Sample records for foot decade year-0

  1. Decades of Discovery

    DOE R&D Accomplishments [OSTI]

    2011-06-01T23:59:59.000Z

    For the past two-and-a-half decades, the Office of Science at the U.S. Department of Energy has been at the forefront of scientific discovery. Over 100 important discoveries supported by the Office of Science are represented in this document.

  2. Foote Hydroelectric Plant spillway rehabilitation

    SciTech Connect (OSTI)

    Sowers, D.L. [Consumers Power Co., Jackson, MI (United States); Hasan, N.; Gertler, L.R. [Raytheon Infrastructures Services, New York, NY (United States)

    1996-10-01T23:59:59.000Z

    In 1993 the spillway of the 9 MW Foote Hydroelectric Plant located on the AuSable River, near Oscoda, Michigan was rehabilitated. The Foote Plant, built in 1917, is owned and operated by Consumers Power Company. In the 76 years of continuous operation the spillway had deteriorated such that much of the concrete and associated structure needed to be replaced to assure safety of the structure. The hydro station includes an earth embankment with concrete corewall, a concrete spillway with three tainter gates and a log chute, a penstock structure and a steel and masonry powerhouse. The electric generation is by three vertical shaft units of 3,000 KW each. A plan of the plant with spillway and an elevation of the spillway section is shown. This paper describes the evaluation and repair of the plant spillway and associated structure.

  3. Weigh-in-motion scale with foot alignment features

    DOE Patents [OSTI]

    Abercrombie, Robert Knox; Richardson, Gregory David; Scudiere, Matthew Bligh

    2013-03-05T23:59:59.000Z

    A pad is disclosed for use in a weighing system for weighing a load. The pad includes a weighing platform, load cells, and foot members. Improvements to the pad reduce or substantially eliminate rotation of one or more of the corner foot members. A flexible foot strap disposed between the corner foot members reduces rotation of the respective foot members about vertical axes through the corner foot members and couples the corner foot members such that rotation of one corner foot member results in substantially the same amount of rotation of the other corner foot member. In a strapless variant one or more fasteners prevents substantially all rotation of a foot member. In a diagonal variant, a foot strap extends between a corner foot member and the weighing platform to reduce rotation of the foot member about a vertical axis through the corner foot member.

  4. GreenFoot Technologies | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, search OpenEI ReferenceJump to: navigation,IISrl Jump to:GreenFoot Technologies

  5. SmallFoot LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-f < RAPID‎ |RippeyInformation SlimSlough Heat andSmallFoot LLC Jump

  6. Brad Foote Gear Works | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof Energy 2,AUDIT REPORT Americium/CuriumAguaBBBWind- GeradoraBorealBrad Foote Gear

  7. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    parasitism and extra-pair paternity in blue- footed boobies.Microsatellites Á SSRs Á Blue-footed booby Á Sula nebouxii Ámicrosatellite loci from blue-footed boobies (Sula nebouxii)

  8. U.S. Total Consumption of Heat Content of Natural Gas (BTU per Cubic Foot)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 34 44Year Jan Feb MarDecade Year-0Sales (Billion CubicConsumption

  9. A Universal AnkleFoot Prosthesis Emulator for Human Locomotion

    E-Print Network [OSTI]

    Collins, Steven H.

    A Universal Ankle­Foot Prosthesis Emulator for Human Locomotion Experiments Joshua M. Caputo of functions. Here we describe a robotic ankle­foot prosthesis system that enables rapid exploration of a wide-board motor and con- trol hardware, a flexible Bowden cable tether, and a lightweight instrumented prosthesis

  10. Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs

    E-Print Network [OSTI]

    Sitti, Metin

    Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing Dept -- This paper proposes two different nanomolding methods to fabricate synthetic gecko foot-hair nanostructures a nano-pore membrane as a template. These templates are molded with silicone rubber, polyimide

  11. Department of Mechanical Engineering Fall 2012 The Jaipur Foot

    E-Print Network [OSTI]

    Demirel, Melik C.

    for the Jaipur Foot and in compliance with the International Organization for Standardization (ISO) standard Foot in compliance with ISO Standard 10328. Approach Gathered customer needs from sponsor Established target specifications from customer needs into measurable metrics Reviewed ISO Standard 10328

  12. Planipes: Mobile Foot Pressure Analysis Samuel Pfaffen, Philipp Sommer, Christian Stocker, Roger Wattenhofer, and Samuel Welten

    E-Print Network [OSTI]

    Planipes: Mobile Foot Pressure Analysis Samuel Pfaffen, Philipp Sommer, Christian Stocker, Roger, sommer, chstocke, wattenhofer, welten}@tik.ee.ethz.ch Abstract Analyzing foot pressure is helpful

  13. Distributed Explosive-Driven Six-foot Diameter by Two-Hundred Foot Long Shock Tubes

    SciTech Connect (OSTI)

    VIGIL, MANUEL G.

    2002-02-01T23:59:59.000Z

    The blast parameters for the 6-foot diameter by 200-foot long, explosively driven shock tube are presented in this report. The purpose, main characteristics, and blast simulation capabilities of this PETN Primacord, explosively driven facility are included. Experimental data are presented for air and Sulfurhexaflouride (SF6) test gases with initial pressures between 0.5 to 12.1 psia (ambient). Experimental data are presented and include shock wave time of amval at various test stations, flow duration, static or side-on overpressure, and stagnation or head-on overpressure. The blast parameters calculated from the above measured parameters and presented in this report include shock wave velocity, shock strength, shock Mach number, flow Mach Number, reflected pressure, dynamic pressure, particle velocity, density, and temperature. Graphical data for the above parameters are included. Algorithms and least squares fit equations are also included.

  14. U.S. crude oil production in July was the highest in more than two decades

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade Year-0E (2001) -heatingintensityArea: U.S. East Coast (PADDU.S.crude

  15. Decadal changes in the equatorial Pacific circulation

    E-Print Network [OSTI]

    Urizar, S. Cristina

    2002-01-01T23:59:59.000Z

    An ocean general circulation model with data assimilation is used to analyze the decadal changes in the tropical Pacific Ocean circulation. Results indicate that the variability in the Equatorial Undercurrent (EUC) and subtropical cells (STC) have...

  16. Highlights from NNSA's Decade of Success

    ScienceCinema (OSTI)

    None

    2010-09-01T23:59:59.000Z

    On April 28, 2010, the National Nuclear Security Administration celebrated its 10-year anniversary with a series of events aimed at highlighting a decade of success across the nuclear security enterprise. This slideshow features images from the past 10 years.

  17. Elements of tropical Pacific decadal variability

    E-Print Network [OSTI]

    Fuckar, Neven-Stjepan

    2003-01-01T23:59:59.000Z

    of the period from 1965 to 1999. Model results show Pacific basin decadal changes, including the prominent 1976-77 climate shift, in agreement with previous research. The reanalysis indicates an evolution intrinsic to the tropical Pacific which propagates...

  18. Chamber transport of "foot" pulses for heavy-ion fusion

    E-Print Network [OSTI]

    Sharp, W.M.; Callahan-Miller, D.A.; Tabak, M.; Yu, S.S.; Peterson, P.F.

    2002-01-01T23:59:59.000Z

    Neutralization on Heavy-Ion-Fusion Chamber Transport," to beChamber transport of "foot" pulses for heavy-ion fusion W.chamber-transport effectiveness is the fraction of enclosed beam ions

  19. Powered Ankle–Foot Prosthesis Improves Walking Metabolic Economy

    E-Print Network [OSTI]

    Au, Samuel K.

    At moderate to fast walking speeds, the human ankle provides net positive work at high-mechanical-power output to propel the body upward and forward during the stance period. On the contrary, conventional ankle-foot ...

  20. The effect of foot conditions on constrained standing

    E-Print Network [OSTI]

    Barlow, Jessica Marie

    1996-01-01T23:59:59.000Z

    This study was conducted to find any differences in physiological effects, subjective rankings, or discomfort with respect to foot conditions in constrained standing. Eight healthy subjects, four female and four male, stood using four different...

  1. Mag-Foot: a steel bridge inspection robot

    E-Print Network [OSTI]

    Asada, Harry

    A legged robot that moves across a steel structure is developed for steel bridge inspection. Powerful permanent magnets imbedded in each foot allow the robot to hang from a steel ceiling powerlessly. Although the magnets ...

  2. ankle foot orthoses: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  3. ankle foot orthosis: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  4. A study conducted on laterally loaded cylindrical footings

    E-Print Network [OSTI]

    Koch, Kenneth Joseph

    1968-01-01T23:59:59.000Z

    A STUDY CONDUCTED ON LATERALLY LOADED CYLINDRICAL FOOTINGS A Thesis by Kenneth Joseph Koch Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree oi MASTER OF SCIENCE May 1968... Major Subject Civil Engineering A STUDY CONDUCTED ON LATERALLY LOADED CYLINDRICAL FOOTINGS A Thesis by Kenneth Joseph Koch Approved as to style and content by (Chairman of Committee) (Head of Department) (Member) (M ber) May 1968...

  5. Design and evaluation of a cantilever beam-type prosthetic foot for Indian persons with amputations

    E-Print Network [OSTI]

    Olesnavage, Kathryn M

    2014-01-01T23:59:59.000Z

    The goal of this work is to design a low cost, high performance prosthetic foot in collaboration with Bhagwan Mahaveer Viklang Sahayata Samiti (BMVSS), in Jaipur, India. In order to be adopted, the foot must cost less than ...

  6. Effects of different restrained foot positions on hand force exertion capability-implications for microgravity operations

    E-Print Network [OSTI]

    Whalen, Scott Allan

    1997-01-01T23:59:59.000Z

    An experiment was conducted to determine restrained foot positions that increase hand force exertion capability (HFEC) over that available under the existing restrained foot position utilized by NASA astronauts during Extra Vehicular Activity (EVA...

  7. A Decade of Population Change in Texas.

    E-Print Network [OSTI]

    Skrabanek, R. L.

    1963-01-01T23:59:59.000Z

    of community facilities. The political representation of rural dwellers is also likely to be reduced. 3. In 1960, for the first time in history, Texas had more females than males. The projected sex ratio is 96.7 males per 100 females in 1970. At the same... of the Panhandle and extending southward beyond Abilene. This area sustained a decline of one-third in rural population during the decade. Only 2 of the 29 counties (Cottle and Donley) in area 6 had an increase in rural population. Another section, state...

  8. The next decade in external dosimetry

    SciTech Connect (OSTI)

    Griffith, R.V.

    1986-10-01T23:59:59.000Z

    As the radiation protection community moves through the last half of the '80s and into the next decade, we can expect the requirements for external dosimetry to become increasingly more restrictive and demanding. As in other health protection fields, growing regulatory and legal pressures, together with a natural evolution in philosophy, require the health physicist to display an increasing degree of accountability, rigor, and professionalism. The good news is that, for the most part, the technology necessary to solve many of the problems will be available or not far behind. This paper describes anticipated technology. 66 refs., 10 figs.

  9. Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy

    E-Print Network [OSTI]

    Herr, Hugh

    Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy by Samuel Kwok-Wai Au LIBRARIES #12;#12;Powered Ankle-Foot Prosthesis for the Improvement of Amputee Walking Economy by Samuel in walking. This objective of this thesis is to evaluate the hypothesis that a powered ankle- foot prosthesis

  10. Load tests on five large spread footings on sand and evaluation of prediction methods

    E-Print Network [OSTI]

    Gibbens, Robert Melvin

    1995-01-01T23:59:59.000Z

    for the engineering profession's lack of trust in the use of spread footings. For this study, five spread footings with sizes ranging from I to 3 m square were load tested to 150 mm of penetration. The footings were all constructed and tested in a similar manner...

  11. Prediction of sinkage depth of footings on soft marine sediments

    E-Print Network [OSTI]

    Yen, Shihchieh

    1990-01-01T23:59:59.000Z

    Tempsonics Transducer? Channels ? Hgdraulic Actuator I rB I :: Mud Tank::. : Guide Rod- Clamp? ? Ram ? Load Transducer ~ Model Footing Detailed Sketch of B Figure 2. Schematic (Side View) of Displacement Controlled Test Set-up. second... generalized bearing capacity factor, versus Z/B. Typical results are presented in Figures 16, 17, 18, 19, and 20. Plots of all analyzed test data are presented in Appendix I. 41 5 G 4 V/S = IKS V/B = OPS 0 0 Figure 16. Analyzed Data for 1-inch...

  12. A study conducted on laterally loaded cylindrical footings 

    E-Print Network [OSTI]

    Koch, Kenneth Joseph

    1968-01-01T23:59:59.000Z

    studies have also been used to analyze the resistance (g) to overturning. R. C. Rutledge developed a nomograph that can be used to find the depth of embedment necessary to withstand applied loads. The chart is based on the results of a series of full... as compared to the diameters of concrete footings of comparable depth. Full-scale test results have also been reported by F. E. Behn( and by Nelson, Nahoney and Fryrear 10) Theory by Reese L. C. Reese studied the ultimate resistance againsr. a rigid (11...

  13. Prediction of sinkage depth of footings on soft marine sediments 

    E-Print Network [OSTI]

    Yen, Shihchieh

    1990-01-01T23:59:59.000Z

    91. 0 91. 0 91. 2 90. 9 90. 9 90. 9 90. 4 90. 6 90. 3 90. 8 91. 5 91. 4 91. 0 91. 3 Su was determined by a miniature vane rotating at 0. 0143 radians per second 30 Table 4. Soil Properties for 4-inch Diameter Footing Tests V/B Dia.... 7 0. 008 105. 7 34. 7 90. 9 103. 9 40. 0 91. 3 * Su was determined by a miniature vane rotating at 0. 0143 radians per second. one of these tests is shown in Figure 12. In comparison to the dead weight test results (Figure 13), the load versus...

  14. 'Insights of the Decade' Enabled by NERSC - NERSC Center News...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ever more powerful and more affordable computers. No field has benefited more than genomics. A decade ago, sequencing a human genome took years, hundreds of people, hundreds of...

  15. astro2010 decadal survey: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    with GRBs: A White Paper for the Astro2010 Decadal Survey CERN Preprints Summary: Gamma-ray Bursts (GRBs) are relativistic cosmological beacons of transient high energy radiation...

  16. Dual Predictive Control of Electrically Stimulated Muscle using Biofeedback for Drop Foot Correction

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    artificially generate action potential in the place of central nervous system (CNS) for inducing muscle) is one of the solutions for drop foot correction. Conventional ES systems deliver prede- fined to adequately dorsiflex or lift the foot. It is associated with a variety of conditions such as stroke, spinal

  17. Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate, Germany

    E-Print Network [OSTI]

    Kammer, Thomas

    Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate.W. 2013: Tube foot preservation in the Devonian crinoid Codiacrinus from the Lower Devonian Hunsruck Slate Follmann from the Lower Devonian Hunsruck Slate of Germany. This is the first definitive proof of tube feet

  18. An Ankle-Foot Emulation System for the Study of Human Walking Biomechanics

    E-Print Network [OSTI]

    Herr, Hugh

    and a prosthesis is one of the main obstacles in the development of a biomimetic ankle-foot prosthesis that the emulator may provide a more natural gait than a conventional passive prosthesis. Index Terms ­ Below-knee prosthesis, biomechanics, force control, biomimetic, ankle-foot emulator I. INTRODUCTION Although

  19. An Ankle-Foot Prosthesis Emulator with Control of Plantarflexion and Inversion-Eversion Torques

    E-Print Network [OSTI]

    Collins, Steven H.

    An Ankle-Foot Prosthesis Emulator with Control of Plantarflexion and Inversion-Eversion Torques-foot prosthesis with two independently-actuated toes that are coordinated to provide plantarflexion and inversion prosthesis features. A similar morphology may be effective for autonomous devices. I. INTRODUCTION Robotic

  20. Development of a three-dimensional finite element model of a horse's foot

    E-Print Network [OSTI]

    Hanft, Joseph Thomas

    1995-01-01T23:59:59.000Z

    The horse's foot, defined as the hoof wall and all the structures within it, is subjected to intense load-bearing and energy-absorbing demands. The foot is actually a complex assembly of components that deform as they support loads and absorb energy...

  1. Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing

    E-Print Network [OSTI]

    Fearing, Ron

    Nanomolding Based Fabrication of Synthetic Gecko Foot-Hairs Metin Sitti and Ronald S. Fearing Dept- This paper proposes two different nanomolding methods to fabricate synthetic gecko foot-hair nanostructures a nano-pore membrane as a template. These templates are molded with silicone rubber, polyamide

  2. Volume 10, No. 1 Decade of the Brain

    E-Print Network [OSTI]

    Dolbow, John

    Winter 2014 Volume 10, No. 1 SHINING A LIGHT ON BRAIN INJURY Decade of the Brain #12;ALSO of traumatic brain injury in children 14 "Hypoxia in a box" may reveal hidden concussion damage 18 Diabetes Clark, MSN'11, builds hope and health in Uganda Decade of the BRAIN #12;From 1990 through 2000, the U

  3. IEEE Robotics & Automation Magazine52 1070-9932/08/$25.002008 IEEE SEPTEMBER 2008 Ankle-Foot Prosthesis

    E-Print Network [OSTI]

    Herr, Hugh

    -Foot Prosthesis T he loss of a limb is a major disability. Unfortunately, today's prosthetic technol- ogy prosthesis [15], [19], [20]. With current actuator technology, it is challenging to build an ankle-foot prosthesis that matches the size and weight of the human ankle-foot complex but still provides sufficient

  4. Summary report on four foot septifoil cooling experiment

    SciTech Connect (OSTI)

    Randolph, H.W.; Collins, S.L.; Verebelyi, D.T.; Foti, D.J.

    1991-10-01T23:59:59.000Z

    Cooling parameters for some of the SRS reactor internal components are computed using the Transient Reactor Analysis Code, TRAC.'' In order to benchmark the code, the Safety Analysis Group of SRL requested an experiment to provide measurements of cooling parameters in a well defined physical system utilizing SRS reactor component(s). The experiment selected included a short length of septifoil with both top and bottom fittings containing five simulated control rods in an unseated'' configuration. Power level to be supplied to the rods was targeted at 2.5 kilowatts per foot. The septifoil segment was to be operated with no forced flow in order to evaluate thermal-hydraulic cooling. Parameters to be measured for comparison with code predictions were basic cooling phenomena, incidence of film boiling, thermal-hydraulic flow rate, pressure rise, and ratio of heat transfer through the wall of the assembly vs heat transfer to axial water flow through the assembly. Experimental apparatus was designed and assembled incorporating five simulated control rods four feet long, joule heated inside a five foot length of type Q'' septifoil. Water at 70 C was fed independently to the bottom inlet and along the outside of the septifoil. Water flowing along the outside of the septifoil was in confined flow and provided calorimetry to measure power flow through the septifoil housing. A shadowgraph technique was developed and used to monitor unforced flow of water pumped thermal-hydraulically through the septifoil. Electrical power of 10,000 to 70,000 watts was fed to the simulated rods from a dc power supply. Computer data acquisition was accomplished using LabView'' software programmed to match the configuration of the experiment along with scanning digital voltmeters and requisite signal sensors. Video camcorders were used to provide video records of six areas of the experiment.

  5. Summary report on four foot septifoil cooling experiment

    SciTech Connect (OSTI)

    Randolph, H.W.; Collins, S.L.; Verebelyi, D.T.; Foti, D.J.

    1991-10-01T23:59:59.000Z

    Cooling parameters for some of the SRS reactor internal components are computed using the Transient Reactor Analysis Code, ``TRAC.`` In order to benchmark the code, the Safety Analysis Group of SRL requested an experiment to provide measurements of cooling parameters in a well defined physical system utilizing SRS reactor component(s). The experiment selected included a short length of septifoil with both top and bottom fittings containing five simulated control rods in an ``unseated`` configuration. Power level to be supplied to the rods was targeted at 2.5 kilowatts per foot. The septifoil segment was to be operated with no forced flow in order to evaluate thermal-hydraulic cooling. Parameters to be measured for comparison with code predictions were basic cooling phenomena, incidence of film boiling, thermal-hydraulic flow rate, pressure rise, and ratio of heat transfer through the wall of the assembly vs heat transfer to axial water flow through the assembly. Experimental apparatus was designed and assembled incorporating five simulated control rods four feet long, joule heated inside a five foot length of type ``Q`` septifoil. Water at 70 C was fed independently to the bottom inlet and along the outside of the septifoil. Water flowing along the outside of the septifoil was in confined flow and provided calorimetry to measure power flow through the septifoil housing. A shadowgraph technique was developed and used to monitor unforced flow of water pumped thermal-hydraulically through the septifoil. Electrical power of 10,000 to 70,000 watts was fed to the simulated rods from a dc power supply. Computer data acquisition was accomplished using ``LabView`` software programmed to match the configuration of the experiment along with scanning digital voltmeters and requisite signal sensors. Video camcorders were used to provide video records of six areas of the experiment.

  6. Y-12 and the 2000 decade ? infrastructure reduction continued

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2000 decade, there were several major changes that took place. A new contractor, BWXT Y-12 (now B&W Y-12) took charge in November, 2000, and quickly became engaged in the many...

  7. Powered Ankle-Foot Prosthesis for the Improvement of Amputee Samuel K. Au, Hugh Herr, Jeff Weber, and Ernesto C. Martinez-Villalpando

    E-Print Network [OSTI]

    Herr, Hugh

    Powered Ankle-Foot Prosthesis for the Improvement of Amputee Ambulation Samuel K. Au, Hugh Herr, control scheme, and clinical evaluation of a novel, motorized ankle-foot prosthesis, called MIT Powered Ankle-Foot Prosthesis. Unlike a conventional passive-elastic ankle-foot prosthesis, this prosthesis can

  8. Powered ankle-foot prosthesis for the improvement of amputee walking economy

    E-Print Network [OSTI]

    Au, Samuel Kwok-Wai

    2007-01-01T23:59:59.000Z

    The human ankle provides a significant amount of net positive work during the stance period of walking, especially at moderate to fast walking speeds. On the contrary, conventional ankle-foot prostheses are completely ...

  9. Estimation of ground reaction force and zero moment point on a powered ankle-foot prosthesis

    E-Print Network [OSTI]

    Martinez Villalpando, Ernesto Carlos

    2006-01-01T23:59:59.000Z

    Commercially available ankle-foot prostheses are passive when in contact with the ground surface, and thus, their mechanical properties remain fixed across different terrains and walking speeds. The passive nature of these ...

  10. Informing Ankle-Foot Prosthesis Prescription through Haptic Emulation of Candidate Devices

    E-Print Network [OSTI]

    Collins, Steven H.

    Informing Ankle-Foot Prosthesis Prescription through Haptic Emulation of Candidate Devices Joshua M using a haptic prosthesis emulator while their walking performance is quantitatively assessed and results are distilled to inform device prescription. In this emulator system, prosthesis behavior

  11. Control of a Powered Ankle–Foot Prosthesis Based on a Neuromuscular Model

    E-Print Network [OSTI]

    Geyer, Hartmut

    Control schemes for powered ankle-foot prostheses rely upon fixed torque-ankle state relationships obtained from measurements of intact humans walking at target speeds and across known terrains. Although effective at their ...

  12. A neuromuscular-model based control strategy for powered ankle-foot prostheses

    E-Print Network [OSTI]

    Eilenberg, Michael Frederick

    2009-01-01T23:59:59.000Z

    In the development of a powered ankle-foot prosthesis, it is desirable to provide the prosthesis with the ability to exhibit human-like dynamics. A simple method for achieving this goal involves trajectory tracking, where ...

  13. asian foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  14. attenuated foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  15. assess foot-and-mouth disease: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Websites Summary: Modelling the spread of foot-and-mouth disease virus F Moutou B Durand CNEVA, Laboratoire Central-and-mouth disease is an economically important viral...

  16. Evaluation of the Franz System Foot Control in a simulated adaptive tracking task

    E-Print Network [OSTI]

    Raab, Charles

    1982-01-01T23:59:59.000Z

    EVALUATION OF THE FRANZ SYSTEM FOOT CONTROL IN A SIMULATED ADAPTIVE TRACKING TASK A Thesis by CHARLES RAAB Submitted to the Graduate College of Texas ASM University in partial fulfillment of the requirement for the degree of MASTER... OF SCIENCE May 1982 Major Subject: Industrial Engineering EVALUATION OF THE FRANZ SYSTEM FOOT CONTROL IN A SIMULATED ADAPTIVE TRACKING TASK A Thesis by CHARLES RAAB Approved as to style and content by: (Chairman of Com ttee) (Member) (Member...

  17. EGS4 in `94: A decade of enhancements

    SciTech Connect (OSTI)

    Nelson, W.R. [Stanford Univ., CA (United States); Bielajew, A.F.; Rogers, D.W.O. [National Research Council of Canada, Ottawa (Canada). Institute for National Measurement Standards; Hirayama, H. [National Lab. for High Energy Physics, Ibaraki-ken (Japan)

    1994-08-18T23:59:59.000Z

    This paper presents an overview of the developments made to the EGS4 code over the past decade. This code is a Monte Carlo code developed to study electron-photon transport properties. It is widely used, in particular in the medical physics field, it has been updated, expanded, benchmarked, and applied to a wide array of problems. The paper covers precursors to this code, a basic snapshop of its physics and calculation methods, and an overview of how it has been expanded during the past decade.

  18. A decade of acoustic thermometry in the North Pacific Ocean

    E-Print Network [OSTI]

    Frandsen, Jannette B.

