-9b87-4114-9f8a-57270e64790f | Open Energy Information

    Open Energy Info (EERE)

    date if known: Rate name: MU-1 - a1b - 400 watt HPS - Painted Bronze Column Sector: Lighting Description: Lamps in enclosed fixtures, mounted on metal or fiberglass columns and...

  12. Data:01e247e8-be67-4602-8694-51e1a78c6bbb | Open Energy Information

    Open Energy Info (EERE)

    15 End date if known: Rate name: MU-1 - a1c - 3-150 watt HPS - Single Column Sector: Lighting Description: Lamps in enclosed post top type fixtures, mounted on metal or fiberglass...

  13. Data:A340ac6e-351a-41dc-ba1a-991cf2075f71 | Open Energy Information

    Open Energy Info (EERE)

    0315 End date if known: Rate name: MU-1 - a1b - 175 watt MV - Fiberglass Sector: Lighting Description: Lamps in enclosed fixtures, mounted on metal or fiberglass columns and...

  14. HTR-PROTEUS Pebble Bed Experimental Program Cores 1, 1A, 2, and 3: Hexagonal Close Packing with a 1:2 Moderator-to-Fuel Pebble Ratio

    SciTech Connect (OSTI)

    John D. Bess; Barbara H. Dolphin; James W. Sterbentz; Luka Snoj; Igor Lengar; Oliver Köberl

    2012-03-01T23:59:59.000Z

    In its deployment as a pebble bed reactor (PBR) critical facility from 1992 to 1996, the PROTEUS facility was designated as HTR-PROTEUS. This experimental program was performed as part of an International Atomic Energy Agency (IAEA) Coordinated Research Project (CRP) on the Validation of Safety Related Physics Calculations for Low Enriched HTGRs. Within this project, critical experiments were conducted for graphite moderated LEU systems to determine core reactivity, flux and power profiles, reaction-rate ratios, the worth of control rods, both in-core and reflector based, the worth of burnable poisons, kinetic parameters, and the effects of moisture ingress on these parameters. Four benchmark experiments were evaluated in this report: Cores 1, 1A, 2, and 3. These core configurations represent the hexagonal close packing (HCP) configurations of the HTR-PROTEUS experiment with a moderator-to-fuel pebble ratio of 1:2. Core 1 represents the only configuration utilizing ZEBRA control rods. Cores 1A, 2, and 3 use withdrawable, hollow, stainless steel control rods. Cores 1 and 1A are similar except for the use of different control rods; Core 1A also has one less layer of pebbles (21 layers instead of 22). Core 2 retains the first 16 layers of pebbles from Cores 1 and 1A and has 16 layers of moderator pebbles stacked above the fueled layers. Core 3 retains the first 17 layers of pebbles but has polyethylene rods inserted between pebbles to simulate water ingress. The additional partial pebble layer (layer 18) for Core 3 was not included as it was used for core operations and not the reported critical configuration. Cores 1, 1A, 2, and 3 were determined to be acceptable benchmark experiments.

  15. HTR-PROTEUS Pebble Bed Experimental Program Cores 1, 1A, 2, and 3: Hexagonal Close Packing with a 1:2 Moderator-to-Fuel Pebble Ratio

    SciTech Connect (OSTI)

    John D. Bess; Barbara H. Dolphin; James W. Sterbentz; Luka Snoj; Igor Lengar; Oliver Köberl

    2013-03-01T23:59:59.000Z

    In its deployment as a pebble bed reactor (PBR) critical facility from 1992 to 1996, the PROTEUS facility was designated as HTR-PROTEUS. This experimental program was performed as part of an International Atomic Energy Agency (IAEA) Coordinated Research Project (CRP) on the Validation of Safety Related Physics Calculations for Low Enriched HTGRs. Within this project, critical experiments were conducted for graphite moderated LEU systems to determine core reactivity, flux and power profiles, reaction-rate ratios, the worth of control rods, both in-core and reflector based, the worth of burnable poisons, kinetic parameters, and the effects of moisture ingress on these parameters. Four benchmark experiments were evaluated in this report: Cores 1, 1A, 2, and 3. These core configurations represent the hexagonal close packing (HCP) configurations of the HTR-PROTEUS experiment with a moderator-to-fuel pebble ratio of 1:2. Core 1 represents the only configuration utilizing ZEBRA control rods. Cores 1A, 2, and 3 use withdrawable, hollow, stainless steel control rods. Cores 1 and 1A are similar except for the use of different control rods; Core 1A also has one less layer of pebbles (21 layers instead of 22). Core 2 retains the first 16 layers of pebbles from Cores 1 and 1A and has 16 layers of moderator pebbles stacked above the fueled layers. Core 3 retains the first 17 layers of pebbles but has polyethylene rods inserted between pebbles to simulate water ingress. The additional partial pebble layer (layer 18) for Core 3 was not included as it was used for core operations and not the reported critical configuration. Cores 1, 1A, 2, and 3 were determined to be acceptable benchmark experiments.

  16. Stick-On Electronic Tattoos -Technology Review http://www.technologyreview.com/computing/38296/?p1=A1[8/14/2011 6:01:33 AM

    E-Print Network [OSTI]

    Rogers, John A.

    Stick-On Electronic Tattoos - Technology Review http://www.technologyreview.com/computing/38296/?p1=A1[8/14/2011 6:01:33 AM] Pinch me: These microelectronics are able to wrinkle, bend, and twist along with skin, even as it is being pinched, without breaking or coming loose. Credit: John A. Rogers, University

  17. Paper No. 11.05 1 A Half Century of Tapered-Pile Usage at the John F. Kennedy International Airport

    E-Print Network [OSTI]

    Horvath, John S.

    Paper No. 11.05 1 A Half Century of Tapered-Pile Usage at the John F. Kennedy International Airport piles have been the deep foundation of choice ever since construction of and at the well-known John F. Kennedy International Airport (JFKIA) in New York City began in the late 1940s. Timber piles were used

  18. Session T1A 978-1-4244-1970-8/08/$25.00 2008 IEEE October 22 25, 2008, Saratoga Springs, NY

    E-Print Network [OSTI]

    Alonso, Javier

    ASEE/IEEE Frontiers in Education Conference T1A-1 Work in Progress - Achieving the ABET professional Skills Using Solidarity Projects Javier Alonso, David López, Josep-Llorenç Cruz, Carlos Álvarez, Daniel acquire these skills. This initiative gets them involved in what we call solidarity projects, where both

  19. The CAP LTER Ecosystem Services Assessment: Preliminary Findings and Next Steps M.L. Kapoor1, A.P. Kinzig2, and C. Perrings3

    E-Print Network [OSTI]

    Hall, Sharon J.

    The CAP LTER Ecosystem Services Assessment: Preliminary Findings and Next Steps M.L. Kapoor1, A a pilot study to assess the ecosystem services provided within the CAP LTER boundaries. GOAL: To identify the ecosystem services provided by the CAP LTER that are most critical, most threatened

  20. ENGI 4421 Term Test 2 2012 06 25 Page 1 of 2 1) A storeroom contains 25 air compressors that were all assembled in the same

    E-Print Network [OSTI]

    George, Glyn

    ENGI 4421 Term Test 2­ 2012 06 25 Page 1 of 2 1) A storeroom contains 25 air compressors that were all assembled in the same production run. It is known that five of those air compressors would fail a quality control test. From the storeroom a random sample of four air compressors is taken and tested. Let

  1. IMPROVING DESIGN FOR RECYCLING -APPLICATION TO COMPOSITES N.Perry1, A.Bernard2 (1), F.Laroche2, S.Pompidou3

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    IMPROVING DESIGN FOR RECYCLING - APPLICATION TO COMPOSITES N.Perry1, A.Bernard2 (1), F.Laroche2, S recycling solutions arise that recover efficiently carbon fibres. This paper explores the design for composites recycling issue. Recycler becomes a new knowledge expert for the designer. It is necessary

  2. Thermodynamics -1 A gas is compressed adiabatically from a pressure of P0 to a pressure P = (1+c)P0. This problem will

    E-Print Network [OSTI]

    Virginia Tech

    by slowly sliding the piston to the right in the above figure so that the pressure becomes P = (1+c)P0. CallThermodynamics - 1 A gas is compressed adiabatically from a pressure of P0 to a pressure P = (1+c perform an adiabatic compression by rapidly sliding the piston, controlling the piston velocity so

  3. Teaching Computer Graphics in Brazil M. WALTER1, A. FRERY2, CARLA M.D.S. FREITAS3, LEO P. MAGALH ~AES4, LUIZ VELHO5

    E-Print Network [OSTI]

    Teaching Computer Graphics in Brazil M. WALTER1, A. FRERY2, CARLA M.D.S. FREITAS3, L´EO P. MAGALH about computer graphics teaching and education in Brazil. We hope this discussion will further The activities related with Computer Graphics Teaching in Brazil have received relatively little attention

