Powered by Deep Web Technologies
Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Business Case Slide 19: High-Volume: Casks - Program Focus  

NLE Websites -- All DOE Office Websites (Extended Search)

Volume: Casks - Program Focus Previous Slide Next Slide Table of Contents High-Volume: Casks - Program Focus ORNL furnace for cermet development ORNL furnace for cermet development...


Business Case Slide 11: High-Volume: Repository - Program Focus  

NLE Websites -- All DOE Office Websites (Extended Search)

Program Focus Previous Slide Next Slide Table of Contents High-Volume: Repository - Program Focus Program focus (ORNL) Fill and cermets are being pursued Both put DUO2 close to...


Business Case Slide 37: International Collaboration - Current...  

NLE Websites -- All DOE Office Websites (Extended Search)

Program Focus Previous Slide Next Slide Table of Contents International Collaboration - Current Program Focus Current program focus Phase I projects: ISTC funding of 1M likely...


Slide 1 of 19NCA -Agriculture with a California Focus Agriculture with a California  

E-Print Network (OSTI)

Slide 1 of 19NCA - Agriculture with a California Focus Agriculture with a California Focus (NCA Draft Findings) Richard Grotjahn Professor of Climate Dynamics University of California, Davis 6 March 2013 #12;Slide 2 of 19NCA - Agriculture with a California Focus Authors of Chapter 6: Agriculture

Grotjahn, Richard


Business Case Slide 28: High-Value: Semiconductors - Program...  

NLE Websites -- All DOE Office Websites (Extended Search)

Semiconductors - Program Focus Previous Slide Next Slide Table of Contents High-Value: Semiconductors - Program Focus Measurement of DUO2 transistor properties at ORNL Measurement...


Business Case Slide 24: High-Value: Catalysts - Program Focus  

NLE Websites -- All DOE Office Websites (Extended Search)

Catalysts - Program Focus Program Focus Off-gas cleanup catalysts (ORNL) Best form and substrate, effect of impurities Desulfurization catalyst (Rutgers) Proof-of-principle...


PPT Slide  

U.S. Energy Information Administration (EIA)

CNG/Sabine Center. Ellisburg-Leidy Center. New York Center. Iroquois Center. Perryville (NORAM) Center. Previous slide: Next slide: Back to first slide: View graphic ...


PPT Slide  

U.S. Energy Information Administration (EIA)

Canada. LNG. Mexico. History Projections. U.S. Natural Gas Net Imports, 1970-2020 (trillion cubic feet) Previous slide: Next slide: Back to first slide: View graphic ...


Business Case Slide 31: High-Value: Energy Uses - Program Focus  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Uses - Program Focus Program Focus Battery research (Univ. Kentucky) Proof-of-principle experiment underway Fuel cell research (Rutgers) Measuring relevant properties of...


Previously Competed FOCUSED PROGRAMS  

Science Conference Proceedings (OSTI)

... The program concentrates on three major commercial markets: engines, power trains, and chassis ... Vapor Compression Refrigeration Technology. ...



Business Case Slide 7: High-Volume: Repository - Diagram  

NLE Websites -- All DOE Office Websites (Extended Search)

Diagram Previous Slide Next Slide Table of Contents High-Volume: Repository - Diagram Repository Tunnel Components...


Production and Handling Slide 28: Winslow Scale  

NLE Websites -- All DOE Office Websites (Extended Search)

Winslow Scale Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Winslow Scale Refer to caption below for image description...


Production and Handling Slide 41: Cylinder Handler  

NLE Websites -- All DOE Office Websites (Extended Search)

Handler Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Cylinder Handler Refer to caption below for image description...


Production and Handling Slide 11: Solvent Extraction  

NLE Websites -- All DOE Office Websites (Extended Search)

Extraction Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Solvent Extraction Refer to caption below for image description...


Production and Handling Slide 40: Straddle Carrier  

NLE Websites -- All DOE Office Websites (Extended Search)

Straddle Carrier Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Straddle Carrier Refer to caption below for image...


Production and Handling Slide 19: UF6  

NLE Websites -- All DOE Office Websites (Extended Search)

Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents UF6 Refer to caption below for image description Uranium hexafluoride UF6...


Production and Handling Slide 7: Yellow Cake  

NLE Websites -- All DOE Office Websites (Extended Search)

Yellow Cake Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Yellow Cake Refer to caption below for image description Yellow...


Annotated bibliography: Marine geologic hazards of the Hawaiian Islands with special focus on submarine slides and turbidity currents  

DOE Green Energy (OSTI)

This annotated bibliography was compiled to highlight the submarine geology of the Hawaiian Islands and identify known and potential marine geologic hazards with special emphasis on turbidity currents, submarine slides and tsunamis. Some references are included that are not specific to Hawaii but are needed to understand the geologic processes that can affect the integrity of submarine cables and other man-made structures. Entries specific to the Hawaiian Island area are shown in bold type.

Normark, W.R.; Herring, H.H.



Production and Handling Slide 22: UF6 Phase Diagram  

NLE Websites -- All DOE Office Websites (Extended Search)

UF6 Phase Diagram Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents UF6 Phase Diagram Refer to caption below for image...


Production and Handling Slide 36: Full Cylinder in Autoclave...  

NLE Websites -- All DOE Office Websites (Extended Search)

Cylinder in Autoclave Prior to Feeding Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Full Cylinder in Autoclave Prior to...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Production and Handling Slide 21: Melting Points of Uranium and...  

NLE Websites -- All DOE Office Websites (Extended Search)

Points of Uranium and Uranium Compounds Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Melting Points of Uranium and Uranium...


Production and Handling Slide 15: Yellow Cake, Uranyl Nitrate...  

NLE Websites -- All DOE Office Websites (Extended Search)

Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Yellow Cake, Uranyl Nitrate, ADU, UO2 Refer to caption below for image...


Production and Handling Slide 2: Natural Uranium and its Ores...  

NLE Websites -- All DOE Office Websites (Extended Search)

Uranium and its Ores* Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Natural Uranium and its Ores* Refer to caption below...


Production and Handling Slide 39: Weighing the Cylinder  

NLE Websites -- All DOE Office Websites (Extended Search)

Weighing the Cylinder Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Weighing the Cylinder Refer to caption below for image...


Production and Handling Slide 31: Certification of UF6 Cylinder...  

NLE Websites -- All DOE Office Websites (Extended Search)

UF6 Cylinder Volume Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Certification of UF6 Cylinder Volume The cylinder...


Production and Handling Slide 32: Full Limit Criteria  

NLE Websites -- All DOE Office Websites (Extended Search)

Full Limit Criteria Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Full Limit Criteria 250F is the maximum temperature to...


Production and Handling Slide 25: The Portsmouth Gaseous Diffusion...  

NLE Websites -- All DOE Office Websites (Extended Search)

Portsmouth Gaseous Diffusion Plant Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents The Portsmouth Gaseous Diffusion Plant...


Production and Handling Slide 24: The Paducah Gaseous Diffusion...  

NLE Websites -- All DOE Office Websites (Extended Search)

Paducah Gaseous Diffusion Site Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents The Paducah Gaseous Diffusion Site Refer to...


Production and Handling Slide 42: Typical Depleted Cylinder Storage...  

NLE Websites -- All DOE Office Websites (Extended Search)

Typical Depleted Cylinder Storage Yard Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Typical Depleted Cylinder Storage Yard...


Production and Handling Slide 13: Yellow Cake, Uranyl Nitrate...  

NLE Websites -- All DOE Office Websites (Extended Search)

ADU Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Yellow Cake, Uranyl Nitrate, ADU Refer to caption below for image...


Production and Handling Slide 34: For Example  

NLE Websites -- All DOE Office Websites (Extended Search)

Example Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents For Example The minimum specified volume of a 48G cylinder is 139 ft3...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Compliance Officer Department of Energy - Chicago Office The National Environmental Policy Act Process Slide 2 The National Environmental Policy Act Slide 3 Signed it into...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Accelerating Electric Vehicle Deployment Accelerating Electric Vehicle Deployment Opportunities for US-China Joint Initiative Roland J. Hwang Transportation Program Director Natural Resources Defense Council US-China Electric Vehicles Forum Beijing, China September 30, 2009 rhwang@nrdc.org, 415-875-6100 2 Slide The Natural Resources Defense Council * National Environmental Non Governmental Organization (NGO) founded in 1970 * 350 Lawyers, Scientists and other professionals * 1.2 million members and activists * 6 offices: New York, D.C., San Francisco, Los Angeles, Chicago and Beijing * Beijing Office founded in 1996 and focuses on energy (including



NLE Websites -- All DOE Office Websites (Extended Search)

milling: milling: Depth control for three-dimensional microfabrication M. J. Vasile, a) Z. Niu, R. Nassar, W. Zhang, and S. Liu Institute for Micromanufacturing, Louisiana Tech University, Ruston, Louisiana 71272 ͑Received 29 May 1997; accepted 28 July 1997͒ Ion milling with a focused ion beam ͑FIB͒ is a potential method for making micromolds, which will then be the primary elements in the mass production of micro- or mini-objects by embossing or injection molding. The challenge lies in controlling the ion milling to produce cavities with predefined, arbitrary geometric cross-sections. This work involves programming variations as a function of position into the algorithm that generates the dwell times in the pixel address scheme of a FIB. These variations are done according to whether an axis of symmetry or a plane of symmetry determines the final geometry, and the result is 26 new


Production and Handling Slide 29: UF6 Cylinder Fill Limit Criteria  

NLE Websites -- All DOE Office Websites (Extended Search)

Criteria Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents UF6 Cylinder Fill Limit Criteria No UF6 cylinder shall be filled...


Production and Handling Slide 30: UF6 Cylinder Fill Limit Weights  

NLE Websites -- All DOE Office Websites (Extended Search)

Weights Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents UF6 Cylinder Fill Limit Weights A minimum volume, stated in cubic...



NLE Websites -- All DOE Office Websites (Extended Search)

milling milling of diamond: Effects of H 2 O on yield, surface morphology and microstructure D. P. Adams, a) M. J. Vasile, T. M. Mayer, and V. C. Hodges Thin Film, Vacuum and Packaging Department, Sandia National Laboratories, Albuquerque, New Mexico 87185 ͑Received 1 July 2003; accepted 22 August 2003; published 24 November 2003͒ The effects of H 2 O vapor introduced during focused ion beam ͑FIB͒ milling of diamond͑100͒ are examined. In particular, we determine the yield, surface morphology, and microstructural damage that results from FIB sputtering and H 2 O-assisted FIB milling processes. Experiments involving 20 keV Ga ϩ bombardment to doses ϳ10 18 ions/cm 2 are conducted at a number of fixed ion incidence angles, ␪. For each ␪ selected, H 2 O-assisted ion milling shows an increased material removal rate compared with FIB sputtering ͑no gas assist͒. The amount by which the


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. 0. 100. 200. 300. 400. Onshore. Offshore. Undiscovered nonassociated. Inferred nonassociated. Unconventional. Other unproved. Proved. Shale gas. Coalbed ...


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. Demand Growth Has Led to Expanded Pipeline Capacity. Options: - New pipelines - Additional compression - Looping - A combination of each


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RE Mahan & JD Fluckiger RE Mahan & JD Fluckiger Pacific Northwest National Laboratory Secure Data Transfer Summary Slide: Secure Data Transfer  Outcomes: Best practices guidance for technical staff on the implementation of secure data transmission technology in the SCADA environment.  Roadmap Challenge: Primary focus is on development and integration of protective measures.  Major Successes: Produced a unified view of significant security issues and developed in-depth guideline for addressing security issues in client/server applications.  Schedule: Guidance for developers by 9/30/2010  Level of Effort: 1.25 fte  Funds Remaining: $174K  Performers: PNNL  Partners: N/A Technical Approach and Feasibility * Approach - Identify & document deficiencies/issues

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Business Case Slide 14: High-Volume: Casks - DUCRETE (cont)  

NLE Websites -- All DOE Office Websites (Extended Search)

DUCRETE (cont.) Previous Slide Next Slide Table of Contents High-Volume: Casks - DUCRETE(tm) (cont.) DUCRETE Casks are Considerably Smaller and Lighter than Casks Constructed of...


Business Case Slide 12: High-Volume: Casks - Description  

NLE Websites -- All DOE Office Websites (Extended Search)

Casks - Description Previous Slide Next Slide Table of Contents High-Volume: Casks - Description Description Use DUO2 to enhance the shielding efficiency in spent fuel casks for...


Business Case Slide 33: Regulatory Constraints Analysis (ANL...  

NLE Websites -- All DOE Office Websites (Extended Search)

Previous Slide Next Slide Table of Contents Regulatory Constraints Analysis (ANL) - Status Status Evaluation of current status completed in FY02 All manufacturing of DU products...


Production and Handling Slide 8: Conversion of Yellow Cake to...  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of Yellow Cake to UF6 Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Conversion of Yellow Cake to UF6 Refer to...


Production and Handling Slide 10: Conversion of Yellow Cake to...  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of Yellow Cake to UF6 Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Conversion of Yellow Cake to UF6 Refer to...


Production and Handling Slide 12: Conversion of Yellow Cake to...  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of Yellow Cake to UF6 Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Conversion of Yellow Cake to UF6 Refer to...


Production and Handling Slide 3: The Uranium Fuel Cycle  

NLE Websites -- All DOE Office Websites (Extended Search)

First Slide Previous Slide Next Slide Last Presentation Table of Contents The Uranium Fuel Cycle See caption below for image description The second step in the uranium fuel cycle...


Production and Handling Slide 17: Yellow Cake, Uranyl Nitrate...  

NLE Websites -- All DOE Office Websites (Extended Search)

, UF4 Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Yellow Cake, Uranyl Nitrate, ADU, UO2, UF4 Refer to caption below for...


Production and Handling Slide 33: Density of UF6  

NLE Websites -- All DOE Office Websites (Extended Search)

of UF6 Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Density of UF6 Refer to caption below for image description The...


Production and Handling Slide 20: Advantages of UF6  

NLE Websites -- All DOE Office Websites (Extended Search)

UF6 Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents Advantages of UF6 Only one isotope of F2 Can be handled at reasonable...


Slide 1  

U.S. Energy Information Administration (EIA)

This slide showcases the Reference and three alternate cases for U.S. shale gas production over the forecast period. ... Standards - Improved ... Working Gas Design ...


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. The Supply Process Consists of a Number of Elements. Commodity Transmission (long-haul) Local delivery Storage Major Issues Related to Supply Acquisition


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. NEXT GENERATION * NATURAL GAS. Problems with EIAs Current Natural Gas Information Program. The data collection program currently in place was designed ...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Laboratory Protocol Analyzer PNNL-SA-73892 Summary Slide: Protocol Analyzer Outcomes: Provide operators of SSCP-deployed technologies the tools to view and troubleshoot...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mark Hadley Pacific Northwest National Laboratory Cryptographic Trust Management PNNL-SA-74014 Summary Slide: Cryptographic Trust Management Outcomes: Scalable, efficient, and...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Laboratory (PNNL) SSCP Commercialization PNNL-SA-73897 Summary Slide: SSCP Commercialization Outcomes: Scalable, cost-effective methods to secure communication between remote...


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. Natural Gas Productive Capacity for the Lower-48 States - Methodology - Oklahoma is a good example of why the methodology was changed to estimate effective ...


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. Natural Gas Productive Capacity for the Lower-48 States - Results - The Lower-48 States were producing at rates close to 95 percent of estimated effective ...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Samarasinghe Self-Excited Instabilities "Partially-Premixed" Conditions Fuel-Forced Flame Response Air-Forced Flame Response Instability Mechanisms Slide 2 Flame Transfer...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TCIPG: Network Access Policy Tool (NetAPT) (Joint work with David Nicol, Mouna Seri, and Sankalp Singh) Summary Slide: NetAPT Outcomes: Tool to prove correctness and compliance...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


PPT Slide  

U.S. Energy Information Administration (EIA)

PPT Slide. Natural Gas Market Outlook. Short-Term (Through 2001) Wellhead prices average $2.48 per Mcf in 2000 (March STEO, $2.57 in 2001) compared to last years ...


Business Case Slide 15: High-Volume: Casks - DU/Steel Cermet  

NLE Websites -- All DOE Office Websites (Extended Search)

DUSteel Cermet Previous Slide Next Slide Table of Contents High-Volume: Casks - DUSteel Cermet Functions Radiation Shielding Gamma: High-Density DUO2Other Neutron Moderation...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Method Method Use the Multiphase Transport Evaluation Loop (MTEL) Facility at PNNL to gather additional data to first calibrate then validate the ParaFlow software  First set of tests will focus on confirming sensor capability and test repeatability  This as well as previously gathered data will be used to calibrate the physical attributes of the simulant as it forms a bed in the pipe Perform ParaFlow model enhancements required to model the two-phase phenomenon of slurry transport with sufficient accuracy to predict critical deposition velocity and bed formation in pipeline configurations  Similar to Lattice-Boltzmann codes, ParaFlow employs a new technique called Lattice-Kinetics. Its framework readily


Sagittal focusing Laue monochromator  

Science Conference Proceedings (OSTI)

An x-ray focusing device generally includes a slide pivotable about a pivot point defined at a forward end thereof, a rail unit fixed with respect to the pivotable slide, a forward crystal for focusing x-rays disposed at the forward end of the pivotable slide and a rearward crystal for focusing x-rays movably coupled to the pivotable slide and the fixed rail unit at a distance rearward from the forward crystal. The forward and rearward crystals define reciprocal angles of incidence with respect to the pivot point, wherein pivoting of the slide about the pivot point changes the incidence angles of the forward and rearward crystals while simultaneously changing the distance between the forward and rearward crystals.

Zhong; Zhong (Stony Brook, NY), Hanson; Jonathan (Wading River, NY), Hastings; Jerome (Stanford, CA), Kao; Chi-Chang (Setauket, NY), Lenhard; Anthony (Medford, NY), Siddons; David Peter (Cutchogue, NY), Zhong; Hui (Coram, NY)



Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mark Hadley Mark Hadley Pacific Northwest National Laboratory Cryptographic Trust Management PNNL-SA-74014 Summary Slide: Cryptographic Trust Management  Outcomes: Scalable, efficient, and automated cryptographic trust management solution for control systems.  Roadmap Challenge: Security upgrades hard to retrofit to legacy systems, may be costly, and may degrade system performance; complexity increases exponentially with an increase in number of nodes.  Major Successes: Requirements and high-level design specifications completed. Protocol paper accepted for publication.  Schedule: Requirements Document, High-Level Design Specification  Level of Effort: $183K  Funds Remaining: $55K  Performers: PNNL  Partners: Industry Advisors Image Technical Approach and Feasibility


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tim Woolf, Vice President Tim Woolf, Vice President Synapse Energy Economics Lisa Schwartz, Senior Associate Regulatory Assistance Project National Association of Regulatory Utility Commissioners, ER&E Committee Meeting, July 24, 2012 Portland, OR Cost-Effectiveness Working Group Outline * Members of the Working Group. * Scope of the report. * Recent experience with demand response cost-effectiveness frameworks. * Proposed demand response cost-effectiveness framework. * Demand response program costs. * Demand response program benefits. * Issues for further research. National Forum on the NAPDR: Cost Effectiveness Working Group Slide 2 Members of the Working Group First Name Last Name Organization Name Organization Type E-mail Alberto Martinez Energy Curtailment Specialists


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Laboratory (PNNL) Laboratory (PNNL) SSCP Commercialization PNNL-SA-73897 Summary Slide: SSCP Commercialization  Outcomes: Scalable, cost-effective methods to secure communication between remote devices and control centers.  Roadmap Challenge: Poorly designed connection of SCADA and business networks can dramatically increase vulnerabilities of control systems.  Major Successes: The task team provided Cisco with multiple SSCP implementation guidance sources and resources. The team also developed a protocol specification that describes deploying SSCP security objectives for routable control system communication.  Schedule: Routable Protocol Specification, Implementation Guidance, Hallmark  Level of Effort: $575k  Funds Remaining: $287K  Performers: PNNL


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Brian Smith Brian Smith EnerNex Lemnos Interoperable Security Summary Slide: Lemnos Interoperable Security  Outcomes: Energy asset owners can better evaluate product functions, purchase, and install products supporting cyber security functions from multiple vendors knowing they will be interoperable  Roadmap Challenge: Vendors do not have specific requirements or standards to build to  Major Successes:  IPsec & Syslog protocols  Lab Testing & Public Plug-fests  Commercial product release (SEL)  Schedule: Centralized Authentication, Secure Remote Access, and Syslog in 2010  Level of Effort: $1.24M (2010)  Performers: Image EnerNex Tennessee Valley Authority Sandia National Laboratories Schweitzer Engineering Laboratories Technical Approach and Feasibility


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Performance of Performance of Hydrate-Bearing Sediments in Offshore Environments Stephen A. Holditch January 19, 2007 Objectives * Create capability to describe geomechanical behavior of hydrate bearing sediments in the ocean, by Developing a knowledge base and Developing a quantitative predictive capability * Determine the envelope of hydrate stability under typical oceanic conditions where oil and gas production occurs Large block of hydrated sediment breaking off and sliding down slope Debris Flow Gas Plume Original Slope Surface Lower Boundary of Hydrate at Low Sea Stand Lower Boundary of Hydrate at High Sea Stand Dissociated (gas-fluidized ) Gas Hydrate Hydrated Zone Figure 1. Diagram showing the effects of gas hydrate dissociation on oceanic hill


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pacific Northwest National Laboratory Pacific Northwest National Laboratory Field Device Management Summary Slide: Field Device Management  Outcomes: Feasibility study and final report, prototypical design specification for implementation of working prototype.  Roadmap Challenge: Standardized test plans and upgrades for new technology are not widely available; complexity increases exponentially with an increase in number of nodes  Major Successes: Outreach during study is identifying/addressing increasing interest from asset owners with regard to technical approach that meets assessment and audit criterion.  Schedule: Feasibility Study/Report - FY10  Level of Effort: $34K  Funds Remaining: $25K  Performers: PNNL  Partners: BPA, ACS Technical Approach and Feasibility * Approach


Business Case Slide 26: High-Value: Semiconductors - Description...  