    A decade of acoustic thermometry in the North Pacific Ocean B. D. Dushaw,1 P. F. Worcester,2 W. H of acoustic thermometry in the North Pacific Ocean, J. Geophys. Res., 114, C07021, doi:10.1029/2008JC005124. 1 of basin-scale heat content in the northeast Pacific Ocean were made using a broadband 133-Hz source

  19. SHAPE YOUR FUTURE For six decades, Carleton University's School

    E-Print Network [OSTI]

    Dawson, Jeff W.

    IMMIGRATION DEMOGRAPHICS ENERGY EVALUATION TRADE #12;School of Public Policy and Administration 5224 RiverSHAPE YOUR FUTURE For six decades, Carleton University's School of Public Policy and Administration and administration -- examining what governments do, why, and how they could do it better. Our two major graduate

  20. Nonlinear optics: The next decade Yuri S. Kivshar

    E-Print Network [OSTI]

    Nonlinear optics: The next decade Yuri S. Kivshar Center for Ultra-high bandwidth Devices for Optical Systems (CUDOS), Nonlinear Physics Center, Research School of Physical Sciences and Engineering assembled of invited papers in key areas of nonlinear optics (Editors: J.M. Dudley and R.W. Boyd

  1. The MSR Cookbook Mining a Decade of Research

    E-Print Network [OSTI]

    Godfrey, Michael W.

    The MSR Cookbook Mining a Decade of Research Hadi Hemmati, Sarah Nadi, Olga Baysal, Oleksii Kononenko, Wei Wang, Reid Holmes, Michael W. Godfrey Software Architecture Group David R. Cheriton School, migod}@uwaterloo.ca Abstract--The Mining Software Repositories (MSR) research community has grown

  2. DECADE IN REVIEW BIOCHEmISTRy & BIOmEDICAL SCIENCES

    E-Print Network [OSTI]

    Hitchcock, Adam P.

    programs worthy of the new millennium. She advanced a sophisticated and energetic agenda for change'S WELCOME ERIC BROWN It seems like just yesterday we were waiting with anticipa- tion for arrival of the new the last decade has been in new faculty, especially young faculty. In 2000 there were only 3 Assistant

  3. NASA Earth Science Technology Office (ESTO) Decadal Survey Technology Investments

    E-Print Network [OSTI]

    Christian, Eric

    investments · Risks are retired before major dollars are invested: a cost-effective approach to technologyNASA Earth Science Technology Office (ESTO) Decadal Survey Technology Investments January 7, 2009 #12;Overview: Earth Science Technology Office Science Driven, Competed, Actively Managed

  4. A Decade of On-road Emissions Measurements

    E-Print Network [OSTI]

    Denver, University of

    A Decade of On-road Emissions Measurements G A R Y A . B I S H O P * A N D D O N A L D H . S T E D. A multiyear, on-road emission measurement program carried outinthecitiesofChicago,Illinois;Denver,Colorado;LosAngeles (LA), California; and Phoenix, Arizona shows large, fuel- specific tailpipe emissions reductions

  5. Over the past decade we have been experiencing

    E-Print Network [OSTI]

    Over the past decade we have been experiencing a quiet revolution in the development of trace gas) and stable calibrations to detect the natural range of small and large methane fluxes (5 to 500 nmol m-2 s-1 and Christenson, Denmark/ Sweden; Baldocchi et al., California). An informal poll of the FLUXNET com- munity

  6. HYBRID DECADE-MEAN GLOBAL SEA LEVEL WITH MESOSCALE RESOLUTION

    E-Print Network [OSTI]

    HYBRID DECADE-MEAN GLOBAL SEA LEVEL WITH MESOSCALE RESOLUTION Nikolai A. Maximenko1 and Pearn P of twin-satellite mission GRACE and mesoscale sea level tilt derived from the momentum balance as seen 55 #12;sea level exhibits excellent accuracy on mesoscale, but may contain significant systematic

  7. Evidence for neutrino mass: A decade of discovery

    SciTech Connect (OSTI)

    Heeger, Karsten M.

    2004-12-08T23:59:59.000Z

    Neutrino mass and mixing are amongst the major discoveries of recent years. From the observation of flavor change in solar and atmospheric neutrino experiments to the measurements of neutrino mixing with terrestrial neutrinos, recent experiments have provided consistent and compelling evidence for the mixing of massive neutrinos. The discoveries at Super-Kamiokande, SNO, and KamLAND have solved the long-standing solar neutrino problem and demand that we make the first significant revision of the Standard Model in decades. Searches for neutrinoless double-beta decay probe the particle nature of neutrinos and continue to place limits on the effective mass of the neutrino. Possible signs of neutrinoless double-beta decay will stimulate neutrino mass searches in the next decade and beyond. I review the recent discoveries in neutrino physics and the current evidence for massive neutrinos.

  8. Wide-Field Astronomical Surveys in the Next Decade

    SciTech Connect (OSTI)

    Strauss, Michael A.; /Princeton U.; Tyson, J.Anthony; /UC, Davis; Anderson, Scott F.; /Washington U., Seattle, Astron. Dept.; Axelrod, T.S.; /LSST Corp.; Becker, Andrew C.; /Washington U., Seattle, Astron. Dept.; Bickerton, Steven J.; /Princeton U.; Blanton, Michael R.; /New York U.; Burke, David L.; /SLAC; Condon, J.J.; /NRAO, Socorro; Connolly, A.J.; /Washington U., Seattle, Astron. Dept.; Cooray, Asantha R.; /UC, Irvine; Covey, Kevin R.; /Harvard U.; Csabai, Istvan; /Eotvos U.; Ferguson, Henry C.; /Baltimore, Space Telescope Sci.; Ivezic, Zeljko; /Washington U., Seattle, Astron. Dept.; Kantor, Jeffrey; /LSST Corp.; Kent, Stephen M.; /Fermilab; Knapp, G.R.; /Princeton U.; Myers, Steven T.; /NRAO, Socorro; Neilsen, Eric H., Jr.; /Fermilab; Nichol, Robert C.; /Portsmouth U., ICG /Harish-Chandra Res. Inst. /Caltech, IPAC /Potsdam, Max Planck Inst. /Harvard U. /Hawaii U. /UC, Berkeley, Astron. Dept. /Baltimore, Space Telescope Sci. /NOAO, Tucson /Carnegie Mellon U. /Chicago U., Astron. Astrophys. Ctr.

    2011-11-14T23:59:59.000Z

    Wide-angle surveys have been an engine for new discoveries throughout the modern history of astronomy, and have been among the most highly cited and scientifically productive observing facilities in recent years. This trend is likely to continue over the next decade, as many of the most important questions in astrophysics are best tackled with massive surveys, often in synergy with each other and in tandem with the more traditional observatories. We argue that these surveys are most productive and have the greatest impact when the data from the surveys are made public in a timely manner. The rise of the 'survey astronomer' is a substantial change in the demographics of our field; one of the most important challenges of the next decade is to find ways to recognize the intellectual contributions of those who work on the infrastructure of surveys (hardware, software, survey planning and operations, and databases/data distribution), and to make career paths to allow them to thrive.

  9. Muon Cooling and Future Muon Facilities: The Coming Decade

    E-Print Network [OSTI]

    Daniel M. Kaplan

    2009-10-21T23:59:59.000Z

    Muon colliders and neutrino factories are attractive options for future facilities aimed at achieving the highest lepton-antilepton collision energies and precision measurements of parameters of the neutrino mixing matrix. The performance and cost of these depend sensitively on how well a beam of muons can be cooled. Recent progress in muon cooling design studies and prototype tests nourishes the hope that such facilities can be built in the decade to come.

  10. Experimental study on hydrodynamic forces acting on an oscillating column with circular footing

    SciTech Connect (OSTI)

    Hoshino, Kunihiro; Sato, Hiroshi [Ministry of Transport, Mitaka (Japan). Ship Research Inst.

    1994-12-31T23:59:59.000Z

    This paper presents the results of an experimental investigation of the in-line and lift forces acting on an oscillating column with circular footing. Forced surging tests were carried out using a column with circular footing of which ratio of diameter was varied from 1.25 to 2.5. The in-line and lift force have been measured concerning both the whole model and the parts of column and footing. The drag coefficients, inertia coefficients, coefficients of root-mean-square values of the in-line force and lift force coefficients in the range of Keulegan Carpenter number from 5 to 30 have been obtained. Those results have been compared with that of a straight finite length circular cylinder.

  11. Multi-functional foot use during running in the zebra-tailed lizard (Callisaurus draconoides)

    E-Print Network [OSTI]

    Chen Li; S. Tonia Hsieh; Daniel I. Goldman

    2013-03-29T23:59:59.000Z

    A diversity of animals that run on solid, level, flat, non-slip surfaces appear to bounce on their legs; elastic elements in the limbs can store and return energy during each step. The mechanics and energetics of running in natural terrain, particularly on surfaces that can yield and flow under stress, is less understood. The zebra-tailed lizard (Callisaurus draconoides), a small desert generalist with a large, elongate, tendinous hind foot, runs rapidly across a variety of natural substrates. We use high speed video to obtain detailed three-dimensional running kinematics on solid and granular surfaces to reveal how leg, foot, and substrate mechanics contribute to its high locomotor performance. Running at ~10 body length/s (~1 m/s), the center of mass oscillates like a spring-mass system on both substrates, with only 15% reduction in stride length on the granular surface. On the solid surface, a strut-spring model of the hind limb reveals that the hind foot saves about 40% of the mechanical work needed per step, significant for the lizard's small size. On the granular surface, a penetration force model and hypothesized subsurface foot rotation indicates that the hind foot paddles through fluidized granular medium, and that the energy lost per step during irreversible deformation of the substrate does not differ from the reduction in the mechanical energy of the center of mass. The upper hind leg muscles must perform three times as much mechanical work on the granular surface as on the solid surface to compensate for the greater energy lost within the foot and to the substrate.

  12. A study of the design criteria for drilled-and-belled footings

    E-Print Network [OSTI]

    Lehmann, Clark Thomas

    1964-01-01T23:59:59.000Z

    A STUDY OF THE DESIGN CRITERIA FOR DRILLED?AND-BELLED FOOTINGS A Thesis Clark Thomas Lehmann Submitted to the Graduate College of Texas ARM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May, 1964... Major Subject: Civil Engineering A STUDY OF THE DESIGN CRITERIA FOR DRILLED-AND-BELLED FOOTINGS A Thesis By Clark Thomas Lehmann Approved as to style and content by: airman o ommittee Head ep tment Nay, 1964 4 0 0 N F 5 O ACKNOWLEDGMENTS...

  13. IEEE TRANSACTIONS ON ROBOTICS, VOL. 25, NO. 1, FEBRUARY 2009 51 Powered AnkleFoot Prosthesis Improves

    E-Print Network [OSTI]

    Herr, Hugh

    IEEE TRANSACTIONS ON ROBOTICS, VOL. 25, NO. 1, FEBRUARY 2009 51 Powered Ankle­Foot Prosthesis, we evaluate the hypothesis that a powered ankle­foot prosthesis, capa- ble of providing human to a conventional passive-elastic prosthesis. To test the hypothesis, a powered prosthesis is built that comprises

  14. Microsoft Word - WIPP Marks A Decade of Safe Disposal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE625 FINALOptimizationForArticle FORMarks a Decade

  15. Decades-long Mystery Solved | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration wouldDECOMPOSITION OFSupplementalC. L.Deadly CarcinogenDeborah S.Decades-long

  16. IMPEE PhD Opportunity Project title: LightFoot PhD A PhD Investigation Lightning Protection of HV Overhead Lines with Non-Ideal

    E-Print Network [OSTI]

    Greenaway, Alan

    IMPEE PhD Opportunity Project title: LightFoot PhD ­ A PhD Investigation Lightning Protection of HV.swingler@hw.ac.uk Abstract LightFoot PhD ­ A PhD Investigation Lightning Protection of HV Overhead Lines with Non-Ideal Tower Footing Resistance funded by SSE. The LightFoot PhD project takes a fresh approach at adding

  17. Driving Low-Power Wearable Systems with an Adaptively-Controlled Foot-Strike Scavenging Platform

    E-Print Network [OSTI]

    Potkonjak, Miodrag

    as a means to scavenge energy from foot-strikes and power wearable systems. While they exhibit large energy densities, DEs must be closely controlled to maximize the energy they transduce. Towards this end, we propose a DE micro-generator array configuration that enhances transduc- tion efficiency, and the use

  18. Flat-Foot Dynamic Walking via Human-Inspired Controller Design

    E-Print Network [OSTI]

    Ma, Wenlong

    2014-05-05T23:59:59.000Z

    This thesis describes a torque control scheme unifying feedback PD control and feed-forward impedance control to realize human-inspired walking on a novel planar footed bipedal robot: AMBER2. It starts with high fidelity modeling of the robot...

  19. A study of factors affecting foot movement time in a braking maneuver

    E-Print Network [OSTI]

    Berman, Andrea Helene

    1994-01-01T23:59:59.000Z

    The nature of foot movement time (MT) in an actual braking maneuver and in a stationary vehicle was investigated regarding the effects of age and gender of the driver and nature of the stimulus to which the driver was responding. ANOVAs showed...

  20. The high-foot implosion campaign on the National Ignition Facility

    SciTech Connect (OSTI)

    Hurricane, O. A., E-mail: hurricane1@llnl.gov; Callahan, D. A.; Casey, D. T.; Dewald, E. L.; Dittrich, T. R.; Döppner, T.; Barrios Garcia, M. A.; Hinkel, D. E.; Berzak Hopkins, L. F.; Kervin, P.; Pape, S. Le; Ma, T.; MacPhee, A. G.; Milovich, J. L.; Moody, J.; Pak, A. E.; Patel, P. K.; Park, H.-S.; Remington, B. A.; Robey, H. F. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); and others

    2014-05-15T23:59:59.000Z

    The “High-Foot” platform manipulates the laser pulse-shape coming from the National Ignition Facility laser to create an indirect drive 3-shock implosion that is significantly more robust against instability growth involving the ablator and also modestly reduces implosion convergence ratio. This strategy gives up on theoretical high-gain in an inertial confinement fusion implosion in order to obtain better control of the implosion and bring experimental performance in-line with calculated performance, yet keeps the absolute capsule performance relatively high. In this paper, we will cover the various experimental and theoretical motivations for the high-foot drive as well as cover the experimental results that have come out of the high-foot experimental campaign. At the time of this writing, the high-foot implosion has demonstrated record total deuterium-tritium yields (9.3×10{sup 15}) with low levels of inferred mix, excellent agreement with implosion simulations, fuel energy gains exceeding unity, and evidence for the “bootstrapping” associated with alpha-particle self-heating.

  1. Comparative Cost Analysis of Alternative Animal Tracing Strategies Directed Toward Foot and Mouth Disease Outbreaks in the Texas High Plains

    E-Print Network [OSTI]

    Looney, John C.

    2010-07-14T23:59:59.000Z

    The primary objective of this study is to evaluate the industry impact of a hypothetical Foot and Mouth Disease (FMD) outbreak in the Texas High Plains using alternative animal tracing levels. To accomplish this objective, an epidemiological disease...

  2. The Decade of Development: Goal Setting and Policy Challenges in India

    E-Print Network [OSTI]

    The Decade of Development: Goal Setting and Policy Challenges in India Jeffrey D. Sachs and Nirupam Papers #12;The Decade of Development: Goal Setting and Policy Challenges in India Jeffrey D. Sachs during several trips to India in the year 2000. #12;1 The Decade of Development: Goal Setting and Policy

  3. Geospatial analysis of vulnerable beach-foredune systems from decadal time series of lidar data

    E-Print Network [OSTI]

    Mitasova, Helena

    Geospatial analysis of vulnerable beach-foredune systems from decadal time series of lidar data, Geospatial analysis of vulnerable beach- foredune systems from decadal time series of lidar data, Journal densities; therefore, geospatial analysis, when applied to decadal lidar time series, needs to address

  4. DECADE Mentor Graduate Diversity Awards DEADLINE TO APPLY: Monday, March 10, 2014

    E-Print Network [OSTI]

    Barrett, Jeffrey A.

    DECADE Mentor Graduate Diversity Awards DEADLINE TO APPLY: Monday, March 10, 2014 Growth. The principal investigator must be a faculty member who has been designated as a DECADE mentor. A current list of DECADE Faculty Mentors is available at http://advance.uci.edu/DECADEmentors.html. The proposal must

  5. Development of the Robotic Touch foot Sensor for 2D walking Robot, for Studying Rough Terrain Locomotion

    E-Print Network [OSTI]

    Lee, Hunwoo

    2012-08-31T23:59:59.000Z

    Development of the Robotic Touch foot Sensor for 2D walking Robot, for Studying Rough Terrain Locomotion By HUNWOO LEE Submitted to the graduate degree program in Mechanical Engineering and the Graduate Faculty of the University of Kansas... ________________________________ Professor Robert Umholtz Date Defended: June 5, 2012 ii The Thesis Committee for HUNWOO LEE certifies that this is the approved version of the following thesis: Development of the Robotic Touch Foot Sensor for 2D Walking Robot...

  6. PHENIX EXPERIMENT AT RHIC: DECADAL PLAN 2004-2013

    SciTech Connect (OSTI)

    ZAJC,W.ET. AL.

    2003-11-30T23:59:59.000Z

    The PHENIX Collaboration has developed a plan for the detailed investigation of quantum chromodynamics in the next decade. The demonstrated capabilities of the PHENIX experiment to measure rare processes in hadronic, leptonic and photonic channels, in combination with RHIC's unparalleled flexibility as a hadronic collider, provides a physics program of extraordinary breadth and depth. A superlative set of measurements to elucidate the states of both hot and cold nuclear matter, and to measure the spin structure of the proton has been identified. The components of this plan include: (1) Definitive measurements that will establish the nature of the matter created in nucleus+nucleus collisions, that will determine if the description of such matter as a quark-gluon plasma is appropriate, and that will quantify both the equilibrium and non-equilibrium features of the produced medium. (2) Precision measurements of the gluon structure of the proton, and of the spin structure of the gluon and sea-quark distributions of the proton via polarized proton+proton collisions. (3) Determination of the gluon distribution in cold nuclear matter using proton+nucleus collisions. Each of these fundamental fields of investigation will be addressed through a program of correlated measurements in some or all of the following channels: (1) Particle production at high transverse momentum, studied via single particle inclusive measurements of identified charged and neutral hadrons, multi-particle correlations and jet production. (2) Direct photon, photon+jet and virtual photon production. (3) Light and heavy vector mesons. (4) Heavy flavor production. These measurements, together with the established PHENIX abilities to identify hadrons at low transverse momentum, to perform detailed centrality selections, and to monitor polarization and luminosity with high precision create a superb opportunity for performing world-class science with PHENIX for the next decade. A portion of this program is achievable using the present capabilities of PHENIX experimental apparatus, but the physics reach is considerably extended and the program made even more compelling by a proposed set of upgrades which include: (1) An aerogel and time-of-flight system to provide complete {pi}/K/p separation for momenta up to 10 GeV/c. (2) A vertex detector to detect displaced vertices from the decay of mesons containing charm or bottom quarks. (3) A hadron-blind detector to detect and track electrons near the vertex. (4) A micro-TPC to extend the range of PHENIX tracking in azimuth and pseudo-rapidity. (5) A forward detector upgrade for an improved muon trigger to preserve sensitivity at the highest projected RHIC luminosities. (6) A forward calorimeter to provide photon+jet studies over a wide kinematic range. The success of the proposed program is contingent upon several factors external to PHENIX. Implementation of the upgrades is predicated on the availability of R&D funds to develop the required detector technologies on a timely, and in some cases urgent, basis. The necessity for such funding, and the physics merit of the proposed PHENIX program, has been endorsed in the first meeting of BNL's Detector Advisory Committee in December, 2002. Progress towards the physics goals depends in an essential way on the development of the design values for RHIC luminosity, polarization and availability. An analysis based on the guidance from the Collider Accelerator Department indicates that moderate increases in the yearly running time lead to very considerable increases in progress toward the enunciated goals. Efficient access to the rarest probes in the proposed program is achieved via the order-of-magnitude increase in luminosity provided by RHIC-II.

  7. Landfill mining: A critical review of two decades of research

    SciTech Connect (OSTI)

    Krook, Joakim, E-mail: joakim.krook@liu.se [Department of Management and Engineering, Environmental Technology and Management, Linkoeping University, SE-581 83 Linkoeping (Sweden); Svensson, Niclas; Eklund, Mats [Department of Management and Engineering, Environmental Technology and Management, Linkoeping University, SE-581 83 Linkoeping (Sweden)

    2012-03-15T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer We analyze two decades of landfill mining research regarding trends and topics. Black-Right-Pointing-Pointer So far landfill mining has mainly been used to solve waste management issues. Black-Right-Pointing-Pointer A new perspective on landfills as resource reservoirs is emerging. Black-Right-Pointing-Pointer The potential of resource extraction from landfills is significant. Black-Right-Pointing-Pointer We outline several key challenges for realization of resource extraction from landfills. - Abstract: Landfills have historically been seen as the ultimate solution for storing waste at minimum cost. It is now a well-known fact that such deposits have related implications such as long-term methane emissions, local pollution concerns, settling issues and limitations on urban development. Landfill mining has been suggested as a strategy to address such problems, and in principle means the excavation, processing, treatment and/or recycling of deposited materials. This study involves a literature review on landfill mining covering a meta-analysis of the main trends, objectives, topics and findings in 39 research papers published during the period 1988-2008. The results show that, so far, landfill mining has primarily been seen as a way to solve traditional management issues related to landfills such as lack of landfill space and local pollution concerns. Although most initiatives have involved some recovery of deposited resources, mainly cover soil and in some cases waste fuel, recycling efforts have often been largely secondary. Typically, simple soil excavation and screening equipment have therefore been applied, often demonstrating moderate performance in obtaining marketable recyclables. Several worldwide changes and recent research findings indicate the emergence of a new perspective on landfills as reservoirs for resource extraction. Although the potential of this approach appears significant, it is argued that facilitating implementation involves a number of research challenges in terms of technology innovation, clarifying the conditions for realization and developing standardized frameworks for evaluating economic and environmental performance from a systems perspective. In order to address these challenges, a combination of applied and theoretical research is required.

  8. Three-Dimensional Rotational Angiography of the Foot in Critical Limb Ischemia: A New Dimension in Revascularization Strategy

    SciTech Connect (OSTI)

    Jens, Sjoerd, E-mail: s.jens@amc.uva.nl [Academic Medical Center, Department of Radiology (Netherlands); Lucatelli, Pierleone, E-mail: pierleone.lucatelli@gmail.com ['Sapienza' University of Rome, Vascular and Interventional Radiology Unit, Department of Radiological Sciences (Italy); Koelemay, Mark J. W., E-mail: m.j.koelemaij@amc.uva.nl [Academic Medical Center, Department of Surgery (Netherlands); Marquering, Henk A., E-mail: h.a.marquering@amc.uva.nl; Reekers, Jim A., E-mail: j.a.reekers@amc.uva.nl [Academic Medical Center, Department of Radiology (Netherlands)

    2013-06-15T23:59:59.000Z

    Purpose. To evaluate the additional value of three-dimensional rotational angiography (3DRA) of the foot compared with digital subtraction angiography (DSA) in patients with critical limb ischemia (CLI). Technique. For 3DRA, the C-arm was placed in the propeller position with the foot in an isocentric position. The patient's unaffected foot was positioned in a footrest outside the field of view. For correct timing of 3DRA, the delay from contrast injection in the popliteal artery at the level of knee joint to complete pedal arterial enhancement was assessed using DSA. With this delay, 3DRA was started after injection of 15 ml contrast. Imaging of the 3DRA could directly be reconstructed and visualized.Materials and MethodsPatients undergoing 3DRA of the foot were prospectively registered. DSA and 3DRA images were scored separately for arterial patency and presence of collaterals. Treatment strategies were proposed based on DSA with and without the availability of 3DRA. Results. Eleven patients underwent 3DRA of the foot. One 3DRA was not included because the acquisition was focused on the heel instead of the entire foot. Diagnostic quality of 3DRA was good in all ten patients. 3DRA compared with DSA showed additional patent arteries in six patients, patent plantar arch in three patients, and collaterals between the pedal arteries in five patients. Additional information from 3DRA resulted in a change of treatment strategy in six patients. Conclusion, 3DRA of the foot contains valuable additional real-time information to better guide peripheral vascular interventions in patients with CLI and nonhealing tissue lesions.

  9. Impact of a 1,000-foot thermal mixing zone on the steam electric power industry

    SciTech Connect (OSTI)

    Veil, J.A.

    1994-04-01T23:59:59.000Z

    Thermal discharge requirements for power plants using once-through cooling systems are based on state water quality standards for temperatures that must be met outside of designated mixing zones. This study evaluates the impact of limiting the extent of thermal mixing zones. This study evaluates the impact of limiting the extent of thermal mixing zones to no more than 1,000 feet from the discharge point. Data were collected from 79 steam electric plants. Of the plants currently using once-through cooling systems, 74% could not meet current thermal standards at the edge of a 1,000-foot mixing zone. Of this total, 68% would retrofit cooling towers, and 6% would retrofit diffusers. The estimated nationwide capital cost for retrofitting plants that could not meet current thermal standards at the edge of a 1,000-foot mixing zone is $21.4 billion. Conversion of a plant from once-through cooling to cooling towers or addition of diffusers would result in a lower energy output from that plant. For the affected plants, the total estimated replacement cost would be $370 to $590 million per year. Some power companies would have to construct new generating capacity to meet the increased energy demand. The estimated nationwide cost of this additional capacity would be $1.2 to $4.8 billion. In addition to the direct costs associated with compliance with a 1,000-foot mixing zone limit, other secondary environmental impacts would also occur. Generation of the additional power needed would increase carbon dioxide emissions by an estimated 8.3 million tons per year. In addition, conversion from once-through cooling systems to cooling towers at affected plants would result in increased evaporation of about 2.7 million gallons of water per minute nationwide.

