Powered by Deep Web Technologies
Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Visual Positioning of Previously Defined ROIs on Microscopic Slides  

E-Print Network [OSTI]

1 Visual Positioning of Previously Defined ROIs on Microscopic Slides Grigory Begelman, Michael slide area. Various microscopy related medical applications, such as telepathology and computer aided of interest. In this paper we present a method for image-based auto positioning on a microscope slide

Rivlin, Ehud


These slides are to help those students who have previously used ...  

E-Print Network [OSTI]

These slides are to help those students who have previously used CourseCompass (previously registered) for MA 15200 or MA 11100. If you used MathXL; it is...



Copyright 2000 Larry Carter & Sean Peisert. Portions of these slides previously Copyright 1998 by Alpern and Carter. Performance Measuring on  

E-Print Network [OSTI]

Copyright © 2000 Larry Carter & Sean Peisert. Portions of these slides previously Copyright © 1998 © 2000 Larry Carter & Sean Peisert. Portions of these slides previously Copyright © 1998 by Alpern & Sean Peisert. Portions of these slides previously Copyright © 1998 by Alpern and Carter. Performance

Peisert, Sean


Slide 1 of 19NCA -Agriculture with a California Focus Agriculture with a California  

E-Print Network [OSTI]

Slide 1 of 19NCA - Agriculture with a California Focus Agriculture with a California Focus (NCA 2013 #12;Slide 2 of 19NCA - Agriculture with a California Focus Authors of Chapter 6: Agriculture of Agriculture #12;Slide 3 of 19NCA - Agriculture with a California Focus Outline · 6 key messages (nationwide

Grotjahn, Richard


Trough-Focus OTF Based Optical Quality Testing of Whole Slide Scanners for Digital Pathology  

Science Journals Connector (OSTI)

We measure the through-focus OTF of whole slide scanners for optical quality testing and monitoring. Analysis of the OTF data gives a system level evaluation of astigmatism, field...

Shakeri, Mojtaba; Hulsken, Bas; van Vliet, Lucas; Stallinga, Sjoerd


Slide Tutorials Slide Tutorials  

E-Print Network [OSTI]

Slide Tutorials 1 Slide Tutorials Up until this point, the main focus of the image atlas has been to provide guidelines for identification of individual silt- and clay-sized components in smear slides in the shipboard/repository smear-slide reference sets. Each tutorial example is first introduced with a written



E-Print Network [OSTI]

Structure? (Slide I). Limit space: finitely ramified in the group-theoretical sense if the intersection of distinct tiles of the same level is finite. Self-similar structure:.

*D. J. Kelleher



Temperature Difference Leads to Magnetism | Physical Review Focus Previous Story / Volume 28 archive  

E-Print Network [OSTI]

Temperature Difference Leads to Magnetism | Physical Review Focus Previous Story / Volume 28 Leads to Magnetism J. Wu/Univ. of California, Berkeley Heat field. Heating the right edge of an n a magnetic field pointing out of the screen, according to computer simulations. Computer simulations suggest

Wu, Junqiao


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Accelerating Electric Vehicle Deployment Accelerating Electric Vehicle Deployment Opportunities for US-China Joint Initiative Roland J. Hwang Transportation Program Director Natural Resources Defense Council US-China Electric Vehicles Forum Beijing, China September 30, 2009 rhwang@nrdc.org, 415-875-6100 2 Slide The Natural Resources Defense Council * National Environmental Non Governmental Organization (NGO) founded in 1970 * 350 Lawyers, Scientists and other professionals * 1.2 million members and activists * 6 offices: New York, D.C., San Francisco, Los Angeles, Chicago and Beijing * Beijing Office founded in 1996 and focuses on energy (including



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

milling: milling: Depth control for three-dimensional microfabrication M. J. Vasile, a) Z. Niu, R. Nassar, W. Zhang, and S. Liu Institute for Micromanufacturing, Louisiana Tech University, Ruston, Louisiana 71272 ͑Received 29 May 1997; accepted 28 July 1997͒ Ion milling with a focused ion beam ͑FIB͒ is a potential method for making micromolds, which will then be the primary elements in the mass production of micro- or mini-objects by embossing or injection molding. The challenge lies in controlling the ion milling to produce cavities with predefined, arbitrary geometric cross-sections. This work involves programming variations as a function of position into the algorithm that generates the dwell times in the pixel address scheme of a FIB. These variations are done according to whether an axis of symmetry or a plane of symmetry determines the final geometry, and the result is 26 new



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

milling milling of diamond: Effects of H 2 O on yield, surface morphology and microstructure D. P. Adams, a) M. J. Vasile, T. M. Mayer, and V. C. Hodges Thin Film, Vacuum and Packaging Department, Sandia National Laboratories, Albuquerque, New Mexico 87185 ͑Received 1 July 2003; accepted 22 August 2003; published 24 November 2003͒ The effects of H 2 O vapor introduced during focused ion beam ͑FIB͒ milling of diamond͑100͒ are examined. In particular, we determine the yield, surface morphology, and microstructural damage that results from FIB sputtering and H 2 O-assisted FIB milling processes. Experiments involving 20 keV Ga ϩ bombardment to doses ϳ10 18 ions/cm 2 are conducted at a number of fixed ion incidence angles, ␪. For each ␪ selected, H 2 O-assisted ion milling shows an increased material removal rate compared with FIB sputtering ͑no gas assist͒. The amount by which the


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

open source compiler called LLVM First release December 2008 Cray Inc. Confidential Slide 2 Cray Inc. Proprietary Slide 3 X86 Code Generator Cray X2 Code Generator Fortran...


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How it Applies to Hanford Mark Coronado, Director RL Budget Division Official Use Only Slide 1 Slide 2 The Federal Budget Process Summary CY 2014 CY 2015 FY 2014 FY 2017...


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

RE Mahan & JD Fluckiger RE Mahan & JD Fluckiger Pacific Northwest National Laboratory Secure Data Transfer Summary Slide: Secure Data Transfer  Outcomes: Best practices guidance for technical staff on the implementation of secure data transmission technology in the SCADA environment.  Roadmap Challenge: Primary focus is on development and integration of protective measures.  Major Successes: Produced a unified view of significant security issues and developed in-depth guideline for addressing security issues in client/server applications.  Schedule: Guidance for developers by 9/30/2010  Level of Effort: 1.25 fte  Funds Remaining: $174K  Performers: PNNL  Partners: N/A Technical Approach and Feasibility * Approach - Identify & document deficiencies/issues


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Sweetser EXERGY Partners Corp. April 23, 2008 A Case for CHP Commissioning Combined Heat and Power (CHP) for Commercial Buildings: Best Practices and Pitfalls SLIDE 2...


Slide 1Slide 1 STVP Educators Corner  

E-Print Network [OSTI]

Slide 1Slide 1 STVP Educators Corner July 28 - 30, 2004 Roundtable on Entrepreneurship Education National University of Singapore #12;Slide 2Slide 2 STVP's Philosophy & Mission We believe that engineers, and we disseminate our research and teaching knowledge throughout the world. #12;Slide 3Slide 3 Teaching

Prinz, Friedrich B.


Slide 1  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

post CD-2 projects with TPCs equal to or greater than 20M. ** Please refer to the next slide for the current file naming convention, which also is found on the PARS II website...


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)



Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- - 6 2 10 ( ) s as as w s T M - + Khler Equation Surface Tension Slide 35 of 46 * 4 0.85 exp ( (85) * ) w as w w p M RT G D ...


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Method Method Use the Multiphase Transport Evaluation Loop (MTEL) Facility at PNNL to gather additional data to first calibrate then validate the ParaFlow software  First set of tests will focus on confirming sensor capability and test repeatability  This as well as previously gathered data will be used to calibrate the physical attributes of the simulant as it forms a bed in the pipe Perform ParaFlow model enhancements required to model the two-phase phenomenon of slurry transport with sufficient accuracy to predict critical deposition velocity and bed formation in pipeline configurations  Similar to Lattice-Boltzmann codes, ParaFlow employs a new technique called Lattice-Kinetics. Its framework readily

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1 | Department of Energy  

Office of Environmental Management (EM)

Slide 1 Slide 1 Slide 1 More Documents & Publications Slide 1 AMCRM.PPT Microsoft Word - MRContingencyProtocolEMFINAL.docx...


Sagittal focusing Laue monochromator  

SciTech Connect (OSTI)

An x-ray focusing device generally includes a slide pivotable about a pivot point defined at a forward end thereof, a rail unit fixed with respect to the pivotable slide, a forward crystal for focusing x-rays disposed at the forward end of the pivotable slide and a rearward crystal for focusing x-rays movably coupled to the pivotable slide and the fixed rail unit at a distance rearward from the forward crystal. The forward and rearward crystals define reciprocal angles of incidence with respect to the pivot point, wherein pivoting of the slide about the pivot point changes the incidence angles of the forward and rearward crystals while simultaneously changing the distance between the forward and rearward crystals.

Zhong; Zhong (Stony Brook, NY), Hanson; Jonathan (Wading River, NY), Hastings; Jerome (Stanford, CA), Kao; Chi-Chang (Setauket, NY), Lenhard; Anthony (Medford, NY), Siddons; David Peter (Cutchogue, NY), Zhong; Hui (Coram, NY)



Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Mark Hadley Mark Hadley Pacific Northwest National Laboratory Cryptographic Trust Management PNNL-SA-74014 Summary Slide: Cryptographic Trust Management  Outcomes: Scalable, efficient, and automated cryptographic trust management solution for control systems.  Roadmap Challenge: Security upgrades hard to retrofit to legacy systems, may be costly, and may degrade system performance; complexity increases exponentially with an increase in number of nodes.  Major Successes: Requirements and high-level design specifications completed. Protocol paper accepted for publication.  Schedule: Requirements Document, High-Level Design Specification  Level of Effort: $183K  Funds Remaining: $55K  Performers: PNNL  Partners: Industry Advisors Image Technical Approach and Feasibility


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Tim Woolf, Vice President Tim Woolf, Vice President Synapse Energy Economics Lisa Schwartz, Senior Associate Regulatory Assistance Project National Association of Regulatory Utility Commissioners, ER&E Committee Meeting, July 24, 2012 Portland, OR Cost-Effectiveness Working Group Outline * Members of the Working Group. * Scope of the report. * Recent experience with demand response cost-effectiveness frameworks. * Proposed demand response cost-effectiveness framework. * Demand response program costs. * Demand response program benefits. * Issues for further research. National Forum on the NAPDR: Cost Effectiveness Working Group Slide 2 Members of the Working Group First Name Last Name Organization Name Organization Type E-mail Alberto Martinez Energy Curtailment Specialists


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Laboratory (PNNL) Laboratory (PNNL) SSCP Commercialization PNNL-SA-73897 Summary Slide: SSCP Commercialization  Outcomes: Scalable, cost-effective methods to secure communication between remote devices and control centers.  Roadmap Challenge: Poorly designed connection of SCADA and business networks can dramatically increase vulnerabilities of control systems.  Major Successes: The task team provided Cisco with multiple SSCP implementation guidance sources and resources. The team also developed a protocol specification that describes deploying SSCP security objectives for routable control system communication.  Schedule: Routable Protocol Specification, Implementation Guidance, Hallmark  Level of Effort: $575k  Funds Remaining: $287K  Performers: PNNL


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Brian Smith Brian Smith EnerNex Lemnos Interoperable Security Summary Slide: Lemnos Interoperable Security  Outcomes: Energy asset owners can better evaluate product functions, purchase, and install products supporting cyber security functions from multiple vendors knowing they will be interoperable  Roadmap Challenge: Vendors do not have specific requirements or standards to build to  Major Successes:  IPsec & Syslog protocols  Lab Testing & Public Plug-fests  Commercial product release (SEL)  Schedule: Centralized Authentication, Secure Remote Access, and Syslog in 2010  Level of Effort: $1.24M (2010)  Performers: Image EnerNex Tennessee Valley Authority Sandia National Laboratories Schweitzer Engineering Laboratories Technical Approach and Feasibility


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Performance of Performance of Hydrate-Bearing Sediments in Offshore Environments Stephen A. Holditch January 19, 2007 Objectives * Create capability to describe geomechanical behavior of hydrate bearing sediments in the ocean, by Developing a knowledge base and Developing a quantitative predictive capability * Determine the envelope of hydrate stability under typical oceanic conditions where oil and gas production occurs Large block of hydrated sediment breaking off and sliding down slope Debris Flow Gas Plume Original Slope Surface Lower Boundary of Hydrate at Low Sea Stand Lower Boundary of Hydrate at High Sea Stand Dissociated (gas-fluidized ) Gas Hydrate Hydrated Zone Figure 1. Diagram showing the effects of gas hydrate dissociation on oceanic hill


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Pacific Northwest National Laboratory Pacific Northwest National Laboratory Field Device Management Summary Slide: Field Device Management  Outcomes: Feasibility study and final report, prototypical design specification for implementation of working prototype.  Roadmap Challenge: Standardized test plans and upgrades for new technology are not widely available; complexity increases exponentially with an increase in number of nodes  Major Successes: Outreach during study is identifying/addressing increasing interest from asset owners with regard to technical approach that meets assessment and audit criterion.  Schedule: Feasibility Study/Report - FY10  Level of Effort: $34K  Funds Remaining: $25K  Performers: PNNL  Partners: BPA, ACS Technical Approach and Feasibility * Approach


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

Presented To: Presented To: Washington DC April 27, 2011 The US Natural Gas Revolution: Technology Transforms A Market 2011 EIA Energy Conference Slide 2 BENTEKENERGY.COM US natural gas production has reached record production levels. Growth has occurred because of evolving technology and process innovation that will continue to drive costs down. Technology is also improving environmental mitigation. Prices will remain relatively low for many years. The implications are profound for consumers, the economy and the environment. Key Points Of My Presentation Slide 3 BENTEKENERGY.COM 45.0 50.0 55.0 60.0 65.0 70.0 1/1 2/1 3/1 4/1 5/1 6/1 7/1 8/1 9/1 10/1 11/1 12/1 Comparison of Marketed Production US Production Is At Record Levels Source: BENTEK Supply and Demand Report Jan Jul Apr Oct Average Daily


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Dale Peterson Dale Peterson Digital Bond, Inc. Bandolier and Portaledge Summary Slide: Bandolier  Outcomes: Insure new and upgraded SCADA and DCS are deployed in the best possible security configuration  Roadmap Challenge: Consistent metrics are not available to measure and assess security posture; there is a lack of tested and validated security tools  Major Successes: Over twenty Bandolier Security Audit Files, major vendor participation, used in FAT/SAT, more vendors want in  Schedule: Over twenty files to date. NERC CIP files and more Bandolier files planned.  Level of Effort: $1.2M to date  Funds Remaining: $575K pending  Performers: Digital Bond, Inc.  Partners: ABB, AREVA, Emerson, Matrikon, OSIsoft, SNC, Tenable, Telvent and more Technical Approach and Feasibility


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Gas Turbine Fuel Systems Division Gas Turbine Fuel Systems Division Micro-Mixing Lean Premix System for Ultra-Low Emission Hydrogen/Syngas Combustion 2010 University Turbine Systems Research Workshop, Oct. 19-21, 2010 Dr. Adel Mansour (PI), Dr. Erlendur Steinthorsson * Introduction * Project Overview; Research Objectives and Approach * Micro-Mixing Cup Development * 1 st Generation Micro-Mixing Cup - Radial Inflow Configuration * 2 nd Generation Micro-Mixing Cup - Mixed Axial/Radial Inflow Configuration * Multi-cup Module * Full-Scale 1.3 MW injector * Atmospheric tests (fuel-air mixing, flame imaging, emissions) * High-pressure combustion tests * Summary and Conclusions Outline PARKER PROPRIETARY INFORMATION -Use or disclosure of data on this slide subject to the restriction(s) listed on the "Title Page" of this document


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Himanshu Khurana Himanshu Khurana University of Illinois TCIPG: Converged Networks for SCADA (Joint work with Erich Heine and Tim Yardley) Summary Slide: CONES  Outcomes: Specify and create an architecture and platform for maintaining real-time and secure communications for control in a converged network.  Roadmap Challenge: Develop and Integrate Protective Measures  Major Successes: CONES enhanced machines outperform non- enhanced machines in representative scenarios; major real-time constraints met.  Schedule: Started 2/8, Design 8/8, Prototype 7/9, Experiments 4/10, Transitioned to TCIPG 2/10  Level of Effort: $250k DOE and TCIPG Funding  Funds Remaining: TCIPG Funding  Performers: University of Illinois  Partners: PNNL Background: Control Systems networks today


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Carl Hauser Carl Hauser Washington State University TCIPG: GridStat Summary Slide: GridStat Outcomes: Develop key and trust management solutions for secure and real-time communication substrate; transition substrate to industry partners to meet increased inter-utility communication needs Roadmap Challenges: Open and flexible control leads to increased risks; complexity increases exponentially with increased number of nodes; Major Successes: long-lived authentication architecture; NASPInet architecture influence  Schedule: Develop preliminary trust model and multicast signing approaches 8/10; implement multicast signing 12/10; large-scale test 6/11  Funding: TCIPG  Performers: Washington State Univ.  Partners: SEL, RTI, PNNL, Avista QoS broker 1


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

States States Naval Nuclear Propulsion Program OPERATING NAVAL NUCLEAR PROPULSION PLANTS AND SHIPPING (RAIL) NAVAL SPENT FUEL SAFELY FOR OVER 45 YEARS SSGN 728 USS Florida CVN 69 USS Dwight D. Eisenhower M-140 Shipping Container NAVAL SPENT FUEL SHIPMENTS NAVAL SPENT FUEL SHIPMENTS * NRC Type B packages * Specially-trained, 24/7 escorts * Government-owned railcars * Location and status constantly monitored * Escort/train crew communications * Rugged fuel * National security shipments Slide 2 NAVAL SPENT FUEL SHIPMENT ACCIDENT EXERCISE BACKGROUND NAVAL SPENT FUEL SHIPMENT ACCIDENT EXERCISE BACKGROUND * Escorted national security shipments. - Exercises provide prime opportunity for outreach, shipment familiarization and emergency response planning. * Regional in nature - 1996 Northwest (Washington/Oregon)


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

/ Jeff Dagle / Jeff Dagle Pacific Northwest National Laboratory "Implications of Design Basis Threat on Critical Infrastructure and Homeland Security" Note! * The context of this presentation doe not represent any findings that are classified or non-classified * The notion or discussion of a critical infrastructure DBT is not itself sensitive and no details that would present such sensitivities are represented in any way in this presentation Summary Slide: Design Basis Threat Implications  Outcomes: Implications of Design Basis Threat concepts relevant to energy sector critical assets and threat  Roadmap Challenge: Vendors do not have specific requirements or standards to build to: threats are hard to demonstrate and quantify  Major Successes: Major projects in


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

July 20-22, 2010 July 20-22, 2010 Thomas J. Overbye University of Illinois at Urbana-Champaign TCIPG - Smart-Grid Enabled Distributed Voltage Support Framework Summary Slide: Project Title *Outcomes: Demonstrate the viability of distributed reactive resources to provide more resilient system voltage control. This will require near real-time distributed control and local control communications  Roadmap Challenge: Control system networks that automatically provide contingency and remedial actions  Major Successes: Project is just beginning; initial simulations are promising  Schedule: 2010 to 2013  Level of Effort: TCIPG funding  Funds Remaining: TCIPG funding  Performers: University of Illinois at Urbana-Champaign  Partners: Non-formalized relationships with power system


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

TCIPG: Network Access Policy Tool (NetAPT) TCIPG: Network Access Policy Tool (NetAPT) (Joint work with David Nicol, Mouna Seri, and Sankalp Singh) Summary Slide: NetAPT  Outcomes: Tool to prove correctness and compliance of firewall settings in networked setting.  Roadmap Challenge: Limited ability to measure and assess cyber security posture  Major Successes (since transition to TCIPG): NetAPT used in major internal audit of industrial partner's control system network. Tool significantly enhanced as based on experience gained during use.  Schedule: Original tool developed with TCIP and I3P funding. Transitioned to TCIPG 2/10.  Level of Effort: TCIPG Funding  Funds Remaining: TCIPG Funding  Performers: University of Illinois  Partners: Ameren, Sandia Background: Control Systems Networks Today


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Laboratory Laboratory Protocol Analyzer PNNL-SA-73892 Summary Slide: Protocol Analyzer  Outcomes: Provide operators of SSCP-deployed technologies the tools to view and troubleshoot SSCP-protected communication.  Roadmap Challenge: Standardized test plans and upgrades for new technology are not widely available.  Major Successes: Demonstration of Open Source solution shown at DistribuTECH.  Schedule: Open source candidate (Q3), Demonstration (Q2)  Level of Effort: $159K  Funds Remaining: None  Performers: Pacific Northwest National Laboratory  Partners: Wireshark Project, ASE, FTE (future partner) Technical Approach and Feasibility * Approach - Utilize PNNL-developed technology to import SSCP protected data into Wireshark's normal interface - Add SSCP digester to Wireshark


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Loren Toole & Andy McCown Loren Toole & Andy McCown Los Alamos National Laboratory Right-Sized SCADA Communications  Outcomes: Scalable, cost-effective security solutions for new architecture designs and communication methods applicable to new systems as well as legacy-system upgrades  Roadmap Challenge: Limited resources available within businesses to address security needs  Major Successes: End-to-end description of EP SCADA systems; survey of literature for SCADA system metrics  Schedule: Detailed analysis of SCADA system 10/30/2010; System metrics 11/30/2010; Detailed specifications document 1/31/2011  Level of Effort: $200K  Funds Remaining: $150K  Performers: LANL Image Summary Slide: Right-Sized SCADA Communications Technical Approach and Feasibility


Slide 1 | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Slide 1 Slide 1 Slide 1 More Documents & Publications Slide 1 Slide 1 Microsoft PowerPoint - DEC1387487090415 OECM Working Group April 16 Presentation Without Notes.ppt...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nuclear Regulatory Commission Methodology Objective and systematic measurement of the organizational behaviors * Surveys * Focus groups * Standard interview protocols Page 3 of...


Slide 1  

Office of Environmental Management (EM)

Mixed Waste Treatment Project Danny Nichols President and Project Manager Idaho Treatment Group April 30, 2014 2 Workers at AMWTP focus on the safe and compliant retrieval,...


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Focus on Markets Focus on Markets Hydro Has Value, but.... Will it be Valued? Richard R. Miller, P.E. HDR Engineering, Inc. _____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ DOE Electricity Advisory Committee June 5-6, 2013 Is BPA Today California's Energy Future? Actual and forecasted wind: large swings in power supply need to be supplemented by other sources Is BPA Today California's Energy Future?


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Report and Proposed Plan (Draft A) Agenda * Waste Site Summary * Previous 300 Area Regulatory Documents * CERCLA Five-Year Review * Risk AssessmentPreliminary Remediation Goals...


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

I N I S T R A T I O N 5 Energy Efficiency 2011 How does BPA define behavior based energy efficiency (BBEE) programs? BBEE programs focus on energy savings resulting from changes...


Slide 1  

Office of Environmental Management (EM)

* Focused on safety and disciplined operations as we near completion Workers remove a pipeline from 100-D reactor area along the Columbia River 18 Our project remains ahead of...


Slide 1 | Department of Energy  

Energy Savers [EERE]

Slide 1 Slide 1 Slide 1 More Documents & Publications DOE Organization Chart - October 2014 DOE Organization Chart - August 7, 2013 DOE Organization Chart - July 23, 2013...


Slide 1 | Department of Energy  

Energy Savers [EERE]

Slide 1 Slide 1 Slide 1 More Documents & Publications Major DOE Biofuels Project Locations Major DOE Biofuels Project Locations The Current State of Technology for Cellulosic...


Slide 1 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Slide 1 Slide 1 Slide 1 More Documents & Publications Environmental Management Completed Projects 2005-Present EMAB Meeting - May 2012 EM Contractors for Capital Asset Projects...


Slide 1 | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Slide 1 Slide 1 Slide 1 More Documents & Publications DOE Supplemental Instructions for OMB Section 1512 Reporting - For Grant and Loan Recipients DOE Supplemental Instructions for...


Slide 1 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Slide 1 Slide 1 Slide 1 More Documents & Publications CX-010271: Categorical Exclusion Determination CX-011098: Categorical Exclusion Determination CX-009587...


Slide 1  

Gasoline and Diesel Fuel Update (EIA)

Applications of the Biomass Applications of the Biomass Scenario Model Brian W Bush Presentation at EIA's "Biofuels in AEO2013 " Workshop 20 March 2013 4 Focus of Biomass Supply-Chain Analysis Deployment Analysis: exploring how rapidly biofuel technologies might be deployed to make a significant contribution to the country's transportation energy - Generate plausible scenarios - Understand the transition dynamics - Investigate potential market penetration scenarios - Analyze prospective policies and incentives - Identify high-impact drivers and bottlenecks - Study competition for biomass resources - Assess R&D and deployment strategies - Enable and facilitate focused


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Hutton Hutton Acting Associate Deputy Assistant Secretary Safety, Security and Quality Programs Office of Environmental Management, U.S. DOE 1 An organization's values and behaviors, modeled by its leaders, and internalized by its members, which serve to make safe performance of work the overriding priority to protect workers, the public, and the environment. DOE Integrated Safety Management Guide 2  Promote a shift from a focus on compliance toward pursuit of excellence Safety Culture Focus Areas Leadership Employee/Worker Engagement Organizational Learning Associated Attributes Behavioral Elements (description) 3  Joint DOE/EFCOG working group - 2007 ◦ Recommended safety culture principles based on nuclear


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Pin-fins Pin-fins are used to remove excess heat from the trailing edge of turbine airfoils. While much research has focused on heat transfer, little work has focused on flowfield measurements which can provide insight into further optimization of pin-fin array geometries. Flowfield Measurements in a Single Row of Low Aspect Ratio Pin-Fins The Pennsylvania State University Jason K. Ostanek and Dr. Karen A. Thole GAS TURBINE NEEDS PROJECT APPROACH HORSESHOE VORTEX Establish large scale facility and high resolution experimental measurement techniques Determine which flow features contribute most to heat transfer for a single row of pin-fins OBJECTIVES Leading edge heat transfer enhancement decreases with increasing Reynolds number SUMMARY AND CONCLUSIONS Kármán vortices contribute most to endwall heat transfer in a single row of pin-fins


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

DEPARTMENT OF ENERGY DEPARTMENT OF ENERGY DATA REPORT ON SPOUSE/COHABITANT DOE F 5631.34 (03/98/Administrative Update 03/2011) All Editions Prior to 03/98 Are Obsolete OMB Control No. 1910-1800 OMB Disclosure Statement on Reverse 1. Name of Employee or Applicant (Last, First, Middle) 2. Present Name of Spouse/Cohabitant (Last, First, Middle) 3. Other Names Used by Employee or Applicant (Maiden name and/or names previously used) 4. Other Names Used by Spouse/Cohabitant (Maiden name and/or names previously used) 5. Social Security Number of Employee or Applicant 6. Social Security Number of Spouse/Cohabitant 7. Present Mailing Address of Spouse/Cohabitant 8. Date of Birth of Spouse /Cohabitant 10. Citizenship of Spouse/Cohabitant (complete a or b - whichever applies) Does your Spouse/Cohabitant hold dual citizenship with any country(ies)?


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Adaptable 3D Electron Microscopy for Adaptable 3D Electron Microscopy for Characterizing Nanoscale Materials Opportunity More Insight, Faster Industry Significance Benefits to Partner Development Status Contact Static characterization has been used for a NETL-RUA project (heat resistant steel), and other fundamental research including catalysts and nanominerals. Dynamic experiment is under-development. * Seeking mid-term collaboration research partner. We usually focus on fundamental materials science and try to establish a material's design principle via microstructure-functional property relationships * Can the capability be applied to solve an industry challenge? Yes, the technique is especially suitable for nanoparticle catalysts (noble and transition metal


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Process Control Process Control Space, Scale & Scope of Plant Control - Increase interconnections of advanced energy systems - More computations are performed at sensor and actuation level * How do we control and coordinate such systems? * Adopt and adapt new approaches to decision science for coordinated control to occur at large scale * Objectives - Derive criteria for assessing sensor effectiveness and system impact - Demonstrate effectiveness and reconfigurability of sensors - Extend work in sensors to actuation and control system architecture * Concept - Focus on what to control, what to optimize (not how to control) * Correct and accurate objective functions for each subsystem * Better system decomposition * Approaches for Control - Centralized - Distributed


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Centennial West Clean Line Centennial West Clean Line February 2012 2 Introduction to Clean Line Energy Connecting Renewable Energy to Demand Strong wind resources Large demand centers * Clean Line is an independent developer solely focused on building transmission lines. * Clean Line is backed by investors with a long-term outlook and patient capital. * Clean Line's management team brings a track record of success in energy project development. Integrating large clean energy sources with demand centers Strong wind and solar resources 3 Why do we need transmission? ...and with limited access to robust transmission systems Best wind resources are in the central spine of the United States away from distant population centers 4


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Environmental Challenge 2009 Environmental Challenge 2009 National Awards Webinar May 26 th , 2010 Agenda Introductory Remarks: Facilities Management - Frank Freda Investor Services - Jim Arce EPA ENERGY STAR - Alyssa Quarforth C&W Environmental Challenge Overview & Results Award Winner Presentations: Overview of environmental achievements Discussion of property best practices C&W Environmental Challenge Introductory Remarks Client Solutions Business Leaders Frank Freda Global Head of Facilities Management Jim Arce Global Head of Investor Services EPA ENERGY STAR Partner C&W became an ENERGY STAR Partner in 1999 ENERGY STAR is a voluntary partnership program: Focused on climate protection Provides strategic approach to energy management,


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

Lee Schipper Lee Schipper Senior Research Engineer Precourt Energy Efficiency Center, Stanford University and Project Scientist, Global Metropolitan Studies, UC Berkeley EIA 2009 Energy Conference April 7 Washington DC Looking Before You Leap into A Model: A New Climate for Seeing Transport Energy Futures? Precourt Energy Efficiency Center Stanford University * A research and analysis institute at Stanford * Established in October 2006 * Initial funding: $30 million pledge by Jay Precourt * Mission - To improve opportunities for and implementation of energy efficient technologies, systems, and practices, with an emphasis on economically attractive deployment - Focus on the demand side of energy markets - Energy efficiency: economically efficient reductions in energy use (or energy intensity)

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Efficient, Versatile, and Cost- Efficient, Versatile, and Cost- Effective Gas Separation Sorbents Opportunity Technology/Capability Overview Development Status Contact NETL has several different types of agreements for industrial collaborations. These include Cooperative Research and Development Agreements, Contributed Funds Agreements, and Nondisclosure Agreements. These instruments enable industrial partners to negotiate an agreement suitable for their needs including Go/No-Go decision points to ensure progress aligns with expectations. Once a technology is developed, it could be available for licensing. More information about working with NETL's Material Science and Engineering Focus Area can be found at: www.netl.doe.gov/onsite_research/materials-science.html


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Technology Technology Review Steven E. Koonin Under Secretary for Science June 2011 DOE-QTR Scope  The DOE-QTR will provide a context and robust framework for the Department's energy programs, as well as principles by which to establish multiyear programs plans and budgets. It will also offer high-level views of the technical status and potential of various energy technologies.  The primary focus of the DOE-QTR process and document will be on the following:  Framing the energy challenges  A discussion of the roles of government, industry, national laboratories, and universities in energy system transformation  Summary roadmaps for advancing key energy technologies, systems, and


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

DOE DOE Environmental Liabilities May 2013 1 Table of Contents Introduction FY12 EL Overview Section I General Background Section II CFO Environmental Liability Guidance Overview Section III Environmental Management Environmental Liability Section IV Active and Surplus Facilities Environmental Liability Section V Other Legacy Environmental Liabilities Section VI Regulatory Environment Section VII Additional Yearend Reporting and Related Liabilities Section VIII Focus for FY 2013 Appendix A Liability Math Appendix B Common Acronyms List Appendix C EM SOPP Appendix D Active Facilities Asbestos Estimation Appendix E Newly Generated Waste Liability Guidance Appendix F ES&H Liability 2 DOE Environmental Liability FY 2012 - $268 billion


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Significant Work. Extraordinary People. SRA. Significant Work. Extraordinary People. SRA. 1 Large-scale Diurnal Storage Study Presentation at DOE ESS Peer Review November 2, 2010 Poonum Agrawal Sentech, Inc., now part of SRA International 2 Project Objective * Characterize and assess emerging innovative bulk ES technologies and relevant applications - Focus on concepts using pumped storage or compressed air with capacities greater than 100 MW * Recommend strategy for DOE to hasten the commercialization of these innovative technologies. Significant Work. Extraordinary People. SRA. 3 Project Details * Project Duration: - May through December 2010 * Sandia Delegated Representative: - Georgianne Huff * Joint project with KEMA Consulting: - Poonum Agrawal, Sentech, Inc., now part of SRA International - Rick Fioravanti, KEMA Consulting


Sliding vane geometry turbines  

SciTech Connect (OSTI)

Various systems and methods are described for a variable geometry turbine. In one example, a turbine nozzle comprises a central axis and a nozzle vane. The nozzle vane includes a stationary vane and a sliding vane. The sliding vane is positioned to slide in a direction substantially tangent to an inner circumference of the turbine nozzle and in contact with the stationary vane.