NLE Websites -- All DOE Office Websites (Extended Search)

(cont.) Previous Slide Next Slide Table of Contents High-Value: Semiconductors - Description (cont.) Measuring the photo-voltaic properties of a DUO2 diode at NREL Measuring the...


Business Case Slide 29: High-Value: Energy Uses - Description  

NLE Websites -- All DOE Office Websites (Extended Search)

Uses - Description Previous Slide Next Slide Table of Contents High-Value: Energy Uses - Description Description Use DUO2 as the core component of advanced energy systems Fuel cell...


Business Case Slide 38: Funding Needed R&D Tasks  

NLE Websites -- All DOE Office Websites (Extended Search)

Needed R&D Tasks Previous Slide Next Slide Table of Contents "Funding Needed" R&D Tasks DUO2 alteration chemistry How DUO2 is altered to other uranium compounds by water with...


Business Case Slide 10: High-Volume: Repository - Issues  

NLE Websites -- All DOE Office Websites (Extended Search)

Issues Previous Slide Next Slide Table of Contents High-Volume: Repository - Issues Issues Technical basis for using DUO2 as a geochemical barrier Technical issues DUO2 alteration...


Business Case Slide 16: High-Volume: Casks - Basis  

NLE Websites -- All DOE Office Websites (Extended Search)

Basis Previous Slide Next Slide Table of Contents High-Volume: Casks - Basis Basis Storage casks with high-density shielding can be directly loaded in reactor pools Eliminates a...


Business Case Slide 13: High-Volume: Casks - DUCRETE  

NLE Websites -- All DOE Office Websites (Extended Search)

Previous Slide Next Slide Table of Contents High-Volume: Casks - DUCRETE(tm) DUAGG Briquettes DUAGG briquettes are made by a liquid-phase-sintering process and crushed and...


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

Presented To: Presented To: Washington DC April 27, 2011 The US Natural Gas Revolution: Technology Transforms A Market 2011 EIA Energy Conference Slide 2 BENTEKENERGY.COM US natural gas production has reached record production levels. Growth has occurred because of evolving technology and process innovation that will continue to drive costs down. Technology is also improving environmental mitigation. Prices will remain relatively low for many years. The implications are profound for consumers, the economy and the environment. Key Points Of My Presentation Slide 3 BENTEKENERGY.COM 45.0 50.0 55.0 60.0 65.0 70.0 1/1 2/1 3/1 4/1 5/1 6/1 7/1 8/1 9/1 10/1 11/1 12/1 Comparison of Marketed Production US Production Is At Record Levels Source: BENTEK Supply and Demand Report Jan Jul Apr Oct Average Daily


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 20-22, 2010 July 20-22, 2010 Thomas J. Overbye University of Illinois at Urbana-Champaign TCIPG - Smart-Grid Enabled Distributed Voltage Support Framework Summary Slide: Project Title *Outcomes: Demonstrate the viability of distributed reactive resources to provide more resilient system voltage control. This will require near real-time distributed control and local control communications  Roadmap Challenge: Control system networks that automatically provide contingency and remedial actions  Major Successes: Project is just beginning; initial simulations are promising  Schedule: 2010 to 2013  Level of Effort: TCIPG funding  Funds Remaining: TCIPG funding  Performers: University of Illinois at Urbana-Champaign  Partners: Non-formalized relationships with power system


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TCIPG: Network Access Policy Tool (NetAPT) TCIPG: Network Access Policy Tool (NetAPT) (Joint work with David Nicol, Mouna Seri, and Sankalp Singh) Summary Slide: NetAPT  Outcomes: Tool to prove correctness and compliance of firewall settings in networked setting.  Roadmap Challenge: Limited ability to measure and assess cyber security posture  Major Successes (since transition to TCIPG): NetAPT used in major internal audit of industrial partner's control system network. Tool significantly enhanced as based on experience gained during use.  Schedule: Original tool developed with TCIP and I3P funding. Transitioned to TCIPG 2/10.  Level of Effort: TCIPG Funding  Funds Remaining: TCIPG Funding  Performers: University of Illinois  Partners: Ameren, Sandia Background: Control Systems Networks Today


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Laboratory Laboratory Protocol Analyzer PNNL-SA-73892 Summary Slide: Protocol Analyzer  Outcomes: Provide operators of SSCP-deployed technologies the tools to view and troubleshoot SSCP-protected communication.  Roadmap Challenge: Standardized test plans and upgrades for new technology are not widely available.  Major Successes: Demonstration of Open Source solution shown at DistribuTECH.  Schedule: Open source candidate (Q3), Demonstration (Q2)  Level of Effort: $159K  Funds Remaining: None  Performers: Pacific Northwest National Laboratory  Partners: Wireshark Project, ASE, FTE (future partner) Technical Approach and Feasibility * Approach - Utilize PNNL-developed technology to import SSCP protected data into Wireshark's normal interface - Add SSCP digester to Wireshark

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Loren Toole & Andy McCown Loren Toole & Andy McCown Los Alamos National Laboratory Right-Sized SCADA Communications  Outcomes: Scalable, cost-effective security solutions for new architecture designs and communication methods applicable to new systems as well as legacy-system upgrades  Roadmap Challenge: Limited resources available within businesses to address security needs  Major Successes: End-to-end description of EP SCADA systems; survey of literature for SCADA system metrics  Schedule: Detailed analysis of SCADA system 10/30/2010; System metrics 11/30/2010; Detailed specifications document 1/31/2011  Level of Effort: $200K  Funds Remaining: $150K  Performers: LANL Image Summary Slide: Right-Sized SCADA Communications Technical Approach and Feasibility


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dale Peterson Dale Peterson Digital Bond, Inc. Bandolier and Portaledge Summary Slide: Bandolier  Outcomes: Insure new and upgraded SCADA and DCS are deployed in the best possible security configuration  Roadmap Challenge: Consistent metrics are not available to measure and assess security posture; there is a lack of tested and validated security tools  Major Successes: Over twenty Bandolier Security Audit Files, major vendor participation, used in FAT/SAT, more vendors want in  Schedule: Over twenty files to date. NERC CIP files and more Bandolier files planned.  Level of Effort: $1.2M to date  Funds Remaining: $575K pending  Performers: Digital Bond, Inc.  Partners: ABB, AREVA, Emerson, Matrikon, OSIsoft, SNC, Tenable, Telvent and more Technical Approach and Feasibility


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Gas Turbine Fuel Systems Division Gas Turbine Fuel Systems Division Micro-Mixing Lean Premix System for Ultra-Low Emission Hydrogen/Syngas Combustion 2010 University Turbine Systems Research Workshop, Oct. 19-21, 2010 Dr. Adel Mansour (PI), Dr. Erlendur Steinthorsson * Introduction * Project Overview; Research Objectives and Approach * Micro-Mixing Cup Development * 1 st Generation Micro-Mixing Cup - Radial Inflow Configuration * 2 nd Generation Micro-Mixing Cup - Mixed Axial/Radial Inflow Configuration * Multi-cup Module * Full-Scale 1.3 MW injector * Atmospheric tests (fuel-air mixing, flame imaging, emissions) * High-pressure combustion tests * Summary and Conclusions Outline PARKER PROPRIETARY INFORMATION -Use or disclosure of data on this slide subject to the restriction(s) listed on the "Title Page" of this document


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Himanshu Khurana Himanshu Khurana University of Illinois TCIPG: Converged Networks for SCADA (Joint work with Erich Heine and Tim Yardley) Summary Slide: CONES  Outcomes: Specify and create an architecture and platform for maintaining real-time and secure communications for control in a converged network.  Roadmap Challenge: Develop and Integrate Protective Measures  Major Successes: CONES enhanced machines outperform non- enhanced machines in representative scenarios; major real-time constraints met.  Schedule: Started 2/8, Design 8/8, Prototype 7/9, Experiments 4/10, Transitioned to TCIPG 2/10  Level of Effort: $250k DOE and TCIPG Funding  Funds Remaining: TCIPG Funding  Performers: University of Illinois  Partners: PNNL Background: Control Systems networks today


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Carl Hauser Carl Hauser Washington State University TCIPG: GridStat Summary Slide: GridStat Outcomes: Develop key and trust management solutions for secure and real-time communication substrate; transition substrate to industry partners to meet increased inter-utility communication needs Roadmap Challenges: Open and flexible control leads to increased risks; complexity increases exponentially with increased number of nodes; Major Successes: long-lived authentication architecture; NASPInet architecture influence  Schedule: Develop preliminary trust model and multicast signing approaches 8/10; implement multicast signing 12/10; large-scale test 6/11  Funding: TCIPG  Performers: Washington State Univ.  Partners: SEL, RTI, PNNL, Avista QoS broker 1


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

States States Naval Nuclear Propulsion Program OPERATING NAVAL NUCLEAR PROPULSION PLANTS AND SHIPPING (RAIL) NAVAL SPENT FUEL SAFELY FOR OVER 45 YEARS SSGN 728 USS Florida CVN 69 USS Dwight D. Eisenhower M-140 Shipping Container NAVAL SPENT FUEL SHIPMENTS NAVAL SPENT FUEL SHIPMENTS * NRC Type B packages * Specially-trained, 24/7 escorts * Government-owned railcars * Location and status constantly monitored * Escort/train crew communications * Rugged fuel * National security shipments Slide 2 NAVAL SPENT FUEL SHIPMENT ACCIDENT EXERCISE BACKGROUND NAVAL SPENT FUEL SHIPMENT ACCIDENT EXERCISE BACKGROUND * Escorted national security shipments. - Exercises provide prime opportunity for outreach, shipment familiarization and emergency response planning. * Regional in nature - 1996 Northwest (Washington/Oregon)


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

/ Jeff Dagle / Jeff Dagle Pacific Northwest National Laboratory "Implications of Design Basis Threat on Critical Infrastructure and Homeland Security" Note! * The context of this presentation doe not represent any findings that are classified or non-classified * The notion or discussion of a critical infrastructure DBT is not itself sensitive and no details that would present such sensitivities are represented in any way in this presentation Summary Slide: Design Basis Threat Implications  Outcomes: Implications of Design Basis Threat concepts relevant to energy sector critical assets and threat  Roadmap Challenge: Vendors do not have specific requirements or standards to build to: threats are hard to demonstrate and quantify  Major Successes: Major projects in


Solar Webinar Presentation Slides  

Energy.gov (U.S. Department of Energy (DOE))

Download presentation slides from the DOE Office of Indian Energy Webinar on solar renewable energy.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and click "Search" to find the previous quarter report that should be linked. * In the search results, click on the previous quarter report that should be linked to the current...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

gas. * Potential research thrusts may focus on improving processing efficiency to utilize shale gas as a low cost chemical feed stock and intermediate; identifying industrial...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Coal in a Smart Grid Environment Conventional Generator Cycling and Variable Generation Workshop Summary of Results Steve Bossart and Steve Pullins 14 June 2011 2 Focus of the...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

to Commercialization Technology Development Time Scale Basic R&D Lab Scale Commercial Demonstration Small Pilot Large Pilot NCCC Program Focus 7 Integrated CO 2...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

technologies and PNNL focus Electrical energy Electrical charges: Capacitors Potential energy: pump hydro, compress air Kinetic energy: flywheels Chemical energy: batteries...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Focus on Markets Focus on Markets Hydro Has Value, but.... Will it be Valued? Richard R. Miller, P.E. HDR Engineering, Inc. _____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ DOE Electricity Advisory Committee June 5-6, 2013 Is BPA Today California's Energy Future? Actual and forecasted wind: large swings in power supply need to be supplemented by other sources Is BPA Today California's Energy Future?


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and each parameter's optimal setting * 100's of settings, previously defaults were often weak - Develop Bandolier Security Audit File - Nessus scanner & Bandolier File can audit a...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The "Existing (previous quarter) Report Information" box will be blank. * Check the "Terms and Conditions" box and enter your FRPIN. * Click "Update Link." Further guidance on...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Contractor: National Electric Systems Contract Completed Oct 2011 BUILDING STRONG Transformer Location & Cable BUS Layout Current Layout Previous Layout BUILDING STRONG ...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

to another. We focus on three different tropical locations, chosen because of their monsoon environments and because of the availability of time-continuous ground- or ship-based...


Slide 1  

National Nuclear Security Administration (NNSA)

NMMSS Users Annual Training Meeting San Antonio, Texas-May 20-22, 2008 Sponsored by the U.S. Department of Energy & the U.S. Nuclear Regulatory Commission Focus * Continuing to...


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Status and DOE Star of Excellence * Focused on safety and disciplined operations as we near completion Workers remove a pipeline from 100-D reactor area along the Columbia River...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Science Conference Proceedings (OSTI)

CRYSTALLISATION BEHAVIOUR OF PALM OIL: Crystal Size Distribution of Palm Oil and the Ternary Blends during Isothermal Crystallization using Focused Beam Reflectance Measurement (FBRM) system Zaliha Omar, Elina Hishamuddin and Nori


Slide 1 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Slide 1 Slide 1 Slide 1 More Documents & Publications Battery SEAB Presentation Energy Storage Systems 2010 Update Conference Presentations - Day 3, Session 3 FY 2011 Budget...


Slide 1 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Slide 1 Slide 1 Slide 1 More Documents & Publications The Kansas City Plant Mobile Device Security Checklist "Cybersecurity for State Regulators" - NARUC Primer (June 2012)...


Slide 1  

Gasoline and Diesel Fuel Update (EIA)

Applications of the Biomass Applications of the Biomass Scenario Model Brian W Bush Presentation at EIA's "Biofuels in AEO2013 " Workshop 20 March 2013 4 Focus of Biomass Supply-Chain Analysis Deployment Analysis: exploring how rapidly biofuel technologies might be deployed to make a significant contribution to the country's transportation energy - Generate plausible scenarios - Understand the transition dynamics - Investigate potential market penetration scenarios - Analyze prospective policies and incentives - Identify high-impact drivers and bottlenecks - Study competition for biomass resources - Assess R&D and deployment strategies - Enable and facilitate focused


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hutton Hutton Acting Associate Deputy Assistant Secretary Safety, Security and Quality Programs Office of Environmental Management, U.S. DOE 1 An organization's values and behaviors, modeled by its leaders, and internalized by its members, which serve to make safe performance of work the overriding priority to protect workers, the public, and the environment. DOE Integrated Safety Management Guide 2  Promote a shift from a focus on compliance toward pursuit of excellence Safety Culture Focus Areas Leadership Employee/Worker Engagement Organizational Learning Associated Attributes Behavioral Elements (description) 3  Joint DOE/EFCOG working group - 2007 ◦ Recommended safety culture principles based on nuclear


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Pin-fins Pin-fins are used to remove excess heat from the trailing edge of turbine airfoils. While much research has focused on heat transfer, little work has focused on flowfield measurements which can provide insight into further optimization of pin-fin array geometries. Flowfield Measurements in a Single Row of Low Aspect Ratio Pin-Fins The Pennsylvania State University Jason K. Ostanek and Dr. Karen A. Thole GAS TURBINE NEEDS PROJECT APPROACH HORSESHOE VORTEX Establish large scale facility and high resolution experimental measurement techniques Determine which flow features contribute most to heat transfer for a single row of pin-fins OBJECTIVES Leading edge heat transfer enhancement decreases with increasing Reynolds number SUMMARY AND CONCLUSIONS Kármán vortices contribute most to endwall heat transfer in a single row of pin-fins


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTMENT OF ENERGY DEPARTMENT OF ENERGY DATA REPORT ON SPOUSE/COHABITANT DOE F 5631.34 (03/98/Administrative Update 03/2011) All Editions Prior to 03/98 Are Obsolete OMB Control No. 1910-1800 OMB Disclosure Statement on Reverse 1. Name of Employee or Applicant (Last, First, Middle) 2. Present Name of Spouse/Cohabitant (Last, First, Middle) 3. Other Names Used by Employee or Applicant (Maiden name and/or names previously used) 4. Other Names Used by Spouse/Cohabitant (Maiden name and/or names previously used) 5. Social Security Number of Employee or Applicant 6. Social Security Number of Spouse/Cohabitant 7. Present Mailing Address of Spouse/Cohabitant 8. Date of Birth of Spouse /Cohabitant 10. Citizenship of Spouse/Cohabitant (complete a or b - whichever applies) Does your Spouse/Cohabitant hold dual citizenship with any country(ies)?


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE DOE Environmental Liabilities May 2013 1 Table of Contents Introduction FY12 EL Overview Section I General Background Section II CFO Environmental Liability Guidance Overview Section III Environmental Management Environmental Liability Section IV Active and Surplus Facilities Environmental Liability Section V Other Legacy Environmental Liabilities Section VI Regulatory Environment Section VII Additional Yearend Reporting and Related Liabilities Section VIII Focus for FY 2013 Appendix A Liability Math Appendix B Common Acronyms List Appendix C EM SOPP Appendix D Active Facilities Asbestos Estimation Appendix E Newly Generated Waste Liability Guidance Appendix F ES&H Liability 2 DOE Environmental Liability FY 2012 - $268 billion


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Significant Work. Extraordinary People. SRA. Significant Work. Extraordinary People. SRA. 1 Large-scale Diurnal Storage Study Presentation at DOE ESS Peer Review November 2, 2010 Poonum Agrawal Sentech, Inc., now part of SRA International 2 Project Objective * Characterize and assess emerging innovative bulk ES technologies and relevant applications - Focus on concepts using pumped storage or compressed air with capacities greater than 100 MW * Recommend strategy for DOE to hasten the commercialization of these innovative technologies. Significant Work. Extraordinary People. SRA. 3 Project Details * Project Duration: - May through December 2010 * Sandia Delegated Representative: - Georgianne Huff * Joint project with KEMA Consulting: - Poonum Agrawal, Sentech, Inc., now part of SRA International - Rick Fioravanti, KEMA Consulting


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Adaptable 3D Electron Microscopy for Adaptable 3D Electron Microscopy for Characterizing Nanoscale Materials Opportunity More Insight, Faster Industry Significance Benefits to Partner Development Status Contact Static characterization has been used for a NETL-RUA project (heat resistant steel), and other fundamental research including catalysts and nanominerals. Dynamic experiment is under-development. * Seeking mid-term collaboration research partner. We usually focus on fundamental materials science and try to establish a material's design principle via microstructure-functional property relationships * Can the capability be applied to solve an industry challenge? Yes, the technique is especially suitable for nanoparticle catalysts (noble and transition metal


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Process Control Process Control Space, Scale & Scope of Plant Control - Increase interconnections of advanced energy systems - More computations are performed at sensor and actuation level * How do we control and coordinate such systems? * Adopt and adapt new approaches to decision science for coordinated control to occur at large scale * Objectives - Derive criteria for assessing sensor effectiveness and system impact - Demonstrate effectiveness and reconfigurability of sensors - Extend work in sensors to actuation and control system architecture * Concept - Focus on what to control, what to optimize (not how to control) * Correct and accurate objective functions for each subsystem * Better system decomposition * Approaches for Control - Centralized - Distributed


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Centennial West Clean Line Centennial West Clean Line February 2012 2 Introduction to Clean Line Energy Connecting Renewable Energy to Demand Strong wind resources Large demand centers * Clean Line is an independent developer solely focused on building transmission lines. * Clean Line is backed by investors with a long-term outlook and patient capital. * Clean Line's management team brings a track record of success in energy project development. Integrating large clean energy sources with demand centers Strong wind and solar resources 3 Why do we need transmission? ...and with limited access to robust transmission systems Best wind resources are in the central spine of the United States away from distant population centers 4


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Environmental Challenge 2009 Environmental Challenge 2009 National Awards Webinar May 26 th , 2010 Agenda Introductory Remarks: Facilities Management - Frank Freda Investor Services - Jim Arce EPA ENERGY STAR - Alyssa Quarforth C&W Environmental Challenge Overview & Results Award Winner Presentations: Overview of environmental achievements Discussion of property best practices C&W Environmental Challenge Introductory Remarks Client Solutions Business Leaders Frank Freda Global Head of Facilities Management Jim Arce Global Head of Investor Services EPA ENERGY STAR Partner C&W became an ENERGY STAR Partner in 1999 ENERGY STAR is a voluntary partnership program: Focused on climate protection Provides strategic approach to energy management,


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

Lee Schipper Lee Schipper Senior Research Engineer Precourt Energy Efficiency Center, Stanford University and Project Scientist, Global Metropolitan Studies, UC Berkeley EIA 2009 Energy Conference April 7 Washington DC Looking Before You Leap into A Model: A New Climate for Seeing Transport Energy Futures? Precourt Energy Efficiency Center Stanford University * A research and analysis institute at Stanford * Established in October 2006 * Initial funding: $30 million pledge by Jay Precourt * Mission - To improve opportunities for and implementation of energy efficient technologies, systems, and practices, with an emphasis on economically attractive deployment - Focus on the demand side of energy markets - Energy efficiency: economically efficient reductions in energy use (or energy intensity)


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficient, Versatile, and Cost- Efficient, Versatile, and Cost- Effective Gas Separation Sorbents Opportunity Technology/Capability Overview Development Status Contact NETL has several different types of agreements for industrial collaborations. These include Cooperative Research and Development Agreements, Contributed Funds Agreements, and Nondisclosure Agreements. These instruments enable industrial partners to negotiate an agreement suitable for their needs including Go/No-Go decision points to ensure progress aligns with expectations. Once a technology is developed, it could be available for licensing. More information about working with NETL's Material Science and Engineering Focus Area can be found at: www.netl.doe.gov/onsite_research/materials-science.html


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Technology Technology Review Steven E. Koonin Under Secretary for Science June 2011 DOE-QTR Scope  The DOE-QTR will provide a context and robust framework for the Department's energy programs, as well as principles by which to establish multiyear programs plans and budgets. It will also offer high-level views of the technical status and potential of various energy technologies.  The primary focus of the DOE-QTR process and document will be on the following:  Framing the energy challenges  A discussion of the roles of government, industry, national laboratories, and universities in energy system transformation  Summary roadmaps for advancing key energy technologies, systems, and