  4. SUBMITTED TO IEEE TRANSACTIONS ON ROBOTICS AND AUTOMATION, JANUARY 2001; REVISED MAY 2001, AND AUG 2001 1 A feedback control scheme for reversing a truck

    E-Print Network [OSTI]

    Altafini, Claudio

    SUBMITTED TO IEEE TRANSACTIONS ON ROBOTICS AND AUTOMATION, JANUARY 2001; REVISED MAY 2001, AND AUG 2001 1 A feedback control scheme for reversing a truck and trailer vehicle Claudio Alta#12;ni, Alberto the parts of the multibody vehicle, sometimes it is necessary to drive forward to enter in a speci#12;c

  5. ADVANCES IN ATMOSPHERIC SCIENCES, VOL. 21, NO. 1, 2004, 112 1 A Possible Role of Solar Radiation and Ocean in the

    E-Print Network [OSTI]

    ADVANCES IN ATMOSPHERIC SCIENCES, VOL. 21, NO. 1, 2004, 1­12 1 A Possible Role of Solar Radiation to simulate the climate of the mid-Holocene period. The role of the solar radiation and ocean in the mid solar radiation induced by the changed orbital parameters and the changed SST simulated by the OGCM

  6. The muonic helium atom as a classical three-body problem T.J.Stuchi 1 , A.C.B.Antunes 1 and M.A.Andreu 2

    E-Print Network [OSTI]

    Barcelona, Universitat de

    The muonic helium atom as a classical three-body problem T.J.Stuchi 1 , A.C.B.Antunes 1 and M problem of the muonic helium atom, a helium atom with one of its electrons replaced by a muon. Firstly, we establish the connection of the model with the one-dimensional frozen planetary approximation of the helium

  7. Submitted to IEEE Design and Test of Computers, Special Issue on Embedded Systems for Real-Time Multimedia 1 A Backlight Power Management Framework for

    E-Print Network [OSTI]

    Pedram, Massoud

    -Time Multimedia 1 A Backlight Power Management Framework for Battery-Operated Multimedia Systems Hojun Shim School techniques are based on power management during idle or slack times, and are therefore difficult to apply introduce a backlight power management framework for color TFT LCD panels, as used in battery

  8. Figure 1. (a) Various contact angles of water droplets on hydrophilic surface terminated by OH after standard cleaning 1 (SC1) and

    E-Print Network [OSTI]

    Maruyama, Shigeo

    SAM converge; (b) SEM images of SWNTs grown on substrate shown in (a) after catalyst dip-coating. High a self-assembled monolayer (SAM) is both simple and nondestructive.5 In addition, the theoretically perfect flatness of a SAM makes the topography-induced effect negligible. Figure 1a shows the profiles

  9. McMaster University Libraries library.mcmaster.ca 905.525.9140 x22533 library@mcmaster.ca Sociology 1A06

    E-Print Network [OSTI]

    Haykin, Simon

    @mcmaster.ca Sociology 1A06: Finding Academic Sources and Newspaper Articles Nora Gaskin Sociology Liaison Librarian Need@mcmaster.ca By the end of this session, you will be able to... Find Academic Sources journal articles books Find@mcmaster.ca Sociological Abstracts · the major database of academic journal articles for sociology · 1952 to the present

  10. Math 103b Spring 2014 Sample Midterm 2 1. (a) Define what it means for a ring R to be a PID (principal ideal

    E-Print Network [OSTI]

    Rogalski, Daniel

    Math 103b Spring 2014 Sample Midterm 2 1. (a) Define what it means for a ring R to be a PID above are UFD's? (no proof necessary) (c2). Which rings on the list above are PID's? (no proof necessary

  11. Nonlinear resonance of superconductor/normal metal structures to microwaves E. Kandelaki,1 A. F. Volkov,1,2 K. B. Efetov,1 and V. T. Petrashov3

    E-Print Network [OSTI]

    Sheldon, Nathan D.

    Nonlinear resonance of superconductor/normal metal structures to microwaves E. Kandelaki,1 A. F.024502 PACS number s : 74.45. c, 74.50. r, 85.25.Dq, 03.67.Lx I. INTRODUCTION Superconductor/normal metal S conductance G=dj/dV of a normal metal wire in a superconductor/ normal metal heterostructure with a cross

  12. Assignment Carbon Footprints Name__Lachniet__ 1) See Figure 1.1a at the back of the assignment (from IPCC)

    E-Print Network [OSTI]

    Lachniet, Matthew S.

    Assignment Carbon Footprints Name__Lachniet__ 1) See Figure 1.1a at the back capita, relative to other countries. 3) Use the carbon footprint calculator at 1) http utility bill. Use the # of people living in your house. a) What is your carbon footprint, in metric

  13. High Performance Computing Update, June 2009 1. A meeting was held with users and potential users of high performance computing systems in April and this

    E-Print Network [OSTI]

    Sussex, University of

    High Performance Computing Update, June 2009 1. A meeting was held with users and potential users of high performance computing systems in April and this considered a proposal from the Director and application "advice" and a core system to host and manage high performance computing nodes (or clusters

  14. Broadband emission in InAs/InGaAlAs quantum-dash-in-well laser Boon S. Ooi1, a

    E-Print Network [OSTI]

    -broadband sources are generated using nonlinear-optical transformations of ultra-short laser pulses and photonicBroadband emission in InAs/InGaAlAs quantum-dash-in-well laser Boon S. Ooi1, a , Hery S. Djie1: Quantum dash, Quantum dot, Broadband emission, Semiconductor Laser. Abstract. We report on the development

  15. PROBLEM-SOLVING MASTERCLASS WEEK 1 1. A game starts with four heaps of beans, containing 3, 4, 5 and 6 beans. The two players

    E-Print Network [OSTI]

    Vakil, Ravi

    PROBLEM-SOLVING MASTERCLASS WEEK 1 1. A game starts with four heaps of beans, containing 3, 4, 5 and 6 beans. The two players move alternately. A move consists of taking either (a) one bean from a heap, provided at least two beans are left behind in that heap, or (b) a complete heap of two or three beans

  16. Chapter 27 JavaBeans and Bean Events 1. A JavaBeans component is a serializable public class with a default public

    E-Print Network [OSTI]

    Liang, Y. Daniel

    Chapter 27 JavaBeans and Bean Events 1. A JavaBeans component is a serializable public class with a default public constructor. Not every GUI class is a JavaBeans component. For example, java.awt.Color is not a JavaBeans component. Every GUI user interface class is a JavaBeans component. However, a JavaBeans

  17. PROBLEMSOLVING MASTERCLASS WEEK 1 1. A game starts with four heaps of beans, containing 3, 4, 5 and 6 beans. The two players

    E-Print Network [OSTI]

    Vakil, Ravi

    PROBLEM­SOLVING MASTERCLASS WEEK 1 1. A game starts with four heaps of beans, containing 3, 4, 5 and 6 beans. The two players move alternately. A move consists of taking either (a) one bean from a heap, provided at least two beans are left behind in that heap, or (b) a complete heap of two or three beans

  18. Math 290 -Guided Practice Homework 23 November 28, 2014 In previous Guided Practices I have asked you to work through the lecture videos for 5.1(a),

    E-Print Network [OSTI]

    Singman, David

    you to work through the lecture videos for 5.1(a), 5.1(b), and 5.2 parts 1 through 8. As you work through more of the video lectures you will see that we have been anticipating some of that material with the last few Class Activities. · Part 9 of the Videos Lectures introduces the Cantor

  19. Evaluation of Carrying Capacity : Measure 7.1A of the Northwest Power Planning Council`s 1994 Fish and Wildlife Program : Report 1 of 4, Final Report.

    SciTech Connect (OSTI)

    Neitzel, Duane A.; Johnson, Gary E.

    1996-05-01T23:59:59.000Z

    This report is one of four that the Pacific Northwest National Laboratory (PNNL) staff prepared to address Measure 7.1A in the Northwest Power Planning Council's (Council) Fish and Wildlife Program (Program) dated december 1994 (NPPC 1994). Measure 7.1A calls for the Bonneville Power Administration (BPA) to fund an evaluation of salmon survival, ecology, carrying capacity, and limiting factors in freshwater, estuarine, and marine habitats. Additionally, the Measure asks for development of a study plan based on critical uncertainties and research needs identified during the evaluation. This report deals with the evaluation of carrying capacity. It describes the analysis of different views of capacity as it relates to salmon survival and abundance. The report ends with conclusions and recommendations for studying carrying capacity.

  20. MBF 614 Population Modeling and Management Course Syllabus Fall Semester 2010 Page 1 Copyrights by Dr. Jerald S. Ault, University of Miami RSMAS

    E-Print Network [OSTI]

    Miami, University of

    and parameter estimation. Simulation modeling tools will highlight concepts in decision theory, adaptive, Operations Research, Systems Analysis. Brief Course Description. A synthesis of mathematical control, and risk assessment. Specific population modeling and resource allocation case studies from

  1. Colorectal cancer and socioeconomic status in Miami-Dade County: Neighborhood-level associations before and after the Welfare Reform Act

    E-Print Network [OSTI]

    Robeson, Scott M.