Sun, Harold Huimin; Zhang, Jizhong; Hu, Liangjun; Hanna, Dave R



PPT Slide  

Gasoline and Diesel Fuel Update (EIA)

Working gas in storage is estimated to have been below 1,800 billion Working gas in storage is estimated to have been below 1,800 billion cubic feet at the end of December, more than 20% below the previous 5-year average. The estimated end-year level is the lowest for the period of time that EIA has records. The current outlook for winter demand and supply suggests that storage is likely to remain very low this winter. In the base case, we project that gas storage will fall to about 470 billion cubic feet at the end of the heating season (March 31, 2001). The previous 30-year observed low was 758 billion cubic feet at the end of the winter of 1995-1996. If summer gas demand next year is as strong as we currently expect it to be, the low end-winter storage levels will present a strong challenge to the North American gas supply system to maintain flexibility and provide


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Energy Storage Systems Program of the U.S. Department Of Energy through Pacific Energy Storage Systems Program of the U.S. Department Of Energy through Pacific Northwest National Laboratories EES technologies and PNNL focus Electrical energy Electrical charges: Capacitors Potential energy: pump hydro, compress air Kinetic energy: flywheels Chemical energy: batteries Direct Storage in charges Indirect storage via energy conversion PNNL strategy in stationary EES R&D EES R&D at PNNL EES Technologies Novel redox flow batteries, MWhs New gen Na-batteries, up to MWhs Low cost, long life Li-ion, community storage ... Crosscutting science Advanced diagnostic study, NMR, TEM, etc. Electrochemical study * Mass/charge transport * Electrical fields * Flow, thermal, ... * Basic chemistry * Materials structure * Physical properties * Electrochemical activity * Reaction kinetics


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

2008 Dominion 2008 Dominion Building New Nuclear Plants: The Utility Decision EIA 2008 Energy Conference April 8, 2008 Eugene S. Grecheck Vice President Nuclear Development © 2008 Dominion © 2008 Dominion © 2008 Dominion The Evolving Utility View of New Nuclear n Pre 2001-Skepticism n 2001-2003-Tentative exploration n 2003-2004-Focus on licensing hurdles, first ESP applications, formation of NuStart, DOE NP2010 solicitations n 2005-EPACT incentives n 2006-2007-Many COLA announcements, first applications submitted n 2008-Facing the realities? © 2008 Dominion The original issues-start of this decade n No new nuclear plant orders since 1978 n Licensing and construction takes too long n Last new plant began operation in 1996 n Construction and operations and maintenance costs are too high n Licensing is unpredictable


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Dave Isiminger Dave Isiminger Site GIS & Environmental Systems Geospatial Technology Summit Flight Planning Tool Powered by: Environmental Data Portal Background Radiological Assistance Program (RAP) The Flight Planning Tool (FPT) 1 2 3 AGENDA Established early 1950s for the production of materials used to fabricate nuclear weapons Today the mission focuses: * Cold war clean up & environmental stewardship * Technology Innovation * Energy independence Background Radiological Assistance Program (RAP) The Flight Planning Tool (FPT) 1 2 3 AGENDA * DOE/NNSA Radiological First Responders * Deployable within 2 hours. * Regionally located to provide a timely response capability and foster relationships with other emergency response elements 8 7 5 8 7 4 2 1 6 2 3 0 DOE Regional Map and Coordinating Offices


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Management Best Practices Webinar Part 2 - Geospatial data NASA EarthData Webinar National Aeronautics and Space Administration www.nasa.gov Introduction to the ORNL DAAC Suresh K.S. Vannan Environmental Sciences Division Oak Ridge National Laboratory September 12, 2013 NASA EarthData Webinar National Aeronautics and Space Administration www.nasa.gov Best Practices, NASA EarthData Webinar, September 12, 2013 3 The Oak Ridge National Laboratory Distributed Active Archive Center (ORNL DAAC) archives data produced by NASA's Terrestrial Ecology Program in support of NASA's Carbon Cycle and Ecosystems Focus Area. About ORNL DAAC http://daac.ornl.gov Field Campaign Model Code Land Validation Regional and Global ORNL DAAC Best Practices, NASA EarthData Webinar, September 12, 2013


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Methodology for Methodology for Assessing CO 2 Storage Potential of U.S. Gas Shale Formations NETL 2013 Summer Research Symposium Angela Goodman, Isis Fukai, Dan Soeder, Grant Bromhal, Bob Dilmore, Kelly Rose, Brian Strazisar, Traci Rodosta, and George Guthrie National Energy Technology Laboratory August 20-22, 2013 Sheraton Station Square, Pittsburgh, Pennsylvania Purpose of Research: Develop a method to estimate CO 2 storage resource for gas shales in United States and Canada Focus of Gas Shale Research Adapt existing DOE-NETL CO 2 Storage Methodology to gas shales Atlas IV - November 2012 Atlas III - November 2010 Atlas II - November 2008 Atlas I - March 2007 * Simple Geometric-Based Formula * Extensive Peer-Review * Extensive Statistical Rigor Volumetric approach: geologic properties & storage efficiency


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Department of Energy's Department of Energy's Phase II Mercury Control Technology Field Testing Program China Workshop on Mercury Control from Coal Combustion October 31-November 2, 2005 Beijing, China Thomas J. Feeley, III thomas.feeley@netl.doe.gov National Energy Technology Laboratory China Hg Workshop_Nov 2005 Outline * Background * Field testing - Mercury-specific technology, focusing on ACI * Field testing - Co-benefit control * Preliminary ACI costs * Conclusion/future plans China Hg Workshop_Nov 2005 Power Plant Mercury Control Baghouse or ESP FGD Boiler Stack Cleaning SCR Hg 75 ton/yr Hg in coal Current Emissions 48 ton/yr out stack Hg Hg Hg Hg 27 ton/yr Sorbent Injection Oxidizing Systems Hg Specific Control Co-Benefit Control China Hg Workshop_Nov 2005 Mercury Control Technology Program Performance/Cost Objectives


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Energy Energy eere.energy.gov 1 Program Name or Ancillary Text eere.energy.gov WIND AND WATER POWER PROGRAM 1 2010 Wind Technologies Market Report Ryan Wiser and Mark Bolinger Lawrence Berkeley National Laboratory Report Summary June 2011 WIND AND WATER POWER PROGRAM 2 Presentation Overview * Introduction to 2010 edition of U.S. wind energy market report * Wind installation trends * Wind industry trends * Price, cost, and performance trends - Power sales prices - Installed wind project costs - Wind turbine transaction prices - Wind project performance - O&M cost trends * Policy and market drivers * Future outlook WIND AND WATER POWER PROGRAM 3 2010 Wind Technologies Market Report Purpose, Scope, and Data: * With a focus on 2010, summarize trends in the U.S. wind power market,


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Performance of Forecasting Models Across the North Slope of Alaska Performance of Forecasting Models Across the North Slope of Alaska During the Mixed-Phase Arctic Cloud Experiment Victor Yannuzzi, Eugene Clothiaux, Johannes Verlinde and Jerry Harrington The Pennsylvania State University Introduction The Mixed-Phase Arctic Cloud Experiment (MPACE) was conducted across the North Slope of Alaska (NSA) from September 27 through October 22, 2004. The experiment was funded by the Department of Energy (DOE)-Atmospheric Radiation Measurement (ARM) program to study the microphysics, radiative properties, thermodynamics, and life cycle of mixed-phase clouds in the Arctic. A focused set of observation stations and soundings were in place across the NSA (figure 1) where conditions could be expected to produce low-level mixed-phase clouds on


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2012 Wind Technologies Market Report Ryan Wiser and Mark Bolinger Lawrence Berkeley National Laboratory Report Summary August 2013 WIND AND WATER POWER PROGRAM 2 2012 Wind Technologies Market Report Purpose, Scope, and Data: * Publicly available annual report summarizing key trends in the U.S. wind power market, with a focus on 2012 * Scope primarily includes wind turbines over 100 kW in size * Separate DOE-funded annual reports on distributed and offshore wind * Data sources include AWEA, EIA, FERC, SEC, etc. (see full report) Report Authors: * Primary authors: Ryan Wiser and Mark Bolinger, Berkeley Lab * Contributions from others at Berkeley Lab, Exeter Associates, NREL Funded by: U.S. DOE Wind & Water Power Technologies Office Available at: http://www1.eere.energy.gov/wind/


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Ward Sproat Ward Sproat Deputy Project Director-WTP Bechtel National, Inc. 1  NRC Finds Operators Sleeping in the Control Room ◦ 2 Unit nuclear plant shutdown for almost 3 years ◦ CEO/COO and other officers fired ◦ Company within months of bankruptcy  Root cause: No nuclear safety culture ◦ Management ignored repeated outside warnings ◦ Management was technically focused ◦ Poor individual accountability was ignored ◦ Performance expectations were low or non-existent 2  Brought in new leadership from outside the company  Defined the safety-oriented performance culture we wanted  Set clear performance and behavioral expectations for managers/supervisors and individual contributors  Established standing processes to monitor/measure


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

WB Barton WB Barton Office of Waste Processing Technical Exchange May 19, 2009 Waste Tank Waste Tank Heels and Heels and Heel Heel Simulants Simulants Tank Operations Contract 2 Acknowledgements * Dan Herting and Heinz Huber did most of the chemistry work. * Don Geniesse did extensive chemical modeling to determine mineral forms expected. * Leela Sasaki, Duc Nguyen, and Doug Adkisson provided valuable insights. Tank Operations Contract 3 Background * WRPS proposed to investigate the ECC process for deployment in Hanford tanks as a heel treatment process. * Needed a chemical simulant of the heel for testing of the ECC process. * Retrieval is focused on C Farm tanks for the next 5 years. Tank Operations Contract 4 Background C-108 C-109 C-110 C-103 Tank Operations Contract 5 Background


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Hillman Hillman Office of Health, Safety and Security September 19, 2012 1  Update DOE safety analysis and emergency management requirements/guidance and perform pilot applications  Perform system walkdowns and evaluations at several Cat 1 and 2 DOE nuclear facilities to assess potential susceptibilities to natural phenomena hazards and external BDBEs  Conduct emergency drills and exercises at DOE sites with nuclear facilities, focusing on BDBEs 2  HSS and NA-41 initiated a project involving a series of pilot studies in response to short-term actions identified in the DOE August 2011 report  The purpose of the pilots was to examine: ◦ How Beyond Design Basis Events (BDBEs) were evaluated and documented in DSAs ◦ Results of actions taken as a result of Safety Bulletin 2011-01


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Geospatial Technologies from the Geospatial Technologies from the Ground Up: The State Perspective Department of Energy Geospatial Technology Summit August 16, 2011 NATIONAL STATES GEOGRAPHIC INFORMATION COUNCIL Jon Gottsegen President, National States Geographic Information Council State GIS Coordinator/Enterprise GIS Services Mgr, State of Colorado Office of Information Technology NATIONAL STATES GEOGRAPHIC INFORMATION COUNCIL What is NSGIC? (www.nsgic.org) * Small 501 (c) 6 nonprofit organization (~579 members) * Formed in 1991 * We Promote - Effective and efficient government through the prudent adoption of geospatial technologies - Statewide GIS coordination efforts * We serve as the voice of States for geospatial issues * Actively engaged with many Federal organizations - Especially focused on the FGDC and the National Spatial Data


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Peer Review Peer Review September 29, 2008 Washington D.C. Evaluation of Lead-Carbon Devices for Utility Applications DOE Energy Storage Program Sandia Contract 659172 Paula Walmet Specialty Chemicals Division MeadWestvaco Corporation Funding: Congressional ear-mark. 2 Program Overview Phase One: Explore possible advantages to carbon in energy storage  Evaluate lead based energy storage technologies  Develop carbon for lead based technologies - Increase cycle life for some applications - Improve charging characteristics Phase Two: Investigate performance benefit and refine understanding  Verify performance  Focus on material properties/mechanisms that result in performance benefit Phase Three: Determine best technology for application needs  Select best technology for 1 MW, 1 MWh utility demonstration

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

As A As A Power Resource Steven Nadel, Executive Director American Council for an Energy-Efficient Economy October 2010 2 The American Council for an Energy- Efficient Economy (ACEEE) 30 year old, non-profit 501(c)(3) dedicated to advancing energy efficiency through research and education. 35+ staff in Washington DC, + field offices in DE, MI, WA and WI. Focus on End-Use Efficiency in Industry, Buildings, Utilities, and Transportation; Economic Analysis & Human Behavior; and State & National Policy Worked on utility-sector energy-efficiency programs and policies since 1980s Savings Potential from Jan. 2009 Electricity Advisory Committee Report Average Statewide Utility Cost of Saved Energy for Efficiency Programs 3.3 3.3 3.1 3.0 2.9 2.8 2.7 2.6 2.1 1.9 1.9 1.7


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Presented to the Presented to the Nuclear Energy Research Advisory Committee Rebecca F. Smith-Kevern Office of Light Water Reactor Deployment Office of Nuclear Energy February 21, 2007 Program Status 169632-NREAC briefing (2) Nuclear Power 2010 ... Began as a Demonstration Project Program initiated in February 2002 Focused on addressing regulatory, financial, and technical challenges Based on Near-term Deployment Roadmap and other studies Government/industry cooperative effort * 50-50 cost-shared industry projects * Market-driven 169632-NREAC briefing (3) Nuclear Power 2010 ... Working with Industry to Build New Nuclear Plants Three Early Site Permit Demonstration Projects * Address site suitability, environmental protection, and emergency planning issues * Clinton and Grand Gulf awaiting Commission decision


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Attribute Attribute Preserving Network Equivalent Thomas J. Overbye (overbye@illinois.edu) Fox Family Professor of Electrical and Computer Eng. University of Illinois at Urbana-Champaign Graduate students Wonhyeok Jang (wjang7@illinois.edu) Saurav Mohapatra (smohapa2@illinois.edu) 1 CERTS Meeting Aug. 6-7, 2013 Overview  Overall objective - To develop equivalent models that preserve desired properties of the full model  Current focus - To create line limit preserving equivalents of interconnection level power systems - To assign limits to equivalent lines so that total transfer capability (TTC) in equivalent system matches that of original system as much as possible 2 Background  For decades power system network models have been equivalenced using the approach originally


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

CALENDAR AND NEXT STEPS CALENDAR AND NEXT STEPS ELENA MELCHERT Committee Manager Ultra-Deepwater Advisory Committee SEPTEMBER 26, 2012 Ultra-Deepwater Advisory Committee  Committee Calendar - September 26, 2012: 20th UDAC Meeting in Houston, TX * Review the Secretary of Energy's 2013 Annual Plan * Establish ad hoc Review Subcommittees that will provide in depth review of the Annual Plan * Develop finding and draft recommendations for the Committee to discuss and review at October 2012 meeting - October 23 - 24, 2012: 21st UDAC Meeting in Houston, TX * Ad hoc Review Subcommittees will present findings and recommendations to the full Committee for discussion * Committee will focus on developing final recommendations - November 1, 2012: 22nd UDAC Meeting via Conference call


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Writing Winning Proposals Writing Winning Proposals Get In Line and Win! James R. Lindsay 10 th Annual U.S. Department of Energy Small Business Conference Small Businesses Leading the Way to Recovery and Reinvestment James R. Lindsay Page 1 Thought Successful grant writing involves the coordination of several activities, including planning, searching for data and resources, writing and packaging a proposal, submitting a proposal to a funder, and follow-up. Corporation for Public Broadcating Introductions Experience in writing government proposals Your expectations for the day! 1-2 years 3-5 years 5 + years Your Competition Government Funding Overview State Versus Federal Government Funding Great Depression New Deal Grants Born Sputnik Focus Science, Education, Technology


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

Busbin Busbin Transmission Policy and Services Southern Company Transmission 2012 National Transmission Congestion Study Eastern Regional Workshop - Philadelphia, PA December 6, 2011 2012 National Transmission Congestion Study Based on the questions posed to panelists, there are two areas upon which I would like to offer comment: * Metrics To Be Used In The Study * Present / Future Congestion I'll then end with a few brief remarks focused on a third topic * EIPC Experience 2012 National Transmission Congestion Study - Metrics To Be Used In The Study #2 What factors should DOE look at when evaluating congestion and identifying congestion areas? 2009 Transmission Congestion Study defines congestion as, "The condition that occurs when transmission capacity in a specific location is not sufficient to enable safe delivery of all


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SOFC Cathodes SOFC Cathodes John S. Hardy, Xiao-Dong Zhou*, Jared W. Templeton, Zigui Lu, Jeffry W. Stevenson * Now at the University of South Carolina July 27-29, 2010 11 th Annual SECA Workshop Pittsburgh, PA FY10 Research Topics in the Cathode Sub-task Importance of Cathode Sintering Temperature Optimization for Cell Performance & Stability Enhanced Densification of the SDC Interlayer Concentration Polarization in LSCF Cathodes Effects of Contamination from Sealing Glass Volatiles on LSM & LSCF Cathodes Capability Development: In-situ XRD of an Operating SOFC Cathode* Effect of A-site Stoichiometry on LSCF Cathode Performance * The focus of this talk Objectives To develop the capability to perform in-situ XRD measurements on operating SOFC cathodes, including: A test fixture compatible with the XRD.


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of November 2009 Recordable Injury Cases * Truck Driver - Contusion of knee - EE tripped over an uneven floor joint while delivering a package. - The floor elevation reveal had been previously blocked by fixed equipment. - The building occupants had removed the fixed object but not addressed the trip hazard.


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

H. Lagdon, Jr. H. Lagdon, Jr. Chief of Nuclear Safety 1  DPO Process  Overview of the Waste Treatment and Immobilization Plant (WTP) Pretreatment (PT) Facility  Panel Membership  DPO Issues  Panel's Review, Conclusions, and Recommendations  Path Forward 2  The purpose of the DPO process is to bring management attention to technical concerns.  A DPO is a technical issue that: ◦ Differs from previous management decisions, stated positions, established policies, or practices; ◦ Has not been adequately considered, in the opinion of the employee; ◦ Has the potential for a significant negative impact on environment, safety, and health (ES&H).  Applies to DOE Federal employees and DOE contractor and


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

1  PRA studies began in the late 1980s  1989, ATR PRA published as a summary report  1991, ATR PRA full report  1994 and 2004 various model changes  2011, Consolidation, update and improvement of previous PRA work  2012/2013, PRA risk monitor implementation 2  The PRA supports the ATR Updated Final Safety Analysis Report (UFSAR)  The PRA provides sufficient information regarding either core or fuel damage (CDF or FDF) to enable ATR personnel to make risk informed decisions  Improved performance in facility operation, testing, maintenance, training, and emergency procedures  Ensure cost-effective approaches and the setting of priorities for plant upgrades and modifications, especially for risk reduction/system improvements


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

response of an oligonucleotide-based biosensor to environmental mercury response of an oligonucleotide-based biosensor to environmental mercury Harry M. Edenborn Geosciences Division, Office of Science and Engineering Research, National Energy Technology Laboratory, U.S. Department of Energy, P.O. Box 10940, Pittsburgh, PA 15236 Introduction 5'-6-FAM (TTCTTTCTTCCCCTTGTTTGTT)-DAB-3' The molecular beacon used previously consisted of two mercury-binding oligonucleotide sequences (underlined), connected by a linker sequence (CCCC), and terminated by the fluorophore and quencher moieties, fluorescein (6-FAM) and dabcyl (DAB), respectively. In this configuration, the fluorophore exhibits its maximum UV fluorescence at 520 nm. CTTGTTTGTT-DAB-3' | C | C Hg Hg Hg | C | CTTCTTTCTT-6-FAM-5' One environmental pollutant of particular relevance to the


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

MicroBlower MicroBlower at a glance  long operating life  solar powered  remediates shallow areas  remediates vadose zone  excellent for treatment polishing  offers significant cost savings  U. S. Patent 6,971,820 The MicroBlower enables the use of simple, low-cost soil vapor extraction in shallower areas than previously considered possible. Perhaps the greatest potential for the MicroBlower is in treatment polishing of an area treated by an expensive, large blower system that still has residual contamination. Installation of an economical MicroBlower system to finish the cleanup at greatly reduced costs, allows the larger systems to be used where they can produce greater returns. The MicroBlower also can remediate sites that are smaller


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxy-combustion Impacts Oxy-combustion Impacts in Existing Coal-fired Boilers 2013 NETL CO 2 Capture Technology Meeting July 8-11, 2013 Bradley Adams, Andrew Fry 1 , Brydger Van Otten, Tim Shurtz 1 University of Utah REACTION ENGINEERING INTERNATIONAL Presentation Outline * Project Overview * Summarize Previous Work * Introduce Current Work * Preliminary Testing Results - Bench-scale Mercury Measurements - Pilot-scale Mercury Measurements - Pilot-scale Corrosion Measurements * Project Status Summary REACTION ENGINEERING INTERNATIONAL Project Overview * Objective: Characterize and predict performance and operational impacts of oxy-combustion retrofit designs on existing coal-fired boilers * Schedule: 10/1/08 - 9/30/13 (includes 1-yr extension) * Program Managers: Timothy Fout, Andrew Jones


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

DOE Agency Fleet Meeting DOE Agency Fleet Meeting FedFleet 2012 Navid Ahdieh & Ryan Daley June 25, 2012 2 NREL - DOE Fleet Sustainability Assistance * Federal fleet requirement guidance o e.g. May 24, 2011 Presidential Memorandum on Federal Fleet Performance - annual VAM submission * Resources for meeting requirements o FleetDASH o NOVA analysis * Assistance with fulfilling reporting mandates o Annual AFV Acquisition Report 3 Statutory & E.O. Requirements EPAct ('92 & '05) E.O. 13423 EISA '07 E.O. 13514 AFV Acquisition AFVs 75% of light- duty acquisitions Use PHEVs when commercially available Alternative Fuel Use AFVs only use AF unless waived Increase AF use 10% from previous year Install renewable pumps at all fueling centers Fleet Planning Agency plan to meet


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in the in the Blackbody Calibration of Pyrgeometers By Ibrahim Reda, Julian Gröbner * , Tom Stoffel, Daryl Myers, and Bruce Forgan ** Eighteenth Atmospheric Radiation Measurement (ARM) Program Science Team Meeting *Physikalisch-Meteorologisches Observatorium Davos, World Radiation Center (PMOD/WRC) ** Bureau of Meteorology, Australia Abstract Pyrgeometers are used to measure the atmospheric longwave irradiance through out the ARM program sites. Previous calibrations of pyrgeometers using ARM/Eppley/NREL blackbody were consistent, but introduced a difference in the historical clear sky measured irradiance. This difference was believed to be in the order of 12 W/m 2 . In this poster we show the improvements to the blackbody and calibration methodology by comparing our


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxalic acid has been Oxalic acid has been used since the 1980's to clean waste tanks - Tank 16 in 1983 - Tank 24 in 1985 - Tanks 5-6 in 2008 - Tank C-106 in 2002 * Also used in the commercial nuclear industry to clean secondary side steam generators Tank 16 Before Tank 16 After History of Chemical Cleaning * Recognizing that the dissolution step of previous oxalic acid campaigns and the dissolution step of ECC are the same: The objective is to: -Describe each oxalic acid cleaning campaign in the SRS and Hanford tanks -Compare and contrast the campaigns -Apply the knowledge gained to planned ECC dissolution Bulk OA ECC Objective dissolved sludge Oxalic Acid Waste Tank Oxalic Acid dissolved sludge ECC Bulk OA ECC Print Close Using Oxalic Acid Cleaning Experience to Improve ECC Tank 16 5 6 24 C-106


Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

January 31, 2013 January 31, 2013 Injury/Illness Cases - January 2013 * Repetitive strain of wrist * The Research Associate experienced the onset of discomfort due to computer keyboard and mouse use at workstations that were not optimally configured for this employee. * Back discomfort / strain * The Business Analyst experienced the onset of discomfort in the back due to sitting for extended periods of time at the computer workstation. * Strain of wrist * The Writer/Editor experienced the onset of wrist discomfort that may relate back to a previous workstation adjustment. 2 Environment / Health / Safety / Security DIVISION Ergonomic Injury/Illness Cases - January 2013 3 Environment / Health / Safety / Security DIVISION * Contusion on knee * The Computer Systems Engineer sustained a minor contusion of the knee


Slide 1  

Broader source: Energy.gov (indexed) [DOE]

TCIPG Center Overview TCIPG Center Overview TCIPG Summary * Builds on NSF/DOE/DHS Effort from 2005-2010 * $15 M per over 5 years from DOE/DHS, starting Oct 1, 2009 * $3.75 M cost share from Universities * Funded by Department of Energy, Office of Electricity - With support from Department of Homeland Security * 5 Universities - University of Illinois at Urbana- Champaign - Washington State University - University of California at Davis - Dartmouth University - Cornell University Extend and integrate previously developed TCIP technologies and to develop new ones that collectively provide resilience in the nation's electric grid cyber infrastructure that ensures - Trustworthy and timely operations, - Survives malicious attacks while ensuring continuous delivery of services, and is built on an


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

06, Itron Inc. 06, Itron Inc. 1 Under the Bright Lights: Energy Efficiency Programs Energy Information Administration Annual Conference April 27, 2011 Joe Loper © 2006, Itron Inc. Boom Times for Energy Efficiency  EISA (2007) > Most significant EE legislation in previous 3 decades > Incandescent light bulb phase out starting 2012 > Vehicle fuel economy standards increased for first time since 1980s > Numerous program budget authorizations  Federal Stimulus Funding  Ratepayer Funded Programs > All states except AK and LA > 4 states half of total funding, 10 states 94% 2 © 2006, Itron Inc. US Energy Efficiency Funding 1990-2013 3 $- $2,000,000 $4,000,000 $6,000,000 $8,000,000 $10,000,000 $12,000,000 $14,000,000 $16,000,000 1990 1991 1992 1993 1994 1995 1996 1997 1998


No Slide Title | Department of Energy  

Energy Savers [EERE]

No Slide Title No Slide Title No Slide Title More Documents & Publications Slide 1 Earned Value Management System (EVMS) and Project Analysis Standard Operating Procedure (EPASOP)-...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slides and Videos  

E-Print Network [OSTI]

Stochastic Analysis and Mathematical Physics conference in honor of Pr. Gross, Cornell University, April 11-13 (2010), Slides; Modelling of anticipations on a...


Slide 1 | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Slide 1 Slide 1 Slide 1 More Documents & Publications Microsoft Word - Agenda F&I Update 090804.doc Agenda Microsoft Word - Issue FY2009 Q4 Draft 20090910.doc...


No Slide Title  

Broader source: Energy.gov (indexed) [DOE]

George Beveridge George Beveridge Director, Europe BNFL Environmental Services 27 June 2003 Slide 4 File Ref: WAGR Decommissioning Programme 2000 2001 2002 2003 2004 2005 2006 Operational Waste Hot Box Loop Tubes Neutron Shield Graphite Core Thermal Shield Lower Structures PV&I TC & OVM Campaign Contract End date early 2005 Slide 5 File Ref: Recent Successes  Preliminary Operations completed to programme  Operational Waste completed to programme  Hot Box 5 months late  Loop Tubes completed 20 days early  Neutron Shield completed 2 mths early  Graphite Core completed 8 mths early  Thermal Shield completed 30 days early Slide 6 File Ref:  What's next? Slide 7 File Ref: WAGR Decommissioning Campaign 7a Lower Structures Dismantling Slide 9 File Ref: Lower Structures Layout


Slide 1 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

1 Slide 1 Slide 1 More Documents & Publications The Kansas City Plant "Cybersecurity for State Regulators" - NARUC Primer (June 2012) NIF Experiments Presentation by Omar Hurricane...


Solar Webinar Presentation Slides | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Solar Webinar Presentation Slides Solar Webinar Presentation Slides Download presentation slides from the DOE Office of Indian Energy Webinar on solar renewable energy. DOE Office...


Biomass Webinar Presentation Slides | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Presentation Slides Biomass Webinar Presentation Slides Download presentation slides for the DOE Office of Indian Energy webinar on biomass renewable energy. DOE Office of Indian...


Remedial Measures for Correcting Slides  

Science Journals Connector (OSTI)

The scope of field investigations should include topography, geology, water, weather, and history of slope changes. If a slide has occurred, the shape of sliding surface should also be determined.

Yang H. Huang



On transient sliding motion  

Science Journals Connector (OSTI)

......1960. Ark. Fysik., 18, 159. Broberg...propagation 3.1 LINEAR THEORY O F IDEALIZED D R...sliding, i.e. the basic assumptions are violated...The linearized theory becomes invalid when...incorporated in the theory by ascribing each...1960.Ark. Fysik., 18,159. Broberg......

K. B. Broberg



Slide system for machine tools  

DOE Patents [OSTI]

The present invention relates to a machine tool which permits the machining of nonaxisymmetric surfaces on a workpiece while rotating the workpiece about a central axis of rotation. The machine tool comprises a conventional two-slide system (X-Y) with one of these slides being provided with a relatively short travel high-speed auxiliary slide which carries the material-removing tool. The auxiliary slide is synchronized with the spindle speed and the position of the other two slides and provides a high-speed reciprocating motion required for the displacement of the cutting tool for generating a nonaxisymmetric surface at a selected location on the workpiece.

Douglass, S.S.; Green, W.L.



Slide system for machine tools  

DOE Patents [OSTI]

The present invention relates to a machine tool which permits the machining of nonaxisymmetric surfaces on a workpiece while rotating the workpiece about a central axis of rotation. The machine tool comprises a conventional two-slide system (X-Y) with one of these slides being provided with a relatively short travel high-speed auxiliary slide which carries the material-removing tool. The auxiliary slide is synchronized with the spindle speed and the position of the other two slides and provides a high-speed reciprocating motion required for the displacement of the cutting tool for generating a nonaxisymmetric surface at a selected location on the workpiece.