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Peer Review Peer Review September 29, 2008 Washington D.C. Evaluation of Lead-Carbon Devices for Utility Applications DOE Energy Storage Program Sandia Contract 659172 Paula Walmet Specialty Chemicals Division MeadWestvaco Corporation Funding: Congressional ear-mark. 2 Program Overview Phase One: Explore possible advantages to carbon in energy storage  Evaluate lead based energy storage technologies  Develop carbon for lead based technologies - Increase cycle life for some applications - Improve charging characteristics Phase Two: Investigate performance benefit and refine understanding  Verify performance  Focus on material properties/mechanisms that result in performance benefit Phase Three: Determine best technology for application needs  Select best technology for 1 MW, 1 MWh utility demonstration


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

As A As A Power Resource Steven Nadel, Executive Director American Council for an Energy-Efficient Economy October 2010 2 The American Council for an Energy- Efficient Economy (ACEEE) 30 year old, non-profit 501(c)(3) dedicated to advancing energy efficiency through research and education. 35+ staff in Washington DC, + field offices in DE, MI, WA and WI. Focus on End-Use Efficiency in Industry, Buildings, Utilities, and Transportation; Economic Analysis & Human Behavior; and State & National Policy Worked on utility-sector energy-efficiency programs and policies since 1980s Savings Potential from Jan. 2009 Electricity Advisory Committee Report Average Statewide Utility Cost of Saved Energy for Efficiency Programs 3.3 3.3 3.1 3.0 2.9 2.8 2.7 2.6 2.1 1.9 1.9 1.7


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Presented to the Presented to the Nuclear Energy Research Advisory Committee Rebecca F. Smith-Kevern Office of Light Water Reactor Deployment Office of Nuclear Energy February 21, 2007 Program Status 169632-NREAC briefing (2) Nuclear Power 2010 ... Began as a Demonstration Project Program initiated in February 2002 Focused on addressing regulatory, financial, and technical challenges Based on Near-term Deployment Roadmap and other studies Government/industry cooperative effort * 50-50 cost-shared industry projects * Market-driven 169632-NREAC briefing (3) Nuclear Power 2010 ... Working with Industry to Build New Nuclear Plants Three Early Site Permit Demonstration Projects * Address site suitability, environmental protection, and emergency planning issues * Clinton and Grand Gulf awaiting Commission decision


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Attribute Attribute Preserving Network Equivalent Thomas J. Overbye (overbye@illinois.edu) Fox Family Professor of Electrical and Computer Eng. University of Illinois at Urbana-Champaign Graduate students Wonhyeok Jang (wjang7@illinois.edu) Saurav Mohapatra (smohapa2@illinois.edu) 1 CERTS Meeting Aug. 6-7, 2013 Overview  Overall objective - To develop equivalent models that preserve desired properties of the full model  Current focus - To create line limit preserving equivalents of interconnection level power systems - To assign limits to equivalent lines so that total transfer capability (TTC) in equivalent system matches that of original system as much as possible 2 Background  For decades power system network models have been equivalenced using the approach originally

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CALENDAR AND NEXT STEPS CALENDAR AND NEXT STEPS ELENA MELCHERT Committee Manager Ultra-Deepwater Advisory Committee SEPTEMBER 26, 2012 Ultra-Deepwater Advisory Committee  Committee Calendar - September 26, 2012: 20th UDAC Meeting in Houston, TX * Review the Secretary of Energy's 2013 Annual Plan * Establish ad hoc Review Subcommittees that will provide in depth review of the Annual Plan * Develop finding and draft recommendations for the Committee to discuss and review at October 2012 meeting - October 23 - 24, 2012: 21st UDAC Meeting in Houston, TX * Ad hoc Review Subcommittees will present findings and recommendations to the full Committee for discussion * Committee will focus on developing final recommendations - November 1, 2012: 22nd UDAC Meeting via Conference call


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Writing Winning Proposals Writing Winning Proposals Get In Line and Win! James R. Lindsay 10 th Annual U.S. Department of Energy Small Business Conference Small Businesses Leading the Way to Recovery and Reinvestment James R. Lindsay Page 1 Thought Successful grant writing involves the coordination of several activities, including planning, searching for data and resources, writing and packaging a proposal, submitting a proposal to a funder, and follow-up. Corporation for Public Broadcating Introductions Experience in writing government proposals Your expectations for the day! 1-2 years 3-5 years 5 + years Your Competition Government Funding Overview State Versus Federal Government Funding Great Depression New Deal Grants Born Sputnik Focus Science, Education, Technology


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Busbin Busbin Transmission Policy and Services Southern Company Transmission 2012 National Transmission Congestion Study Eastern Regional Workshop - Philadelphia, PA December 6, 2011 2012 National Transmission Congestion Study Based on the questions posed to panelists, there are two areas upon which I would like to offer comment: * Metrics To Be Used In The Study * Present / Future Congestion I'll then end with a few brief remarks focused on a third topic * EIPC Experience 2012 National Transmission Congestion Study - Metrics To Be Used In The Study #2 What factors should DOE look at when evaluating congestion and identifying congestion areas? 2009 Transmission Congestion Study defines congestion as, "The condition that occurs when transmission capacity in a specific location is not sufficient to enable safe delivery of all


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Cathodes SOFC Cathodes John S. Hardy, Xiao-Dong Zhou*, Jared W. Templeton, Zigui Lu, Jeffry W. Stevenson * Now at the University of South Carolina July 27-29, 2010 11 th Annual SECA Workshop Pittsburgh, PA FY10 Research Topics in the Cathode Sub-task Importance of Cathode Sintering Temperature Optimization for Cell Performance & Stability Enhanced Densification of the SDC Interlayer Concentration Polarization in LSCF Cathodes Effects of Contamination from Sealing Glass Volatiles on LSM & LSCF Cathodes Capability Development: In-situ XRD of an Operating SOFC Cathode* Effect of A-site Stoichiometry on LSCF Cathode Performance * The focus of this talk Objectives To develop the capability to perform in-situ XRD measurements on operating SOFC cathodes, including: A test fixture compatible with the XRD.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Storage Systems Program of the U.S. Department Of Energy through Pacific Energy Storage Systems Program of the U.S. Department Of Energy through Pacific Northwest National Laboratories EES technologies and PNNL focus Electrical energy Electrical charges: Capacitors Potential energy: pump hydro, compress air Kinetic energy: flywheels Chemical energy: batteries Direct Storage in charges Indirect storage via energy conversion PNNL strategy in stationary EES R&D EES R&D at PNNL EES Technologies Novel redox flow batteries, MWhs New gen Na-batteries, up to MWhs Low cost, long life Li-ion, community storage ... Crosscutting science Advanced diagnostic study, NMR, TEM, etc. Electrochemical study * Mass/charge transport * Electrical fields * Flow, thermal, ... * Basic chemistry * Materials structure * Physical properties * Electrochemical activity * Reaction kinetics


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

2008 Dominion 2008 Dominion Building New Nuclear Plants: The Utility Decision EIA 2008 Energy Conference April 8, 2008 Eugene S. Grecheck Vice President Nuclear Development © 2008 Dominion © 2008 Dominion © 2008 Dominion The Evolving Utility View of New Nuclear n Pre 2001-Skepticism n 2001-2003-Tentative exploration n 2003-2004-Focus on licensing hurdles, first ESP applications, formation of NuStart, DOE NP2010 solicitations n 2005-EPACT incentives n 2006-2007-Many COLA announcements, first applications submitted n 2008-Facing the realities? © 2008 Dominion The original issues-start of this decade n No new nuclear plant orders since 1978 n Licensing and construction takes too long n Last new plant began operation in 1996 n Construction and operations and maintenance costs are too high n Licensing is unpredictable


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dave Isiminger Dave Isiminger Site GIS & Environmental Systems Geospatial Technology Summit Flight Planning Tool Powered by: Environmental Data Portal Background Radiological Assistance Program (RAP) The Flight Planning Tool (FPT) 1 2 3 AGENDA Established early 1950s for the production of materials used to fabricate nuclear weapons Today the mission focuses: * Cold war clean up & environmental stewardship * Technology Innovation * Energy independence Background Radiological Assistance Program (RAP) The Flight Planning Tool (FPT) 1 2 3 AGENDA * DOE/NNSA Radiological First Responders * Deployable within 2 hours. * Regionally located to provide a timely response capability and foster relationships with other emergency response elements 8 7 5 8 7 4 2 1 6 2 3 0 DOE Regional Map and Coordinating Offices


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Management Best Practices Webinar Part 2 - Geospatial data NASA EarthData Webinar National Aeronautics and Space Administration www.nasa.gov Introduction to the ORNL DAAC Suresh K.S. Vannan Environmental Sciences Division Oak Ridge National Laboratory September 12, 2013 NASA EarthData Webinar National Aeronautics and Space Administration www.nasa.gov Best Practices, NASA EarthData Webinar, September 12, 2013 3 The Oak Ridge National Laboratory Distributed Active Archive Center (ORNL DAAC) archives data produced by NASA's Terrestrial Ecology Program in support of NASA's Carbon Cycle and Ecosystems Focus Area. About ORNL DAAC http://daac.ornl.gov Field Campaign Model Code Land Validation Regional and Global ORNL DAAC Best Practices, NASA EarthData Webinar, September 12, 2013


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Methodology for Methodology for Assessing CO 2 Storage Potential of U.S. Gas Shale Formations NETL 2013 Summer Research Symposium Angela Goodman, Isis Fukai, Dan Soeder, Grant Bromhal, Bob Dilmore, Kelly Rose, Brian Strazisar, Traci Rodosta, and George Guthrie National Energy Technology Laboratory August 20-22, 2013 Sheraton Station Square, Pittsburgh, Pennsylvania Purpose of Research: Develop a method to estimate CO 2 storage resource for gas shales in United States and Canada Focus of Gas Shale Research Adapt existing DOE-NETL CO 2 Storage Methodology to gas shales Atlas IV - November 2012 Atlas III - November 2010 Atlas II - November 2008 Atlas I - March 2007 * Simple Geometric-Based Formula * Extensive Peer-Review * Extensive Statistical Rigor Volumetric approach: geologic properties & storage efficiency


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Department of Energy's Department of Energy's Phase II Mercury Control Technology Field Testing Program China Workshop on Mercury Control from Coal Combustion October 31-November 2, 2005 Beijing, China Thomas J. Feeley, III thomas.feeley@netl.doe.gov National Energy Technology Laboratory China Hg Workshop_Nov 2005 Outline * Background * Field testing - Mercury-specific technology, focusing on ACI * Field testing - Co-benefit control * Preliminary ACI costs * Conclusion/future plans China Hg Workshop_Nov 2005 Power Plant Mercury Control Baghouse or ESP FGD Boiler Stack Cleaning SCR Hg 75 ton/yr Hg in coal Current Emissions 48 ton/yr out stack Hg Hg Hg Hg 27 ton/yr Sorbent Injection Oxidizing Systems Hg Specific Control Co-Benefit Control China Hg Workshop_Nov 2005 Mercury Control Technology Program Performance/Cost Objectives


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Energy eere.energy.gov 1 Program Name or Ancillary Text eere.energy.gov WIND AND WATER POWER PROGRAM 1 2010 Wind Technologies Market Report Ryan Wiser and Mark Bolinger Lawrence Berkeley National Laboratory Report Summary June 2011 WIND AND WATER POWER PROGRAM 2 Presentation Overview * Introduction to 2010 edition of U.S. wind energy market report * Wind installation trends * Wind industry trends * Price, cost, and performance trends - Power sales prices - Installed wind project costs - Wind turbine transaction prices - Wind project performance - O&M cost trends * Policy and market drivers * Future outlook WIND AND WATER POWER PROGRAM 3 2010 Wind Technologies Market Report Purpose, Scope, and Data: * With a focus on 2010, summarize trends in the U.S. wind power market,


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Performance of Forecasting Models Across the North Slope of Alaska Performance of Forecasting Models Across the North Slope of Alaska During the Mixed-Phase Arctic Cloud Experiment Victor Yannuzzi, Eugene Clothiaux, Johannes Verlinde and Jerry Harrington The Pennsylvania State University Introduction The Mixed-Phase Arctic Cloud Experiment (MPACE) was conducted across the North Slope of Alaska (NSA) from September 27 through October 22, 2004. The experiment was funded by the Department of Energy (DOE)-Atmospheric Radiation Measurement (ARM) program to study the microphysics, radiative properties, thermodynamics, and life cycle of mixed-phase clouds in the Arctic. A focused set of observation stations and soundings were in place across the NSA (figure 1) where conditions could be expected to produce low-level mixed-phase clouds on


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

2012 Wind Technologies Market Report Ryan Wiser and Mark Bolinger Lawrence Berkeley National Laboratory Report Summary August 2013 WIND AND WATER POWER PROGRAM 2 2012 Wind Technologies Market Report Purpose, Scope, and Data: * Publicly available annual report summarizing key trends in the U.S. wind power market, with a focus on 2012 * Scope primarily includes wind turbines over 100 kW in size * Separate DOE-funded annual reports on distributed and offshore wind * Data sources include AWEA, EIA, FERC, SEC, etc. (see full report) Report Authors: * Primary authors: Ryan Wiser and Mark Bolinger, Berkeley Lab * Contributions from others at Berkeley Lab, Exeter Associates, NREL Funded by: U.S. DOE Wind & Water Power Technologies Office Available at: http://www1.eere.energy.gov/wind/


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ward Sproat Ward Sproat Deputy Project Director-WTP Bechtel National, Inc. 1  NRC Finds Operators Sleeping in the Control Room ◦ 2 Unit nuclear plant shutdown for almost 3 years ◦ CEO/COO and other officers fired ◦ Company within months of bankruptcy  Root cause: No nuclear safety culture ◦ Management ignored repeated outside warnings ◦ Management was technically focused ◦ Poor individual accountability was ignored ◦ Performance expectations were low or non-existent 2  Brought in new leadership from outside the company  Defined the safety-oriented performance culture we wanted  Set clear performance and behavioral expectations for managers/supervisors and individual contributors  Established standing processes to monitor/measure


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

WB Barton WB Barton Office of Waste Processing Technical Exchange May 19, 2009 Waste Tank Waste Tank Heels and Heels and Heel Heel Simulants Simulants Tank Operations Contract 2 Acknowledgements * Dan Herting and Heinz Huber did most of the chemistry work. * Don Geniesse did extensive chemical modeling to determine mineral forms expected. * Leela Sasaki, Duc Nguyen, and Doug Adkisson provided valuable insights. Tank Operations Contract 3 Background * WRPS proposed to investigate the ECC process for deployment in Hanford tanks as a heel treatment process. * Needed a chemical simulant of the heel for testing of the ECC process. * Retrieval is focused on C Farm tanks for the next 5 years. Tank Operations Contract 4 Background C-108 C-109 C-110 C-103 Tank Operations Contract 5 Background


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hillman Hillman Office of Health, Safety and Security September 19, 2012 1  Update DOE safety analysis and emergency management requirements/guidance and perform pilot applications  Perform system walkdowns and evaluations at several Cat 1 and 2 DOE nuclear facilities to assess potential susceptibilities to natural phenomena hazards and external BDBEs  Conduct emergency drills and exercises at DOE sites with nuclear facilities, focusing on BDBEs 2  HSS and NA-41 initiated a project involving a series of pilot studies in response to short-term actions identified in the DOE August 2011 report  The purpose of the pilots was to examine: ◦ How Beyond Design Basis Events (BDBEs) were evaluated and documented in DSAs ◦ Results of actions taken as a result of Safety Bulletin 2011-01


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Geospatial Technologies from the Geospatial Technologies from the Ground Up: The State Perspective Department of Energy Geospatial Technology Summit August 16, 2011 NATIONAL STATES GEOGRAPHIC INFORMATION COUNCIL Jon Gottsegen President, National States Geographic Information Council State GIS Coordinator/Enterprise GIS Services Mgr, State of Colorado Office of Information Technology NATIONAL STATES GEOGRAPHIC INFORMATION COUNCIL What is NSGIC? (www.nsgic.org) * Small 501 (c) 6 nonprofit organization (~579 members) * Formed in 1991 * We Promote - Effective and efficient government through the prudent adoption of geospatial technologies - Statewide GIS coordination efforts * We serve as the voice of States for geospatial issues * Actively engaged with many Federal organizations - Especially focused on the FGDC and the National Spatial Data


PPT Slide  

Gasoline and Diesel Fuel Update (EIA)

Working gas in storage is estimated to have been below 1,800 billion Working gas in storage is estimated to have been below 1,800 billion cubic feet at the end of December, more than 20% below the previous 5-year average. The estimated end-year level is the lowest for the period of time that EIA has records. The current outlook for winter demand and supply suggests that storage is likely to remain very low this winter. In the base case, we project that gas storage will fall to about 470 billion cubic feet at the end of the heating season (March 31, 2001). The previous 30-year observed low was 758 billion cubic feet at the end of the winter of 1995-1996. If summer gas demand next year is as strong as we currently expect it to be, the low end-winter storage levels will present a strong challenge to the North American gas supply system to maintain flexibility and provide


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of November 2009 Recordable Injury Cases * Truck Driver - Contusion of knee - EE tripped over an uneven floor joint while delivering a package. - The floor elevation reveal had been previously blocked by fixed equipment. - The building occupants had removed the fixed object but not addressed the trip hazard.


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-combustion Impacts Oxy-combustion Impacts in Existing Coal-fired Boilers 2013 NETL CO 2 Capture Technology Meeting July 8-11, 2013 Bradley Adams, Andrew Fry 1 , Brydger Van Otten, Tim Shurtz 1 University of Utah REACTION ENGINEERING INTERNATIONAL Presentation Outline * Project Overview * Summarize Previous Work * Introduce Current Work * Preliminary Testing Results - Bench-scale Mercury Measurements - Pilot-scale Mercury Measurements - Pilot-scale Corrosion Measurements * Project Status Summary REACTION ENGINEERING INTERNATIONAL Project Overview * Objective: Characterize and predict performance and operational impacts of oxy-combustion retrofit designs on existing coal-fired boilers * Schedule: 10/1/08 - 9/30/13 (includes 1-yr extension) * Program Managers: Timothy Fout, Andrew Jones

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Agency Fleet Meeting DOE Agency Fleet Meeting FedFleet 2012 Navid Ahdieh & Ryan Daley June 25, 2012 2 NREL - DOE Fleet Sustainability Assistance * Federal fleet requirement guidance o e.g. May 24, 2011 Presidential Memorandum on Federal Fleet Performance - annual VAM submission * Resources for meeting requirements o FleetDASH o NOVA analysis * Assistance with fulfilling reporting mandates o Annual AFV Acquisition Report 3 Statutory & E.O. Requirements EPAct ('92 & '05) E.O. 13423 EISA '07 E.O. 13514 AFV Acquisition AFVs 75% of light- duty acquisitions Use PHEVs when commercially available Alternative Fuel Use AFVs only use AF unless waived Increase AF use 10% from previous year Install renewable pumps at all fueling centers Fleet Planning Agency plan to meet


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

in the in the Blackbody Calibration of Pyrgeometers By Ibrahim Reda, Julian Gröbner * , Tom Stoffel, Daryl Myers, and Bruce Forgan ** Eighteenth Atmospheric Radiation Measurement (ARM) Program Science Team Meeting *Physikalisch-Meteorologisches Observatorium Davos, World Radiation Center (PMOD/WRC) ** Bureau of Meteorology, Australia Abstract Pyrgeometers are used to measure the atmospheric longwave irradiance through out the ARM program sites. Previous calibrations of pyrgeometers using ARM/Eppley/NREL blackbody were consistent, but introduced a difference in the historical clear sky measured irradiance. This difference was believed to be in the order of 12 W/m 2 . In this poster we show the improvements to the blackbody and calibration methodology by comparing our


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxalic acid has been Oxalic acid has been used since the 1980's to clean waste tanks - Tank 16 in 1983 - Tank 24 in 1985 - Tanks 5-6 in 2008 - Tank C-106 in 2002 * Also used in the commercial nuclear industry to clean secondary side steam generators Tank 16 Before Tank 16 After History of Chemical Cleaning * Recognizing that the dissolution step of previous oxalic acid campaigns and the dissolution step of ECC are the same: The objective is to: -Describe each oxalic acid cleaning campaign in the SRS and Hanford tanks -Compare and contrast the campaigns -Apply the knowledge gained to planned ECC dissolution Bulk OA ECC Objective dissolved sludge Oxalic Acid Waste Tank Oxalic Acid dissolved sludge ECC Bulk OA ECC Print Close Using Oxalic Acid Cleaning Experience to Improve ECC Tank 16 5 6 24 C-106


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

January 31, 2013 January 31, 2013 Injury/Illness Cases - January 2013 * Repetitive strain of wrist * The Research Associate experienced the onset of discomfort due to computer keyboard and mouse use at workstations that were not optimally configured for this employee. * Back discomfort / strain * The Business Analyst experienced the onset of discomfort in the back due to sitting for extended periods of time at the computer workstation. * Strain of wrist * The Writer/Editor experienced the onset of wrist discomfort that may relate back to a previous workstation adjustment. 2 Environment / Health / Safety / Security DIVISION Ergonomic Injury/Illness Cases - January 2013 3 Environment / Health / Safety / Security DIVISION * Contusion on knee * The Computer Systems Engineer sustained a minor contusion of the knee


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TCIPG Center Overview TCIPG Center Overview TCIPG Summary * Builds on NSF/DOE/DHS Effort from 2005-2010 * $15 M per over 5 years from DOE/DHS, starting Oct 1, 2009 * $3.75 M cost share from Universities * Funded by Department of Energy, Office of Electricity - With support from Department of Homeland Security * 5 Universities - University of Illinois at Urbana- Champaign - Washington State University - University of California at Davis - Dartmouth University - Cornell University Extend and integrate previously developed TCIP technologies and to develop new ones that collectively provide resilience in the nation's electric grid cyber infrastructure that ensures - Trustworthy and timely operations, - Survives malicious attacks while ensuring continuous delivery of services, and is built on an