  10. Foot Drop after Ethanol Embolization of Calf Vascular Malformation: A Lesson on Nerve Injury

    SciTech Connect (OSTI)

    Tay, Vincent Khwee-Soon, E-mail: vincentkstay@gmail.com [Singapore General Hospital, Department of Plastic, Reconstructive, and Aesthetic Surgery (Singapore); Mohan, P. Chandra, E-mail: chandra.mohan@sgh.com.sg [Singapore General Hospital, Department of Diagnostic Radiology (Singapore); Liew, Wendy Kein Meng, E-mail: wendy.liew.km@kkh.com.sg [KK Women's and Children's Hospital, Department of Paediatrics (Neurology Service) (Singapore); Mahadev, Arjandas, E-mail: arjandas.mahadev@kkh.com.sg [KK Women's and Children's Hospital, Department of Orthopaedic Surgery (Singapore); Tay, Kiang Hiong, E-mail: tay.kiang.hiong@sgh.com.sg [Singapore General Hospital, Department of Diagnostic Radiology (Singapore)

    2013-08-01T23:59:59.000Z

    Ethanol is often used in sclerotherapy to treat vascular malformations. Nerve injury is a known complication of this procedure. However, the management of this complication is not well described in literature. This case describes a 10-year-old boy with a slow flow vascular malformation in the right calf who underwent transarterial ethanol embolization following prior unsuccessful direct percutaneous sclerotherapy. The development of a dense foot drop that subsequently recovered is described, and the management of this uncommon but distressful complication is discussed.

  11. Table 6a. Total Electricity Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet)4. U.S. Vehicle FuelFoot,

  12. Collaborative Research: Separating Forced and Unforced Decadal Predictability in Models and Observations

    SciTech Connect (OSTI)

    Tippett, Michael K. [Columbia University

    2014-04-09T23:59:59.000Z

    This report is a progress report of the accomplishments of the research grant “Collaborative Research: Separating Forced and Unforced Decadal Predictability in Models and Observa- tions” during the period 1 May 2011- 31 August 2013. This project is a collaborative one between Columbia University and George Mason University. George Mason University will submit a final technical report at the conclusion of their no-cost extension. The purpose of the proposed research is to identify unforced predictable components on decadal time scales, distinguish these components from forced predictable components, and to assess the reliability of model predictions of these components. Components of unforced decadal predictability will be isolated by maximizing the Average Predictability Time (APT) in long, multimodel control runs from state-of-the-art climate models. Components with decadal predictability have large APT, so maximizing APT ensures that components with decadal predictability will be detected. Optimal fingerprinting techniques, as used in detection and attribution analysis, will be used to separate variations due to natural and anthropogenic forcing from those due to unforced decadal predictability. This methodology will be applied to the decadal hindcasts generated by the CMIP5 project to assess the reliability of model projections. The question of whether anthropogenic forcing changes decadal predictability, or gives rise to new forms of decadal predictability, also will be investigated.

  13. Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

    SciTech Connect (OSTI)

    Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

    2007-06-26T23:59:59.000Z

    A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

  14. Decadal cyclicity of regional mid-Holocene precipitation: Evidence from Dominican coral proxies

    E-Print Network [OSTI]

    Greer, Lisa

    Decadal cyclicity of regional mid-Holocene precipitation: Evidence from Dominican coral proxies of four Holocene specimens of Montastraea sp. and Siderastrea sp. coral skeletons from the Dominican Republic were analyzed to examine decadal-scale fluctuations in regional precipitation. The specimens range

  15. Links between biomass and tree demography in a northern hardwood forest: a decade of stability

    E-Print Network [OSTI]

    Battles, John

    Links between biomass and tree demography in a northern hardwood forest: a decade of stability recent trends in tree biomass and demography. We found no significant change in live-tree biomass during the decade. Total biomass was 246 Mg·ha­1 (95%CI = 235­258) in 1995­1996 and 245 Mg·ha­1 (95%CI = 234

  16. Decadal Prediction in the Pacific Region GERALD A. MEEHL AND AIXUE HU

    E-Print Network [OSTI]

    Meehl, Gerald A.

    Decadal Prediction in the Pacific Region GERALD A. MEEHL AND AIXUE HU National Center ensemble is used to address decadal prediction of Pacific SSTs. All model data are low-pass filtered, representing nearly 80% of the total variance, are used as the basis for early twenty-first-century predictions

  17. Proceedings of the 2007 IEEE 10th International Conference on Rehabilitation Robotics, June 12-15, Noordwijk, The Netherlands Biomechanical Design of a Powered Ankle-Foot Prosthesis

    E-Print Network [OSTI]

    Herr, Hugh

    -15, Noordwijk, The Netherlands Biomechanical Design of a Powered Ankle-Foot Prosthesis Samuel K. Au, Jeff Weber, and Hugh Herr Abstract-Although the potential benefits of a powered ankle- foot prosthesis have been well documented, no one has suc- cessfully developed and verified that such a prosthesis can improve amputee gait

  18. Foot & Mouth Disease & Ulcerative/Vesicular Rule-outs: Challenges Encountered in Recent Outbreaks

    SciTech Connect (OSTI)

    Hullinger, P

    2008-01-28T23:59:59.000Z

    Foot and mouth disease (FMD) is a highly infectious and contagious viral disease affecting bovidae (cattle, zebus, domestic buffaloes, yaks), sheep, goats, swine, all wild ruminants and suidae. Camelidae (camels, dromedaries, llamas, vicunas) have low susceptibility. Foot and mouth disease is caused by a RNS virus of the family Picornaviridae, genus Aphthovirus. There are seven immunologically distinct serotypes: A, O, C, SAT1, SAT2, SAT3, Asia 1. Foot and mouth disease causes significant economic loss both to countries who manage it as an endemic disease (with or without vaccination), as well as those FMD free countries which may become infected. The mortality rate is low in adult animals, but often higher in young due to myocarditis. Foot and mouth disease is endemic in parts of Asia, Africa, the Middle East and South America (sporadic outbreaks in free areas). The Office of International Epizootics (OIE), also referred to the World Organization for Animal Health maintains an official list of free countries and zones.1 The OIE Terrestrial Code (Chapter 2.2.10) provides detailed information on the categories of freedom that can be allocated to a country as well as guidelines for the surveillance for foot and mouth disease (Appendix 3.8.7). In short, countries may be completely free of FMD, free with vaccination or infected with foot and mouth disease virus (FMDV). Source of FMDV include incubating and clinically affected animals with virus present in breath, saliva, faeces, urine, milk and semen. In experimental settings virus has been detected in milk several days before the onset of clinical signs2. Additional sources of virus are meat and by-products in which pH has remained above 6.0 as well as persistently infected carrier animals. Carrier animals may include cattle and water buffalo; convalescent animals and exposed vaccinates (virus persists in the oropharynx for up to 30 months in cattle or longer in buffalo, 9 months in sheep). Pigs do not become carriers. It has been shown that the African Cape buffalo are the major maintenance host of SAT serotypes. FMDV transmission can occur by either direct or indirect contact. Indirect transmission can occur via contaminated animate vectors (humans, etc.), inanimate vectors (vehicles, implements) or airborne transmission. Indirect disease transmission via animate or inanimate vectors can play a major role in disease transmission. Good biosecurity can significantly reduce this type of transmission. Airborne transmission is often debated and is known to be serotype and species specific as well as require specific environmental conditions to occur. Airborne transmission is favored in temperate zones and has been postulated to occur over distances of up to 60 km overland and 300 km by sea. Foot and mouth disease virus is an unenveloped virus which is preserved by refrigeration and freezing and progressively inactivated by temperatures above 50 C. FMDV is highly sensitive to pH change and is inactivated by pH < 6.0 or > 9.0. There are many disinfectants which are effective against FMDV including sodium hydroxide (2%), sodium carbonate (4%), and citric acid (0.2%). FMDV is resistant to iodophores, quaternary ammonium compounds, hypochlorite and phenol, especially in the presence of organic matter. The virus can survive in lymph nodes and bone marrow at neutral pH, but is destroyed in muscle when is pH < 6.0 i.e. after rigor mortis. FMDV can persist in contaminated feed/commodities and the environment for over to 1 month, depending on the temperature and pH conditions. The incubation period for FMD is 2-14 days. Animals transition through latent (infected but not infectious), subclinically infected (infectious but lacking clinical signs) clinically infected and recovered disease states. In cattle clinical signs include pyrexia, reluctance to eat, bruxism, drooling, lameness, treading or stamping of the feet and decreased milk production. Most clinical signs are related to the development and subsequent rupturing of vesicles at the coronary band and in the oral cavity. V

  19. Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe Abstract-- Electric powered vehicles use energy stored in some form of battery for the vehicle of electric vehicles through on-road testing, user led trials and the analysis of the data collected from

  20. Stem cubic-foot volume tables for tree species in the piedmont. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 16 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Piedmont. Tables are based on form class measurement data for 2,753 trees sampled in the Piedmont and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  1. Fuel economy testing of six 40-foot transit buses. Final report Aug 82-Mar 83

    SciTech Connect (OSTI)

    Francis, G.A.; Nelson, S.R.

    1983-03-01T23:59:59.000Z

    The importance of life-cycle cost analyses in transit bus procurement is recognized by the industry and has been a Congressional requirement for grantees. This report documents a program of fuel economy testing of six standard 40-foot buses. The main purpose of this series of tests is to assist transit authorities and bus suppliers by providing accurate comparable fuel consumption data on transit buses produced by different manufacturers. Six buses were selected by the manufacturers and supplied for testing by six transit properties directly from revenue service. This report makes the data available to the industry for discretionary use in estimating life-cycle costs. A list of bus manufacturers and the supplying transit system is provided.

  2. Despite technological advances in surgery and anesthesia during the last few decades, the incidence of postoperative

    E-Print Network [OSTI]

    Mandal, Pravat K.

    SUMMARY Despite technological advances in surgery and anesthesia during the last few decades inhalational agents currently used in anesthesia (volatile anesthetics: isoflurane, desflurane and sevoflurane dysfunction. However, such infor- mation is crucial to improve anesthesia performance and patient safety

  3. On the Pacific Decadal Oscillation and the Atlantic Multidecadal Oscillation: Might they be related?

    E-Print Network [OSTI]

    Peltier, W. Richard

    ? Marc d'Orgeville1 and W. Richard Peltier1 Received 3 August 2007; revised 21 September 2007; accepted 1. Peltier (2007), On the Pacific Decadal Oscillation and the Atlantic Multidecadal Oscillation: Might

  4. Evaluation of short-term climate change prediction in multi-model CMIP5 decadal hindcasts

    E-Print Network [OSTI]

    Webster, Peter J.

    events such as trop- ical cyclone activity. On decadal timescales, some aspects of internal climate skill of individual models have been analyzed separately for multi-year prediction horizons over

  5. Did the Great Recession Wipe Out a Decade of Economic Progress in Colorado?

    E-Print Network [OSTI]

    1 Did the Great Recession Wipe Out a Decade of Economic Associate Professor of Economics Michael Marturana Research Economist Colorado rebuild. To make better decisions about Colorado's open economic path

  6. Arthur Symons and Decadent Lyric: Art in the Age of Urban Modernity

    E-Print Network [OSTI]

    Shiralian, Sahar

    2013-01-01T23:59:59.000Z

    Whistler and the English Poets of the 1890s. ” 16 NovemberBaudelaire: A Lyric Poet in the Era of High Capitalism.in the minor Decadent poet Arthur Symons’ second volume of

  7. Evaluation of Multiplexed Foot-and-Mouth Disease Nonstructural Protein Antibody Assay Against Standardized Bovine Serum Panel

    SciTech Connect (OSTI)

    Perkins, J; Parida, S; Clavijo, A

    2007-05-14T23:59:59.000Z

    Liquid array technology has previously been used to show proof-of-principle of a multiplexed non structural protein serological assay to differentiate foot-and-mouth infected and vaccinated animals. The current multiplexed assay consists of synthetically produced peptide signatures 3A, 3B and 3D and recombinant protein signature 3ABC in combination with four controls. To determine diagnostic specificity of each signature in the multiplex, the assay was evaluated against a naive population (n = 104) and a vaccinated population (n = 94). Subsequently, the multiplexed assay was assessed using a panel of bovine sera generated by the World Reference Laboratory for foot-and-mouth disease in Pirbright, UK. This sera panel has been used to assess the performance of other singleplex ELISA-based non-structural protein antibody assays. The 3ABC signature in the multiplexed assay showed comparative performance to a commercially available non-structural protein 3ABC ELISA (Cedi test{reg_sign}) and additional information pertaining to the relative diagnostic sensitivity of each signature in the multiplex is acquired in one experiment. The encouraging results of the evaluation of the multiplexed assay against a panel of diagnostically relevant samples promotes further assay development and optimization to generate an assay for routine use in foot-and-mouth disease surveillance.

  8. Higher velocity, high-foot implosions on the National Ignition Facility laser

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Callahan, D. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000315498916); Hurricane, O. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hinkel, D. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Döppner, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ma, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Park, H. -S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Barrios Garcia, M. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Berzak Hopkins, L. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000291875667); Casey, D. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Cerjan, C. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000251686845); Dewald, E. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dittrich, T. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Edwards, M. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haan, S. W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000184045131); Hamza, A. V. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kline, J. L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Knauer, J. P. [Univ. of Rochester, NY (United States); Kritcher, A. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Landen, O. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); LePape, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); MacPhee, A. G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000341604479); Milovich, J. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Nikroo, A. [General Atomics, San Diego, CA (United States)] (ORCID:0000000288550378); Pak, A. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Patel, P. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rygg, J. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ralph, J. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Salmonson, J. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Spears, B. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Springer, P. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tommasini, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benedetti, L. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bionta, R. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bond, E. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bradley, D. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Caggiano, J. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Field, J. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Fittinghoff, D. N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Frenje, J. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States)] (ORCID:0000000168460378); Gatu Johnson, M. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States); Grim, G. P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hatarik, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Merrill, F. E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Nagel, S. R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)] (ORCID:0000000277686819); Izumi, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Khan, S. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-05-01T23:59:59.000Z

    By increasing the velocity in “high foot” implosions [Dittrich et al., Phys. Rev. Lett. 112, 055002 (2014); Park et al., Phys. Rev. Lett. 112, 055001 (2014); Hurricane et al., Nature 506, 343 (2014); Hurricane et al., Phys. Plasmas 21, 056314 (2014)] on the National Ignition Facility laser, we have nearly doubled the neutron yield and the hotspot pressure as compared to the implosions reported upon last year. The implosion velocity has been increased using a combination of the laser (higher power and energy), the hohlraum (depleted uranium wall material with higher opacity and lower specific heat than gold hohlraums), and the capsule (thinner capsules with less mass). We find that the neutron yield from these experiments scales systematically with a velocity-like parameter of the square root of the laser energy divided by the ablator mass. By connecting this parameter with the inferred implosion velocity (v), we find that for shots with primary yield >1e15 neutrons, the total yield ~ v???. This increase is considerably faster than the expected dependence for implosions without alpha heating ( ~v???) and is additional evidence that these experiments have significant alpha heating.

  9. Higher velocity, high-foot implosions on the National Ignition Facility laser

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Callahan, D. A.; Hurricane, O. A.; Hinkel, D. E.; Döppner, T.; Ma, T.; Park, H. -S.; Barrios Garcia, M. A.; Berzak Hopkins, L. F.; Casey, D. T.; Cerjan, C. J.; et al

    2015-05-01T23:59:59.000Z

    By increasing the velocity in “high foot” implosions [Dittrich et al., Phys. Rev. Lett. 112, 055002 (2014); Park et al., Phys. Rev. Lett. 112, 055001 (2014); Hurricane et al., Nature 506, 343 (2014); Hurricane et al., Phys. Plasmas 21, 056314 (2014)] on the National Ignition Facility laser, we have nearly doubled the neutron yield and the hotspot pressure as compared to the implosions reported upon last year. The implosion velocity has been increased using a combination of the laser (higher power and energy), the hohlraum (depleted uranium wall material with higher opacity and lower specific heat than gold hohlraums), andmore »the capsule (thinner capsules with less mass). We find that the neutron yield from these experiments scales systematically with a velocity-like parameter of the square root of the laser energy divided by the ablator mass. By connecting this parameter with the inferred implosion velocity (v), we find that for shots with primary yield >1e15 neutrons, the total yield ~ v???. This increase is considerably faster than the expected dependence for implosions without alpha heating ( ~v???) and is additional evidence that these experiments have significant alpha heating.« less

  10. Simulation and analysis of the plutonium shipping container subject to 30-foot drops

    SciTech Connect (OSTI)

    Gong, C.; Gupta, N.K.; Gromada, R.J. [Westinghouse Savannah River Co., Aiken, SC (United States). Savannah River Technology Center

    1995-12-31T23:59:59.000Z

    The shipping container 5320 is a shipping package for radioactive materials. In order to maintain the component in this packaging within the sub-critical state when subjected to any kind of Hypothetical Accident conditions (HAC), this Type B packaging is designed with various impact limiters. The present study is to examine the energy absorbing capacity of the impact limiter design of this container subjected to a 30-foot drop onto a flat unyielding horizontal surface in each of the three critical dropping orientations. This paper presents the results of a three dimensional nonlinear dynamic impact analysis. This analysis shows the deformed configuration of the container caused by the impact and also determines the effects of different stress wave paths in three distinct drops on the stress states in the critical component. The solution to the problem was obtained using the ABAQUS (explicit) finite element computer code. The nonlinearity of this analysis involves large structural deformation, elasto-plastic materials with strain hardening as well as multiple contact interfaces. Three drop orientations were studied, namely, top down impact, bottom down impact and side impact. Results will be compared against actual drop test data.

  11. Modeling Estimated Personnel Needs for a Potential Foot and Mouth Disease Outbreak

    SciTech Connect (OSTI)

    Simmons, K; Hullinger, P

    2008-01-29T23:59:59.000Z

    Foot and Mouth disease (FMD) is a highly infectious and contagious viral disease affecting cloven-hoofed livestock that was last detected in the United States (US) in 1929. The prevalence of FMD in other countries, as well as the current potential for this virus to be used as a form of agroterrorism, has made preparations for a potential FMD outbreak a national priority. To assist in the evaluation of national preparedness, all 50 states were surveyed via e-mail, telephone and web search to obtain emergency response plans for FMD or for foreign animal diseases in general. Information from 33 states was obtained and analyzed for estimates of personnel resources needed to respond to an outbreak. These estimates were consolidated and enhanced to create a tool that could be used by individual states to better understand the personnel that would be needed to complete various tasks over time during an outbreak response. The estimates were then coupled, post-processing, to the output from FMD outbreaks simulated in California using the Multiscale Epidemiological/Economic Simulation and Analysis (MESA) model at Lawrence Livermore National Laboratory to estimate the personnel resource demands, by task, over the course of an outbreak response.

  12. Medical Image Analysis: Progress over Two Decades and the Challenges Ahead

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Medical Image Analysis: Progress over Two Decades and the Challenges Ahead James S. Duncan, Senior the underlying normal and abnormal ground truth. In this paper, we look at progress in the field over the last 20 10 years prior to the time frame we are looking atÐthe analysis of cardiac nuclear medicine images

  13. please recycle. Recent decades have seen fundamental shifts in the business of forestry worldwide. Private

    E-Print Network [OSTI]

    Reif, John H.

    please recycle. Recent decades have seen fundamental shifts in the business of forestry worldwide analysis and management. Today's master's programs in forestry and environmental management address forest; one of the oldest and best forestry education programs in the world; and a strong network

  14. Asia Research Centre public lecture Pakistan and the challenges of a new decade

    E-Print Network [OSTI]

    Asia Research Centre public lecture Pakistan and the challenges of a new decade Douglas Alexander of Economics and Political Science Wednesday 26 October 2011 Check against delivery http://www.labour.org.uk/pakistan that Pakistan will be high up in the in tray of whoever becomes Foreign Secretary in 2015. Pakistan is today

  15. Introduction Over the last decade, the growth and uses of computer networking have increased

    E-Print Network [OSTI]

    transmission systems and link capacities, router and switch speeds, and network protocol and softwareChapter 1 Introduction Over the last decade, the growth and uses of computer networking have to that of the power grid and the transportation system. The success of the Internet has to do with the advances

  16. Introduction ACIS continues to perform well more than a decade after launch. Over

    E-Print Network [OSTI]

    Grant, Catherine E.

    , and into the next decade Catherine Grant for the ACIS Instrument Team MIT Kavli Institute for Astrophysics and Space Research Particle Background · Measured using the high energy reject rate on ACIS-S3 · During quiet times-correlated with the solar cycle ­ rates are expected to decline as solar activity increases · ACIS calibration (gain

  17. Multi-decadal projections of surface and interior pathways of the Fukushima Cesium-137 radioactive plume

    E-Print Network [OSTI]

    England, Matthew

    contaminated with radionuclides, including Cesium-137, were released into the Pacific Ocean. With a halfMulti-decadal projections of surface and interior pathways of the Fukushima Cesium-137 radioactive of the leaked Cs-137 in the North Pacific Ocean. The simulations suggest that the contaminated plume would have

  18. NRC Earth Science Decadal Survey-Mission Concept Earth Sciences from the Astronomer's Perspective, a Deep

    E-Print Network [OSTI]

    Christian, Eric

    NRC Earth Science Decadal Survey-Mission Concept Earth Sciences from the Astronomer's Perspective Irina Melnikova #12;1 Earth Sciences from the Astronomer's Perspective 1.0 Mission Concept and Purpose Earth observations from satellites located in deep space offer the exciting opportunity to look

  19. Over the past decade, the advent of robotics has enabled a paradigm shift in

    E-Print Network [OSTI]

    Pfrender, Michael

    Over the past decade, the advent of robotics has enabled a paradigm shift in molecular biology rhizospheres, soil communities and ocean dwelling or even airborne microorganisms, such as those present and the population structure, variation in food and energy supply and the geography of the habitat4 . Eco

  20. Building on a Decade of Accomplishments Report of the 2010 Blue Ribbon Panel on Genomics

    E-Print Network [OSTI]

    Levin, Judith G.

    Building on a Decade of Accomplishments Report of the 2010 Blue Ribbon Panel on Genomics Division of Microbiology and Infectious Diseases, Genomics Programs National Institute of Allergy and Infectious Diseases Blue Ribbon Panel on Genomics Division of Microbiology and Infectious Diseases, Genomics Programs

  1. Two Decades of River Restoration in California: What Can We Learn?

    E-Print Network [OSTI]

    Merenlender, Adina

    Restoration Science Synthe- sis (NRRSS), we developed a summary database of 4,023 stream restoration projectsTwo Decades of River Restoration in California: What Can We Learn? G. M. Kondolf,1 S. Anderson,2 for design, monitoring, and reporting restoration projects, and that although moni- toring is far more

  2. about 2% per decade in the second half of the twentieth century,possibly with some

    E-Print Network [OSTI]

    Stocker, Thomas

    about 2% per decade in the second half of the twentieth century,possibly with some recovery,2042­2061. Liepert,B.(2002),Observed reductions of surface solar radiation at sites in the United States most significant greenhouse gases (after water vapor),also rise and fall,in a remarkably simi- lar

  3. Warming accelerates decomposition of decades-old carbon in forest soils

    E-Print Network [OSTI]

    ). Although there are no global estimates of decadal-aged C, it makes up the majority of C in mineral soils, CA 94720; and d Energy and Resources Group, University of California, Berkeley, CA 94720 Edited (received for review January 10, 2012) Global climate carbon-cycle models predict acceleration of soil

  4. Stone Axes and Warhammers: A Decade of Distributed Simulation in Aviation Research

    E-Print Network [OSTI]

    Tropper, Carl

    Systems Development (CAASD) is the Federal Aviation Administration's (FAA) federally funded researchStone Axes and Warhammers: A Decade of Distributed Simulation in Aviation Research Frank M. Sogandares Center for Advanced Aviation System Development (CAASD) 7515 Colshire Drive, McLean VA 22102

  5. Dynamics of decadal variability in the Atlantic subpolar gyre: a stochastically forced oscillator

    E-Print Network [OSTI]

    Born, Andreas

    shows irregular oscillations of decadal time scale with most spectral power between 15 and 20 years freshwater input into the North Atlantic and adjacent Nordic Seas is considered critical for the observed Yoshimori et al. 2010 for an overview). This circulation system was found to redistribute freshwater

  6. First decadal response to treatment in a disturbance-based silviculture experiment in Maine

    E-Print Network [OSTI]

    Wagner, Robert G.