    . Introduction Colorectal cancer (CRC) is the second leading cause of cancer- related death in the United States., 2001). Between the years 1975 and 2002, CRC mortality rates in the United States decreased for Whites) derived from United States Bureau of the Census data releases. Statistical analyses were repeated for two

  2. AS{01 : MMM-98 Miami, Florida Nov 9{12 1998. Magnetic Ordering in Re-Doped a Fe 90 Zr 10

    E-Print Network [OSTI]

    Ryan, Dominic

    -line of DUALSPEC, a triple-axis spectrometer, at AECL, Chalk River. Initial polarisations of #24;96%

  3. Searching for an invisible <mi>A> ? vector boson with DarkLight

    SciTech Connect (OSTI)

    Kahn, Yonatan; Thaler, Jesse

    2012-12-01T23:59:59.000Z

    High-luminosity experiments are able to search for new physics at low energies, which could have evaded detection thus far due to very weak couplings to the Standard Model. The DarkLight experiment at Jefferson Lab is designed to search for a new U(1) vector boson A' in the mass range 10–100 MeV through its decay A'?e?e?. In this paper, we demonstrate that DarkLight is also sensitive to an A' decaying to invisible final states. We analyze the DarkLight reach for invisible A' bosons assuming a nominal two month running time, including the possibility of augmenting the DarkLight design to include photon detection. We also propose two new analysis techniques that might prove useful for other high-luminosity searches: a cut on missing energy to improve the invariant mass resolution, and a cut on the sign of the missing invariant mass-squared to mitigate pileup. We compare the DarkLight reach to existing experimental proposals, including a complementary search using the VEPP-3 positron beam.

  4. This paper was accepted by The 22nd IEEE International Parallel and Distributed Processing Symposium (IPDPS 2008, main conference), Miami, Florida, USA, April 14-18, 2008.

    E-Print Network [OSTI]

    Xie, Tao

    @rohan.sdsu.edu Abstract Mainstream energy conservation schemes for disk arrays inherently affect the reliability of disks lowers down the overall MTBF of the entire system. More recently, energy conservation for disk arrays has. While some of energy conservation schemes, such as caching based energy saving approaches, normally do

  5. Gravitational-like interactions in a cloud of cold J. Barre(1), B. Marcos(1), A. Olivetti(1), D. Wilkowski(2),

    E-Print Network [OSTI]

    Dauxois, Thierry

    Gravitational-like interactions in a cloud of cold atoms? J. Barr´e(1), B. Marcos(1), A. Olivetti(1 with a friction and a white noise (fixed temperature T = D/): xi = vi vi = -vi + 1 m j=i Fji + 2Di (t) Associated and a white noise (fixed temperature T = D/): xi = vi vi = -vi + 1 m j=i Fji + 2Di (t) Associated Non Linear

  6. SPECTROMTRE 03B1 A SCINTILLATION AVEC I Cs(Tl) Par J. FLEURY, P. PERRIN, M. BOGE et J. LAUGIER,

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    480. SPECTROMÈTRE 03B1 A SCINTILLATION AVEC I Cs(Tl) Par J. FLEURY, P. PERRIN, M. BOGE et J 03B1 de 9 MeV. Abstract. 2014 In spectrometry with CsI(Tl) crystals the following characteristicsV with NaI). The best resolution in spectrometry 03B1 is 2.5 % with 9 MeV 03B1-particles. LE .IOURNAL DE

  7. Explanation of Significant Difference (ESD) for the A-Area Burning/Rubble Pits (731-A/1A) and Rubble Pit (731-2A) (U)

    SciTech Connect (OSTI)

    Morgan, Randall

    2000-11-17T23:59:59.000Z

    The A-Area Burning/Rubble Pits (731-A/1A) and Rubble Pit (731-2A) (ABRP) operable unit (OU) is located in the northwest portion of Savannah River Site (SRS), approximately 2.4 kilometers (1.5 miles) south of the A/M Area operations. Between 1951 and 1973, Pits 731-A and 731-1A were used to burn paper, plastics, wood, rubber, rags, cardboard, oil, degreasers, and solvents. Combustible materials were burned monthly. After burning was discontinued in 1973, Pits 731-A and 731-1A were also converted to rubble pits and used to dispose of concrete rubble, bricks, tile, asphalt, plastics, metal, wood products, and rubber until about 1978. When the pits were filled to capacity, there were covered with compacted clay-rich native soils and vegetation was established. Pit 731-2A was only used as a rubble pit until 1983 after which the area was backfilled and seeded. Two other potential source areas within the OU were investigated and found to be clean. The water table aquifer (M-Area aquifer) was also investigated.

  8. c1a.xls

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    have the end use, not consumption specifically for that particular end use. HVAC Heating, Ventilation, and Air Conditioning. Due to rounding, data may not sum to...

  9. Fall 2013 Exam 1A

    E-Print Network [OSTI]

    Patrick Devlin

    2015-01-05T23:59:59.000Z

    A large solar heating panel requires 120-gallons of a fluid that is 30% antifreeze. The fluid comes in either a 50% solution or a 20% solution. How many gallons ...

  10. c1a.xls

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    Q N Food Service ... 297 1,654 6,865 5,176 1,615 Q Q Health Care ... 129 3,163 7,440 4,882 1,538 79 Q...

  11. Spring 2014 Exam 1A

    E-Print Network [OSTI]

    Patrick Devlin

    2015-01-05T23:59:59.000Z

    An electrician and his apprentice make $55 and $20 an hour, respectively. ... for labor on a job, and the apprentice worked 3 hours fewer than the electrician, ...

  12. c1a.xls

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,397 125 Q 69 (MillionAdjustments174.37,681.01998$11.157 2163266South

  13. c1a.xls

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,397 125 Q 69 (MillionAdjustments174.37,681.01998$11.157

  14. Page1A.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for RenewableSpeedingBiomassPPPO Website DirectoryCommunityFuture UseProbabilistic

  15. Addendum 1 - A5 CA

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysisDarby/%2AO 474.2 Chg 1KANSAS CITY

  16. Production of medium-mass neutron-rich nuclei in reactions induced by 136Xe projectiles at 1 A GeV on a beryllium target

    E-Print Network [OSTI]

    J. Benlliure; M. Fernandez-Ordonez; L. Audouin; A. Boudard; E. Casarejos; J. E. Ducret; T. Enqvist; A. Heinz; D. Henzlova; V. Henzl; A. Kelic; S. Leray; P. Napolitani; J. Pereira; F. Rejmund; M. V. Ricciardi; K. -H. Schmidt; C. Schmitt; C. Stephan; L. Tassan-Got; C. Volant; C. Villagrasa; O. Yordanov

    2008-07-17T23:59:59.000Z

    Production cross sections of medium-mass neutron-rich nuclei obtained in the fragmentation of 136Xe projectiles at 1 A GeV have been measured with the FRagment Separator (FRS) at GSI. 125Pd was identified for the first time. The measured cross sections are compared to 238U fission yields and model calculations in order to determine the optimum reaction mechanism to extend the limits of the chart of the nuclides around the r-process waiting point at N=82.

  17. Robot Locomotion Controller Generation Through Human-Inspired Optimization

    E-Print Network [OSTI]

    Powell, Matthew Joseph

    2013-11-13T23:59:59.000Z

    Kinematics: Coordinates and Convention . . . . . . . 10 2.2 Robot Model Dynamics and Constraints . . . . . . . . . . . . . . . . 13 2.2.1 Foot-Ground Contact Constraints . . . . . . . . . . . . . . . . 14 2.2.2 Lagrangian Dynamics with Constraints... OF FIGURES FIGURE Page 1.1 Anthropomorphic bipedal robots: NAO and NASA’s Leg Testbed. . . 1 2.1 A depiction of the modeled rigid-body robot, comprised of links ` ? {f, c, t, T} corresponding to the foot, calf, thigh and torso, each with mass m`, inertia I...

