Sample records for fo rm eia-80

  1. Heavy Construction Internship Program RegistRation foRm

    E-Print Network [OSTI]

    Haykin, Simon

    in this program, it must relate to the Heavy Construction industry, be a minimum of 35 hours per weekHeavy Construction Internship Program RegistRation foRm eCCs engineeRing Co-oP anD CaReeR se are strongly encouraged to work with Engineering Co-op and Career Services (ECCS) and the Heavy Construction

  2. Sandia National Laboratories: RM3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RM3 Sandia, NREL Release Wave Energy Converter Modeling and Simulation Code: WEC-Sim On July 29, 2014, in Computational Modeling & Simulation, Energy, News, News & Events,...

  3. MHK Technologies/FO | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose Bend < MHK Projects JumpPlaneElectric Buoy.jpgEnCurrentPicoJumpFO

  4. WA_01_022_PRAXAIR_INC_AND_BP_AMOCO_Waiver_of_Domestic_and_Fo...

    Broader source: Energy.gov (indexed) [DOE]

    1022PRAXAIRINCANDBPAMOCOWaiverofDomesticandFo.pdf WA01022PRAXAIRINCANDBPAMOCOWaiverofDomesticandFo.pdf WA01022PRAXAIRINCANDBPAMOCOWaiverofDomestic...

  5. RM Eolica | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit with form History Facebook iconQuito,Jump to: navigation,REpower NorthRGERLTecRM

  6. FO(FD): Extending classical logic with rule-based fixpoint definitions

    E-Print Network [OSTI]

    Ping, Hou; Denecker, Marc; 10.1017/S1471068410000293

    2010-01-01T23:59:59.000Z

    We introduce fixpoint definitions, a rule-based reformulation of fixpoint constructs. The logic FO(FD), an extension of classical logic with fixpoint definitions, is defined. We illustrate the relation between FO(FD) and FO(ID), which is developed as an integration of two knowledge representation paradigms. The satisfiability problem for FO(FD) is investigated by first reducing FO(FD) to difference logic and then using solvers for difference logic. These reductions are evaluated in the computation of models for FO(FD) theories representing fairness conditions and we provide potential applications of FO(FD).

  7. 3000 and 3000RM Uninterruptible Power Supplies

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    . Recycling is the best method. Never burn batteries to dispose of them. They may explode. Do not open START OUTPUT LOAD OVERLOAD 100% 75% 50% 25% LINE PRESENT LINE FAILURE SERVICE LOW BATTERY WARNING LOW BATTERY SHUTDOWN TEST #12;CFR 3000 and 3000RM NOTICE: The CFR 3000 and 3000RM generates, uses and can

  8. LERU Roadmap foR REsEaRch data

    E-Print Network [OSTI]

    Zrich, Universitt

    LERU Roadmap foR REsEaRch data LERU REsEaRch data WoRking gRoUp University of Amsterdam, Responsibilities and Skills 28 7 Recommendations 31 #12;3 INTRODUCTION The LERU Roadmap for Research Data that LERU members need to act. In 2011, the LERU community of Chief Information Officers produced a Roadmap

  9. Modeling Machine Learning and Data Mining Problems with FO()

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . © Hendrik Blockeel, Bart Bogaerts, Maurice Bruynooghe, Broes De Cat, Stef De Pooter, Marc Denecker, AnthonyModeling Machine Learning and Data Mining Problems with FO(·) Hendrik Blockeel, Bart Bogaerts, Maurice Bruynooghe, Broes De Cat, Stef De Pooter, Marc Denecker, Anthony Labarre, Jan Ramon,1 and Sicco

  10. ITP Steel: Energy and Environmental Profile fo the U.S. Iron...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy and Environmental Profile fo the U.S. Iron and Steel Industry ITP Steel: Energy and Environmental Profile fo the U.S. Iron and Steel Industry steelprofile.pdf More...

  11. Advanced Calculus 2 1. The derivative: Let Rm

    E-Print Network [OSTI]

    Logan, David

    , . . . , m). (9) We assume the transformation (9) to be invertible, that is, we can for the xj as functionsAdvanced Calculus 2 1. The derivative: Let Rm have components j and x: Rm Rn by x() = x1 matrix. You can think of A as a linear function taking Rm to Rm . We denote by AB the image of B under A

  12. The $E_{\\rm p}$ - $E_{\\rm iso}$ relation and the internal shock model

    E-Print Network [OSTI]

    Mochkovitch, R

    2014-01-01T23:59:59.000Z

    The validity of the $E_{\\rm p}$ - $E_{\\rm iso}$ correlation in gamma-ray bursts and the possibility of explaining the prompt emission with internal shocks are highly debated questions. We study whether the $E_{\\rm p}$ - $E_{\\rm iso}$ correlation can be reproduced if internal shocks are indeed responsible for the prompt emission, or conversely, if the correlation can be used to constrain the internal shock scenario. We developed a toy model where internal shocks are limited to the collision of only two shells. Synthetic burst populations were constructed for various distributions of the model parameters, such as the injected power in the relativistic outflow, the average Lorentz factor, and its typical contrast between the shells. These parameters can be independent or linked by various relations. Synthetic $E_{\\rm p}$ - $E_{\\rm iso}$ diagrams are obtained in the different cases and compared with the observed correlation. The reference observed correlation is the one defined by the BAT6 sample, a sample of Swi...

  13. FoP: Never-ending face recognition and data lifting. Julien Subercaze

    E-Print Network [OSTI]

    Boyer, Edmond

    Services; I.2.6 [Artificial in- telligence]: Learning--Learning Keywords face recognition, data liftingFoP: Never-ending face recognition and data lifting. Julien Subercaze Université de Saint.gravier@univ-st-etienne.fr ABSTRACT In this demonstration, we present Faces of Politics (FoP), a face detection system from pictures

  14. How Fo-ATPase generates rotary torque George Oster, Hongyun Wang and Michael Grabe

    E-Print Network [OSTI]

    Oster, George

    of California, Berkeley, CA 94720-3112, USA The F-ATPases synthesize ATP using a transmembrane ionmotive force to a rotary torque in the transmem- brane Fo portion. This torque is communicated from Fo to the F1 portion to Boyer's binding change mechanism. Here we explain the principle by which an IMF generates this rotary

  15. Measurement of $J/\\psi\\to\\gamma\\eta_{\\rm c}$ decay rate and $\\eta_{\\rm c}$ parameters at KEDR

    E-Print Network [OSTI]