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

06, Itron Inc. 06, Itron Inc. 1 Under the Bright Lights: Energy Efficiency Programs Energy Information Administration Annual Conference April 27, 2011 Joe Loper © 2006, Itron Inc. Boom Times for Energy Efficiency  EISA (2007) > Most significant EE legislation in previous 3 decades > Incandescent light bulb phase out starting 2012 > Vehicle fuel economy standards increased for first time since 1980s > Numerous program budget authorizations  Federal Stimulus Funding  Ratepayer Funded Programs > All states except AK and LA > 4 states half of total funding, 10 states 94% 2 © 2006, Itron Inc. US Energy Efficiency Funding 1990-2013 3 $- $2,000,000 $4,000,000 $6,000,000 $8,000,000 $10,000,000 $12,000,000 $14,000,000 $16,000,000 1990 1991 1992 1993 1994 1995 1996 1997 1998


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

H. Lagdon, Jr. H. Lagdon, Jr. Chief of Nuclear Safety 1  DPO Process  Overview of the Waste Treatment and Immobilization Plant (WTP) Pretreatment (PT) Facility  Panel Membership  DPO Issues  Panel's Review, Conclusions, and Recommendations  Path Forward 2  The purpose of the DPO process is to bring management attention to technical concerns.  A DPO is a technical issue that: ◦ Differs from previous management decisions, stated positions, established policies, or practices; ◦ Has not been adequately considered, in the opinion of the employee; ◦ Has the potential for a significant negative impact on environment, safety, and health (ES&H).  Applies to DOE Federal employees and DOE contractor and


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1  PRA studies began in the late 1980s  1989, ATR PRA published as a summary report  1991, ATR PRA full report  1994 and 2004 various model changes  2011, Consolidation, update and improvement of previous PRA work  2012/2013, PRA risk monitor implementation 2  The PRA supports the ATR Updated Final Safety Analysis Report (UFSAR)  The PRA provides sufficient information regarding either core or fuel damage (CDF or FDF) to enable ATR personnel to make risk informed decisions  Improved performance in facility operation, testing, maintenance, training, and emergency procedures  Ensure cost-effective approaches and the setting of priorities for plant upgrades and modifications, especially for risk reduction/system improvements


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

response of an oligonucleotide-based biosensor to environmental mercury response of an oligonucleotide-based biosensor to environmental mercury Harry M. Edenborn Geosciences Division, Office of Science and Engineering Research, National Energy Technology Laboratory, U.S. Department of Energy, P.O. Box 10940, Pittsburgh, PA 15236 Introduction 5'-6-FAM (TTCTTTCTTCCCCTTGTTTGTT)-DAB-3' The molecular beacon used previously consisted of two mercury-binding oligonucleotide sequences (underlined), connected by a linker sequence (CCCC), and terminated by the fluorophore and quencher moieties, fluorescein (6-FAM) and dabcyl (DAB), respectively. In this configuration, the fluorophore exhibits its maximum UV fluorescence at 520 nm. CTTGTTTGTT-DAB-3' | C | C Hg Hg Hg | C | CTTCTTTCTT-6-FAM-5' One environmental pollutant of particular relevance to the


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

MicroBlower MicroBlower at a glance  long operating life  solar powered  remediates shallow areas  remediates vadose zone  excellent for treatment polishing  offers significant cost savings  U. S. Patent 6,971,820 The MicroBlower enables the use of simple, low-cost soil vapor extraction in shallower areas than previously considered possible. Perhaps the greatest potential for the MicroBlower is in treatment polishing of an area treated by an expensive, large blower system that still has residual contamination. Installation of an economical MicroBlower system to finish the cleanup at greatly reduced costs, allows the larger systems to be used where they can produce greater returns. The MicroBlower also can remediate sites that are smaller


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 OSTI and Science.gov OSTI focuses on DOE R&D results and related STI Science.gov integrates most STI across all agencies 50 million pages of STI All searchable...


Business Case Slide 3: DU Uses R&D Program Foundation  

NLE Websites -- All DOE Office Websites (Extended Search)

DU Uses R&D Program Foundation Previous Slide Next Slide Table of Contents DU Uses R&D Program Foundation Based on DU materials use "roadmap" developed by DOE and lab staff from...


Business Case Slide 2: Drivers for DU Use R&D  

NLE Websites -- All DOE Office Websites (Extended Search)

Drivers for DU Use R&D Previous Slide Next Slide Table of Contents Drivers for DU Use R&D Compliance agreement with Ohio EPA Still in force; requires R&D effort and annual report...


No Slide Title  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

George Beveridge George Beveridge Director, Europe BNFL Environmental Services 27 June 2003 Slide 4 File Ref: WAGR Decommissioning Programme 2000 2001 2002 2003 2004 2005 2006 Operational Waste Hot Box Loop Tubes Neutron Shield Graphite Core Thermal Shield Lower Structures PV&I TC & OVM Campaign Contract End date early 2005 Slide 5 File Ref: Recent Successes  Preliminary Operations completed to programme  Operational Waste completed to programme  Hot Box 5 months late  Loop Tubes completed 20 days early  Neutron Shield completed 2 mths early  Graphite Core completed 8 mths early  Thermal Shield completed 30 days early Slide 6 File Ref:  What's next? Slide 7 File Ref: WAGR Decommissioning Campaign 7a Lower Structures Dismantling Slide 9 File Ref: Lower Structures Layout


Previous Testbed Research  

NLE Websites -- All DOE Office Websites (Extended Search)

Previous Testbed Research R&D Overview 100G Testbed Testbed Description Testbed Results Current Testbed Research Previous Testbed Research Proposal Process Terms and...


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

HTS Magnet R&D at BNL Napa, CA, November 6, 2012 Slide No. 1 LTHFSW12 HTS Magnet R&D at BNL Ramesh Gupta (on behalf of BNL staff and external collaborators) Superconducting Magnet...


Wind Webinar Presentation Slides | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Presentation Slides Wind Webinar Presentation Slides Download presentation slides from the DOE Office of Indian Energy webinar on wind renewable energy. DOE Office of Indian Energy...


Biomass Webinar Presentation Slides | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Presentation Slides Biomass Webinar Presentation Slides Download presentation slides for the DOE Office of Indian Energy webinar on biomass renewable energy. DOE Office of Indian...


Business Case Slide 39: Deferred Pending Need R&D Tasks  

NLE Websites -- All DOE Office Websites (Extended Search)

Deferred Pending Need R&D Tasks Previous Slide End of Presentation Table of Contents "Deferred Pending Need" R&D Tasks Heavy concretecermet demo cask Dose calculation...


Slide system for machine tools  

DOE Patents (OSTI)

The present invention relates to a machine tool which permits the machining of nonaxisymmetric surfaces on a workpiece while rotating the workpiece about a central axis of rotation. The machine tool comprises a conventional two-slide system (X-Y) with one of these slides being provided with a relatively short travel high-speed auxiliary slide which carries the material-removing tool. The auxiliary slide is synchronized with the spindle speed and the position of the other two slides and provides a high-speed reciprocating motion required for the displacement of the cutting tool for generating a nonaxisymmetric surface at a selected location on the workpiece.

Douglass, S.S.; Green, W.L.


Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Headlines Previous Editions  

NLE Websites -- All DOE Office Websites (Extended Search)

Previous Previous Editions: Volume 14 Volume 13 OCT 2013 SEP 2013 AUG 2013 JUL 2013 JUN 2013 MAY 2013 APR 2013 MAR 2013 FEB 2013 JAN 2013 DEC 2012 NOV 2012 OCT 2012 SEP 2012 AUG 2012 JUL 2012 Volume 12 Volume 11 Volume 10 Volume 9 Volume 8 Volume 7 JUN 2012 MAY 2012 APR 2012 MAR 2012 FEB 2012 JAN 2012 DEC 2011 NOV 2011 OCT 2011 SEP 2011 AUG 2011 JUL 2011 JUN 2011 MAY 2011 APR 2011 MAR 2011 FEB 2011 JAN 2011 DEC 2010 NOV 2010 OCT 2010 SEP 2010 AUG 2010 JUL 2010 JUN 2010 MAY 2010 APR 2010 MAR 2010 FEB 2010 JAN 2010 DEC 2009 NOV 2009 OCT 2009 SEP 2009 AUG 2009 JUL 2009 JUN 2009 MAY 2009 APR 2009 MAR 2009 FEB 2009 JAN 2009 DEC 2008 NOV 2008 OCT 2008 SEP 2008 AUG 2008 JUL 2008 JUN 2008 MAY 2008 APR 2008 MAR 2008 FEB 2008 JAN 2008 DEC 2007 NOV 2007 OCT 2007 SEP 2007 AUG 2007


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov New Features NEW NEW 2 New Features * "At A Glance" clip art descriptor used in case narratives. - Examples * Slip, Trip and Fall * Computer Workstation Ergonomic * Struck Against * Two new slides that compare organizational injury case profile by month. - Science Divisions - Operations Divisions


Previous Year Awards  

NLE Websites -- All DOE Office Websites (Extended Search)

Awards Awards Previous Year Awards 2013 Allocation Awards This page lists the allocation awards for NERSC for the 2013 allocation year (Jan 8, 2013 through Jan 13, 2014). Read More » NERSC Initiative for Scientific Exploration (NISE) 2013 Awards NISE is a mechanism used for allocating the NERSC reserve (10% of the total allocation). In 2013 we made the second year of the two-year awards made in 2012, supplemented by projects selected by the NERSC director. Read More » Data Intensive Computing Pilot Program 2012/2013 Awards NERSC's new data-intensive science pilot program is aimed at helping scientists capture, analyze and store the increasing stream of scientific data coming out of experiments, simulations and instruments. Read More » 2012 Allocation Awards This page lists the allocation awards for NERSC for the 2012 allocation


USS Previous Speakers  

NLE Websites -- All DOE Office Websites (Extended Search)

2011 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 Speaker Host Schedule Previous User Science Seminar Speakers Date Speaker Affiliation CAT/ Beamline Title 3/8/13 3/1/13 3/1/13 2/22/13 Xianghui Xiao ANL-XSD-IMG 2-BM X-ray fast tomography and its applications in dynamical phenomena studies in geoscience at the APS 2/22/13 Patrick Clancy Univeristy of Toronto 6-ID & 30-ID Magnetic Order and Excitations in Rh-doped Sr2IrO4 Probed with Resonant X-ray Scattering Jan-2013 Canceled - Beam Shutdown 2012 Dec./11 Lab Shutdown 12/14/12 Chad Folkman ANL-MSD In-operando catalysis and X-ray diffraction from complex epitaxial oxide thin films 12/14/12 Ben Ocko Brookhaven National Lab Grazing-incidence transmission small-angle x-ray scattering (GTXSAXS)


No Slide Title  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 1 Presented by: Mark Steele: Ex WAGR Project Manager Decommissioning of Windscale Advanced Gas-Cooled Reactor (WAGR) Slide 2 Introduction * UK policy for nuclear power plant decommissioning is long-term safe- storage of reactor facilities * WAGR Project is being used to demonstrate that such a plant can be fully decommissioned * Project funded by the UK Government * Windscale Licensee UKAEA * During early and mid 1990"s facility modified and construction of Reactor Dismantling Machine and Waste Route * 1999 contract let for the dismantling of the reactor to Magnox Electric - fixed price * Scope included engineering and design, safety submission, provision of equipment and operations


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of June 2010 Recordable Injury Cases * Custodian - Shoulder strain - Use of a wet vacuum with worn rollers caused strain of shoulder region. * Custodian - Contusion of thumb - Due to construction site activity, the walkway was constricted and obstructed. Movement of the refuse barrel on the walkway became awkward and


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of May 2010 Recordable Injury Cases * Custodian - Knee strain - While walking on level ground outside B64, the employee heard a 'pop' and felt a sharp knee pain. * Truck Driver - Inhalation of solvents - While delivering packages and picking up material in B90, the employee became overcome by solvent


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2008 Recordable Injury Case * There was one recordable case in October - An employee was standing on a seismic bracing support while working on scientific apparatus. The employee slipped off the bracing resulting in an ankle strain. - This was a Lost Work Day Case * ISM Deficiency


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2009 Recordable Injury Cases * Chemist Post Doc Fellow - Laceration of finger - EE was disconnecting tubing from a condenser. The condenser broke from the forces applied and EE sustained small laceration. * Custodian - Knee strain - EE was pivoting to reach for a waste container and


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

November 30, 2011 November 30, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall November 2011 * Computer Systems Engineer - Chipped tooth and bruised buttocks - While descending stairs from a building at Argonne National Lab, the LBNL employee slipped on the second step down from the top landing. The employee was carrying a server unit


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of January 2011 Injury/Illness Cases * Mechanical Engineering Technician - Minor contusion to hand - While using a hand truck to raise and move a pallet, the employee applied additional force to handle to lift load by pressing on the hand gripping the hand truck handle. * Guest Postdoctoral Fellow - Hand laceration


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

October 31, 2011 October 31, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall October 2011 * Administrative Specialist - Fractured nose and facial abrasion - The employee slipped and fell against the steps while ascending the wet wooden stairway behind 50F [WWY 089]. * Custodian - Foot strain - The employee slipped and twisted the right foot while


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

09 09 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of December 2009 Recordable Injury Cases * Graduate Student Research Assistant - Repetitive strain of shoulder - EE worked at optical microscope station, lab bench, and computer workstations for extended time periods without assessing ergonomic factors. * Student Assistant - Thumb laceration


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

09 09 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of February 2009 Recordable Injury Cases * Computer ergonomics - right hand and shoulder strain - Developed pain in right shoulder and right hand several weeks after moving work locations. The set-up of the new work station caused EE to twist in odd positions to perform her job. * Slip/Trip/Fall - laceration of forehead


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

January 31, 2012 January 31, 2012 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - January 2012 Ergonomic (keyboard/mouse) * Repetitive strain multiple upper extremities - The Computer Systems Engineer developed acute symptoms of pain and discomfort of the shoulders and upper extremities after using a laptop computer while on travel. Less than


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of April 2009 Recordable Injury Cases * Technician - Musculoskeletal strain - Employee felt an acute pain in left shoulder while turning steering wheel. * Shop work - strain - EE was treated for aggravation of non- occupational upper arm injury. * Shop work - strain - EE was treated for upper arm discomfort


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

10 10 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of August 2010 Recordable Injury Cases * Student Assistant - Strain/sprain of ankles, bruises - While quickly going down ATM stairs, was holding wallet in hands. Fell from upper step and landed on hands on landing at bottom of steps. * Biologist Research Sci/Eng - Repetitive strain of neck


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of February 2011 Injury/Illness Cases * Electrical Engineer - Ankle strain - While walking to office after arriving at work in the morning, the employee's knee buckled causing the ankle to roll. * Postdoctoral Fellow - Clean needle puncture of finger - While manipulating a needle attached to a building


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall June 2011 * Administrator - Fractured wrist - The employee fell to the parking lot surface while walking. * Project Manager - Contusion of wrist and hand - The employee tripped while ascending exterior wooden staircase (handrail was not used). * Custodian - Ankle sprain


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of April 2010 Recordable Injury Cases * Computer Systems Engineer - Finger strain - Associated with mouse use at computer workstation. (A case from 2009 that became recordable in April of 2010) 3 Narrative of April 2010 First Aid Cases * Administrative Assistant - Wrist strain - Loading and unloading boxes of conference

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of August 2009 Recordable Injury Cases * Material Specialist - Knee strain while climbing stairs - EE reported to Health Services after twisting left knee while climbing stairs after arriving at work in the morning. * Property Specialist - Laceration to scalp due to fall on staircase


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

August 31, 2011 August 31, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall August 2011 * Administrator - Abrasions and contusions, multiple - The employee lost balance and fell from the second step of a platform ladder while retrieving supplies from a shelf in the supply storage room. 3 Injury/Illness Cases - Material Handling


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of June 2009 Recordable Injury Cases * Senior Research Technician - Upper extremity strain - EE reported right upper extremity pain that relates to computer and repetitive laboratory bench process work. * Senior Administrator - Lower back pain - EE reported to Health Services with lower back


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Musculoskeletal May 2011 * Electrician Apprentice - Strain of right wrist - The employee was tightening a beam clamp with an open end wrench and felt a "pop" in the wrist. * Custodian - Knee strain - The employee noted some pain in the knee while ascending and descending stairs.


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of January 2010 Recordable Injury Cases * Guest Postdoctoral Fellow - Second degree burn of forearm - Employee spilled hot agarose gel on forearm. * Principal Research Technician - Elbow and shoulder strain - Employee had developed discomfort and pain in the upper extremities in July of 2009 in response to


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

December 31, 2011 December 31, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - December 2011 Slip / Trip / Fall * Administrative Assistant - Contusion of knee - The employee slipped on a steep portion of the paved driveway (possibly on the built up painted crosswalk striping) to the N4 parking area. * Subcontracts Administrator - Contusion of hand


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2008 Recordable Injury Case * There was one recordable case in October - An employee was standing on a seismic bracing support while working on scientific apparatus. The employee slipped off the bracing resulting in an ankle strain. - This was a Lost Work Day Case * ISM Deficiency


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of March 2009 Recordable Injury Cases * Employee experienced a sudden acute onset of pain in the wrist and hand while performing routine computer keyboard activities. * Computer ergonomics - strain - Employee was treated for upper trunk and extremity pain related to a combination of workstation changes and


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of February 2010 Recordable Injury Cases * Custodian - Lower back strain - Employee developed pain while lifting refuse bags. * Carpenter - Shoulder strain - Employee felt pain sensation while hoisting a bucket of tools (using a rope) to the roof top work location. [December case reported in Feb.]


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of September 2009 Recordable Injury Cases * Research Associate - Repetitive strain of hands - EE experienced discomfort and pain from a combination of laboratory (pipetting) manipulations and keyboard and mouse use. * Physicist - Laceration forearm - EE slipped while descending stairway in B50B and


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

10 10 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2010 Injury/Illness Cases * Guest Student Assistant - Finger contusion - While plumbing additional signal cables in a NIM bin rack the left middle finger struck the blade of one of the cooling fans. * Materials Project Scientist/Engineer - Allergic response - Employee experienced a sudden onset of allergy


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of December 2008 Recordable Injury Case * No injuries incurred during December were classified as recordable during the month of December, however: - A keyboard / mouse repetitive strain case reported in November 08 became recordable in December - The case was initially reported as


Assessing Energy Resources Webinar Presentation Slides  

Energy.gov (U.S. Department of Energy (DOE))

Download presentation slides from the DOE Office of Indian Energy webinar on assessing energy resources.


Strategic Energy Planning Webinar Presentation Slides  

Energy.gov (U.S. Department of Energy (DOE))

Download presentation slides from the DOE Office of Indian Energy webinar on strategic energy planning.


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

February 29, 2008 February 29, 2008 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 LBNL Recordable Cases FY08 vs FY06 and FY07 through February 29, 2008 0 1 2 3 4 5 6 7 8 9 O c t o b e r N o v e m b e r D e c e m b e r J a n u a r y F e b r u a r y M a r c h A p r i l M a y J u n e J u l y A u g u s t S e p t e m b e r Num ber of Case s FY '06 Total = 37 Cases FY '07 Total = 47 Cases FY ' 08 Total To Date = 16 Cases 3 LBNL DART Cases FY08 vs FY06 and FY07


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 LBNL Recordable Cases FY '08 vs FY '06 and FY '07 through October 31, 2007 0 1 2 3 4 5 6 7 8 9 O c t o b e r N o v e m b e r D e c e m b e r J a n u a r y F e b r u a r y M a r c h A p r i l M a y J u n e J u l y A u g u s t S e p t e m b e r Num ber of Case s FY '06 Total = 37 Cases FY '07 Total = 47 Cases FY '08 Total To Date = 8 Cases 3 LBNL Injury Cases By Division for FY'06, FY'07, and FY'O8


No Slide Title  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 LBNL Recordable Cases FY06 through August 31 FY08 0 1 2 3 4 5 6 7 8 9 Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Number of Cases FY '06 Total = 37 Cases FY '07 Total = 48 Cases FY '08 Total To Date = 45 Cases 3 LBNL DART Cases FY06 through August 31 FY08 0 1 2 3 4 5 Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Number of Cases FY '06 Total = 8 Cases


No Slide Title  

National Nuclear Security Administration (NNSA)

Users Annual Training Meeting New Orleans, Louisiana-May 24-26, 2005 Sponsored by the U.S. Department of Energy & the U.S. Nuclear Regulatory Commission Major Focuses * Improve...


Electricity Grid Basics Webinar Presentation Slides and Text...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electricity Grid Basics Webinar Presentation Slides and Text Version Electricity Grid Basics Webinar Presentation Slides and Text Version Download presentation slides and a text...


Previous Meetings: Artificial Retina Project  

NLE Websites -- All DOE Office Websites (Extended Search)

Previous Meetings Second DOE International Symposium on Artificial Sight, Sponsored by DOE, April 18, 2005 First DOE International Symposium on Artificial Sight, Sponsored by DOE,...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


No Slide Title  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

999 Federal Advisory Committee 999 Federal Advisory Committee September 9-12, 2008 Guide DeHoratiis Acting Deputy Assistant Secretary Office of Oil and Natural Gas Designated Federal Officer Ultra-Deepwater and Unconventional Natural Gas and Other Petroleum Resources Committee Instructions * Role: Provide advice to DOE - Provide recommendations on the development and priorities of the research program - Look at objectives of the annual plan within the context of the overall plan - Focus on Consortium-administered portion of the Plan, and also comment on NETL research and potential for duplication between NETL and Consortium portions * Guidance - Focus on big picture. Don't rewrite plan but advise on strengths and weaknesses. - Consensus is good, but should not be forced. - Majority opinion with minority viewpoint is fine.


Production and Handling Slide 4: Yellow Cake  

NLE Websites -- All DOE Office Websites (Extended Search)

Uranium oxide (U3O8), a granular solid, is commonly called "yellowcake" because of its characteristic color. Slide 4...


Pressure vessel sliding support unit and system using the sliding support unit  

DOE Patents (OSTI)

Provided is a sliding support and a system using the sliding support unit. The sliding support unit may include a fulcrum capture configured to attach to a support flange, a fulcrum support configured to attach to the fulcrum capture, and a baseplate block configured to support the fulcrum support. The system using the sliding support unit may include a pressure vessel, a pedestal bracket, and a plurality of sliding support units.

Breach, Michael R.; Keck, David J.; Deaver, Gerald A.