Douglass, Spivey S. (Oak Ridge, TN); Green, Walter L. (Knoxville, TN)



Headlines Previous Editions  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Previous Previous Editions: Volume 14 Volume 13 OCT 2013 SEP 2013 AUG 2013 JUL 2013 JUN 2013 MAY 2013 APR 2013 MAR 2013 FEB 2013 JAN 2013 DEC 2012 NOV 2012 OCT 2012 SEP 2012 AUG 2012 JUL 2012 Volume 12 Volume 11 Volume 10 Volume 9 Volume 8 Volume 7 JUN 2012 MAY 2012 APR 2012 MAR 2012 FEB 2012 JAN 2012 DEC 2011 NOV 2011 OCT 2011 SEP 2011 AUG 2011 JUL 2011 JUN 2011 MAY 2011 APR 2011 MAR 2011 FEB 2011 JAN 2011 DEC 2010 NOV 2010 OCT 2010 SEP 2010 AUG 2010 JUL 2010 JUN 2010 MAY 2010 APR 2010 MAR 2010 FEB 2010 JAN 2010 DEC 2009 NOV 2009 OCT 2009 SEP 2009 AUG 2009 JUL 2009 JUN 2009 MAY 2009 APR 2009 MAR 2009 FEB 2009 JAN 2009 DEC 2008 NOV 2008 OCT 2008 SEP 2008 AUG 2008 JUL 2008 JUN 2008 MAY 2008 APR 2008 MAR 2008 FEB 2008 JAN 2008 DEC 2007 NOV 2007 OCT 2007 SEP 2007 AUG 2007


USS Previous Speakers  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2011 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 Speaker Host Schedule Previous User Science Seminar Speakers Date Speaker Affiliation CAT/ Beamline Title 3/8/13 3/1/13 3/1/13 2/22/13 Xianghui Xiao ANL-XSD-IMG 2-BM X-ray fast tomography and its applications in dynamical phenomena studies in geoscience at the APS 2/22/13 Patrick Clancy Univeristy of Toronto 6-ID & 30-ID Magnetic Order and Excitations in Rh-doped Sr2IrO4 Probed with Resonant X-ray Scattering Jan-2013 Canceled - Beam Shutdown 2012 Dec./11 Lab Shutdown 12/14/12 Chad Folkman ANL-MSD In-operando catalysis and X-ray diffraction from complex epitaxial oxide thin films 12/14/12 Ben Ocko Brookhaven National Lab Grazing-incidence transmission small-angle x-ray scattering (GTXSAXS)


Previous Year Awards  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Awards Awards Previous Year Awards 2013 Allocation Awards This page lists the allocation awards for NERSC for the 2013 allocation year (Jan 8, 2013 through Jan 13, 2014). Read More » NERSC Initiative for Scientific Exploration (NISE) 2013 Awards NISE is a mechanism used for allocating the NERSC reserve (10% of the total allocation). In 2013 we made the second year of the two-year awards made in 2012, supplemented by projects selected by the NERSC director. Read More » Data Intensive Computing Pilot Program 2012/2013 Awards NERSC's new data-intensive science pilot program is aimed at helping scientists capture, analyze and store the increasing stream of scientific data coming out of experiments, simulations and instruments. Read More » 2012 Allocation Awards This page lists the allocation awards for NERSC for the 2012 allocation


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov New Features NEW NEW 2 New Features * "At A Glance" clip art descriptor used in case narratives. - Examples * Slip, Trip and Fall * Computer Workstation Ergonomic * Struck Against * Two new slides that compare organizational injury case profile by month. - Science Divisions - Operations Divisions


Sliding Luttinger liquid phases  

Science Journals Connector (OSTI)

We study systems of coupled spin-gapped and gapless Luttinger liquids. First, we establish the existence of a sliding Luttinger liquid phase for a system of weakly coupled parallel quantum wires, with and without disorder. It is shown that the coupling can stabilize a Luttinger liquid phase in the presence of disorder. We then extend our analysis to a system of crossed Luttinger liquids and establish the stability of a non-Fermi-liquid state: the crossed sliding Luttinger liquid phase. In this phase the system exhibits a finite-temperature, long-wavelength, isotropic electric conductivity that diverges as a power law in temperature T as T?0. This two-dimensional system has many properties of a true isotropic Luttinger liquid, though at zero temperature it becomes anisotropic. An extension of this model to a three-dimensional stack exhibits a much higher in-plane conductivity than the conductivity in a perpendicular direction.

Ranjan Mukhopadhyay; C. L. Kane; T. C. Lubensky



Copyright 2013 Gaia Geothermal, LLC 1Hybrid Design Slide 1.1 -Hybrid Design with the New GLD  

E-Print Network [OSTI]

Copyright © 2013 ­ Gaia Geothermal, LLC 1Hybrid Design ­ Slide 1.1 - Hybrid Design Geothermal, LLC 2Hybrid Design ­ Slide 1.1 - The new hybrid design tool in GLD provides: · Precision peak;Copyright © 2013 ­ Gaia Geothermal, LLC 3Hybrid Design ­ Slide 1.1 - In previous versions of GLD, the hybrid


Insert presenter logo here on slide master.  

E-Print Network [OSTI]

Insert presenter logo here on slide master. See hidden slide 2 for directions Peter Gutmann: Intermediate Insert presenter logo here on slide master. See hidden slide 2 for directions Agenda 2 Lemon Markets/PKI Markets What's the Problem? Consequences Solutions #12;Insert presenter logo here on slide

Gutmann, Peter


Gradient Sliding for Composite Optimization  

E-Print Network [OSTI]

Noname manuscript No. (will be inserted by the editor). Gradient Sliding for Composite Optimization. Guanghui Lan the date of receipt and acceptance should...



Slide 1 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

DEC1387487090415 OECM Working Group April 16 Presentation Without Notes.ppt Slide 1 Microsoft PowerPoint - DEC1387487090408 OECM Working Group April 9 Presentation.ppt...


Slide 1 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

DOE Supplemental Instructions for OMB Section 1512 Reporting - For Grant and Loan Recipients Slide 1 Instructions for Grant and Loan Recipients...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1 | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Tennessee Recovery Act State Memo Slide 1 American Recovery & Reinvestment Act, ARRA, clean energy projects, energy efficiency, smart grid, alternative fuels, geothermal energy...


Slide 1 | Department of Energy  

Energy Savers [EERE]

Texas Recovery Act State Memo Slide 1 American Recovery & Reinvestment Act, ARRA, clean energy projects, energy efficiency, smart grid, alternative fuels, geothermal energy...


No Slide Title  

Broader source: Energy.gov (indexed) [DOE]

1 1 Presented by: Mark Steele: Ex WAGR Project Manager Decommissioning of Windscale Advanced Gas-Cooled Reactor (WAGR) Slide 2 Introduction * UK policy for nuclear power plant decommissioning is long-term safe- storage of reactor facilities * WAGR Project is being used to demonstrate that such a plant can be fully decommissioned * Project funded by the UK Government * Windscale Licensee UKAEA * During early and mid 1990"s facility modified and construction of Reactor Dismantling Machine and Waste Route * 1999 contract let for the dismantling of the reactor to Magnox Electric - fixed price * Scope included engineering and design, safety submission, provision of equipment and operations


Title Slide "Memorability and Invisibility  

E-Print Network [OSTI]

Title Slide 2002- "Memorability and Invisibility: A tale of two alarm clocks and other stories from. Disclaimer #12;v. 1.1, 26/Aug/2002, (slide 1 - 3). © L.Hatton, 2001- O Memorability and invisibility Mobile phone tariffs O Memorability and invisibility for defects: the dark side Overview #12;v. 1.1, 26

Hatton, Les


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of April 2010 Recordable Injury Cases * Computer Systems Engineer - Finger strain - Associated with mouse use at computer workstation. (A case from 2009 that became recordable in April of 2010) 3 Narrative of April 2010 First Aid Cases * Administrative Assistant - Wrist strain - Loading and unloading boxes of conference


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of August 2009 Recordable Injury Cases * Material Specialist - Knee strain while climbing stairs - EE reported to Health Services after twisting left knee while climbing stairs after arriving at work in the morning. * Property Specialist - Laceration to scalp due to fall on staircase


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

August 31, 2011 August 31, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall August 2011 * Administrator - Abrasions and contusions, multiple - The employee lost balance and fell from the second step of a platform ladder while retrieving supplies from a shelf in the supply storage room. 3 Injury/Illness Cases - Material Handling


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of June 2009 Recordable Injury Cases * Senior Research Technician - Upper extremity strain - EE reported right upper extremity pain that relates to computer and repetitive laboratory bench process work. * Senior Administrator - Lower back pain - EE reported to Health Services with lower back


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Musculoskeletal May 2011 * Electrician Apprentice - Strain of right wrist - The employee was tightening a beam clamp with an open end wrench and felt a "pop" in the wrist. * Custodian - Knee strain - The employee noted some pain in the knee while ascending and descending stairs.


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of January 2010 Recordable Injury Cases * Guest Postdoctoral Fellow - Second degree burn of forearm - Employee spilled hot agarose gel on forearm. * Principal Research Technician - Elbow and shoulder strain - Employee had developed discomfort and pain in the upper extremities in July of 2009 in response to


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

December 31, 2011 December 31, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - December 2011 Slip / Trip / Fall * Administrative Assistant - Contusion of knee - The employee slipped on a steep portion of the paved driveway (possibly on the built up painted crosswalk striping) to the N4 parking area. * Subcontracts Administrator - Contusion of hand


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2008 Recordable Injury Case * There was one recordable case in October - An employee was standing on a seismic bracing support while working on scientific apparatus. The employee slipped off the bracing resulting in an ankle strain. - This was a Lost Work Day Case * ISM Deficiency


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of March 2009 Recordable Injury Cases * Employee experienced a sudden acute onset of pain in the wrist and hand while performing routine computer keyboard activities. * Computer ergonomics - strain - Employee was treated for upper trunk and extremity pain related to a combination of workstation changes and


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of February 2010 Recordable Injury Cases * Custodian - Lower back strain - Employee developed pain while lifting refuse bags. * Carpenter - Shoulder strain - Employee felt pain sensation while hoisting a bucket of tools (using a rope) to the roof top work location. [December case reported in Feb.]


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of September 2009 Recordable Injury Cases * Research Associate - Repetitive strain of hands - EE experienced discomfort and pain from a combination of laboratory (pipetting) manipulations and keyboard and mouse use. * Physicist - Laceration forearm - EE slipped while descending stairway in B50B and


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

10 10 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2010 Injury/Illness Cases * Guest Student Assistant - Finger contusion - While plumbing additional signal cables in a NIM bin rack the left middle finger struck the blade of one of the cooling fans. * Materials Project Scientist/Engineer - Allergic response - Employee experienced a sudden onset of allergy


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of December 2008 Recordable Injury Case * No injuries incurred during December were classified as recordable during the month of December, however: - A keyboard / mouse repetitive strain case reported in November 08 became recordable in December - The case was initially reported as


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of June 2010 Recordable Injury Cases * Custodian - Shoulder strain - Use of a wet vacuum with worn rollers caused strain of shoulder region. * Custodian - Contusion of thumb - Due to construction site activity, the walkway was constricted and obstructed. Movement of the refuse barrel on the walkway became awkward and


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 0 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of May 2010 Recordable Injury Cases * Custodian - Knee strain - While walking on level ground outside B64, the employee heard a 'pop' and felt a sharp knee pain. * Truck Driver - Inhalation of solvents - While delivering packages and picking up material in B90, the employee became overcome by solvent


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2008 Recordable Injury Case * There was one recordable case in October - An employee was standing on a seismic bracing support while working on scientific apparatus. The employee slipped off the bracing resulting in an ankle strain. - This was a Lost Work Day Case * ISM Deficiency

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of October 2009 Recordable Injury Cases * Chemist Post Doc Fellow - Laceration of finger - EE was disconnecting tubing from a condenser. The condenser broke from the forces applied and EE sustained small laceration. * Custodian - Knee strain - EE was pivoting to reach for a waste container and


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

November 30, 2011 November 30, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall November 2011 * Computer Systems Engineer - Chipped tooth and bruised buttocks - While descending stairs from a building at Argonne National Lab, the LBNL employee slipped on the second step down from the top landing. The employee was carrying a server unit


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of January 2011 Injury/Illness Cases * Mechanical Engineering Technician - Minor contusion to hand - While using a hand truck to raise and move a pallet, the employee applied additional force to handle to lift load by pressing on the hand gripping the hand truck handle. * Guest Postdoctoral Fellow - Hand laceration


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

October 31, 2011 October 31, 2011 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall October 2011 * Administrative Specialist - Fractured nose and facial abrasion - The employee slipped and fell against the steps while ascending the wet wooden stairway behind 50F [WWY 089]. * Custodian - Foot strain - The employee slipped and twisted the right foot while


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

09 09 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of December 2009 Recordable Injury Cases * Graduate Student Research Assistant - Repetitive strain of shoulder - EE worked at optical microscope station, lab bench, and computer workstations for extended time periods without assessing ergonomic factors. * Student Assistant - Thumb laceration


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

09 09 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of February 2009 Recordable Injury Cases * Computer ergonomics - right hand and shoulder strain - Developed pain in right shoulder and right hand several weeks after moving work locations. The set-up of the new work station caused EE to twist in odd positions to perform her job. * Slip/Trip/Fall - laceration of forehead


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

January 31, 2012 January 31, 2012 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - January 2012 Ergonomic (keyboard/mouse) * Repetitive strain multiple upper extremities - The Computer Systems Engineer developed acute symptoms of pain and discomfort of the shoulders and upper extremities after using a laptop computer while on travel. Less than


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 9 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of April 2009 Recordable Injury Cases * Technician - Musculoskeletal strain - Employee felt an acute pain in left shoulder while turning steering wheel. * Shop work - strain - EE was treated for aggravation of non- occupational upper arm injury. * Shop work - strain - EE was treated for upper arm discomfort


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

10 10 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of August 2010 Recordable Injury Cases * Student Assistant - Strain/sprain of ankles, bruises - While quickly going down ATM stairs, was holding wallet in hands. Fell from upper step and landed on hands on landing at bottom of steps. * Biologist Research Sci/Eng - Repetitive strain of neck


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Narrative of February 2011 Injury/Illness Cases * Electrical Engineer - Ankle strain - While walking to office after arriving at work in the morning, the employee's knee buckled causing the ankle to roll. * Postdoctoral Fellow - Clean needle puncture of finger - While manipulating a needle attached to a building


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 1 These slides are updated on a monthly basis as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. Every effort is made to present accurate and final data. However, changes may occur in subsequent months as additional information becomes available and as developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 Injury/Illness Cases - Slip / Trip / Fall June 2011 * Administrator - Fractured wrist - The employee fell to the parking lot surface while walking. * Project Manager - Contusion of wrist and hand - The employee tripped while ascending exterior wooden staircase (handrail was not used). * Custodian - Ankle sprain


Strategic Energy Planning Webinar Presentation Slides  

Broader source: Energy.gov [DOE]

Download presentation slides from the DOE Office of Indian Energy webinar on strategic energy planning.


Stanford London 2005 Slide 1 Technology Entrepreneurship  

E-Print Network [OSTI]

Stanford London 2005 Slide 1 Technology Entrepreneurship: A Personal Top 10 List Stanford Club;Stanford London 2005 Slide 2 "Don't Hate Me `Cause I'm a Weenie!" Then... Now... #12;Stanford London 2005 Slide 3 A Stanford University Legacy #12;Stanford London 2005 Slide 4 Stanford and Silicon Valley

Prinz, Friedrich B.


LANSCE Focus  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Focus Nuclear science observations and opportunities at the Los Alamos Neutron Science Center Colleagues, This special Focus issue highlights a set of nuclear physics capabilities...


TEMPORAL MODELING OF SLIDE CHANGE IN PRESENTATION VIDEOS Quanfu Fan (1), Arnon Amir (2), Kobus Barnard (1), Ranjini Swaminathan (1) and Alon Efrat (1)  

E-Print Network [OSTI]

TEMPORAL MODELING OF SLIDE CHANGE IN PRESENTATION VIDEOS Quanfu Fan (1), Arnon Amir (2), Kobus develop a general framework to automatically match elec- tronic slides to the videos of corresponding video libraries. Our approach extends previous work that matches slides based on visual features alone

Barnard, Kobus


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8 8 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 LBNL Recordable Cases FY06 through August 31 FY08 0 1 2 3 4 5 6 7 8 9 Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Number of Cases FY '06 Total = 37 Cases FY '07 Total = 48 Cases FY '08 Total To Date = 45 Cases 3 LBNL DART Cases FY06 through August 31 FY08 0 1 2 3 4 5 Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Number of Cases FY '06 Total = 8 Cases


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

February 29, 2008 February 29, 2008 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 LBNL Recordable Cases FY08 vs FY06 and FY07 through February 29, 2008 0 1 2 3 4 5 6 7 8 9 O c t o b e r N o v e m b e r D e c e m b e r J a n u a r y F e b r u a r y M a r c h A p r i l M a y J u n e J u l y A u g u s t S e p t e m b e r Num ber of Case s FY '06 Total = 37 Cases FY '07 Total = 47 Cases FY ' 08 Total To Date = 16 Cases 3 LBNL DART Cases FY08 vs FY06 and FY07


No Slide Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 7 These slides are updated on a monthly basis, as soon as data are reasonably final for the preceding month. Hours worked are estimated monthly and updated with final and actual values quarterly. While every effort is made to present accurate and final data, data may change in subsequent months, as additional information becomes available and as later developments change the recordability of some cases. Refer questions about these charts to rwfisher@lbl.gov 2 LBNL Recordable Cases FY '08 vs FY '06 and FY '07 through October 31, 2007 0 1 2 3 4 5 6 7 8 9 O c t o b e r N o v e m b e r D e c e m b e r J a n u a r y F e b r u a r y M a r c h A p r i l M a y J u n e J u l y A u g u s t S e p t e m b e r Num ber of Case s FY '06 Total = 37 Cases FY '07 Total = 47 Cases FY '08 Total To Date = 8 Cases 3 LBNL Injury Cases By Division for FY'06, FY'07, and FY'O8


Online Tutorial A. Introduction 4 slides (page 3)  

E-Print Network [OSTI]

Online Tutorial 1 #12;A. Introduction ­ 4 slides (page 3) B. eGrades Timeline ­ 5 slides (page 8) C. Accessing eGrades ­ 5 slides (page 14) D. Authorized Graders ­ 22 slides (page 20) E. Submitting Grades ­ 42 slides (page 43) F. Grade changes ­ 19 slides (page 86) G. Importing Grades ­ 29 slides (page 106) H

Tsien, Roger Y.


Geothermal Webinar Presentation Slides and Text Version | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Geothermal Webinar Presentation Slides and Text Version Geothermal Webinar Presentation Slides and Text Version Download presentation slides and a text version of the audio from...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


No Slide Title  

Broader source: Energy.gov (indexed) [DOE]

999 Federal Advisory Committee 999 Federal Advisory Committee September 9-12, 2008 Guide DeHoratiis Acting Deputy Assistant Secretary Office of Oil and Natural Gas Designated Federal Officer Ultra-Deepwater and Unconventional Natural Gas and Other Petroleum Resources Committee Instructions * Role: Provide advice to DOE - Provide recommendations on the development and priorities of the research program - Look at objectives of the annual plan within the context of the overall plan - Focus on Consortium-administered portion of the Plan, and also comment on NETL research and potential for duplication between NETL and Consortium portions * Guidance - Focus on big picture. Don't rewrite plan but advise on strengths and weaknesses. - Consensus is good, but should not be forced. - Majority opinion with minority viewpoint is fine.



E-Print Network [OSTI]

GELATIN SUBBED SLIDES (SOP-21) GELATIN SOLUTION · Warm 1000 ml dH2O to 70° C (Do not heat water. Solution may be stored in the refrigerator for up to l week. CLEANING SLIDES · Fill a staining dish with 1:1 mixture of 95 % (v/v) ethanol and glacial acetic acid. · Soak slides placed in large metal slide rack

Kleinfeld, David


Slide 1 Lecture 19 Amitabh Varshney  

E-Print Network [OSTI]

·1 Slide 1 Lecture 19 Copyright Amitabh Varshney Radiosity · Local Lighting (OpenGL). ­ Captures or refractive direction. · What is missing? ­ Light striking diffuse material from non-sources. Slide 2 Lecture 19 Copyright Amitabh Varshney Does this matter? Is it black here? #12;·2 Slide 3 Lecture 19

Jacobs, David


Visual Perception Slide 2 Aditi Majumder, UCI  

E-Print Network [OSTI]

1 PERCEIVING MOVEMENT Visual Perception Slide 2 Aditi Majumder, UCI Ways to create movement Perception More than one ways to create the sense of movement Real movement is only one of them #12;2 Slide 3, follow conversations Slide 4 Aditi Majumder, UCI Real Movement Movement is not the only criteria

Majumder, Aditi



E-Print Network [OSTI]

Slide #1CENTER FOR INTEGRATED ACCESS NETWORKS Photonics Communication Engineering Khanh Kieu, Ph.D. College of Optical Sciences, University of Arizona #12;Slide #2CENTER FOR INTEGRATED ACCESS NETWORKS is around 340m/s. #12;Slide #3CENTER FOR INTEGRATED ACCESS NETWORKS Homework Problem 2: Calculate

Kieu, Khanh



E-Print Network [OSTI]

Slide #1CENTER FOR INTEGRATED ACCESS NETWORKS Photonics Communication Engineering Khanh Kieu, Ph.D. College of Optical Sciences, University of Arizona #12;Slide #2CENTER FOR INTEGRATED ACCESS NETWORKS multiplexing · Network topology #12;Slide #3CENTER FOR INTEGRATED ACCESS NETWORKS Communication Source

Kieu, Khanh



E-Print Network [OSTI]

Slide #1CENTER FOR INTEGRATED ACCESS NETWORKS Photonics Communication Engineering Khanh Kieu, Ph.D. College of Optical Sciences, University of Arizona #12;Slide #2CENTER FOR INTEGRATED ACCESS NETWORKS Significant progress #12;Slide #3CENTER FOR INTEGRATED ACCESS NETWORKS What else can we multiplex

Kieu, Khanh


Slide 1 Lecture 13 Amitabh Varshney  

E-Print Network [OSTI]

·1 Slide 1 Lecture 13 Copyright Amitabh Varshney Sampling and Aliasing · Sects. 4.17-18 in H from sampling and consequent loss of information · Anti-aliasing: Attempts to overcome aliasing Slide 2 Centres Sampled Signal Luminosity Signal Rendered Image Images from SIGGRAPH 93 Educators' Slide Set #12

Jacobs, David


Title Slide "Building on success  

E-Print Network [OSTI]

in seismic data processing software as used in oil and gas exploration. Problems with defect longevity #12;v is subjected to 14 processes in a pipeline, (the input of process N+1 Is the output of process N, 1 ). Process 1 reads the input tape. Defect longevity in large systems #12;v. 1.1, 30/Mar/2003, (slide 1 - 7

Hatton, Les


slides compiled from Alex Aiken's,  

E-Print Network [OSTI]

Testing slides compiled from Alex Aiken's, Neelam Gupta's, Tao Xie's. #12;CS590F Software Reliability Why Testing Researchers investigate many approaches to improving software quality But the world tests > 50% of the cost of software development is testing Testing is consistently a hot research topic

Zhang, Xiangyu


Deterministic Time Classes Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. p.1  

E-Print Network [OSTI]

Lecture 11 Deterministic Time Classes Slides modified by Benny Chor, based on original slides on Model Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. ­ p Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. ­ p.1 #12

Beimel, Amos



Science Journals Connector (OSTI)

NEWS FOCUS ... The turbines run on liquid fuel or natural gas. ... Tests now under way will prove out the engine as a pump and compressor drive for industry and as a power source for marine craft including an experimental hydrofoil ...



Phylum Arthropods Study Material: Demodex folliculorum. 2 slides: section in situ, whole mount.  

E-Print Network [OSTI]

Phylum Arthropods Study Material: Demodex folliculorum. 2 slides: section in situ, whole mount. Sarcoptes scabei. 1 slide, wholemount. Dermanyssus gallinae. 1 slide, wholenount. Argas persicus. 1 slide, wholemount. Dermacentor andersoni. 1 slide, wholemount. Amblyomma americana. 1 slide, wholemount

Schluter, Dolph


Research Focus  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Focus Focus Work at FEERC is centered on three interrelated areas of research: fuels, engines, and emis- sions. FEERC scientists study the impacts of fuel properties on advanced combustion processes as well as on emissions and emission control strategies and devices. The range of fuels studied includes gaseous (natural gas) and liquid fuels from conventional and unconventional fossil- based sources, as well as non-petroleum fuels from synthetic and renewable sources. The FEERC conducts research on innovative internal combustion engine technologies and control systems for improved efficiency. Combining novel diagnostic and experimental methods with modeling, the Center's scientists also develop improved understanding of the functions and key mechanisms of emission control devices


Slide 1 Fig 7-1, p.154 Planet Earth  

E-Print Network [OSTI]

Slide 1 Fig 7-1, p.154 Planet Earth #12;Slide 2 The New Solar System ch9 #12;Slide 3 Fig 7-2, p.155 Interior Structure of the Earth #12;Slide 4 Fig 7-4, p.156 Earth!s Magnetosphere #12;Slide 5 The New Solar System ch9 #12;Slide 6 Fig 7-3, p.155 Earth!s Crust #12;Slide 7 Fig 7-6, p.157 Earth!s Continental Plates

Wardle, Mark



Science Journals Connector (OSTI)

NEWS FOCUS ... The unit drives a 15,000 hp. ... gas compressor at Texas Eastern's Egypt, Miss., compressor station, one of 20 stations operating on the company's 30-inch natural gas lines, which run from Texas to storage fields in Pennsylvania ...



Slide 1 Hchstleistungsrechenzentrum Stuttgart First Experiences with  

E-Print Network [OSTI]

Uwe Küster Slide 1 Höchstleistungsrechenzentrum Stuttgart First Experiences with Itanium 1-Performance Computing Center Stuttgart (HLRS) www.hlrs.de Bull, Les Clayes au Bois 5.12.2002 #12;Uwe Küster Slide 2 processors each ­ 4 MB L3 cache ­ 32 GB memory ­ efc version 7.0 · some other machines #12;Uwe Küster Slide 3

Fiebig, Peter


Hydroelectric Webinar Presentation Slides and Text Version  

Broader source: Energy.gov [DOE]

Download presentation slides and a text version of the audio from the DOE Office of Indian Energy webinar onhydroelectric renewable energy.



E-Print Network [OSTI]

Nov 12, 2014 ... HilleYosida. Infinitesimal Generator ... infinitesimal generator, and that. E .... is a bounded linear function on C0(X), and thus there is a.

Daniel J. Kelleher




E-Print Network [OSTI]

Jun 21, 2012 ... the least likely places for a quantum particle in the energy state ?2 j to be. ... How do nodal hypersurfaces wind around on M.? We put the...

Steve Zelditch Northwestern Joint work in part with J. A. Toth, C. Sogge


Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network [OSTI]

The resulting theory involves PDEs, Functional Analysis, Inf. Dim. Dyn. Systems; Diff ..... density-dependent diffusivity c(u) = mu ..... my book Smoothing. Juan L.




E-Print Network [OSTI]

model of the brain utilizing the structures of modern differential geometry and topology. To some, this may seem a bit much. William. C. Hoffman, The primary...





E-Print Network [OSTI]

Aug 23, 2011 ... Suppose you have a particle on R d subject to the potential V (x) = 1. 8 ...... MR. 2426712 (2009e:58012). [3] Bruce K. Driver and Maria Gordina,...




E-Print Network [OSTI]

We begin with a sequence (word) (Xk )1?k?n taken from an ordered alphabet ..... j=1 ??(j). ? Let dr be the multiplicity of ??(r). ? Let mr = {. 0, if ??(r) = ??(1),.

Trevis L. Litherland Christian Houdr




E-Print Network [OSTI]

May 28, 2009 ... Aronszajn 1954 and K. T. Smith 1961 for sums of squares L(x) = ?pj(x)2,. i. e. formally positive forms ?|pj(x)|2, in Lipschitz domains.

G. C. Verchota Syracuse University




E-Print Network [OSTI]

Pendry, Schurig and Smith, Science 312, 1780 (2006) spatial transformations;! Leonhardt and Philbin, NJP 8, 247 (2006)]space-time & negative refraction]!

Ulf Leonhardt




E-Print Network [OSTI]

Jun 18, 2012 ... formula by Radon (1917). ? basis for ... Define f (x, v) = fi1im (x)vi1 vim . .... This equation has gauge group via multiplication by functions.




E-Print Network [OSTI]

6-1, page 106: cell membrane, with ion channels. 14-14, page 272: axon terminal, with synaptic vesicles. 1-3, page 9: structure of brain. 1-2, page 8: parts of...



E-Print Network [OSTI]

Academic Press, Second Edition, 2003. 3/2/2004. 3. Pituitary Gland and Hypothalamus. Anatomy of the brain, showing pituitary gland and hypothalamus. From:.



E-Print Network [OSTI]

Curvature bounds and heat kernels methods in subriemannian geometry. Fabrice Baudoin. Based on joint works with N. Garofalo, M. Bonnefont, B. Kim,.

Fabrice Baudoin




E-Print Network [OSTI]

3/4/2004. 1. The Pituitary Gonadotropes, II. 3/4/2004. 2. Articles on Ca2+ signaling in P.G.. [1] A. Tse, F.W. Tse, W. Almers, and B. Hille, Rhythmic. exocytosis...



E-Print Network [OSTI]

Jun 21, 2012 ... High-frequency imaging of a moving object. Clifford Nolan. University of Limerick. Conference in honour of Gunther Uhlmann's 60th Birthday.




E-Print Network [OSTI]

Intoduction. Uniqueness. Reconstruction. Literature. Nonlinear Integral Equations for the Inverse. Problem in Corrosion Detection from Partial. Cauchy Data.




E-Print Network [OSTI]

A mathematical model and inversion procedure for. Magneto-Acousto-Electric Tomography. (MAET). Leonid Kunyansky. University of Arizona, Tucson, AZ.




E-Print Network [OSTI]

Generalized curvature dimension inequalities for subelliptic operators. Fabrice Baudoin. Purdue University. 5th Conference in Stochastic Analysis and its...

Fabrice Baudoin




E-Print Network [OSTI]

and Spectroscopy. David Isaacson. Jonathan Newell. Gary Saulnier. RPI. Page 49. With help from. D.G.Gisser, M.Cheney. J.Mueller,S.Siltanen and. Page 50...





E-Print Network [OSTI]

Kazakhstan. Joint work with Nurlan Dairbekov ... X-ray transform. I recall that the Radon transform makes from a function on R2 a function on straight lines:.

Yernat M. Assylbekov




E-Print Network [OSTI]

and School of Biomedical Engineering. Colorado State ... Figure courtesy of M. Amato from Real-time detection of pneumothorax using electrical impedance.

Jennifer Mueller




E-Print Network [OSTI]

Such methods include Op- tical, Electrical Impedance Tomography, and Elastography. .... Exponentially increasing Bio-Engineering literature. Guillaume Bal.




E-Print Network [OSTI]

Resistance forms. For any set X, a pair (E,F) is called a resistance form on X ... Typically, one considers resistance forms the way we considered the Sierpinski...

Daniel J. Kelleher


Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network [OSTI]

Oct 2, 2012 ... Sketch of the proof. Consider the function ?(s) = Ps?(Pt?sf ), by easy calculation, we have that ? (s) = 2Ps?2(Pt?sf ), ..... Page 59...

Jing Wang Based on joint works with Fabrice Baudoin




E-Print Network [OSTI]

kF vet &R[X1;:::;Xk] e finite set of polynomils with deg P. dD P P D nd card = sF hefinition e sign condition on is n element of fH; I;Ig ...... Page 59

Saugata Basu




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

www.datacenterdynamics.com www.datacenterdynamics.com FOCUS COOLING Issue 28, March/April 2013 LBNL'S NOVEL APPROACH TO COOLING Lawrence Berkeley National Laboratory and APC by Schneider Electric test a unique double-exchanger cooling system LBNL program manager Henry Coles says can cut energy use by half A s part of a demonstration sponsored by the California Energy Commission in support of the Silicon Valley Leadership Group's data center summit, Lawrence Berkeley National Laboratory (LBNL) collaborated with APC by Schneider Electric to demonstrate a novel prototype data center cooling device. The device was installed at an LBNL data center in Berkeley, California. It included two air-to-water heat exchangers. Unlike common single-heat-exchanger configurations, one of these was supplied with


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Slide19 Current and Future Information Landscape - Challenges and Solutions Continued Solutions Balance strategic partnerships and strategic individualism So, for every challenge, we need a solution, and these thoughts for solutions apply not just to ETDE but to any similar source of information. These first several thoughts relate to maintaining an identity amidst the clutter and competition of other information sources. And one of these particular thoughts is to balance strategic partnerships against strategic individualism. In the ETDE case, for example, which has an international focus, we could benefit from partnerships with organizations having a regional focus. Here, I would suggest that we could benefit by working with the European Union on a gateway to European Energy


Sliding friction in electrodeposited nanocrystalline Ni Alloys : transitional behavior associated with grain size, sliding speed, and contact stress.  