    ) in central Maine, that was designed to emulate the annual 1% disturbance frequency typicalFirst decadal response to treatment in a disturbance-based silviculture experiment in Maine Justin 3 April 2011 Available online xxxx Keywords: Irregular shelterwood Expanding gap Disturbance

  7. A 7-decades Tunable Translinear SiGe BiCMOS 3-phase Sinusoidal Oscillator

    E-Print Network [OSTI]

    Cauwenberghs, Gert

    A 7-decades Tunable Translinear SiGe BiCMOS 3-phase Sinusoidal Oscillator Dimitrios N. Loizos 1 of these controls to external current biases. Measurements on a 0.5m SiGe BiCMOS implementation of the architecture

  8. Table 3a. Total Natural Gas Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet) DecadeV49 155 181 177391.070.51992

  9. Table 4a. Total Fuel Oil Consumption per Effective Occupied Square Foot,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial ConsumersThousandCubic Feet) DecadeV493,552.13,846.302.8

  10. Initial Value Predictability of Intrinsic Oceanic Modes and Implications for Decadal Prediction over North America

    SciTech Connect (OSTI)

    Branstator, Grant

    2014-12-09T23:59:59.000Z

    The overall aim of our project was to quantify and characterize predictability of the climate as it pertains to decadal time scale predictions. By predictability we mean the degree to which a climate forecast can be distinguished from the climate that exists at initial forecast time, taking into consideration the growth of uncertainty that occurs as a result of the climate system being chaotic. In our project we were especially interested in predictability that arises from initializing forecasts from some specific state though we also contrast this predictability with predictability arising from forecasting the reaction of the system to external forcing – for example changes in greenhouse gas concentration. Also, we put special emphasis on the predictability of prominent intrinsic patterns of the system because they often dominate system behavior. Highlights from this work include: • Development of novel methods for estimating the predictability of climate forecast models. • Quantification of the initial value predictability limits of ocean heat content and the overturning circulation in the Atlantic as they are represented in various state of the artclimate models. These limits varied substantially from model to model but on average were about a decade with North Atlantic heat content tending to be more predictable than North Pacific heat content. • Comparison of predictability resulting from knowledge of the current state of the climate system with predictability resulting from estimates of how the climate system will react to changes in greenhouse gas concentrations. It turned out that knowledge of the initial state produces a larger impact on forecasts for the first 5 to 10 years of projections. • Estimation of tbe predictability of dominant patterns of ocean variability including well-known patterns of variability in the North Pacific and North Atlantic. For the most part these patterns were predictable for 5 to 10 years. • Determination of especially predictable patterns in the North Atlantic. The most predictable of these retain predictability substantially longer than generic patterns, with some being predictable for two decades.

  11. Colorado Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecade Year-0c.+Foot) Decade

  12. 164 IEEE TRANSACTIONS ON NEURAL SYSTEMS AND REHABILITATION ENGINEERING, VOL. 18, NO. 2, APRIL 2010 Control of a Powered AnkleFoot Prosthesis

    E-Print Network [OSTI]

    Geyer, Hartmut

    Control of a Powered Ankle­Foot Prosthesis Based on a Neuromuscular Model Michael F. Eilenberg, Hartmut the difficulties of explicit terrain sensing. Specifically, the energy provided by the prosthesis was directly--Neuromuscular model, powered prosthesis, pros- thesis control, terrain adaptation. I. INTRODUCTION TODAY

  13. The potential role of wildlife in the spread and control of foot and mouth disease in an extensive livestock management system

    E-Print Network [OSTI]

    Highfield, Linda

    2009-05-15T23:59:59.000Z

    Foot and mouth disease (FMD) is a highly contagious viral infection that affects all Artiodactyls (cloven-hoofed) species. The United States has been free of FMD since 1929, and the entire population of cloven-hoofed species is therefore susceptible...

  14. Stem cubic-foot volume tables for tree species in the upper coastal plain. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 11 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Upper Coastal Plain. Tables are based on form class measurement data for 521 trees sampled in the Upper Coastal Plain and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  15. Stem cubic-foot volume tables for tree species in the Appalachian area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 20 species and 8 species groups based on equations used to estimate timber sale volumes on national forests in the Appalachian Area. Tables are based on form class measurement data for 2,670 trees sampled in the Appalachian Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  16. Stem cubic-foot volume tables for tree species in the Gulf and Atlantic coastal plain. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 14 species and 9 species groups based on equations used to estimate timber sale volumes on national forests in the Gulf and Atlantic Coastal Plain. Tables are based on form class measurement data for 2,728 trees sampled in the Gulf and Atlantic Coastal Plain and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  17. Stem cubic-foot volume tables for tree species in the Arkansas area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 9 species and 9 species groups based on equations used to estimate timber sale volumes on national forests in the Arkansas Area. Tables are based on form class measurement data for 1,417 trees sampled in the Arkansas Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination woth total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on d.b.h. in combination with height to a 7-inch d.o.b. top for softwoods and height to a 9-inch d.o.b. top for hardwoods.

  18. Stem cubic-foot volume tables for tree species in the Delta area. Forest Service research paper

    SciTech Connect (OSTI)

    Clark, A.; Souter, R.A.

    1996-03-01T23:59:59.000Z

    Steamwood cubic-foot volume inside bark tables are presented for 13 species and 6 species groups based on equations used to estimate timber sale volumes on national forests in the Delta Area. Tables are based on form class measurement data for 990 trees sampled in the Delta Area and taper data collected across the South. A series of tables is presented for each species based on diameter at breast height (d.b.h.) in combination with total height and height to a 4-inch diameter outside bark (d.o.b.) top. Volume tables are also presented based on diameter outside of the bark (d.o.b.) in combination with height with to a 9-inch d.o.b. top.

  19. Seismic damage estimation for buried pipelines - challenges after three decades of progress

    SciTech Connect (OSTI)

    Pineda-porras, Omar Andrey [Los Alamos National Laboratory; Najafi, Mohammand [U. OF TEXAS

    2009-01-01T23:59:59.000Z

    This paper analyzes the evolution over the past three decades of seismic damage estimation for buried pipelines and identifies some challenges for future research studies on the subject. The first section of this paper presents a chronological description of the evolution since the mid-1970s of pipeline fragility relations - the most common tool for pipeline damage estimation - and follows with a careful analysis of the use of several ground motion parameters as pipeline damage indicators. In the second section of the paper, four gaps on the subject are identified and proposed as challenges for future research studies. The main conclusion of this work is that enhanced fragility relations must be developed for improving pipeline damage estimation, which must consider relevant parameters that could influence the seismic response of pipelines.

  20. A boom in energy technology innovation despite decades of stagnant investment

    SciTech Connect (OSTI)

    Bettencourt, Luis M [Los Alamos National Laboratory; Trancik, Jessika A [SANTA FE INSTITUTE; Kaur, Jasleen [INDIANA UNIV

    2009-01-01T23:59:59.000Z

    Rates of patenting in energy technologies in the United States stagnated during a period of low federal investment in the sector from the mid-1980's through 2000. To analyze the current state of the field, we built a new comprehensive database of energy patents in the USA and worldwide aggregated by nation and technology. We show that innovation in energy technologies, as measured by numbers of new patents, has grown dramatically over the last decade both for renewable and fossil fuel-based technologies, but that traditional investment -government and private support for research and development (R&D) -has not risen commensurately. We also show that while venture capital investment in the sector has increased significantly in the last few years it lags the observed uptick in patenting. We find increasing patenting rates in nations worldwide but also differences in regional priorities, as well as a marked divergence in innovation rates across technologies. Renewable energy technologies - especially solar and wind - currently show the fastest rates of innovation, while patenting levels in nuclear fission have remained low despite relatively high levels of sustained investment. While this sharp increase of innovative activity bodes well for change in the energy sector, the future of emerging technologies may hinge on sustained investment in R&D and favorable incentives for market entry.

  1. Astro2010 Decadal Survey Whitepaper: Coordinated Science in the Gravitational and Electromagnetic Skies

    E-Print Network [OSTI]

    Joshua S. Bloom; Daniel E. Holz; Scott A. Hughes; Kristen Menou; Allan Adams; Scott F. Anderson; Andy Becker; Geoffrey C. Bower; Niel Brandt; Bethany Cobb; Kem Cook; Alessandra Corsi; Stefano Covino; Derek Fox; Andrew Fruchter; Chris Fryer; Jonathan Grindlay; Dieter Hartmann; Zoltan Haiman; Bence Kocsis; Lynne Jones; Abraham Loeb; Szabolcs Marka; Brian Metzger; Ehud Nakar; Samaya Nissanke; Daniel A. Perley; Tsvi Piran; Dovi Poznanski; Tom Prince; Jeremy Schnittman; Alicia Soderberg; Michael Strauss; Peter S. Shawhan; David H. Shoemaker; Jonathan Sievers; Christopher Stubbs; Gianpiero Tagliaferri; Pietro Ubertini; Przemyslaw Wozniak

    2009-02-10T23:59:59.000Z

    It is widely expected that the coming decade will witness the first direct detection of gravitational waves (GWs). The ground-based LIGO and Virgo GW observatories are being upgraded to advanced sensitivity, and are expected to observe a significant binary merger rate. The launch of The Laser Interferometer Space Antenna (LISA) would extend the GW window to low frequencies, opening new vistas on dynamical processes involving massive (M >~ 10^5 M_Sun) black holes. GW events are likely to be accompanied by electromagnetic (EM) counterparts and, since information carried electromagnetically is complementary to that carried gravitationally, a great deal can be learned about an event and its environment if it becomes possible to measure both forms of radiation in concert. Measurements of this kind will mark the dawn of trans-spectral astrophysics, bridging two distinct spectral bands of information. The aim of this whitepaper is to articulate future directions in both theory and observation that are likely to impact broad astrophysical inquiries of general interest. What will EM observations reflect on the nature and diversity of GW sources? Can GW sources be exploited as complementary probes of cosmology? What cross-facility coordination will expand the science returns of gravitational and electromagnetic observations?

  2. The XRF080109-SN2008D and a decade of GRB-Jet-SN connection

    E-Print Network [OSTI]

    Fargion, D; Oliva, P; Manniti, F

    2009-01-01T23:59:59.000Z

    Last and nearest GRB-XRF 080109 has been an exceptional lesson on GRB nature. After a decade (since 25 April 08) we know that Supernovae may often contain a Jet. Its persistent activity may shine on axis as a GRBs. Such a persistent, thin beamed gamma jet may be powered by either a BH (Black Holes) or Pulsars. Late stages of these jets may loose the SN traces and appear as a short GRB or a long orphan GRB (depending on jet angular velocity and view angle). XRF are peripherical viewing of the jets. These precessing and spinning gamma jet are originated by Inverse Compton and-or Synchrotron Radiation at pulsars or micro-quasars sources, by ultra-relativistic electrons. These Jets are most powerful at Supernova birth, blazing, once on axis, to us and flashing GRB detector. The trembling of the thin jet explains naturally the observed erratic multi-explosive structure of different GRBs. The jets are precessing (by binary companion or inner disk asymmetry) and decaying by power on time scales of few hours, but the...

  3. Strategic environmental assessment for sustainability: A review of a decade of academic research

    SciTech Connect (OSTI)

    White, Lisa, E-mail: lisa.white@usask.ca [School of Environment and Sustainability, University of Saskatchewan, 117 Science Place, Saskatoon, Saskatchewan, Canada S7N 5A5 (Canada)] [School of Environment and Sustainability, University of Saskatchewan, 117 Science Place, Saskatoon, Saskatchewan, Canada S7N 5A5 (Canada); Noble, Bram F., E-mail: b.noble@usask.ca [Department of Geography and Planning, School of Environment and Sustainability, University of Saskatchewan, 117 Science Place, Saskatoon, Saskatchewan, Canada S7N 5A5 (Canada)

    2013-09-15T23:59:59.000Z

    This paper examines the strategic environmental assessment (SEA)–sustainability relationship over the past decade, from 2000 to 2010, focusing in particular on the incorporation of sustainability in SEA. A total of 86 papers from the academic literature containing the terms ‘sustainability’ or ‘sustainable development’ and ‘strategic environmental assessment’ were identified and reviewed. Several common themes emerged by which SEA can support sustainability, including providing a framework to support decision making for sustainability; setting sustainability objectives, ensuring the consideration of ‘more sustainable’ alternatives, and integrating sustainability criteria in PPP development; and promoting sustainability outcomes through tiering and institutional learning. At the same time, our review identified many underlying barriers that challenge SEA for sustainability, including the variable interpretations of the scope of sustainability in SEA; the limited use of assessment criteria directly linked to sustainability objectives; and challenges for decision-makers in operationalizing sustainability in SEA and adapting PPP development decision-making processes to include sustainability issues. To advance SEA for sustainability there is a need to better define the scope of sustainability in SEA; clarify how to operationalize the different approaches to sustainability in SEA, as opposed to simply describing those approaches; provide guidance on how to operationalize broad sustainability goals through assessment criteria in SEA; and understand better how to facilitate institutional learning regarding sustainability through SEA application. -- Highlights: ? There is significant potential for SEA to support sustainability in PPP development. ? However, there are still many barriers in place that challenge SEA for sustainability. ? The scope and approaches to sustainability in SEA must be better defined and described. ? Guidance is needed to link impact assessment criteria to sustainability objectives. ? Focus on how to facilitate institutional learning regarding sustainability is required.

  4. Economic Impacts of Potential Foot and Mouth Disease Agro-terrorism in the United States: A Computable General Equilibrium Analysis

    SciTech Connect (OSTI)

    Oladosu, Gbadebo A [ORNL] [ORNL; Rose, Adam [University of Southern California, Los Angeles] [University of Southern California, Los Angeles; Bumsoo, Lee [University of Illinois] [University of Illinois

    2013-01-01T23:59:59.000Z

    The foot and mouth disease (FMD) virus has high agro-terrorism potential because it is contagious, can be easily transmitted via inanimate objects and can be spread by wind. An outbreak of FMD in developed countries results in massive slaughtering of animals (for disease control) and disruptions in meat supply chains and trade, with potentially large economic losses. Although the United States has been FMD-free since 1929, the potential of FMD as a deliberate terrorist weapon calls for estimates of the physical and economic damage that could result from an outbreak. This paper estimates the economic impacts of three alternative scenarios of potential FMD attacks using a computable general equilibrium (CGE) model of the US economy. The three scenarios range from a small outbreak successfully contained within a state to a large multi-state attack resulting in slaughtering of 30 percent of the national livestock. Overall, the value of total output losses in our simulations range between $37 billion (0.15% of 2006 baseline economic output) and $228 billion (0.92%). Major impacts stem from the supply constraint on livestock due to massive animal slaughtering. As expected, the economic losses are heavily concentrated in agriculture and food manufacturing sectors, with losses ranging from $23 billion to $61 billion in the two industries.

  5. Introduction In the past two decades China has embarked on a series of ambitious reforms, not the

    E-Print Network [OSTI]

    Huang, Youqin

    Introduction In the past two decades China has embarked on a series of ambitious reforms because of the coexistence of housing markets and the socialist government. Furthermore, housing reform in urban China is decentralized, with central govern- ment laying out the framework of housing reform

  6. CB26CH23-Ideker ARI 26 June 2010 20:15 A Decade of Systems Biology

    E-Print Network [OSTI]

    advances in soft- ware tools that allow biologists to explore system-wide models and to formulate newCB26CH23-Ideker ARI 26 June 2010 20:15 R E V I E W S IN A D V A N CE A Decade of Systems Biology) Abstract Systems biology provides a framework for assembling models of biolog- ical pathways from

  7. Dynamical Role of Mode Water Ventilation in Decadal Variability in the Central Subtropical Gyre of the North Pacific*

    E-Print Network [OSTI]

    Xie, Shang-Ping

    Dynamical Role of Mode Water Ventilation in Decadal Variability in the Central Subtropical Gyre and weakening of the STCC because of var- iations in mode water ventilation. The changes in mode water can are characteristic of changes in mode water ventilation. Indeed, this natural mode of STCC variability is excited

  8. The Pump: A Decade of Covert Fun Annual Computer Security Applications Conference, Dec. 2005 Invited Classic Paper

    E-Print Network [OSTI]

    1 The Pump: A Decade of Covert Fun 21st Annual Computer Security Applications Conference, Dec. 2005}@itd.nrl.navy.mil Abstract This paper traces the ten plus year history of the Naval Research Laboratory's Pump idea. The Pump. The reason for the Pump is the need to send messages from a "Low" enclave to a "High" enclave, in a secure

  9. Role of the tropical Atlantic sea surface temperature in the decadal change of the summer North Atlantic Oscillation

    E-Print Network [OSTI]

    pattern exhibited a traditional distribution with two centers over the North Atlantic. Citation: Sun, JRole of the tropical Atlantic sea surface temperature in the decadal change of the summer North Atlantic Oscillation Jianqi Sun,1,2 Huijun Wang,1,2 and Wei Yuan2,3 Received 1 May 2009; revised 11 July

  10. Multi-Decadal Solar Radiation Trends in the United States and Germany and Direct Tropospheric Aerosol Forcing

    E-Print Network [OSTI]

    Multi-Decadal Solar Radiation Trends in the United States and Germany and Direct Tropospheric.S. the strengthening is almost equal. We attained these results by scrutinizing clear sky global solar radiation of solar radiation were used for constraining the observed trends. Increased absorption and declined light

  11. Research turbine supports sustained technology development. For more than three decades, engineers at the National Renewable Energy Labora-

    E-Print Network [OSTI]

    Research turbine supports sustained technology development. For more than three decades, engineers, improve wind turbine performance, and reduce the cost of energy. Although there have been dramatic turbine test platform. Working with DOE, NREL purchased and installed a GE 1.5-MW wind turbine at the NWTC

  12. The non-aqueous chemistry of uranium has been an active area of exploration in recent decades1,2

    E-Print Network [OSTI]

    Cai, Long

    -purity depleted uranium produced as a by-product of nuclear isotope enrichment programmes. The early actinideThe non-aqueous chemistry of uranium has been an active area of exploration in recent decades1 for uranium will be created in part by the quest of researchers to understand the properties and potential

  13. Colorado Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecade Year-0c.+Foot)

  14. Colorado Natural Gas % of Total Residential Deliveries (Percent)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecade Year-0c.+Foot)% of

  15. Colorado Natural Gas Delivered to Commercial Consumers for the Account of

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecade Year-0c.+Foot)%

  16. Kentucky Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot) Decade

  17. Kentucky Natural Gas Gross Withdrawals (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot)%Decade

  18. Kentucky Natural Gas Gross Withdrawals (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot)%DecadeYear

  19. New Hampshire Heat Content of Natural Gas Deliveries to Consumers (BTU per

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office of(Millionthrough,Cubic Foot) Decade Year-0 Year-1

  20. New Hampshire Natural Gas % of Total Residential Deliveries (Percent)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office of(Millionthrough,Cubic Foot) Decade Year-0% of

  1. New Hampshire Natural Gas Delivered to Commercial Consumers for the Account

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office of(Millionthrough,Cubic Foot) Decade Year-0% ofof

  2. New York Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office(Billion CubicProductionFoot) Decade Year-0 Year-1

  3. New York Natural Gas % of Total Residential Deliveries (Percent)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office(Billion CubicProductionFoot) Decade Year-0% of

  4. New York Natural Gas Delivered to Commercial Consumers for the Account of

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office(Billion CubicProductionFoot) Decade Year-0%

  5. Arkansas Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecadeExpectedFoot)

  6. Aspen Global Change Institute (AGCI) Interdisciplinary Science Workshop: Decadal Climate Prediction; Aspen, CO; June 22-28, 2008

    SciTech Connect (OSTI)

    Katzenberger, John

    2010-03-12T23:59:59.000Z

    Decadal prediction lies between seasonal/interannual forecasting and longer-term climate change projections, and focuses on time-evolving regional climate conditions over the next 10?30 yr. Numerous assessments of climate information user needs have identified this time scale as being important to infrastructure planners, water resource managers, and many others. It is central to the information portfolio required to adapt effectively to and through climatic changes.

  7. foote-98.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron4 Self-Scrubbing:,, , ., December 8,John Wagoner,, 2012Temperature

  8. The rapidly evolving field of decadal climate prediction, using initialized climate models to produce time-evolving predictions of regional climate, is producing new results for

    E-Print Network [OSTI]

    , and it is on those time scales of interest to water managers that decadal climate prediction is being appliedThe rapidly evolving field of decadal climate prediction, using initialized climate models to produce time-evolving predictions of regional climate, is producing new results for predictions

  9. Bugs boost Cold War clean-up: Bacteria could scrub uranium from sites contaminated decades ago. updated at midnight GMTtoday is friday, november 14

    E-Print Network [OSTI]

    Lovley, Derek

    2003 · Fungus catches radioactive fallout 8 May 2002 · Depleted uranium soils battlefields 12 MarchBugs boost Cold War clean-up: Bacteria could scrub uranium from sites contaminated decades ago boost Cold War clean-up Bacteria could scrub uranium from sites contaminated decades ago. 13 October

  10. Decades: 1760-1800

    E-Print Network [OSTI]

    Multiple Contributors

    1982-01-01T23:59:59.000Z

    him and he fel t its teeth sl ice i nt o his fles h. Then he was the bat, SOa r i ng in t he ni ght , red-eyed, vicious , bloodth irsty... He didn't qui te wa ke screami ng . But he sat the e t rembling for hour s , hugging hi s pil low, hi...'s uniform came out onto the porch. "I've nothing more to tell you, Li eu tenant." Naomi ' s vo ice floated across the dead lawn, sounding irritable, yet just a shade apprehensive. "And whe re do you say your husband is, Mrs. Collins?" "Away...

  11. Decades of Discovery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration wouldDECOMPOSITION OFSupplementalC. L.Deadly CarcinogenDeborah S. Jin2839

  12. Decades of Discovery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration wouldDECOMPOSITION OFSupplementalC. L.Deadly CarcinogenDeborah S. Jin283948

  13. Old School vs. New School: Status of Threadfin Shad (Dorosoma petenense) Five Decades After Its Introduction to the Sacramento–San Joaquin Delta

    E-Print Network [OSTI]

    Feyrer, Frederick; Sommer, Ted; Slater, Steven B.

    2009-01-01T23:59:59.000Z

    K, Baxter R, Hymanson Z, Sommer T, Gingras?M, Cadrett P.68:51-59. Feyrer F, Nobriga M, Sommer T. 2007. Multi-decadalEcology & Evolution 17:170-176 Sommer T, Armor C, Baxter R,

  14. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    SciTech Connect (OSTI)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26T23:59:59.000Z

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  15. Hawaii Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at1,066,688ElectricityLess than 200Decade Year-0 Year-1Foot) Year

  16. Hawaii Natural Gas % of Total Residential Deliveries (Percent)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at1,066,688ElectricityLess than 200Decade Year-0 Year-1Foot)

  17. Kentucky Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot)

  18. Kentucky Natural Gas % of Total Residential Deliveries (Percent)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot)% of Total

  19. Kentucky Natural Gas Delivered to Commercial Consumers for the Account of

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot)% of

  20. Kentucky Natural Gas Deliveries to Electric Power Consumers (Million Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet) Decade Year-0Foot)%

  1. Alaska Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptemberProcessedDecade Year-0 Year-1Foot) Year

  2. Alaska Maximum Number of Active Crews Engaged in Four-Dimensional Seismic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptemberProcessedDecade Year-0 Year-1Foot)

  3. Alaska Maximum Number of Active Crews Engaged in Seismic Surveying (Number

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptemberProcessedDecade Year-0 Year-1Foot)of

  4. Florida Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,Light-Duty Vehicles, 1975-2004Foot) Decade Year-0

  5. Montana Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office of Coal,CubicWithdrawals6,992 (Million CubicFoot) Decade Year-0 Year-1

  6. Virginia Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year JanThousand CubicFoot) Decade Year-0 Year-1

  7. Virginia Natural Gas % of Total Residential Deliveries (Percent)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year JanThousand CubicFoot) Decade Year-0% of

  8. Virginia Natural Gas Delivered to Commercial Consumers for the Account of

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year JanThousand CubicFoot) Decade Year-0%

  9. Comparing resolved-sideband cooling and measurement-based feedback cooling on an equal footing: analytical results in the regime of ground-state cooling

    E-Print Network [OSTI]

    Kurt Jacobs; Hendra I. Nurdin; Frederick W. Strauch; Matthew James

    2015-03-19T23:59:59.000Z

    We show that in the regime of ground-state cooling, simple expressions can be derived for the performance of resolved-sideband cooling --- an example of coherent feedback control --- and optimal linear measurement-based feedback cooling for a harmonic oscillator. These results are valid to leading order in the small parameters that define this regime. They provide insight into the origins of the limitations of coherent and measurement-based feedback for linear systems, and the relationship between them. These limitations are not fundamental bounds imposed by quantum mechanics, but are due to the fact that both cooling methods are restricted to use only a linear interaction with the resonator. We compare the performance of the two methods on an equal footing --- that is, for the same interaction strength --- and confirm that coherent feedback is able to make much better use of the linear interaction than measurement-based feedback. We find that this performance gap is caused not by the back-action noise of the measurement but by the projection noise. We also obtain simple expressions for the maximal cooling that can be obtained by both methods in this regime, optimized over the interaction strength.