  18. ORIGINAL ARTICLE The Effect of Foot and Ankle Prosthetic Components on

    E-Print Network [OSTI]

    -9. Objective: To assess the influence of energy storage and return (ESAR) prosthetic feet and multi-axis ankles on ground reaction forces and loading asymmetry between lower limbs in transtibial amputees. Design: The anteroposterior ground re- action force impulse, peak ground reaction forces, and braking and propulsion impulse

  19. Foot Tapping for Mobile Interaction Andrew Crossan, Stephen Brewster, Alexander Ng

    E-Print Network [OSTI]

    Williamson, John

    become a standard part of mobile interfaces. Touch screens allow a user to quickly and easily perform

  20. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    abalone shell. Materials Science and Engineering A 2005;390:comparative study. Materials Science and Engineering C 2006;21. xxii VITA Materials Science and Engineering Program,

  1. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    CT)^8 A Range Repeat HO HE PIC Locus Sequence BOOB-RM2-F07U GTTTGCTAATCCCCTGGTGCAAGTG BOOB-RM2-F07 LAAAG)^35… (AAAG) ^5 BOOB-RM3-D07 U GTTTGGCCTACTGCCATCCAGGG

  2. he town of Herculaneum, lying at the foot of Mount Vesuvius on a cliff over-

    E-Print Network [OSTI]

    Jellinek, Mark

    advanced as a deflating current with low momentum until it reached the 20-metre cliff drop, when its basal, denser component emplaced abruptly on the beach, halted probably by hydraulic-jump effects, bursting. Some of the skeletons have articulated fractures, as seen in incinerated bodies3,4 , and the inner

  3. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    inorganic materials could lead to significant advances in materials science, opening the door to novel synthesis

  4. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    relative position of calcium and carbonate ions creating ascaffolding. The calcium and carbonate ions can penetratewith surrounding calcium and carbonate ions. Since these

  5. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    of microfabricated polyimide hairs in a 1cm2 array, (b) re-et al. [135] microfabricated polyimide hairs (Figure 2.35 a)of microfabricated polyimide hairs in a 1cm 2 array, (b) re-

  6. Design and fabrication of force sensing robotic foot utilizing the volumetric displacement of a hyperelastic polymer

    E-Print Network [OSTI]

    Estrada, Matthew A

    2012-01-01T23:59:59.000Z

    This thesis illustrates the fabrication and characterization of a footpad based on an original principle of volumetric displacement sensing. It is intended for use in detecting ground reaction forces in a running quadrupedal ...

  7. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  8. A study of the design criteria for drilled-and-belled footings 

    E-Print Network [OSTI]

    Lehmann, Clark Thomas

    1964-01-01T23:59:59.000Z

    Drilling Machine . . ~ . ~ . 44 14. Shelby Tube Sampler . . . . ~ . ~ ~ ~ ~ . ~ ~ ~ . 44 15. Dri. lling Machine in Operation ~ ~ ~ ~ ~ ~ 46 16. Sample Data Sheet for Triaxial Compression Test . . 49 17. Stress-Strain Curve for Triaxial Test Specimen... to Pascal~s Law Now, the active pressure~ G~, on surface AC is 5 A. R Jumikis, ~o . cit. , pp. 618-624. Pd 11 B A 45 P/2 B Pp 4So + p/2 C I v/1+8 (a) Forces in Prandtl's System (b) Mohr Stress Diagram for Compression Test FIGURB 3. Prandtl...

  9. Ground Covers for northern ArizonA Above 6,000 foot elevAtions

    E-Print Network [OSTI]

    Sanderson, Mike

    or the use of fabric or plastic mulch may be required. Most Northern Arizona soils are limited in the amount to turf, bare ground, and rock mulches. Ground covers fill a number of important design needs. They can or even highway embankments. They can soften and add a touch of greenery to the large rock-mulched areas

  10. Department of Mechanical Engineering Spring 2012 IMPROVING THE TRANSMISSION OF A12FOOT DANCE VEHICLE

    E-Print Network [OSTI]

    Demirel, Melik C.

    DANCE VEHICLE Overview A Penn State Creative Campus collaborative project called the "Secret Life of Public Spaces" (SLoPS) prompted the creative idea of a mobile dance vehicle. This vehicle would be used system for this vehicle, which was discovered after they built an initial prototype that didn't function

  11. Procedures employed in the verification of postings, footings, and ledger balances

    E-Print Network [OSTI]

    Sain, Carl

    1939-01-01T23:59:59.000Z

    app??oint ion 989 &414& 55 115&54f &5? $5&lid& ae 15 & fs'F. BO 108 & $15& 04 1& $08& 48 $&944, 15 ?5&4$4, 05 e&?95&000&00 I&140&gg, oo? f 05 & 000& 00 I, 180 & 000& 00 4 8&9$5&455&95 4 sde&ff1&vo 4 sgesa&aod. ds l&odf &8$9&59 114&fde&04... Sd&i'd, oa 4{1) 159&40? 59, 4dl. ee 4&155&000&00 8&8?5&000, 00 (5) 958&dls&50 l&odf &889&58 je) 58, 44f, dd 114&fde&04 (F) 58&9?0. 00 $5 &905& BI s9. 411. 55 &e) sd, eef. s9? 4&154&000&00 I & 885 & 000& 00 10&954& 00 948&515& 50 1 & 155...

  12. Literature Cited FIGURE 3.-Respiratory demand (Gooding and Neill see foot-

    E-Print Network [OSTI]

    ventilation by increasing gape rather than simply swimming faster. fairly rapid rise in the water column is possible, it does not appear to be a significant problem. Ofthe last 10 cetaceans that I have captured. Analysis ofram ventilation offish gills with applica- tion to skipjack tuna (Katsuwonus pelamis). J. Fish

  13. Factors associated with spatial clustering of foot-and-mouth disease in Nepal

    E-Print Network [OSTI]

    Chhetri, Bimal K.; Perez, Andres M.; Thurmond, Mark C.

    2010-01-01T23:59:59.000Z

    control and eradication in Nepal, Bulletin of VeterinaryScience and Animal Husbandry, Nepal,Nepal Veterinary Association, 26, 18–26. Grubman, M. J. ,

  14. Table 3a. Total Natural Gas Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet) DecadeV49 155 181 177391.070.51992

  15. Table 4a. Total Fuel Oil Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet) DecadeV493,552.13,846.302.8

  16. U.S. Total Consumption of Heat Content of Natural Gas (BTU per Cubic Foot)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 34 44Year Jan Feb MarDecade Year-0Sales (Billion CubicConsumption

  17. Type B Accident Investigation Board Report BNFL, Inc. Employee Foot Injury

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssuesEnergyTransportation WorkDecember 28,Injury at

  18. U.S. Nominal Cost per Foot of Crude Oil, Natural Gas, and Dry Wells Drilled

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)Oil

  19. U.S. Real Cost per Foot of Crude Oil, Natural Gas, and Dry Wells Drilled

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb MarRevision2009 2010(Million(Dollars

  20. High-solids black liquor firing in pulp and paper industry kraft recovery boilers. Quarterly report, Phase 1a: Black liquor gasifier evaluation

    SciTech Connect (OSTI)

    NONE

    1996-07-01T23:59:59.000Z

    This project phase addresses the following workscope: Conduct bench-scale tests of a low temperature, partial combustion gasifier; Prepare a gasifier pilot-plant preliminary design and cost estimate and prepare a budgetary cost estimate of the balance of the program; Outline a test program to evaluate gasification; Prepare an economic/market analysis of gasification and solicit pulp and paper industry support for subsequent phases; and Prepare a final report and conduct a project review prior to commencement of work leading to construction of any pilot scale components or facilities. The primary accomplishments included completion of installation of the bench-scale black liquor gasifier and supporting systems, preparing test plans and related safety procedures and detailed operating procedures, defining the functional design requirements and outlining the test plans for the pilot-scale gasifier, and preparing a preliminary economic assessment of the black liquor gasifier. This work accomplished under Phase 1a during this period is further described by task.

  1. Proceedings of the Third NRC/ASME Symposium on Valve and Pump Testing. Session 1A--Session 2C: Volume 1

    SciTech Connect (OSTI)

    Not Available

    1994-07-01T23:59:59.000Z

    The 1994 Symposium on Valve and Pump Testing, jointly sponsored by the Board of Nuclear Codes and Standards of the American Society of Mechanical Engineers and by the Nuclear Regulatory Commission, provides a forum for the discussion of current programs and methods for inservice testing and motor-operated valve testing at nuclear power plants. The symposium also provides an opportunity to discuss the need to improve that testing in order to help ensure the reliable performance of pumps and valves. The participation of industry representatives, regulators, and consultants results in the discussion of a broad spectrum of ideas and perspectives regarding the improvement of inservice testing of pumps and valves at nuclear power plants. This document, Volume 1, covers sessions 1A through session 2C. The individual papers have been cataloged separately.