SciTech Connect (OSTI)

Metallic materials in sliding contact typically undergo dislocation-mediated plasticity, which results in stick-slip frictional behavior associated with high coefficients of friction ({mu} > 0.8). Our recent work on two electroplated nanocrystalline Ni alloys reveal that under combined conditions of low stress and low sliding velocity, these metals have very low friction ({mu} < 0.3). The observed frictional behavior is consistent with the transition from dislocation-mediated plasticity to an alternative mechanism such as grain boundary sliding. Focused ion beam cross-sections viewed in the TEM reveal the formation of a subsurface tribological bilayer at the contact surface, where the parent nanocrystalline material has evolved in structure to accommodate the frictional contact. Grain growth at a critical distance below the contact surface appears to promote a shear-accomodation layer. We will discuss these results in the context of a grain-size dependent transition from conventional microcrystalline wear behavior to this unusual wear behavior in nanocrystalline FCC metals.

Prasad, Somuri V.; Battaile, Corbett Chandler; Boyce, Brad Lee; Kotula, Paul Gabriel; Padilla, Henry A.



updated slides: http://sideinfo.wikkii.com Rich Prior Knowledge  

E-Print Network [OSTI]

updated slides: http://sideinfo.wikkii.com Rich Prior Knowledge in Learning for NLP Gregory Druck, Kuzman Ganchev, João Graça updated slides: http://sideinfo.wikkii.com 1 1 #12;updated slides: http://sideinfo.wikkii.com Goal: Build a Statistical NLP System · ` 2 2 #12;updated slides: http://sideinfo.wikkii.com Goal: Build

Taskar, Ben



E-Print Network [OSTI]

: ..'; I ~ ··,~ ' . LSPE SAFE/ ARM SLIDE NO. ATM-1088 REV. NO. PAGE OF- DATE 28 March 197 FAILURE/ ARM SLIDE FAILURE EVALUATION REPORT TABLE OF CONTENTS PURPOSE BACKGROUND DESCRIPTION OF FAILURE with Slides Having PAGI i DATE 0, Page 1 1 3 3 3 12 15 16 Larger Fillet Radius 16 6. 2 Slide Tests With 10

Rathbun, Julie A.


Canonical Ridge Analysis with Ridge Parameter Optimization Description of slides  

E-Print Network [OSTI]

Canonical Ridge Analysis with Ridge Parameter Optimization Description of slides Finn š Arup Nielsen May 25, 1998 1 First slide: The formula and an example The first slide shows a simplification is yellow/red for positive and blue for negative. Black is zero. 2 Second slide: Pros and cons The second

Nielsen, Finn ?rup


Better Plants Look Ahead Webinar: Presentation Slides  

Broader source: Energy.gov [DOE]

The presentation slides from a webinar hosted by Better Plants on Jan. 22, 2015. The webinar covered accomplishments to date and detailed new initiatives to save partners energy and water.


Reduction Involving Controlled Execution Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. p.1  

E-Print Network [OSTI]

Lecture 10 Reduction Involving Controlled Execution Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. ­ p.1 #12;Lecture 10 Reduction Involving Controlled Execution Rice Theorem Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown

Beimel, Amos


How to Prepare a PowerPoint Slide for Large-format Poster Printing 1. To create a poster slide, create a new slide (with nothing on it), then go to File/Page Setup.  

E-Print Network [OSTI]

How to Prepare a PowerPoint Slide for Large-format Poster Printing 1. To create a poster slide, create a new slide (with nothing on it), then go to File/Page Setup. Select "Slide sized for: Custom from other slides, or from other applications. DO NOT import or link data to this poster slide from

Stuart, Josh


A Greener Focus: 2012 Ford Focus Electric  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Greener Focus: 2012 Ford Focus Electric Greener Focus: 2012 Ford Focus Electric JOHN DAVIS: With its 2012 re-design, the Focus compact has become Ford's core global program. Focus is already generating offspring, including small vans, a high performance hatchback, and this car - the Ford Focus Electric. It's actually one of only several new plug-ins and hybrids due from the blue oval this year. So let's go for a drive in the EV Focus and see if this green approach means greener pastures for Ford. At first glance, the 2012 Ford Focus Electric doesn't look that much different than the compact, front-


Carnegie Mellon University 1 Previous Catalogs  

E-Print Network [OSTI]

Carnegie Mellon University 1 Previous Catalogs · 2013-2014 Catalog (Web, PDF) · 2012-2013 Catalog (Web (http://coursecatalog.web.cmu.edu/ previous/2012-2013), PDF (http://coursecatalog.web.cmu.edu/ previous/1213_catalog.pdf)) · 2011-2012 Catalog (Web (http://coursecatalog.web.cmu.edu/ previous/2011


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 Slide20 Distributed Search This search example demonstrates the power of our distributed search feature. As the title suggests, it gives the user a "one-stop" searching capability, where you can search all of ETDEWEB as well as up to six additional sources, which represent over 50 million pages of R&D output. For the most part, these are energy-focused sources, such as the Danish Energy R&D projects, IEA's information center, and the French Petroleum Institute. Some are very broad and include multiple scientific disciplines, such as CORDIS (the EU's R&D database), Science.gov, and Science Conferences. The default option is to search all of these sources, but you can also uncheck certain boxes if you don't want to search a particular


Slide26 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide26 Slide26 Slide26 Science.gov Version 5.0 * Quadrupled the content - now searches 200 million pages of science information * Offers clustering technology, Wikipedia results and EurekAlert! Science News * Updated Alerts feature The new version, Science.gov 5.0 was released September 15. It includes seven additional databases: Hazardous Substances Databank Cancer.gov PubMed Central TOXLINE DOepatents DOE R&D Accomplishments Database E-print Network Other new features include: Clustering: on the left side of the screen you can see clustering of results by subtopics or dates to help you target your search. Wikipedia: In most cases, your search terms will also bring up an article from Wikipedia can help users better understand what the are searching for. Eureka Alert: EurekAlert! features news and resources focused on all areas


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 Legacy Document Types Technical Reports 4272 Conference Papers 2354 Book/Monograph 90 Conference Proceedings 73 Journal Articles 28 Miscellaneous/Other 24 Thesis/Dissertation 7 Patent/Patent Application 4 TOTAL 6852 In addition to "where" the documents come from, this provides an idea of the types of documents represented in the Legacy collection. The greatest focus has been on Technical Reports. For some of the larger proceedings documents, we've scanned in the individual papers to improve document searching and download time for items of interest. You'll also see the relationships...that is, links...from one paper to another for the respective proceedings. The links are shown in the individual record citations. We'll be interested to hear if you find


Synthetic Biology Slides by Daisuke KigaSlides by Daisuke Kiga  

E-Print Network [OSTI]

#12; DNA RNA #12;Synthetic Biology Slides by Daisuke KigaSlides by Daisuke Kiga #12;Two #12; DNA RNA DNA DNA #12; DNA RNA DNA DNA #12; DNA RNA DNA DNA translation DNAamino acid translation signal transduction rhythm RNA protein nucleotide Synthetic Biology #12

Hagiya, Masami


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 OSTI Works In Partnership with DOE Laboratories to Fulfill STI-related Requirements Under the Laboratories' Contract * DOE's STI Program Managed by OSTI - Provides accountability and historical record by creating a central, authoritative collection of DOE STI for long-term use and access - Fulfills statutory mandates - Enhances transparency of DOE research - Saves research dollars by reducing duplication and enabling reuse of previous research * OSTI Responsibility Has Been Established In: - Atomic Energy Acts of 1946 and 1954 - Energy Reorganization Act of 1974 - Department of Energy Act of 1977 - Energy Policy Act of 2005 - America COMPETES Act of 2007 ...OSTI does this while also providing a host of products to assist librarians and researchers


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 Slide18 New Age of Digital Delivery * Enables more robust products performing in new and different ways * Permits ability to engage customers with heretofore unprecedented levels of interactivity So, this new age of digital delivery let's us have: -- more robust products - that perform in different ways -- the ability for us to engage customers in new and more direct ways I'd like to transition now to talk about how OSTI has responded to change. -- A previous Board of Visitors review suggested that OSTI had a confusing array of too many products and suggested OSTI eliminate/consolidate. -- OSTI then spent some time attempting to eliminate products, but customers who had come to heavily rely on those products protested. -- After a few stops and starts, and knowing that the feedback of the BOV


Strategic Sequential Voting In previous two chapters we have been focusing on designing "good" voting rules  

E-Print Network [OSTI]

to vote to decide whether they should build a swimming pool and/or a tennis court. There are two issue S and T. S can take the value of s (meaning "to build the swimming pool") or ¯s (meaning "not to build the swimming pool"). Similarly, T takes a value in ?t, ¯t?. Suppose the preferences of the three voters are

Chen, Yiling

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Production and Handling Slide 35: UF6 Cylinder Data Summary  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

UF6 Cylinder Data Summary UF6 Cylinder Data Summary Skip Presentation Navigation First Slide Previous Slide Next Slide Last Presentation Table of Contents UF6 Cylinder Data Summary Cylinder Model Nominal Diam. (in.) Material of Construction Minimum Volume Approximate Tare Weight Without Valve Protector Maximum Enrichment Uranium-235 Shipping Limit Maximum, a UF6 ft3 liters lb kg Weight % lb kg 1S 1.5 Nickel 0.0053 0.15 1.75 0.79 100.00 1.0 0.45 2S .5 Nickel 0.026 0.74 4.2 1.91 100.00 4.9 2.22 5A 5 Monel 0.284 8.04 55 25 100.00 55 24.95 5B 5 Nickel 0.284 8.04 55 25 100.00 55 24.95 8A 8 Monel 1.319 37.35 120 54 12.5 255 115.67 12A 12 Nickel 2.38 67.4 185 84 5.0 460 208.7 12B 12 Monel 2.38 67.4 185 84 5.0 460 208.7 308c 30 Steel 26.0 736.0 1,400 635 5.0b 5,020 2,277 48A 48 Steel 108.9 3,.84 4,500 2,041 4.5b 21,030 9,539 48Xd 48 Steel 108.9 3,084 4,500 2,041 4.5b,g 21,030 9,539 48F 48 Steel


FRED Overview Slides | OpenEI Community  

Open Energy Info (EERE)

FRED Overview Slides FRED Overview Slides Home > Groups > FRED Dbrodt's picture Submitted by Dbrodt(72) Contributor 2 July, 2012 - 10:43 Upload Files: application/vnd.openxmlformats-officedocument.presentationml.presentation icon fred_overview_slides_v11.pptx Groups: FRED Login to post comments Comments Amirsaedlou Amirsaedlou1 year 17 weeks ago hi how can i get wind data hi how can i get wind data for specific point with google earth data, do you know a tool to design wind sola hybrid power plants? Login to post comments NickL NickL39 weeks 3 days ago Wind Data Hello- There are various types of wind data available. These can be searched for on OpenEI using the Search tool with keyword wind and filtering the content to only display datasets. Depending on the global region you are


Using a Slide in Beef Cattle Marketing  

E-Print Network [OSTI]

this agreement is $488.36 per head. 6.17 cwt (617 lbs.) x $79.15/cwt = $488.36 L-5063 8-98 Using a Slide in Beef Cattle Marketing Rick Machen and Ronald Gill* *Extension Livestock Specialists, The Texas A&M University System. Down Slide A down slide is exercised.../cwt) to get $3.40/cwt, which is added to the sale price of $90/cwt to obtain the actual price of $93.40 per hundred- weight. 34 lbs. = 0.34 cwt 0.34 cwt x $10/cwt = $3.40/cwt $90/cwt + $3.40/cwt = $93.40/cwt $93.40/cwt x 4.66 cwt (466 lbs.) = $435...

Machen, Richard V.; Gill, Ronald J.



SAFETY SLIDES Electrospraying/Electrospinning equipment in 66-353  

E-Print Network [OSTI]

SAFETY SLIDES Electrospraying/Electrospinning equipment in 66-353 1 #12;Overview of electrospinning apparatus 2 #12;Safety Slides ­ High voltage electrical equipment 3 Maximum voltage ~ 40,000 V Low current

Cohen, Robert E.


File:RAPID Single Slide.pdf | Open Energy Information  

Open Energy Info (EERE)

Single Slide.pdf Jump to: navigation, search File File history File usage Metadata File:RAPID Single Slide.pdf Size of this preview: 776 600 pixels. Go to page 1 2 Go next page...


Previous Sandia National Laboratories | National Nuclear Security  

National Nuclear Security Administration (NNSA)

Previous Sandia National Laboratories | National Nuclear Security Previous Sandia National Laboratories | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Previous Sandia National Laboratories Home > About Us > Our Operations > Acquisition and Project Management > M & O Support Department > Sandia National Laboratories > Previous Sandia


Predicting Debris-Slide Locations in Northwestern California1  

E-Print Network [OSTI]

Predicting Debris-Slide Locations in Northwestern California1 Mark E. Reid,2 Stephen D. Ellen,3 tested four topographic models for predicting locations of debris-slide sources: 1) slope; 2) proximity to stream; 3) SHALSTAB with "standard" parameters; and 4) debris-slide-prone landforms, which delineates

Standiford, Richard B.


Slide 1 of 30 www.chrisbilder.com  

E-Print Network [OSTI]

Slide 1 of 30 www.chrisbilder.com This research is supported in part by NIH grant R01AI067373 Comparisons Application Discussion 1 Slide 2 of 30 www.chrisbilder.com · USC seminar on November 4, 2005 2 Outline Motivation Halving Ordering Comparisons Application Discussion Slide 3 of 30 www

Bilder, Christopher R.


Lateral Geniculate Nucleus Slide 2 Aditi Majumder, UCI  

E-Print Network [OSTI]

1 Lateral Geniculate Nucleus (LGN) Slide 2 Aditi Majumder, UCI What happens beyond the retina? What happens in Lateral Geniculate Nucleus (LGN) Visual cortex Information Flow Superior colliculus #12;2 Slide Retina From Brain stem Thalamus Neurons LGN Neurons LGN Cell From Cortex From Retina To Cortex Slide 4

Majumder, Aditi


Vol. ?, No. ?, Fall ???? 1 The Crichlow Slide Rule  

E-Print Network [OSTI]

Vol. ?, No. ?, Fall ???? 1 The Crichlow Slide Rule Brian Borchers Introduction In 1936, Robert required the solution of many problems involving trigonometry. Crichlow developed a circular slide rule to the rank of Major General before his retirement in 1953. The first version of this slide rule is described

Borchers, Brian


Title/Loc/Date: Slide # 1 Jo EllisMonaghan  

E-Print Network [OSTI]

Title/Loc/Date: Slide # 1 Jo Ellis­Monaghan e­mail: joellis@emba.uvm.edu website: http://academics.smcvt.edu/jellis­monaghan #12; Title/Loc/Date: Slide # 2 29(59,(:# . First some problems (network reliability, scheduling; Title/Loc/Date: Slide # 3 6RPH#3UHOLPLQDULHV# # 'HOHWLRQ

Ellis-Monaghan, Joanna


Conceptual Framework Presentation, 2006, Slide 1 The Conceptual Framework for  

E-Print Network [OSTI]

Conceptual Framework Presentation, 2006, Slide 1 The Conceptual Framework for Programs that Prepare Professionals Who Work in Schools What - Why - and Why You? #12;Conceptual Framework Presentation, 2006, Slide 2 on and develop your philosophy as a professional. . . WHY YOU? #12;Conceptual Framework Presentation, 2006, Slide

de Lijser, Peter


Slide 1 of 37 www.chrisbilder.com  

E-Print Network [OSTI]

Slide 1 of 37 www.chrisbilder.com Outline BSG Basics Estimation Identification Covariates NIH grant of Statistics University of Nebraska-Lincoln www.chrisbilder.com chris@chrisbilder.com Slide 2 of 37 wwwGalacticaGalactica BSG · Statistics and Battlestar Galactica · The story so far... ­ Video Slide 3 of 37 www

Bilder, Christopher R.


For Peter Szolovits slide #1 Secure content distribution  

E-Print Network [OSTI]

For Peter Szolovits slide #1 Secure content distribution using untrusted servers Kevin Fu MIT Labs), Ron Rivest (MIT), Ram Swaminathan (HP Labs) January-April 2005 #12;For Peter Szolovits slide #2 How do we distribute content? January-April 2005 #12;For Peter Szolovits slide #3 We pay services

Fu, Kevin


ABB Group April 16, 2009 | Slide 1  

E-Print Network [OSTI]

discharge overview Left-hand plot: Arc current Right-hand plot: Arc pressure and heating volume pressure -10© ABB Group April 16, 2009 | Slide 1 Physics of arc interruption in circuit breakers Nils P. Basse breaker? A circuit breaker is an automatically-operated electrical switch It is designed to protect

Basse, Nils Plesner


Bruce Jacob SLIDE 1 Sensing, Actuation, Control  

E-Print Network [OSTI]

· On nearly every steam engine made · Sensor: centrifugal pendulum · Actuator: valve · Power: torque on shaft. Bruce Jacob Electrical & Computer Engineering (with enormous thanks to Prof. Bill Levine) OUTLINEP CoM CoM CoP CoP #12;SENSORS & CONTROL ENES 100 Bruce Jacob SLIDE 10 Steam Valve · Plug/spring acts

Jacob, Bruce


Title Slide "The broadband acoustic output of  

E-Print Network [OSTI]

Title Slide "The broadband acoustic output of marine seismic airgun sources" Les Hatton CISM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . #12;Seismic sources ­ marine airguns Introduction Modelling Marine Life Impact Where next Overview #12 Normal speed surface movie of airgun firing Courtesy IO limited #12;Seismic sources ­ marine airguns

Hatton, Les


NTIME and the classes NP. Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. p.1  

E-Print Network [OSTI]

Lecture 12 NTIME and the classes NP. Slides modified by Benny Chor, based on original slides in NP. Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. ­ p.1 #12;Lecture 12 NTIME and the classes NP. Examples of Problems in NP. Verifiability. Slides

Beimel, Amos


Focusing in Linear Accelerators  

DOE R&D Accomplishments [OSTI]

Review of the theory of focusing in linear accelerators with comments on the incompatibility of phase stability and first-order focusing in a simple accelerator.

McMillan, E. M.



Title Slide "The Power of Modern Testing  

E-Print Network [OSTI]

.Hatton, 2001- Software safety defect hits BMW · 20/May/2002. 2000 top of the range BMW cars had to be recalled a balance ­ More egg on our faces ­ An interesting survey ­ Problems with interfaces ­ Problems with defect with interfaces O Problems with defect longevity Optimism v. Pessimism #12;v. 1.2, 10/Sep/2002, (slide 1 - 5). © L

Hatton, Les

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Summary Slides of ALS Science Highlights  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary Slides of ALS Science Highlights Print Summary Slides of ALS Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 280 Learning from Roman Seawater Concrete 5.3.2, 12.2.2, 12.3.2 09.25.2013 Vol. 346 279 New Research on Jamming Behavior... 12.2.2 10.30.2013 Vol. 347 278 The Nuclear Pore Complex as Gatekeeper 8.2.1 08.28.2013 Vol. 345 277 A Semiconductor for Spintronics 7.0.1 08.28.2013 Vol. 345 276 Rate-of-Charge Mapping in Batteries 5.3.2, 11.0.2 07.31.2013 Vol. 344 275 Circulation Reversal in Magnetic Vortices 6.1.2 07.31.2013 Vol. 344 274 Pseudo-Single-Bunch Expands Capabilities -- 09.25.2013 Vol. 346 273 Shedding Light on Nanocrystal Defects 12.2.2 06.26.2013 Vol. 343 272 One Vaccine Leads to Another 5.0.3 05.25.2013 Vol. 342 271 Iron Availability in the Southern Ocean 11.0.2 06.26.2013 Vol. 343


Summary Slides of ALS Science Highlights  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary Slides of ALS Science Highlights Print Summary Slides of ALS Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 280 Learning from Roman Seawater Concrete 5.3.2, 12.2.2, 12.3.2 09.25.2013 Vol. 346 279 New Research on Jamming Behavior... 12.2.2 10.30.2013 Vol. 347 278 The Nuclear Pore Complex as Gatekeeper 8.2.1 08.28.2013 Vol. 345 277 A Semiconductor for Spintronics 7.0.1 08.28.2013 Vol. 345 276 Rate-of-Charge Mapping in Batteries 5.3.2, 11.0.2 07.31.2013 Vol. 344 275 Circulation Reversal in Magnetic Vortices 6.1.2 07.31.2013 Vol. 344 274 Pseudo-Single-Bunch Expands Capabilities -- 09.25.2013 Vol. 346 273 Shedding Light on Nanocrystal Defects 12.2.2 06.26.2013 Vol. 343 272 One Vaccine Leads to Another 5.0.3 05.25.2013 Vol. 342 271 Iron Availability in the Southern Ocean 11.0.2 06.26.2013 Vol. 343


I'T Slide Page I of I  

Broader source: Energy.gov (indexed) [DOE]

I'T Slide Page I of I I'T Slide Page I of I '^° J/ «- -I . .. X -. . ,;.~-:~ ~li~ e r 48 AD:- Alaska Slide 20 of 33 hrp: vw;-\-\ eia doe.ov\pub'oil_pas:natural_gas/presentations'2000"markets reliabilit lcc. 2, 122 782 DOE006-0139 PP1 Slide Page I of 1 _ -_ Slide 21 of 33 ' I http://www.iadoc-gov/pub/oilgas/naturalgas/presentations/2000/marketsreliability)_ele... 2/12/20(783 DOE006-0140 DOE006-0 140 PPT Slide Page I of 1 (g~* * Slide 22 of 33 Slide 22 of 33 hnp://ww.eia.doe.gov/pub/oilgas/natura l gas/presentations/2000/markets_rel iability ele... 2/I2/202784 DOE006-0141 I i slide Page I of I ;x b mmlps g q:-.j^^., Slide 23 of 33 http://www.eia.doe.gov/pub/oil_ gas/natural_gas/prcsentations/2000/markets_rel iability_cile... 2/1 /20 7 8 5 DOE006-0142 rri ao31e Page I of I - . .v 1,, I !9 2'-;-;/' .. -


CKBGroup/Previous Events | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » CKBGroup/Previous Events < CKBGroup Jump to: navigation, search Home | 2013 Workshop | Previous Events | CKB Snapshots | Collaborative Projects | Shared Tools Knowledge Sharing events - November 2012, Washington Two knowledge sharing workshops were held in Washington, D.C. this November, on consecutive days: 12 November - hosted by NREL and REEEP: "Linked Open Data - learn how to make open data work for your organization" For more information, visit the workshop website http://en.openei.org/wiki/Open_Data_Workshop_2012. 13 November - a two-part Workshop hosted by the World Bank: "Discovering


Staining Slides with Sybr Green Aime M. Dudley  

E-Print Network [OSTI]

Staining Slides with Sybr Green Aimée M. Dudley Sybr Green I is a double-stranded DNA dye slides at room temperature over 0.3 M potassium phosphate 30 min. 2. UV cross link on setting 1 large volumes of ddH2O 8. Wash 7 min. in Hexane 9. Scan Slide on Sybr Green protocol (Laser #4, Filter

Dudley, Aimee


Electricity Grid Basics Webinar Presentation Slides and Text Version  

Broader source: Energy.gov [DOE]

Download presentation slides and a text version of the audiofrom the DOE Office of Indian Energy webinar on electricity grid basics.


Presentation: FracFocus  

Broader source: Energy.gov [DOE]

Mike Paque, Gerry Baker, and Stan Belieu reported on the work of FracFocus and the improvements made in FracFocus 2.0 as well as their connection with Risk Based Data Management System (RBDMS) used...


Focus Sensitive Coordination  

E-Print Network [OSTI]

This thesis investigates the role of the Focus Sensitive Operators (FSOs) even and also when found inside of a coordination. Coordinations of this form are called Focus Sensitive Coordinations (FSC) and include or even, ...

Hulsey, Sarah McNearney



A mechanism for enhanced static sliding resistance owing to surface waviness  

Science Journals Connector (OSTI)

...static sliding resistance of a rigid...soft elastic material with axisymmetric...static sliding resistance on the surface of a soft material owing to surface...static sliding resistance of viscoelastic...biological materials, as indicated...



fug@usm.unimuenchen.de Frank Grupp Slide 1 Measuring the properties of fibers  

E-Print Network [OSTI]

fug@usm.unimuenchen.de Frank Grupp Slide 1 Measuring@usm.unimuenchen.de Frank Grupp Slide 2 Outline: The Potsdam fiber testbench ­ Hardware #12;fug@usm.unimuenchen.de Frank Grupp Slide 3 Intention

Grupp, Frank


Sizing sliding gate valves for steam service  

SciTech Connect (OSTI)

Sliding gate valves have been used in thousands of applications during the past 40 yr. While steam control is a common application for these valves, thy are also used to control other gases and liquids. The sliding gate design provides straight-through flow, which minimizes turbulence, vibration, and noise. Seats are self-cleaning and self-lapping to provide a tight, long-lasting shutoff. A correctly sized valve is essential for accurate control. Valve size should be determined by service and system requirements, not by the size of the existing pipeline. Sizing a valve on the basis of pipeline size usually results in an oversized valve and poor control. Generally, regulator size is smaller than pipe size. Whenever complete information is known (inlet pressure, outlet pressure, or pressure drop, and required flow), determine the valve flow coefficient (C{sub v}) using the equations in ANSI/ISA S75.01 or a flow sizing chart. Tables of values for various types of valves are available from manufacturers. However, when complete system requirements are not known, valve oversizing is prevented by determining the design capacity of piping downstream from the valve. The valve should not be sized to pass more flow than the maximum amount the pipe can handle at a reasonable velocity. An example calculation is given.

Bollinger, R. [Jordan Value, Cincinnati, OH (United States)



Time-slide window join over data streams  

Science Journals Connector (OSTI)

The join is an important operator in processing data streams. To produce outputs continuously over unbounded data streams, sliding windows are generally used to limit the scope of the join at a certain time. In the existing join algorithms, only a simple ... Keywords: Data streams, symmetric hash join, time-slide windows, window join, windowing structure

Hyeon Gyu Kim, Yoo Hyun Park, Yang Hyun Cho, Myoung Ho Kim



BCSE Industry Overview slides | OpenEI Community  

Open Energy Info (EERE)

BCSE Industry Overview slides BCSE Industry Overview slides Home > Groups > Renewable Energy Finance Workshop Kalston's picture Submitted by Kalston(5) Member 20 December, 2012 - 13:56 Upload Files: application/vnd.ms-powerpoint icon BCSE Industry Overview slides Groups: Renewable Energy Finance Workshop Login to post comments Latest documents Kalston BCSE Industry Overview slides Posted: 20 Dec 2012 - 13:56 by Kalston Ianjkalin Department of Defense 3 GW Solar Target Posted: 15 Dec 2012 - 16:56 by Ianjkalin 1 of 2 ›› Groups Menu You must login in order to post into this group. Latest document comments No comments have been made yet Recent content BCSE Industry Overview slides Department of Defense 3 GW Solar Target Presentation on Open Data & Finance Value Meeting Agenda Group members (2)


HASQARD Focus Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

failure occurs." for ICPMS analysis and "One per analytical batch" for ICPAES and flame atomic absorption analysis. This was more frequent than the Focus Group members recalled...


HASQARD Focus Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

expectations for incorporating Focus Group interpretations of HASQARD requirements in the document without a new letter from DOE contracting officers (COs) going out to the...


On Hilbert after slide 4 1 echo $SHELL  

E-Print Network [OSTI]

On Hilbert after slide 4 1 echo $SHELL 2 ls ­la /bin/*sh* 3 clear 4 ls 5 cat get 6 ls ­la get after slide 5 1 cat Rb 2 cat rnorm.R 3 ./R 4 ls ­la Rb 5 chmod +x Rb 6 cat Rb 7 man ls 8 ls ­c *.out 9 ls ­lc *.out 10 man head 11 ./Rb rnorm.R 12 clear On Hilbert after slide 7 1 cat res 2 man

Dahl, David B.


Focus Group I  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CARBON SEQUESTRATION - A COMMUNITY FOCUS GROUP STUDY OF CARBON SEQUESTRATION - A COMMUNITY FOCUS GROUP STUDY OF ATTITUDES IN WILLISTON, NORTH DAKOTA Sheila K. Hanson, Energy & Environmental Research Center Daniel J. Daly, Energy & Environmental Research Center Edward N. Steadman, Energy & Environmental Research Center John A. Harju, Energy & Environmental Research Center June 2005 EXECUTIVE SUMMARY In April 2005, representatives of the Plains CO 2 Reduction (PCOR) Partnership, led by the Energy & Environmental Research Center (EERC) at the University of North Dakota, held two focus groups in Williston, North Dakota. A total of sixteen people participated; seven on April 20 and nine on April 21. The purpose of the focus group research was to gain insight into the public perception of carbon sequestration from


Givenness, focus, and prosody  

E-Print Network [OSTI]

In this dissertation, I investigate the grammatical effects of focus and the inseparable phenomenon of givenness. As Schwarzschild (1999) has proposed, a proper understanding of givenness eliminates the need for a separate ...

Bader, Christopher (Christopher Banks), 1954-



HASQARD Focus Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Group to introduce themselves and their role in the Focus Group to Jeff. III. The Action Tracking matrix was discussed. The following updates were provided: a. The process for...


Focusing corner cube  

DOE Patents [OSTI]

This invention retortreflects and focuses a beam of light. The invention comprises a modified corner cube reflector wherein one reflective surface is planar, a second reflective surface is spherical, and the third reflective surface may be planar or convex cylindrical.

Monjes, J.A.


Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Incorporating Multiple cDNA Microarray Slide Scans -Application to Somatic Embryogenesis in Maize  

E-Print Network [OSTI]

Incorporating Multiple cDNA Microarray Slide Scans -Application to Somatic Embryogenesis in Maize 1 the measurements of gene expression. Because `optimal' settings may vary from slide to slide, operators typically scan each slide multiple times and then choose the reading with the fewest over-exposed and under


katherine henderson Pathology Slide Scanning rev1 Page 1 10/21/14 Scanning in Pathology  

E-Print Network [OSTI]

katherine henderson Pathology Slide Scanning rev1 Page 1 10/21/14 Scanning in Pathology Pathology offers several scanning methods: · Whole slide scans to be used as virtual microscopy ­ Aperio Coolscan for 35mm slides or glass slides with adapter (scans tissue area, not cells) The above scanners


A one-mesh method for the cell-centered discretization of slide lines , B. Despresb  

E-Print Network [OSTI]

A one-mesh method for the cell-centered discretization of slide lines G. Claira, , B. Despresb , E is described to handle slide lines in cell-centered Lagrangian schemes for the modeling of sliding problems on the minimization of an objective function over a specific set that models the sliding constraint. We illustrate

Paris-Sud XI, Université de


frank@grupp-astro.de Frank Grupp Slide 1 Pasadena November 8th  

E-Print Network [OSTI]

frank@grupp-astro.de Frank Grupp Slide 1 Pasadena ­ November 8th 2006 How accurately can we;frank@grupp-astro.de Frank Grupp Slide 2 Teff determination: Outline Model atmospheres ­ the backbone@grupp-astro.de Frank Grupp Slide 3 Model atmospheres: Backbone (1) #12;frank@grupp-astro.de Frank Grupp Slide 4 Model

Grupp, Frank


Slide diamond burnishing of tool steels with adhesive coatings and diffusion layers  

E-Print Network [OSTI]

Slide diamond burnishing of tool steels with adhesive coatings and diffusion layers W. Brostow*1 with a scratch tester. A combination of both approaches, slide burnishing with hard chrome coating and/or slide in manufacturing tools and structural elements in automotive and aerospace industries. Keywords: Tool steels, Slide

North Texas, University of


A Vendor-Neutral Library and Viewer for Whole-Slide Images  

E-Print Network [OSTI]

A Vendor-Neutral Library and Viewer for Whole-Slide Images Adam Goode, M. Satyanarayanan June 2008 Although widely touted as a replacement for glass slides and microscopes, whole-slide images used-neutral C library for reading whole-slide image files. The library is high- performance, extensible


On the relationship between grain boundary sliding and intragranular slip during superplastic deformation  

SciTech Connect (OSTI)

This paper examines grain boundary sliding under the conditions of plastic strain incompatibility that is the most frequent case in polycrystalline materials. Two components of grain boundary sliding: dependent and independent on intragranular slip are distinguished. Theoretical estimate of a ratio between slip induced sliding and intragranular slip is obtained. It is concluded that slip and sliding are rather independent than interrelated processes.