    Anashin, V V; Baldin, E M; Barladyan, A K; Barnyakov, A Yu; Barnyakov, M Yu; Baru, S E; Basok, I Yu; Bedny, I V; Blinov, A E; Blinov, V E; Bobrov, A V; Bobrovnikov, V S; Bogomyagkov, A V; Bondar, A E; Buzykaev, A R; Eidelman, S I; Glukhovchenko, Yu M; Gulevich, V V; Gusev, D V; Karnaev, S E; Karpov, G V; Karpov, S V; Kharlamova, T A; Kiselev, V A; Kononov, S A; Kotov, K Yu; Kravchenko, E A; Kulikov, V F; Kurkin, G Ya; Kuper, E A; Levichev, E B; Maksimov, D A; Malyshev, V M; Maslennikov, A L; Medvedko, A S; Meshkov, O I; Mishnev, S I; Morozov, I I; Muchnoi, N Yu; Neufeld, V V; Nikitin, S A; Nikolaev, I B; Okunev, I N; Onuchin, A P; Oreshkin, S B; Orlov, I O; Osipov, A A; Peleganchuk, S V; Pivovarov, S G; Piminov, P A; Petrov, V V; Poluektov, A O; Pospelov, G E; Prisekin, V G; Rezanova, O L; Ruban, A A; Sandyrev, V K; Savinov, G A; Shamov, A G; Shatilov, D N; Shwartz, B A; Simonov, E A; Sinyatkin, S V; Skrinsky, A N; Smaluk, V V; Sokolov, A V; Sukharev, A M; Starostina, E V; Talyshev, A A; Tayursky, V A; Telnov, V I; Tikhonov, Yu A; Todyshev, K Yu; Tumaikin, G M; Usov, Yu V; Vorobiov, A I; Yushkov, A N; Zhilich, V N; Zhulanov, V V; Zhuravlev, A N

    2014-01-01T23:59:59.000Z

    Using the inclusive photon spectrum based on a data sample collected at the $J/\\psi$ peak with the KEDR detector at the VEPP-4M $e^+e^-$ collider, we measured the rate of the radiative decay $J/\\psi\\to\\gamma\\eta_{\\rm c}$ as well as $\\eta_{\\rm c}$ mass and width. Taking into account an asymmetric photon lineshape we obtained: $\\Gamma^0_{\\gamma\\eta_{\\rm c}}=2.98\\pm0.18 \\phantom{|}^{+0.15}_{-0.33}$ keV, $M_{\\eta_{\\rm c}} = 2983.5 \\pm 1.4 \\phantom{|}^{+1.6}_{-3.6}$ MeV/$c^2$, $\\Gamma_{\\eta_{\\rm c}} = 27.2 \\pm 3.1 \\phantom{|}^{+5.4}_{-2.6}$ MeV.

  16. RequiRements foR GRADuAtion ApplicAtion

    E-Print Network [OSTI]

    Hart, Gus

    in the online graduation application. 2. Your prospectus or project proposal has been approved and your oralRequiRements foR GRADuAtion ApplicAtion ADV Form 8a 8/12 ecclesiastical endorsement Requirement for Graduation You must be a degree-seeking graduate student and have a current ecclesiastical endorsement

  17. This is MoFo. Scientific/Technical Patent Analysts/Agents

    E-Print Network [OSTI]

    Straight, Aaron

    This is MoFo. Scientific/Technical Patent Analysts/Agents (Los Angeles, CA; McLean, VA; Palo Alto level patent analysts/agents for our Los Angeles, Palo Alto, San Diego and San Francisco offices of business strategies. Patent analysts/agents participate in domestic and foreign patent prosecution

  18. Energy Dependence of Profile Functions in $\\rm{p\\bar p}$ and $\\rm pp$ Scattering

    E-Print Network [OSTI]

    Anderson Kendi Kohara; Erasmo Ferreira; Takeshi Kodama

    2013-05-15T23:59:59.000Z

    We construct analytical forms in the impact parameter $b$-space for the real and imaginary amplitudes describing elastic pp and $\\rm p \\bar p $ scattering. The amplitudes converted analytically to the momentum transfer $t$-space have magnitudes, slopes, curvatures, zeros, signs, obeying phenomenological and theoretical expectations, and describe with high precision all details of the data, in the full-t range, and for energies from 20 GeV to 7 TeV. The connection of forward with large-$|t|$ behavior allows precise determination of total cross-sections, slopes and other scattering parameters. We study the properties and the energy dependence of the $b$-space profile functions, observing that the real part has fundamental influence in the structure of $d\\sigma/dt$ at intermediate and large $|t|$ values. We discuss the 540/546 GeV and 1.8/1.96 TeV data from CERN SPS and Fermilab TEVATRON and the 7 TeV results from TOTEM measurements at LHC, and investigate the extrapolation to 14 TeV and higher energies.

  19. Global analysis of Fo rster resonance energy transfer in live cells measured by fluorescence lifetime imaging microscopy exploiting

    E-Print Network [OSTI]

    van Stokkum, Ivo

    Global analysis of Fo¨ rster resonance energy transfer in live cells measured by fluorescence of Fo¨ rster resonance energy transfer (FRET) in live cells using the rise time of acceptor fluorescence those molecules that are involved in the energy-transfer process are monitored. This contrasts

  20. Selection biases in the gamma ray burst E$_{\\rm iso}$ -- L$_{\\rm opt,X}$ correlation

    E-Print Network [OSTI]

    Coward, David; Wan, Linfeng; Macpherson, Damien

    2014-01-01T23:59:59.000Z

    Gamma ray burst (GRB) optical and X-ray afterglow luminosity is expected to correlate with the GRB isotropic equivalent kinetic energy of the outflow in the standard synchrotron model for GRB afterglows. Previous studies, using prompt GRB isotropic equivalent energy ($E_{\\rm iso}$) as a proxy for isotropic equivalent kinetic energy, have generally confirmed a correlation between X-ray and optical afterglow luminosities. Assuming that GRB afterglow luminosity does not evolve strongly with redshift, we identify a strong Malmquist bias in GRB optical and X-ray afterglow luminosity data. We show that selection effects dominate the observed E$_{\\rm iso}$ -- L$_{\\rm opt,X}$ correlations, and have likely been underestimated in other studies. The bias is strongest for a subset of optically faint bursts $m>24$ at 24 hr with $z>2$. After removing this optical selection bias, the E$_{\\rm iso}$ -- L$_{\\rm opt,X}$ correlation for long GRBs is not statistically significant, but combining both long and short GRB luminosity ...