  10. The tale of a modern animal plague: Tracing the evolutionary history and determining the time-scale for foot and mouth disease virus

    SciTech Connect (OSTI)

    Tully, Damien C. [Smurfit Institute of Genetics, Trinity College Dublin (Ireland)], E-mail: dtully@tcd.ie; Fares, Mario A. [Smurfit Institute of Genetics, Trinity College Dublin (Ireland)], E-mail: faresm@tcd.ie

    2008-12-20T23:59:59.000Z

    Despite significant advances made in the understanding of its epidemiology, foot and mouth disease virus (FMDV) is among the most unexpected agricultural devastating plagues. While the disease manifests itself as seven immunologically distinct strains their origin, population dynamics, migration patterns and divergence times remain unknown. Herein we have assembled a comprehensive data set of gene sequences representing the global diversity of the disease and inferred the time-scale and evolutionary history for FMDV. Serotype-specific rates of evolution and divergence times were estimated using a Bayesian coalescent framework. We report that an ancient precursor FMDV gave rise to two major diversification events spanning a relatively short interval of time. This radiation event is estimated to have taken place towards the end of the 17th and the beginning of the 18th century giving us the present circulating Euro-Asiatic and South African viral strains. Furthermore our results hint that Europe acted as a possible hub for the disease from where it successfully dispersed elsewhere via exploration and trading routes.

  11. To be published in Earth, Moon, and Planets from the Proceedings of the First Decadal Review of the Edgeworth-Kuiper-Belt -Towards New Frontiers, European

    E-Print Network [OSTI]

    Richardson, John

    To be published in Earth, Moon, and Planets from the Proceedings of the First Decadal Review CLOUD OBJECTS AT PLASMA TO COSMIC RAY ENERGY JOHN F. COOPER Raytheon Technical Services Company, SSDOO present model flux spectra derived from spacecraft data and models for eV to GeV protons at 40 AU

  12. PV modules, with a life measured in decades, will typically be in place longer than the outdoor unit of a HVAC system.

    E-Print Network [OSTI]

    Johnson, Eric E.

    PV modules, with a life measured in decades, will typically be in place longer than the outdoor and repaired promptly. PV systems suffer gradual degradation that is often not monitored, and the PV array may with copper conductors. On the other hand, PV systems have numerous modules (tens to thousands) and mounting

  13. This study is funded by the National Science Foundation (NSF) through grant EF1049251: "Assessing Decadal Climate Change Impacts on Urban Populations in the Southwestern United States."

    E-Print Network [OSTI]

    Hall, Sharon J.

    Decadal Climate Change Impacts on Urban Populations in the Southwestern United States." Data calibrates a point-scale soil water balance model to available soil moisture data, using historical, despite its notable effects on water, energy and biomass conditions. This omission is noteworthy

  14. [Type a quote from the document or the summary of an interesting point. Juhree's career includes decades of management, consulting, strategic planning, policy

    E-Print Network [OSTI]

    Illinois at Chicago, University of

    [Type a quote from the document or the summary of an interesting point. . Juhree's career includes decades of management, consulting, strategic planning, policy development and coaching at senior levels training has also equipped staff to manage conflict, adapt to new roles and organizational changes

  15. IEEE TRANSACTIONS ON GEOSCIENCE AND REMOTE SENSING, VOL. 52, NO. 7, JULY 2014 4281 A Decade of QuikSCAT Scatterometer

    E-Print Network [OSTI]

    Long, David G.

    IEEE TRANSACTIONS ON GEOSCIENCE AND REMOTE SENSING, VOL. 52, NO. 7, JULY 2014 4281 A Decade of Quik remote sensing, sea ice, SeaWinds. I. INTRODUCTION WIND scatterometers are satellite-borne radars of sea ice impedes heat transfer between the relatively warm ocean and cool at- mosphere. In addition

  16. nature materials | VOL 2 | OCTOBER 2003 | www.nature.com/naturematerials 689 ver the past decade great progress has been made on synthesis of

    E-Print Network [OSTI]

    Zubarev, Eugene

    the past decade great progress has been made on synthesis of nanostructures as a tool-set for new materials containing ZnO nanocrystals as the inorganic component, both phases are oriented in the hybrid materialARTICLES nature materials | VOL 2 | OCTOBER 2003 | www.nature.com/naturematerials 689 O ver

  17. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    SciTech Connect (OSTI)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06T23:59:59.000Z

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses (which are of two bovine types) bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). A timeline for this development is presented in Table 1. The development of the Version 1.0 panel for FMDV rule-out and the most current efforts aimed to designed species specific panels has spanned over 2 1/2 years with multiple collaborative partnerships. This document provides a summary of the development, testing and performance data at OIE Stage 1 Feasibility into Stage 2 Assay Development and Standardization1 (see Table 2), gathered as of June 30th, 2007 for the porcine and bovine MUX assay panels. We present an overview of the identification and selection of candidate genetic signatures, the assay development process, and preliminary performance data for each of the individual signatures as characterized in the multiplexed format for the porcine and bovine panels. The Stage 1 Feasibility data of the multiplexed panels is presented in this report also includes relevant data acquired from the Version 1.0 panel as supporting information where appropriate. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must precede efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available. As a summary report, this document does not provide the details of signature generation, evaluation, and testing, nor does it provide spec

  18. Y-12 through the decades

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the 1950's the nation turned to Y-12 to provide the lithium-6 for the hydrogen or thermonuclear bombs being designed for the Cold War. This unusually difficult task has been...

  19. Final Report for UW-Madison Portion of DE-SC0005301, "Collaborative Project: Pacific Decadal Variability and Central Pacific Warming El Niño in a Changing Climate"

    SciTech Connect (OSTI)

    Vimont, Daniel [University of Wisconsin - Madison

    2014-06-13T23:59:59.000Z

    This project funded two efforts at understanding the interactions between Central Pacific ENSO events, the mid-latitude atmosphere, and decadal variability in the Pacific. The first was an investigation of conditions that lead to Central Pacific (CP) and East Pacific (EP) ENSO events through the use of linear inverse modeling with defined norms. The second effort was a modeling study that combined output from the National Center for Atmospheric Research (NCAR) Community Atmospheric Model (CAM4) with the Battisti (1988) intermediate coupled model. The intent of the second activity was to investigate the relationship between the atmospheric North Pacific Oscillation (NPO), the Pacific Meridional Mode (PMM), and ENSO. These two activities are described herein.

  20. Characterization of timing jitter spectra in free-running mode-locked lasers with 340 dB dynamic range over 10 decades of Fourier frequency

    E-Print Network [OSTI]

    Jung, Kwangyun

    2014-01-01T23:59:59.000Z

    We demonstrate a method that enables accurate timing jitter spectral density characterization of free-running mode-locked laser oscillators over more than 10-decade of Fourier frequency from mHz to tens MHz range. The method is based on analyzing both the input voltage noise to the slave laser and the output voltage noise from the balanced optical cross- correlator (BOC), when two mode-locked lasers are synchronized in repetition rate by the BOC. As a demonstration experiment, timing jitter spectrum of a free-running mode-locked Er-fiber laser with a dynamic range of >340 dB is measured over Fourier frequency ranging from 1 mHz to 38.5 MHz (Nyquist frequency). The demonstrated method can resolve different noise mechanisms that cause specific jitter characteristics in free-running mode-locked laser oscillators for a vast range of time scales from 1000-s.

  1. Impacts of Climate Change and Vegetation Dynamics on Runoff in the Mountainous Region of the Haihe River Basin in the Past Five Decades

    SciTech Connect (OSTI)

    Lei, Huimin; Yang, Dawen; Huang, Maoyi

    2014-04-16T23:59:59.000Z

    Climate and atmospheric CO2 concentration have changed significantly in the mountainous region of the Haihe River basin over the past five decades. In the study, a process-based terrestrial model, version 4 of the Community Land Model (CLM4), was used to quantify the spatiotemporal changes in runoff over the region, driven by the varying climate factors and CO2 concentration. Overall, our simulations suggest that climate-induced change in runoff in this region show a decreasing trend since 1960. Changes in precipitation, solar radiation, air temperature, and wind speed accounts for 56%, -14%, 13%, -5% of the overall decrease in annual runoff, respectively, but their relative contributions vary across the study area. Rising atmospheric CO2 concentration was found to have limited impacts on runoff. Significant decrease in runoff over the southern and northeastern portion of the region is primarily attributed to decreasing precipitation, while decreasing solar radiation and increasing air temperature are the main causes of slight runoff increase in the northern portion. Our results also suggest that the magnitude of decreasing trend could be greatly underestimated if the dynamical interactions of vegetation phenology with the environmental factors are not considered in the modeling, highlighting the importance of including dynamic vegetation phenology in the prediction of runoff in this region.

  2. A Comparison of Multiscale Variations of Decade-long Cloud Fractions from Six Different Platforms over the Southern Great Plains in the United States

    SciTech Connect (OSTI)

    Wu, Wei; Liu, Yangang; Jensen, Michael; Toto, Tami; Foster, Michael J.; Long, Charles N.

    2014-03-27T23:59:59.000Z

    This study investigates 1997-2011 observationally based cloud fraction estimates from different platforms over the Southern Great Plains, United States, including three ground-based estimates and three satellite-based estimates at multiple temporal and spatial scales. They are: 1) the Active Remotely Sensed Clouds Locations (ARSCL); 2) the Total Sky Imager (TSI); 3) the Radiative Flux Analysis (RFA); 4) Geostationary Operational Environmental Satellite (GOES); 5) the International Satellite Cloud Climatology Project (ISCCP); and 6) Advanced Very High Resolution Radiometer Pathfinder Atmospheres Extended (PATMOS-x). A substantial disagreement is evident among different estimates, especially for ISCCP and ARSCL with statistically significant larger cloud fractions than the other estimates. For example, ISCCP and ARSCL mean cloud fractions in January are ~21% and 8% larger than the average from all the other estimates, respectively. Three estimates (ISCCP, ARSCL, GOES) exhibit an 8%-10% overall increase in the annually averaged cloud fractions from 1998 to 2009; the other three estimates (TSI, RFA, and PATMOS-x) exhibit no significant tendency of increase in this decade. Monthly cloud fractions from all the estimates exhibit Gaussian-like distributions while the distributions of daily cloud fractions are dependent on spatial scales. Investigations of high-resolution cloud fractions reveal that the differences stem from the inconsistent definitions of cloud fraction. Findings from this study suggest caution when using observationally based cloud fraction estimates for climate studies, highlighting that the consistency in defining cloud fraction between models and observations is crucial for studying the Earth’s climate.

  3. Final Progress Report: Collaborative Research: Decadal-to-Centennial Climate & Climate Change Studies with Enhanced Variable and Uniform Resolution GCMs Using Advanced Numerical Techniques

    SciTech Connect (OSTI)

    Fox-Rabinovitz, M; Cote, J

    2009-06-05T23:59:59.000Z

    The joint U.S-Canadian project has been devoted to: (a) decadal climate studies using developed state-of-the-art GCMs (General Circulation Models) with enhanced variable and uniform resolution; (b) development and implementation of advanced numerical techniques; (c) research in parallel computing and associated numerical methods; (d) atmospheric chemistry experiments related to climate issues; (e) validation of regional climate modeling strategies for nested- and stretched-grid models. The variable-resolution stretched-grid (SG) GCMs produce accurate and cost-efficient regional climate simulations with mesoscale resolution. The advantage of the stretched grid approach is that it allows us to preserve the high quality of both global and regional circulations while providing consistent interactions between global and regional scales and phenomena. The major accomplishment for the project has been the successful international SGMIP-1 and SGMIP-2 (Stretched-Grid Model Intercomparison Project, phase-1 and phase-2) based on this research developments and activities. The SGMIP provides unique high-resolution regional and global multi-model ensembles beneficial for regional climate modeling and broader modeling community. The U.S SGMIP simulations have been produced using SciDAC ORNL supercomputers. Collaborations with other international participants M. Deque (Meteo-France) and J. McGregor (CSIRO, Australia) and their centers and groups have been beneficial for the strong joint effort, especially for the SGMIP activities. The WMO/WCRP/WGNE endorsed the SGMIP activities in 2004-2008. This project reflects a trend in the modeling and broader communities to move towards regional and sub-regional assessments and applications important for the U.S. and Canadian public, business and policy decision makers, as well as for international collaborations on regional, and especially climate related issues.

  4. FOUR DECADES OF IRC +10216: EVOLUTION OF A CARBON-RICH DUST SHELL RESOLVED AT 10 {mu}m WITH MMT ADAPTIVE OPTICS AND MIRAC4

    SciTech Connect (OSTI)

    Males, Jared R.; Close, Laird M.; Skemer, Andrew J.; Hinz, Philip M.; Hoffmann, William F. [Steward Observatory, Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States); Marengo, Massimo, E-mail: jrmales@email.arizona.edu [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)

    2012-01-10T23:59:59.000Z

    The evolved carbon-rich asymptotic giant branch star IRC +10216 (CW Leo) is the brightest mid-infrared source outside the solar system, as well as one of the closest examples of an evolved star losing mass. It has a complex and variable circumstellar structure on small scales in the near-infrared, and mid-infrared interferometry has revealed a dynamic dust formation zone. We have obtained diffraction-limited imaging and grism spectroscopy of IRC +10216 at the 6.5 m MMT in the N band ({approx}8-13 {mu}m). These new observations show that a change has occurred in the dust shell surrounding IRC +10216 over the last two decades, which is illustrated by a change in the apparent shape of the well-known SiC spectral feature at {approx}11 {mu}m and a reduction in the continuum at 13 {mu}m. As expected, our diffraction-limited spatial information shows an extended circumstellar envelope. We also demonstrate that the dusty envelope appears to be {approx}30% larger at the wavelengths of the SiC feature, likely due to the increased opacity of SiC. The deconvolved full width at half-maximum of the object increases from 0.''43 ({approx} 56 AU) for {lambda} < 10 {mu}m to 0.''58 ({approx}75 AU) at 11.8 {mu}m, then decreases to 0.''5 ({approx}65 AU) at 12.7 {mu}m. Our estimates of IRC +10216's size allow us to plausibly tie the change in the spectrum over the last 12.5 years to the evolution of the dusty circumstellar envelope at speeds of 12-17 km s{sup -1}.

  5. For the last decades, cement technologies encountered a very rapid evolution following the will to always built quicker with more efficient materials. The additional young appearance of ecological trends pushed cement industries to an adaption and improve

    E-Print Network [OSTI]

    Dalang, Robert C.

    For the last decades, cement technologies encountered a very rapid evolution following pushed cement industries to an adaption and improvement of their production methods in order to mini of the cement with supplementary cementitious mate- rials (SCMs) being generally waste from other industries

  6. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    SciTech Connect (OSTI)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06T23:59:59.000Z

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  7. P h y s i c a l O c e a n o g r a p h y D i v i s i o n Role of Mesoscale Eddies on Decadal Variability of the South

    E-Print Network [OSTI]

    P h y s i c a l O c e a n o g r a p h y D i v i s i o n Role of Mesoscale Eddies on Decadal representation of mesoscale eddies in the ocean. Therefore, the impact of mesoscale eddies on climate variability the mesoscale eddies are properly parameterized in CMIP5 models. Our overall goal is to explore the impact

  8. Vennetier M. ; Ripert C. (2010) Climate change impact on vegetation: lessons from an exceptionally hot and dry decade in South-eastern France. In: Climate Change and variability, (eds Simlard S.W. ; Austin M.E.), Sciyo, Rijeka, Croatia, p. 225-241.

    E-Print Network [OSTI]

    Boyer, Edmond

    Vennetier M. ; Ripert C. (2010) Climate change impact on vegetation: lessons from an exceptionally hot and dry decade in South-eastern France. In: Climate Change and variability, (eds Simlard S°13 Climate change impact on vegetation: lessons from an exceptionally hot and dry decade in south

  9. Foot-conditioned phonotactics and prosodic constituency

    E-Print Network [OSTI]

    Bennett, Ryan Thomas

    2012-01-01T23:59:59.000Z

    constituency by Ryan T. Bennett There has been a recurrentin LINGUISTICS by Ryan T. Bennett September 2012 TheDissertation of Ryan T. Bennett is approved: Professor Junko

  10. Evaluation of environmental foot printing techniques

    E-Print Network [OSTI]

    Conway, John J., M.B.A. Massachusetts Institute of Technology

    2012-01-01T23:59:59.000Z

    With a growing focus on sustainability many companies are proactively assessing their product and supply chain footprints. Cisco is a leader in the ICT (Information and Communications Technology) industry and is working ...

  11. LittleFoot Energy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |Jilin ZhongdiantouLichuan CityLiqcrytech LLC JumpListLittle Sioux

  12. 8, 20132059, 2008 Decadal trends in

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    a general decline in the level of NOx emissions in Western and Central European countries (France, Ger-10 instead of the positive ones in the "bottom-up" inventory are found for the Balkan countries, Russia

  13. Y-12 and the 2000 decade ? Modernization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Y-12 made its mark on history with its role in the Manhattan Project to help win World War II and supported the nation through the winning of the Cold War. In the last 30 years,...

  14. Clean energy partnerships: A decade of success

    SciTech Connect (OSTI)

    None

    2000-03-01T23:59:59.000Z

    This report contains a partial catalog of recent accomplishments of the U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy (EERE)in collaboration with its many private- and public-sector partners. This compendium of success stories illustrates the range and diversity of EERE programs and achievements. Part of an ongoing effort, the principal goal of this collection is to provide stakeholders with the evidence they need to assess the value they are receiving from investments in these DOE programs. The report begins with an introduction and a description of the methodology. It then presents an overview of the accomplishments of EERE programs. This is followed by the stories themselves.

  15. Renewable Electricity: Insights for the Coming Decade

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    actually change over that time, so the results should be considered as one view of the future. The estimated costs used in this study were taken from a combination of literature...

  16. A DECADE OF DISCOVERY THE COMMON FUND

    E-Print Network [OSTI]

    Rau, Don C.

    that transcended the individual NIH Institutes and Centers, known collectively as the "NIH Roadmap." This novel Roadmap was a bold set of programs designed to transform medical research capabilities and speed the movement of research from the laboratory to the patient's bedside. The Roadmap consisted of a compelling

  17. 5, 16791731, 2005 Two decades of OH

    E-Print Network [OSTI]

    of chemically active species, such as methane, requires a good knowledge of OH variability. As OH can hardly which methane (CH4), carbon monoxide (CO), Non Methane Hydro- carbons, and halogenated species has already been employed by several authors to infer OH fields5 based on different m

  18. Superfund reauthorization: A decade of experience

    SciTech Connect (OSTI)

    Casper, B.; Mathie, S.K.; Epstein, F. [Booz Allen and Hamilton Inc., Bethesda, MD (United States)

    1994-12-31T23:59:59.000Z

    Since its passage in 1980, the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) has provided the US Environmental Protection Agency a tool for combating threats to human health and the environment resulting from hazardous wastes. As times have changed, so has the program. The 1986 Superfund Amendments and Reauthorization Act (SARA) changed CERCLA for the first time. The time has come to change the bill again. Many proposals for Superfund reform have been debated in Congress. These debates have focused in large part on the following aspects of the program: community involvement; State involvement; liability; and remedy selection. By focusing on these areas, and making changes where needed, the program can build upon lessons learned and chart a course for the future.

  19. ALICE ATLAS Cover 3 decades of energy

    E-Print Network [OSTI]

    = nuclear particles = mesons, baryons Courtesy Nat. Geographic, Vol. 185, No. 1, 1994 ­ Graphics by Chuck Harris (Yale) 6th Odense Winter School on Theoretical Physics, 20 Quark-Gluon Plasma · Standard Model?" #12;How to Make Quark Soup!! Nuclear particles (quarks are confined) Melt the particlesQuark Gluon

  20. DECADE_for Internet.indd

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM | Department ofCommunications3Department of

  1. Decades of Wind Turbine Load Simulation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration wouldDECOMPOSITION OFSupplementalC. L.Deadly CarcinogenDeborah S.

  2. Abstract: The challenges in nuclear safeguards and in nuclear security have significantly changed over the last decades. On the one side nuclear safeguards evolved from the simple verifica9on of declared amounts of material to a more informa9on driven app

    E-Print Network [OSTI]

    Abstract: The challenges in nuclear safeguards and in nuclear security have significantly changed over the last decades. On the one side nuclear safeguards evolved-doctoral researcher where he analysed dissolu9on residues from reprocessing of nuclear fuels

  3. U.S. Nominal Cost per Foot of Crude Oil Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)Oil Wells

  4. U.S. Nominal Cost per Foot of Dry Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)OilDry Wells

  5. U.S. Nominal Cost per Foot of Natural Gas Wells Drilled (Dollars per Foot)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)OilDry

  6. Highlights from ThreeHighlights from Three Decades of Loblolly PineDecades of Loblolly Pine

    E-Print Network [OSTI]

    Payne''s Flying Services Flying Service Smurfit CartSmurfit Cartóón de Venezuelan de Venezuela Synagro

  7. Final Progress Report submitted via the DOE Energy Link (E-Link) in June 2009 [Collaborative Research: Decadal-to-Centennial Climate & Climate Change Studies with Enhanced Variable and Uniform Resolution GCMs Using Advanced Numerical Techniques

    SciTech Connect (OSTI)

    Fox-Rabinovitz, M; Cote, J

    2009-10-09T23:59:59.000Z

    The joint U.S-Canadian project has been devoted to: (a) decadal climate studies using developed state-of-the-art GCMs (General Circulation Models) with enhanced variable and uniform resolution; (b) development and implementation of advanced numerical techniques; (c) research in parallel computing and associated numerical methods; (d) atmospheric chemistry experiments related to climate issues; (e) validation of regional climate modeling strategies for nested- and stretched-grid models. The variable-resolution stretched-grid (SG) GCMs produce accurate and cost-efficient regional climate simulations with mesoscale resolution. The advantage of the stretched grid approach is that it allows us to preserve the high quality of both global and regional circulations while providing consistent interactions between global and regional scales and phenomena. The major accomplishment for the project has been the successful international SGMIP-1 and SGMIP-2 (Stretched-Grid Model Intercomparison Project, phase-1 and phase-2) based on this research developments and activities. The SGMIP provides unique high-resolution regional and global multi-model ensembles beneficial for regional climate modeling and broader modeling community. The U.S SGMIP simulations have been produced using SciDAC ORNL supercomputers. The results of the successful SGMIP multi-model ensemble simulations of the U.S. climate are available at the SGMIP web site (http://essic.umd.edu/~foxrab/sgmip.html) and through the link to the WMO/WCRP/WGNE web site: http://collaboration.cmc.ec.gc.ca/science/wgne. Collaborations with other international participants M. Deque (Meteo-France) and J. McGregor (CSIRO, Australia) and their centers and groups have been beneficial for the strong joint effort, especially for the SGMIP activities. The WMO/WCRP/WGNE endorsed the SGMIP activities in 2004-2008. This project reflects a trend in the modeling and broader communities to move towards regional and sub-regional assessments and applications important for the U.S. and Canadian public, business and policy decision makers, as well as for international collaborations on regional, and especially climate related issues.

  8. alters foot mobility: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ja (more) Nousiainen, Sari 2013-01-01 57 Theoretical Mobility Analysis of Ion Mobility Spectrometry Physics Websites Summary: Results Theoretical Mobility Analysis of Ion...

  9. Successful treatment of hand and foot psoriasis with infliximab

    E-Print Network [OSTI]

    Lernia, Vito Di; Guareschi, Elisa

    2010-01-01T23:59:59.000Z

    pustular psoriasis (PPP) may be a distinct entity inmay be successful in PPP [ 9 , 10 , 11 ]. Infliximab hasin localized recalcitrant PPP [ 14 ]. Here we present four

  10. american orthopaedic foot: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Berdichevsky, Victor 12 Orthopaedic Health, Conformation and Longevity in Riding Horses Multidisciplinary Databases and Resources Websites Summary: Orthopaedic Health,...

  11. ames 11-foot transonic: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Congress and Exposition (IMECE), IMECE Combustion System for a Silicon Micro Gas Turbine Engine," Journal of Microelectromechanical Systems, Volume 432 Leopold Center...

  12. Passive dynamic walking with knees : a point foot model

    E-Print Network [OSTI]

    Hsu Chen, Vanessa F. (Vanessa Fang)

    2007-01-01T23:59:59.000Z

    In this thesis, a hybrid model for a passive 2D walker with knees and point feet is presented. The step cycle of the model has two phases of continuous dynamics: one with an unlocked knee configuration and a second one ...

  13. Foote Creek Rim I Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources JumpI

  14. Foote Creek Rim II Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources JumpIII

  15. Foote Creek Rim III Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy Resources

  16. Foote Creek Rim IV Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489Information HydroFontana, California: Energy ResourcesIV Wind

  17. DOE - Office of Legacy Management -- Foote Mineral Co - PA 27

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTable ofArizonaBuffalo -Elk River ReactorProject

  18. Foote Creek Rim Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump to:ar-80m.pdfFillmoreGabbs Valley Area(Sasada, 1988)PevafersaType

  19. Hand, Foot, and Mouth Disease Hand, Foot, and Mouth Disease (HFMD) is an illness caused by a virus. It is

    E-Print Network [OSTI]

    through bodily fluids, which include: nose secretions (coughs, sneezes, runny nose, contaminated surfaces), saliva (coughs, sneezes, drool, mouthing toys, contaminated surfaces), blister fluids (blisters drain

  20. Price of U.S. Liquefied Natural Gas Imports From Indonesia (Dollars...

    Gasoline and Diesel Fuel Update (EIA)

    Indonesia (Dollars per Thousand Cubic Feet) Price of U.S. Liquefied Natural Gas Imports From Indonesia (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...

  1. Liquefied U.S. Natural Gas Re-Exports to Japan (Million Cubic...

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2010's 2,822 2,741 5,037 0...

  2. Liquefied U.S. Natural Gas Re-Exports to Spain (Million Cubic...

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 0 0 0 2010's 4,117 5,918...