Sheikh-Ali, A.D.; Szpunar, J.A.; Garmestani, H.



Plutonium focus area  

SciTech Connect (OSTI)

To ensure research and development programs focus on the most pressing environmental restoration and waste management problems at the U.S. Department of Energy (DOE), the Assistant Secretary for the Office of Environmental Management (EM) established a working group in August 1993 to implement a new approach to research and technology development. As part of this new approach, EM developed a management structure and principles that led to the creation of specific Focus Areas. These organizations were designed to focus the scientific and technical talent throughout DOE and the national scientific community on the major environmental restoration and waste management problems facing DOE. The Focus Area approach provides the framework for intersite cooperation and leveraging of resources on common problems. After the original establishment of five major Focus Areas within the Office of Technology Development (EM-50, now called the Office of Science and Technology), the Nuclear Materials Stabilization Task Group (EM-66) followed the structure already in place in EM-50 and chartered the Plutonium Focus Area (PFA). The following information outlines the scope and mission of the EM, EM-60, and EM-66 organizations as related to the PFA organizational structure.





E-Print Network [OSTI]

Chapter 3 HIGHER ORDER SLIDING MODES L. FRIDMAN and A. LEVANT Chihuahua Institute of Technology, Chihuahua, Mexico. Institute for Industrial Mathematics, Beer-Sheva, Israel. 3.1 Introduction One

Levant, Arie


Sliding-mode amplitude control techniques for harmonic oscillators  

E-Print Network [OSTI]

This thesis investigates both theoretical and implementation-level aspects of switching- feedback control strategies for the development of voltage-controlled oscillators. We use a modified sliding-mode compensation scheme based on various norms...

Marquart, Chad A.



Introduction slide 2 Biofuels and Algae Markets, Systems,  

E-Print Network [OSTI]

Introduction slide 2 Biofuels and Algae Markets, Systems, Players and Commercialization Outlook http://www.emerging-markets.com Consultant, Global Biofuels Business Development Author, Biodiesel 2020: A Global Market Survey (2008) Algae 2020: Biofuels Commercialization Outlook (2009) Columnist, Biofuels


Overview Slides | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Print Text Size: A A A FeedbackShare Page The following table contains links to single-slide overviews produced by the EFRCs. Date Updated Notes 100113 .pdf file (8.3MB) First...


Andy Haas -5/21/2010 Slide 1 LHC DATA!LHC DATA!  

E-Print Network [OSTI]

Andy Haas - 5/21/2010 Slide 1 LHC DATA!LHC DATA! Current status of LHC and ATLASCurrent status 21, 2010May 21, 2010 #12;Andy Haas - 5/21/2010 Slide 2 Overview LHC commissioning progress at 7 Te/21/2010 Slide 3 #12;Andy Haas - 5/21/2010 Slide 4 #12;Andy Haas - 5/21/2010 Slide 5 #12;Andy Haas - 5

California at Santa Cruz, University of


Decontamination & decommissioning focus area  

SciTech Connect (OSTI)

In January 1994, the US Department of Energy Office of Environmental Management (DOE EM) formally introduced its new approach to managing DOE`s environmental research and technology development activities. The goal of the new approach is to conduct research and development in critical areas of interest to DOE, utilizing the best talent in the Department and in the national science community. To facilitate this solutions-oriented approach, the Office of Science and Technology (EM-50, formerly the Office of Technology Development) formed five Focus AReas to stimulate the required basic research, development, and demonstration efforts to seek new, innovative cleanup methods. In February 1995, EM-50 selected the DOE Morgantown Energy Technology Center (METC) to lead implementation of one of these Focus Areas: the Decontamination and Decommissioning (D & D) Focus Area.




Vertical Velocity Focus Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Velocity Focus Group Velocity Focus Group ARM 2008 Science Team Meeting Norfolk, VA March 10-14 Background Vertical velocity measurements have been at the top of the priority list of the cloud modeling community for some time. Doppler measurements from ARM profiling radars operating at 915-MHz, 35-GHz and 94-GHz have been largely unexploited. The purpose of this new focus group is to develop vertical velocity ARM products suitable for modelers. ARM response to their request has been slow. Most ARM instruments are suitable for cloud observations and have limited capabilities in precipitation Using ARM datasets for evaluating and improving cloud parameterization in global climate models (GCMs) is not straightforward, due to gigantic scale mismatches. Consider this... Looking only vertically drastically limits opportunities


Customer-Focused Deployment  

Broader source: Energy.gov (indexed) [DOE]

Customer-Focused Customer-Focused Deployment SAM RASHKIN Chief Architect Building Technologies Program February 29, 2012 Building America Meeting 2 | INNOVATION & INTEGRATION: Transforming the Energy Efficiency Market Buildings.Energy.gov 'Good Government' As-A-System IECC Code: Mandates technologies and practices proven reliable and cost- effective ENERGY STAR: Recognizes Builders Who Deliver Significantly Above Code Performance Builders Challenge: Recognizes Leading Builders Applying Proven Innovations and Best Practices Building America: Develops New Innovations and Best Practices 3 | INNOVATION & INTEGRATION: Transforming the Energy Efficiency Market Buildings.Energy.gov Disseminating Research Results: Building America Resource Tool 4 | INNOVATION & INTEGRATION: Transforming the Energy Efficiency Market


Aerodynamic Focusing Of High-Density Aerosols  

SciTech Connect (OSTI)

High-density micron-sized particle aerosols might form the basis for a number of applications in which a material target with a particular shape might be quickly ionized to form a cylindrical or sheet shaped plasma. A simple experimental device was built in order to study the properties of high-density aerosol focusing for 1#22; m silica spheres. Preliminary results recover previous findings on aerodynamic focusing at low densities. At higher densities, it is demonstrated that the focusing properties change in a way which is consistent with a density dependent Stokes number.

Ruiz, D. E.; Fisch, Nathaniel



Focus on Fusion...  

Science Journals Connector (OSTI)

Focus on Fusion... ... As 1957 ended, the British press set off a thermonuclear uproar, blasted the U. S. Atomic Energy Commission for assertedly withholding information on British breakthroughs in controlled thermonuclear reactions. ... However, last year did see a breakthrough of sorts as thermonuclear information managed to clear the secrecy hurdle at last; by fall, fusion research was completely declassified. ...



Focused Ion Beam (FIB):  

Science Journals Connector (OSTI)

...al., 1990; Basile et al., 1992; Overwijk et al., 1993). Focused gallium ion...detailed descriptions are given elsewhere (Overwijk et al., 1993; Heaney et al., 2001...Kluwer Academic Publishers, 316 pp. Overwijk, M.H.E., van den Heuvel, F...

Richard WIRTH



Science Journals Connector (OSTI)

NASA CHANGES SCIENCE FOCUS ... In the past year and a half, NASA has received a presidential plan to refocus its efforts with the goal of returning humans to the moon and then on to Mars. ... But the shift of scientific support has drawn concern from both Congress and other NASA followers. ...



Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


STRATEGIC FOCUS: Sustainable Systems  

E-Print Network [OSTI]

to apply sustain- ability principles to building and design, transportation and other fields, to green, presented an ecologically-sustainable sanitation system developed for a small hospital in northern Haiti1010 STRATEGIC FOCUS: Sustainable Systems Biology doctoral student Tanya Lubansky uses quan


Strategic Focus Points  

Broader source: Energy.gov (indexed) [DOE]

Focus Points Focus Points June 2011 1. Establish the human capital and organizational foundation to create a high-performing organization. 2. Implement a cyber risk-management and incident response program that ensures effective security of Federal and M&O networks, provides appropriate flexibility, and meets legal requirements and OMB expectations. 3. Improve IT Services (EITS) into a best-in-class provider from both a technical and business perspective. 4. Implement and institutionalize a reformed, integrated information management governance process that respects the goal to treat M&Os distinctively different than true Federal entities. 5. Transition to 5-year planning and programming, using the NNSA Planning, Programming, Budgeting and Evaluation (PPBE) process as a starting point to include resource and requirements validation.


Focus Area Summary  

Broader source: Energy.gov (indexed) [DOE]

information provided was consolidated from the original five focus areas for the EM information provided was consolidated from the original five focus areas for the EM Corporate QA Board. The status of QAP/QIP approvals etc. was accurate at the time of posting; however, additional approvals may have been achieved since that time. If you have any questions about the information provided, please contact Bob Murray at robert.murray@em.doe.gov Task # Task Description Status 1.1 Develop a brief questionnaire to send out to both commercial and EM contractors to describe their current approach for identifying the applicable QA requirements for subcontractors, tailoring the requirements based upon risk, process for working with procurement to ensure QA requirements are incorporated into subcontracts, and implementing verification of requirement flow-down by their


Focused ion beam system  

DOE Patents [OSTI]

A focused ion beam (FIB) system produces a final beam spot size down to 0.1 {mu}m or less and an ion beam output current on the order of microamps. The FIB system increases ion source brightness by properly configuring the first (plasma) and second (extraction) electrodes. The first electrode is configured to have a high aperture diameter to electrode thickness aspect ratio. Additional accelerator and focusing electrodes are used to produce the final beam. As few as five electrodes can be used, providing a very compact FIB system with a length down to only 20 mm. Multibeamlet arrangements with a single ion source can be produced to increase throughput. The FIB system can be used for nanolithography and doping applications for fabrication of semiconductor devices with minimum feature sizes of 0.1 m or less. 13 figs.

Leung, K.; Gough, R.A.; Ji, Q.; Lee, Y.Y.



Subsurface contaminants focus area  

SciTech Connect (OSTI)

The US Department of Enregy (DOE) Subsurface Contaminants Focus Area is developing technologies to address environmental problems associated with hazardous and radioactive contaminants in soil and groundwater that exist throughout the DOE complex, including radionuclides, heavy metals; and dense non-aqueous phase liquids (DNAPLs). More than 5,700 known DOE groundwater plumes have contaminated over 600 billion gallons of water and 200 million cubic meters of soil. Migration of these plumes threatens local and regional water sources, and in some cases has already adversely impacted off-site rsources. In addition, the Subsurface Contaminants Focus Area is responsible for supplying technologies for the remediation of numerous landfills at DOE facilities. These landfills are estimated to contain over 3 million cubic meters of radioactive and hazardous buried Technology developed within this specialty area will provide efective methods to contain contaminant plumes and new or alternative technologies for development of in situ technologies to minimize waste disposal costs and potential worker exposure by treating plumes in place. While addressing contaminant plumes emanating from DOE landfills, the Subsurface Contaminants Focus Area is also working to develop new or alternative technologies for the in situ stabilization, and nonintrusive characterization of these disposal sites.




seminar.sty A LATEX style for slides and notes  

E-Print Network [OSTI]

seminar.sty A LATEX style for slides and notes User's Guide Timothy Van Zandt tvz@Princeton.EDU 1 ' & $ % ' & $ % ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥ ¥¥ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢ ¢¢ seminar.sty is a LATEX style for typesetting slides or transparen- cies, and accompanying notes. Here fonts. Slides can be landscape and portrait. There is support for color and frames. The magnifi- cation

Ihn, Thomas


Simulations of neutralized final focus  

E-Print Network [OSTI]

result of too little plasma density near focus where n b > nof a plasma- neutralized solenoidal final focus. A Ne+ beamto NDC, beam-plasma instability growth and final focus in a

Welch, D.R.; Rose, D.V.; Genoni, T.C.; Yu, S.S.; Barnard, J.J.



Focus Group | Department of Energy  

Energy Savers [EERE]

Focus Group Meeting (Activities Status) Meeting agenda, summary and 2011 Directives Reform Status Meeting Date: May 19, 2011 January 20, 2011 Focus Group Meeting (Activities...


Focus Series | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Better Buildings Partners Focus Series Focus Series On-Bill Financing Brings Lenders and Homeowners on Board bbnpfocusseriescew9-2-14.jpg Read how Clean Energy Works'...


Linkage to Previous International PV Module QA Task Force Workshops: Proposal for Rating System  

Broader source: Energy.gov [DOE]

This PowerPoint presentation, focused on humidity, temperature and voltage testing, was originally presented at the NREL 2013 PV Module Reliability Workshop on Feb. 26-27, 2013 in Denver, CO. It summarizes the efforts of previous QA task forces and proposes a QA rating system to differentiate the relative durability of model designs.


Focus Area 3 Deliverables  

Broader source: Energy.gov (indexed) [DOE]

3 - Commercial Grade item and Services 3 - Commercial Grade item and Services Dedication Implementation and Nuclear Services Office of Environmental Management And Energy Facility Contractors Group Quality Assurance Improvement Project Plan Project Focus Area Task # and Description Deliverable Project Area 3-Commercial Grade Item and Services Dedication 3.1-Complete a survey of selected EM contractors to identify the process and basis for their CGI dedication program including safety classification of items being dedicated for nuclear applications within their facilities Completed Survey Approvals: Yes/No/NA Project Managers: S. Waisley, D. Tuttel Yes Executive Committee: D. Chung, J. Yanek, N. Barker, D. Amerine No EM QA Corporate Board: No Energy Facility Contractors Group


Defining the role of elastic lubricants and micro textured surfaces in lubricated, sliding friction  

E-Print Network [OSTI]

Solutions for reducing friction in sliding, lubricated systems include modifying lubricant rheology using polymers and adding a micro-scale texture to the sliding surfaces, but the mechanism of how lubrication properties ...

Hupp, Sara J. (Sara Jean), 1979-



Effects of mechanical properties and surface friction on elasto-plastic sliding contact  

E-Print Network [OSTI]

Effects of mechanical properties and surface friction on elasto-plastic sliding contact S and many recent computational studies have established quantitative relationships between elasto-plastic systematically quantified the effect of the plastic deformation characteristics on the frictional sliding

Suresh, Subra


E-Print Network 3.0 - adaptive sliding mode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sweden (KTH) Collection: Engineering 83 High-Order Sliding Mode Control of a DFIG-Based Wind Turbine Summary: High-Order Sliding Mode Control of a DFIG-Based Wind...


Direct Use for Building Heat and Hot Water Presentation Slides and Text Version  

Broader source: Energy.gov [DOE]

Download presentation slides from the DOE Office of Indian Energy webinar on direct use for building heat and hot water.


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 7: Models: The Spread of Knowledge Can Be Accelerated Paths of Acceleration Bettencourt, Luis M.A., et. al....


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 22: Ensuring Access to Science Information and Research Results Science Accelerator Science.gov WORLDWIDESCIENCE.ORG...


Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 6 Slide 1 Requirements Engineering Processes  

E-Print Network [OSTI]

and the business environment change #12;©Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 6 Slide 10©Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 6 Slide 1 Requirements Engineering Software Engineering, 6th edition. Chapter 6 Slide 2 Objectives l To describe the principal requirements

Scharff, Christelle


Ian Sommerville 2004 Software Engineering, 7th edition. Chapter 28 Slide 1 Process Improvement  

E-Print Network [OSTI]

Sommerville 2004 Software Engineering, 7th edition. Chapter 28 Slide 8 Process quality and product quality Engineering, 7th edition. Chapter 28 Slide 9 Principal product quality factors ©Ian Sommerville 2004 Software Engineering, 7th edition. Chapter 28 Slide 10 Quality factors For large projects with `average' capabilities

Huang, Jung-Chang


IS&JCH040421 Software Engineering. Chapter 25 Slide 0 of 33 Process Improvement  

E-Print Network [OSTI]

change Train engineers ©IS&JCH040421 Software Engineering. Chapter 25 Slide 7 of 33 Process quality Software Engineering. Chapter 25 Slide 8 of 33 Principal product quality factors Product quality Engineering. Chapter 25 Slide 9 of 33 Quality factors For large projects with `average' capabilities

Huang, Jung-Chang

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Universitt Mannheim Paulheim, Bizer: Team Project Introduction FSS2013 Slide 1 Team Project  

E-Print Network [OSTI]

Universität Mannheim ­ Paulheim, Bizer: Team Project Introduction ­ FSS2013 ­ Slide 1 Team Project;Universität Mannheim ­ Paulheim, Bizer: Team Project Introduction ­ FSS2013 ­ Slide 2 Ingredients A hot topic;Universität Mannheim ­ Paulheim, Bizer: Team Project Introduction ­ FSS2013 ­ Slide 3 Ingredient 1: A Hot

Mannheim, Universität


frank@grupp-astro.de Frank GRUPP Slide 1 Guangzhou November 24th  

E-Print Network [OSTI]

frank@grupp-astro.de Frank GRUPP Slide 1 Guangzhou ­ November 24th 2007 Opacity Sampling Model@grupp-astro.de Frank GRUPP Slide 2 Outline Opacity sampling model atmospheres ­ OS versus ODF ­ Solar flux and colors@grupp-astro.de Frank GRUPP Slide 3 Model atmospheres ­ Importance Why are model atmospheres so important

Grupp, Frank


frank@grupp-astro.de Frank GRUPP Slide 1 Hamburg September 17th  

E-Print Network [OSTI]

frank@grupp-astro.de Frank GRUPP Slide 1 Hamburg ­ September 17th 2007 LAMOST-HiRes Status of the design and next steps HiRes - Status and next steps #12;frank@grupp-astro.de Frank GRUPP Slide 2 Hi The spectrograph Instrument control & Interfaces #12;frank@grupp-astro.de Frank GRUPP Slide 3 FPU: Site conditions

Grupp, Frank


2 Journal of the Oughtred Society Five Pickett Electronics Slide Rules  

E-Print Network [OSTI]

2 Journal of the Oughtred Society Five Pickett Electronics Slide Rules Brian Borchers The five Pickett slide rules described in this article were especially designed for electronics calculations. Sev. In the follow- ing, I will describe these slide rules and their specialized scales, and present some examples

Borchers, Brian


Ashot Minasyan On quasiconvex subsets. . . -slide #1 On Quasiconvex Subsets of Hyperbolic Groups  

E-Print Network [OSTI]

Ashot Minasyan On quasiconvex subsets. . . - slide #1 On Quasiconvex Subsets of Hyperbolic Groups Ashot Minasyan On quasiconvex subsets. . . - slide #2 The Cayley Graph Suppose G is a group generated Corollaries Ashot Minasyan On quasiconvex subsets. . . - slide #2 The Cayley Graph Suppose G is a group

Minasyan, Ashot


Slide 1Falk Herwig7 Aug 2006 Convective and non-convective mixing  

E-Print Network [OSTI]

Slide 1Falk Herwig7 Aug 2006 Convective and non-convective mixing in AGB stars Falk Herwig and Bernd Freytag Los Alamos National Laboratory Theoretical Astrophysics Group #12;Slide 2Falk Herwig7 Aug envelope models for sun-like stars #12;Slide 3Falk Herwig7 Aug 2006 3D hydro simulations of AGB convective

Herwig, Falk


Detecting local-scale fire episodes on pollen slides Hugo Asselin *, Serge Payette  

E-Print Network [OSTI]

Detecting local-scale fire episodes on pollen slides Hugo Asselin *, Serge Payette NSERC Northern be retrieved by counting charcoal particles on pollen slides, although it is still debated whether microscopic charcoal on pollen slides is presented, taking into account the size distribution of the charcoal

Asselin, Hugo


February 2004 Dalhousie University Faculty of Medicine Slide 1 Instructional Technology  

E-Print Network [OSTI]

February 2004 Dalhousie University Faculty of Medicine Slide 1 Instructional Technology Basic Conferencing Presenting with a PDA February 2004 Dalhousie University Faculty of Medicine Slide 2 Introduction! February 2004 Dalhousie University Faculty of Medicine Slide 3 Who To Call On Carleton Campus

Beaumont, Christopher


Slide ICentre for Development of Teaching and Learning National University of Singapore  

E-Print Network [OSTI]

-C D T L S tudent IT w orkshops- Slide ICentre for Development of Teaching and Learning National IT w orkshops- Slide ICentre for Development of Teaching and Learning National University of SingaporePoint presentation based on styles from report Workshop Objectives: #12;-C D T L S tudent IT w orkshops- Slide

Chaudhuri, Sanjay


frank@grupp-astro.de Frank Grupp Slide 1 Lijiang May 15th  

E-Print Network [OSTI]

frank@grupp-astro.de Frank Grupp Slide 1 Lijiang ­ May 15th 2007 Planet host stars, parameters and element abundances. Planet Host Stars: Params & More #12;frank@grupp-astro.de Frank Grupp Slide 2 Our, stellar parameters, instrument development #12;frank@grupp-astro.de Frank Grupp Slide 3 Planet host stars

Grupp, Frank



E-Print Network [OSTI]

SYNCHRONIZATION OF PRESENTATION SLIDES AND LECTURE VIDEOS USING BIT RATE SEQUENCES G. Schroth1 , N The temporal synchronization of presentation slides and lecture videos enables us to enhance the user and reliably detect and recognize slide changes, which is based on bit rate sequences. By exploiting readily

Girod, Bernd


Geomorphology, stability and mobility of the Currituck slide Jacques Locat a,  

E-Print Network [OSTI]

Geomorphology, stability and mobility of the Currituck slide Jacques Locat a, , Homa Lee b , Uri S: Currituck submarine slides mobility stability yield strength flow Over the last 100,000 years, the U trigger caused a major submarine mass movement off the coast of Virginia: the Currituck slide which

ten Brink, Uri S.



E-Print Network [OSTI]

ROLE OF SOIL BEHAVIOR ON THE INITIAL KINEMATICS OF TSUNAMIGENIC SLIDES A.S. BRADSHAW Department acceleration of the failure itself. In a number of these studies, a translational slide is modeled as a rigid body sliding down an inclined plane and basal resistance is neglected. In this paper, a similar rigid

Grilli, Stéphan T.


frank@grupp-astro.de Frank Grupp Slide 1 Nanjing August 17th  

E-Print Network [OSTI]

frank@grupp-astro.de Frank Grupp Slide 1 Nanjing ­ August 17th 2007 A massively replicated Slide 2 VIRUS: Outline A few facts about HET VIRUS-HETDEX, the experiment VIRUS spectrograph VIRUS fiberlink and IFU The system as whole Another VIRUS device #12;frank@grupp-astro.de Frank Grupp Slide 3

Grupp, Frank


Mastering science of the slide crucial to success of every winter Olympian  

E-Print Network [OSTI]

Mastering science of the slide crucial to success of every winter Olympian By IVAN SEMENIUK Think about it: Every sport at the Winter Olympics relies on some kind of manmade object sliding over, every competition in Sochi will come down to some kind of manmade object sliding over ice or snow

Machel, Hans


Safe-Arm Slide Ejection Effect IATM-972 I PAGE OFon Grenade Trajectory  

E-Print Network [OSTI]

Safe-Arm Slide Ejection Effect IATM-972 i I' I 1 I PAGE OFon Grenade Trajectory DATEz6 Januar 1971 Safe-Arm Slide l!:jectwn £:t:tect on Grenade Trajectory Ref: Space Ordnance Systems "Appendix V, 11, the safe-arm slide was omitted from the system, and therefore, any perturbation to the trajectory due

Rathbun, Julie A.


www.ptvgroup.com I Slide 1www.ptvgroup.com ANALYTICAL EFFICIENCIES  

E-Print Network [OSTI]

www.ptvgroup.com I Slide 1www.ptvgroup.com ANALYTICAL EFFICIENCIES THROUGH THE INTEGRATION Perone, President PTV Vision Traffic Suite Software #12;www.ptvgroup.com I Slide 2 Who is PTV Group Prediction AGENDA #12;www.ptvgroup.com I Slide 3 Who is PTV Group? Multi-Resolution Modeling ­ The PTV Way

Bertini, Robert L.


Robust Spatio-temporal Matching of Electronic Slides to Presentation Videos  

E-Print Network [OSTI]

1 Robust Spatio-temporal Matching of Electronic Slides to Presentation Videos Quanfu Fan, Kobus- matically matching and time-aligning electronic slides to videos of corresponding presentations. Matching electronic slides to videos provides new methods for indexing, searching, and browsing videos in distance

Barnard, Kobus


Beyond Next slide, please": The use of content and speech in multi-modal control  

E-Print Network [OSTI]

Beyond Next slide, please": The use of content and speech in multi-modal control David Franklin and Speech Recognition to provide hands-free con- trol of slide presentations. We look at utterances that can be used to match slide content to the speaker's words, providing new and useful ways of performing

Bustamante, Fabián E.


CSER 2007 Shah, Rhodes, Hastings 2007 MIT Slide 1 Systems of Systems and  

E-Print Network [OSTI]

CSER 2007 Shah, Rhodes, Hastings © 2007 MIT Slide 1 Systems of Systems and Emergent System Context MIT Slide 2 Agenda · What is a system of systems (SOS)? · What is the context of a system? · What;CSER 2007 Shah, Rhodes, Hastings © 2007 MIT Slide 3 What is a systems of systems? Much greater

de Weck, Olivier L.

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


frank@grupp-astro.de Frank Grupp Slide 1 LangZhong -June 20, 2006  

E-Print Network [OSTI]

frank@grupp-astro.de Frank Grupp Slide 1 LangZhong - June 20, 2006 LAMOST-HiRes A Fiber-Fed High Resolution Echelle Spectrograph for LAMOST LAMOST-HiRes #12;frank@grupp-astro.de Frank Grupp Slide 2 Outline coverage #12;frank@grupp-astro.de Frank Grupp Slide 3 Outline (2) HiRes spectrograph design ­ FOCES

Grupp, Frank


frank@grupp-astro.de Frank Grupp Slide 1 Fengshan -September 4, 2006  

E-Print Network [OSTI]

frank@grupp-astro.de Frank Grupp Slide 1 Fengshan - September 4, 2006 LAMOST-HiRes A Fiber-Fed High Resolution Echelle Spectrograph for LAMOST LAMOST-HiRes #12;frank@grupp-astro.de Frank Grupp Slide 2 Outline device Observation strategy Summary and next steps #12;frank@grupp-astro.de Frank Grupp Slide 3 General

Grupp, Frank


Biomarker Detection in Whole Slide Imaging based on Statistical Color Models  

E-Print Network [OSTI]

Biomarker Detection in Whole Slide Imaging based on Statistical Color Models Jie Shu1 , Guoping Qiu slides. We treat immunostaining detection as a color image analysis problem and build statistical color slides of oesophagitis and colorectal biopsies. We present experimental results and show

Aickelin, Uwe


October 30, 2007 SKF Group Slide 0 Strain tempering of superbainite  

E-Print Network [OSTI]

October 30, 2007 © SKF Group Slide 0 #12;Strain tempering of superbainite Mohamed Sherif Research © SKF Group Slide 2 Superbainite High-carbon high-silicon carbide-free bainite Carbon suppresses the bainite-start temperature leading to a finer structure #12;October 30, 2007 © SKF Group Slide 3

Cambridge, University of


Ashot Minasyan On the engulfing property. . . -slide #1 On the Engulfing Property for word hyperbolic  

E-Print Network [OSTI]

Ashot Minasyan On the engulfing property. . . - slide #1 On the Engulfing Property for word property. . . - slide #2 The profinite topology Let G be a group. Consider the cosets to finite index Questions Ashot Minasyan On the engulfing property. . . - slide #2 The profinite topology Let G be a group

Minasyan, Ashot


Falk Herwig18 July 2007 Slide 1 Nucleosynthesis and mixing in  

E-Print Network [OSTI]

Falk Herwig18 July 2007 Slide 1 Nucleosynthesis and mixing in the first generations of low July 2007 Slide 2 We have seen yesterday: rotation is important at extremely low and zero metalicity Slide 3 The convective-reactive events occur favorably at Z=0 or extremely low metallicity: ·the entropy

Herwig, Falk


Robust Neural Sliding Mode Control of Robot Manipulators  

SciTech Connect (OSTI)

This paper proposes a robust neural sliding mode control method for robot tracking problem to overcome the noises and large uncertainties in robot dynamics. The Lyapunov direct method has been used to prove the stability of the overall system. Simulation results are given to illustrate the applicability of the proposed method.

Nguyen Tran Hiep [Le Quy Don University Hanoi-Vietnam (Viet Nam); Pham Thuong Cat [Institute of Information Technology, Academy of Science and Technology Vietnam (Viet Nam)



Sliding Mode Control of EV Electric Differential System  

E-Print Network [OSTI]

of an electric differential system for Electric Vehicle (EV) with two induction motor drives (one for each wheel of electric drives to control the generated torque and the introduction of an independent control400 1 Sliding Mode Control of EV Electric Differential System A. Haddoun, M. E. H. Benbouzid, D

Paris-Sud XI, Université de


Sliding Friction with Polymer Brushes Rafael Tadmor,* Joanna Janik,  

E-Print Network [OSTI]

Sliding Friction with Polymer Brushes Rafael Tadmor,* Joanna Janik, and Jacob Klein Department) Using high-resolution shear force measurements, we examine in detail the frictional drag between rubbing characteristic of kinetic friction. This has a very weak velocity dependence, attributed to chain moieties

Klein, Jacob


Bilayer Membrane in Confined Geometry: Interlayer Slide and Steric Repulsion  

E-Print Network [OSTI]

We derived free energy functional of a bilayer lipid membrane from the first principles of elasticity theory. The model explicitly includes position-dependent mutual slide of monolayers and bending deformation. Our free energy functional of liquid-crystalline membrane allows for incompressibility of the membrane and vanishing of the in-plane shear modulus and obeys reflectional and rotational symmetries of the flat bilayer. Interlayer slide at the mid-plane of the membrane results in local difference of surface densities of the monolayers. The slide amplitude directly enters free energy via the strain tensor. For small bending deformations the ratio between bending modulus and area compression coefficient, Kb/KA, is proportional to the square of monolayer thickness, h. Using the functional we performed self-consistent calculation of steric potential acting on bilayer between parallel confining walls separated by distance 2d. We found that temperature-dependent curvature at the minimum of confining potential is enhanced four times for a bilayer with slide as compared with a unit bilayer. We also calculate viscous modes of bilayer membrane between confining walls. Pure bending of the membrane is investigated, which is decoupled from area dilation at small amplitudes. Three sources of viscous dissipation are considered: water and membrane viscosities and interlayer drag. Dispersion has two branches. Confinement between the walls modifies the bending mode with respect to membrane in bulk solution. Simultaneously, inter-layer slipping mode, damped by viscous drag, remains unchanged by confinement.

S. V. Baoukina; S. I. Mukhin



Page 1 of 1 Slide notes: Welcome. This video will show you how to find the full text of a particular journal article.  

E-Print Network [OSTI]

Page 1 of 1 Slide 1 Slide notes: Welcome. This video will show you how to find the full text of a particular journal article. #12;Page 2 of 2 Slide 2 Slide notes: You have been told this is an ideal article articles are freely available on the Internet. #12;Page 3 of 3 Slide 3 Slide notes: To help find the full

Blows, Mark


Memory impairment in the weapon focus effect  

Science Journals Connector (OSTI)

Two experiments are reported in which postevent source of misinformation was manipulated within weaponpresent and weapon-absent scenarios. Participants viewed slides depicting either a weapon or a newspaper event...