  1. TraceyStancik Bldg.201,Rm.2S-06

    E-Print Network [OSTI]

    Kemner, Ken

    Paul Blanton Project Manager, Savannah River National Laboratory Agenda Tuesday, WednesdayTraceyStancik Bldg.201,Rm.2S-06 ArgonneNationalLaboratory 9700SouthCassAve. Argonne,IL60439 Hotel Argonne National Laboratory Argonne, Illinois Announcement also available at: http

  2. Bremsstrahlung emission during $?$-decay of $^{226}{\\rm Ra}$

    E-Print Network [OSTI]

    Giorgio Giardina; Giovanni Fazio; Giuseppe Mandaglio; Marina Manganaro; Serghei P. Maydanyuk; Vladislav S. Olkhovsky; Nikolay V. Eremin; Anton A. Paskhalov; Dmitry A. Smirnov; Carmelo Sacca

    2008-04-16T23:59:59.000Z

    We obtained the spectrum of probability of the bremsstrahlung emission accompanying the $\\alpha$-decay of $^{226}{\\rm Ra}$ (E$_{\\alpha}$=4.8 MeV) by measuring the $\\alpha$-$\\gamma$ coincidences and using the model presented in our previous study on the $\\alpha-$decay of $^{214}{\\rm Po}$ (E$_{\\alpha}$=7.7 MeV). We compare the experimental data with the quantum mechanical calculation and find a good agreement between theory and experiment. We discuss the differences between the photon spectra connected with the $\\alpha$-decay of the $^{226}{\\rm Ra}$ and $^{214}{\\rm Po}$ nuclei. For the two mentioned nuclei we analyze the bremsstrahlung emission contributions from the tunneling and external regions of the nucleus barrier into the total spectrum, and we find the destructive interference between these contributions. We also find that the emission of photons during tunneling of the $\\alpha$-particle gives an important contribution to the bremsstrahlung spectrum in the whole E$_{\\gamma}$ energy range of the studied $^{226}$Ra nucleus.

  3. A Tight $L_{\\rm p, iso}-E'_{\\rm p}-\\Gamma_0$ Correlation of Gamma-Ray Bursts

    E-Print Network [OSTI]

    Liang, En-Wei; LV, Jing; Lu, Ruijing; Zhang, Jin; Zhang, Bing

    2015-01-01T23:59:59.000Z

    We select a sample of 34 gamma-ray bursts (GRBs) whose $\\Gamma_0$ values are derived with the onset peak observed in the afterglow lightcurves (except for GRB 060218 whose $\\Gamma_0$ is estimated with its radio data), and investigate the correlations among $\\Gamma_0$, the isotropic peak luminosity ($L_{\\rm p, iso}$), and the peak energy of the $\

  4. F.O. Licht's 17th Annual World Ethanol & Biofuels Conference

    Broader source: Energy.gov [DOE]

    The F.O. Licht's 17th Annual World Ethanol & Biofuels Conference will be held on November 36, 2014, in Budapest, Hungary. Valerie Reed, Deputy Director of the Bioenergy Technolgies Office will be serving on two panels: "Maintaining Next Generation Investments in the Years Ahead" on November 4 and "Putting Together a Constant Supply of Feedstocks for Advanced and Cellulosic Biofuels, Biochemicals and Aviation Fuels" on November 5.

  5. TraceyStancik Bldg.201,Rm.2S-06

    E-Print Network [OSTI]

    Kemner, Ken

    Gelder Technical Advisor, Savannah River National Laboratory Agenda Day 1: 8:00 a.m. 5:00 p.m. Day 2: 8TraceyStancik Bldg.201,Rm.2S-06 ArgonneNationalLaboratory 9700SouthCassAve. ArgonneIL60439 Hotel://www.dis.anl.gov/maps/maps.html June 25-27, 2013 Argonne National Laboratory Argonne, Illinois Announcement also available at: http

  6. Relations for Direct CP asymmetries \\\\in $B\\to \\rm PP$ and $B\\to \\rm PV$ decays

    E-Print Network [OSTI]

    T. N. Pham

    2005-10-14T23:59:59.000Z

    The presence of additional strong phase from power corrections and other chirally enhanced terms makes it more difficult to predict direct CP asymmetries in two-body charmless B decays. In this talk, I would like to report on a recent work on QCD Factorisation and Power Corrections in Charmless B Decays. Using the measured branching ratios for $B\\to \\rm PV$, it is shown that power corrections in charmless B decays are probably large, at least for penguin dominated $\\rm PV$ channels. Since the tree-penguin interference responsible for direct CP asymmetries in two-body charmless B decays are related by CKM factors and SU(3) symmetry, we find that, if power corrections other than the chirally enhanced power corrections and annihilation topology were negligible, QCD Factorisation would predict the direct CP asymmetry of $B \\to \\pi^+ \\pi^-$ to be about 3 times larger than that of $B \\to \\pi^\\pm K^\\mp$, with opposite sign, in agreement with the latest measurement from Belle. Similar relations are also given for direct CP asymmetries in $B\\to\\rm PV$ .

  7. Reference Inflow Characterization for River Resource Reference Model (RM2)

    SciTech Connect (OSTI)

    Neary, Vincent S [ORNL

    2011-12-01T23:59:59.000Z

    Sandia National Laboratory (SNL) is leading an effort to develop reference models for marine and hydrokinetic technologies and wave and current energy resources. This effort will allow the refinement of technology design tools, accurate estimates of a baseline levelized cost of energy (LCoE), and the identification of the main cost drivers that need to be addressed to achieve a competitive LCoE. As part of this effort, Oak Ridge National Laboratory was charged with examining and reporting reference river inflow characteristics for reference model 2 (RM2). Published turbulent flow data from large rivers, a water supply canal and laboratory flumes, are reviewed to determine the range of velocities, turbulence intensities and turbulent stresses acting on hydrokinetic technologies, and also to evaluate the validity of classical models that describe the depth variation of the time-mean velocity and turbulent normal Reynolds stresses. The classical models are found to generally perform well in describing river inflow characteristics. A potential challenge in river inflow characterization, however, is the high variability of depth and flow over the design life of a hydrokinetic device. This variation can have significant effects on the inflow mean velocity and turbulence intensity experienced by stationary and bottom mounted hydrokinetic energy conversion devices, which requires further investigation, but are expected to have minimal effects on surface mounted devices like the vertical axis turbine device designed for RM2. A simple methodology for obtaining an approximate inflow characterization for surface deployed devices is developed using the relation umax=(7/6)V where V is the bulk velocity and umax is assumed to be the near-surface velocity. The application of this expression is recommended for deriving the local inflow velocity acting on the energy extraction planes of the RM2 vertical axis rotors, where V=Q/A can be calculated given a USGS gage flow time-series and stage vs. cross-section area rating relationship.