  2. Measurement of charged pions in 12C + 12C collisions at 1A GeV and 2A GeV with HADES

    E-Print Network [OSTI]

    The HADES Collaboration; G. Agakishiev; C. Agodi; A. Balanda; G. Bellia; D. Belver; A. Belyaev; J. Bielcik; A. Blanco; A. Bortolotti; J. L. Boyard; P. Braun-Munzinger; P. Cabanelas; S. Chernenko; T. Christ; R. Coniglione; M. Destefanis; J. Diaz; F. Dohrmann; I. Duran; A. Dybczak; T. Eberl; L. Fabbietti; O. Fateev; R. Ferreira-Marques; P. Finocchiaro; P. Fonte; J. Friese; I. Froehlich; T. Galatyuk; J. A. Garzon; R. Gernhaeuser; A. Gil; C. Gilardi; M. Golubeva; D. Gonzalez-Diaz; E. Grosse; F. Guber; M. Heilmann; T. Heinz; T. Hennino; R. Holzmann; A. Ierusalimov; I. Iori; A. Ivashkin; M. Jurkovic; B. Kaempfer; K. Kanaki; T. Karavicheva; D. Kirschner; I. Koenig; W. Koenig; B. W. Kolb; R. Kotte; A. Kozuch; A. Krasa; F. Krizek; R. Kruecken; W. Kuehn; A. Kugler; A. Kurepin; J. Lamas-Valverde; S. Lang; J. S. Lange; K. Lapidus; L. Lopes; M. Lorenz; L. Maier; C. Maiolino; A. Mangiarotti; J. Marin; J. Markert; V. Metag; B. Michalska; J. Michel; E. Moriniere; J. Mousa; M. Muench; C. Muentz; L. Naumann; R. Novotny; J. Otwinowski; Y. C. Pachmayer; M. Palka; Y. Parpottas; V. Pechenov; O. Pechenova; T. Perez Cavalcanti; P. Piattelli; J. Pietraszko; V. Pospisil; W. Przygoda; B. Ramstein; A. Reshetin; M. Roy-Stephan; A. Rustamov; A. Sadovsky; B. Sailer; P. Salabura; P. Sapienza; A. Schmah; C. Schroeder; E. Schwab; R. S. Simon; Yu. G. Sobolev; S. Spataro; B. Spruck; H. Stroebele; J. Stroth; C. Sturm; M. Sudol; A. Tarantola; K. Teilab; P. Tlusty; M. Traxler; R. Trebacz; H. Tsertos; V. Wagner; M. Weber; M. Wisniowski; T. Wojcik; J. Wuestenfeld; S. Yurevich; Y. Zanevsky; P. Zhou; P. Zumbruch

    2009-05-18T23:59:59.000Z

    We present the results of a study of charged pion production in 12C + 12C collisions at incident beam energies of 1A GeV and 2A GeV using the HADES spectrometer at GSI. The main emphasis of the HADES program is on the dielectron signal from the early phase of the collision. Here, however, we discuss the data with respect to the emission of charged hadrons, specifically the production of pi+- mesons, which are related to neutral pions representing a dominant contribution to the dielectron yield. We have performed the first large-angular range measurement of the distribution of pi+- mesons for the 12C + 12C collision system covering a fairly large rapidity interval. The pion yields, transverse-mass and angular distributions are compared with calculations done within a transport model, as well as with existing data from other experiments. The anisotropy of pion production is systematically analyzed.

  3. CX-000124: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Miami Tribe Energy Efficiency RetrofitsCX(s) Applied: B5.1, B2.5, A1Date: 12/10/2009Location(s): Miami Tribe, OklahomaOffice(s): Energy Efficiency and Renewable Energy

  4. THERMAL ENERGY STORAGE IN AQUIFERS WORKSHOP

    E-Print Network [OSTI]

    Authors, Various

    2011-01-01T23:59:59.000Z

    III, "Man-made Geothermal Energy," presented at MiamiA.C.Meyers III; "Manmade Geothermal Energy", Proc. of MiamiBlack is director of Geothermal Energy Systems, Fox Parry is

  5. Comings&GoingsFrom the oFFice oF the Dean For extension Table of Contents

    E-Print Network [OSTI]

    Jawitz, James W.

    in Washington DC: Joy Hazell (Lee County), Lisa Krimsky (Miami-Dade County), Brooke Saari (Okaloosa, Walton

  6. Interpretations and implications of the top quark rapidity asymmetries <mi>A> FB t and <mi>A> FB ?

    SciTech Connect (OSTI)

    Berger, Edmond L.; Cao, Qing-Hong; Chen, Chuan-Ren; Zhang, Hao

    2013-07-01T23:59:59.000Z

    Forward-backward asymmetries AtFB and AlFB are observed in the top-quark t rapidity distribution and in the rapidity distribution of charged leptons l from top-quark decay at the Tevatron proton-antiproton collider, and a charge asymmetry AC is seen in proton-proton collisions at the Large Hadron Collider (LHC). In this paper, we update our previous studies of the Tevatron asymmetries using the most recent data. We provide expectations for AC at the LHC based first on simple extrapolations from the Tevatron, and second based on new physics models that can explain the Tevatron asymmetries. We examine the relationship of the two asymmetries AtFB and AlFB. We show their connection through the (V–A) spin correlation between the charged lepton and the top quark with different polarization states. We show that the ratio of the two asymmetries provides independent insight into the physics interpretation of the top-quark asymmetry. We emphasize the value of the measurement of both asymmetries, and we conclude that a model which produces more right-handed than left-handed top quarks is suggested by the present Tevatron data.

  7. P-23 Highlights 6/10/12: Cygnus Dual Beam Radiographic Facility Refurbishment completed at U1A tunnel in Nevada NNSS meeting Level 2 milestone

    SciTech Connect (OSTI)

    Deyoung, Anemarie [Los Alamos National Laboratory; Smith, John R. [Los Alamos National Laboratory

    2012-05-03T23:59:59.000Z

    A moratorium was placed on U.S. underground nuclear testing in 1992. In response, the Stockpile Stewardship Program was created to maintain readiness of the existing nuclear inventory through several efforts such as computer modeling, material analysis, and subcritical nuclear experiments (SCEs). As in the underground test era, the Nevada National Security Site (NNSS), formerly the Nevada Test Site, provides a safe and secure environment for SCEs by the nature of its isolated and secure facilities. A major tool for SCE diagnosis installed in the 05 drift laboratory is a high energy x-ray source used for time resolved imaging. This tool consists of two identical sources (Cygnus 1 and Cygnus 2) and is called the Cygnus Dual Beam Radiographic Facility (Figs. 2-6). Each Cygnus machine has 5 major elements: Marx Generator, Pulse Forming Line (PFL), Coaxial Transmission Line (CTL), 3-cell Inductive Voltage Adder (IVA), and Rod Pinch Diode. Each machine is independently triggered and may be fired in separate tests (staggered mode), or in a single test where there is submicrosecond separation between the pulses (dual mode). Cygnus must operate as a single shot machine since on each pulse the diode electrodes are destroyed. The diode is vented to atmosphere, cleaned, and new electrodes are inserted for each shot. There is normally two shots per day on each machine. Since its installation in 2003, Cygnus has participated in: 4 Subcritical Experiments (Armando, Bacchus, Barolo A, and Barolo B), a 12 shot plutonium physics series (Thermos), and 2 plutonium step wedge calibration series (2005, 2011), resulting in well over 1000 shots. Currently the Facility is in preparation for 2 SCEs scheduled for this calendar year - Castor and Pollux. Cygnus has performed well during 8 years of operations at NNSS. Many improvements in operations and performance have been implemented during this time. Throughout its service at U1a, major maintenance and replacement of many hardware items were delayed due to programmatic requirements. It is anticipated that Cygnus will be in service at U1a for another 5 years. With this assumption, it was realized that significant resources and effort should be allotted to bring the hardware back to its original condition, or even to improve elements when appropriate. The Cygnus Refurbishment and Enhancement Project started in April, 2011 with the intent to encompass a major overhaul of Cygnus.

  8. Prepared By Lon Hatamiya, MBA, JD

    E-Print Network [OSTI]

    Shyu, Mei-Ling

    the economic impact of the University of Miami ("University or UM") upon the surrounding tri-county region are tremendously significant, not only to the south Florida Tri-County region including Miami-Dade, Broward, and Palm Beach Counties, but also to the entire state of Florida. 2 http://www6.miami

  9. Preparation of the Crystal Complex of Phosphopantetheine Adenylyltransferase from Mycobacterium tuberculosis with Coenzyme A and Investigation of Its Three-Dimensional Structure at 2.1-A Resolution

    SciTech Connect (OSTI)

    Timofeev, V. I.; Smirnova, E. A., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Chupova, L. A.; Esipov, R. S. [Russian Academy of Sciences, Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2010-11-15T23:59:59.000Z

    Recombinant phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis (PPAT Mt), which was produced by a high-producing strain and purified to 99%, was used for the crystal growth of the complex of the enzyme with coenzyme A (CoA). Crystals suitable for X-ray diffraction study were obtained by cocrystallization. The crystals belong to sp. gr. R32 and have the unit-cell parameters a = b = 98.840 A, c = 112.880 A, {alpha} = {beta} = 90.00{sup o}, and {gamma} = 120.00{sup o}. The three-dimensional structure of the complex was determined based on X-ray diffraction data collected from the crystals to 2.1 A resolution and refined to Rf = 22.7% and Rfree = 25.93%. Active-site bound coenzyme A was found, and its nearest environment was described. The conformational changes of the enzyme due to ligand binding were revealed. The binding of CoA by tuberculosis phosphopantetheine adenylyltransferase was characterized by comparing the structures of the title complex to a similar complex of PPAT from E. coli (PPAT Ec).