Jo Saunders



Previous Computer Science Award Announcements | U.S. DOE Office...  

Office of Science (SC) Website

Previous Computer Science Award Announcements Advanced Scientific Computing Research (ASCR) ASCR Home About Research Applied Mathematics Computer Science Exascale Tools Workshop...


Focus Areas | Critical Materials Institute  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Focus Areas FA 1: Diversifying Supply FA 2: Developing Substitutes FA 3: Improving Reuse and Recycling FA 4: Crosscutting Research...


Creating a poster using Powerpoint: Psych 330 [ Once you open Powerpoint, you want to work with a blank slide.  

E-Print Network [OSTI]

Creating a poster using Powerpoint: Psych 330 [ Once you open Powerpoint, you want to work with a blank slide. FORMAT: Slide Layout: Blank [ You poster will consist of just this one slide. Before adding content to the slide, set the poster size by clicking FILE: Page Setup: size: custom width: 24 height: 20


Whole Slide Image Analysis Quantification using Aperio Digital Imaging in a Mouse Lung Metastasis Ronne L. Surface2  

E-Print Network [OSTI]

Whole Slide Image Analysis Quantification using Aperio Digital Imaging in a Mouse Lung Metastasis, Indiana University School of Medicine Digital whole slide imaging is the technique of digitizing a microscope slide at the highest resolution to produce a "digital virtual microscope slide". This digital

Zhou, Yaoqi


Editorial Focus Editorial Focus: Going with the Wnt? Focus on "Hyperaldosteronism,  

E-Print Network [OSTI]

Editorial Focus Editorial Focus: Going with the Wnt? Focus on "Hyperaldosteronism, hypervolemia in mice and humans. Upon binding of these lipid-modified glycopeptides to their plasma membrane receptors complex to the plasma membrane, which leads to degradation of the complex and release of ?

Just, Armin


Previous Members | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Previous ASCAC Members Previous ASCAC Members Advanced Scientific Computing Advisory Committee (ASCAC) ASCAC Home Meetings Members ASCAC Members Bio Previous ASCAC Members Charges/Reports Charter .pdf file (38KB) ASCR Committees of Visitors ASCR Home Members Previous ASCAC Members Print Text Size: A A A RSS Feeds FeedbackShare Page Dr. F. Ronald Bailey Computer Sciences Corp. 591 Branciforte Ridge Santa Cruz, CA 95065 Dr. Horst D. Simon Director, Computational Research Division Lawrence Berkeley Laboratory 1 Cyclotron Road, MS 50B-4230 Berkeley, CA 94720 Mr. Gordon Bell Microsoft Research 835 Market St. Suite 700 San Francisco, CA 94103 Dr. Larry L. Smarr Calit2/UCSD 9500 Gilman Drive, MC 0436 La Jolla, CA 92093-0436 Marjory S. Blumenthal Office of the Provost Georgetown University 3700 O Street, NW, ICC 650


Previous Meetings | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Previous Meetings Previous Meetings High Energy Physics Advisory Panel (HEPAP) HEPAP Home Meetings Previous Meetings Members .pdf file (20KB) Charges/Reports Charter .pdf file (44KB) HEP Committees of Visitors HEP Home Meetings Previous Meetings Print Text Size: A A A RSS Feeds FeedbackShare Page December 6-7, 2013 Gaithersburg, MD Agenda and Talks September 5-6, 2013 Arlington, VA Agenda and Talks March 11-12, 2013 Gaithersburg, MD Agenda and Talks December 5-6, 2012 Bethesda, MD Agenda and Talks Minutes .pdf file (5.7MB) August 27-28, 2012 Rockville, MD Agenda and Talks Minutes .pdf file (6.1MB) March 12-13, 2012 Washington, DC Agenda and Talks Minutes .pdf file (5.7MB) October 27-28, 2011 Washington, DC Agenda and Talks Minutes .docx file (72KB) Summary Letter from Chair .pdf file (94KB)


Tribological contact analysis of a rigid ball sliding on a hard coated surface: Part II: Material deformations, influence of coating thickness and Young's modulus  

Science Journals Connector (OSTI)

Material deformations and the influence of coating thickness and elastic modulus were analysed by three-dimensional finite element method (FEM) modelling on microlevel, by stress, strain, and displacement computer simulations and by experimental studies with a scratch tester. The studied tribological contact was a diamond ball sliding with increasing load on a thin titanium nitride (TiN) coating on a flat steel substrate. The ball was modelled as rigid, the coating was linearly elastic, and the steel substrate was elasticplastic, taking into account strain hardening effects. It was shown that a thin TiN ceramic coating on a steel substrate has only a very slight effect on friction and on the plastic deformations (i.e., the groove formation) in the surface, but changes considerably the stress pattern at the surface. The stress simulations showed how a thicker hard coating on a soft substrate has a better load-carrying capacity that a thinner one. Higher tensile stresses at the coating/substrate interface increase the risk for interface cracks and delamination of the thicker coating. A stiffer hard coating on a soft substrate has a better load-carrying capacity than a more elastic one. The stiffer coating will accommodate higher tensile stresses with the same indentation depth compared to a more elastic one. The results show that much more attention should be given to optimizing the elastic properties of the coating than previously has been done. In many cases, it can be much more effective to improve the wear resistance of the coated surface by focusing on the elastic modulus of the coating than changing the coating thickness.

Kenneth Holmberg; Anssi Laukkanen; Helena Ronkainen; Kim Wallin; Simo Varjus; Jari Koskinen


Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Compile lessons learned and good practices from ongoing and previous  

Open Energy Info (EERE)

Compile lessons learned and good practices from ongoing and previous Compile lessons learned and good practices from ongoing and previous sustainable development efforts in the country Jump to: navigation, search Stage 2 LEDS Home Introduction to Framework Assess current country plans, policies, practices, and capacities Develop_BAU Stage 4: Prioritizing and Planning for Actions Begin execution of implementation plans 1.0. Organizing the LEDS Process 1.1. Institutional Structure for LEDS 1.2. Workplan to Develop the LEDS 1.3. Roles and responsibilities to develop LEDS 2.1. Assess current country plans, policies, practices, and capacities 2.2. Compile lessons learned and good practices from ongoing and previous sustainable development efforts in the country 2.3. Assess public and private sector capacity to support initiatives 2.4. Assess and improve the national GHG inventory and other


Xunlight Corp previously MWOE Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Xunlight Corp previously MWOE Solar Inc Xunlight Corp previously MWOE Solar Inc Jump to: navigation, search Name Xunlight Corp (previously MWOE Solar Inc) Place Toledo, Ohio Zip 43607 Product US-based developer of single and triple-junction thin-film PV cells and modules. Coordinates 46.440613°, -122.847838° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.440613,"lon":-122.847838,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brawley- Resurrection Of A Previously Developed Geothermal Field | Open  

Open Energy Info (EERE)

Brawley- Resurrection Of A Previously Developed Geothermal Field Brawley- Resurrection Of A Previously Developed Geothermal Field Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Paper: Brawley- Resurrection Of A Previously Developed Geothermal Field Details Activities (1) Areas (1) Regions (0) Abstract: The Brawley Geothermal Field was originally developed by Unocal. In addition to drilling geothermal wells, this development included building and operating a 10 MWe power plant. Corrosion and scaling issues resulted in Unocal abandoning the project in the 1980's. Ormat Nevada investigated the potential of the shallow sands in 2006. It was concluded that these matrixpermeable sands contained moderately saline water, high porosity, and could support a binary-type power plant. In 2007, Ormat Nevada drilled and tested five wells. These test results confirmed the


Joule Unlimited previously Joule Biotechnologies | Open Energy Information  

Open Energy Info (EERE)

Joule Unlimited previously Joule Biotechnologies Joule Unlimited previously Joule Biotechnologies Jump to: navigation, search Name Joule Unlimited (previously Joule Biotechnologies) Place Cambridge, Massachusetts Zip 2142 Product Massachusetts-based industrial biotechnology company developing transformative systems to enable highly efficient, low-cost cell-based biodiesel production. Coordinates 43.003745°, -89.017499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.003745,"lon":-89.017499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brawley Resurrection of a Previously Developed Geothermal Field | Open  

Open Energy Info (EERE)

Brawley Resurrection of a Previously Developed Geothermal Field Brawley Resurrection of a Previously Developed Geothermal Field Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Brawley Resurrection of a Previously Developed Geothermal Field Abstract The Brawley Geothermal Field was originally developed byUnocal. In addition to drilling geothermal wells, this developmentincluded building and operating a 10 MWe power plant.Corrosion and scaling issues resulted in Unocal abandoning theproject in the 1980's. Ormat Nevada investigated the potentialof the shallow sands in 2006. It was concluded that these matrixpermeablesands contained moderately saline water, high porosity,and could support a binary-type power plant. In 2007, OrmatNevada drilled and tested five wells. These test results confirmedthe earlier conclusions and


Effect of displacement rate and gouge composition on the sliding behavior of simulated gouge  

E-Print Network [OSTI]

) fluorite and galena gouges which exhibit rather peculiar behavior in that after the initial stress drop the frictional strength becomes very low and only stable sliding occurs; and (4) barite and halite gouges which show stable sliding at least up... composed of a hard mineral (e. g. , quartz, pyrite, or orthoclase) and of a soft mineral (e. g. , barite or halite) shows only stable sliding to 200 MPa confining pressure, whereas gouge com- posed of intermediate hardness (e. g. , apatite, dolomite...

Chang, Hui-Cheng



N.E. Leonard U. Pisa 18-20 April 2007Slide 1 Cooperative Control  

E-Print Network [OSTI]

1 N.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 1 Cooperative Control and Mobile Sensor Networks.princeton.edu/~naomi N.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 2 Outline and Key References A. Artificial Potentials-20 April 2007Slide 3 Outline and Key References D. Virtual Tensegrity Structures: B. Nabet and N.E. Leonard

Leonard, Naomi


Quelques slides sur les gr n s dans la serie : "hangman game for dummies"  

E-Print Network [OSTI]

Quelques slides sur les gr n s dans la s´erie : "hangman game for dummies" Laurent LIFL, Universit´e Lille 1 - INRIA Journ´ees au vert 20 et 21 mai 2011 Laurent Quelques slides sur les gr n s #12;NGS://www.illumina.com/systems/miseq.ilmn Laurent Quelques slides sur les gr n s #12;Alors, de quoi vais-je bien pouvoir parler ? Laurent Quelques

Noé, Laurent


seminar.sty A L A T E X style for slides and notes  

E-Print Network [OSTI]

seminar.sty A L A T E X style for slides and notes User's Guide Timothy Van Zandt tvz style for typesetting slides or transparen­ cies, and accompanying notes. Here are some of its special features: It is compati­ ble with A M S­L A T E X, and you can use PostScript and A M S fonts. Slides can


N.E. Leonard U. Pisa 18-20 April 2007Slide 1 Cooperative Control  

E-Print Network [OSTI]

1 N.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 1 Cooperative Control and Mobile Sensor Networks.princeton.edu/~naomi N.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 2 Key References [1] Leonard, Paley, Lekien. Pisa ­ 18-20 April 2007Slide 3 5 Scripps Spray Gliders 10 WHOI Slocum Gliders AOSN-II Glider Plan N

Leonard, Naomi


N.E. Leonard U. Pisa 18-20 April 2007Slide 1 Cooperative Control  

E-Print Network [OSTI]

1 N.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 1 Cooperative Control and Mobile Sensor Networks.princeton.edu/~naomi N.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 2 Outline 1. Introduction to cooperative control.E. Leonard ­ U. Pisa ­ 18-20 April 2007Slide 3 Reference 1. E. Fiorelli, N.E. Leonard, P. Bhatta, D. Paley, R

Leonard, Naomi


Aerodynamic Focusing of High-Density Aerosols D.E. Ruiza,  

E-Print Network [OSTI]

Aerodynamic Focusing of High-Density Aerosols D.E. Ruiza, , L. Gundersona , M.J. Haya , E. Merinob-density aerosol focusing for 1µm silica spheres. Preliminary results recover previous findings on aerodynamic


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 Slide 3: Leadership and Staff Walter L. Warnick, Director RL Scott, Deputy Director Vince Dattoria, Senior Advisor Administration & Information Services Brian Hitson, Assoc. Director Information Systems Karen Spence, Assistant Director Program Integration Sharon Jordan, Assistant Director STI Acquisitions & Management, Judy Gilmore STI policies and procedures, e-journal consortia, R&D project summaries, intellectual property rights, special projects Brabson, Delores Elliott, Jannean Foust, Susie Waldrop, Kathy Chambers, Kathy Goodman, Paulette Rita Hohenbrink External Relations & Communication, Linda Ponce SC communication liaison, OSTI home page, web policies, interagency & E-gov initiatives, software, report requests Allen, Valerie Buckner, Kim


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Slide10 Slide 10: Management of Scientific Text Is a Model for Numeric Data -Defense Technical Information Center (Department of Defense) -Office of Research and Development & Office of Environmental Information (Environmental Protection Agency) -Government Printing Office -NASA Scientific and Technical Information Program -National Agricultural Library (Department of Agriculture) -National Archives and Records Administration -National Library of Education (Department of Education) -National Library of Medicine (Department of Heath and Human Services) -National Science Foundation -National Technical Information Service (Department of Commerce) -Office of Scientific and Technical Information (Department of Energy) -USGS/Biological Resources Discipline (Department of Interior)


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)



Slide21 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 21: Multimedia Prototypes * Partnering with Microsoft on a prototype site, which demonstrates the audio searching of videos, available at: * https:www.msravs.com...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

From STI Sources to Customers ... This slide shows the flow in information through OSTI, from the sources of the STI to the customers who use the STI....


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 4: Science Progresses as Knowledge Is Shared OSTI corollary: If the sharing of knowledge - or knowledge diffusion - is accelerated, scientific progress is accelerated....


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 15: In Summary: Three Points on Nano Info Diffusion -Modeling - it's possible -Metadata - numeric data, unlike textual data, requires metadata to ensure access -Stewardship -...


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 2: Three Topics Relating to Nano Info Diffusion We see three complementary approaches to improve information sharing and awareness - Modeling - it's possible - Metadata -...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Flattening coefficient of aerosols collected on treated slides  

E-Print Network [OSTI]

collected from oleic acid and DOP (dioctylphthalate) aerosols, The microscope slides were made oilphobic by immersion in a widely used fluorocarbon sur- factant (NYE BAR Type CT 2X or 3' Co. Chemical FC-721). The mean value of F f' or oleic acid... was found to be 1. 338, and for DOP, 1. 354. There is no apparent variation of F with particle diameter for aerosols in the 2. 7-29. 1 um range. The slightly lower value of F for oleic acid suggests that the contact angle of oleic acid with respect...

Olan-Figueroa, Excel



Highly asymmetric Laue focusing monochromator  

SciTech Connect (OSTI)

By using two highly asymmetric Laue crystals in a dispersive arrangement with a circular profile (Oe 8 mm) we have created a sagittaly focusing Laue system for the first time. The crystallographic planes (111) of the two Si crystals formed an angle of 7.95 deg. with the entrance surface. The crystals dimensions were 40 mmx20 mm and the diffracting surface was a 0.5 mm thick neck between the two circular profiles. The 15.35 keV diffracted beam formed an angle of 0.55 deg. with the exit surface. The calculated focusing distance of the Laue-Laue focusing system was 14 m.

Oberta, P. [Institute of Physics, Academy of Sciences of the Czech Republic v.v.i., Na Slovance 2, Praha 8 (Czech Republic); Swiss Light Source, Paul Scherrer Institut, Villigen (Switzerland); Mikulik, P. [Department of Condensed Matter Physics, Faculty of Science, Masaryk University, Kotlarska 2, Brno (Czech Republic); Hrdy, J.; Kittler, M. [Institute of Physics, Academy of Sciences of the Czech Republic v.v.i., Na Slovance 2, Praha 8 (Czech Republic)



General Technical Base Qualification Equivalencies Based On Previous  

Broader source: Energy.gov (indexed) [DOE]

General Technical Base Qualification Equivalencies Based On General Technical Base Qualification Equivalencies Based On Previous Experience, 12/12/95 General Technical Base Qualification Equivalencies Based On Previous Experience, 12/12/95 "The header lists the general field of experience, Commercial Nuclear Power or Navy Nuclear Power Program, with all other categories under these two areas. The subheader lists the position title of the military or job category within that industry. The next level lists the qualification standard subject with the competencies associated with it listed below. To locate the equivalencies that you may claim, locate the position title of your prior military or job category, then find the qualification standards and listed competencies that apply to your current position. The competencies listed below the qualification standards are those you


Independent Oversight Focus Area Review, DOE Nuclear Facilities - April  

Broader source: Energy.gov (indexed) [DOE]

Independent Oversight Focus Area Review, DOE Nuclear Facilities - Independent Oversight Focus Area Review, DOE Nuclear Facilities - April 2010 Independent Oversight Focus Area Review, DOE Nuclear Facilities - April 2010 April 2010 Review of Specific Administrative Controls at DOE Nuclear Facilities The U.S. Department of Energy (DOE) Office of Independent Oversight, within the Office of Health Safety and Security occasionally reviews specific focus areas. Focus areas are aspects of safety programs that Independent Oversight determines warrant increased management attention based on reviews of performance data, inspection results, and operating experience across DOE sites. Due, in part, to operating experience and previous inspection results. DOE selected specific administrative controls (SACs) as a focus area. SACs are new or revised technical safety requirements (TSRs)


Focus Areas | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Mission » Focus Areas Mission » Focus Areas Focus Areas Safety With this focus on cleanup completion and risk reducing results, safety still remains the utmost priority. EM will continue to maintain and demand the highest safety performance. All workers deserve to go home as healthy as they were when they came to the job in the morning. There is no schedule or milestone worth any injury to the work force. Project Management EM is increasing its concentration on project management to improve its overall performance toward cost-effective risk reduction. This will involve review of validated project baselines, schedules, and assumptions about effective identification and management of risks. Instrumental in refining the technical and business approaches to project management are the senior


Some facts about weapon focus  

Science Journals Connector (OSTI)

Weapon focus refers to the concentration of acrime witness's attention on a weapon, and the resultant reduction in ability to ... that subjects made more eye fixations on the weapon than on the check, and fixat...

Elizabeth F. Loftus; Geoffrey R. Loftus; Jane Messo



Focus Area Tax Credits (Maryland)  

Broader source: Energy.gov [DOE]

Focus Area Tax Credits for businesses in Baltimore City or Prince Georges County enterprise zones include: (1) Ten-year, 80% credit against local real property taxes on a portion of real property...


Focus Groups | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Outreach & Collaboration » Focus Groups Outreach & Collaboration » Focus Groups Focus Groups A forum for interface between union worker representatives and senior DOE managers and stakeholders to address key issues and concerns from worker perspectives, share information regarding HSS activities and programs, and identify potential opportunities to work together to improve worker health and safety at DOE sites. Learn more about the HSS Focus Groups... Labor Management Meetings and Activities HSS provides forums for communication between labor and management related to worker health, safety and security improvements across the DOE complex. 10 CFR 851 Worker Safety and Health Program The 10 C.F.R. 851 Work Group promotes excellence in the implementation of 10 C.F.R. 851, "Worker Safety and Health" and continuous improvement in the


Global Warming Solutions Inc previously Southern Investments Inc | Open  

Open Energy Info (EERE)

Warming Solutions Inc previously Southern Investments Inc Warming Solutions Inc previously Southern Investments Inc Jump to: navigation, search Name Global Warming Solutions Inc (previously Southern Investments Inc) Place Houston, Texas Zip 77002 Sector Solar Product Developer of a combined PV and thermal energy solar system called light electric and thermal generator (LETG). Coordinates 29.76045°, -95.369784° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.76045,"lon":-95.369784,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Siemens Concentrated Solar Power Ltd previously Solel Solar Systems | Open  

Open Energy Info (EERE)

Siemens Concentrated Solar Power Ltd previously Solel Solar Systems Siemens Concentrated Solar Power Ltd previously Solel Solar Systems Jump to: navigation, search Name Siemens Concentrated Solar Power Ltd (previously Solel Solar Systems) Place Beit-Shemesh, Israel Zip 99107 Sector Solar Product Israel-based subsidiary manufacturing solar thermal electricity generation (STEG) components for power plants, also develops some of its own STEG projects. Coordinates 31.75°, 35° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.75,"lon":35,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Just the Right Size for Small Sample Dialysis! Now available: Trial-size packages of our versatile Slide-A-Lyzer MINI  

E-Print Network [OSTI]

Slide-A-Lyzer® MINI Dialysis Units Slide-A-Lyzer® Mini Tubes Slide-A-Lyzer® Mini Tubes Slide-A-Lyzer® Mini Units & Float For small-sample preparation (5-100 µl), nothing is more versatile than Pierce Slide new formats allow you to test the Slide-A-Lyzer® MINI Units as a single sample (microtube format

Lebendiker, Mario


Evaluation of a petroleum jelly slide technique for monitoring Oidium mangiferae conidia in mango orchards  

E-Print Network [OSTI]

Evaluation of a petroleum jelly slide technique for monitoring Oidium mangiferae conidia in mango mangiferae conidia in mango orchards. African Plant Protection 1(1): 51-54. A petroleum jelly slide technique disease, mango, Oidium mangiferae, petroleum jelly-coated spore trap. Powdery mildew, caused by the fungus


IS&JCH050207 Software Engineering, Chapter 6 Slide 0 of 55 Requirements Engineering Processes  

E-Print Network [OSTI]

environment. ©IS&JCH050207 Software Engineering, Chapter 6 Slide 7 of 55 Elicitation and analysis activities©IS&JCH050207 Software Engineering, Chapter 6 Slide 0 of 55 Chapter 6 Requirements Engineering Processes Processes used to discover, analyze, and validate system requirements ©IS&JCH050207 Software

Huang, Jung-Chang


SSB Functions as a Sliding Platform that Migrates on DNA via Reptation  

E-Print Network [OSTI]

SSB Functions as a Sliding Platform that Migrates on DNA via Reptation Ruobo Zhou,1 Alexander G Hughes Medical Institute, Urbana, IL 61801, USA 6Present address: Department of Chemistry and Chemical is perturbed, suggesting that even in crowded cellular conditions SSB can act as a sliding platform to recruit

Lohman, Timothy M.


Second-Order Sliding Mode Control for DFIG-Based Wind Turbines  

E-Print Network [OSTI]

Second-Order Sliding Mode Control for DFIG-Based Wind Turbines Fault Ride-Through Capability-based wind turbine using a high-order sliding mode control. Indeed, it has been recently suggested extra mechanical stress on the wind turbine drive train). Simulations using the NREL FAST code on a 1

Brest, Université de


Detecting research fronts in OLED field using bibliographic coupling with sliding window  

Science Journals Connector (OSTI)

Research fronts represent cutting edge studies in specific fields. One can better understand current and future development trends in the relevant field when updated with trends in research fronts. This study uses bibliographic coupling and sliding window ... Keywords: Bibliographic coupling, Citation windows, OLED, Research fronts, Sliding window

Mu-Hsuan Huang; Chia-Pin Chang



High-Order Sliding Mode Control of a DFIG-Based Wind Turbine  

E-Print Network [OSTI]

High-Order Sliding Mode Control of a DFIG-Based Wind Turbine for Power Maximization and Grid Fault have several advantages over the traditional wind turbine operating methods, such as the reduction = Doubly-Fed Induction Generator; WT = Wind Turbine; HOSM = High-Order Sliding Mode; MPPT = Maximum Power

Paris-Sud XI, Université de


DFIG Driven Wind Turbine Grid Fault-Tolerance Using High-Order Sliding Mode Control  

E-Print Network [OSTI]

DFIG Driven Wind Turbine Grid Fault-Tolerance Using High-Order Sliding Mode Control Mohamed (DFIG), control, second-order sliding mode, grid fault-tolerance. Nomenclature WT = Wind Turbine; DFIG increased currents, which may lead to converter failure. Achieving ride-through requirement for DFIG

Boyer, Edmond


Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 20 Slide 1 Defect testing  

E-Print Network [OSTI]

©Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 20 Slide 1 Defect testing l Testing programs to establish the presence of system defects #12;©Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 20 Slide 2 Objectives l To understand testing techniques that are geared

Scharff, Christelle


Nonlinear friction of a damped dimer sliding on a periodic substrate S. Gonalves,1,2,  

E-Print Network [OSTI]

Nonlinear friction of a damped dimer sliding on a periodic substrate S. Gonçalves,1,2, * V. M, USA (Received 23 July 2004; published 12 November 2004) The nonlinear sliding friction of a dimer over that the friction force has an approximate v-3 depen- dence if the velocity is sufficiently large

Kenkre, V.M.

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SSAT Module Slide 1: Hello, and welcome to this introduction to the Steam System Assessment Tool.  

E-Print Network [OSTI]

, and welcome to this introduction to the Steam System Assessment Tool. Slide 2: Technology Delivery, and software tools. This tool, the Steam System Assessment Tool, also known as `the Assessment Tool', or its your energy reduction goals. Slide 3: Now, we will show you the Steam System Assessment Tool

Oak Ridge National Laboratory


Safety Slides Rota/ng Sha3s AR-G2 Coue;e Fixture  

E-Print Network [OSTI]

Safety Slides ­ Rota/ng Sha3s 1 AR-G2 Coue;e Fixture · loose-fi@ng shirts max = 250 to 300 rad/s #12;Safety Slides ­ Rota/ng Sha3s 2 Pinch Points in Rota

Cohen, Robert E.


Sliding Mode Power Control of Variable Speed Wind Energy Conversion Systems  

E-Print Network [OSTI]

Sliding Mode Power Control of Variable Speed Wind Energy Conversion Systems B. Beltran, T. Ahmed power generation in variable speed wind energy conversion systems (VS-WECS). These systems have two variations. Index Terms--Wind energy conversion system, power generation control, sliding mode control

Boyer, Edmond


Surface folding in metals: a mechanism for delamination wear in sliding  

Science Journals Connector (OSTI)

...influential family of slip-line field (SLF) models [15], complemented by experiments...and typical of what is usually assumed in SLF analysis of sliding and deformation processing...patterns commonly assumed (or predicted) in SLF or upper bound analysis of sliding and deformation...



Information regarding previous INCITE awards including selected highlights  

Office of Science (SC) Website

Information regarding previous INCITE awards including selected highlights Advanced Scientific Computing Research (ASCR) ASCR Home About Research Facilities Accessing ASCR Supercomputers Oak Ridge Leadership Computing Facility (OLCF) Argonne Leadership Computing Facility (ALCF) National Energy Research Scientific Computing Center (NERSC) Energy Sciences Network (ESnet) Research & Evaluation Prototypes (REP) Innovative & Novel Computational Impact on Theory and Experiment (INCITE) ASCR Leadership Computing Challenge (ALCC) Science Highlights Benefits of ASCR Funding Opportunities Advanced Scientific Computing Advisory Committee (ASCAC) News & Resources Contact Information Advanced Scientific Computing Research U.S. Department of Energy SC-21/Germantown Building


Unusually large polarizabilities and previously unidentified atomic states in Ba  

Science Journals Connector (OSTI)

Electric polarizabilities of four even-parity states of atomic barium in the range 35?60036?000cm?1, excited via two successive E1 transitions, are measured using direct spectroscopy. Several states have polarizabilities more than two orders of magnitude larger than might be expected from the known energy levels of Ba, implying the existence of two previously unobserved odd-parity states nearby. These two states are located using Stark-induced excitation, and tentatively identified as (Xe)6s8pP0,23. The (also unusually high) polarizabilities of these states, as well as that of a third odd-parity state, are reported.

C.-H. Li; S. M. Rochester; M. G. Kozlov; D. Budker



Nivolumab in Previously Untreated Melanoma without BRAF Mutation  

Science Journals Connector (OSTI)

...symptoms), and the availability of tumor tissue from a metastatic or unresectable site for PD-L1 biomarker analysis. Key exclusion criteria were active brain metastases, uveal melanoma, and a history of serious autoimmune disease. Patients who had received adjuvant therapy previously were not excluded. Study... The global incidence of melanoma continues to rise, and the mortality associated with unresectable or metastatic melanoma remains high.1 Globally, 132,000 new cases of melanoma are diagnosed and an estimated 48,000 persons die from advanced melanoma each ...



Adenoid cystic carcinoma of the nasopharynx after previous adenoid irradiation  

SciTech Connect (OSTI)

In 1978, Pratt challenged the otolaryngology community to identify an incidence of malignancy in individuals who have previously received radium therapy to the nasopharyngeal lymphoid tissues. This case report is a direct response to that quest and presents a well documented adenoid cystic carcinoma evolving 23 years after radium applicator treatment to the fossa of Rosenmuller. Although a cause-and-effect relationship cannot be scientifically proven, the case history raises several important questions concerning the stimulating effects of radiation on the later onset of frank malignancy.

Sofferman, R.A.; Heisse, J.W. Jr.



Independent Oversight Focused Program Review, Argonne National...  

Broader source: Energy.gov (indexed) [DOE]

Focused Program Review, Argonne National Laboratory-West - May 2001 Independent Oversight Focused Program Review, Argonne National Laboratory-West - May 2001 May 2001 Focused...


Two?dimensional magnetohydrodynamic calculations of the plasma focus  

Science Journals Connector (OSTI)

Two?dimensional magnetohydrodynamic calculations on plasma focus experiments in the Mather geometry are described. The properties of the two?dimensional numerical solutions are discussed. Detailed results are given for a specific problem which compares favorably with experiment. The numerical solution for the plasma focus previously given by Potter has been rerun with substantial disagreement. Arguments are given to show that the Potter code is incorrect.

Stephen Maxon; James Eddleman



We have completed installing our upgraded Multi-Technique Spectrometer/Diffractometer (Slides 3-6), together with a newly completed five-axis variable-temperature sample manipulator (Slides 7-9), other  

E-Print Network [OSTI]

We have completed installing our upgraded Multi-Technique Spectrometer/Diffractometer (Slides 3-6), together with a newly completed five-axis variable-temperature sample manipulator (Slides 7-9), other mechanical upgrades to improve spectrometer rotation and provide a sixth axis of sample rotation (Slide 10

Fadley, Charles


Evaluation of previous remedial construction along the Duquesne Bluff  

Science Journals Connector (OSTI)

The Boulevard of the Allies is a major four lane roadway in Pittsburgh, Pennsylvania that is constructed atop a near vertical, 35 meter high rock slope known locally as the Duquesne Bluff. Stratigraphic relief observed on the bluff consists of alternating sequences of flat lying sedimentary deposits of sandstone, siltstone, shale, carbonaceous shale, claystone and limestone. Expsoure of alternating sequences of durable and less durable rock has resulted in differential weathering and the formation of precarious overhanging conditions. In the interest of motorist safety and roadway improvement, a major remedial program was undertaken by the Pennsylvania Department of Transportation (PennDOT) in the mid 1980s. Primary remedial activities included rock trimming, rock bolting, the construction of dental concrete buttressing for overhanging rock support and shotcrete slope facing to arrest continued weathering of less durable claystone and carbonaceous shale exposures. As part of a current roadway improvement project, PennDOT and their consultant, Gannett Fleming, Inc., are evaluating the performance of previous remedial construction and are developing preliminary alternatives for future remediation. This paper will discuss the slope geology, overall favorable performance of the previous remedial construction and unfavorable slope conditions that may have resulted from large scale trimming operations.

J.W. Kovacs; W.R. Adams Jr.