  8. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Steven Jahn

    Broader source: Energy.gov [DOE]

    Commenter: Steven Jahn 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  9. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Susan Leckband

    Broader source: Energy.gov [DOE]

    Commenter: Susan Leckband 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  10. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Mark Strauch

    Broader source: Energy.gov [DOE]

    Commenter: Mark Strauch 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  11. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Mark Fisher

    Broader source: Energy.gov [DOE]

    Commenter: Mark Fisher 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  12. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Scott Yundt

    Broader source: Energy.gov [DOE]

    Commenter: Scott Yundt 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  13. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Richard L. Dickson

    Broader source: Energy.gov [DOE]

    Commenter: Richard L. Dickson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  14. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Curtis Valle

    Broader source: Energy.gov [DOE]

    Commenter: Curtis Valle 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  15. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Faye Vleger

    Broader source: Energy.gov [DOE]

    Commenter: Faye Vleger 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  16. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Anoop Agrawal

    Broader source: Energy.gov [DOE]

    Commenter: Anoop Agrawal 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  17. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Cameron Anderson

    Broader source: Energy.gov [DOE]

    Commenter: Cameron Anderson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  18. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Timothy Bolden

    Broader source: Energy.gov [DOE]

    Commenter: Timothy Bolden 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  19. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Joseph Herndon

    Broader source: Energy.gov [DOE]

    Commenter: Joseph Herndon 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  20. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Jamie Stalker

    Broader source: Energy.gov [DOE]

    Commenter: Jamie Stalker 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  1. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Ed Kvartek

    Broader source: Energy.gov [DOE]

    Commenter: Ed Kvartek 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  2. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- John Walter

    Broader source: Energy.gov [DOE]

    Commenter: John Walter 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  3. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Cheryl Floreen

    Broader source: Energy.gov [DOE]

    Commenter: Cheryl Floreen 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  4. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Troy Bodily

    Broader source: Energy.gov [DOE]

    Commenter: Troy Bodily 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  5. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Reginald Gaylord

    Broader source: Energy.gov [DOE]

    Commenter: Reginald Gaylord 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  6. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Pete Stafford

    Broader source: Energy.gov [DOE]

    Commenter: Pete Stafford 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  7. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Mario Moreno

    Broader source: Energy.gov [DOE]

    Commenter: Mario Moreno 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  8. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Roby Enge

    Broader source: Energy.gov [DOE]

    Commenter: Roby Enge 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  9. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Terry Vaughn

    Broader source: Energy.gov [DOE]

    Commenter: Terry Vaughn 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  10. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Bret Moscon

    Broader source: Energy.gov [DOE]

    Commenter: Bret Moscon 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  11. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Paul A. Schulte

    Broader source: Energy.gov [DOE]

    Commenter: Paul A. Schulte 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  12. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Thomas W. Morris

    Broader source: Energy.gov [DOE]

    Commenter: Thomas W. Morris 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  13. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Thomas Peterson

    Broader source: Energy.gov [DOE]

    Commenter: Thomas Peterson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  14. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Michael Brisson

    Broader source: Energy.gov [DOE]

    Commenter: Michael Brisson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  15. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Jim Withers

    Broader source: Energy.gov [DOE]

    Commenter: Jim Withers 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  16. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- J. Chris Cantwell

    Broader source: Energy.gov [DOE]

    Commenter: J. Chris Cantwell 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  17. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Scott Stafford

    Broader source: Energy.gov [DOE]

    Commenter: Scott Stafford 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  18. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- William R. Kleem

    Broader source: Energy.gov [DOE]

    Commenter: William R. Kleem 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  19. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Kenneth Meyer

    Broader source: Energy.gov [DOE]

    Commenter: Kenneth Meyer 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  20. STYRIAN AcADEmY FoR SUSTAINABlE ENERGIES INTERNATIoNAl WINTER School 2011

    E-Print Network [OSTI]

    STYRIAN AcADEmY FoR SUSTAINABlE ENERGIES INTERNATIoNAl WINTER School 2011 "SUSTAINABlE SmART c climate, hazardous nuclear technologies, high investment costs for modernizing the energy system sustainable development of society with innovative energy solutions. The STYRIAN ACADEMY Winter School 2011

  1. APRIL 3 10:3011:30am Rm 102 Status and Future of Recreational Fisheries in

    E-Print Network [OSTI]

    Anderson, Richard

    Anderson, Director, Washington Department of Fish and Wildlife (WDFW) APRIL 8 5:00­6:00pm Rm 107 Evolution of Saltwater Recreational Fisheries in Washington State Tony Floor, Director, Fishing Affairs, NW Marine Trade APRIL 17 10:30am­12:20pm Rm 102 A) Involving Youth in Recreational Fishing B) Management and Status

  2. The role of the RM-ODP Computational Viewpoint Concepts in the MDA approach

    E-Print Network [OSTI]

    Pires, Luís Ferreira

    43 The role of the RM-ODP Computational Viewpoint Concepts in the MDA approach João Paulo A.utwente.nl Abstract An MDA design approach should be able to accommodate designs at different levels of platform that makes it possible to use RM-ODP concepts in our MDA design approach. This framework allows a recursive

  3. Reference Model 6 (RM6): Oscillating Wave Energy Converter.

    SciTech Connect (OSTI)

    Bull, Diana L; Smith, Chris; Jenne, Dale Scott; Jacob, Paul; Copping, Andrea; Willits, Steve; Fontaine, Arnold; Brefort, Dorian; Gordon, Margaret Ellen; Copeland, Robert; Jepsen, Richard A.

    2014-10-01T23:59:59.000Z

    This report is an addendum to SAND2013-9040: Methodology for Design and Economic Analysis of Marine Energy Conversion (MEC) Technologies. This report describes an Oscillating Water Column Wave Energy Converter reference model design in a complementary manner to Reference Models 1-4 contained in the above report. In this report, a conceptual design for an Oscillating Water Column Wave Energy Converter (WEC) device appropriate for the modeled reference resource site was identified, and a detailed backward bent duct buoy (BBDB) device design was developed using a combination of numerical modeling tools and scaled physical models. Our team used the methodology in SAND2013-9040 for the economic analysis that included costs for designing, manufacturing, deploying, and operating commercial-scale MEC arrays, up to 100 devices. The methodology was applied to identify key cost drivers and to estimate levelized cost of energy (LCOE) for this RM6 Oscillating Water Column device in dollars per kilowatt-hour (%24/kWh). Although many costs were difficult to estimate at this time due to the lack of operational experience, the main contribution of this work was to disseminate a detailed set of methodologies and models that allow for an initial cost analysis of this emerging technology. This project is sponsored by the U.S. Department of Energy's (DOE) Wind and Water Power Technologies Program Office (WWPTO), within the Office of Energy Efficiency & Renewable Energy (EERE). Sandia National Laboratories, the lead in this effort, collaborated with partners from National Laboratories, industry, and universities to design and test this reference model.

  4. Sampling and analyses report for postburn sampling at the RM1 UCG Site, Hanna, Wyoming

    SciTech Connect (OSTI)

    Crader, S.E.