  10. Multifragmentation and the Phase Transition: A Systematic Study of the MF of 1A GeV Au, La, and Kr

    E-Print Network [OSTI]

    B. K. Srivastava

    2002-02-27T23:59:59.000Z

    A systematic analysis of the multifragmentation (MF) in fully reconstructed events from 1A GeV Au, La and Kr collisions with C has been performed. This data is used to provide a definitive test of the variable volume version of the statistical multifragmentation model (SMM). A single set of SMM parameters directly determined by the data and the semi-empiricalmass formula are used after the adjustable inverse level density parameter, $\\epsilon_{o}$ is determined by the fragment distributions. The results from SMM for second stage multiplicity, size of the biggest fragment and the intermediate mass fragments are in excellent agreement with the data. Multifragmentation thresholds have been obtained for all three systems using SMM prior to secondary decay. The data indicate that both thermal excitation energy $E_{th}^{*}$ and the isotope ratio temperature $T_{He-DT}$ decrease with increase in system size at the critical point. The breakup temperature obtained from SMM also shows the same trend as seen in the data. The SMM model is used to study the nature of the MF phase transition. The caloric curve for Kr exhibits back-bending (finite latent heat) while the caloric curves for Au and La are consistent with a continuous phase transition (nearly zero latent heat) and the values of the critical exponents $\\tau$, $\\beta$ and $\\gamma$, both from data and SMM, are close to those for a 'liquid-gas' system for Au and La. We conclude that the larger Coulomb expansion energy in Au and La reduces the latent heat required for MF and changes the nature of the phase transition. Thus the Coulomb energy plays a major role in nuclear MF.

  11. EVALUATION OF RISKS IN THE LIFE CYCLE OF PHOTOVOLTAICS IN A COMPARATIVE CONTEXT V.M. Fthenakis1,2 H.C. Kim1, A. Colli3, and C. Kirchsteiger3

    E-Print Network [OSTI]

    EVALUATION OF RISKS IN THE LIFE CYCLE OF PHOTOVOLTAICS IN A COMPARATIVE CONTEXT V.M. Fthenakis1,2 H.C. Kim1, A. Colli3, and C. Kirchsteiger3 1 National Photovoltaic EH&S Research Center, Brookhaven: The greatest potential risks in the photovoltaic (PV) fuel cycle probably are associated with using some

  12. CYP1A1*2B (Val) allele is overrepresented in a subgroup of acute myeloid leukemia patients with poor-risk karyotype associated with NRAS mutation, but

    E-Print Network [OSTI]

    California at Berkeley, University of

    NEOPLASIA CYP1A1*2B (Val) allele is overrepresented in a subgroup of acute myeloid leukemia T. Smith, Stephen E. Langabeer, and Gareth J. Morgan The etiology of acute myeloid leukemia (AML of Hematology Introduction The etiology of acute myeloid leukemia (AML) is unknown for the majority of cases

  13. Role of hydrogen in hydrogen-induced layer exfoliation of germanium J. M. Zahler,1 A. Fontcuberta i Morral,1,2 M. J. Griggs,1 Harry A. Atwater,1 and Y. J. Chabal3

    E-Print Network [OSTI]

    Atwater, Harry

    Role of hydrogen in hydrogen-induced layer exfoliation of germanium J. M. Zahler,1 A. Fontcuberta i 2006; published 9 January 2007 The role of hydrogen in the exfoliation of Ge is studied using cross for the physical and chemical action of hydrogen in the exfoliation of these materials is presented, in which H

  14. Galbraith Building, 35 St George Street, Toronto, ON M5S 1A4 Canada Tel: +1 416 978-3131 Fax +1 416 978-4859 dean.engineering@ecf.utoronto.ca www.engineering.utoronto.ca

    E-Print Network [OSTI]

    Prodiæ, Aleksandar

    capacity/autonomy 5. Level of communication skills 6. Awareness of limits of knowledge #12;our Engineering undergraduate programs: 1. A knowledge base for engineering 2. Problem analysis 3. Investigation 4. Design 5 978-4859 dean.engineering@ecf.utoronto.ca www.engineering.utoronto.ca MEMORANDUM 2009/10-09 To: Chairs

  15. ECRH Results during Current Ramp-up and Post-Pellet Injection in G. Bracco 1), A. Bruschi 1), P. Buratti 1), S. Cirant 2), F. Crisanti 1), B. Esposito 1), D.

    E-Print Network [OSTI]

    Vlad, Gregorio

    ECRH Results during Current Ramp-up and Post-Pellet Injection in FTU Plasma G. Bracco 1), A produced by pellet injection, resulting in strong ion heating as shown by the increase of the neutron yield. The analysis of this scenario shows that, when the post pellet phase is MHD quiescent, an enhanced energy

  16. TL1A induces the expression of TGF-b-inducible gene h3 (big-h3) through PKC, PI3K, and ERK in THP-1 cells

    E-Print Network [OSTI]

    Lee, Won-Ha

    TL1A induces the expression of TGF-b-inducible gene h3 (big-h3) through PKC, PI3K, and ERK in THP-1 of protein kinase C (PKC), extracellular signal-regulated kinase (ERK), phosphoinositide kinase-3 (PI3K blocked the phos- phorylation of AKT without affecting ERK phosphorylation. On the other hand, suppression

  17. Fig. 1: (a) Conventional dual-pump degenerate PSA using a straight HNLF: phase regeneration effect varies with polarization alignment between BPSK signal and two phase-locked pumps. (b) Polarization-diversity PSA

    E-Print Network [OSTI]

    Touch, Joe

    Fig. 1: (a) Conventional dual-pump degenerate PSA using a straight HNLF: phase regeneration effect varies with polarization alignment between BPSK signal and two phase-locked pumps. (b) Polarization. Pump 2Signal Pump 1 HNLF Impaired by phase noise I Q Single-polarization BPSK signal Pump1 (Phase

  18. Key to Juniperus of Europe, Canary Islands, Azores, Asia Minor and Africa rev. 16 Jun 2011 1a. All leaves acicular (subulate), jointed at the base, in whorls of 3; cones borne axillary

    E-Print Network [OSTI]

    Adams, Robert P.

    Key to Juniperus of Europe, Canary Islands, Azores, Asia Minor and Africa rev. 16 Jun 2011 1a. All as wide as midrib, mature seed cones about as long as leaves, endemic to Madeira Island...........................J. maderensis 7a.2 Stomatal bands wider than midrib, mature seed cones longer that leaves, endemic to the Canary

  19. Disruption Characterization and Database Activities for ITER J.C. Wesley 1), A.W. Hyatt 1), E.J. Strait 1), D.P. Schissel 1), S.M. Flanagan 1),

    E-Print Network [OSTI]

    1 IT/P1-21 Disruption Characterization and Database Activities for ITER J.C. Wesley 1), A.W. Hyatt, New Jersey, USA 5) Plasma Science Fusion Center, Massachusetts Institute of Technology, Cambridge Massachusetts, USA 6) Japan Atomic Energy Agency, Fusion Research and Development Directorate, Naka, Ibaraki

  20. Figure 1: A boxcar is towed without friction up a track at an angle 1 with respect to the horizontal. The mass inside the boxcar hangs at an angle 2 with respect to the top of the boxcar.

    E-Print Network [OSTI]

    Texas at Austin. University of

    a m 1 2 Figure 1: A boxcar is towed without friction up a track at an angle 1 with respect: Boxcar on a Hill In the figure, a boxcar of mass M is being towed up a hill by train car without friction. It is accelerating up the slope with a constant acceleration a. Inside the boxcar, an object of mass m hangs

  1. Yellowstone in Yukon: The Late Cretaceous Carmacks Group Stephen T. Johnston* Canada/Yukon Geoscience Office, Box 2703 (F-3), Whitehorse, Yukon Y1A 2C6, Canada

    E-Print Network [OSTI]

    Johnston, Stephen T.