Magnetically focused liquid drop radiator  

DOE Patents [OSTI]

A magnetically focused liquid drop radiator for application in rejecting energy from a spacecraft, characterized by a magnetizable liquid or slurry disposed in operative relationship within the liquid droplet generator and its fluid delivery system, in combination with magnetic means disposed in operative relationship around a liquid droplet collector of the LDR. The magnetic means are effective to focus streams of droplets directed from the generator toward the collector, thereby to assure that essentially all of the droplets are directed into the collector, even though some of the streams may be misdirected as they leave the generator. The magnetic focusing means is also effective to suppress splashing of liquid when the droplets impinge on the collector.

Botts, T.E.; Powell, J.R.; Lenard, R.



A comparison of the dynamic stiffness of the Goldcrown GC-500 grinding machine for three slide designs  

SciTech Connect (OSTI)

This report provides a summary of the results obtained from the calculations that compare the dynamic stiffness of three slide design systems for the Goldcrown GC-500 centerless grinder; it also describes the models and procedures used to develop the calculations, the assumptions made, and the details that went into performing this work. The authors developed analytical models of the three Goldcrown slide designs and performed several computational studies to determine the dynamic stiffness of the designs. The three slide systems are hereafter referred to as the plane slide, the INA slide, and the polymer-coated slide. The plane slide is the dovetail slide and way traditionally used in machine tool designs. The INA slide is a design created by Goldcrown using INA Bearing Company recirculating roller bearings, and dampers on a rail guideway. The polymer-coated slide is a design using a low friction polymer coating for a modified plane slide system. A study of the drawings indicated that a comparison could be made, within a reasonable amount of time and effort, that would be indicative of the dynamic stiffness of the three designs if the machine was modeled as being composed of the following seven structural components: (1) the base, (2) the swivel plate, (3) the lower slide, (4) the upper housing, (5) the regulating wheel housing, (6) the ball screw, and (7) the in-feed body.

Bennett, J.G.; Goldman, P.; Williams, D.C.; Farrar, C.R.



Abstract--A study determined people's perceptions of many types of managed and unmanaged landscapes as represented on slides.  

E-Print Network [OSTI]

landscapes as represented on slides. In scenes of arid lands in the western United States, most respon- dents of respondentswereshown sets of color slides that illustrated various landscape com- ponents, structures, and management actions throughout the western United States. Slide sets represented objects photographed from fixed


Slide 2 What is the Office of Employee Assistance Services? The Office of Employee Assistance Services incorporates several employee services  

E-Print Network [OSTI]

Slide 2 What is the Office of Employee Assistance Services? The Office of Employee Assistance Development Slide 3 Why does FSU have an Office of Employee Assistance Services? The Office of Employee need it. Slide 4 How can the Office of Employee Assistance Services help me? The "Employee Assistance

Weston, Ken


ADA/EEO Talking Notes Slide 1-Welcome to the New Employee Orientation session presented by the Office of Equal  

E-Print Network [OSTI]

ADA/EEO Talking Notes Slide 1-Welcome to the New Employee Orientation session presented by the Office of Equal Opportunity & Compliance or EOC. Slide2-This overview will cover EEO, ADA, Retaliation in the workplace. Please direct any of your questions regarding today's overview directly to EOC. Slide 3-The

Weston, Ken


Methodology for Preparing an Oral Presentation of a Scientific Paper (I assume the talk is organized around slides/overheads)  

E-Print Network [OSTI]

is organized around slides/overheads) 1) Read the paper 2) Take whatever steps necessary to ensure that you constraints on your talk (time, method of presentation, etc.) 5) Determine how many slides/overheads you can use (The ACS recommends spending at least 2 minutes on each slide/overhead)) 6) Determine the levels

Dibble, Theodore


Fredericton, New Brunswick, 5 June 2010 CMS Summer Meeting slide 1 Modular Invariant Theory of the Cyclic Group  

E-Print Network [OSTI]

Fredericton, New Brunswick, 5 June 2010 CMS Summer Meeting ­ slide 1 Modular Invariant Theory Some Consequences Fredericton, New Brunswick, 5 June 2010 CMS Summer Meeting ­ slide 2 Modular 2010 CMS Summer Meeting ­ slide 3 #12;The Modular Group of Prime Order Modular Representation Theory

Wehlau, David


Aladdin Animation: Supplementary Notes These animated slides were designed for the investigation of the syntax of motion events.  

E-Print Network [OSTI]

Aladdin Animation: Supplementary Notes These animated slides were designed for the investigation embedded in the slides. These have been removed to make the presentation easier to adapt for future closely to particular slides (for context) and particular sound files (for uniformity of delivery). #12

Indiana University

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ashot Minasyan SQ-universality and residual properties. . . -slide #1 The SQ-universality and residual properties of  

E-Print Network [OSTI]

Ashot Minasyan SQ-universality and residual properties. . . - slide #1 The SQ-universality Main Results Ashot Minasyan SQ-universality and residual properties. . . - slide #2 SQ-universality and residual properties. . . - slide #2 SQ-universality A group G is called SQ-universal if any countable group

Minasyan, Ashot


Fluid-escape features as a precursor of a large sublacustrine sediment slide in Lake Le Bourget, NW Alps, France  

E-Print Network [OSTI]

Fluid-escape features as a precursor of a large sublacustrine sediment slide in Lake Le Bourget, NW Introduction Glacial lakes are prone to large-scale sediment slides and slumps owing to their high sediment slides are often associ- ated with catastrophic waves (seiche effect), especially when they occur

Gilli, Adrian


Ian Sommerville 2006 (mods by LNL) Software Engineering, 8th edition. Chapter 25 Slide 1 Managing people  

E-Print Network [OSTI]

©Ian Sommerville 2006 (mods by LNL) Software Engineering, 8th edition. Chapter 25 Slide 1 Managing Engineering, 8th edition. Chapter 25 Slide 2 From Facts & Fallacies Book, by Glass (which we discussed earlier) Software Engineering, 8th edition. Chapter 25 Slide 3 People in the process Without an understanding


Cleaning Glass Slides and Coverslips The following carriers can be purchased from the Fluoroware division of Entegris  

E-Print Network [OSTI]

Cleaning Glass Slides and Coverslips Materials The following carriers can be purchased from coverslips. - Handle for LCD Carrier (Polypropylene) / Catalog # A45-03-0603 For 3" glass slides. - Carrier and seal with cover. The glass is now ready for storage. Before Use - Before using a slide or coverslip

Fygenson, Deborah Kuchnir


Wildfires may contribute more to global warming than previously predicted  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wildfires may contribute more to global warming Wildfires may contribute more to global warming Wildfires may contribute more to global warming than previously predicted They suggest that fire emissions could contribute a lot more to the observed climate warming than current estimates show. July 9, 2013 Haze of smoke emanating from the 2011 Las Conchas, NM fire. Haze of smoke emanating from the 2011 Las Conchas, NM fire. Contact Nancy Ambrosiano Communications Office (505) 667-0471 Email "The fact that we are experiencing more fires and that climate change may increase fire frequency underscores the need to include these specialized particles in the computer models, and our results show how this can be done," Dubey said. Particle analysis shows "tar ball" effect is significant LOS ALAMOS, N.M., July 9, 2013-Wildfires produce a witch's brew of


Wildfires may contribute more to global warming than previously predicted  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wildfires may contribute more to global warming Wildfires may contribute more to global warming Wildfires may contribute more to global warming than previously predicted They suggest that fire emissions could contribute a lot more to the observed climate warming than current estimates show. July 9, 2013 Haze of smoke emanating from the 2011 Las Conchas, NM fire. Haze of smoke emanating from the 2011 Las Conchas, NM fire. Contact Nancy Ambrosiano Communications Office (505) 667-0471 Email "The fact that we are experiencing more fires and that climate change may increase fire frequency underscores the need to include these specialized particles in the computer models, and our results show how this can be done," Dubey said. Particle analysis shows "tar ball" effect is significant LOS ALAMOS, N.M., July 9, 2013-Wildfires produce a witch's brew of


Independent Oversight Focused Safety Management Evaluation, Idaho...  

Energy Savers [EERE]

Focused Safety Management Evaluation, Idaho National Engineering and Environmental Laboratory - January 2001 Independent Oversight Focused Safety Management Evaluation, Idaho...


Focus On.... Biodiversity and Conservation  

E-Print Network [OSTI]

Focus On.... Biodiversity and Conservation This resource guide aims to provide useful, detailed, high quality sources of information on biodiversity and conservation for students in Higher and Further into biodiversity and government bodies trying to implement conservation measures, but there are many others

Miranda, Eduardo Reck



Science Journals Connector (OSTI)

WORLDWIDE FOCUS ON NUCLEAR WASTE ... Volume grows and years pile up, but world lacks consensus on disposing of nuclear waste ... WHAT TO DO WITH SPENT nuclear fuel and high-level radioactive waste is a problem shared by much of the world. ...





E-Print Network [OSTI]

Winter 2010 EVENTS FOCUS: RUSSIA Tue, Jan 12, 4-5:30 pm WCED/CREES/Ford School Lecture. "U.S.-Russia Relations: Status of the `Reset'." John Beyrle, U.S. Ambassador to Russia. Co-sponsors: International Policy and literature, Oberlin College. Wed, Feb 3, 12-1:30 pm CREES Brown Bag. "Nostalgia in Post-Socialist Russia

Eustice, Ryan


Focused X-ray source  

DOE Patents [OSTI]

Disclosed is an intense, relatively inexpensive X-ray source (as compared to a synchrotron emitter) for technological, scientific, and spectroscopic purposes. A conical radiation pattern produced by a single foil or stack of foils is focused by optics to increase the intensity of the radiation at a distance from the conical radiator. 8 figs.

Piestrup, M.A.; Boyers, D.G.; Pincus, C.I.; Maccagno, P.




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

H-mode performance and pedestal H-mode performance and pedestal studies with enhanced particle control on Alcator C-Mod J.W. Hughes, B. LaBombard, M. Greenwald, A. Hubbard, B. Lipschultz, K. Marr, R. McDermott, M. Reinke, J.L. Terry MIT Plasma Science and Fusion Center American Physical Society 49th Annual Meeting of the Division of Plasma Physics Orlando, FL 14 November 2007 J.W. Hughes et al. "H-mode performance and pedestal studies with enhanced particle control on Alcator C-Mod" 49th APS-DPP, Orlando FL, 14 November 2007 Slide x of 9 Goal: Understand influences of particle control on H-mode behavior 2 Density control desirable in H-mode - Mitigate unwanted density rises that deteriorate confinement - Extend operation to lower collisionality for studies of ELMs and core density peaking


Turbocharger with sliding piston, and having vanes and leakage dams  

DOE Patents [OSTI]

A turbocharger having a sliding piston for regulating exhaust gas flow into the turbine wheel includes a set of first vanes mounted on a fixed first wall of the turbine nozzle and projecting axially toward an opposite second wall of the nozzle, and/or a set of second vanes mounted on the end of the piston and projecting in an opposite axial direction toward the first wall of the nozzle. For the/each set of vanes, there are leakage dams formed on the wall that is adjacent the vane tips when the piston is closed. The leakage dams are closely adjacent the vane tips and discourage exhaust gas from leaking in a generally radial direction past the vane tips as the piston just begins to open from its fully closed position.

Roberts, Quentin (Nancy, FR); Alnega, Ahmed (Thaon Les Vosges, FR)



IPAA; U. S. oil production to resume long slide  

SciTech Connect (OSTI)

This paper reports that although production rose slightly in 1991 in response to the Persian Gulf War, U.S. oil flow will resume its decline this year in downward trend that will persist at least until 2000. The independent Petroleum Association of America's supply/demand committee pegs crude oil production at less than 7.2 million b/d, down 2.9% from 1991 and the lowest level in 30 years. Crude oil production will continue sliding to 5.8 million b/d by 2000, the smallest volume since 1950. U.S. natural gas production will increase to 20.3 tcf by 2000 for a growth rate of almost 2%/year. Natural gas trade will increase, too, with imports rising to 2.7 tcf by 2000, an average of nearly 6%/year. U.S. natural gas exports to northern Mexico also are expected to grow.

Not Available



XPS analysis of 440C steel surfaces lubricated with perfluoropolyethers under sliding conditions in high vacuum  

SciTech Connect (OSTI)

This work presents the results of the X-Ray Photoelectron Spectroscopy (XPS) analysis of AISI 440C ball surfaces lubricated with perfluoropolyether (PFPE) oils after friction experiments under sliding conditions at high load in air and vacuum environments. The PFPE lubricants tested were Demnum S100, Fomblin Z-25, and Krytox 143AB. It was found that all the PFPE lubricants were degraded by sliding contact causing the formation of inorganic fluorides on the metallic surfaces and a layer of organic decomposition products. KRYTOX 143AB was the least reactive of the three lubricants tested. It was also found that metal fluoride formed at off-scar areas. This suggests the formation of reactive species, such as COF2 or R[sub f]COF, during sliding experiments, which can diffuse through the lubricant film and react with the metallic surfaces away from the contact region. Comparison of reference specimens before sliding with those that had undergone the sliding tests showed that the amount of non-degraded PFPE remaining on the surface of the balls after the sliding experiments was greater than that of the balls without sliding.

Herrera-Fierro, P.; Masuko, M.; Jones, W.R. Jr.; Pepper, S.V.



Computational simulation of plasma focus  

Science Journals Connector (OSTI)

The movement and shaping of the plasma sheet in a plasma focus is modeled by means of finite elements. The sheet is represented by conical segments carrying mass internal energy and momentum. The Lorentz force accelerates each element in its normal direction which leads to the continuous reshaping of the sheet. Tracking techniques should be applied to the nodes between the elements in order to avoid numerical instabilities. The results are compared against experimental data showing good agreement.

G. Correa-Reina; F. Casanova; M. Vnere; C. Moreno; H. Bruzzone; A. Clausse



Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 Slide07 * Fielded Search provides a very sophisticated search experience. * Reports fall into the disciplines of physics, chemistry, materials, biology, environmental sciences, energy technologies, engineering, computer and information science, renewable energy, and other topics of interest related to the DOE mission. The Information Bridge Advanced Search provides a variety of search fields for a very sophisticated search feature. Keep in mind that energy is not really a scientific discipline. Reports contained in the Information Bridge fall into the disciplines of physics, chemistry, materials, biology, environmental sciences, energy technologies, engineering, computer and information science, renewable energy, and other topics of interest related


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 The Science.gov Alliance 17 organizations from 13 agencies * Department of Agriculture National Agricultural Library United States Forest Service * Department of Commerce National Institute of Standards and Technology National Technical Information Service * Department of Defense Defense Technical Information Center * Department of Education National Library of Education * Department of Energy Office of Scientific and Technical Information * Department of Health and Human Services Food and Drug Administration National Institutes of Health National Library of Medicine * Department of Interior United States Geological Survey National Biological Information Infrastructure * Environmental Protection Agency Office of Environmental Information Office of Research and Development *


Slide15 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide15 Slide15 Slide15 Current WorldWideScience.org Sources * African Journals Online * Article@INIST (France) * Australian Antarctic Data Centre * Bangladesh Journals Online (BanglaJOL) * Canada Institute for Scientific and Technical Information * Catalogue of the TIB, German National Library of Science & Technology * CSIR Research Space (South Africa) * Czech Academy of Sciences Manuscriptorium * Czech Academy of Sciences Repository * Defence Research and Development Canada (Canada) * DEFF Global E Prints (Denmark) * DEFF Research Database (Denmark) * Digital Repository Service at National Institute of Oceanography (India) * Directory of Open Access Journals (Sweeden) * Electronic Table of Contents (ETOC) (United Kingdom) * Indian Academy of Sciences * Indian Institute of Science Eprints * Indian Institute of


Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide13 Slide13 Slide13 The FundRef Workflow FundRef Registry provides standard funder names to publisher manuscript tracking systems. Publishers ask authors to select correct funders and provide grant numbers upon manuscript submission. Funder information transferred to publisher production systems. Publishers send collected funder information in their CrossRef deposits. Funders and other stakeholders query FundRef API: Given funder & grant numbers, return DOIs of publication funded Given DOI, return funder identifiers and grant numbers associated with DOI Funding information displayed on publisher PDFs and websites using standard CrossMark UI. Governance to be determined: Funder Registry* Publisher System: Manuscript Tracking System Publisher Production Systems

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 Our Shared Vision world summit on the information society Geneva 2003 - Tunis 2005 Document WSIS-03/GENEVA/DOC/4-E 12 December 2003 In keeping with the vision of the World Summit on the Information Society (WSIS), WorldWideScience: * "strive [s] to promote universal access with equal opportunities for all to scientific knowledge and the creation and dissemination of scientific and technical information." * is the product of "new forms of solidarity, partnership and cooperation among governments and other stakeholders." * provides "equitable access to information for economic, social, political, health, cultural, educational and scientific activities." * "facilitates access to public domain information ..."


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 Founding Alliance Members Canada Institute for Scientific and Technical Information (CISTI) - Canada VTT Technical Research Centre of Finland (VTT) - Finland Institut de l'Information Scientifique et Technique (INIST) - France TIB - German National Library of Science and Technology - Germany Japan Science and Technology Agency (JST) - Japan Korea Institute of Science and Technology Information (KISTI) - Korea Scientific Electronic Library Online (SciELO) - Argentina, Brazil, Chile, Colombia, Portugal, Spain Council for Scientific and Industrial Research (CSIR) - South Africa African Journals Online (AJOL) - Representing 24 African countries British Library - United Kingdom Science.gov Alliance - United States International Council for Scientific and Technical Information


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Slide02 What Is OSTI? OSTI is a program within DOE's Office of Science, with a corporate responsibility for ensuring access to DOE R&D results. Since 1947! * Public access to unclassified, unlimited * Restricted access to classified and sensitive Energy Policy Act of 2005 "The Secretary, through the Office of Scientific and Technical Information, shall maintain within the Department publicly available collections of scientific and technical information resulting from research, development, demonstration, and commercial applications activities supported by the Department." "...the Department's role as a source of information...is unique and indispensable in the advancement of energy technologies."* -- from Quadrennial Technology Review press release


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Slide02 What Is OSTI? OSTI is a program within DOE's Office of Science, with a corporate responsibility for ensuring access to DOE R&D results. Since 1947! Public access to unclassified, unlimited Restricted access to classified and sensitive Energy Policy Act of 2005 "The Secretary, through the Office of Scientific and Technical Information, shall maintain within the Department publicly available collections of scientific and technical information resulting from research, development, demonstration, and commercial applications activities supported by the Department." "...the Department's role as a source of information...is unique and indispensable in the advancement of energy technologies."* -- from Quadrennial Technology Review press release


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 Slide05 Science.gov Databases Agriculture & Food * AGRICOLA * Center for Food Safety and Applied Nutrition (CFSAN) Technology Transfer Automated Retrieval System (TEKTRAN) Applied Science & Technologies * DefenseLINK Website * DOT National Transportation Library Integrated Search * DTIC S & T Database * National Institute of Standards and Technology Data Gateway * U.S. Patent & Trademark Office Database Astronomy & Space * NASA Technical Reports Server (NTRS) * SAO/NASA Astrophysics Data System (ADS) Biology & Nature * NBII National Biological Information Infrastructure Earth & Ocean Sciences * NOAA Photo Library * USGS Publications Warehouse Energy & Energy Conservation * DOE Information Bridge * Energy Citations


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Slide23 Developing Country Access Afghanistan Guatemala Nigeria Albania Guinea Pakistan Algeria Guinea-Bissau Palestinian Territories (West Bank/ Gaza) Angola Guyana Papua New Guinea Armenia Haiti Paraguay Azerbaijan Honduras Peru Bangladesh Indonesia Philippines Belize Iraq Rwanda Benin Jordan Samoa Bhutan Kenya Sao Tome and Principe Bolivia Kiribati Senegal Burkina Faso Kyrgyzstan Sierra Leone Burundi Lao People's Democratic Republic Solomon Islands Cambodia Lesotho Somalia Cameroon Liberia Sri Lanka Cape Verde Macedonia, The Former Yugoslav Republic of Swaziland Central African Republic Madagascar Tajikistan Chad Malawi Tanzania, United Republic of Colombia Maldives Thailand Comoros Mali Timor-Leste Congo Marshall Islands Togo Congo, The Democratic Republic of Mauritania Tonga


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Slide19 Founding Alliance Members * African Journals Online (AJOL) * British Library - United Kingdom * Canada Institute for Scientific and Technical Information (CISTI) * Council for Scientific and Industrial Research (CSIR) - South Africa * German National Library of Science and Technology (TIB) * Institut de l'Information Scientifique et Technique (INIST) - France * International Council for Scientific and Technical Information (ICSTI) * International Network for the Availability of Scientific Publications (INASP) * Japan Science and Technology Agency (JST) * Korea Institute of Science and Technology Information (KISTI) * Science.gov Alliance - United States * Scientific Electronic Library Online (SciELO) * VTT Technical Research Centre of Finland (VTT)


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 Slide20 42 Large Scientific Databases Agriculture & Food General Science AGRICOLA Code of Federal Regulations Center for Food Safety and Applied Nutrition (CFSAN) Federal Register Technology Transfer Automated Retrieval System (TEKTRAN) National Technical Information Service (NTIS) USDA Food and Nutrition Center Science.gov Websites Applied Science & Technologies Health & Medicine DefenseLINK Website Cancer.gov DOT National Transportation Library Integrated Search Centers Biologics Evaluation and Research (CBER) DTIC S & T Database Center for Drug Evaluation (CDER) National Institute of Standards and Technology Data Gateway ClinicalTrials.gov U.S. Patent & Trademark Office Database MedlinePLUS PubMed Astronomy & Space PubMed Central


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Slide04 Public Dissemination Obligations U.S. Government has long recognized its responsibilities to publicly disseminate unclassified STI. Atomic Energy Acts of 1946 and 1954 established a program for the dissemination of unclassified scientific and technical information and for the control of classified information. Energy Reorganization Act of 1974 defined responsibilities for developing, collecting, and making scientific and technical information available for distribution. Department of Energy Organization Act of 1977 provided for maintaining a central source of information and disseminating information. Energy Policy Act of 2005 "The Secretary, through the Office of Scientific and Technical Information, shall maintain within the Department publicly available collections of


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Slide19 OSTI Staff and Outreach * Valerie Allen - Immediate past Director of the Special Library Association's (SLA) Government Information Division (Served two consecutive one year terms) * Erin Anderson - 2009 Membership Chair, Tennessee Valley Chapter (formerly Southern Appalachian Chapter) of SLA - 2010 President-Elect, Tennessee Valley Chapter, SLA * Tim Byrne - 2009 Chair of the Depository Library Council for the Federal Depository Library Program * Presentation at the Federal Depository Library Program Conference-October 2009 * Exhibit at the ALA Annual Conference-June 2010 * Presentation at the Tennessee Library Association's Government Documents Roundtable-October 2009 * Support of the Office of Science Exhibit at AAAS 2010 * CENDI (longtime interagency collaboration)


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Slide02 Why Science.gov? * Information seekers* need to find U.S. government scientific and technical information quickly and easily, but information is dispersed across thousands of websites ("surface web") and databases ("deep web") at agencies, departments, and laboratories. The majority (>84%1) of the public uses large search engines rather than seek out individual online databases, thus a "Google-like" easy search with relevant results was desired. *Seekers include researchers, entrepreneurs, students, educators, policymakers, program managers, or the science-aware citizen with an interest in science and technology 1 Perceptions of Library and Information Resources, OCLC survey report, 2005. Add new comment Thumbnail


Slide05 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide05 Slide05 Slide05 ETDE's "Product" - ETDEWEB 3.8 million energy research, technology, and development (RTD) - the world's largest database of energy RTD information. "ETDEWEB is clearly the information system of reference; many national Web sites on energy RTD link to ETDEWEB." (source: European Commission, May 2005, "Energy RTD Information Systems in the European Research Area") Broad coverage of energy and environmental subjects: "Renewables" - 225,202 records "Fossil fuels" - 553,687 records "Energy Planning, Policy and Economy" - 195,408 records "Energy Conservation, Consumption and Utilization" - 166,833 records "Environmental" - 252,860 records Add new comment Thumbnail Mobile_320x340


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 Management of Scientific Text Is a Model for Numeric Data The senior STI managers from 12 U.S. federal agencies form an interagency working group called CENDI. Each agency has an organization to manage STI (Numeric data would need specialist administrator, or steward) Defense Technical Information Center (Department of Defense) Office of Research and Development & Office of Environmental Information (Environmental Protection Agency) Government Printing Office NASA Scientific and Technical Information Program National Agricultural Library (Department of Agriculture) National Archives and Records Administration National Library of Education (Department of Education) National Library of Medicine (Department of Heath and Human Services) National Science Foundation


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Slide22 Founding Alliance Members * Canada Institute for Scientific and Technical Information (CISTI) - Canada * VTT Technical Research Centre of Finland (VTT) - Finland * Institut de l'Information Scientifique et Technique (INIST) - France * TIB - German National Library of Science and Technology - Germany * Japan Science and Technology Agency (JST) - Japan * Korea Institute of Science and Technology Information (KISTI) - Korea * Scientific Electronic Library Online (SciELO) - Argentina, Brazil, Chile, Colombia, Portugal, Spain * Council for Scientific and Industrial Research (CSIR) - South Africa * African Journals Online (AJOL) - Representing 24 African countries * British Library - United Kingdom * Science.gov Alliance - United States * International Council for


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Slide02 Information Is Critical to Scientific Progress Scientific Progress Expertise Research and Scholarship Education Learning and Workforce Development Interoperability and operations Cyberscience Organizations Universities, schools Government labs, agencies Research and Medical Centers Libraries, Museums Virtual Organizations Communities Scientific Instruments Large Facilities, MREFCs, telescopes Colliders, shake Tables Sensor Arrays - Ocean, environment, weather, buildings, climate. etc Information Databases, Data repositories Collections and Libraries Data Access; storage, navigation management, mining tools, curation, privacy Networking Campus, national, international networks Research and experimental networks End-to-end throughput Cybersecurity Software Applications, middleware


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide20 Slide20 Slide20 Current WorldWideScience.org Sources * African Journals Online * Article@INIST (France) * Australian Antarctic Data Centre * Canada Institute for Scientific and Technical Information * CSIR Research Space (South Africa) * Defence Research and Development Canada (Canada) * DEFF Global E Prints (Denmark) * DEFF Research Database (Denmark) * Directory of Open Access Journals (Sweden) * Electronic Table of Contents (ETOC) (United Kingdom) * Indian Academy of Sciences * Indian Institute of Science Eprints * Indian Institute of Science Theses & Dissertations * Indian Medlars Centre * J-EAST (Japan) * J-STAGE (Japan) * J-STORE (Japan) * Journal@rchive (Japan) * Korea Science (Korea) * NARCIS (Netherlands) * Science.gov (United States) * Scientific


Magill, Arthur W. 1989. Monitoring environmental change with color slides. Gen. Tech. Rep. PSW-117. Berkeley, CA: Pacific Southwest Forest and Range Experiment  

E-Print Network [OSTI]

#12;Magill, Arthur W. 1989. Monitoring environmental change with color slides. Gen. Tech. Rep. PSW and use repeat color slides. Successful monitoring from slides requires the observer to determine on recreation sites and view landscapes. Slides taken at various intervals demonstrate how to detect differences

Standiford, Richard B.


AUGUST 2014 | DALHOUSIE BRAND GUIDE AND TOOL KIT Some of the slide layouts in the Dalhousie PowerPoint template contain text in the  

E-Print Network [OSTI]

AUGUST 2014 | DALHOUSIE BRAND GUIDE AND TOOL KIT Some of the slide layouts in the Dalhousie Power. Navigate to the VIEW tab. 2. Click the SLIDE MASTER button. 3. Choose the fifth thumbnail in the slide GUIDE AND TOOL KIT Some of the slide layouts in the Dalhousie PowerPoint template contain text

Dellaire, Graham


Tanks focus area. Annual report  

SciTech Connect (OSTI)

The U.S. Department of Energy Office of Environmental Management is tasked with a major remediation project to treat and dispose of radioactive waste in hundreds of underground storage tanks. These tanks contain about 90,000,000 gallons of high-level and transuranic wastes. We have 68 known or assumed leaking tanks, that have allowed waste to migrate into the soil surrounding the tank. In some cases, the tank contents have reacted to form flammable gases, introducing additional safety risks. These tanks must be maintained in the safest possible condition until their eventual remediation to reduce the risk of waste migration and exposure to workers, the public, and the environment. Science and technology development for safer, more efficient, and cost-effective waste treatment methods will speed up progress toward the final remediation of these tanks. The DOE Office of Environmental Management established the Tanks Focus Area to serve as the DOE-EM`s technology development program for radioactive waste tank remediation in partnership with the Offices of Waste Management and Environmental Restoration. The Tanks Focus Area is responsible for leading, coordinating, and facilitating science and technology development to support remediation at DOE`s four major tank sites: the Hanford Site in Washington State, Idaho National Engineering and Environmental Laboratory in Idaho, Oak Ridge Reservation in Tennessee, and the Savannah River Site in South Carolina. The technical scope covers the major functions that comprise a complete tank remediation system: waste retrieval, waste pretreatment, waste immobilization, tank closure, and characterization of both the waste and tank. Safety is integrated across all the functions and is a key component of the Tanks Focus Area program.

Frey, J.



Focus on rotary drill rigs  

SciTech Connect (OSTI)

This article discusses the drill rig, focusing on the rotary drill rigs. There are two principal drilling methods - rotary and percussion. In certain situations, percussion drilling is the most practical method, but for most applications, rotary drilling using the rotary-tricone bit with either steel-toothed cones or carbide inserts, is the common and accepted drilling technique. There are four principal reasons for a rotary drill rig: to provide power to the rotary-tricone bit; to provide air to clean the hole; to provide a life-support system for the rotary-tricone bits; and, to provide a stable and efficient platform from which to drill the hole.

Schivley, G.P. Jr.


Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Comparison of plasma focus calculations  

Science Journals Connector (OSTI)

A simple model for the current history of plasma focus experiments is presented. The presence of a leak current which does not pass through the plasma sheath is allowed. Results are found to compare quite well with those of much more sophisticated two?dimensional magnetohydrodynamic calculations. For the Frascati experiment which has detailed current measurements computed results do not agree with experimentally derived values. A reasonable match for the total current in the Frascati experiment can be found by lowering the leak current. Both total and leak current can be matched if a mass loss from the run?down region is allowed.

Peter G. Eltgroth



slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

slide12 slide12 slide12 This is the front page of Science.gov. It is the USA.gov designated site for science. Rather than describe all that's available from Science.gov, I'll point out a few specific things. Note that in addition to the Science Education websites which you'll see on another slide, see also on the left side of this screen, a couple of other education links under "Special Collections" - 1. Diversity Education is a link to The Science Diversity Center (SDC) is a web-based comprehensive one-stop science, technology, engineering, and mathematics (STEM) educational resource 2. Internships & Fellowships provides links to: * K-12 Students and Teachers * Undergraduate Students * Graduate Students/Postdoctoral Fellowships * College Faculty Members


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Slide06 Two Conferences The seeds for the concepts you are about to hear about are traceable to a workshop held at the National Academy of Science in 2000. The workshop was chaired by our moderator, Al Trivelpiece. With an immodest attempt at levity, I have shown the participants of the workshop on this slide. The participants recognized the enormous potential for advancing science presented by new and emerging electronic media. Even today, the Internet must still be considered new. Its emergence as a useful medium for communication really only dates from the first half of the 1990s, just a dozen years ago or so. It is a transformational technology still in its infancy. Our goal is to forge its application to the advancement of science. Add new comment


Robust stabilization of internally delayed uncertain systems via sliding mode control  

Science Journals Connector (OSTI)

The problem of robust stabilization of internally delayed uncertain systems via sliding mode controllers (SMC's) is studied in this paper. The robustness property and assymptotic stability of the system are di...

N. Luo; M. de la Sen



Slide13 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 13: Search for Nano Should Reach Text and Numeric Data -A Search for "nanotubes" finds many documents, but numeric data is harder to locate -Information centers, such as...