    1989-06-01T23:59:59.000Z

    Between June 22, 1989 and June 26, 1989, Western Research Institute (WRI) completed the second quarterly Rocky Mountain 1 Underground Coal Gasification (RM1 UCG) site groundwater monitoring for the year 1989. This quarterly sample outing represents the third sampling since the completion of the RM1 groundwater restoration. Background material and the sampling and analytical procedures associated with this task are described in the `Rocky Mountain 1 Postburn Groundwater Monitoring Quality Assurance Plan`, prepared by the U.S. DOE.

  5. Dark Matter Searches in Jet plus Missing Energy in $\\rm ?p$ collision at CERN LHC

    E-Print Network [OSTI]

    Hao Sun

    2014-08-01T23:59:59.000Z

    In this paper, we investigate the $\\rm \\gamma p$ photoproduction of jet plus missing energy signal to set limits on the couplings of the fermionic dark matter to the quarks at the LHC via the main reaction $\\rm pp\\rightarrow p\\gamma p\\rightarrow p \\chi\\chi j$. We assume a typical LHC multipurpose forward detectors and work in a model independent Effective Field Theory framework. Typically, when we do the background analysis, we also include their corresponding Single Diffractive (SD) productions. Our result shows that by requiring a $5\\sigma$ ($\\rm S/\\sqrt{B} \\geq 5$) signal deviation, with an integrated luminosity of $\\rm {\\cal L} = 200 fb^{-1}$, the lower bounds of WIMP masses scale can be detected up to $\\rm \\Lambda$ equal 665.5, 808.9 and 564.0 GeV for the forward detector acceptances $\\xi_1$, $\\xi_2$, and $\\xi_3$, respectively, where $0.00150.5$, $0.10.5$ and $0.0015<\\xi_3<0.15$.

  6. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Alliance for Water Efficiency (AWE)

    Broader source: Energy.gov [DOE]

    Commenter: Alliance for Water Efficiency (AWE) 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  7. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Christopher R. McKean

    Broader source: Energy.gov [DOE]

    Commenter: Christopher R. McKean 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  8. BREA Minutes Meeting Date and Place: Tuesday, Oct. 14, 2014; Building 400, Rm RSB 2

    E-Print Network [OSTI]

    Johnson, Peter D.

    BREA Minutes Meeting Date and Place: Tuesday, Oct. 14, 2014; Building 400, Rm RSB 2 Attendees live in New York State (NYS), you can change your medical plan after the first year i.e., if you in NYS. Our current insurance with CIGNA is through the Lab, which is selfinsured. How long

  9. Fish and Wildlife Management Questions and RM&E Strategies Key Management Questions

    E-Print Network [OSTI]

    1 Fish and Wildlife Management Questions and RM&E Strategies Key Management Questions 1. Are we meeting biological and programmatic performance objectives established within the Columbia Basin Fish implemented and accomplished as proposed? Strategic Category: Fish Population Status Monitoring The following

  10. Sequence Optimization-based UWB Receiver Jihad Ibrahim, Rekha Menon, and Dr. R.M. Buehrer

    E-Print Network [OSTI]

    Southern California, University of

    Sequence Optimization-based UWB Receiver Jihad Ibrahim, Rekha Menon, and Dr. R.M. Buehrer Sponsored transmit pulse shape Proposed Receiver Transmit Sequence X Channel Receiver Sequence- Correlator Y UWB Objective: Maximize SNR Optimal transmit sequence X solves: H is the channel matrix Optimal X

  11. Statistical investigation of the saturation effect in the ionospheric foF2 versus sunspot, solar radio noise, and solar EUV radiation

    E-Print Network [OSTI]

    Chen, Yuh-Ing

    radio noise, and solar EUV radiation J. Y. Liu Institute of Space Science and Center for Space are important for the saturation features. INDEX TERMS: 2479 Ionosphere: Solar radiation and cosmic ray effects: Solar radiation and cosmic ray effects; KEYWORDS: saturation effect, ionospheric foF2, sunspot number

  12. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wray Wind Energy Project Environmental Assessment DOEEA - 1884 Environmental Assessment December 2012 Finding of No Significant Impact 2012 Comments may be sent to: Mr. Rod...

  13. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hermosa West Wind Energy Project Albany County, Wyoming Draft Environmental Impact Statement DOEEIS - 0438 Draft Environmental Impact Statement Volume I Draft Environmental Impact...

  14. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Buffalo Head Substation Project Adoption of Bureau of Land Management Environmental Assessment (Document No. WY-050-EA11-108) DOEEA - 1938 Environmental Assessment July 2012...

  15. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    South Table Wind Project Environmental Assessment for Pre-Approval Review DOEEA - 1909 Environmental Assessment July 2012 Finding of No Significant Impact August 2012 Comments may...

  16. Micro-Segmentao de Clientes com Base em Dados de Consumo: Modelo RM-Similis

    E-Print Network [OSTI]

    Cavique, Luís

    1 Micro-Segmentação de Clientes com Base em Dados de Consumo: Modelo RM-Similis Luís Cavique ESCS apresentadas as conclusões. 2 Base de Dados de Clientes Na caracterização de clientes são geralmente utilizados dados resultantes de inquéritos. Com o apoio das Base de Dados ou Aplicações para Clientes, pretende

  17. jou.rm.alnf ELSEVIER Journal of Nuclear Materials 241-243 (1997) 255-259

    E-Print Network [OSTI]

    Raffray, A. René

    jou.rm.alnf HUMOr ELSEVIER Journal of Nuclear Materials 241-243 (1997) 255-259 Erosion lifetime at the side walls. 0022-3115/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved. PII S0022-3!15(96)00510-7 #12;256 H.D. Pacher et al. / Journal of Nuclear Materials 241 243 (1997) 255 259 10~' ~10 4 1000 ~ _ 1

  18. Measurement of jet $p_{\\rm T}$ spectra and $R_{\\rm AA}$ in pp and Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 2.76 TeV with the ALICE detector

    E-Print Network [OSTI]

    Salvatore Aiola; for the ALICE Collaboration

    2014-12-08T23:59:59.000Z

    Hard-scattered partons provide an ideal probe for the study of the Quark-Gluon Plasma because they are produced prior to the formation of the QCD medium in heavy-ion collisions. Jet production is therefore susceptible to modifications induced by the presence of the medium ("jet quenching"). Both RHIC and LHC experiments have provided compelling evidence of jet quenching. Jets are reconstructed in ALICE utilizing the central tracking system for the charged constituents and the Electromagnetic Calorimeter for the neutral constituents. Jet spectra are reported for central (0-10%) and semi-central (10-30%) Pb-Pb events at $\\sqrt{s_{\\rm NN}}=2.76$ TeV. The nuclear modification factor, determined using a pp baseline measured at the same collisional energy, shows a strong suppression of jet production in central Pb-Pb collisions with the expected centrality ordering. Observations are in qualitative agreement with medium-induced energy loss models. Furthermore, indication of a path-length dependence of jet suppression is inferred from measurements of the yields relative to the orientation of the event plane.