    Yellowstone in Yukon: The Late Cretaceous Carmacks Group Stephen T. Johnston* Canada/Yukon Geoscience Office, Box 2703 (F-3), Whitehorse, Yukon Y1A 2C6, Canada P. Jane Wynne Geological Survey of Canada, 9860 West Saanich Road, P.O. Box 6000, Sidney, British Columbia V8L 4B2, Canada Don Francis Earth

  2. CONDENSATION IN EJECTA FROM DENSE THERMONUCLEAR SUPERNOVAE. T. Yu1, B. S. Meyer1, A. V. Fedkin2, and L. Grossman2,3, 1Department of Physics and Astronomy, Clemson University, Clemson, SC

    E-Print Network [OSTI]

    Grossman, Lawrence

    CONDENSATION IN EJECTA FROM DENSE THERMONUCLEAR SUPERNOVAE. T. Yu1, B. S. Meyer1, A. V. Fedkin2 Thermonuclear Supernova Model: Thermonuclear (Type Ia) supernovae are explosions of white dwarf stars. Our model and then oxy- gen burning proceed under degenerate conditions, a thermonuclear runaway occurs, which leads

  3. Figure S1. Growth of the wild-type and agr mutant over time. This includes the 48 h data point shown in Fig. 1a. We grew the wild-type() and agr mutant() in

    E-Print Network [OSTI]

    West, Stuart

    Figure S1. Growth of the wild-type and agr mutant over time. This includes the 48 h data point shown in Fig. 1a. We grew the wild-type() and agr mutant() in waxmoths for 48 h, in single and mixed infections. When grown as monocultures in hosts, the QS wild-type grew to higher densities than the agr

  4. Maniatis suggests that the Leaning Tower illusion (figure 1a) is not an illusion of perspective, as proposed by us (Kingdom et al 2007a, 2007b), but a variant of the

    E-Print Network [OSTI]

    Kingdom, Frederick A. A.

    Maniatis suggests that the Leaning Tower illusion (figure 1a) is not an illusion of perspective that the Jastrow illusion is an example of simulta- neous size contrast, and that the Leaning Tower illusion is the orientation analog of the Jastrow. In other words the Leaning Tower illusion is an example of simultaneous

  5. Submitted to J. Appl. Phys., revised October, 1999 1 A Rate Equation Model for the Growth of GaN on GaN(0001) by Molecular Beam Epitaxy

    E-Print Network [OSTI]

    Cohen, Philip I.

    Submitted to J. Appl. Phys., revised October, 1999 1 A Rate Equation Model for the Growth of GaN on GaN(000¯1) by Molecular Beam Epitaxy R.Held, B.E. Ishaug, A. Parkhomovsky, A.M. Dabiran, and P (October 7, 1999) GaN(000¯1)filmsweregrownbymolecularbeamepitaxyusingammoniaandelemental

  6. Stretch-bend combination polyads in the Ã1Au [A tilde superscript 1 A subscript u] state of acetylene, C2H2 [C subscript 2 H subscript 2

    E-Print Network [OSTI]

    Steeves, Adam H.

    Rotational analyses are reported for a number of newly-discovered vibrational levels of the S1-trans [S subscriopt 1 -trans](Ã1Au) [A tilde superscript 1 A subscript u] state of C2H2 [C subscript 2 H subscript 2]. These ...

  7. Proceedings from a Workshop on Ecological Carrying Capacity of Salmonids in the Columbia River Basin : Measure 7.1A of the Northwest Power Planning Council`s 1994 Fish and Wildlife Program : Report 3 of 4, Final Report.

    SciTech Connect (OSTI)

    Johnson, Gary E.; Neitzel, D.A.; Mavros, William V.

    1996-05-01T23:59:59.000Z

    This report contains the proceedings of a workshop held during 1995 in Portland, Oregon. The objective of the workshop was to assemble a group of experts that could help us define carrying capacity for Columbia River Basin salmonids. The workshop was one activity designed to answer the questions asked in Measure 7.1A of the Council`s Fish and Wildlife Program. Based, in part, on the information we learned during the workshop we concluded that the approach inherent in 7.1A will not increase understanding of ecology, carrying capacity, or limiting factors that influence salmon under current conditions. Measure 7.1A requires a definition of carrying capacity and a list of determinants (limiting factors) of capacity. The implication or inference then follows that by asking what we know and do not know about the determinants will lead to research that increases our understanding of what is limiting salmon survival. It is then assumed that research results will point to management actions that can remove or repair the limiting factors. Most ecologists and fisheries scientists that have studied carrying capacity clearly conclude that this approach is an oversimplification of complex ecological processes. To pursue the capacity parameter, that is, a single number or set of numbers that quantify how many salmon the basin or any part of the basin can support, is meaningless by itself and will not provide useful information.

  8. Building the urban river edge : proposed connections to the water at the foot of Boston's Beacon Hill

    E-Print Network [OSTI]

    Gorini, Daniel

    1994-01-01T23:59:59.000Z

    The core of this investigation is based on the design of built form at the public urban river edge. It proposes the transformation of a portion of public park edge into public built edge. The Esplanade embankment at the ...

  9. Technical and economic evaluation of selected compact drill rigs for drilling 10,000 foot geothermal production wells

    SciTech Connect (OSTI)

    Huttrer, G.W. [Geothermal Management Company, Inc., Frisco, CO (United States)

    1997-11-01T23:59:59.000Z

    This report summarizes the investigation and evaluation of several {open_quotes}compact{close_quotes} drill rigs which could be used for drilling geothermal production wells. Use of these smaller rigs would save money by reducing mobilization costs, fuel consumption, crew sizes, and environmental impact. Advantages and disadvantages of currently-manufactured rigs are identified, and desirable characteristics for the {open_quotes}ideal{close_quotes} compact rig are defined. The report includes a detailed cost estimate of a specific rig, and an evaluation of the cost/benefit ratio of using this rig. Industry contacts for further information are given.

  10. SHASTA COUNTY The Shasta County Jail is a 115,035 square-foot facility located in Redding. Built in

    E-Print Network [OSTI]

    identified ways to improve the comfort and reduce operating costs of the jail through energy efficiency by 1997. PROJECTS IMPLEMENTED The County Jail received a comprehensive efficiency makeover that included: · Replacing the electric boiler with a natural gas-fired boiler to provide hot water for domestic, kitchen

  11. Recovery Act Weekly Video: 200 Area Asbestos Removal, U-Ancillary Demolition, 200 West Transfer Building Footings

    ScienceCinema (OSTI)

    None

    2012-06-14T23:59:59.000Z

    A weekly update of the Recovery Act at work. Demolition of U-Ancillary that was contaminated with uranium and asbestos as well as removing asbestos from the Steam Generation Plant in the 200 East Area.

  12. Report on the LOTS cruise to map foot of the slope and 2500-m isobath of Bowers Ridge

    E-Print Network [OSTI]

    New Hampshire, University of

    for Coastal and Ocean Mapping/Joint Hydrographic Center University of New Hampshire Durham, NH 03824 August 1 block 01..................................................38 Shaded-relief map of Bowers Ridge block 02..................................................39 Shaded-relief map of Bowers Ridge block 03..................................................40 Shaded

  13. Recovery Act Weekly Video: 200 Area Asbestos Removal, U-Ancillary Demolition, 200 West Transfer Building Footings

    SciTech Connect (OSTI)

    None

    2010-01-01T23:59:59.000Z

    A weekly update of the Recovery Act at work. Demolition of U-Ancillary that was contaminated with uranium and asbestos as well as removing asbestos from the Steam Generation Plant in the 200 East Area.

  14. Comparative Cost Analysis of Alternative Animal Tracing Strategies Directed Toward Foot and Mouth Disease Outbreaks in the Texas High Plains 

    E-Print Network [OSTI]

    Looney, John C.

    2010-07-14T23:59:59.000Z

    to Garner and Lack (1995) was used to carry out the research. Five health states were installed in the model including susceptible, latent, infected, immune, and depopulated. The economic model connected to the disease spread model was comprised of three... sections. The first dealt with the direct costs of depopulation, disinfection, and enforcing the quarantine zone. The second of the economic model used an input-output model to calculate the direct, indirect, and induced losses for California. The final...

  15. The Social Context of Foot-and-Mouth Disease Control in Texas: Foundations for Effective Risk Communication 

    E-Print Network [OSTI]

    Delgado, Amy Haley

    2012-02-14T23:59:59.000Z

    and at-risk animals means that animals must be gathered and held by their owners for testing and depopulation, while strict movement bans designed to slow disease spread are essentially unenforceable without the cooperation of livestock producers..., whose animals were exposed either directly or indirectly to animals, animal products, materials, people, or aerosol from the infected premises, will be quarantined, tested for FMD, and possibly depopulated. Vaccination with or without the subsequent...

  16. Party Platter $38.00 (serves 5-9) Three-Foot Sub $48.00 (serves 10-12)

    E-Print Network [OSTI]

    Milchberg, Howard

    .50 Pepsi, Diet Pepsi, Sierra Mist Bottled Water $1.65 ea Traditional Flavors Half-gallon $5.79 Three, soft tacos or bean burritos $10.99: ten piece, $44.99: fifty piece Pick-up ONLY, no delivery for Taco.65 Beverages Gallon Lemonade $10.50 Gallon Strawberry Lemonade Mixer $10.50 Six-pack Soda $4.50 Bottled Water

  17. An investigation of the bearing capacity of footings under eccentric and inclined loading on sand in a geotechnical centrifuge

    E-Print Network [OSTI]

    James, R.G.; Tanaka, H.