Research Focus  

NLE Websites -- All DOE Office Websites (Extended Search)

Focus Focus Work at FEERC is centered on three interrelated areas of research: fuels, engines, and emis- sions. FEERC scientists study the impacts of fuel properties on advanced combustion processes as well as on emissions and emission control strategies and devices. The range of fuels studied includes gaseous (natural gas) and liquid fuels from conventional and unconventional fossil- based sources, as well as non-petroleum fuels from synthetic and renewable sources. The FEERC conducts research on innovative internal combustion engine technologies and control systems for improved efficiency. Combining novel diagnostic and experimental methods with modeling, the Center's scientists also develop improved understanding of the functions and key mechanisms of emission control devices


Hydroelectric Webinar Presentation Slides and Text Version  

Energy.gov (U.S. Department of Energy (DOE))

Download presentation slides and a text version of the audio from the DOE Office of Indian Energy webinar onhydroelectric renewable energy.



NLE Websites -- All DOE Office Websites (Extended Search)

www.datacenterdynamics.com www.datacenterdynamics.com FOCUS COOLING Issue 28, March/April 2013 LBNL'S NOVEL APPROACH TO COOLING Lawrence Berkeley National Laboratory and APC by Schneider Electric test a unique double-exchanger cooling system LBNL program manager Henry Coles says can cut energy use by half A s part of a demonstration sponsored by the California Energy Commission in support of the Silicon Valley Leadership Group's data center summit, Lawrence Berkeley National Laboratory (LBNL) collaborated with APC by Schneider Electric to demonstrate a novel prototype data center cooling device. The device was installed at an LBNL data center in Berkeley, California. It included two air-to-water heat exchangers. Unlike common single-heat-exchanger configurations, one of these was supplied with


Templates for pre-grasp sliding interactions  

Science Conference Proceedings (OSTI)

In manipulation tasks that require object acquisition, pre-grasp interaction such as sliding adjusts the object in the environment before grasping. This change in object placement can improve grasping success by making desired grasps reachable. However, ... Keywords: Humanoid robotics, Object manipulation, Pre-grasp interaction, Pushing, Sliding

Daniel Kappler; Lillian Y. Chang; Nancy S. Pollard; Tamim Asfour; Rdiger Dillmann



Geothermal Webinar Presentation Slides and Text Version | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Field Sites Power Marketing Administration Other Agencies You are here Home Geothermal Webinar Presentation Slides and Text Version Geothermal Webinar Presentation Slides...


Depleted UF6 Production and Handling Slide Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

Production and Handling Depleted UF6 Production and Handling Slide Presentation An online slide presentation about production and handling of depleted UF6, from mining of uranium...


Direct Use for Building Heat and Hot Water Presentation Slides...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Direct Use for Building Heat and Hot Water Presentation Slides and Text Version Direct Use for Building Heat and Hot Water Presentation Slides and Text Version Download...


Sliding mode control of quantum systems  

E-Print Network (OSTI)

This paper proposes a new robust control method for quantum systems with uncertainties involving sliding mode control (SMC). Sliding mode control is a widely used approach in classical control theory and industrial applications. We show that SMC is also a useful method for robust control of quantum systems. In this paper, we define two specific classes of sliding modes (i.e., eigenstates and state subspaces) and propose two novel methods combining unitary control and periodic projective measurements for the design of quantum sliding mode control systems. Two examples including a two-level system and a three-level system are presented to demonstrate the proposed SMC method. One of main features of the proposed method is that the designed control laws can guarantee desired control performance in the presence of uncertainties in the system Hamiltonian. This sliding mode control approach provides a useful control theoretic tool for robust quantum information processing with uncertainties.

Daoyi Dong; Ian R. Petersen



Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Slide19 Current and Future Information Landscape - Challenges and Solutions Continued Solutions Balance strategic partnerships and strategic individualism So, for every challenge, we need a solution, and these thoughts for solutions apply not just to ETDE but to any similar source of information. These first several thoughts relate to maintaining an identity amidst the clutter and competition of other information sources. And one of these particular thoughts is to balance strategic partnerships against strategic individualism. In the ETDE case, for example, which has an international focus, we could benefit from partnerships with organizations having a regional focus. Here, I would suggest that we could benefit by working with the European Union on a gateway to European Energy


Slide 1 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Energy Ministerial Press Fact Sheer Demand Response is Focus of New Effort by Electricity Industry Leaders GNEP Partners and Observers...


GPS Meteorology: Sliding-Window Analysis  

Science Conference Proceedings (OSTI)

The sliding-window technique uses a moving time window to select GPS data for processing. This makes it possible to routinely incorporate the most recently collected data and generate estimates for atmospheric delay or precipitable water in (near)...

James Foster; Michael Bevis; Steven Businger



Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 Slide20 Distributed Search This search example demonstrates the power of our distributed search feature. As the title suggests, it gives the user a "one-stop" searching capability, where you can search all of ETDEWEB as well as up to six additional sources, which represent over 50 million pages of R&D output. For the most part, these are energy-focused sources, such as the Danish Energy R&D projects, IEA's information center, and the French Petroleum Institute. Some are very broad and include multiple scientific disciplines, such as CORDIS (the EU's R&D database), Science.gov, and Science Conferences. The default option is to search all of these sources, but you can also uncheck certain boxes if you don't want to search a particular


Slide26 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide26 Slide26 Slide26 Science.gov Version 5.0 * Quadrupled the content - now searches 200 million pages of science information * Offers clustering technology, Wikipedia results and EurekAlert! Science News * Updated Alerts feature The new version, Science.gov 5.0 was released September 15. It includes seven additional databases: Hazardous Substances Databank Cancer.gov PubMed Central TOXLINE DOepatents DOE R&D Accomplishments Database E-print Network Other new features include: Clustering: on the left side of the screen you can see clustering of results by subtopics or dates to help you target your search. Wikipedia: In most cases, your search terms will also bring up an article from Wikipedia can help users better understand what the are searching for. Eureka Alert: EurekAlert! features news and resources focused on all areas


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 Legacy Document Types Technical Reports 4272 Conference Papers 2354 Book/Monograph 90 Conference Proceedings 73 Journal Articles 28 Miscellaneous/Other 24 Thesis/Dissertation 7 Patent/Patent Application 4 TOTAL 6852 In addition to "where" the documents come from, this provides an idea of the types of documents represented in the Legacy collection. The greatest focus has been on Technical Reports. For some of the larger proceedings documents, we've scanned in the individual papers to improve document searching and download time for items of interest. You'll also see the relationships...that is, links...from one paper to another for the respective proceedings. The links are shown in the individual record citations. We'll be interested to hear if you find


A Greener Focus: 2012 Ford Focus Electric  

NLE Websites -- All DOE Office Websites (Extended Search)

Greener Focus: 2012 Ford Focus Electric Greener Focus: 2012 Ford Focus Electric JOHN DAVIS: With its 2012 re-design, the Focus compact has become Ford's core global program. Focus is already generating offspring, including small vans, a high performance hatchback, and this car - the Ford Focus Electric. It's actually one of only several new plug-ins and hybrids due from the blue oval this year. So let's go for a drive in the EV Focus and see if this green approach means greener pastures for Ford. At first glance, the 2012 Ford Focus Electric doesn't look that much different than the compact, front-


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 ETDEWEB Search Results This slide shows results from that search. Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 Slide18 New Age of Digital Delivery * Enables more robust products performing in new and different ways * Permits ability to engage customers with heretofore unprecedented levels of interactivity So, this new age of digital delivery let's us have: -- more robust products - that perform in different ways -- the ability for us to engage customers in new and more direct ways I'd like to transition now to talk about how OSTI has responded to change. -- A previous Board of Visitors review suggested that OSTI had a confusing array of too many products and suggested OSTI eliminate/consolidate. -- OSTI then spent some time attempting to eliminate products, but customers who had come to heavily rely on those products protested. -- After a few stops and starts, and knowing that the feedback of the BOV

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 OSTI Works In Partnership with DOE Laboratories to Fulfill STI-related Requirements Under the Laboratories' Contract * DOE's STI Program Managed by OSTI - Provides accountability and historical record by creating a central, authoritative collection of DOE STI for long-term use and access - Fulfills statutory mandates - Enhances transparency of DOE research - Saves research dollars by reducing duplication and enabling reuse of previous research * OSTI Responsibility Has Been Established In: - Atomic Energy Acts of 1946 and 1954 - Energy Reorganization Act of 1974 - Department of Energy Act of 1977 - Energy Policy Act of 2005 - America COMPETES Act of 2007 ...OSTI does this while also providing a host of products to assist librarians and researchers


FRED Overview Slides | OpenEI Community  

Open Energy Info (EERE)

FRED Overview Slides FRED Overview Slides Home > Groups > FRED Dbrodt's picture Submitted by Dbrodt(72) Contributor 2 July, 2012 - 10:43 Upload Files: application/vnd.openxmlformats-officedocument.presentationml.presentation icon fred_overview_slides_v11.pptx Groups: FRED Login to post comments Comments Amirsaedlou Amirsaedlou1 year 17 weeks ago hi how can i get wind data hi how can i get wind data for specific point with google earth data, do you know a tool to design wind sola hybrid power plants? Login to post comments NickL NickL39 weeks 3 days ago Wind Data Hello- There are various types of wind data available. These can be searched for on OpenEI using the Search tool with keyword wind and filtering the content to only display datasets. Depending on the global region you are


Production and Handling Slide 35: UF6 Cylinder Data Summary  

NLE Websites -- All DOE Office Websites (Extended Search)

UF6 Cylinder Data Summary UF6 Cylinder Data Summary Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents UF6 Cylinder Data Summary Cylinder Model Nominal Diam. (in.) Material of Construction Minimum Volume Approximate Tare Weight Without Valve Protector Maximum Enrichment Uranium-235 Shipping Limit Maximum, a UF6 ft3 liters lb kg Weight % lb kg 1S 1.5 Nickel 0.0053 0.15 1.75 0.79 100.00 1.0 0.45 2S .5 Nickel 0.026 0.74 4.2 1.91 100.00 4.9 2.22 5A 5 Monel 0.284 8.04 55 25 100.00 55 24.95 5B 5 Nickel 0.284 8.04 55 25 100.00 55 24.95 8A 8 Monel 1.319 37.35 120 54 12.5 255 115.67 12A 12 Nickel 2.38 67.4 185 84 5.0 460 208.7 12B 12 Monel 2.38 67.4 185 84 5.0 460 208.7 308c 30 Steel 26.0 736.0 1,400 635 5.0b 5,020 2,277 48A 48 Steel 108.9 3,.84 4,500 2,041 4.5b 21,030 9,539 48Xd 48 Steel 108.9 3,084 4,500 2,041 4.5b,g 21,030 9,539 48F 48 Steel


Adaptive fuzzy sliding mode control for flexible satellite  

Science Conference Proceedings (OSTI)

The adaptive fuzzy sliding mode control is applied to the attitude stabilization of flexible satellite. The detailed design procedure of the fuzzy sliding mode control system is presented. The adaptive fuzzy control is utilized to approach the equivalent ... Keywords: Adaptive fuzzy control, Attitude control, Flexible satellite, Sliding mode control

Ping Guan; Xiang-Jie Liu; Ji-Zhen Liu



Friction microprobe investigation of particle layer effects on sliding friction  

DOE Green Energy (OSTI)

Interfacial particles (third-bodies), resulting from wear or external contamination, can alter and even dominate the frictional behavior of solid-solid sliding in the absence of effective particle removal processes (e.g., lubricant flow). A unique friction microprobe, developed at Oak Ridge National Laboratory, was used to conduct fine- scale friction studies using 1.0 mm diameter stainless steel spheres sliding on several sizes of loose layers of fine aluminum oxide powders on both aluminum and alumina surfaces. Conventional, pin-on-disk experiments were conducted to compare behavior with the friction microprobe results. The behavior of the relatively thick particle layers was found to be independent of the nature of underlying substrate, substantiating previous work by other investigators. The time-dependent behavior of friction, for a spherical macrocontact starting from rest, could generally be represented by a series of five rather distinct phases involving static compression, slider breakaway, transition to steady state, and dynamic layer instability. A friction model for the steady state condition, which incorporates lamellar powder layer behavior, is described.

Blau, P.J.



Previous Sandia National Laboratories | National Nuclear Security  

National Nuclear Security Administration (NNSA)

Previous Sandia National Laboratories | National Nuclear Security Previous Sandia National Laboratories | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Previous Sandia National Laboratories Home > About Us > Our Operations > Acquisition and Project Management > M & O Support Department > Sandia National Laboratories > Previous Sandia


Previous Determinations | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Previous Determinations Commercial Determinations Residential Determinations ANSIASHRAEIESNA Standard 90.1-2007 On July 20, 2011, DOE issued a final determination that...


Intelligent computer evaluation of offender's previous record  

Science Conference Proceedings (OSTI)

This paper describes a decision support system to be used by a judge about to pass sentence in a criminal case. The system deals with the problem of how to evaluate the offender's previous criminal record.The system may be used as a stand-alone system, ... Keywords: criminal sentencing, decision support systems, previous criminal record

Uri J. Schild; Ruth Kannai



Focus on Obesity  

Science Conference Proceedings (OSTI)

AOCS focuses on obesity with this fully searchable multimedia CD ROM. Focus on Obesity Health Nutrition DVD & CD-ROMs Health - Nutrition - Biochemistry Biochemistry AOCS Press AOCS focuses on obesity with this fully searchable multimedia CD ROM.


Summary Slides of ALS Science Highlights  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary Slides of ALS Science Highlights Print Summary Slides of ALS Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 280 Learning from Roman Seawater Concrete 5.3.2, 12.2.2, 12.3.2 09.25.2013 Vol. 346 279 New Research on Jamming Behavior... 12.2.2 10.30.2013 Vol. 347 278 The Nuclear Pore Complex as Gatekeeper 8.2.1 08.28.2013 Vol. 345 277 A Semiconductor for Spintronics 7.0.1 08.28.2013 Vol. 345 276 Rate-of-Charge Mapping in Batteries 5.3.2, 11.0.2 07.31.2013 Vol. 344 275 Circulation Reversal in Magnetic Vortices 6.1.2 07.31.2013 Vol. 344 274 Pseudo-Single-Bunch Expands Capabilities -- 09.25.2013 Vol. 346 273 Shedding Light on Nanocrystal Defects 12.2.2 06.26.2013 Vol. 343 272 One Vaccine Leads to Another 5.0.3 05.25.2013 Vol. 342 271 Iron Availability in the Southern Ocean 11.0.2 06.26.2013 Vol. 343


Summary Slides of ALS Science Highlights  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary Slides of ALS Science Highlights Print Summary Slides of ALS Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 280 Learning from Roman Seawater Concrete 5.3.2, 12.2.2, 12.3.2 09.25.2013 Vol. 346 279 New Research on Jamming Behavior... 12.2.2 10.30.2013 Vol. 347 278 The Nuclear Pore Complex as Gatekeeper 8.2.1 08.28.2013 Vol. 345 277 A Semiconductor for Spintronics 7.0.1 08.28.2013 Vol. 345 276 Rate-of-Charge Mapping in Batteries 5.3.2, 11.0.2 07.31.2013 Vol. 344 275 Circulation Reversal in Magnetic Vortices 6.1.2 07.31.2013 Vol. 344 274 Pseudo-Single-Bunch Expands Capabilities -- 09.25.2013 Vol. 346 273 Shedding Light on Nanocrystal Defects 12.2.2 06.26.2013 Vol. 343 272 One Vaccine Leads to Another 5.0.3 05.25.2013 Vol. 342 271 Iron Availability in the Southern Ocean 11.0.2 06.26.2013 Vol. 343


I'T Slide Page I of I  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I'T Slide Page I of I I'T Slide Page I of I '^° J/ «- -I . .. X -. . ,;.~-:~ ~li~ e r 48 AD:- Alaska Slide 20 of 33 hrp: vw;-\-\ eia doe.ov\pub'oil_pas:natural_gas/presentations'2000"markets reliabilit lcc. 2, 122 782 DOE006-0139 PP1 Slide Page I of 1 _ -_ Slide 21 of 33 ' I http://www.iadoc-gov/pub/oilgas/naturalgas/presentations/2000/marketsreliability)_ele... 2/12/20(783 DOE006-0140 DOE006-0 140 PPT Slide Page I of 1 (g~* * Slide 22 of 33 Slide 22 of 33 hnp://ww.eia.doe.gov/pub/oilgas/natura l gas/presentations/2000/markets_rel iability ele... 2/I2/202784 DOE006-0141 I i slide Page I of I ;x b mmlps g q:-.j^^., Slide 23 of 33 http://www.eia.doe.gov/pub/oil_ gas/natural_gas/prcsentations/2000/markets_rel iability_cile... 2/1 /20 7 8 5 DOE006-0142 rri ao31e Page I of I - . .v 1,, I !9 2'-;-;/' .. -


Strategic Focus Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Focus Areas Lockheed Martin on behalf of Sandia National Laboratories will consider grant requests that best support the Corporation's strategic focus areas and reflect effective...


Focusing in Linear Accelerators  

DOE R&D Accomplishments (OSTI)

Review of the theory of focusing in linear accelerators with comments on the incompatibility of phase stability and first-order focusing in a simple accelerator.

McMillan, E. M.




A turbocharger having a sliding piston for regulating exhaust gas flow into the turbine wheel includes a set of first vanes mounted on a fixed first ...


Production and Handling Slide 18: Conversion of Yellow Cake to...  

NLE Websites -- All DOE Office Websites (Extended Search)

last step of the conversion process involves the chemical conversion of uranium tetrafluoride UF4 to uranium hexafluoride UF6 using fluorine F2. Slide 1...


Production and Handling Slide 1: The Uranium Fuel Cycle  

NLE Websites -- All DOE Office Websites (Extended Search)

and Handling The Uranium Fuel Cycle Skip Presentation Navigation Next Slide Last Presentation Table of Contents The Uranium Fuel Cycle Refer to caption below for image...


Production and Handling Slide 14: Conversion of Yellow Cake to...  

NLE Websites -- All DOE Office Websites (Extended Search)

Uranium dioxide UO2, called "brown oxide," is formed by reducing ammonium diuranate (NH4)2U2O7 by the addition of hydrogen. Slide 14...


Production and Handling Slide 16: Conversion of Yellow Cake to...  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrofluoric acid HF is added to uranium dioxide UO2 to form uranium tetrafluoride UF4, often called "green salt." Slide 16...


Electricity Grid Basics Webinar Presentation Slides and Text Version  

Energy.gov (U.S. Department of Energy (DOE))

Download presentation slides and a text version of the audiofrom the DOE Office of Indian Energy webinar on electricity grid basics.

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tendency of Cooperative Grain Boundary Sliding in Nanocrystalline ...  

Science Conference Proceedings (OSTI)

Presentation Title, Tendency of Cooperative Grain Boundary Sliding in ... The objective of this research is to identify the tendency of cooperative grain boundary...


CKBGroup/Previous Events | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » CKBGroup/Previous Events < CKBGroup Jump to: navigation, search Home | 2013 Workshop | Previous Events | CKB Snapshots | Collaborative Projects | Shared Tools Knowledge Sharing events - November 2012, Washington Two knowledge sharing workshops were held in Washington, D.C. this November, on consecutive days: 12 November - hosted by NREL and REEEP: "Linked Open Data - learn how to make open data work for your organization" For more information, visit the workshop website http://en.openei.org/wiki/Open_Data_Workshop_2012. 13 November - a two-part Workshop hosted by the World Bank: "Discovering


Rigidity sensing by stochastic sliding friction  

E-Print Network (OSTI)

The sliding friction force exerted by stochastic linkers interacting with a moving filament is calculated. The elastic properties of the substrate on which the linkers are anchored are shown to strongly influence the friction force. In some cases, the force is maximal for a finite substrate rigidity. Collective effects give rise to a dynamical instability resulting in a stick-slip behaviour, which is substrate-sensitive. The relevance of these results for the motility of crawling cells powered by an actin retrograde flow is discussed.

Pierre Sens



Focused natural deduction  

Science Conference Proceedings (OSTI)

Natural deduction for intuitionistic linear logic is known to be full of non-deterministic choices. In order to control these choices, we combine ideas from intercalation and focusing to arrive at the calculus of focused natural deduction. The calculus ...

Taus Brock-Nannestad; Carsten Schrmann



Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 ETDEWEB Easy Search Slides 5 through 13 depict actual searches of the ETDEWEB database on a number of highly relevant, current energy topics and the breadth and...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Slide 13: Search for Nano Should Reach Text and Numeric Data -A Search for "nanotubes" finds many documents, but numeric data is harder to locate -Information...


Alternating phase focused linacs  

SciTech Connect

A heavy particle linear accelerator employing rf fields for transverse and ongitudinal focusing as well as acceleration. Drift tube length and gap positions in a standing wave drift tube loaded structure are arranged so that particles are subject to acceleration and succession of focusing and defocusing forces which contain the beam without additional magnetic or electric focusing fields.

Swenson, Donald A. (Los Alamos, NM)



Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Development Milestones * Science.gov Phase 1 (2001-2002) * Established policy & governance, technical design teams * Agreed on goals, policies, website look & feel...


Slide35 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide35 Slide35 National Institutes of Health (NIH) * Implemented Public Access Policy May 2, 2005 * Requests and strongly encourages all investigators to make their NIH-funded...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Energy Policy Act of 2005 Called Out OSTI "The Secretary, through the Office of Scientific and Technical Information, shall maintain within the Department publicly...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 OSTI & STIP 60+ years later We are still on that frontier, deploying information technology in revolutionary ways to accelerate what President Roosevelt and...


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 Audio Indexing of Video Read about us at the Microsoft ("Microsoft Research's video search hits the DOE" http:research.microsoft.comen-usprojectsmavis)...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Multimedia and Speech Indexing Multimedia (e.g., video, audio, images) represents a major emerging form of scientific information Multimedia presents special...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 OSTI and Microsoft Research Partnership * Video files collected from DOE's National Laboratories * RSS feeds with metadata and URLs sent to Microsoft Research *...