  19. Bryant fall 2010 FC fall 2010a Bryant Unive rsity resoU rce fo r P ro fessional sUccess

    E-Print Network [OSTI]

    Blais, Brian

    Bryant fall 2010 FC fall 2010a Bryant Unive rsity resoU rce fo r P ro fessional sUccess P H I L A NWard BY giVing BaCK Alumni and friends share their inspiration for giving to the next cohort of Bryant the University by investing in the future of the accounting industry. 22 tHe BrYant LeadersHiP COUnCiL Bryant

  20. Development of an aerosol microphysical module: Aerosol Two-dimensional bin module for foRmation and Aging Simulation (ATRAS)

    SciTech Connect (OSTI)

    Matsui, H.; Koike, Makoto; Kondo, Yutaka; Fast, Jerome D.; Takigawa, M.

    2014-09-30T23:59:59.000Z

    Number concentrations, size distributions, and mixing states of aerosols are essential parameters for accurate estimation of aerosol direct and indirect effects. In this study, we developed an aerosol module, designated Aerosol Two-dimensional bin module for foRmation and Aging Simulation (ATRAS), that can represent these parameters explicitly by considering new particle formation (NPF), black carbon (BC) aging, and secondary organic aerosol (SOA) processes. A two-dimensional bin representation is used for particles with dry diameters from 40 nm to 10 m to resolve both aerosol size (12 bins) and BC mixing state (10 bins) for a total of 120 bins. The particles with diameters from 1 to 40 nm are resolved using an additional 8 size bins to calculate NPF. The ATRAS module was implemented in the WRF-chem model and applied to examine the sensitivity of simulated mass, number, size distributions, and optical and radiative parameters of aerosols to NPF, BC aging and SOA processes over East Asia during the spring of 2009. BC absorption enhancement by coating materials was about 50% over East Asia during the spring, and the contribution of SOA processes to the absorption enhancement was estimated to be 10 20% over northern East Asia and 20 35% over southern East Asia. A clear north-south contrast was also found between the impacts of NPF and SOA processes on cloud condensation nuclei (CCN) concentrations: NPF increased CCN concentrations at higher supersaturations (smaller particles) over northern East Asia, whereas SOA increased CCN concentrations at lower supersaturations (larger particles) over southern East Asia. Application of ATRAS to East Asia also showed that the impact of each process on each optical and radiative parameter depended strongly on the process and the parameter in question. The module can be used in the future as a benchmark model to evaluate the accuracy of simpler aerosol models and examine interactions between NPF, BC aging, and SOA processes under different meteorological conditions and emissions.

  1. $N_{\\rm eff}$ in low-scale seesaw models versus the lightest neutrino mass

    E-Print Network [OSTI]

    Hernandez, P; Lopez-Pavon, J

    2014-01-01T23:59:59.000Z

    We evaluate the contribution to $N_{\\rm eff}$ of the extra sterile states in low-scale Type I seesaw models (with three extra sterile states). We explore the full parameter space and find that at least two of the heavy states always reach thermalisation in the Early Universe, while the third one might not thermalise provided the lightest neutrino mass is below ${\\mathcal O}(10^{-3}$eV). Constraints from cosmology therefore severely restrict the spectra of heavy states in the range 1eV- 100 MeV. The implications for neutrinoless double beta decay are also discussed.

  2. $^4{\\rm He}$+$n$+$n$ continuum within an ab initio framework

    E-Print Network [OSTI]

    Carolina Romero-Redondo; Sofia Quaglioni; Petr Navrtil; Guillaume Hupin

    2014-04-07T23:59:59.000Z

    The low-lying continuum spectrum of the $^6{\\rm He}$ nucleus is investigated for the first time within an ab initio framework that encompasses the $^4{\\rm He}$+$n$+$n$ three-cluster dynamics characterizing its lowest decay channel. This is achieved through an extension of the no-core-shell model combined with the resonating-group method, in which energy-independent non-local interactions among three nuclear fragments can be calculated microscopically starting from realistic nucleon-nucleon interactions and consistent ab initio many-body wave functions of the clusters. The three-cluster Schr\\"odinger equation is solved with three-body scattering boundary conditions by means of the hyperspherical-harmonic method on a Lagrange mesh. Using a soft similarity-renormalization-group evolved chiral nucleon-nucleon potential, we find the known $J^\\pi = 2^+$ resonance as well as a result consistent with a new low-lying second $2^+$ resonance recently observed at GANIL at $2.6$ MeV above the $^6$He ground state. We also find resonances in the $2^-$, $1^+$ and $0^-$ channels, while no low-lying resonances are present in the $0^+$ and $1^-$ channels.

  3. NUCLEAR ISOTOPIC DILUTION OF HIGHLY ENRICHED URANIUM BY DRY BLENDING VIA THE RM-2 MILL TECHNOLOGY

    SciTech Connect (OSTI)

    Raj K. Rajamani; Sanjeeva Latchireddi; Vikas Devrani; Harappan Sethi; Roger Henry; Nate Chipman

    2003-08-01T23:59:59.000Z

    DOE has initiated numerous activities to focus on identifying material management strategies to disposition various excess fissile materials. In particular the INEEL has stored 1,700 Kg of offspec HEU at INTEC in CPP-651 vault facility. Currently, the proposed strategies for dispositioning are (a) aqueous dissolution and down blending to LEU via facilities at SRS followed by shipment of the liquid LEU to NFS for fabrication into LWR fuel for the TVA reactors and (b) dilution of the HEU to 0.9% for discard as a waste stream that would no longer have a criticality or proliferation risk without being processed through some type of enrichment system. Dispositioning this inventory as a waste stream via aqueous processing at SRS has been determined to be too costly. Thus, dry blending is the only proposed disposal process for the uranium oxide materials in the CPP-651 vault. Isotopic dilution of HEU to typically less than 20% by dry blending is the key to solving the dispositioning issue (i.e., proliferation) posed by HEU stored at INEEL. RM-2 mill is a technology developed and successfully tested for producing ultra-fine particles by dry grinding. Grinding action in RM-2 mill produces a two million-fold increase in the number of particles being blended in a centrifugal field. In a previous study, the concept of achieving complete and adequate blending and mixing (i.e., no methods were identified to easily separate and concentrate one titanium compound from the other) in remarkably short processing times was successfully tested with surrogate materials (titanium dioxide and titanium mono-oxide) with different particle sizes, hardness and densities. In the current project, the RM-2 milling technology was thoroughly tested with mixtures of natural uranium oxide (NU) and depleted uranium oxide (DU) stock to prove its performance. The effects of mill operating and design variables on the blending of NU/DU oxides were evaluated. First, NU and DU both made of the same oxide, UO{sub 3}, was used in the testing. Next, NU made up of UO{sub 3} and DU made up of UO{sub 2} was used in the test work. In every test, the blend achieved was characterized by spatial sampling of the ground product and analyzing for {sup 235}U concentration. The test work proved that these uranium oxide materials can be blended successfully. The spatial concentration was found to be uniform. Next, sintered thorium oxide pellets were used as surrogate for light water breeder reactor pellets (LWBR). To simulate LWBR pellet dispositioning, the thorium oxide pellets were first ground to a powder form and then the powder was blended with NU. In these tests also the concentration of {sup 235}U and {sup 232}Th in blended products fell within established limits proving the success of RM-2 milling technology. RM-2 milling technology is applicable to any dry radioactive waste, especially brittle solids that can be ground up and mixed with the non-radioactive stock.