  3. Natural Gas Citygate Price in Wyoming (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecadeDecade Year-0Decade Year-0Decade

  4. ICTD Interventions: Trends Over the Last Decade Christopher Chepken

    E-Print Network [OSTI]

    Blake, Edwin

    . The seven variables include: telecommunication, terminal device, target group, domain area, region, research which are further broken down into seven variables used to categorize projects over this period, development and research. These dimensions are broken down into seven variables namely: terminal device

  5. A Decade of Giant Earthquakes - What does it mean?

    SciTech Connect (OSTI)

    Wallace, Terry C. Jr. [Los Alamos National Laboratory

    2012-07-16T23:59:59.000Z

    On December 26, 2004 the largest earthquake since 1964 occurred near Ache, Indonesia. The magnitude 9.2 earthquake and subsequent tsunami killed a quarter of million people; it also marked the being of a period of extraordinary seismicity. Since the Ache earthquake there have been 16 magnitude 8 earthquakes globally, including 2 this last April. For the 100 years previous to 2004 there was an average of 1 magnitude 8 earthquake every 2.2 years; since 2004 there has been 2 per year. Since magnitude 8 earthquakes dominate global seismic energy release, this period of seismicity has seismologist rethinking what they understand about plate tectonics and the connectivity between giant earthquakes. This talk will explore this remarkable period of time and its possible implications.

  6. Energy in the '80s: decade of decision

    SciTech Connect (OSTI)

    Not Available

    1980-06-01T23:59:59.000Z

    This proceeding includes the six papers presented at the Public Awareness Symposium plus the WATTEC/Engineers' Week banquet address on nuclear power by Dr. Harold M. Agnew of General Atomic Co.; these presentations on the final day, February 22, concluded the 1980 WATTEC conference. A separate abstract was prepared for each paper and for the banquet address.

  7. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    improvements through its “Six Sigma” program. 9 From 2001 toWarranty Provisions Six Sigma is a quality improvement tool

  8. A Decade of Progress in Constraint Modelling and Reformulation

    E-Print Network [OSTI]

    St Andrews, University of

    and Automation Alan M Frisch Artificial Intelligence Group Dept of Computer Science University ofYork 1 #12 Languages: Direct Systems · Inherited from GAMS and MGG mathematical programming languages. Later AMPL to be specified separately. This is used to specify instances. t = 12 1. Base Case: 2. Parameterise: 3. Lift: 10

  9. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    Dissecting Wind Turbine Costs. ” WindStats Newsletter, vol.A. Laxson. 2006. Wind Turbine Design Cost and Scaling Model.they can impact wind turbine costs but fall mostly outside

  10. Energy technology X: a decade of progress. Proceedings

    SciTech Connect (OSTI)

    Hill, R.F. (ed.)

    1983-06-01T23:59:59.000Z

    The characterization, development, and availability of various energy sources for large scale energy production are discussed. Attention is given to government, industry, and international policies on energy resource development and implementation. Techniques for energy analysis, planning, and regulation are examined, with consideration given to conservation practices, military energy programs, and financing schemes. Efficient energy use is examined, including energy and load management, building retrofits, and cogeneration installations, as well as waste heat recovery. The state of the art of nuclear, fossil, and geothermal power extraction is investigated, with note taken of synthetic fuels, fluidized bed combustion, and pollution control in coal-powered plants. Finally, progress in renewable energy technologies, including solar heating and cooling, biomass, and large and small wind energy conversion devices is described.

  11. Over the past decade, lighting became more efficient across all...

    Broader source: Energy.gov (indexed) [DOE]

    of light output (in lumen-hours) provided by each lamp type. "Other" includes light-emitting diode (LED) lamps as well as other lamps such as fiber optic lights, induction lamps,...

  12. Pedigree evaluation of four decades of quarter horse breeding

    E-Print Network [OSTI]

    Tunnell, Jo Ann

    1981-01-01T23:59:59.000Z

    to be influential ancestors, and those that appeared as influential in more than one of the samples were King, Zantanon, Old Sorrel~ Little Joe, 1'~d. dnight, Hickory Bill, and Peter NcCue, Average coefficients of inbreeding and inter se relationship were... evident until many gener- ations have passed which or how many of the original foundation animals were in reality the influential foundation sires (Rhoad, 196lb) ~ Peter McCue and Traveler have been identified as the most prominent ancestors...

  13. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    embodied in wind turbine materials (6.37 GJ/kW) from the3.5-3.7). Wind turbines are material-intensive. Eachmanufacturing these materials into turbine components may

  14. Understanding Trends in Wind Turbine Prices Over the Past Decade

    SciTech Connect (OSTI)

    Bolinger, Mark; Wiser, Ryan

    2011-10-26T23:59:59.000Z

    Taking a bottom-up approach, this report examines seven primary drivers of wind turbine prices in the United States, with the goal of estimating the degree to which each contributed to the doubling in turbine prices from 2002 through 2008, as well as the subsequent decline in prices through 2010 (our analysis does not extend into 2011 because several of these drivers are best gauged on a full-year basis due to seasonality issues). The first four of these drivers can be considered, at least to some degree, endogenous influences – i.e., those that are largely within the control of the wind industry – and include changes in: 1) Labor costs, which have historically risen during times of tight turbine supply; 2) Warranty provisions, which reflect technology performance and reliability, and are most often capitalized in turbine prices; 3) Turbine manufacturer profitability, which can impact turbine prices independently of costs; and 4) Turbine design, which for the purpose of this analysis is principally manifested through increased turbine size. The other three drivers analyzed in this study can be considered exogenous influences, in that they can impact wind turbine costs but fall mostly outside of the direct control of the wind industry. These exogenous drivers include changes in: 5) Raw materials prices, which affect the cost of inputs to the manufacturing process; 6) Energy prices, which impact the cost of manufacturing and transporting turbines; and 7) Foreign exchange rates, which can impact the dollar amount paid for turbines and components imported into the United States.

  15. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    cost of electricity (“LCOE”) generated by the turbine, basedthe capacity factor and LCOE estimates in Figure 8 meritcapacity factor and decline in LCOE shown in Figure 8 could

  16. Computational Mechanics: The Next Decade Drewberry Hall, Johnson Center

    E-Print Network [OSTI]

    Löhner, Rainald

    System ­ An Overview Perumal Nithiarasu School of Engineering, Swansea University, Swansea, Wales, UK Hydrodynamics/Hydraulics Do Analytical Methods Have A Future? Francis Noblesse NSWC-CD, Potomac, MD The Future Dynamics, GMU, Fairfax, VA Hydrodynamics vs. Hydraulics: An Old Controversy Yet to be Settled in Flow

  17. Three Versions of Russian Decadent Dandyism: Demonism, Hellenism, and Theatricality

    E-Print Network [OSTI]

    BYUN, YOUNG JIN

    2012-01-01T23:59:59.000Z

    W. (1984). Byron: A poet before his public. Cambridge, MA:Cultural myths of the modern poet. Cambridge, MA: HarvardBlok kak chelovek i poet: Vvedenie v poeziiu Bloka.

  18. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    the reported energy consumption data for the transport phaseAs such, the energy consumption data used in this sectionDetailed “end-use” energy consumption data reported in the “

  19. Y-12 and the 2000 decade ? infrastructure reduction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    When BWXT Y-12 (now B&W Y-12) won the contract to manage and operate Y-12 in 2000, taking over in November, 2000, one of the main elements in their winning proposal was the idea...

  20. Will new disposal regulations undo decades of progress?

    SciTech Connect (OSTI)

    Ward, J. [John Ward Inc. (United States)

    2009-07-01T23:59:59.000Z

    In 1980, the Belville Amendments to RCRA instructed EPA to 'conduct a detailed and comprehensive study and submit a report' to Congress on the 'adverse effects on human health and the environment, if any, of the disposal and utilization' of coal ash. In both 1988 and 1999, EPA submitted reports to Congress and recommended coal ash should not be regulated as hazardous waste. After the failure of a Tennesse power plant's coal ash disposal facility, EPA will be proposing new disposal regulations.

  1. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    consumption of a variety of primary energy sources – including hard coal, lignite (soft coal), crude oil,

  2. A systems analysis of solar power potential in coming decades

    E-Print Network [OSTI]

    Bateman, Chris (Chris B.)

    2007-01-01T23:59:59.000Z

    Energy is a very important aspect of human life. In the past few centuries, energy consumption has increased dramatically to a point where humans are very much dependant of energy. Under the current nonrenewable energy ...

  3. Nine decades of decreasing phenotypic variability in Atlantic cod

    E-Print Network [OSTI]

    Carlson, Stephanie

    complex trait changes in Atlantic cod along the Norwegian Skagerrak coast: (i) an annual beach seineÕs Skagerrak coast (Fig. 1). The Skagerrak coastal cod have been the subject of scientific inquiry for nearly capture­mark­ recapture data collected on coast

  4. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    A. Zervos. 2011a. “Wind Energy. ” In IPCC Special Report onWashington, D.C. : American Wind Energy Association. Aubrey,Innovation and the price of wind energy in the US. ” Energy

  5. Energy Exchange: Federal Sustainability for the Next Decade

    Broader source: Energy.gov [DOE]

    The 2015 Energy Exchange in Phoenix, Arizona, is being launched to provide two-and-a-half days of structured training to employees from federal agencies, both civilian and military, who are working to improve facility performance, advance the use of renewable energy, and reduce greenhouse gas emissions.

  6. Decadal variability of the Atlantic Meridional Overturning Circulation

    E-Print Network [OSTI]

    Buckley, Martha Weaver

    2011-01-01T23:59:59.000Z

    In the mean, the Atlantic Ocean transports 1 to 1.5 PW of heat northward, and estimates suggest that 60% of this heat transport is associated with a circulation that reaches the cold waters of the abyss. Due to the role ...

  7. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    Mark Bolinger. 2011. 2010 Wind Technologies Market Report.G. Sinden, A. Zervos. 2011a. “Wind Energy. ” In IPCC SpecialWashington, D.C. : American Wind Energy Association. Aubrey,

  8. aerosol modeling decadal: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy System (CERES) 20 experiment. Index Terms--Remote sensing, satellites, solar energy, solar radiation. I. INTRODUCTION BEGINNING Christopher, Sundar A. 49 A spherical...

  9. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    Innovation and the price of wind energy in the US. ” Energythe impact of energy price changes on wind turbine prices.Costs 3.6 Energy Prices Life-cycle analyses of wind projects

  10. Performing Perversion: Decadence in Twentieth-Century Chinese Literature

    E-Print Network [OSTI]

    Wang, Hongjian

    2012-01-01T23:59:59.000Z

    the image of clouds: The white cloud sleeps in the sky-bed,tuijiadang” to the white cloud’s infidelity and promiscuity,his description of the white cloud’s “tuijiadang” behaviors

  11. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    interconnection – both of which are assumed to fall outside of the scope of most turbine supply agreements

  12. astronomy decadal survey: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and multicolour star count surveys. The near infrared (NIR) members of these surveys (Eaton et al 79 Thread Safe Astronomy Astrophysics (arXiv) Summary: Observational astronomy...

  13. Underwater Computer Vision: Two Decades of Traditional Approaches

    E-Print Network [OSTI]

    Treuille, Adrien

    waters). Why is vision difficult in underwater? environment lighting medium Sensor & sensor platform #12) Why is vision difficult in underwater? environment lighting medium Sensor & sensor platform #12;7 Why is vision difficult in underwater? environment lighting medium Sensor & sensor platform 4. Poor positioning

  14. NREL: News Feature - Assuring Solar Modules Will Last for Decades

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Laboratory (NREL) is co-leading an international push to assure the reliability of solar panels-an assurance demanded by customers, manufacturers, lenders, and utilities....

  15. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    Developments in the Levelized Cost of Energy from U.S. Windleft scale) Levelized Cost of Energy (right scale) COD:

  16. decades. Worldwide, there are at least nine different populations

    E-Print Network [OSTI]

    . In some instances, the adaptive function of behaviour matching is less obvious. Contagious yawning ancestry. Human yawning is also contagious to dogs, but it is not yet known whether dogs affect each other

  17. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    driven down wind energy costs (for a brief survey of themore on driving the cost of wind energy lower, regardless ofstill, whether the cost of wind energy continues down the

  18. General Theory of Relativity: Will it survive the next decade?

    E-Print Network [OSTI]

    Orfeu Bertolami; Jorge Paramos; Slava G. Turyshev

    2006-07-10T23:59:59.000Z

    The nature of gravity is fundamental to our understanding of our own solar system, the galaxy and the structure and evolution of the Universe. Einstein's general theory of relativity is the standard model that is used for almost ninety years to describe gravitational phenomena on these various scales. We review the foundations of general relativity, discuss the recent progress in the tests of relativistic gravity, and present motivations for high-accuracy gravitational experiments in space. We also summarize the science objectives and technology needs for the laboratory experiments in space with laboratory being the entire solar system. We discuss the advances in our understanding of fundamental physics anticipated in the near future and evaluate discovery potential for the recently proposed gravitational experiments.

  19. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    Hand, A. Laxson. 2006. Wind Turbine Design Cost and Scalingof a Multi-MegaWatt Wind Turbine. ” Renewable Energy, vol.David. 2008. “Dissecting Wind Turbine Costs. ” WindStats

  20. HELLO ALUMNI! own through the decades, NJIT alumni have

    E-Print Network [OSTI]

    Bieber, Michael

    that leads to this success. There are many ways to help, among them sharing your own career insights for helping to make NJIT an even more vibrant learning community, this password-protected portal is your point What's new? Do you have a new job, addition to your family, honor, award or publication to share? We

  1. Closest Type Ia Supernova in Decades Solves a Cosmic Mystery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    PTF 11kly as it appeared in the nearby M101 galaxy. (Images: Peter Nugent) Type Ia supernovae (SN Ia's) are the extraordinarily bright and remarkably similar "standard candles"...

  2. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    of wind energy lower, regardless of the policy environment.price of wind energy in the US. ” Energy Policy, Volume 37,

  3. Y-12 and the 2000 decade ? Modernization to Transformation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Transformation Tom Smith, who for a number of years has led the forward thinking and long-range planning functions at Y-12, observed the following about the Infrastructure...

  4. Y-12 and the 2000 decade ? Modernization to Transformation,...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    "Two moderate level line item projects were proposed, Quality Evaluation Relocation and Depleted Uranium Upgrades, but could never get funding traction. Realizing the benefits of...

  5. OceanAtmosphere Interactions on Interannual to Decadal

    E-Print Network [OSTI]

    Vuille, Mathias

    , and the land surface and the biosphere. Ocean­atmosphere interac- tions include exchanges of energy (i.e., radia- tive transfer and heat fluxes), momentum (i.e., wind stress), water (i.e., precipitation temperature shows high power at all time scales. This variation in behavior is the funda- mental cause of many

  6. The decadal mean ocean circulation and Sverdrup balance

    E-Print Network [OSTI]

    Wunsch, Carl

    Elementary Sverdrup balance is tested in the context of the time-average of a 16-year duration time-varying ocean circulation estimate employing the great majority of global-scale data available between 1992 and 2007. The ...

  7. Understanding Trends in Wind Turbine Prices Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2012-01-01T23:59:59.000Z

    cycle assessment of a wind farm and related externalities. ”and onshore sited wind farms. Document number 200128,

  8. ARM - Publications: Science Team Meeting Documents: A decade long aerosol

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa-Anomalous Radiative AbsorptionARM In TheACloudStatus,New ConceptsARMandModel forand

  9. New Book Updates INL's History, Documents a Decade of Transformation |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for Renewable Energy:Nanowire Solar541,9337, 2011R - 445 CU - 2 3 1 Nevis

  10. Assuring Solar Modules Will Last for Decades - News Feature | NREL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProductsAlternativeOperational ManagementDemand Module This Assurance

  11. The First Decade, 2003 - 2013 | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof Energy 2, 2015 - JanuaryTank 48HPublic Dissemination ofSecurity |The Fifth CleanThe

  12. Closest Type Ia Supernova in Decades Solves a Cosmic Mystery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t zManufacturing:DOE National LaboratoryLabNew

  13. Celebrating a Decade of Carbon Storage Research Through Partnership |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJuneWasteDepartment of Energy Below isCharles

  14. Energy Intensity of Federal Buildings Slashed 25% in Past Decade |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny:RevisedAdvisoryStandard |in STEMEnergyI.ofTrack 1 TrackDepartment ofDepartment

  15. The US Geothermal Industry: Three Decades of Growth | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-f <MaintainedInformation 2EnergyCityGreenElectricity

  16. The First Decade, 2003 - 2013 | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOriginEducationVideoStrategic| DepartmentDepartmentTheEnergy TheClean TechThe Fifth CleanThe

  17. Iowa Natural Gas Underground Storage Net Withdrawals (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0Decade Year-0 Year-1DecadeDecade Year-0

  18. Iowa Natural Gas Underground Storage Withdrawals (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0Decade Year-0 Year-1DecadeDecade Year-0

  19. Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,128 2,469Decade Year-0 Year-1Feet) Decade Year-0Decade

  20. Nebraska Natural Gas Marketed Production (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office of(Millionthrough, 2002Decade Year-0Decade Year-0

  1. Nebraska Natural Gas Marketed Production (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office of(Millionthrough, 2002Decade Year-0Decade Year-0Year

  2. Natural Gas Citygate Price in Wisconsin (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecadeDecade Year-0Decade Year-0

  3. Louisiana Natural Gas Underground Storage Capacity (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office of Coal,Cubic Feet)FuelDecade Year-0Input (MillionDecade Year-0Decade

  4. OFFICE OF RESPONSE AND RESTORATION EMERGENCY RESPONSE DIVISION Other Significant Oil Spills

    E-Print Network [OSTI]

    in the Gulf of Mexico While there have been many oil spills in the Gulf of Mexico in past decades, six stand impact: Ixtoc The largest oil spill in North America occurred in the Gulf of Mexico. The 200- foot, Louisiana, spilling 65,500 barrels (2.7 million gallons) of Venuzuelan crude oil into the Gulf of Mexico

  5. Iowa Natural Gas Residential Consumption (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0Decade Year-0 Year-1Decade Year-0

  6. Iowa Natural Gas Total Consumption (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0Decade Year-0 Year-1Decade Year-0Total

  7. Alabama Natural Gas Underground Storage Withdrawals (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS8) Distribution Category UC-950 Cost and Quality of Fuels forA 6 J 9 U B u oDecade Year-0Decade Year-0

  8. Alabama Natural Gas Underground Storage Withdrawals (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS8) Distribution Category UC-950 Cost and Quality of Fuels forA 6 J 9 U B u oDecade Year-0Decade Year-0Year

  9. Arizona Natural Gas Industrial Consumption (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion CubicPotentialNov-14 Dec-14Decade Year-0 Year-1Decade Year-0

  10. Delaware Natural Gas Deliveries to Electric Power Consumers (Million Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,128 2,469Decade Year-0 Year-1Feet) Decade Year-0 Year-1

  11. Delaware Natural Gas Industrial Consumption (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,128 2,469Decade Year-0 Year-1Feet) Decade Year-0

  12. Arizona Natural Gas Gross Withdrawals from Gas Wells (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year Jan Feb Mar AprDecade Year-0

  13. Arizona Nonhydrocarbon Gases Removed from Natural Gas (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0 Year-1 Year-2

  14. Arizona Nonhydrocarbon Gases Removed from Natural Gas (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0 Year-1

  15. Arizona Price of Natural Gas Delivered to Residential Consumers (Dollars

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0 Year-1per

  16. Arizona Price of Natural Gas Sold to Commercial Consumers (Dollars per

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0

  17. Arkansas Associated-Dissolved Natural Gas, Wet After Lease Separation,

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0Proved Reserves

  18. Arkansas Coalbed Methane Production (Billion Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0Proved

  19. Arkansas Coalbed Methane Proved Reserves (Billion Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0ProvedProved

  20. Arkansas Crude Oil + Lease Condensate Proved Reserves (Million Barrels)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year JanDecade Year-0ProvedProved+

  1. Arkansas Natural Gas Gross Withdrawals from Shale Gas (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecade Year-0 Year-1Year% of TotalFeet)Decade Year-0

  2. Wyoming Natural Gas Industrial Consumption (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,397 125 Q 69 (MillionAdjustments (BillionDecade Year-0Decade Year-0

  3. Virginia Natural Gas Removed from Natural Gas (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 34 44Year JanDecade Year-0 Year-1 Year-2 (MillionDecade Year-0

  4. Virginia Natural Gas Removed from Natural Gas (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 34 44Year JanDecade Year-0 Year-1 Year-2 (MillionDecade Year-0Year

  5. Virginia Natural Gas Underground Storage Net Withdrawals (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 34 44Year JanDecade Year-0 Year-1 Year-2Feet) Decade Year-0

  6. Price of U.S. Natural Gas Exports (Dollars per Thousand Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocks Nov-14 Dec-14Table 4. U.S.Feet) Decade Year-0Decade Year-0

  7. U.S. Natural Gas Gross Withdrawals from Gas Wells (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are nowTotal" (Percent) Type: Sulfur Content API GravityDakota" "Fuel, quality",Area: U.S. East Coast (PADD 1) New EnglandReservesCubicDecade Year-0Decade Year-0

  8. Natural Gas Citygate Price in Iowa (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb Mar AprYearDecade Year-0Decade Year-0

  9. Natural Gas Citygate Price in New York (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecade Year-0 Year-1Decade Year-0

  10. Natural Gas Citygate Price in Oklahoma (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecade Year-0Decade Year-0 Year-1

  11. Natural Gas Citygate Price in Oregon (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecade Year-0Decade Year-0

  12. Natural Gas Citygate Price in Pennsylvania (Dollars per Thousand Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecade Year-0Decade Year-0Feet)

  13. Buildings Sector Working Group

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade Energy IDecade Year-0 Year-1Year Jan4: Oil andDecade Year-0 FullJuly

  14. North Dakota Natural Gas Industrial Consumption (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthrough 1996)McGuire"Feet)Feet) Decade Year-0Decade Year-0

  15. Oklahoma Natural Gas Gross Withdrawals from Oil Wells (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthroughYear Jan Feb Mar Apr May JunFeet) Decade Year-0Decade Year-0

  16. Natural Gas Citygate Price in Washington (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion2,12803andYear Jan Feb MarDecadeDecade Year-0 Year-1DecadeDecade

  17. New York Natural Gas Imports (No intransit Receipts) (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office(Billion CubicProductionFoot) DecadeDecade(No

  18. Ohio Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade1 Source: Office(BillionYear Jan Feb(BillionDecadeFoot) Decade

  19. South Carolina Nuclear Profile - All Fuels

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthroughYear Jan FebDecadeDecade Year-0Total ConsumptionDecadetotal

  20. South Carolina Nuclear Profile - Catawba

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthroughYear Jan FebDecadeDecade Year-0Total

  1. South Carolina Nuclear Profile - Power Plants

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthroughYear Jan FebDecadeDecade Year-0TotalH B

  2. South Dakota Natural Gas Number of Residential Consumers (Number of

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthroughYear Jan FebDecadeDecade Year-0TotalH

  3. South Dakota Natural Gas Processed (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthroughYear Jan FebDecadeDecade Year-0TotalH (Million

  4. North Dakota Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5 Tables July 1996 Energy Information Administration Office ofthrough 1996)McGuire"Feet)Feet) Decade Year-0Decade

  5. ORIGINAL ARTICLE The Effect of Foot and Ankle Prosthetic Components on

    E-Print Network [OSTI]

    -9. Objective: To assess the influence of energy storage and return (ESAR) prosthetic feet and multi-axis ankles on ground reaction forces and loading asymmetry between lower limbs in transtibial amputees. Design: The anteroposterior ground re- action force impulse, peak ground reaction forces, and braking and propulsion impulse

  6. Foot Tapping for Mobile Interaction Andrew Crossan, Stephen Brewster, Alexander Ng

    E-Print Network [OSTI]

    Williamson, John

    become a standard part of mobile interfaces. Touch screens allow a user to quickly and easily perform

  7. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    abalone shell. Materials Science and Engineering A 2005;390:comparative study. Materials Science and Engineering C 2006;21. xxii VITA Materials Science and Engineering Program,

  8. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    CT)^8 A Range Repeat HO HE PIC Locus Sequence BOOB-RM2-F07U GTTTGCTAATCCCCTGGTGCAAGTG BOOB-RM2-F07 LAAAG)^35… (AAAG) ^5 BOOB-RM3-D07 U GTTTGGCCTACTGCCATCCAGGG

  9. he town of Herculaneum, lying at the foot of Mount Vesuvius on a cliff over-

    E-Print Network [OSTI]

    Jellinek, Mark

    advanced as a deflating current with low momentum until it reached the 20-metre cliff drop, when its basal, denser component emplaced abruptly on the beach, halted probably by hydraulic-jump effects, bursting. Some of the skeletons have articulated fractures, as seen in incinerated bodies3,4 , and the inner

  10. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    inorganic materials could lead to significant advances in materials science, opening the door to novel synthesis

  11. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    relative position of calcium and carbonate ions creating ascaffolding. The calcium and carbonate ions can penetratewith surrounding calcium and carbonate ions. Since these

  12. Structural and functional biological materials : abalone nacre, sharp materials, and abalone foot adhesion

    E-Print Network [OSTI]

    Lin, Albert Yu-Min

    2008-01-01T23:59:59.000Z

    of microfabricated polyimide hairs in a 1cm2 array, (b) re-et al. [135] microfabricated polyimide hairs (Figure 2.35 a)of microfabricated polyimide hairs in a 1cm 2 array, (b) re-

  13. Design and fabrication of force sensing robotic foot utilizing the volumetric displacement of a hyperelastic polymer

    E-Print Network [OSTI]

    Estrada, Matthew A

    2012-01-01T23:59:59.000Z

    This thesis illustrates the fabrication and characterization of a footpad based on an original principle of volumetric displacement sensing. It is intended for use in detecting ground reaction forces in a running quadrupedal ...