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Innovative Web Technologies- Opportunities On the Horizon More can and should be done with innovative web technologies to: * Make video full-text searchable *...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 OSTI Web Traffic OSTI information transactions have increased from 2 million to 250 million. Information Transactions: discrete information exchanges between a user...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 * Surface Web * Deep Web databases Federated search drills down to the deep Web where scientific databases reside. Unlike the Google solution, federated search...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 * 'Data owners' an important component of process * Well received: - "As a research librarian, my experience is that "data" can be the most highly useful...


Slide16 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide16 Slide16 The Internet and advanced Web tools have created wonderful opportunities But also great challenges for those along the leading edge in information dissemination...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 ETDE's Distributed Searching Strategy ETDE's Distributed Searching Strategy ETDEWEB's new distributed search feature makes R&D information from 39 databases and...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Distributed Search Results The results page shows the relevance ranking, indicated by stars. The relevance ranking algorithm gives greater weight to records where...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Content Management Is Distributed * NTIS developed the original "catalog" with input from agencies * CENDI Secretariat now maintains catalog with agency...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Federal Depository Library Conference (FDLC) October 21, 2008 (12 of 31) Federal Depository Library Conference (FDLC) October 21, 2008 You requested it MARC...


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Other OSTI Collections DOE R&D Accomplishments DOepatents Research & Development Project Summaries Energy Science and Technology Software Center OSTI Federated...


Slide16 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide16 Slide16 Enhancements & Updates DOE R&D Accomplishments http:www.osti.govaccomplishments * Tag Cloud that contains most-frequently appearing terms in the bibliographic...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Through such efforts, WorldWideScience.org is well timed to other trends in global scientific communication. National research organizations recognize the...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 Other Potential Benefits Facilitate retrieval of scientific and technical information by librarians and other information professionals Apply concept to traditional...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 6 Core Information Practices of Scientists * Intensive study and reading * Directed research for retrieval * Regular monitor and review * Document original content...


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 1. What does WorldWideScience.org do? (cont'd) C. Integrates symbiotic technologies to further accelerate scientific discovery > Multilingual translations > Speech...


Slide24 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide24 Slide24 You get up-to-the-minute information relevant to your query. Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 Deep Web Solution: Federated Searching * A single user query simultaneously sent to multiple deep web databases. * Federated search engine sorts and presents...


Slide39 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide39 Slide39 DOE Laboratories and Open Access Los Alamos National Laboratory encourages researchers to consider publishing in an open access publication for these benefits: *...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 OSTI Collaborations OSTI works with the Department of Energy's National Laboratories, as well as with energy researchers at universities, colleges, and other...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Current National Partners in WorldWideScience.org Australia Brazil Canada Denmark France Germany Japan The Netherlands New Zealand South Africa United Kingdom...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Current National Partners in WorldWideScience.org Australia Argentina Brazil Canada Chile Colombia Denmark France Germany Japan The Netherlands New Zealand Portugal...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 The "Why" - Historical "To provide that free interchange of ideas and criticism which is essential to scientific and industrial progress and public understanding...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Federated Search Gateways Agency level - Science Accelerator Search key DOE databases Interagency level - Science.gov Search 200 million pages of science from 13...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Latest Attractions We are rapidly introducing search technology that "thinks like we think" (Semantic Search) www.OSTI.govgreenenergy Improving search accuracy by...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Eclipsing Current Search Technology Google is capitalizing on this early era of web technology and is hugely successful, powering more than half the world's...


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 OSTI Strategies - Overview Content distribution via major search engines. + Providing STI specific vertical search capabilities enabled via Federated Search and Web...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Collaborative search, enhancing knowledge, advancing science Global Discovery Speaker Notes: We call it Global Discovery, and we must aim for this place just barely...


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 Eclipsing Current Search Technology Google is capitalizing on this early era of web technology and is hugely successful, powering more than half the world's...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Federated Search Innovation in science demands innovation in sharing science knowledge. OSTI has recognized this need; our emerging solution is "federated" search....


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Eclipsing Current Search Technology Google is capitalizing on this early era of web technology and is hugely successful, powering more than half the world's...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 Federated search drills down to the deep web where scientific databases reside. Surface Web Deep Web Databases Unlike the Google sitemap protocol solution,...


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Multimedia Search Demo Play Demonstration of Multimedia Search (opens new window) Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Federated Search: Emerging Technology Pioneered by OSTI * Surface Web * Deep Web databases Federated search drills down to the deep Web where scientific databases...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Overview Users and Search Current problems with search and retrieval OSTI strategy for overcoming problems Future and current work Add new comment Original...


Slide33 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide33 Slide33 Classification Reform * Executive Order 13526 Classified National Security Information issued in December 2009. * Addresses issues of over-classification,...


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide15 Slide15 OSTI Strategies Distribution of DOE content to major search engines. - Sitemap Protocol - low development time, low maintenance, reduces amount of unnecessary...


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Multimedia Research * Speech Search * Face identification * Object recognition * Video browsing * Semantic extraction * (3D) Segmentation * (3D) Image search Add...


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Computers in Libraries 2009 Theme: "Creating Tomorrow: Spreading Ideas & Learning" * Science progresses as knowledge is shared * OSTI Corollary: Accelerating the...


BCSE Industry Overview slides | OpenEI Community  

Open Energy Info (EERE)

BCSE Industry Overview slides BCSE Industry Overview slides Home > Groups > Renewable Energy Finance Workshop Kalston's picture Submitted by Kalston(5) Member 20 December, 2012 - 13:56 Upload Files: application/vnd.ms-powerpoint icon BCSE Industry Overview slides Groups: Renewable Energy Finance Workshop Login to post comments Latest documents Kalston BCSE Industry Overview slides Posted: 20 Dec 2012 - 13:56 by Kalston Ianjkalin Department of Defense 3 GW Solar Target Posted: 15 Dec 2012 - 16:56 by Ianjkalin 1 of 2 ›› Groups Menu You must login in order to post into this group. Latest document comments No comments have been made yet Recent content BCSE Industry Overview slides Department of Defense 3 GW Solar Target Presentation on Open Data & Finance Value Meeting Agenda Group members (2)


Discrete sliding-mode control of a PWM inverter for sinusoidal output waveform synthesis with optimal sliding curve  

SciTech Connect

This paper presents a discrete sliding-mode control scheme with feedforward compensation for the closed-loop regulation of the pulse-width modulated (PWM) inverter used in an uninterruptible power supply (UPS). The proposed feedforward controller can effectively improve the tracking performance of the PWM inverter. In designing the sliding-mode controller, the authors have taken load disturbance into consideration to enhance the robustness of the PWM inverter. Moreover, the upper bound of the load disturbance under which the sliding condition can be maintained has also been derived. The sliding curve of the sliding-mode controller is designed such that the behavior of the controlled PWM inverter is optimal subject to the selected cost function. Due to the coordinate transformation proposed in this paper, only the output voltage needs to be measured as feedback for the purpose of closed-loop regulation. Simulation and experimental results are given to show the effectiveness of the proposed control scheme.

Jung, S.L.; Tzou, Y.Y. [National Chiao Tung Univ., Hsinchu (Taiwan, Province of China). Dept. of Control Engineering



Focus on Solar Energy  

Science Conference Proceedings (OSTI)

... Focus on Solar Energy. Why a net-zero energy house? ... Solar Energy Presentation. Additional information, tools, weblinks, and photos from the day. ...



Technical Communique: Output overshoots in systems with integral action operating in sliding mode  

Science Conference Proceedings (OSTI)

This paper deals with the pole assignment technique in systems with integral action and sliding mode control. It is known that, because of the order reduction provided by the sliding mode, one gain of the sliding surface that determines the pole placement ... Keywords: Integral action, Pole assignment, Reset wind up, Sliding mode, Variable structure control

R. J. Mantz; P. F. Puleston; H. De Battista



Focus Group I  

NLE Websites -- All DOE Office Websites (Extended Search)

CARBON SEQUESTRATION - A COMMUNITY FOCUS GROUP STUDY OF CARBON SEQUESTRATION - A COMMUNITY FOCUS GROUP STUDY OF ATTITUDES IN WILLISTON, NORTH DAKOTA Sheila K. Hanson, Energy & Environmental Research Center Daniel J. Daly, Energy & Environmental Research Center Edward N. Steadman, Energy & Environmental Research Center John A. Harju, Energy & Environmental Research Center June 2005 EXECUTIVE SUMMARY In April 2005, representatives of the Plains CO 2 Reduction (PCOR) Partnership, led by the Energy & Environmental Research Center (EERC) at the University of North Dakota, held two focus groups in Williston, North Dakota. A total of sixteen people participated; seven on April 20 and nine on April 21. The purpose of the focus group research was to gain insight into the public perception of carbon sequestration from


Focus on trans Fat  

Science Conference Proceedings (OSTI)

This comprehensive CD-ROM contains a surplus of information regarding trans fats. Focus on trans Fat Health Nutrition Biochemistry Trans DVD & CD-ROMs Health - Nutrition - Biochemistry Food Science This comprehensive CD-ROM contains a


Focus on Biodiesel  

Science Conference Proceedings (OSTI)

AOCS spotlights the topic of renewable energy with this comprehensive CD-ROM containing various Powerpoint presentations, abstracts, book chapters, technical tables, biodiesel standards, and numerous links to Internet resources. Focus on Biodiesel Biofuel


Business Case Slide 35: International Collaboration - Description...  

NLE Websites -- All DOE Office Websites (Extended Search)

with Russia Focused on potential uses identified by us Basis Cost-effective Driven by DOE Undersecretary Card Policy support and potential funding from: Dept. of State DOENN...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Sliding Mode Multimodel Control for a Sensorless Photovoltaic System  

E-Print Network (OSTI)

In this work we will talk about a new control test using the sliding mode control with a nonlinear sliding mode observer, which are very solicited in tracking problems, for a sensorless photovoltaic panel. In this case, the panel system will has as a set point the sun position at every second during the day for a period of five years; then the tracker, using sliding mode multimodel controller and a sliding mode observer, will track these positions to make the sunrays orthogonal to the photovoltaic cell that produces more energy. After sunset, the tracker goes back to the initial position (which of sunrise). Experimental measurements show that this autonomic dual axis Sun Tracker increases the power production by over 40%.

Rhif, Ahmed; Braiek, Naceur BenHadj



Production and Handling Slide 23: The Uranium Fuel Cycle  

NLE Websites -- All DOE Office Websites (Extended Search)

Presentation Table of Contents The Uranium Fuel Cycle Refer to caption below for image description The fourth major step in the uranium fuel cycle is uranium enrichment. Slide 23...


A Sliding Mode Multimodel Control for a Sensorless Photovoltaic System  

E-Print Network (OSTI)

In this work we will talk about a new control test using the sliding mode control with a nonlinear sliding mode observer, which are very solicited in tracking problems, for a sensorless photovoltaic panel. In this case, the panel system will has as a set point the sun position at every second during the day for a period of five years; then the tracker, using sliding mode multimodel controller and a sliding mode observer, will track these positions to make the sunrays orthogonal to the photovoltaic cell that produces more energy. After sunset, the tracker goes back to the initial position (which of sunrise). Experimental measurements show that this autonomic dual axis Sun Tracker increases the power production by over 40%.

Ahmed Rhif; Zohra Kardous; Naceur BenHadj Braiek



Vertical Velocity Focus Group  

NLE Websites -- All DOE Office Websites (Extended Search)

Velocity Focus Group Velocity Focus Group ARM 2008 Science Team Meeting Norfolk, VA March 10-14 Background Vertical velocity measurements have been at the top of the priority list of the cloud modeling community for some time. Doppler measurements from ARM profiling radars operating at 915-MHz, 35-GHz and 94-GHz have been largely unexploited. The purpose of this new focus group is to develop vertical velocity ARM products suitable for modelers. ARM response to their request has been slow. Most ARM instruments are suitable for cloud observations and have limited capabilities in precipitation Using ARM datasets for evaluating and improving cloud parameterization in global climate models (GCMs) is not straightforward, due to gigantic scale mismatches. Consider this... Looking only vertically drastically limits opportunities


Decontamination & decommissioning focus area  

Science Conference Proceedings (OSTI)

In January 1994, the US Department of Energy Office of Environmental Management (DOE EM) formally introduced its new approach to managing DOE`s environmental research and technology development activities. The goal of the new approach is to conduct research and development in critical areas of interest to DOE, utilizing the best talent in the Department and in the national science community. To facilitate this solutions-oriented approach, the Office of Science and Technology (EM-50, formerly the Office of Technology Development) formed five Focus AReas to stimulate the required basic research, development, and demonstration efforts to seek new, innovative cleanup methods. In February 1995, EM-50 selected the DOE Morgantown Energy Technology Center (METC) to lead implementation of one of these Focus Areas: the Decontamination and Decommissioning (D & D) Focus Area.




Focus on Basque movements  

E-Print Network (OSTI)

This thesis can be summarized in the following two objectives: (i) to develop a new version of the Nuclear Stress Rule (NSR) which overcomes certain problems found with previous versions, and (ii) to explain the so-called ...

Arregui-Urbina, Karlos, 1971-



Customer-Focused Deployment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Customer-Focused Customer-Focused Deployment SAM RASHKIN Chief Architect Building Technologies Program February 29, 2012 Building America Meeting 2 | INNOVATION & INTEGRATION: Transforming the Energy Efficiency Market Buildings.Energy.gov 'Good Government' As-A-System IECC Code: Mandates technologies and practices proven reliable and cost- effective ENERGY STAR: Recognizes Builders Who Deliver Significantly Above Code Performance Builders Challenge: Recognizes Leading Builders Applying Proven Innovations and Best Practices Building America: Develops New Innovations and Best Practices 3 | INNOVATION & INTEGRATION: Transforming the Energy Efficiency Market Buildings.Energy.gov Disseminating Research Results: Building America Resource Tool 4 | INNOVATION & INTEGRATION: Transforming the Energy Efficiency Market


Focus Article Nuclear winter  

E-Print Network (OSTI)

Focus Article Nuclear winter Alan Robock Nuclear winter is the term for a theory describing the climatic effects of nuclear war. Smoke from the fires started by nuclear weapons, especially the black, sooty smoke from cities and industrial facilities, would be heated by the Sun, lofted into the upper

Robock, Alan


Strategic Focus Points  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Focus Points Focus Points June 2011 1. Establish the human capital and organizational foundation to create a high-performing organization. 2. Implement a cyber risk-management and incident response program that ensures effective security of Federal and M&O networks, provides appropriate flexibility, and meets legal requirements and OMB expectations. 3. Improve IT Services (EITS) into a best-in-class provider from both a technical and business perspective. 4. Implement and institutionalize a reformed, integrated information management governance process that respects the goal to treat M&Os distinctively different than true Federal entities. 5. Transition to 5-year planning and programming, using the NNSA Planning, Programming, Budgeting and Evaluation (PPBE) process as a starting point to include resource and requirements validation.


Focus Area Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

information provided was consolidated from the original five focus areas for the EM information provided was consolidated from the original five focus areas for the EM Corporate QA Board. The status of QAP/QIP approvals etc. was accurate at the time of posting; however, additional approvals may have been achieved since that time. If you have any questions about the information provided, please contact Bob Murray at robert.murray@em.doe.gov Task # Task Description Status 1.1 Develop a brief questionnaire to send out to both commercial and EM contractors to describe their current approach for identifying the applicable QA requirements for subcontractors, tailoring the requirements based upon risk, process for working with procurement to ensure QA requirements are incorporated into subcontracts, and implementing verification of requirement flow-down by their


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 International public-private Collaboration WorldWideScienceAlliance ICSTI osti.gov * WorldWideScience Alliance * ICSTI * U.S. DOEOSTI * Deep Web Technologies *...


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Science.gov Contributing Agencies USDA 16% DOC 10% DOD 3% DOE 24% DOI 10% ED 1% EPA 7% GPO 1% HHS 13% NASA 7% NSF 8% Based on number of URLs in Web site catalogue...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 The Challenge Dr. Orbach's challenge to create a new STI policy to advance missions of the future Ensuring that the definition of STI matches the mission Labs and...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 New STI Policy on the Way To affirm that DOE values all forms and formats of STI, the "tangible" result of R&D To ensure STI program clearly encompasses text...


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 NIH Policy Enhancing public access to archived publications resulting from NIH-funded research NIH-funded investigators requested to submit to the NIH National...


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide15 Slide15 Science.gov - A Living Website * Science.gov Phase 1 * Created core policy team, technical design team * Agreed on goals, policies, designs * Created taxonomy *...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Fuel Handbook On this screen, we go to the actual electronic full text, where one can see the document in its full color and scroll through, in this case, all 105...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Fuel Handbook By selecting a PDF icon, you can retrieve the full text; in most cases, you can search it as well as view, save, or print it. Add new comment Original...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 STIP Collaboration: Meeting the Challenges Together Walt Warnick, Ph.D. Director U.S. Department of Energy Office of Science Office of Scientific and Technical...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 Advancing Science, Accelerating Discovery 2008 STIP Working Meeting Santa Fe, New Mexico April 23, 2008 Add new comment Thumbnail Mobile320x340 Icon64x64...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Our purpose STIP annual meetings are not just a time to renew acquaintances. It is also a time to openly discuss our visions for the future, to set goals, and to...


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 Seamless Access through STIP Central: Currently OSTI provides stewardship for almost 5M citations and 1.5M reports Distributed: Almost 100,000 of these reports are...


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 OSTI Partnerships include but are not limited to * STIP * Science.gov Alliance * CENDI * ETDE * ICSTI * WorldWideScience Alliance Add new comment Thumbnail...


Slide30 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide30 Slide30 Onward STIP meeting agenda is full of great topics & presentations We'll learn from each other and Invigorate our ideas & path forward Add new comment Thumbnail...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 Dr. Walter Warnick, Director, OSTI STIP Meeting April 21-22, 2005 Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide24 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide24 Slide24 STIP: New Media Working Group * Revision of DOE Order 241.1 will explicitly include data and multimedia as STI formats that need to be submitted to OSTI * Resulting...


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide15 Slide15 STIP Vision? At this meeting, let's continue on that steadily evolving course Work together to craft practical strategies for embracing emerging types of STI Add...


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 Seamless Access Through STIP Central Currently OSTI Provides stewardship for almost 5M citations and 1.5M documents Distributed Over 121,000 of these reports are...


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Appreciation The further I get into SC-33 duties and other activities, the more I appreciate STIP Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 The web is transformational technology for sharing knowledge We are about 15 years into the age of the web. But remember, the web is still young and will certainly...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Future Work Utilize HCI labs and testing results to optimize web sites Expand reach of federated search by adding additional deep web content Add functionality to...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 The Web Is Transformational Technology for Sharing Knowledge The Web is still young and will certainly hold surprises as it evolves, just as another well-known...


Slide28 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide28 Slide28 Web 2.0 at OSTI Web 2.0 Beginnings Wiki Blog Widgets Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 The web is transformational technology for sharing knowledge The web is still young and will certainly hold surprises as it evolves Just as another well-known...


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 At OSTI, Web 2.0 has arrived.... Web 2.0 is a term describing changing trends in the use of World Wide Web technology and web design that aims to enhance...


Slide1 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide1 Slide1 Innovative Web Resources Can Advance the DOE R&D Mission ARPA-E June 24, 2010 Walter L. Warnick, Ph.D. Director Office of Scientific & Technical Information Office of...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Scientific databases stump Google Systems that crawl the Web do not typically reach below the surface. Google "crawls" the surface Web, but scientific databases are...


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Web 2.0 at OSTI * Web 2.0 Beginnings - RSS - Wiki - Blog - Widgets Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 1. What does WorldWideScience.org do? A. It searches the Deep Web * Where science is hundreds of times larger than the "surface web" * Generally not searchable by...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Much of science is non-Googleable The Deep Web is Huge Surface Web Deep Web Most STI is in databases in the Deep Web - govenment databases - journals In fact, the...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 The web is transformational technology for sharing knowledge The web is still young and will certainly hold surprises as it evolves. Just as another well-known...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 WorldWideScience.org searches the 'deep web' Deep Web Where science is hundreds of times larger than the "surface web" Generally not searchable by major search...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Deep Web Current models include only a few international sources Only small parts of the deep Web are metasearchable Add new comment Thumbnail Mobile320x340...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Much of Science Is Non-Googleable The Deep Web Is Huge In fact, the vast majority of science information is in databases within the deep web - or the non-Googleable...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 The Web Is Transformational Technology for Sharing Knowledge The web is still young and will certainly hold surprises as it evolves. Just as another well-known...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 Do You Know? How big is the web? How much of the worlds information is on the web? How similar are the major search engines in terms of search results? What...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Much of science is non-Googleable The Deep Web is Huge In fact, the vast majority of science information is in databases within the deep web - or the non-Googleable...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 The Deep Web Is HUGE 99% of scientific documents in databases in Deep Web Deep Web is not accessible to search engines and robots Challenge: Metasearch has scaling...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 E-Link Web-Based Reporting System * Documents the receipt, review and release from "input" to "output" products * Used by grantees to submit final reports and by...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Surface Web and Deep Web-2005 * Size: Estimated to be 8+ billion (Google) to 45 billion (About.com) web pages * Static, crawlable web pages * Large amounts of...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 What Makes WorldWideScience.org Unique? 1. It searches the Deep Web * Where science is hundreds of times larger than the "surface web" * Generally not searchable by...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 The deep Web is huge The deep Web is huge. Link to larger image. Basically, there are two ways to get to knowledge on the Web. In fact, one can think of them as two...


Slide16 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide16 Slide16 Energy Link Renewed Web forms Updated options, e.g., access limitations Added DOI field Began caching FT hosted at site URLs Made passwords compliant Revealed the...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 Prominent Deep Web Search Engines * Science.gov * ScienceAccelerator.gov * E-print Network * Science Conference Proceedings * Federal R&D Project Summaries Add new...


Slide44 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide44 Slide44 Sampling of Information Sources http:openaccess.eprints.org http:www.arl.orgsparc http:www.sparceurope.org http:www.plos.orgindex.php http:...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 With a large number of open access sources, WorldWideScience.org provides a single point of access to vast quantities of full-text science literature. Add new...