  4. The Spin Structure Function $g_1^{\\rm p}$ of the Proton and a Test of the Bjorken Sum Rule

    E-Print Network [OSTI]

    Adolph, C; Alexeev, M G; Alexeev, G D; Amoroso, A; Andrieux, V; Anosov, V; Austregesilo, A; Azevedo, C; Badelek, B; Balestra, F; Barth, J; Baum, G; Beck, G R; Bedfer, Y; Bernhard, J; Bicker, K; Bielert, E R; Birsa, R; Bisplinghoff, J; Bodlak, M; Boer, M; Bordalo, P; Bradamante, F; Braun, C; Bressan, A; Buechele, M; Burtin, E; Capozza, L; Chang, W -C; Chiosso, M; Choi, I; Chung, S U; Cicuttin, A; Crespo, M L; Curiel, Q; Torre, S Dalla; Dasgupta, S S; Dasgupta, S; Denisov, O Yu; Dhara, L; Donskov, S V; Doshita, N; Duic, V; Dziewiecki, M; Efremov, A; Eversheim, P D; Eyrich, W; Ferrero, A; Finger, M; Fischer, H; Franco, C; von Hohenesche, N du Fresne; Friedrich, J M; Frolov, V; Fuchey, E; Gautheron, F; Gavrichtchouk, O P; Gerassimov, S; Giordano, F; Gnesi, I; Gorzellik, M; Grabmller, S; Grasso, A; Grosse-Perdekamp, M; Grube, B; Grussenmeyer, T; Guskov, A; Haas, F; Hahne, D; von Harrach, D; Hashimoto, R; Heinsius, F H; Herrmann, F; Hinterberger, F; Horikawa, N; d'Hose, N; Hsieh, C -Yu; Huber, S; Ishimoto, S; Ivanov, A; Ivanshin, Yu; Iwata, T; Jahn, R; Jary, V; Jrg, P; Joosten, R; Kabu, E; Ketzer, B; Khaustov, G V; Khokhlov, Yu A; Kisselev, Yu; Klein, F; Klimaszewski, K; Koivuniemi, J H; Kolosov, V N; Kondo, K; Koenigsmann, K; Konorov, I; Konstantinov, V F; Kotzinian, A M; Kouznetsov, O; Kraemer, M; Kremser, P; Krinner, F; Kroumchtein, Z V; Kuchinski, N; Kunne, F; Kurek, K; Kurjata, R P; Lednev, A A; Lehmann, A; Levillain, M; Levorato, S; Lichtenstadt, J; Longo, R; Maggiora, A; Magnon, A; Makins, N; Makke, N; Mallot, G K; Marchand, C; Martin, A; Marzec, J; Matousek, J; Matsuda, H; Matsuda, T; Meshcheryakov, G; Meyer, W; Michigami, T; Mikhailov, Yu V; Miyachi, Y; Nagaytsev, A; Nagel, T; Nerling, F; Neyret, D; Nikolaenko, V I; Novy, J; Nowak, W -D; Nunes, A S; Olshevsky, A G; Orlov, I; Ostrick, M; Panzieri, D; Parsamyan, B; Paul, S; Peng, J -C; Pereira, F; Pesek, M; Peshekhonov, D V; Platchkov, S; Pochodzalla, J; Polyakov, V A; Pretz, J; Quaresma, M; Quintans, C; Ramos, S; Regali, C; Reicherz, G; Riedl, C; Rocco, E; Rossiyskaya, N S; Ryabchikov, D I; Rychter, A; Samoylenko, V D; Sandacz, A; Santos, C; Sarkar, S; Savin, I A; Sbrizzai, G; Schiavon, P; Schmidt, K; Schmieden, H; Schoenning, K; Schopferer, S; Selyunin, A; Shevchenko, O Yu; Silva, L; Sinha, L; Sirtl, S; Slunecka, M; Sozzi, F; Srnka, A; Stolarski, M; Sulc, M; Suzuki, H; Szabelski, A; Szameitat, T; Sznajder, P; Takekawa, S; ter Wolbeek, J; Tessaro, S; Tessarotto, F; Thibaud, F; Tosello, F; Tskhay, V; Uhl, S; Veloso, J; Virius, M; Weisrock, T; Wilfert, M; Zaremba, K; Zavertyaev, M; Zemlyanichkina, E; Ziembicki, M; Zink, A

    2015-01-01T23:59:59.000Z

    New results for the double spin asymmetry $A_1^{\\rm p}$ and the proton longitudinal spin structure function $g_1^{\\rm p}$ are presented. They were obtained by the COMPASS collaboration using polarised 200 GeV muons scattered off a longitudinally polarised NH$_3$ target. The data were collected in 2011 and complement those recorded in 2007 at 160\\,GeV, in particular at lower values of $x$. They improve the statistical precision of $g_1^{\\rm p}(x)$ by about a factor of two in the region $x\\lesssim 0.02$. A next-to-leading order QCD fit to the $g_1$ world data is performed. It leads to a new determination of the quark spin contribution to the nucleon spin, $\\Delta \\Sigma$ ranging from 0.26 to 0.36, and to a re-evaluation of the first moment of $g_1^{\\rm p}$. The uncertainty of $\\Delta \\Sigma$ is mostly due to the large uncertainty in the present determinations of the gluon helicity distribution. A new evaluation of the Bjorken sum rule based on the COMPASS results for the non-singlet structure function $g_1^{\\rm...