  14. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  15. A study of the design criteria for drilled-and-belled footings 

    E-Print Network [OSTI]

    Lehmann, Clark Thomas

    1964-01-01T23:59:59.000Z

    Drilling Machine . . ~ . ~ . 44 14. Shelby Tube Sampler . . . . ~ . ~ ~ ~ ~ . ~ ~ ~ . 44 15. Dri. lling Machine in Operation ~ ~ ~ ~ ~ ~ 46 16. Sample Data Sheet for Triaxial Compression Test . . 49 17. Stress-Strain Curve for Triaxial Test Specimen... to Pascal~s Law Now, the active pressure~ G~, on surface AC is 5 A. R Jumikis, ~o . cit. , pp. 618-624. Pd 11 B A 45 P/2 B Pp 4So + p/2 C I v/1+8 (a) Forces in Prandtl's System (b) Mohr Stress Diagram for Compression Test FIGURB 3. Prandtl...

  16. Ground Covers for northern ArizonA Above 6,000 foot elevAtions

    E-Print Network [OSTI]

    Sanderson, Mike

    or the use of fabric or plastic mulch may be required. Most Northern Arizona soils are limited in the amount to turf, bare ground, and rock mulches. Ground covers fill a number of important design needs. They can or even highway embankments. They can soften and add a touch of greenery to the large rock-mulched areas

  17. Department of Mechanical Engineering Spring 2012 IMPROVING THE TRANSMISSION OF A12FOOT DANCE VEHICLE

    E-Print Network [OSTI]

    Demirel, Melik C.

    DANCE VEHICLE Overview A Penn State Creative Campus collaborative project called the "Secret Life of Public Spaces" (SLoPS) prompted the creative idea of a mobile dance vehicle. This vehicle would be used system for this vehicle, which was discovered after they built an initial prototype that didn't function

  18. Procedures employed in the verification of postings, footings, and ledger balances

    E-Print Network [OSTI]

    Sain, Carl

    1939-01-01T23:59:59.000Z

    app??oint ion 989 &414& 55 115&54f &5? $5&lid& ae 15 & fs'F. BO 108 & $15& 04 1& $08& 48 $&944, 15 ?5&4$4, 05 e&?95&000&00 I&140&gg, oo? f 05 & 000& 00 I, 180 & 000& 00 4 8&9$5&455&95 4 sde&ff1&vo 4 sgesa&aod. ds l&odf &8$9&59 114&fde&04... Sd&i'd, oa 4{1) 159&40? 59, 4dl. ee 4&155&000&00 8&8?5&000, 00 (5) 958&dls&50 l&odf &889&58 je) 58, 44f, dd 114&fde&04 (F) 58&9?0. 00 $5 &905& BI s9. 411. 55 &e) sd, eef. s9? 4&154&000&00 I & 885 & 000& 00 10&954& 00 948&515& 50 1 & 155...

  19. Literature Cited FIGURE 3.-Respiratory demand (Gooding and Neill see foot-

    E-Print Network [OSTI]

    ventilation by increasing gape rather than simply swimming faster. fairly rapid rise in the water column is possible, it does not appear to be a significant problem. Ofthe last 10 cetaceans that I have captured. Analysis ofram ventilation offish gills with applica- tion to skipjack tuna (Katsuwonus pelamis). J. Fish

  20. Factors associated with spatial clustering of foot-and-mouth disease in Nepal

    E-Print Network [OSTI]

    Chhetri, Bimal K.; Perez, Andres M.; Thurmond, Mark C.

    2010-01-01T23:59:59.000Z

    control and eradication in Nepal, Bulletin of VeterinaryScience and Animal Husbandry, Nepal,Nepal Veterinary Association, 26, 18–26. Grubman, M. J. ,

  1. Type B Accident Investigation Board Report BNFL, Inc. Employee Foot Injury

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssuesEnergyTransportation WorkDecember 28,Injury at

  2. U.S. Nominal Cost per Foot of Crude Oil, Natural Gas, and Dry Wells Drilled

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb Mar AprYear JanFeet)Oil

  3. U.S. Real Cost per Foot of Crude Oil, Natural Gas, and Dry Wells Drilled

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40CoalLease(Billion Cubic Feet)Year Jan Feb MarRevision2009 2010(Million(Dollars

  4. U.S. Liquefied Natural Gas Imports From Indonesia (Million Cubic...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1980's 1,669 1990's 0 0 0 2000's 2,760 0 0 0 0 0 0 0 0 0 2010's...

  5. Price of U.S. Liquefied Natural Gas Imports From The United Arab...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's -- -- -- 3.46 3.74 2.63 3.03 2000's 3.53 -- -- -- -- -- -- -- -- -- 2010's...

  6. Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- 9.56 4.45 2010's 5.21 5.97 2.83 14.85 4.47...

  7. Price of U.S. Liquefied Natural Gas Imports From Egypt (Dollars...

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- 10.88 6.80 6.83 9.01 3.94 2010's 4.82 5.85 2.52 --...

  8. U.S. Liquefied Natural Gas Imports From Egypt (Million Cubic...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 72,540 119,528 114,580 54,839 160,435 2010's 72,990 35,120 2,811 0...

  9. ENSO-Like and ENSO-Induced Tropical Pacific Decadal Variability in CGCMs

    E-Print Network [OSTI]

    Choi, Jung; An, Soon-Il; Yeh, Sang-Wook; Yu, Jin-Yi

    2013-01-01T23:59:59.000Z

    the prediction of El Nin˜o. J. Climate, 2, 1381–1387. Zhang,terdecadal variability: 1900–93. J. Climate, 10, 1004–1020.and prediction. J. Climate, 11, 2804–2822. Knutson, T. R. ,

  10. 0278-6648/06/$20.00 2006 IEEESEPTEMBER/OCTOBER 2006 31 FOR DECADES, DIGITAL INTEGRAT-

    E-Print Network [OSTI]

    Dick, Robert

    reliable run-time operation, cooling systems need to handle the worst-case chip temperatures. Chip (ICs) have benefited from the relentless progress predicted by Moore's Law. With each new technol- ogy generation, ICs become denser, faster, and cheaper. However, with increasing system integration, as well

  11. Interannual-to-Decadal Changes in Phytoplankton Phenology, Fish Spawning Habitat, and Larval Fish Phenology /

    E-Print Network [OSTI]

    Asch, Rebecca G.

    2013-01-01T23:59:59.000Z

    in the Community Earth System Model (CESM1(BGC)). Journal ofCCSM) and Community Earth System Model (CESM). Los Alamosbe explored with earth system models in greater depth than

  12. In Vitro Human Embryos: Interdisciplinary reflections on the first 4 decades

    E-Print Network [OSTI]

    de Gispert, Adrià

    , in the Marshall Lab in the early 1970's #12;1 In Vitro Human Embryos: Interdisciplinary reflections on the first Department) for providing organisational support; Debbie Spikins for her untiring work dealing

  13. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    structural shifts to heavy industry such as cement and steelthe development of heavy industry. The result was thatan enormous growth of heavy industry in China. This in turn

  14. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    A. Zervos. 2011a. “Wind Energy. ” In IPCC Special Report onconsequent impacts on wind turbine and wind energy pricing.References American Wind Energy Association (AWEA). 2011.

  15. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    in a lower cost of wind generation. Acknowledgments The worklevelized cost of wind generation (which is further affectedlevelized cost of wind generation (due to the latter also

  16. Combined Heat and Power - A Decade of Progress, A Vision for...

    Broader source: Energy.gov (indexed) [DOE]

    Combined heat and power (CHP) technology holds enormous potential to improve the nation's energy security and reduce greenhouse gas (GHG) emissions. This paper describes DOE's...

  17. Behavioral/Systems/Cognitive Mapping of Cortical Activity in the First Two Decades of Life

    E-Print Network [OSTI]

    , Boulder, Colorado 80309, and 4The Warren Alpert Medical School of Brown University, Department through adolescence (Jenni and Carskadon, 2004; Campbell and Feinberg, 2009), a developmental time window adolescence (Feinberg, 1982; Gaudreau et al., 2001; Jenni et al., 2004; Campbell and Feinberg, 2009

  18. fter decades of global antipoverty efforts in which nonprofit organizations oper-

    E-Print Network [OSTI]

    Kammen, Daniel M.

    with four billion people at the bottom who live on less than $2 (in purchasing-power parity terms) per day of people, often poor and rural, who form what is called the bottom of the pyramid (BOP. The 100 million people at the top collectively control more wealth and resources than the bottom four

  19. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    coal-fired electricity generation in China, appliance standards and labeling programs also help to mitigate air-pollution

  20. A Decade of Changes in the Wildcat Creek Flood Control Channel, North Richmond

    E-Print Network [OSTI]

    Ginsberg, Ben

    2008-01-01T23:59:59.000Z

    requires help in the form of dredging. Methods In order toor unnatural processes, such as dredging of the channel. Theto these changes is the dredging of the channel in September

  1. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    thermal electricity generation, coal-fired plants accountedthe dominance of coal-fired electricity generation in China,electric power generation, non-ferrous metals, coal mining,

  2. Sir --After decades of relative neglect, malaria control is again high on the

    E-Print Network [OSTI]

    Kammen, Daniel M.

    analysis of the genomes of two malaria parasites, Plasmodium falciparum and P. yoelii, in this issue the emphasis on genomics and vaccine development likely to be stimulated by the new results, may delay the re approaches from the past while we eagerly await the benefits of the genomics revolution. Jürg Utzinger

  3. www.emsl.pnnl.gov New Decade, New Tools, New Science: SyStemS biology

    E-Print Network [OSTI]

    , including high-throughput genomics, transcriptomics, proteomics, and metabolomics analyses as well as high

  4. Abstract--Over the last decades, research on microelectromechanical systems (MEMS) has focused on

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    -dimensional Surfaces with Applications on Flexible Microelectromechanical Systems," Applied Physics Letter, in press 3

  5. GIS, Cartography, and Story-Telling: A Decade of GIS Research

    E-Print Network [OSTI]

    McDermott, Dave

    2011-11-16T23:59:59.000Z

    of flooding per day a public policy problem? If my basement floods for one hour per year, at the highest of high tides, and destroys my water heater and well pump every year, is that a problem for me and my insurance company? Physical geography matters: GIS analyses are only as good as the... At mean sea level, extensive tide flats surround all coastal communities Even if sea levels rise six feet, mean sea level still does not reach the current shoreline. But at high tide, water laps at the edge of the causeway, even with no...

  6. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    Dissecting Wind Turbine Costs. ” WindStats Newsletter, vol.A. Laxson. 2006. Wind Turbine Design Cost and Scaling Model.driven down wind energy costs (for a brief survey of the

  7. Strategies for oil and gas companies to remain competitive in the coming decades of energy challenges

    E-Print Network [OSTI]

    Singh, Aditya, M.B.A. Massachusetts Institute of Technology

    2010-01-01T23:59:59.000Z

    There are a variety of challenges facing the energy industry, from decreased access to sovereign reserves, to declining fields, innovation challenges, increased regulation and new energy policies. These challenges pose a ...

  8. Predicting decadal trends and transient responses of radiocarbon storage and fluxes in a temperate forest soil

    E-Print Network [OSTI]

    Sierra, C. A; Trumbore, S. E; Davidson, E. A; Frey, S. D; Savage, K. E; Hopkins, F. M

    2012-01-01T23:59:59.000Z

    carbon cycling in a temperate forest: radiocarbon-based es- timates of residence times, sequestration

  9. SOLAR AND SPACE PHYSICS RESEARCH: THE COMING DECADE Statement of Louis J. Lanzerotti

    E-Print Network [OSTI]

    to the study of distant stars and galaxies and are related to laboratory plasma research. And, very importantly

  10. Diet Through the Decades: Nutrition as We Age What should I eat and When?

    E-Print Network [OSTI]

    Chisholm, Rex L.

    health issues, such as obesity, osteoporosis, and other diseases. DRI: Dietary Reference Intakes;supplements, people should have 1000 mg of fish oil per day ­ this should be comprised of EPA + DHA. Menopause: During the menopausal transition and afterward, women need to pay attention to preserving bone health

  11. Interannual-to-Decadal Changes in Phytoplankton Phenology, Fish Spawning Habitat, and Larval Fish Phenology /

    E-Print Network [OSTI]

    Asch, Rebecca G.

    2013-01-01T23:59:59.000Z

    Oceanography 48( 6): 2171-2185. Platt, T. , C. Fuentes-YacoSathyendranath and T. Platt. 2012. Phytoplankton phenologySpringer-Verlag, Berlin. Platt, T. , C. Fuentes-Yaco and

  12. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    embodied in wind turbine materials (6.37 GJ/kW) from theMaterials Prices Wind turbines are material-intensive. Eachprofitability, turbine scaling, raw materials prices, energy

  13. Decadal-scale variations in ice flow along Whillans Ice Stream and its tributaries, West Antarctica

    E-Print Network [OSTI]

    Stearns, Leigh; Jezek, K.A.; Van der Veen, C.J.

    2005-01-01T23:59:59.000Z

    We investigate velocity changes occurring along Whillans Ice Stream (WIS) by comparing velocities derived from repeat aerial photographs acquired in 1985–89 (average date of 1987) to interferometric satellite radar (InSAR) velocities collected...

  14. INTRODUCTION Weakly electric knifefish have been studied for several decades to

    E-Print Network [OSTI]

    Curet, Oscar M.

    of South American electric fish (family Gymnotidae) swim by using a ribbon fin positioned along the ventral the mechanical principles of force generation by the ribbon fin in the context of the South American weakly direction rapidly (in 100ms) (MacIver et al., 2001) is integral to several behaviors. Previous work by Mac

  15. 5/16/05 ABYSS-Lite Decadal Survey Concept 1 ABYSS-Lite

    E-Print Network [OSTI]

    Vernon, Frank

    @ucsd.edu Godin Ray Integrated Program Office Ray.Godin@noaa.gov Goff John Univ. of Texas, Austin, TX goff@ig Office of Global Navigation AndreasenC@nga.mil Arbic Brian Princeton University and NOAA GFDL arbic & Ocean Mapping larry.mayer@unh.edu McGuire James Integrated Program Office james.mcguire@noaa.gov Mc

  16. Managing Financial Integration and Capital Mobility— Policy lessons from the past two decades

    E-Print Network [OSTI]

    Aizenman, Joshua; Pinto, Brian

    2011-01-01T23:59:59.000Z

    and KA Open. , non-EMG LDC Year Mon. Indep. , EMG KAOPEN,Exchr. Stab. , EMG Year Mon. Indep. , non-EMG LDC KAOPEN,non-EMG LDC Exchr. Stab. , non-EMG LDC Definitions: The

  17. Reconciling Development and Conservation in the First Decade of the 21st Century

    E-Print Network [OSTI]

    forces: local, national, global Technology y Sustainability Timber Industry · Reduced Impact Logging · Logging · Climate Change Impacts · Loss of timber (10-59%) · Human health (smoke) · Co2 emissions Oil Aquatic Systems Deforestation Andean Piedmont Urucú & Western Amazon 2nd Tier companies Mines Urucú

  18. A Prototype Two-Decade Fully-Coupled Fine-Resolution CCSM Simulation

    SciTech Connect (OSTI)

    McClean, Julie L. [Scripps Institute of Oceanography; Bader, David C [ORNL; Bryan, Frank O. [National Center for Atmospheric Research (NCAR); Maltrud, Matthew E. [Los Alamos National Laboratory (LANL); Dennis, John [National Center for Atmospheric Research (NCAR); Mirin, Arthur A. [Lawrence Livermore National Laboratory (LLNL); Jones, Philip W [Los Alamos National Laboratory (LANL); Vertenstein, Mariana [National Center for Atmospheric Research (NCAR); Ivanova, Detelina P. [Lawrence Livermore National Laboratory (LLNL); Kim, Yoo Yin [Scripps Institute of Oceanography; Boyle, James S. [Lawrence Livermore National Laboratory (LLNL); Jacob, Robert L. [Argonne National Laboratory (ANL); Norton, Nancy [IBM and National Center for Atmospheric Research; Craig, Anthony [National Center for Atmospheric Research (NCAR); Worley, Patrick H [ORNL

    2011-01-01T23:59:59.000Z

    A fully coupled global simulation using the Community Climate System Model (CCSM) was configured using grid resolutions of 0.1{sup o} for the ocean and sea-ice, and 0.25{sup o} for the atmosphere and land, and was run under present-day greenhouse gas conditions for 20 years. It represents one of the first efforts to simulate the planetary system at such high horizontal resolution. The climatology of the circulation of the atmosphere and the upper ocean were compared with observational data and reanalysis products to identify persistent mean climate biases. Intensified and contracted polar vortices, and too cold sea surface temperatures (SSTs) in the subpolar and mid-latitude Northern Hemisphere were the dominant biases produced by the model. Intense category 4 cyclones formed spontaneously in the tropical North Pacific. A case study of the ocean response to one such event shows the realistic formation of a cold SST wake, mixed layer deepening, and warming below the mixed layer. Too many tropical cyclones formed in the North Pacific however, due to too high SSTs in the tropical eastern Pacific. In the North Atlantic anomalously low SSTs lead to a dearth of hurricanes. Agulhas eddy pathways are more realistic than in equivalent stand-alone ocean simulations forced with atmospheric reanalysis.

  19. North Pacific carbon cycle response to climate variability on seasonal to decadal timescales

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in the subarctic North Pacific Ocean, Global Biogeochem.of the tropical Pacific Ocean: I. Seasonal and interannualthe subtropical North Pacific Ocean, Nature, 424, 754 – 757.

  20. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    and India Insights. Paris: IEA. 34. Wyckoff AW, Roop JM.and India Insights. Paris: IEA. 3. US Energy Inf. Adm. 2007.Organization Year of Forecast IEA (WEO) EIA (IEO) (after

  1. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    cost of electricity (“LCOE”) generated by the turbine, basedEnergy (right scale) COD: LCOE (2010 $/MWh) Capacity Factorcase, the benefit (lower LCOE) outweighs the incremental

  2. Upgrades and consolidation of the CERN AD for operation during the next decades

    E-Print Network [OSTI]

    Eriksson, T; Arnaudon, L; Baillie, J; Calviani, M; Caspers, F; Joergensen, L; Kersevan, R; Le Godec, G; Louwerse, R; Ludwig, M; Maury, S; Newborough, A; Oliveira, C; Tranquille, G

    2013-01-01T23:59:59.000Z

    As the ELENA project is now well underway, focus is turned to the Antiproton Decelerator (AD) itself. Most of the machine’s key components are in operation since more than 25 years and a substantial consolidation program is now being launched in view of continued operation beyond 2025. \

  3. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    Energy Agency. 2007. World Energy Outlook 2007: China andEnergy Agency. 2007. World Energy Outlook 2007: China andAgency in its recent World Energy Outlook 2007 projects that

  4. Interannual-to-Decadal Changes in Phytoplankton Phenology, Fish Spawning Habitat,and Larval Fish Phenology

    E-Print Network [OSTI]

    Asch, Rebecca

    2014-01-01T23:59:59.000Z

    alongshore winds that induce offshore Ekman transport ofvolume of offshore Ekman transport (Q x ), wind stress (?)

  5. Decadal Change in Vegetation and Soil Phosphorus Pattern across the Everglades Landscape

    E-Print Network [OSTI]

    to eutrophication tend to be more rapid and longer ing into Everglades wetlands has been considerably en- lasting role in the eutrophication of than 1 km from the western margin canal into the Loxahatchee NWR

  6. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    from revised total energy consumption data published in thefrom revised total energy consumption data published in thefrom revised total energy consumption data published in the

  7. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    Detailed “end-use” energy consumption data reported in the “GJ/kW based on energy consumption data reported in D’Souzain Section 3.5. LCA data on energy consumption during the

  8. A Decade of Changes in the Wildcat Creek Flood Control Channel, North Richmond

    E-Print Network [OSTI]

    Ginsberg, Ben

    2008-01-01T23:59:59.000Z

    of Changes in the Wildcat Creek Flood Control Channel, NorthAbstract: The lower Wildcat Creek flood control and ripariancontinue. Introduction Wildcat Creek Watershed is located in

  9. Geothermal progress monitor report No. 9, June 1985. A decade of progress, 1974-1984

    SciTech Connect (OSTI)

    Not Available

    1986-05-01T23:59:59.000Z

    This issue--No. 9--focuses on 10 years of progress in: geothermal research and development, geothermal leasing, and geothermal resource assessment.

  10. A miniaturized mW thermoelectric generator for nw objectives: continuous, autonomous, reliable power for decades.

    SciTech Connect (OSTI)

    Aselage, Terrence Lee; Siegal, Michael P.; Whalen, Scott; Frederick, Scott K.; Apblett, Christopher Alan; Moorman, Matthew Wallace

    2006-10-01T23:59:59.000Z

    We have built and tested a miniaturized, thermoelectric power source that can provide in excess of 450 {micro}W of power in a system size of 4.3cc, for a power density of 107 {micro}W/cc, which is denser than any system of this size previously reported. The system operates on 150mW of thermal input, which for this system was simulated with a resistive heater, but in application would be provided by a 0.4g source of {sup 238}Pu located at the center of the device. Output power from this device, while optimized for efficiency, was not optimized for form of the power output, and so the maximum power was delivered at only 41mV. An upconverter to 2.7V was developed concurrently with the power source to bring the voltage up to a usable level for microelectronics.

  11. Decadal changes in glacier parameters in the Cordillera Blanca, Peru, derived from remote sensing

    E-Print Network [OSTI]

    , France 5 Direcion de Hidrologi´a y Recursos Hidricos, Servicio Nacional de Meteorologi´a e Hidrologi

  12. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    consumption of a variety of primary energy sources – including hard coal, lignite (soft coal), crude oil,

  13. WINTER 2005 37 Perhaps as little as a decade ago, it

    E-Print Network [OSTI]

    Kearns, Michael

    . These examples range from macroscopic in- sights about the economic incentives of Internet users be ex- pressed in a strongly economic or game-theoretic framework. For in- stance, individuals deciding's The Tipping Point, but the central relevance of economic prin- ciples in such problems is only be- ginning

  14. A DECADE OF SOLAR TYPE III RADIO BURSTS OBSERVED BY THE NANCAY RADIOHELIOGRAPH 1998-2008

    SciTech Connect (OSTI)

    Saint-Hilaire, P. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States)] [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Vilmer, N.; Kerdraon, A., E-mail: shilaire@ssl.berkeley.edu [LESIA, Observatoire de Paris, CNRS, UPMC, Universite Paris-Diderot 5 place Jules Janssen, F-92195 Meudon (France)

    2013-01-01T23:59:59.000Z

    We present a statistical survey of almost 10,000 radio type III bursts observed by the Nancay Radioheliograph from 1998 to 2008, covering nearly a full solar cycle. In particular, sources sizes, positions, and fluxes were examined. We find an east-west asymmetry in source positions that could be attributed to a 6 Degree-Sign {+-} 1 Degree-Sign eastward tilt of the magnetic field, that source FWHM sizes s roughly follow a solar-cycle-averaged distribution (dN/ds) Almost-Equal-To 14 {nu}{sup -3.3} s {sup -4} arcmin{sup -1} day{sup -1}, and that source fluxes closely follow a solar-cycle-averaged (dN/ds {sub {nu}}) Almost-Equal-To 0.34 {nu}{sup -2.9} S {sup -1.7} {sub {nu}} sfu{sup -1} day{sup -1} distribution (when {nu} is in GHz, s in arcminutes, and S {sub {nu}} in sfu). Fitting a barometric density profile yields a temperature of 0.6 MK, while a solar wind-like ({proportional_to}h {sup -2}) density profile yields a density of 1.2 Multiplication-Sign 10{sup 6} cm{sup -3} at an altitude of 1 R{sub S} , assuming harmonic emission. Finally, we found that the solar-cycle-averaged radiated type III energy could be similar in magnitude to that radiated by nanoflares via non-thermal bremsstrahlung processes, and we hint at the possibility that escaping electron beams might carry as much energy away from the corona as is introduced into it by accelerated nanoflare electrons.

  15. Abstract--During the last decade, an increasing incorporation of Information and Communication Technologies

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    (electrical power grid and its information and communication system (ICS)) in the modeling, design, a large amount of communication electronic devices are distributed in electrical power systems to control, protect and supervise their functioning. Power systems are for the most part remotely controlled

  16. In the last two decades, compute power, storage density, and network bandwidth

    E-Print Network [OSTI]

    Funkhouser, Thomas A.