Slide30 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide30 Slide30 Key ChangesImpacts in Internet Era * Increased usevisibility of DOE R&D: from 1995 to 2009, web transactions increase from 300,000 to 87,000,000 - a 28,900%...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 Fulfilling the Mission 1. DOE's STI: Collect and preserve DOE-funded R&D results in a variety of document formats, housed in a central repository of both physical...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Energy R&D Investments The U.S. invests approximately 8.5 billion (USD) in energy-related Research & Development annually. OSTI collects, preserves, disseminates,...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Recognition for DOE R&D Online search tools hold six slots in TOP 100 ScienceTechnology Government Information Web Sites by the Association of College and Research...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Ensuring Access to DOE R&D Results * OSTI coordinates with POCs across the complex * DOE R&D results are: * Collected from DOE offices, labs, and facilities, as...


Slide3 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide3 Slide3 Free Aggregator of Multiple Government R&D-related Databases Drills down to selected databases and websites in parallel, then presents ranked search results Science...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 Delivering R&D Results Presented by: Dr. Walter L. Warnick Director Office of Scientific and Technical Information (OSTI) Delivering R&D Results Add new comment...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Federal R&D Project Summaries * Provides a portal to more than 750,000 Federal research projects, complete with full-text single-query searching across databases...


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 Ensuring DOE R&D Is Globally Accessible; Bringing R&D from Global Sources to DOE Sources of Scientific and Technical Information (STI) Key Specialized OSTI...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Getting the R&D Message Out OSTI's deployment of groundbreaking information access technology has been developed only through the most judicious use of very limited...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 DOE-generated resources Information Bridge R&D Project Summaries R&D Accomplishments Soon to be added: Patents Database ESTSC DOE-related resources Energy Citations...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 STI Products Today Information Bridge - R&D technical reports are full-text searchable, freely available online. Is primary set of R&D findings published as...


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide15 Slide15 DOE R&D Project Summaries XML Data Service * The DOE R&D Project Summaries is a database containing records describing ongoing or recently completed projects...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 DOE STI Repository Legacy R&D Document Collection: * 1.2 MILLION full-text scientific documents, representing the cumulative scientific knowledge from DOE and...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Making R&D Accessible Multiplier factor Accelerating the spread of knowledge inspires everything we do at OSTI Making DOE's discoveries more broadly known Diffusing...


Slide24 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide24 Slide24 Remaining Challenge How do you unleash the value of 400 billion in R&D? DOE's Total Historic R&D Output 15% Digitized 85% Non-digitized Yes, OSTI's electronic...


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 R&D Deliverables The main deliverable coming out of R&D projects is scientific and technical information (STI) STI takes the form of journal articles, gray...


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Because R&D Results Are Useful Making DOE STI searchable and easily found Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 R&D flows through OSTI to public * Technical reports (150,000 full text) * E-prints (1.1 million and growing) * Science conference proceedings * Project...


Slide1 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide1 Slide1 Vantage Point: Government R&D Results Distributor to Accelerate Science Discovery Sharon M. Jordan Assistant Director for Program Integration U.S. DOE Office of...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 DOE's STI Offerings Information Bridge - Reports of DOE-funded R&D Results E-Print Network - A gateway to over 24,600 Web sites and databases worldwide, containing...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 DOE's STI Program and Products Sharon Jordan Assistant Director for Program Integration CENDI Meeting May 5, 2010 Add new comment Original Thumbnail Mobile320x340...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Questions? Comments? Sharon Jordan Assistant Director DOESC OSTI Operating Agent for Science.gov 865-576-1194 jordans@osti.gov Add new comment Thumbnail...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 STI Program & A Year in Review, A Look Ahead Sharon M. Jordan Assistant Director OSTI Add new comment Original Thumbnail Mobile320x340 Icon64x64...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Vision for EPN * OSTI hopes to evolve the EPN from a primarily information search and retrieval product to one that supports the researcher more broadly in all of...


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 Information Bridge and Energy Citation Database * Useful Enhancements: - Spell Check when using Basic Search - Zotero plug-in integration when using FireFox - DOI...


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 1 Science.gov Way Stewardship of: * 1 million + hard-copy documents representing DOE's 60-year legacy * 4 million + electronic DOE-produced R&D records dating to...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 1. The Research Division of the District is making plans for a complete and authoritative scientific record of all research work performed by Manhattan District...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 1. What does WorldWideScience.org do? (cont'd) B. It overcomes historic constraints on global science discovery: i. Not knowing "what's out there." (examples:...


Slide26 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide26 Slide26 You get up-to-the-minute information relevant to your query. Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide25 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide25 Slide25 With just one click, your query will be sent from our server in Oak Ridge, TN, to databases around the world. Those databases will return results in real time that...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Science Accelerator DOEOSTI STI products now searchable via a single query www.scienceaccelerator.gov Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Your query will return to your desktop from the server in Oak Ridge, TN, with a list of results in "real time." Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Advanced Search (cont.) Again, the query is sent to all the portals in parallel, in real time and returned. Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide25 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide25 Slide25 Your query will return to your desktop from the server in Oak Ridge, TN, with a list of results in "real time." Add new comment Original Thumbnail Mobile320x340...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 With just one click, your query will be sent from the server in Oak Ridge, TN, to databases around the globe Add new comment Original Thumbnail Mobile320x340...


Slide21 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide21 Slide21 With just one click, your query will be sent from the server in Oak Ridge, TN, to databases around the globe Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 STI Access in the Information Age * Single Query Access * Tailored Product Functionalities * Customer Driven Services * Non-Text Media * Web 2.0 Capabilities Add...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Science.gov Interface similar to Google Under the hood, NOT like Google * USA.gov's portal for science * Resources represent 97 percent of the federal R&D budget...


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Uniqueness of WorldWideScience.org * 33 sample queries launched in Google, Google Scholar, and WorldWideScience.org * Similar quantities in the numbers of results,...


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Google Founder Delivered Message to Scientists "Virtually all economic growth (in the world) was due to technological progress. I think as a society we're not...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 Google Founder Delivers Message to Scientists Larry Page, speaking to scientists at AAAS, February, 2007 He called on scientists to make more of their research...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 We must ensure access to science information that is Non-Googleable Google: v., to search for information through Google Googleable: adj., information found by...


Slide16 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide16 Slide16 Metadata Input System: For Websites in Searchable Index ("Surface Web" portion of Science.gov) Provides Alliance members and content managers a secure tool to...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

slide02 slide02 What is It? It's tons of FREE federally funded and international science research information from: * Department of Energy (DOE) * Other U.S. government science...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Enhancements & Updates ECD FY 10 UpdatesEnhancements: * Provides free public access to more than 2,387,659 citations with over 259,000 full-text DOE documents and...


Slide36 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide36 Slide36 DOE Fugitive Documents OSTI conducted a pilot to determine if DOE fugitives existed: DOE sponsored or authored by DOE or DOE contractor personnel Publicly available...


Defining the role of elastic lubricants and micro textured surfaces in lubricated, sliding friction  

E-Print Network (OSTI)

Solutions for reducing friction in sliding, lubricated systems include modifying lubricant rheology using polymers and adding a micro-scale texture to the sliding surfaces, but the mechanism of how lubrication properties ...

Hupp, Sara J. (Sara Jean), 1979-



Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 We need systems, such as federated search, that probe the deep web Federated search drills down to the deep web where scientific databases reside (1) A user types...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Advanced Search This screen displays the different fields you can specify to really tailor and refine your search. I want to see records where the terms...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 We need systems, such as federated search, that probe the deep Web. Federated search drills down to the deep Web where scientific databases reside. Unlike the...


Slide7 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide7 Slide7 Single-Query Search The Challenge: Researchers needed help sorting through the numerous products to get the most relevant results quickly The Solution: To simplify...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Eclipsing Current Search Technology Google Google is capitalizing on this early era of Web technology and is hugely successful, powering more than half the world's...


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Search Results The SEARCH RESULTS are re-displayed and now show the SUBJECT terms...as pointed out, here. Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Type a search term such as "weather prediction" into the search box and click "Search". Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Search and Retrieval Challenges with Multimedia Science Information * Lack of written transcripts, i.e. no "full text" to search * Metadata, if available, is often...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Basic Search Search term: "electric vehicles" AND batteries This is an example of a search on WorldWideScience.org, which is a brand new global science gateway that...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Search Results If you select one of those icons, as in this IEA record, you go directly to the full text. So, again, the distributed searching is a very nice way to...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Brief History: Federated Search and WorldWideScience.org Deep Web * where science is * hundreds of times larger than the "surface web" * generally not "googleable,"...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Federated search drills down to the deep web where scientific databases reside Federated search systems probe the deep web OSTI has been a leader in the development...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Search Results Switching subject areas, a search for Hydrogen and Fuel Cells retrieves almost 10,000 matches. Add new comment Original Thumbnail Mobile320x340...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 ETDEWEB Search Results The search results screen displays the number received (over 5000), document titles, and dates. Document links and PDF icons are displayed on...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Search Results Shown are a series of search results from several different terms. First there are results from searching on "hydrogen" and "fuel cells," meaning we...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 ETDEWEB Advanced Search A more specific search may be conducted using options available on the Advanced Search screen. The search criteria in this example are...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

slide14 slide14 To give you an idea of search results from Science.gov, let's look at the Featured Search which is often a topic of current interest. When you click the current...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Search for Nano Should Reach Text and Numeric Data A Search for "nanotubes" finds many documents, but numeric data is harder to locate. Information centers, such as...


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 Application Main Menu & Search Results Figure 1. Main Menu Figure 2. Search Results Add new comment Original Thumbnail Mobile320x340 Icon64x64...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 We need systems, such as federated search, that probe the deep web Federated search drills down to the deep web where scientific databases reside. Surface Web Deep...


Slide21 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide21 Slide21 Easy-to-Use Search Get the simplicity of a "Google-type" search box; get results that are not "Google-like" at all. Less than 1% overlap with Google; approximately...


Slide16 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide16 Slide16 We Are Pioneers in Gov Federated Search-A Unique Search Engine Capability Innovative technology drills down to selected databases and websites in parallel, then...


slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

slide07 slide07 1 of the Big 3 - Science Accelerator Search key resources from DOE OSTI To pick resource(s) andor to search by field(s), see Advanced Search (U.S. DOE-sponsored...


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide15 Slide15 OSTI Enhancing Search Making search relevant Fully searchable full text Alert Services Real-time search results Deep Web search Speaker Notes: OSTI has sought ways...


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 Type a search term such as "weather prediction" into the search box and click "Search". Add new comment Thumbnail Mobile320x340 Icon64x64...


Slide21 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide21 Slide21 Distributed Search (cont.) Once the search is launched, the user will see a progress bar, which indicates how far the search has gone. Distributed searching...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Users and Search User Goals: - Find authoritative and relevant information. - Users don't want to search, they want to get something done. Broad scope search...


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Federated search drills down to the deep Web where scientific databases reside. We need systems that probe the deep Web. Unlike the Google solution, federated...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Federated Search Useful when full bibliographical control is not feasible. Most Science Info Is in the Deep Web. Federated search drills down to the deep Web where...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Search Results The next screen shows "SEARCH RESULTS". Note that your search term is highlighted where it appears. You will also find appearances of your search...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 These Gateways Search Non-Googleable Science Agency level * Search key DOE databases. Interagency level * Search 50 million pages of science from 13 federal science...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 DOE: Direct Descendant of the Manhattan Project DOE produced the first nuclear reactors. DOE produced the first atomic bombs. DOE is now the largest U.S. funder of...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 Science.gov @ Five Years InterLab '07 Los Alamos, New Mexico October 1-3, 2007 Add new comment Thumbnail Mobile320x340 Icon64x64...


Focus Area 3 Deliverables  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 - Commercial Grade item and Services 3 - Commercial Grade item and Services Dedication Implementation and Nuclear Services Office of Environmental Management And Energy Facility Contractors Group Quality Assurance Improvement Project Plan Project Focus Area Task # and Description Deliverable Project Area 3-Commercial Grade Item and Services Dedication 3.1-Complete a survey of selected EM contractors to identify the process and basis for their CGI dedication program including safety classification of items being dedicated for nuclear applications within their facilities Completed Survey Approvals: Yes/No/NA Project Managers: S. Waisley, D. Tuttel Yes Executive Committee: D. Chung, J. Yanek, N. Barker, D. Amerine No EM QA Corporate Board: No Energy Facility Contractors Group


Direct Use for Building Heat and Hot Water Presentation Slides and Text Version  

Energy.gov (U.S. Department of Energy (DOE))

Download presentation slides from the DOE Office of Indian Energy webinar on direct use for building heat and hot water.


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

2 Slide12 Home Pages Updated DOE unveiled January 2006 SC in progress OSTI redesign unveiled September 2005...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Optimal approximation of linear systems using Taguchi-sliding-based differential evolution algorithm  

Science Conference Proceedings (OSTI)

A Taguchi-sliding-based differential evolution algorithm (TSBDEA) is proposed in this study to solve the problem of optimally approximating linear systems. The TSBDEA is an approach of combining the differential evolution algorithm (DEA) with the Taguchi-sliding-level-method ... Keywords: Differential evolution algorithm, Model reduction, Taguchi sliding level method

Jinn-Tsong Tsai; Wen-Hsien Ho; Jyh-Horng Chou; Ching-Yi Guo



On Indexing Sliding Windows over On-line Data Streams Lukasz Golab  

E-Print Network (OSTI)

On Indexing Sliding Windows over On-line Data Streams Lukasz Golab School of Comp. Sci. University and Engineering Research Council (NSERC) of Canada. 1 #12;Abstract We consider indexing sliding windows in main on a division of the sliding window into sub-windows. When a new sub-window fills up with newly arrived tuples

Waterloo, University of


Designing an interactive OpenGL slide-based presentation of the softbody simulation system for teaching and learning of computer graphics techniques  

Science Conference Proceedings (OSTI)

3D graphics power-point-like slides in OpenGL is a way to present a demo or a teaching item. We focus on how the softbody objects are modeled and rendered with the intent to make a base for teaching, learning, and education of/for computer graphics and ... Keywords: OpenGL, education, frameworks, physical-based modeling, presentation, real-time, softbody

Miao Song; Serguei A. Mokhov; Peter Grogono



Cerenkov Particle Identification in FOCUS  

E-Print Network (OSTI)

We describe the algorithm used to identify charged tracks in the fixed-target charm-photoproduction experiment FOCUS.

The FOCUS Collaboration



Previous world record shattered during six-experiment pulse  

NLE Websites -- All DOE Office Websites (Extended Search)

Magnetic field researchers target hundred-tesla goal Previous world record shattered during six-experiment pulse Researchers met the grand challenge of producing magnetic fields in...


Sliding drops across alternating hydrophobic and hydrophilic stripes  

E-Print Network (OSTI)

We perform a joint numerical and experimental study to sistematically characterize the motion of drops sliding over a periodic array of alternating hydrophobic and hydrophilic stripes with large wettability contrast, and typical width of hundreds of $\\mu \\textrm{m}$. The fraction of the hydrophobic stripes has been varied from about 20% to 80%. The effects of the heterogeneous patterning can be described by a renormalized value of the critical Bond number, i.e. the critical dimensionless force needed to depin the drop before it starts to move. Close to the critical Bond number we observe a jerkily motion characterized by an evident stick-slip dynamics. As a result, dissipation is strongly localized in time, and the mean velocity of the drops can easily decrease by an order of magnitude compared to the sliding on homogeneous surface. Lattice Boltzmann (LB) numerical simulations are crucial for disclosing to what extent the sliding dynamics can be deduced from the computed balance of capillary, viscous and body forces at varying the Bond number, the surface composition and the liquid viscosity. Away from the critical Bond number, we characterize both experimentally and numerically the dissipation inside the droplet by studying the relation between the average velocity and the applied volume forces.

M. Sbragaglia; L. Biferale; G. Amati; S. Varagnolo; D. Ferraro; G. Mistura; M. Pierno



On concurrency control in sliding window queries over data streams  

E-Print Network (OSTI)

Work done while the author was visiting the University of Waterloo. Data stream systems execute a dynamic workload of long-running and one-time queries, with the streaming inputs typically bounded by sliding windows. For efficiency, windows may be advanced periodically by replacing the oldest part of the window with a batch of newly arrived data. Existing work on stream processing assumes that a window cannot be advanced while it is being accessed by a query. In this paper, we argue that concurrent processing of queries (reads) and window-slides (writes) is required by data stream systems in order to allow prioritized query scheduling and improve the freshness of answers. We prove that the traditional notion of conflict serializability is insufficient in this context and define stronger isolation levels that restrict the allowed serialization orders. We also design and experimentally evaluate a transaction scheduler that efficiently enforces the new isolation levels by taking advantage of the access patterns of sliding window queries. 1

Lukasz Golab; Kumar Gaurav Bijay; M. Tamer zsu



What Previous Disasters Teach: The (Really) Hard Lessons  

E-Print Network (OSTI)

What Previous Disasters Teach: The (Really) Hard Lessons What Previous Disasters Teach: The (Really) Hard LessonsThe (Really) Hard Lessons of Katrina and Haiti for Humanitarian Logistics The (Really) Hard debacle or How not to do it The Port au Prince Earthquake: More Hard Lessons Implications Suggestions #12

Mitchell, John E.



NLE Websites -- All DOE Office Websites (Extended Search)

the year 2009. With rising global temperatures, scientists worry about the potential impact that the thawing perma- frost and ensuing release of trapped carbon might have on the...


Mirror alignment and focus of point-focus solar concentrators  

DOE Green Energy (OSTI)

Distributed point-focusing solar concentrators are being developed for dish-Stirling systems and other applications. Many of these concentrators make use of faceted mirrors that have to be accurately aligned. Some of the solar concentrator designs use stretched-membrane facets that also require focusing. Accurate mirror alignment and focus of faceted solar concentrators have two benefits. First, the concentration ratio of the concentrator/receiver (collector) system is improved with accurate alignment and focus. The receiver aperture diameter can therefore be smaller, thereby reducing thermal losses from the receiver and improving the overall efficiency of the collector. Second, and perhaps more importantly, flux intensities on the receiver can be sensitive to facet alignment and focus. In this paper, the theory and practical application of an alignment and focusing technique are presented. In the technique, light from an artificial source is reflected from the concentrator`s facets to a target. From basic geometric principles, the shape and location of the reflected light on the target can be predicted. Alignment is accomplished by adjusting the facets aim so that the reflected image falls on the predetermined location. To focus a stretched-membrane facet, the reflected image size is adjusted to match that of the target. The governing equations used to draw the alignment targets are developed and the practical application of the technique to the alignment and focus of the Cummins Power Generation, Inc. CPG-460 are presented. Alignment uncertainty associated with this technique on the CPG-460 is also discussed.

Diver, R.B.



Industries in focus | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

ENERGY STAR Energy Performance Indicators for plants Industries in focus Secondary menu About us Press room Contact Us Portfolio Manager Login Facility owners and managers...


Previous Members | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Previous ASCAC Members Previous ASCAC Members Advanced Scientific Computing Advisory Committee (ASCAC) ASCAC Home Meetings Members ASCAC Members Bio Previous ASCAC Members Charges/Reports Charter .pdf file (38KB) ASCR Committees of Visitors ASCR Home Members Previous ASCAC Members Print Text Size: A A A RSS Feeds FeedbackShare Page Dr. F. Ronald Bailey Computer Sciences Corp. 591 Branciforte Ridge Santa Cruz, CA 95065 Dr. Horst D. Simon Director, Computational Research Division Lawrence Berkeley Laboratory 1 Cyclotron Road, MS 50B-4230 Berkeley, CA 94720 Mr. Gordon Bell Microsoft Research 835 Market St. Suite 700 San Francisco, CA 94103 Dr. Larry L. Smarr Calit2/UCSD 9500 Gilman Drive, MC 0436 La Jolla, CA 92093-0436 Marjory S. Blumenthal Office of the Provost Georgetown University 3700 O Street, NW, ICC 650


Previous Meetings | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Previous Meetings Previous Meetings High Energy Physics Advisory Panel (HEPAP) HEPAP Home Meetings Previous Meetings Members .pdf file (20KB) Charges/Reports Charter .pdf file (44KB) HEP Committees of Visitors HEP Home Meetings Previous Meetings Print Text Size: A A A RSS Feeds FeedbackShare Page December 6-7, 2013 Gaithersburg, MD Agenda and Talks September 5-6, 2013 Arlington, VA Agenda and Talks March 11-12, 2013 Gaithersburg, MD Agenda and Talks December 5-6, 2012 Bethesda, MD Agenda and Talks Minutes .pdf file (5.7MB) August 27-28, 2012 Rockville, MD Agenda and Talks Minutes .pdf file (6.1MB) March 12-13, 2012 Washington, DC Agenda and Talks Minutes .pdf file (5.7MB) October 27-28, 2011 Washington, DC Agenda and Talks Minutes .docx file (72KB) Summary Letter from Chair .pdf file (94KB)


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)



Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

4 Slide04 Nuclear Data * Nuclear Data* * Types: ?Experimental (e.g., Experimental Nuclear Reaction Data (EXFOR)) ?Evaluated (e.g., Evaluated Nuclear Data File (ENDF-6) and...


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

0 Slide10 OSTI Partnerships International Atomic Energy Agency (IAEA) International Nuclear Information System (INIS) - since 1970. Energy Technology Data Exchange (ETDE) - since...