    1984-01-01T23:59:59.000Z

    The application of centrifuge modelling to geotechnicalADVANCES IN GEOTECHNICAL CENTRIFUGE MODELING A symposium onAdvances in Geotechnical Centrifuge Modeling was held on

  18. Low magnitude high frequency vibrations applied to the foot through the pedal of a human powered artificial gravity (HPAG) cycle

    E-Print Network [OSTI]

    Webster, Bruce Naakaii Ts'oh

    2006-01-01T23:59:59.000Z

    Astronauts are exposed to hazards unique to space travel. These hazards include radiation exposure and adaptation of the human body to the microgravity environment. For lunar and low earth orbital missions, the exposure ...

  19. Ecological evaluation of proposed discharge of dredged material from Oakland Harbor into ocean waters (Phase 2 of -42-foot project)

    SciTech Connect (OSTI)

    Word, J.Q.; Ward, J.A.; Strand, J.A.; Kohn, N.P.; Squires, A.L. (Battelle Marine Research Lab., Sequim, WA (USA))

    1990-09-01T23:59:59.000Z

    The US Army Corps of Engineers (USACE), San Francisco District, was authorized by the Water Resources Development Act of 1986 to deepen and widen the navigation channels of Inner and Outer Oakland Harbor, California, to accommodate modern deep-draft vessels. The recommended plan consists of deepening the harbor channels from the presently authorized water depth of {minus}35 ft mean lower low water (MLLW) to {minus}42 ft MLLW and supplying the harbor with adequate turning basins and berthing areas. Offshore ocean disposal of the dredged sediment is being considered, provided there is no evident of harmful ecological effects. It harmful ecological effects are not evident then the appropriate certifications from state environmental quality agencies and concurrence from the Environmental Protection Agency can be obtained to allow disposal of sediment. To help provide the scientific basis for determining whether Oakland Harbor sediments are suitable for offshore disposal, the Battelle/Marine Sciences Laboratory (MSL) collected sediment cores from 23 stations in Inner and Outer Oakland Harbor, evaluated these sediment cores geologically, performed chemical analyses for selected contaminants in sediments, conducted a series of solid phase toxicity tests with four sensitive marine invertebrates and assessed the bioaccumulation potential of sediment-associated contaminants in the tissues of Macoma Nasuta. 43 refs., 26 figs., 61 tabs.

  20. Interactions of foot-and-mouth disease virus with cells in organised lymphoid tissue influence innate and adaptive immune responses 

    E-Print Network [OSTI]

    Juleff, Nicholas Dylan

    2009-01-01T23:59:59.000Z

    to that in the controls, including rapid isotype switching to IgG antibody. These data suggest that antibody responses to sites on the surface of the virus capsid are T cell-independent whereas those directed against the non-structural proteins are T cell-dependent. CD4...

  1. Special Problem for Chapter 4: Compare the Lower Heating Values of different fuel gases per Standard Cubic Foot, recalling that

    E-Print Network [OSTI]

    2 + 3.76N2) - 1H2Ovapor + 1.88N2 0 = 1 lbmolH2 O lbmolfuel � 18.016 lbmH2 O lbmolH2 O µ -5774.6 BTU lbmH2 0 ¶ + Qout 0 = -104040 BTU/lbmolfuel + Qout Qout = 104040 BTU/lbmolfuel = 51607 BTU/lbmfuel = 266 BTU/ft3 fuel [274 BTU/SCF] For 16.043 lbm of Methane CH4 + 2 (O2 + 3.76N2) - 2H2O + CO2 + 7.52N2

  2. Microsoft Word - Chemetall Foote_Kings Mountain and Silver Peak Final EA 9-15-10-1 _3_

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE SWPAURTeC:8 3.After-Hours PolicycalciumDOE 27-15

  3. Forty-Six-Foot Tall Needle Sculpture Rises Over Arts Quad > EMC2 News > The

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8,Dist.Newof Energy Forrestal Garage Parking Procedures,

  4. ADDENDUM #1A ABOUT LSI SUPPORT SERVICES

    E-Print Network [OSTI]

    Mann, Tim

    . In an ongoing effort to support LS-DOS 6.3.x LSI will from time to time issue a revision statement. You may, in most cases, make the revisions yourself or you may send your MASTER disk in for updating. LSI has categorized revisions to fall into two categories. These consist of CRITICAL REVISIONS and NON

  5. 1 A LOGIC FOR PROGRAMMING DATABASE TRANSACTIONS

    E-Print Network [OSTI]

    Bonner, Anthony

    propose an extension of classical predicate calculus, called Transaction Logic, which provides a logical updates. Fi­ nally, Transaction Logic holds promise as a logical model of hitherto non­logical phenomena Transaction Logic, including a natural model theory; (ii) we show that this logic has a ``Horn'' fragment

  6. 1 A LOGIC FOR PROGRAMMING DATABASE TRANSACTIONS

    E-Print Network [OSTI]

    Bonner, Anthony

    propose an extension of classical predicate calculus, called Transaction Logic, which provides a logical updates. Fi- nally, Transaction Logic holds promise as a logical model of hitherto non-logical phenomena a natural model theory; ii we show that this logic has a Horn" fragment, with both a procedural

  7. in this issue 1 A Systems Take

    E-Print Network [OSTI]

    Gabrieli, John

    of the MIT International Science and Technology Initiatives­Japan (MISTI­Japan). After submitting a marketing International Science and Technology Initiatives­Japan (MISTI­Japan); Patricia Gercik, managing director culture affects consumers Last spring, All Nippon Airlines (ANA), a leading Japanese airline and the 2007

  8. GESTUREBASED PROGRAMMING, PART 1: A MULTIAGENT APPROACH

    E-Print Network [OSTI]

    programming environments like Chimera/Onika (Stewart et al, 1993)(Gertz, 1994) and commercial packages

  9. 1 A selection of Technical Publications produced

    E-Print Network [OSTI]

    below are published for the Forestry Commission by Policy and Practice Division. New titles are listed. Simmons*. 33 Forest condition 1999, by D. Redfern, R. Boswell and J. Proudfoot. 34 An introduction to new Information and Advisory Note 115) Armstrong, H.M. and Robertson, A. (2000) Energetics of free-ranging large

  10. Microsoft Word - 4CO 11 1a

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    spectrum. Also, we only used short term data from a single climate (high desert). Future work will include analyses using fixed tilt module IV data, take advantage of new...

  11. Fig. 1 A 1 2 Conductance

    E-Print Network [OSTI]

    Hasegawa, Shuji

    were direct electrical conductivity measurements with monolithic microscopic four-point probes and four. The probe spacing (a side of the square) was 60 µm. Experimental data are fitted by a function described of monolithic MFPP measurements with 8-µm spacing probes (A) on a step-bunching region and (B) a step-free re

  12. Phase 1: A Compilation of Options

    E-Print Network [OSTI]

    California Green

    2008-01-01T23:59:59.000Z

    Every week, news headlines report on toxic substances discovered in consumer products. The public assumes that the government tests products for chemical safety, but that is not true for most items. We know little about how the thousands of industrial chemicals in use today affect people and the

  13. 1. . (a), (b) (n = 10) / . (c) (d)

    E-Print Network [OSTI]

    Park, Namkyoo

    -near-zero media", Phys. Rev. B 75, 075119 (2007). 3. X Huang, Y. Lai, Z. H. Hang, H. Zheng and C. T. Chan, "Dirac Materials 10, 582 (2011). 4. Q. Cheng, R. Liu, D. Huang, T. J. Cui, and D. R. Smith, "Circuit verification

  14. Is Her X-1 a strange star?

    E-Print Network [OSTI]

    Jes Madsen

    1996-01-23T23:59:59.000Z

    The possible identification of Her X-1 with a strange star (Li et al. 1995) is shown to be incorrect.

  15. DOE O 442.1A

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsNovember 13, 2014ContributingDOE Contract DOE Internationalwith 17

  16. Microsoft Word - 4CO 11 1a

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE SWPAURTeC: 215362227/15/13x4-A Bonds andOUTDOOR

  17. Climate Zone 1A | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model, clickInformation SmyrnaNewClayClearSpotYork:Trust Jump to: navigation,type

  18. EPA Mobile Source Enforcement Memo 1A

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageStationGreenhouse GasCalifornia State0 Cleanr

  19. Mobile Source Enforcement Memorandum No. 1a

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageStationGreenhouse GasCalifornia State0ButtonWeb site The

  20. UNIVERSITY OF HOUSTON SYSTEM Board of Regents Meeting

    E-Print Network [OSTI]

    Azevedo, Ricardo

    to convey FCMP- 1 a ten foot wide perpetual easement to CenterPoint Energy Resources Corp. -- University Broadcasting Services -- University of F&A-3 Houston Action: Approval H. Review and Approval of Audit Report and Financial Statements, AUDIT-i University of Houston Charter School, FY 2010-- University of Houston System