    , the authors have developed various techniques, software tools, and applications. Grant Wallace, Otto J. Anshus Gupta, Matthew Hibbs, Kai Li, Zhiyan Liu, Rudrajit Samanta, Rahul Sukthankar, and Olga Troyanskaya

  17. Perceptions of Species Abundance, Distribution, and Diversity: Lessons from Four Decades

    E-Print Network [OSTI]

    Dorcas, Michael E.

    years, the US Department of Energy's (DOE) Savannah River Site National Environ- mental Research Park management; Reptile 1Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, South a 44-year study period on the US Department of Energy's (DOE) Savannah River Site Na- tional

  18. The construction of a building capable of hosting the nation's supercomputers for the next decades

    E-Print Network [OSTI]

    is a highly complex task due to the rapid changes in technology in this field. That is why the defining and large windows in the offices provide light-flooded work spaces. An underground corridor and a footbridge's infrastructure which cannot tolerate any in- terruption to the power supply (such as data storage, networks

  19. The construction of a building capable of hosting the nation's supercomputers for the next decades

    E-Print Network [OSTI]

    is a highly complex task due to the rapid changes in technology in this field. That is why the defining and large windows in the offices provide light-flooded work spaces. An underground corridor and a footbridge cannot tolerate any in- terruption to the power supply (such as data storage, networks and the Meteo

  20. Decadal oscillation of lakes and aquifers in the upper Great Lakes region of North America

    E-Print Network [OSTI]

    Stanley, Emily

    , Peking University, Beijing, China, 7 Department of Electrical and Computer Engineering, University by changes in the net atmospheric flux of water (PÀ E) and stage-dependent outflow. The oscillation Pacific that support the flux of moisture into the region from the Gulf of Mexico. Recent data indicate

  1. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    Electrification Since 1978, institutional reforms, demographic shifts to smaller families, and increased receipts of foreign direct investment have stimulated rural-

  2. Part I: SST for NWP Part II: Decadal Strategic Plan for USGCRP

    E-Print Network [OSTI]

    Maryland at College Park, University of

    ) Subcommittee on Global Climate Research (SGCR) also U.S. Global Change Research Program (USGCRP) National for Meteorological Satellites (CGMS) 3-7 October 2011, Saint Petersburg, Russia #12;3 Hurricanes form only in oceanic Coordination Office USGCRP (Brief) History ·National Climate Program Act of 1978 ·Presidential initiative

  3. Lessons Learned from a Decade of Sudden Oak Death in California: Evaluating Local Management

    E-Print Network [OSTI]

    Alexander, Janice; Lee, Christopher A.

    2010-01-01T23:59:59.000Z

    12–15 Cohn JP (2008) Citizen science: can volunteers do realrecent focus on collaborative learning and citizen science.The growing trend of citizen science, or using volunteers to

  4. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    2006 kg CO2/kg coal equivalent energy produced Note: LBNLrole in replacing coal, increasing energy demand meansemissions. 8. With coal as the major energy source, and no

  5. Solar Flares and the Chromosphere A white paper for the Decadal Survey*

    E-Print Network [OSTI]

    California at Berkeley, University of

    detail the progression of flare energy re- lease. Flare chromo deserves attention in our attempts to find answers to the riddles of the corona, including flares flares radiate most of their lu- minous energy in the chromosphere. The chromosphere is where electrons

  6. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    consequent impacts on wind turbine and wind energy pricing.Bloomberg NEF”). 2011c. Wind Turbine Price Index, Issue V.Understanding Trends in Wind Turbine Prices Over the Past

  7. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    G. Sinden, A. Zervos. 2011a. “Wind Energy. ” In IPCC Specialdemand shocks, with consequent impacts on wind turbineand wind energy pricing. References American Wind Energy

  8. From Dimming to Brightening: Decadal Changes in Solar Radiation at Earth's Surface

    SciTech Connect (OSTI)

    Wild, Martin F.; Gilgen, Hans; Roesch, Andreas; Ohmura, Atsumu; Long, Charles N.; Dutton, Ellsworth G.; Forgan, B. W.; Kallis, A.; Russak, V.; Tsvetkov, Anatoly

    2005-05-06T23:59:59.000Z

    Variations in solar radiation incident at Earth's surface profoundly affect the human and terrestrial environment. A decline in solar radiation at land surfaces has become apparent in many observational records up to 1990, a phenomenon known as global dimming. Newly available surface observations from 1990 to the present, primarily from the Northern Hemisphere, show that the dimming did not persist into the 1990s. Instead, a widespread brightening has been observed since the late 1980s. This reversal is reconcilable with changes in cloudiness and atmospheric transmission and may substantially affect surface climate, the hydrological cycle, glaciers, and ecosystems.

  9. How Does Employment Growth in Wisconsin Compare to Other States Over the Past Decade?

    E-Print Network [OSTI]

    Saldin, Dilano

    How Does Employment Growth in Wisconsin of employment growth in the state. Yet, for all the politicized spinning of official employment statistics in recent years, there has been little systematic

  10. US Department of Energy multiprogram laboratories, 1981 to 1991, a decade of change

    SciTech Connect (OSTI)

    Not Available

    1993-04-01T23:59:59.000Z

    The U.S. Department of Energy`s multiprogram laboratories were conceived as a means of enlisting private enterprise and managerial skills to develop atomic weapons during World War II. Today these laboratories perform research and development in a host of areas critical to the U.S. Research and development areas incorporated within their missions include: technologies for maintaining national security; the fundamental nature of matter and energy processes; environmental processes; energy production technologies; and energy conserving technologies. This document identifies the laboratories and describes historical trends, laboratory projections, individual laboratory profiles, and laboratory organization and oversight for the multiprogram system.

  11. U.S. Department of Energy A Decade of Discovery Documents Advances...

    Broader source: Energy.gov (indexed) [DOE]

    National Laboratories WASHINGTON, DC - Finding new and better ways to detect and treat cancer, Parkinson's disease and other debilitating diseases; developing new, cleaner and...

  12. 230 American Scientist, Volume 97 In recent decades there has been con-

    E-Print Network [OSTI]

    Hall, Charles A.S.

    - lentlessly. The most immediate of these issues appears to be a decline in oil reservoirs, a phenomenon for humans. Despite our inatten- tion, resource depletion and popula- tion growth have been continuing re commonly referred to as "peak oil" because global production appears to have reached a maximum and is now

  13. Guest Editorial After two decades a second anchor for the VPDB d13

    E-Print Network [OSTI]

    Description d13 C Â 103 USGS41 L-glutamic acid þ37.63 IAEA-CO-1 calcium carbonate þ2.49 NBS 19 calcium carbonate þ1.95 RM 8562 carbon dioxide À3.72 NBS 18 calcium carbonate À5.01 IAEA-CO-8 calcium carbonate À513 C scale be established with NBS 19 carbonate assigned to be þ1.95% as its single anchor

  14. Informatica 37 (2013) 49-54 49 DEX Methodology: Three Decades of Qualitative Multi-Attribute

    E-Print Network [OSTI]

    Bohanec, Marko

    2013-01-01T23:59:59.000Z

    -Attribute Modeling Marko Bohanec and Martin Znidarsic Jozef Stefan Institute, Department of Knowledge Technologies

  15. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    Innovation and the price of wind energy in the US. ” Energy3.6 Energy Prices Life-cycle analyses of wind projects findEnergy Finance (“Bloomberg NEF”). 2011c. Wind Turbine Price

  16. biodiversity over the past two decades, but, except for a few flagship species, detailed

    E-Print Network [OSTI]

    Li, Zhanqing

    as a carbon-free source of energy (10). The construction of dams is increas- ingly regarded as the biggest biodiversity. One thing is for sure, though: The rising water brings a tremendous amount of energy, but what Academy of Sciences, Beijing 100093, People's Republic of China. References and Notes 1. D. Dudgeon, Bio

  17. 11.1 Introduction Owing to significant efforts in genome sequencing over nearly three decades

    E-Print Network [OSTI]

    Zhang, Yang

    is the structuralgenomics(SG)projectinitiatedattheendoflastcentury(Sali1998;Terwilliger et al. 1998; Burley et al. 1999

  18. Persistent multi-decadal Greenland temperature fluctuation through the last millennium

    E-Print Network [OSTI]

    Kobashi, Takuro; Severinghaus, Jeffrey P.; Barnola, Jean-Marc; Kawamura, Kenji; Carter, Tara; Nakaegawa, Tosiyuki

    2010-01-01T23:59:59.000Z

    Cappelen J (2006) Extending Greenland temper- ature recordssurface elevation at the Greenland summit. J Glaciol 48:199–hemisphere tempera- ture and Greenland temperature changed

  19. Climate-Driven Basin-Scale Decadal Oscillations of Oceanic Phytoplankton

    E-Print Network [OSTI]

    Antoine, David

    Antoine, Fabrizio D'Ortenzio, Bernard Gentili Phytoplankton--the microalgae that populate the upper lit layers of the ocean--fuel the oceanic food web and affect oceanic and atmospheric carbon dioxide levels

  20. Perspectives on US program support of FNSF and ITER in coming decade

    E-Print Network [OSTI]

    -pulse PMI, stellarator) · U.S. Burning Plasma Organization could also expand beyond ITER to incorporate FNSP facility support a staged approach? (PMI FNSF CTF Pilot?) · Which ITER physics and technology can

  1. Scientists Mix Matter and Anti-Matter Results to Resolve Decade...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lab's Experimental Hall B was used to measure electrons during the experiment. Fans of science and science fiction have been warned that mixing matter with anti-matter can yield...

  2. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    thermal electricity generation, coal-fired plants accountedelectricity use. In average generation terms, this is equivalent to 27 1-GW coal fired plants

  3. he prospect of millions of vehicles plugging into the nation's electric grid in the coming decades

    E-Print Network [OSTI]

    Firestone, Jeremy

    PHEVstomarkethasemerged,bolsteredbytheunde- niable economic and national-security benefits that result from displacing gasoline with electricity. One fuel costs, reduce petroleum consumption, and decrease harmful emissions is described elsewhere.1 of the increased load that PHEVs would represent under a range of assumptions. Next, we evaluate PHEVs serving

  4. In recent decades, however, people have begun to question the feasibility of

    E-Print Network [OSTI]

    Peet, Robert K.

    be desirable to maintain naturalness. Is the concept of naturalness still sufficient to guide protected area The George Wright Forum36 Naturalness and Beyond: Protected Area Stewardship in an Era of Global, the goal of naturalness has been cod- ified in legislation and protected area policy and built into agency

  5. Influence of Mean State on Climate Variability at Interannual and Decadal Time Scales 

    E-Print Network [OSTI]

    Zhu, Xiaojie

    2013-05-17T23:59:59.000Z

    for many phenomena associated with variables that are nonlinear by definition, such as the vertical wind shear and surface wind speed. In the first part of this dissertation, the influence of mean flow and anomalous flow on vertical wind shear variability...

  6. Decadal Variability in the Formation of the North Pacific Subtropical Mode Water: Oceanic versus Atmospheric Control

    E-Print Network [OSTI]

    Qiu, Bo

    , during which time high regional eddy variability infuses high-PV KE water into the recirculation gyre

  7. During the past two decades, dozens of coun-tries around the world have implemented

    E-Print Network [OSTI]

    Sharp, Kim

    --OOrriieenntteedd IInnffrraassttrruuccttuurree RReeffoorrmm,, 11997777­­11999999 Witold J. Henisz Bennet A. Zelner University of Pennsylvania

  8. The Decade of Violent Destabilisation in Nepal: An Analysis of its Historical Background and Trajectory

    E-Print Network [OSTI]

    Bleie, Tone

    2007-01-01T23:59:59.000Z

    -Beijing and pro-Moscow factions) were not considered as real a contender for power as was the Congress. The Beijing faction was thus assisted in order to undermine the Congress's support-base. The Panchayat regime also received considerable aid from the Maoist...

  9. Decadal variability in the northeast Pacific in a physical-ecosystem model

    E-Print Network [OSTI]

    Maine, University of

    the lower trophic levels of the food web and if so by what means. The physical component is an ocean general in late winter, did not penetrate as deep in the central GOA. As a result, more phytoplankton remained that resulted in basin-wide changes in ocean temper- atures, currents, and mixed layer depth [e.g., Miller et al

  10. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    Developments in the Levelized Cost of Energy from U.S. Windleft scale) Levelized Cost of Energy (right scale) COD:

  11. Decadal timescale shift in the 14C record of a central equatorial Pacific coral

    E-Print Network [OSTI]

    Grottoli, A; Gille, S; Druffel, Ellen R M; Dunbar, R

    2003-01-01T23:59:59.000Z

    South-Central Pacific coral records. Geophysical Research1981. Radiocarbon in annual coral rings from the easterntemperature from banded coral records: implications for the

  12. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    CO2 IEA estimate LBNL estimate ORNL estimate Sources: IEA, Carbon Emissions from Fossil Fuel Combustion

  13. Decadal-Timescale Estuarine Geomorphic Change Under Future Scenarios of Climate and Sediment Supply

    E-Print Network [OSTI]

    Ganju, Neil K.; Schoellhamer, David H.

    2010-01-01T23:59:59.000Z

    the effect of wind-wave resuspension, as areas become deepervelocities (which reduces resuspension). Depending on thedependent wave-induced resuspension, combine to create these

  14. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    driven down wind energy costs (for a brief survey of themore on driving the cost of wind energy lower, regardless ofstill, whether the cost of wind energy continues down the

  15. Articles and Commentaries A Decade of WTO Dispute Settlement: New Zealand's Experience

    E-Print Network [OSTI]

    Hickman, Mark

    Tuna and CCBST in the CCAMLR Area (Alan Hemmings) New Zealand State Conduct Treaty Action: Selectivity and the International Criminal Law Regime (Chris Gallavin) Book Review: Roda Verheyen's Climate the details and send this form and your payment to: School of Law University of Canterbury Private Bag 4800

  16. Decadal-Timescale Estuarine Geomorphic Change Under Future Scenarios of Climate and Sediment Supply

    E-Print Network [OSTI]

    Ganju, Neil K.; Schoellhamer, David H.

    2010-01-01T23:59:59.000Z

    on sedimentation and intertidal mudflat change in San Pabloestimate the change in mudflat profile or marsh accretion.

  17. Decadal Climate Variability: Economic Implications in Agriculture and Water in the Missouri River Basin

    E-Print Network [OSTI]

    Fernandez Cadena, Mario

    2013-07-23T23:59:59.000Z

    and water use. The model is used to evaluate the welfare gains and adaptations given various levels of DCV information. The analysis shows the value (for a 10-year average) for a perfect forecast is about 5.2 billion dollars, though 86% of this value, 4...

  18. A DECADE-BASELINE STUDY OF THE PLASMA STATES OF EJECTA KNOTS IN CASSIOPEIA A

    SciTech Connect (OSTI)

    Rutherford, John; Dewey, Daniel; Figueroa-Feliciano, Enectali; Heine, Sarah N. T.; Canizares, C. R.; Bastien, Fabienne A.; Sato, Kosuke, E-mail: enectali@mit.edu, E-mail: jmrv@mit.edu [Department of Physics and Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)

    2013-05-20T23:59:59.000Z

    We present the analysis of 21 bright X-ray knots in the Cassiopeia A supernova remnant from observations spanning 10 yr. We performed a comprehensive set of measurements to reveal the kinematic and thermal state of the plasma in each knot, using a combined analysis of two high energy resolution High Energy Transmission Grating (HETG) and four medium energy resolution Advanced CCD Imaging Spectrometer (ACIS) sets of spectra. The ACIS electron temperature estimates agree with the HETG-derived values for approximately half of the knots studied, yielding one of the first comparisons between high resolution temperature estimates and ACIS-derived temperatures. We did not observe the expected spectral evolution-predicted from the ionization age and density estimates for each knot-in all but three of the knots studied. The incompatibility of these measurements with our assumptions has led us to propose a dissociated ejecta model, with the metals unmixed inside the knots, which could place strong constraints on supernova mixing models.

  19. Global Carbon Emissions in the Coming Decades: The Case of China

    SciTech Connect (OSTI)

    Levine, Mark; Levine, Mark D.; Aden, Nathaniel T.

    2008-05-01T23:59:59.000Z

    China's annual energy-related carbon emissions surpassed those of the United States in In order to build a more robust understanding of China's energy-related carbon emissions, emissions after 2001? The divergence between actual and forecasted carbon emissions international trade, and central government policies in driving emissions growth. so greatly in error and what drove the rapid growth of China's energy-related carbon this article reviews the role of economic restructuring, urbanization, coal dependence, underscores the rapid changes that have taken place in China's energy system since 2001.

  20. Growth and Stewardship: Frank Zwart's Four Decades at UC Santa Cruz

    E-Print Network [OSTI]

    Zwart, Frank; Reti, Irene

    2012-01-01T23:59:59.000Z

    I saw, for example, of the shelving at McHenry Library whereHall, where pretty flimsy shelving had been attached to thecriteria for library shelving was strengthened so that later

  1. Thousand-year-long Chinese time series reveals climatic forcing of decadal locust dynamics

    E-Print Network [OSTI]

    -dependent effects deserve increased at- tention in global warming studies. agricultural pest ecological response and Rodents in Agriculture, Institute of Zoology, Chinese Academy of Sciences, Tatun Road, Chao Yang District and droughts in the lower Yangtze River, phenomena that are associated with locust outbreaks. Our results imply

  2. Quaternary International 188 (2008) 3140 Associations of multi-decadal sea-surface temperature

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    in societies dependent on subsistence agriculture (FAO, 2004). Because of the potential substantial effects variability with US drought Gregory J. McCabea,Ã, Julio L. Betancourtb , Stephen T. Grayc , Michael A Available online 18 July 2007 Abstract Recent research suggests a link between drought occurrence

  3. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    of wind energy lower, regardless of the policy environment.price of wind energy in the US. ” Energy Policy, Volume 37,to Energy Policy Abstract: On a $-per-kW basis, wind turbine

  4. "It Became My Case Study": Professor Michael Cowan's Four Decades at UC Santa Cruz

    E-Print Network [OSTI]

    Cowan, Michael; Reti, Irene

    2013-01-01T23:59:59.000Z

    texts, but working at it from my interest in looking at themBut I enjoyed working on CPB, given my interests. I found itor of interest to them, [and] the excitement of working, not

  5. ARM Research in the Equatorial Western Pacific: A Decade and Counting

    SciTech Connect (OSTI)

    Long, Charles N.; McFarlane, Sally A.; Del Genio, Anthony D.; Minnis, Patrick; Ackerman, Thomas P.; Mather, James H.; Comstock, Jennifer M.; Mace, Gerald G.; Jensen, Michael; Jakob, Christian

    2013-05-22T23:59:59.000Z

    The tropical western Pacific (TWP) is an important climatic region. Strong solar heating, warm sea surface temperatures and the annual progression of the Intertropical Convergence Zone (ITCZ) across this region generate abundant convective systems, which through their effects on the heat and water budgets have a profound impact on global climate and precipitation. To accurately represent tropical cloud systems in models, measurements of tropical clouds, the environment in which they reside, and their impact on the radiation and water budgets are needed. Because of the remote location, ground-based datasets of cloud, atmosphere, and radiation properties from the TWP region have traditionally come primarily from short-term field experiments. While providing extremely useful information on physical processes, these datasets are limited in statistical and climatological information because of their short duration. To provide long-term measurements of the surface radiation budget in the tropics, and the atmospheric properties that affect it, the Atmospheric Radiation Measurement program established a measurement site on Manus Island, Papua New Guinea in 1996 and on the island republic of Nauru in late 1998. These sites provide unique datasets available from more than 10 years of operation in the equatorial western Pacific on Manus and Nauru. We present examples of the scientific use of these datasets including characterization of cloud properties, analysis of cloud radiative forcing, model studies of tropical clouds and processes, and validation of satellite algorithms. We also note new instrumentation recently installed at the Manus site that will expand opportunities for tropical atmospheric science.

  6. Understanding Wind Turbine Price Trends in the U.S. Over the Past Decade

    E-Print Network [OSTI]

    Bolinger, Mark

    2013-01-01T23:59:59.000Z

    cycle assessment of a wind farm and related externalities. ”and onshore sited wind farms. Document number 200128,

  7. Chu Visits Site of America's First New Nuclear Reactor in Three Decades |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T, Inc.'sEnergyTexas1. Feedstock &Energy Chronic BerylliumDepartment of

  8. Chu Visits Site of America's First New Nuclear Reactor in Three Decades |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T, Inc.'sEnergyTexas1. Feedstock &Energy Chronic BerylliumDepartment

  9. NNSA Recognizes the Multispectral Thermal Imager Satellite for a Decade of

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLoveReferenceAgendaSecurityAbout Us / Our Operationsin FY

  10. Towards the Prediction of Decadal to Centennial Climate Processes in the

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2, 2003Tool ofTopo II:7.1 7.0Coupled Earth System

  11. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    forecasts, carbon intensity, energy policy, emissions reductions Abstract China’China Surpassing American Energy-Related Carbon Emissions (1, 2) ForecastChina’s energy demand grew faster than any of the forecasts –

  12. An Assessment of State-and-Transition Models: Perceptions Following Two Decades of Development and Implementation

    E-Print Network [OSTI]

    entre manejadores e investigadores, en cuatro regiones ecolo´gicas para determinar sus conocimientos del

  13. The warming climate could put food supplies at risk over the next decade or two.

    E-Print Network [OSTI]

    Floeter, Sergio Ricardo

    change. The results suggest that with climate warming, the risk of losing 10% or more of the global wheat by 20 times, to a 1 in 10 chance. Environ. Res. Lett. 9, 074003 (2014) AGRICULTURE Global warming could, has a buried ocean that is saltier than many seas on Earth. Titan, with its thick atmosphere

  14. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01T23:59:59.000Z

    of energy-related CO2 emissions in China during 1980 todrivers of accelerating CO2 emissions. Proceedings of thefraction of China’s CO2 emissions can be attributed to

  15. Chu Visits Site of America's First New Nuclear Reactor in Three Decades |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube platformBuilding RemovalCSSDepartment

  16. Combined Heat and Power - A Decade of Progress, A Vision for the Future,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube platformBuildingCoal Combustion Products CoalEnergyColumbus HTSAugust 2009 |

  17. DOE Proposes First Revision to its NEPA Rules in More than a Decade |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesvilleAbout »Department of2 DOEDepartment ofPosting PracticesSite

  18. 'Insights of the Decade' Enabled by NERSC - NERSC Center News, Feb 10, 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengtheningWildfiresImpurityRotation;ReportLANLEnergy$3

  19. Chu Visits Site of America's First New Nuclear Reactor in Three Decades |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO OverviewAttachments4 Chairs Meeting - April 2014Christopher Smith AssistantDepartment of

  20. LOS ALAMOS, New Mexico, May 19, 2011-For decades, Los Alamos National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12electron 9 5 - -/e),,s - 16, 2011 LOSsmallhostsnamed

  1. Chu Visits Site of America�s First New Nuclear Reactor in Three Decades

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z CPlasma ofTop EnvironmentaltoPeter S.Department of5,

  2. U.S. Department of Energy A Decade of Discovery Documents Advances in

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO Overview OCHCOSystems Analysis Success| DepartmentEnergy Cooperation |U.S.8 Annual9

  3. U.S. Department of Energy A Decade of Discovery Documents Advances in

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssuesEnergyTransportation WorkDecemberInjuryU.S.the25, 2014Energy,

  4. Combined Heat and Power - A Decade of Progress, A Vision for the Future,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"Wave the White Flag"Department of8,catalysts for3ServicesAugust

  5. A Challenge to America: Develop Fusion Power Within a Decade | Princeton

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del(ANL-IN-03-032) -Less isNFebruaryOctober 2, AlgeriaQ1 Q2 Q3(SC) A

  6. Idaho Site Completes Cleanup with Help from Workers who Shipped Waste Decades Ago

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions for DOEthe RankingReform at the Department ofImproper Use of

  7. Scientists Mix Matter and Anti-Matter Results to Resolve Decade-Old Proton

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiationImplementingnpitcheResearchPhysics Lab Scientist's Quest ForScienceDOEPuzzle

  8. Seasonal And Decadal Variation of the Mixed Layer Across the ACRF Using RWP Data

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiationImplementingnpitcheResearchPhysics LabwildfiresScotttheSwitchSeasonal And

  9. ITP Industrial Distributed Energy: Combined Heat and Power - A Decade of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(Fact Sheet), GeothermalGridHYDROGENDDepartmentSeptember 20092009

  10. Iowa Natural Gas Vehicle Fuel Consumption (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0Decade Year-0 Year-1DecadeDecade

  11. Iowa Natural Gas Vehicle Fuel Consumption (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0Decade Year-0 Year-1DecadeDecadeIowa

  12. Kansas Natural Gas Vented and Flared (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0DecadeYear JanDecade Year-0Decade

  13. Kansas Natural Gas Vented and Flared (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Building FloorspaceThousandWithdrawals0.0DecadeYear JanDecade Year-0DecadeYear

  14. Liquefied U.S. Natural Gas Re-Exports to China (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto China (Million Cubic Feet) 3 0 0 0 156 57 61Decade Year-0DecadeDecade

  15. Liquefied U.S. Natural Gas Re-Exports to Mexico (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto China (Million Cubic Feet) 3 0 0 0 156 57 61DecadeDecade Year-0Decade

  16. Liquefied U.S. Natural Gas Re-Exports to Russia (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto China (Million Cubic Feet) 3 0 0 0 156 57 61DecadeDecadeDecade Year-0

  17. Colorado Natural Gas Gross Withdrawals (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecadeDecade Year-0 Year-1 Year-2

  18. Colorado Natural Gas Gross Withdrawals (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecadeDecade Year-0 Year-1

  19. Colorado Natural Gas Industrial Consumption (Million Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecadeDecade Year-0 Year-1Year Jan

  20. Colorado Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear JanDecadeDecade Year-0 Year-1Year