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 Slide 3: Leadership and Staff Walter L. Warnick, Director RL Scott, Deputy Director Vince Dattoria, Senior Advisor Administration & Information Services Brian Hitson, Assoc. Director Information Systems Karen Spence, Assistant Director Program Integration Sharon Jordan, Assistant Director STI Acquisitions & Management, Judy Gilmore STI policies and procedures, e-journal consortia, R&D project summaries, intellectual property rights, special projects Brabson, Delores Elliott, Jannean Foust, Susie Waldrop, Kathy Chambers, Kathy Goodman, Paulette Rita Hohenbrink External Relations & Communication, Linda Ponce SC communication liaison, OSTI home page, web policies, interagency & E-gov initiatives, software, report requests Allen, Valerie Buckner, Kim


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Slide10 Slide 10: Management of Scientific Text Is a Model for Numeric Data -Defense Technical Information Center (Department of Defense) -Office of Research and Development & Office of Environmental Information (Environmental Protection Agency) -Government Printing Office -NASA Scientific and Technical Information Program -National Agricultural Library (Department of Agriculture) -National Archives and Records Administration -National Library of Education (Department of Education) -National Library of Medicine (Department of Heath and Human Services) -National Science Foundation -National Technical Information Service (Department of Commerce) -Office of Scientific and Technical Information (Department of Energy) -USGS/Biological Resources Discipline (Department of Interior)


Slide29 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide29 Legislative Update the debate continues * Currently, the NIH Public Access Policy ensures public has access to published results of NIH-funded research * Requires...


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

7 Slide17 Some Interesting titles... ETDEWEB Bibliographic Citation Preliminary investigation of the potential of harnessing tidal energy for electricity generation in Malaysia...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 15: In Summary: Three Points on Nano Info Diffusion -Modeling - it's possible -Metadata - numeric data, unlike textual data, requires metadata to ensure access -Stewardship -...


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 2: Three Topics Relating to Nano Info Diffusion We see three complementary approaches to improve information sharing and awareness - Modeling - it's possible - Metadata -...


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide06 Overcoming Challenges of the "Deep" Federated search drills down to the deep web where scientific databases reside Surface Web Deep Web Databases First Deep Web Search...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide04 What Is... WorldWideScience.org? * A multilingual translations tool searching sources and translating results in nine languages: * Chinese Chinese * German Deutsch *...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide23 In short: OSTI Empowers Cyber-enabled Discovery & Innovation We accelerate retrieval of deep Web science info. Which accelerates the advancement of discovery. Advancing...


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide07 Two Major Advances Beyond Searching Within Databases Harvesting Analogous to Google - crawls and mines data that does not reside in databases but ... Different from...


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

record. The citation example in this slide is for "Fuel handbook - Wood and other renewable fuels" from Sweden. Note the abstract in English and the subject indexing, among...


Distributed sliding window scheduling implemented in Java for a JADE agent system.  

E-Print Network (OSTI)

??This thesis describes a fully distributed approach to resource scheduling within a sliding time frame, implemented for a system of agents across multiple JADE platforms. (more)

Logie, Scott Stewart Allan



Business Case Slide 34: Regulatory Constraints Analysis (ANL...  

NLE Websites -- All DOE Office Websites (Extended Search)

Regulatory Constraints Analysis (ANL) - Program Focus Program focus ANL will be preparing a risk analysis and regulatory plan for a specific case: use of DU in catalysts Enhance...


Superlubricity and wearless sliding in diamondlike carbon films.  

DOE Green Energy (OSTI)

Diamondlike carbon (DLC) films have attracted great interest in recent years mainly because of their unusual optical, electrical, mechanical, and tribological properties. Such properties are currently being exploited for a wide range of engineering applications including magnetic hard disks, gears, sliding and roller bearings, scratch resistant glasses, biomedical implants, etc. Systematic studies on carbon-based materials in our laboratory have led to the development of a new class of amorphous DLC films that provide extremely low friction and wear coefficients of 0.001 to 0.005 and 10{sup -11} to 10{sup -10} mm{sup 3} /N.m, respectively, when tested in inert-gas or high-vacuum environments. These films were produced in highly hydrogenated gas discharge plasmas by a plasma enhanced chemical vapor deposition process at room temperature. The carbon source gases used in the deposition of these films included methane, acetylene, and ethylene. Tribological studies in our laboratory have established a very close correlation between the composition of the plasmas and the friction and wear coefficients of the resultant DLC films. Specifically, the friction and wear coefficients of DLC films grown in plasmas with higher hydrogen-to-carbon ratios were much lower than films derived from source gases with lower hydrogen-to-carbon ratios. Fundamental tribological and surface analytical studies have led us to conclude that hydrogen (within the film, as well as on the sliding surfaces) is extremely important for the superlubricity and wearless sliding behavior of these films. Based on these studies, a mechanistic model is proposed to explain the superlow friction and wear properties of the new DLC films.

Erdemir, A.



Sliding Scale Contingencies for the Highway Construction Project Development Process  

E-Print Network (OSTI)

In the Highway construction project development process, State Highway Agencies (SHA) prepare cost estimates for effective communication to stakeholders and for project cost control. Cost estimates prepared in the planning phase of project development typically in a time range of 10 to 20 years from project letting are characterized by a great deal of uncertainty due to low scope definition. SHAs typically include an amount as contingency in the project cost estimate to cover costs due to unidentified or unquantified risks during project development. However, most of the methods used by SHAs to apply contingency to projects lack consistency in definition and application. This leads to poor communication to stakeholders, project cost escalation and other project control issues due to inaccuracy of baseline cost estimates. This study developed a set of sliding scale contingencies for estimating contingency on highway projects taking into consideration the effect of major factors, such as project complexity that impacts contingency application. Expert opinion was sought through the use of the Delphi technique. Experimental techniques were not suitable for this study due to the exploratory nature of the problem and the lack of data to analyze using empirical methods. The Delphi method typically consists of a series of rounds called questionnaires. Twenty-three professionals with experience in risk assessment and cost estimating agreed to participate in the study. Email was the means of communication using an excel spreadsheet. The assessment was completed in three iterative rounds with controlled feedback to the participants on the panel at the end of each round. Sliding scale contingencies were developed for three levels of project complexity: noncomplex (minor), moderately complex, and most complex (major) projects. The sliding scale contingencies are presented as a final output of this study. This method of estimating contingency provides consistent rationale for estimating contingency. Risks are an inextricable part of the contingency estimating process. Estimators are encouraged to identify and document risks as justification for contingency values applied to a project.

Olumide, Adeniyi O.



Surface charging, discharging and chemical modification at a sliding contact  

Science Conference Proceedings (OSTI)

Electrostatic charging, discharging, and consequent surface modification induced by sliding dissimilar surfaces have been studied. The surface-charge related phenomena were monitored by using a home-built capacitive, non-contact electrical probe, and the surface chemistry was studied by X-ray photoelectron spectroscopy (XPS). The experiments were performed on the disk surface of a ball-on-rotating-disk apparatus; using a glass disk and a Teflon (polytetrafluoroethylene) ball arrangement, and a polyester disks and a diamondlike carbon (DLC) coated steel ball arrangement. The capacitive probe is designed to perform highly resolved measurements, which is sensitive to relative change in charge density on the probed surface. For glass and Teflon arrangement, electrical measurements show that the ball track acquires non-uniform charging. Here not only the increase in charge density, but interestingly, increase in number of highly charged regions on the ball track was resolved. Threefold increase in the number of such highly charged regions per cycle was detected immediately before the gas breakdown-like incidences compared to that of other charge/discharge incidences at a fixed disk rotation speed. We are also able to comment on the behavior and the charge decay time in the ambient air-like condition, once the sliding contact is discontinued. XPS analysis showed a marginal deoxidation effect on the polyester disks due to the charging and discharging of the surfaces. Moreover, these XPS results clearly indicate that the wear and friction (sliding without charging) on the surface can be discarded from inducing such a deoxidation effect.

Singh, S. V.; Kusano, Y. [Department of Wind Energy, Section of Composites and Materials Mechanics, Technical University of Denmark, Risoe Campus, Frederiksborgvej 399, DK-4000 Roskilde (Denmark); Morgen, P. [Department of Physics, Chemistry and Pharmacy, University of Southern Denmark, DK-5230 Odense (Denmark); Michelsen, P. K. [Department of Physics, Technical University of Denmark, P.O. Box 49, DK-4000 Roskilde (Denmark)



Joule Unlimited previously Joule Biotechnologies | Open Energy Information  

Open Energy Info (EERE)

Joule Unlimited previously Joule Biotechnologies Joule Unlimited previously Joule Biotechnologies Jump to: navigation, search Name Joule Unlimited (previously Joule Biotechnologies) Place Cambridge, Massachusetts Zip 2142 Product Massachusetts-based industrial biotechnology company developing transformative systems to enable highly efficient, low-cost cell-based biodiesel production. Coordinates 43.003745°, -89.017499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.003745,"lon":-89.017499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brawley Resurrection of a Previously Developed Geothermal Field | Open  

Open Energy Info (EERE)

Brawley Resurrection of a Previously Developed Geothermal Field Brawley Resurrection of a Previously Developed Geothermal Field Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Brawley Resurrection of a Previously Developed Geothermal Field Abstract The Brawley Geothermal Field was originally developed byUnocal. In addition to drilling geothermal wells, this developmentincluded building and operating a 10 MWe power plant.Corrosion and scaling issues resulted in Unocal abandoning theproject in the 1980's. Ormat Nevada investigated the potentialof the shallow sands in 2006. It was concluded that these matrixpermeablesands contained moderately saline water, high porosity,and could support a binary-type power plant. In 2007, OrmatNevada drilled and tested five wells. These test results confirmedthe earlier conclusions and


Compile lessons learned and good practices from ongoing and previous  

Open Energy Info (EERE)

Compile lessons learned and good practices from ongoing and previous Compile lessons learned and good practices from ongoing and previous sustainable development efforts in the country Jump to: navigation, search Stage 2 LEDS Home Introduction to Framework Assess current country plans, policies, practices, and capacities Develop_BAU Stage 4: Prioritizing and Planning for Actions Begin execution of implementation plans 1.0. Organizing the LEDS Process 1.1. Institutional Structure for LEDS 1.2. Workplan to Develop the LEDS 1.3. Roles and responsibilities to develop LEDS 2.1. Assess current country plans, policies, practices, and capacities 2.2. Compile lessons learned and good practices from ongoing and previous sustainable development efforts in the country 2.3. Assess public and private sector capacity to support initiatives 2.4. Assess and improve the national GHG inventory and other


Xunlight Corp previously MWOE Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Xunlight Corp previously MWOE Solar Inc Xunlight Corp previously MWOE Solar Inc Jump to: navigation, search Name Xunlight Corp (previously MWOE Solar Inc) Place Toledo, Ohio Zip 43607 Product US-based developer of single and triple-junction thin-film PV cells and modules. Coordinates 46.440613°, -122.847838° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.440613,"lon":-122.847838,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brawley- Resurrection Of A Previously Developed Geothermal Field | Open  

Open Energy Info (EERE)

Brawley- Resurrection Of A Previously Developed Geothermal Field Brawley- Resurrection Of A Previously Developed Geothermal Field Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Paper: Brawley- Resurrection Of A Previously Developed Geothermal Field Details Activities (1) Areas (1) Regions (0) Abstract: The Brawley Geothermal Field was originally developed by Unocal. In addition to drilling geothermal wells, this development included building and operating a 10 MWe power plant. Corrosion and scaling issues resulted in Unocal abandoning the project in the 1980's. Ormat Nevada investigated the potential of the shallow sands in 2006. It was concluded that these matrixpermeable sands contained moderately saline water, high porosity, and could support a binary-type power plant. In 2007, Ormat Nevada drilled and tested five wells. These test results confirmed the


Focus On.... Biodiversity and Conservation  

E-Print Network (OSTI)

Focus On.... Biodiversity and Conservation This resource guide aims to provide useful, detailed, high quality sources of information on biodiversity and conservation for students in Higher and Further and Conservation Introduction.....................................................................................3

Miranda, Eduardo Reck


Focus Groups | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Outreach & Collaboration » Focus Groups Outreach & Collaboration » Focus Groups Focus Groups A forum for interface between union worker representatives and senior DOE managers and stakeholders to address key issues and concerns from worker perspectives, share information regarding HSS activities and programs, and identify potential opportunities to work together to improve worker health and safety at DOE sites. Learn more about the HSS Focus Groups... Labor Management Meetings and Activities HSS provides forums for communication between labor and management related to worker health, safety and security improvements across the DOE complex. 10 CFR 851 Worker Safety and Health Program The 10 C.F.R. 851 Work Group promotes excellence in the implementation of 10 C.F.R. 851, "Worker Safety and Health" and continuous improvement in the


Focus Areas | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mission » Focus Areas Mission » Focus Areas Focus Areas Safety With this focus on cleanup completion and risk reducing results, safety still remains the utmost priority. EM will continue to maintain and demand the highest safety performance. All workers deserve to go home as healthy as they were when they came to the job in the morning. There is no schedule or milestone worth any injury to the work force. Project Management EM is increasing its concentration on project management to improve its overall performance toward cost-effective risk reduction. This will involve review of validated project baselines, schedules, and assumptions about effective identification and management of risks. Instrumental in refining the technical and business approaches to project management are the senior

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


FEMP Focus: Fall 2003 Issue  

NLE Websites -- All DOE Office Websites (Extended Search)

event of utility interruptions, and will provide 68 percent (56,402 megawatt-hours per year) of the Base's electricity requirement. FEMP Focus: As a FEMP constituent, how do you...


LANL: Facility Focus: Sigma Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

of Energy under contract DE-AC52-06NA25396. A U.S. Department of Energy Laboratory. www.lanl.govorgsmst Materials Science and Technology Division Facility Focus Materials...


Sliding mode for detection and accommodation of computation time delay fault  

Science Conference Proceedings (OSTI)

Computation time delay in digital control systems reduces its robustness as well as degrades its performance. In this paper, the computation time delay is assumed to be constant and smaller than the sampling time and is treated as a fault to be detected, ... Keywords: Computation time delay, Discrete-time sliding mode control, Fault detection, Sliding mode observer

Jos Paulo F. Garcia; Lizete Maria C. F. Garcia; Gisele C. Apolinrio; Fernando B. Rodrigues



Sliding Mode Control of Boost Converter: Application to energy storage system via supercapacitors  

E-Print Network (OSTI)

Sliding Mode Control of Boost Converter: Application to energy storage system via supercapacitors», «Robust control», «Supercapacitor». Abstract Sliding mode control of boost converter is studied. In order of an energy storage system based on supercapacitors technology in order to regulate the output voltage. Given

Paris-Sud XI, Université de


Depth control of remotely operated underwater vehicles using an adaptive fuzzy sliding mode controller  

Science Conference Proceedings (OSTI)

Sliding mode control, due to its robustness against modelling imprecisions and external disturbances, has been successfully employed to the dynamic positioning of remotely operated underwater vehicles. In order to improve the performance of the complete ... Keywords: Adaptive algorithms, Depth control, Fuzzy logic, Nonlinear control, Remotely operated vehicles, Sliding modes

Wallace M. Bessa; Max S. Dutra; Edwin Kreuzer



An adaptive fuzzy sliding mode controller for remotely operated underwater vehicles  

Science Conference Proceedings (OSTI)

Sliding mode control is a very attractive control scheme because of its robustness against both structured and unstructured uncertainties as well as external disturbances. In this way, it has been widely employed for the dynamic positioning of remotely ... Keywords: Adaptive algorithms, Dynamic positioning, Fuzzy logic, Remotely operated underwater vehicles, Sliding modes

Wallace M. Bessa; Max S. Dutra; Edwin Kreuzer



DFIG Driven Wind Turbine Grid Fault-Tolerance Using High-Order Sliding Mode Control  

E-Print Network (OSTI)

DFIG Driven Wind Turbine Grid Fault-Tolerance Using High-Order Sliding Mode Control Mohamed (DFIG), control, second-order sliding mode, grid fault-tolerance. Nomenclature WT = Wind Turbine; DFIG increased currents, which may lead to converter failure. Achieving ride-through requirement for DFIG

Brest, Université de


A High-Order Sliding Mode Observer for Sensorless Control ofDFIG-Based Wind Turbines  

E-Print Network (OSTI)

A High-Order Sliding Mode Observer for Sensorless Control ofDFIG-Based Wind Turbines Mohamed control of a doubly-fed induction generator (DFIG) based wind turbine. The sensorless control scheme is based on a high-order sliding mode (HOSM) observer to estimate the DFIG rotational speed. Indeed, high

Paris-Sud XI, Université de


Using a High Order Sliding Modes for diving control a torpedo Autonomous Underwater Vehicle  

E-Print Network (OSTI)

Using a High Order Sliding Modes for diving control a torpedo Autonomous Underwater Vehicle T Underwater Vehicle AUV is not a trivial task, due to: Parameter uncertainties (as added mass, hydrodynamic underwater robots are basically two: PD [2] [10] and Sliding Modes Control (SMC) [6] [11]. These algorithms

Paris-Sud XI, Université de


IS&JCH050205 Software Engineering. Chapter 7 Slide 0 of 59 System Models  

E-Print Network (OSTI)

Software Engineering. Chapter 7 Slide 10 of 59 Equipment procurement process Get cost estimates Accept + Blank order form Spec. + supplier + estimate Supplier list Equipment spec. ©IS&JCH050205 Software;©IS&JCH050205 Software Engineering. Chapter 7 Slide 6 of 59 Examples of system model Data processing

Huang, Jung-Chang


Design of model reference adaptive sliding mode tracking controllers for mismatched uncertain dynamic systems  

Science Conference Proceedings (OSTI)

Based on the Lyapunov stability theorem, a model reference adaptive sliding mode control scheme is proposed in this paper for a class of multi-input multi-output (MIMO) dynamic systems with mismatched model uncertainties and external disturbances in ... Keywords: Lyapunov stability theorem, adaptive control, mismatched perturbations, sliding mode control

Chih-Chiang Cheng; Hung-An Chen; Jia-Ming Hsiao



Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 DOE has largest share of Federal STI in Science.gov* DOC 10% DOD 3% DOE 24% DOI 10% ED 1% EPA 7% GPO 1% HHS 13% NASA 7% NSF 8% USDA 16% *Based on number of URLs in...


Constant Time Sliding Window Filter SLAM as a Basis for Metric Visual Perception  

E-Print Network (OSTI)

on Robotics and Automation, pages 1099­1104, Washington, DC, 2001. [17] G. Sibley. Sliding window filters, pages 652­659, Washington, DC, 2004. [16] C. F. Olson, L. H. Matthies, M. Schoppers, and M. W. MaimoneConstant Time Sliding Window Filter SLAM as a Basis for Metric Visual Perception Gabe Sibley, Larry

Sibley, Gabe


University of Wisconsin Madison !Solar Energy Laboratory !Slide 1! John Edlebeck  

E-Print Network (OSTI)

University of Wisconsin ­ Madison !Solar Energy Laboratory !Slide 1! John Edlebeck M@wisc.edu Hometown: Duluth, MN #12;University of Wisconsin ­ Madison !Solar Energy Laboratory !Slide 2 " · Fabricate and test optimized seal geometries " #12;University of Wisconsin ­ Madison !Solar Energy

Wisconsin at Madison, University of


Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 2 Slide 1 Systems Engineering  

E-Print Network (OSTI)

;©Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 2 Slide 2 Objectives l To explain why be considered in the system design process l To explain system engineering and system procurement processes #12©Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 2 Slide 1 Systems Engineering l

Scharff, Christelle


General Technical Base Qualification Equivalencies Based On Previous  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

General Technical Base Qualification Equivalencies Based On General Technical Base Qualification Equivalencies Based On Previous Experience, 12/12/95 General Technical Base Qualification Equivalencies Based On Previous Experience, 12/12/95 "The header lists the general field of experience, Commercial Nuclear Power or Navy Nuclear Power Program, with all other categories under these two areas. The subheader lists the position title of the military or job category within that industry. The next level lists the qualification standard subject with the competencies associated with it listed below. To locate the equivalencies that you may claim, locate the position title of your prior military or job category, then find the qualification standards and listed competencies that apply to your current position. The competencies listed below the qualification standards are those you


Global Warming Solutions Inc previously Southern Investments Inc | Open  

Open Energy Info (EERE)

Warming Solutions Inc previously Southern Investments Inc Warming Solutions Inc previously Southern Investments Inc Jump to: navigation, search Name Global Warming Solutions Inc (previously Southern Investments Inc) Place Houston, Texas Zip 77002 Sector Solar Product Developer of a combined PV and thermal energy solar system called light electric and thermal generator (LETG). Coordinates 29.76045°, -95.369784° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.76045,"lon":-95.369784,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Siemens Concentrated Solar Power Ltd previously Solel Solar Systems | Open  

Open Energy Info (EERE)

Siemens Concentrated Solar Power Ltd previously Solel Solar Systems Siemens Concentrated Solar Power Ltd previously Solel Solar Systems Jump to: navigation, search Name Siemens Concentrated Solar Power Ltd (previously Solel Solar Systems) Place Beit-Shemesh, Israel Zip 99107 Sector Solar Product Israel-based subsidiary manufacturing solar thermal electricity generation (STEG) components for power plants, also develops some of its own STEG projects. Coordinates 31.75°, 35° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.75,"lon":35,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Independent Oversight Focus Area Review, DOE Nuclear Facilities - April  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Independent Oversight Focus Area Review, DOE Nuclear Facilities - Independent Oversight Focus Area Review, DOE Nuclear Facilities - April 2010 Independent Oversight Focus Area Review, DOE Nuclear Facilities - April 2010 April 2010 Review of Specific Administrative Controls at DOE Nuclear Facilities The U.S. Department of Energy (DOE) Office of Independent Oversight, within the Office of Health Safety and Security occasionally reviews specific focus areas. Focus areas are aspects of safety programs that Independent Oversight determines warrant increased management attention based on reviews of performance data, inspection results, and operating experience across DOE sites. Due, in part, to operating experience and previous inspection results. DOE selected specific administrative controls (SACs) as a focus area. SACs are new or revised technical safety requirements (TSRs)


Magnetically focused liquid drop radiator  

DOE Patents (OSTI)

A magnetically focused liquid drop radiator for application in rejecting energy from a spacecraft, characterized by a magnetizable liquid or slurry disposed in operative relationship within the liquid droplet generator and its fluid delivery system, in combination with magnetic means disposed in operative relationship around a liquid droplet collector of the LDR. The magnetic means are effective to focus streams of droplets directed from the generator toward the collector, thereby to assure that essentially all of the droplets are directed into the collector, even though some of the streams may be misdirected as they leave the generator. The magnetic focusing means is also effective to suppress splashing of liquid when the droplets impinge on the collector.

Botts, T.E.; Powell, J.R.; Lenard, R.