Sliding electric arc discharge as a means of aircraft trajectory control  

Science Journals Connector (OSTI)

The dynamics of sliding electric arc discharge and the formation of shock waves in the stages of leader motion and the electric arc development in a supersonic air flow behind ... (bar). The air flow in the discharge

V. S. Aksenov; V. V. Golub; S. A. Gubin; V. P. Efremov



Experimental investigation of the sliding electric frequency mode arc discharge in the subsonic and supersonic flow  

Science Journals Connector (OSTI)

The plasma of the discharge, initiated along a surface of wing or the fuselage, is promising aircraft control facility. Strong shock wave formation at air gap disruption by the sliding discharge (SD) changes a...

V.S. Aksenov; S.A. Gubin; K.V. Efremov; V.V. Golub



Micro and Nano-structure Development and Multiscale Physics at Sliding Metal Interfaces  

SciTech Connect (OSTI)

This final report describes research on the response of ductile materials to extreme loading conditions and high strain rates during impact combined with sliding friction. The work has involved a collaboration among two groups at Los Alamos National Laboratory and a tribology research grouup at The Ohio State University. The project involved experimental work and computer simulations at both laboratories and continuum mechanics analysis at OSU, supplemented by testing at AWE, Harwell, UK. Results demonstrated the importance of vorticity and mechanical mixing near the sliding interface in the development of nanocrystalline tribomaterial that is far from equilibrium. The work also revealed that strain rate sensitivity is an important materials property for determining the development of the velocity profile during sliding. As such, it is a property that is key to understanding the evolution of sliding behavior.

Rigney; David; A.



Micro and nano mechanics of materials response during instrumented frictional sliding  

E-Print Network [OSTI]

Over the past decade, many computational studies have explored the mechanics of instrumented normal indentation. In contrast, very few studies have investigated quantitative aspects of frictional sliding contact in the ...

Bellemare, Simon C. (Simon Claude)



slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

slide20 DOE Office of Scientific and Technical Information http:www.osti.gov Thank You Presenter: Lynn Davis davisl@osti.gov Presentation address: http:www.osti.govspeeches...


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

in several research projects that might prove fruitful in late 2008 or 2009. This slide shows an early prototype of work done by Teragram Corporation on Chinese-English...


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 11: Textual Research Results Are Available through Interagency Portal www.science.gov Provides access to 50 million pages of science information in a single query A parallel...


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Slide 23: Continuing to Adapt and Adopt We must do new things because what it means to manage STI in 2010 is very different than what it was even 10 years ago....


Development of Mechanical Systems for Automated Medical Slide Specimen Storage and Retrieval  

E-Print Network [OSTI]

and intriguing considering that improving medical systems can save the lives of patients. The Intelligent System and Automation Laboratory at the University of Kansas has created a prototype machine with the goal of making the process of medical slide specimen...

Wurtz, Joshua James



Akermanite in the Cascade Slide xenolith and its significance for regional metamorphism in the Adirondacks  

Science Journals Connector (OSTI)

Akermanite (Ak90) coexists with monticellite (Mo92) and wollastonite (Wo99...) in an unusual calc-silicate xenolith in anorthosite at Cascade Slide in the Adirondack Mountains, New York. Experimental results bear...

J. W. Valley; E. J. Essene



Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

In Summary: Search Results On this slide, the search is changed from "hydrogen" and "fuel cells" to "platinum" and "fuel cells," which yields 2,191 matches, and the first few...


Modelica Landing Gear Modelling and On-Ground Trajectory Tracking with Sliding Mode Control  

Science Journals Connector (OSTI)

A control system for an aircraft taxiing on ground based on sliding mode has been developed. The controller is capable to track the trajectory assigned in terms of longitudinal velocity and yaw rate and to dri...

Fabrizio Re



Do liquid drops roll or slide on inclined surfaces?  

E-Print Network [OSTI]

We study the motion of a two-dimensional droplet on an inclined surface, under the action of gravity, using a diffuse interface model which allows for arbitrary equilibrium contact angles. The kinematics of motion is analysed by decomposing the gradient of the velocity inside the droplet into a shear and a residual flow. This decomposition helps in distinguishing sliding versus rolling motion of the drop. Our detailed study confirms intuition, in that rolling motion dominates as the droplet shape approaches a circle, and the viscosity contrast between the droplet and the ambient fluid becomes large. As a consequence of kinematics, the amount of rotation in a general droplet shape follows a universal curve characterised by geometry, and independent of Bond number, surface inclination and equilibrium contact angle, but determined by the slip length and viscosity contrast. Our results open the way towards a rational design of droplet-surface properties, both when rolling motion is desirable (as in self-cleaning hydrophobic droplets) or when it must be prevented (as in insecticide sprays on leaves).

Sumesh P. Thampi; Ronojoy Adhikari; Rama Govindarajan



Geothermal Academy: Focus Center | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Academy: Focus Center Geothermal Academy: Focus Center Project objective: to develop a sufficiently robust data collection and analysis framework to: Accommodate many different...


Hydrogen Fuel Quality - Focus: Analytical Methods Development...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Fuel Quality - Focus: Analytical Methods Development & Hydrogen Fuel Quality Results Hydrogen Fuel Quality - Focus: Analytical Methods Development & Hydrogen Fuel Quality Results...

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy focusing in bubbly flows  

Science Journals Connector (OSTI)

Sonoluminescence cavitation damage at surfaces and cavitation in accelerating flows are realizations of spectacular levels of energy focusing in nature. In a resonant sound field a single trapped bubble of gas can focus the ambient sound energy by 12 orders of magnitude to generate a clocklike string of picosecond flashes of ultraviolet light. [Barber et al. Defining the unknowns of sonoluminescence Phys. Rep. 281 65 (1977)]. In more complicated geometries a high level of sound leads to the formation of hemispherical bubbles attached to an exposed surface. These bubbles also emit light and in addition damage the surface. Measurements show that the pulsation of these bubbles maintains the hemispherical symmetry [Weninger et al. Sonoluminescence from an isolated bubble on a solid surface Phys. Rev. E 56 6745 (1997)] thus raising the question as to whether cavitation damage is due to (micro)jets or imploding (hemispherical) shock waves. Finally flow through a Venturi tube generates a stream of bubbles which also emit subnanosecond flashes of light [F. B. Peterson and T. P. Anderson Phys. Fluids 10 874 (1967)]. Luminescence from an isolated trapped bubble in water seems to work well with any noble gas whereas luminescence from cavitating flows and surface bubbles is quite dependent on xenon [argon bubbles appear to give no light at all]. The width of the SL flash [Gompf et al. Phys. Rev. Lett. 79 1405 (1997) Hiller et al. Phys. Rev. Lett. 80 1090 (1998)] has been found to be independent of wavelength suggesting that light is emitted from a new high energy phase of matter?probably a cold dense nano?plasma. The key unknowns of SL are the size and temperature of the hot spot from which the light is emitted. Experiments aimed at measuring these quantities will be discussed. [Research supported by the NSF.] a)Present address: CMS Los Alamos National Laboratories Los Alamos NM. b)Present address: Lucent Technologies Murray Hill NJ.

Seth Putterman; Keith Weninger; Robert A. Hiller; Bradley P. Barber



Welcome to the latest issue of Harvard Medicine News, a weekly electronic publication that will continue to chronicle the extraordinary world of HMS, previously reported in Focus. [More  

E-Print Network [OSTI]

In Twitter YouTube Featured Events 09.17.13 Leadership Forum: What's Next for Health Care Reform? Waterhouse colleagues, but the question is why. MORE » Headed to Washington? HMS health care policy expert Richard Frank Chase Harvard Health Publications Compass Blog Diabetes and Depression Scientists are homing

Yellen, Gary


Comparison of Joint Modeling Approaches Including Eulerian Sliding Interfaces  

SciTech Connect (OSTI)

Accurate representation of discontinuities such as joints and faults is a key ingredient for high fidelity modeling of shock propagation in geologic media. The following study was done to improve treatment of discontinuities (joints) in the Eulerian hydrocode GEODYN (Lomov and Liu 2005). Lagrangian methods with conforming meshes and explicit inclusion of joints in the geologic model are well suited for such an analysis. Unfortunately, current meshing tools are unable to automatically generate adequate hexahedral meshes for large numbers of irregular polyhedra. Another concern is that joint stiffness in such explicit computations requires significantly reduced time steps, with negative implications for both the efficiency and quality of the numerical solution. An alternative approach is to use non-conforming meshes and embed joint information into regular computational elements. However, once slip displacement on the joints become comparable to the zone size, Lagrangian (even non-conforming) meshes could suffer from tangling and decreased time step problems. The use of non-conforming meshes in an Eulerian solver may alleviate these difficulties and provide a viable numerical approach for modeling the effects of faults on the dynamic response of geologic materials. We studied shock propagation in jointed/faulted media using a Lagrangian and two Eulerian approaches. To investigate the accuracy of this joint treatment the GEODYN calculations have been compared with results from the Lagrangian code GEODYN-L which uses an explicit treatment of joints via common plane contact. We explore two approaches to joint treatment in the code, one for joints with finite thickness and the other for tight joints. In all cases the sliding interfaces are tracked explicitly without homogenization or blending the joint and block response into an average response. In general, rock joints will introduce an increase in normal compliance in addition to a reduction in shear strength. In the present work we consider the limiting case of stiff discontinuities that only affect the shear strength of the material.

Lomov, I; Antoun, T; Vorobiev, O



Previous Workshops  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

About ESnet Overview ESnet Staff Governance Our Network Case Studies ESnet Strategic Plan ESnet Organizational Chart ESnet History Science Requirements Network Requirements...


Nanofriction Mechanisms Derived from the Dependence of Friction on Load and Sliding Velocity from Air to UHV on Hydrophilic Silicon  

Science Journals Connector (OSTI)

This paper examines friction as a function of the sliding velocity and applied normal load from air to UHV in a scanning force microscope (SFM)...

A. Opitz; S. I.-U. Ahmed; M. Scherge; J.A. Schaefer



Slide4 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide4 Slide4 Slide4 Science.gov Integrated Search Portal: Single Query of Science.gov Databases and Websites Integrates simple search interface with database functionality & searches in real time: over 40 databases of 14 U.S. science agencies 200 million pages of science information Thousands of authoritative scientific websites within .gov domain/sponsorship Science.gov helps users identify databases for more advanced searching as needed Science.gov results are uniquely different from Google and Google Scholar results 95.8% of the time less than 1% overlap with Google approximately 3.2% overlap with Google Scholar Key Features Clusters results EurekAlert! Science News Wikipedia links Download capabilities Relevancy ranked results Alerts service Search within a search


Slide22 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide22 Slide22 Slide22 Here's how it works ... 1. A Chinese scientist submits a query in Chinese to Multilingual WorldWideScience.org. 2. MWWS.org uses Microsoft to translate the Chinese query into individual languages of source databases (English, French, Portuguese, Russian, etc.) 3. MWWS.org sends the translated queries to corresponding databases, which search their contents and return results in native languages to MWWS.org. 4. MWWS.org uses Microsoft to translate native language results into Chinese and presents results to the user in relevance-ranked order. Conversely, an English-speaking user could have a query translated into languages of non-English databases and then get results back in English. Add new comment Original Thumbnail Mobile_320x340 Icon_64x64


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Slide14 Enhancements & Updates science.gov USA.gov for SCIENCE Version 5.0 FY 10 Enhancements: * An aggregated RSS news feed, populated by 11 participating agencies, now appears on the main page of Science.gov. - Provides one stop for major science agency news feeds. - A rolling window of the most current news from each of the participating agencies, with a MORE link offering news from the past 24 hours. * The Science.gov Internships and Fellowships section is very popular. - A new search capability on this section was applied in September to provide the opportunity to both browse and search for science internships and fellowships. * Federal science sites available via Science.gov are now at about 2100 contributed by 18 organizations within 14 agencies.


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 Google, non-Googleable evolution Google: v., to search for information through Google Googleable: adj., information found by Googling Non-Googleable: adj., information that cannot be found by Googling In fact, much of the information on the Web is inherently unavailable to Google and Yahoo! This key limitation would come as a surprise to many Web users, especially young students. The concept that if you "Google" long enough you can find it, is so firmly entrenched in the Web-cognizant public, that the word "Google" has been elevated to a verb. In the Web-savvy vernacular, "To Google" of course means to search the Web using the Google search engine. For example, to find information about the interagency organization CENDI, one "Googles" CENDI.


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 Slide18 Just this week, we have released a new version of WorldWideScience.org that includes the Clustering capability. I will illustrate this capability with a screen shot of it from Science.gov. In many ways WorldWideScience.org is modeled after Science.gov. A search on "fuel cells" has produced the relevance ranked results list shown in the middle of the screen. To the left, clusters of results based on similar keywords and concepts also add value for the user. Clustering search results into more precise subtopics helps the patron to further refine his or her search and drill down to the information needed more quickly. By simply clicking on the cluster of interest, those results are immediately displayed. Then, each one of those clusters can be displayed in an even more granular fashion.


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 OSTI Products For specific document or media types Information Bridge DOE Data Explorer ScienceCinema E-Print Network DOepatents ESTSC DOE Green Energy DOE R&D Accomplishments Science Conference Proceedings Energy Citation Database Aggregator Products - federated search Science Accelerator - Integrates key DOE databases Covers a range of R&D results (reports, patents, citations, e-prints, etc.) Science.gov - Integrates 12 U.S. federal science agencies Databases and websites offer over 200 million pages of science information WorldWideScience.org - Integrates >70 nations Provides over 400 million pages of science information from databases and portals worldwide; performs multilingual search across 10 languages; translation of English content for non-English speakers and non-English


Slide25 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide25 Slide25 Slide25 Science.gov Interface similar to Google Under the hood, NOT like Google * USA.gov's portal for science * Resources represent 97 percent of the federal R&D budget! Departments of Agriculture, Commerce, Defense, Education, Energy, Health and Human Services, the Interior, Environmental Protection Agency, Library of Congress, National Aeronautics and Space Administration, National Science Foundation, United States Government Printing Office, and the National Archives and Records Administration Another OSTI federated search product that you may be familiar with is Science.gov. The Science.gov Alliance consists of 17 scientific and technical organizations from 13 federal agencies. Science.gov searches over 36 databases and 1,850 selected websites,


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Slide11 OSTI, through federated search, ensures access to non-Googleable science Volume of Content Made Searchable by OSTI WorldWideScience.org: 400,000,000 pages of Global Scientific and Technical Information (STI) These web-available pages would fill 62,000 traditional 2-feet deep file drawers. Science.gov: 200,000,000 pages of U.S. Government STI These web-available pages would fill 33,000 traditional 2-feet deep file drawers. STIP Collection: 11,400,000 pages of U.S. Department of Energy STI These web-available pages would fill 1,900 traditional 2-feet deep file drawers. Amount of Data Transferred in FY08: 9.95 terabytes Through OSTI products, librarians, researchers and the public can access a science page count comparable to, but not duplicative of, Google's entire


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 Breakthroughs and Enhancements (Information Bridge) FY09 Enhancements: * Provides Free public access to more than 211,973 full-text DOE documents (last year 10/2008 188,139 full-text) * Expanding in full text digitization efforts via multiple approaches (30,000-35,000 legacy documents were digitized as result of INIS microfiche digitization project) * Search results: - possible alternative spelling suggestions, - clustering of authors and subjects, - capacity to create Alerts on the fly, - capability to export citations using Endnote or Zotero * Web 2.0: Widgets and Share features added * Spell check when using Basic Search: when a word is spelled incorrectly, offers options to the spelling used * News features and ability to participate in Document Discussions


Slide09 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide09 Slide09 Slide09 WorldWideScience.org & Federated Search Technology Many popular search engines rely on crawler-based technology * Google * Yahoo! * MSN WorldWideScience.org implements federated searching to provide its encompassing coverage of global science and research results. It is a little known fact that many of the popular search engines overlook a large portion of the web. Their technology relies upon crawlers, which find and visit websites one at a time by following hyperlinks. Each time a crawler finds a page, it indexes it. The index is then merged with the master index, and when the user does a search, the query is actually applied against the master index. When there is a match, the results are to hyperlinks indexed sometime in the past.


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Slide11 Serving the Nation... by Sharing Science www.osti.gov 1940's Atomic Energy Commission created Nuclear Science Abstracts began 1950's Microfiche & Full-Text Docs to Depository Libraries Atoms-For-Peace Program 1960's Computer Technology implemented International cooperations put in place (IAEA) 1970's AEC became Energy Research and Development Administration Energy Database (EDB) began, broadened info scope ERDA became Dept of Energy Dept Directive DOE O 1340.1 includes technical reports 1980's International Energy Technology Data Exchange (ETDE) Charter member of CENDI Database Structure DOE STI Directives created 1990's Digitization of Report Literature Began Innovation of Multiple Internet Age Tools STIP Strategic Plan Adopted Dublin Core Electronic STI


Slide19 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide19 Slide19 Slide19 Types of STI Required Distinct Tools DOE research community produces many types of scientific and technical information, each of which has its own unique characteristics and life cycle As a consequence, OSTI set out to create new web-based tools for each type of STI and make it efficiently accessible to users As I mentioned, scientific and technical information resulting from the Department's diverse research and development efforts takes many forms. Technical reports, e-prints, conference papers, are but a few examples of the types of the types of STI produced. Each of these of these types of STI has its own unique characteristics and life cycle and as a result OSTI must frequently create distinct tools to virtually collect each type and make it accessible to users.


Slide18 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide18 Slide18 Slide18 Enhancements & Updates Energy Technology Data Exchange FY10 Enhancements: * ETDEWEB new features include: OpenURL capability (any libraries interested can contact us); subject clustering as a way to narrow searches; updated Federated Search with a few new sources and new features; and, the capability to suggest additions to the database * Developing country access to ETDEWEB has increased again; the count is now around 100 countries, and member country territories are now also permitted access * As of 1 Sep 2010: Total Bibliographic records available: 4,367,000 Total records with full text available onsite: 356,000(significant increase) Total records with Digital Object Identifier (DOI) links: 1,034,000 * Many thousands more have URLs linking to sites worldwide that make the


Slide02 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide02 Slide02 Slide02 Advances in energy technology depend on the diffusion of knowledge. To be truly committed to the field of information and communication, we have to believe that information, or knowledge, or whatever form of communication we are promoting is valuable, meaningful, and has an impact on the future. Energy technology, indeed any field of science, is very much a cumulative field, where we use our own knowledge to build on the work of others to come up with even better ideas and innovation. This cumulative cycle of building on the information from someone else, over and over again, has delivered us to the state of technology and the standard of living we have today. This premise goes back to the beginning of time, and was perhaps most famously summed up by Sir Isaac Newton, when he said: "If I have seen


Slide24 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide24 Slide24 Slide24 Through such efforts as clustering, alerts services, and translations, WorldWideScience.org complements other trends in global scientific communication. National research organizations recognize the importance of increasing visibility of their R&D outputs, even in very small countries. At the same time, full-text information accessibility has increased. Through the innovative combinations of federated search and other technologies, scientists and citizens across the globe now have unprecedented access to scientific knowledge. Thus, the availability of WorldWideScience and the formation of the Alliance tomorrow are historic events. Thank you again to ICSTI for their sponsorship, and to all of the WorldWideScience Alliance Members and source owners. We look forward to a

Note: This page contains sample records for the topic "focus previous slide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide10 Slide10 Slide10 Web Is Transformational Technology for Sharing Knowledge Web is still young, and will certainly hold surprises as it evolves, just as another well-known transformational technology held surprises ... Just as the web first captured public imagination about 1994, the automobile first captured public imagination about 1903 when Henry Ford introduced his first mass produced car. In the years that followed, Ford made very significant technological progress. Fourteen years later, in 1917, Ford offered electric lights, secure doors, a roof, and numerous improvements under the hood. We have now reached the fourteenth birthday of the web, and it, too, has evolved dramatically. We now have enormous content, better browsers, search engines, and databases on the web which can be federated.


Slide14 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide14 Slide14 Slide14 More Research Results E-print Network - a searchable gateway to over 500,000 documents, access to more than 16,000 scientific Web sites DOE R&D Accomplishments - where you can find remarkable advances in science Our interagency collaborations: Federal R&D Project Summaries Science.gov: 50 million pages All-in-all: 35 million transactions per year Speaker Notes: Other research results: E-print Network is a searchable gateway to preprints, papers, and other documents circulated among the research community. We now have over 500,000 documents and access to more than 16,000 scientific Web sites. DOE R&D Accomplishments - that's where you can find remarkable advances in science. And our collaborations: Federal R&D Project Summaries - it's a unique window to the


slide10 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

slide10 slide10 slide10 Another resource searchable from the Science Accelerator is the DOE R&D Accomplishments database. It has a diversity of accomplishments, including: * Decoded three DNA chromosomes (5, 16, and 19) [Human Genome] * Contributed to nuclear medicine, including radiation and cancer therapy [Cancer Therapy] * Created the first self-sustaining nuclear chain reaction [Fermi] * Discovered over eight of the elements on the Periodic Table [Seaborg] * Developed the battery that powered the lunar lander module and other spacecraft [RTG] * Invented the cyclotron (an early accelerator) [Lawrence] * Provided evidence as to why dinosaurs are extinct [Alvarez] For Science Accelerator then, the E-print Network and DOE R&D Accomplishments are a couple of sample databases you can search among 10.


Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Slide23 Criteria for a DOE Public Access Model Enables LONG-TERM free access by the public to the "best available version" of peer-reviewed scientific and technical information sponsored by DOE. Enables single search box of all DOE-sponsored research literature without requiring that articles be in a centralized collection. Maintains a comprehensive metadata collection in order for the agency to fully account for its scholarly output. Preserves the freedom of researchers to promote and disseminate their research, i.e., preserves researchers' choice in selecting the journal to which they wish to submit manuscripts Recognizes the value added by publishers in providing high-quality scholarly communications and research tools and accommodates flexible


Slide06 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide06 Slide06 Slide06 Current WorldWideScience.org Sources African Journals Online Article@INIST (France) Australian Antarctic Data Centre Canada Institute for Scientific and Technical Information CSIR Research Space (South Africa) Defence Research and Development Canada (Canada) Directory of Open Access Jornals (Sweeden) DEFF Global E Prints (Denmark) DEFF Research Database (Denmark) Electronic Table of Contents (ETOC) (United Kingdom) Indian Academy of Sciences Indian Institute of Science Eprints Indian Institute of Science Theses & Dissertations Indian Medlars Centre J-EAST (Japan) J-STAGE (Japan) J-STORE (Japan) Journal@rchive (Japan) Korea Science (Korea) NARCIS (Netherlands) Science.gov (United States) Scientific Electronic Library Online (Argentina, Brazil, Chile,


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 Slide08 * Agencies brought to the Internet table their unique information specialties and resources * Flagship service a commitment * Notable contributions of many: * Science.gov Alliance and CENDI - seized opportunity without mandate * FirstGov.gov - supported the early stages through advice and two grants * Member agencies - provided ~200 staff members to working teams * U.S.Geological Survey - manages website search engine * Commerce's NTIS - created initial catalog of websites * Information International Associates, Inc. - secretariat support * DOE/OSTI - conceived idea, developed technologies/deep web search and hosts website * Department of Agriculture and USGS - provided Science.gov Alliance co-chairs Add new comment Thumbnail Mobile_320x340 Icon_64x64


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide01 Slide01 Slide01 WorldWideScience.org Accelerating Global Scientific Discovery Walter L. Warnick, Ph.D. Director United States Department of Energy Office of Scientific & Technical Information (Operating Agent for WorldWideScience.org) Washington, D.C., United States Good afternoon and thank you for that introduction. Thank you to KISTI for hosting this conference and to both KISTI and ICSTI for organizing it. I will begin my talk by explaining what is WorldWideScience. WorldWideScience begins with the observation that many countries publish scientific and technical information on the web. We call the sites where this information is posted a "national science portal." National portals can take a variety of forms, from a collection of conventional web pages,


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Slide11 Eclipsing Current Search Technology Google is capitalizing on this early era of web technology and is hugely successful, powering more than half the world's searching. But we must remember that we are just in the beginning of this transformation. Further technological transformations may very well eclipse today's search technology! A new, promising technology now emerging: federated search The technology used by Google and Yahoo does most of its work in anticipation of users doing searches. Their technology relies upon crawlers, which are computers that find and visit web sites one at a time, typically by following hyperlinks. Each time the crawler finds a page, it indexes it, which might be considered something akin to making an alphabetical list of words on that page. This index is then merged with a


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Slide12 Much of Science Is Non-Googleable In fact, the vast majority of science information is in databases within the deep Web - or the non-Googleable Web - where popular search engines cannot go. We in the information business need to recognize this gap between availability and need, and seize the opportunity to... Provide science information consumers with better tools. The bulk of science information, especially scholarly science information, resides in databases. Crawlers can get to the first page of a database, but, typically, they cannot get past the front page. The databases search box is often the only systematic way to see the contents of the database, and the crawler cannot deal with that search box. The part of the web that is off limits to crawlers is called the deep Web.


Slide03 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide03 Slide03 Slide03 Often the knowledge scientists need resides in distant communities Nor do we depend just on the work of giants. We also depend on our colleagues down the hall, or at another lab, as well as a myriad of other researchers we do not know. According to the National Science Foundation, there are over 2.5 million research workers worldwide, with more than 1.2 million in the U.S. alone.1 If we look at all the articles, reports, emails and conversations that pass between them, we could count billions of knowledge transactions every year. This incredible diffusion of knowledge is the very fabric of science. Given that the diffusion of knowledge is central to science, it behooves us to see if we can accelerate it. We note that diffusion takes time.


slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

slide08 slide08 slide08 Single Query Searching Search 10 OSTI databases containing: * DOE citations * DOE full-text documents * DOE patents * DOE project summaries * Energy science * Energy science & technology software * E-prints from around the world * Federal project summaries * R&D accomplishments * Science conference proceedings * Worldwide energy databases & websites Among the important DOE databases searchable via Science Accelerator is the E-print Network (includes 1 million documents & 30,000 Web sites) and Information Bridge (includes over 200,000 DOE full-text reports). Let's look at a couple of these databases more closely and what you can find in them: * E-prints from around the world, and * R&D Accomplishments Add new comment Thumbnail


Slide28 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide28 Slide28 Slide28 WorldWideScience.org * A federation of the leading science portals sponsored by the governments and national institutions of over 50 countries * A quantity of science (more than 375 million pages from every inhabited continent) comparable to, but not duplicative of, Google's entire science content. * A breakthrough in content enabled by breakthrough technology Let me show you WorldWideScience.org, a global science gateway connecting you to national and international scientific databases and portals One-stop searching of 45 databases and portals from more than 50 countries. Users have much-needed access to both prominent as well as smaller, less well-known sources of highly valuable science. Science.gov is the U.S. contribution to WorldWideScience.org.


Slide17 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide17 Slide17 Slide17 Energy Citations Database Contains over 2.3 million citations * Nuclear Science Abstracts, 1948-1976 * Energy Research Abstracts, 1976-1995 * Entire Information Bridge Energy Citations Database is the comprehensive database for STI reports from the AEC, ERDA, and DOE. Energy Citations Database contains over 2.3 million citations, including technical reports, books, conference proceedings and papers, journal articles, patents, software manuals, and thesis and dissertations To help you know when to use the ECD, here is what it contains: * ECD contains the contents of Nuclear Science Abstracts covering 1948-1976. NSA provided international coverage of nuclear energy information from the U.S. government, foreign governments, private publishers, associations and


Slide07 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide07 Slide07 Slide07 The OSTI Corollary Premise: Science advances only if knowledge is shared Corollary: Accelerating the sharing of scientific knowledge accelerates the advancement of science Accelerating the advancement of science benefits DOE researchers, the Nation, and the world -- OSTI works on the premise that speeding and sharing knowledge will accelerate the advancement of science and thus accelerate benefits to DOE researchers, the Nation, and the world -- OSTI continually seeks to expose more of the world's STI to researchers and the public with the belief that this approach will help transform our understanding of energy and matter, and assist our researchers advance the national, economic, and energy security of the United States Add new comment Original


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide04 Slide04 Slide04 Larry Page, speaking to scientists, AAAS 2007 "Virtually all economic growth (in the world) was due to technological progress. I think as a society we're not really paying attention to that." He called on the scientists to make more of their research available digitally. "We have to unlock the wealth of scientific knowledge and get it to everyone." By the way, I want to make it perfectly clear that I am not saying anything more about Google than Google is saying about itself. Google founder Larry Page personally delivered a speech at this year's annual meeting of the American Association for the Advancement of Science (AAAS) where he lamented that much of science is not available for Google to retrieve. The July 27 issue of Science Magazine presented an article by a Google Research


Slide08 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide08 Slide08 Slide08 Legacy Collection Resources Here is an idea of the collections included: National Labs, universities, organizations' or individuals' own collections. The information is detailed and will be available online for your convenience after the conference. Handouts are also available. Of course, some of these numbers are still growing... National Laboratories: Brookhaven 130 Idaho 262 * Lawrence Berkeley 616 Lawrence Livermore 397 Los Alamos 613 NREL 13 Oak Ridge 117 Sandia 417 Organizations or Individuals: Dick Benoit 9 Dave Blackwell 66 GRC 16 ** Meridian 74 *** Ted Mock 19 OIT Geo-Heat Center 80 * PERI 163 Rogers Eng. Co., Inc. 38 Sentech 115 Universities: California, San Diego, LA, Riverside 10 Duke 6 Penn State 10 Southern California 17 Southwestern Louisiana 17


Slide25 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide25 Slide25 Slide25 OSTI & Google April 4, 2007 Google moves ahead with plan to open up federal Web sites Google is making strides on an initiative to make information stored on public government Web sites more accessible to people looking for it, but challenges remain, officials with the search engine company said Wednesday. Three federal organizations recently agreed to structure their sites to make them accessible for nearly all Internet searches, the officials said. Information on the Plain Language Web site aimed at eliminating jargon in government communications, and on sites by the Energy Department's Office of Scientific and Technical Information and the Education Department's National Center for Education Statistics, has been opened up to the three


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Slide12 Google works to solve the problem, but there's a better way ... Google moves ahead with plan to open up federal Web sites. Google is making strides on an initiative to make information stored on public government Web sites more accessible to people looking for it, but challenges remain, officials with the search engine company said Wednesday. Three federal organizations recently agreed to structure their sites to make them accessible for nearly all Internet searches, the officials said. Information on the Plain Language Web site aimed at eliminating jargon in government communications, and on sites by the Energy Department's Office of Scientific and Technical Information and the Education Department's National Center for Education Statistics, has been opened up to the three


Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide11 Slide11 Slide11 Here's how it works ... 1. A Chinese scientist submits a query in Chinese to Multilingual WorldWideScience.org. 2. MWWS.org uses Microsoft to translate the Chinese query into individual languages of source databases (English, French, Portuguese, Russian, etc.) 3. MWWS.org sends the translated queries to corresponding databases, which search their contents and return results in native languages to MWWS.org. 4. MWWS.org uses Microsoft to translate native language results into Chinese and presents results to the user in relevance-ranked order. Conversely, an English-speaking user could have a query translated into languages of non-English databases and then get results back in English. Add new comment Original Thumbnail Mobile_320x340 Icon_64x64


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide12 Slide12 Slide12 Times Have Changed Responsibilities Remain the Same But the Technologies and the Execution Are Dramatically Different -- Clearly, times have changed, but OSTI still has many of the same responsibilities. However, the technologies and the way in which we execute our responsibilities have changed dramatically. -- To give you some idea of how much things have changed, we need only compare data from a few years ago. -- You can see the many web-enabled milestones that have been pioneered by OSTI. -- In 1993, OSTI distributed 5 million pieces of paper/microfiche. Last year, we had more than 84 million customer transactions. -- For explanation purposes, OSTI considers a customer transaction to occur when a user of an OSTI system is presented with information he/she did not