  5. Double Spin Asymmetries of Inclusive Hadron Electroproductions from a Transversely Polarized $^3\\rm{He}$ Target

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhao, Yuxiang; et. al.,

    2015-07-01T23:59:59.000Z

    We report the measurement of beam-target double-spin asymmetries ($A_\\text{LT}$) in the inclusive production of identified hadrons, $\\vec{e}~$+$~^3\\text{He}^{\\uparrow}\\rightarrow h+X$, using a longitudinally polarized 5.9 GeV electron beam and a transversely polarized $^3\\rm{He}$ target. Hadrons ($\\pi^{\\pm}$, $K^{\\pm}$ and proton) were detected at 16$^{\\circ}$ with an average momentum $$=2.35 GeV/c and a transverse momentum ($p_{T}$) coverage from 0.60 to 0.68 GeV/c. Asymmetries from the $^3\\text{He}$ target were observed to be non-zero for $\\pi^{\\pm}$ production when the target was polarized transversely in the horizontal plane. The $\\pi^{+}$ and $\\pi^{-}$ asymmetries have opposite signs, analogous to the behavior of $A_\\text{LT}$ in semi-inclusive deep-inelastic scattering.

  6. Double Spin Asymmetries of Inclusive Hadron Electroproductions from a Transversely Polarized $^3\\rm{He}$ Target

    E-Print Network [OSTI]

    The Jefferson Lab Hall A Collaboration; Y. X. Zhao; K. Allada; K. Aniol; J. R. M. Annand; T. Averett; F. Benmokhtar; W. Bertozzi; P. C. Bradshaw; P. Bosted; A. Camsonne; M. Canan; G. D. Cates; C. Chen; J. -P. Chen; W. Chen; K. Chirapatpimol; E. Chudakov; E. Cisbani; J. C. Cornejo; F. Cusanno; M. Dalton; W. Deconinck; C. W. de Jager; R. De Leo; X. Deng; A. Deur; H. Ding; P. A. M. Dolph; C. Dutta; D. Dutta; L. El Fassi; S. Frullani; H. Gao; F. Garibaldi; D. Gaskell; S. Gilad; R. Gilman; O. Glamazdin; S. Golge; L. Guo; D. Hamilton; O. Hansen; D. W. Higinbotham; T. Holmstrom; J. Huang; M. Huang; H. F Ibrahim; M. Iodice; X. Jiang; G. Jin; M. K. Jones; J. Katich; A. Kelleher; W. Kim; A. Kolarkar; W. Korsch; J. J. LeRose; X. Li; Y. Li; R. Lindgren; N. Liyanage; E. Long; H. -J. Lu; D. J. Margaziotis; P. Markowitz; S. Marrone; D. McNulty; Z. -E. Meziani; R. Michaels; B. Moffit; C. Muoz Camacho; S. Nanda; A. Narayan; V. Nelyubin; B. Norum; Y. Oh; M. Osipenko; D. Parno; J. -C. Peng; S. K. Phillips; M. Posik; A. J. R. Puckett; X. Qian; Y. Qiang; A. Rakhman; R. Ransome; S. Riordan; A. Saha; B. Sawatzky; E. Schulte; A. Shahinyan; M. H. Shabestari; S. irca; S. Stepanyan; R. Subedi; V. Sulkosky; L. -G. Tang; W. A. Tobias; G. M. Urciuoli; I. Vilardi; K. Wang; B. Wojtsekhowski; Y. Wang; X. Yan; H. Yao; Y. Ye; Z. Ye; L. Yuan; X. Zhan; Y. Zhang; Y. -W. Zhang; B. Zhao; X. Zheng; L. Zhu; X. Zhu; X. Zong

    2015-02-04T23:59:59.000Z

    We report the measurement of beam-target double-spin asymmetries ($A_\\text{LT}$) in the inclusive production of identified hadrons, $\\vec{e}~$+$~^3\\text{He}^{\\uparrow}\\rightarrow h+X$, using a longitudinally polarized 5.9 GeV electron beam and a transversely polarized $^3\\rm{He}$ target. Hadrons ($\\pi^{\\pm}$, $K^{\\pm}$ and proton) were detected at 16$^{\\circ}$ with an average momentum $$=2.35 GeV/c and a transverse momentum ($p_{T}$) coverage from 0.60 to 0.68 GeV/c. Asymmetries from the $^3\\text{He}$ target were observed to be non-zero for $\\pi^{\\pm}$ production when the target was polarized transversely in the horizontal plane. The $\\pi^{+}$ and $\\pi^{-}$ asymmetries have opposite signs, analogous to the behavior of $A_\\text{LT}$ in semi-inclusive deep-inelastic scattering.

  7. Blast Wave Fits to Elliptic Flow Data at $\\sqrt{s_{\\rm NN}} =$ 7.7--2760 GeV

    E-Print Network [OSTI]

    X. Sun; H. Masui; A. M. Poskanzer; A. Schmah

    2015-02-18T23:59:59.000Z

    We present blast wave fits to elliptic flow ($v_{2}(p_{\\rm T})$) data in minimum bias collisions from the $\\sqrt{s_{\\rm NN}} =$ 7.7--200 GeV at RHIC, and 2.76 TeV at LHC. The fits are performed separately for particles and corresponding anti-particles. The mean transverse velocity parameter $\\beta$ shows an energy dependent difference between particles and corresponding anti-particles, which increases as the beam energy decreases. Possible effects of feed down, baryon stopping, anti-particle absorption, and early production times for anti-particles are discussed.

  8. Leptonic decay of the phi(1020) meson in Au+Au collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV measured with the STAR experiment

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calder'on de la Barca S'anchez; J. M. Campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; X. Chen; J. Cheng; M. Cherney; W. Christie; M. J. M. Codrington; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Feng; P. Filip; Y. Fisyak; C. E. Flores; L. Fulek; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; X. Huang; H. Z. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; K. Jiang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; Z. M. Li; Y. Li; X. Li; C. Li; W. Li; X. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; Y. G. Ma; R. Ma; G. L. Ma; L. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; K. Meehan; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. L. Olvitt Jr.; B. S. Page; R. Pak; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; A. Peterson; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; M. Posik; A. M. Poskanzer; N. K. Pruthi; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; S. Raniwala; R. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; M. K. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. Sikora; M. Simko; M. J. Skoby; N. Smirnov; D. Smirnov; D. Solanki; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; M. Stepanov; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. J. Summa; Y. Sun; X. M. Sun; X. Sun; Z. Sun; B. Surrow; D. N. Svirida; M. A. Szelezniak; A. H. Tang; Z. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; A. N. Vasiliev; R. Vertesi; F. Videbaek; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; J. S. Wang; G. Wang; F. Wang; Y. Wang; Y. Wang; H. Wang; G. Webb; J. C. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; Q. H. Xu; Z. Xu; Y. F. Xu; N. Xu; H. Xu; Y. Yang; S. Yang; Q. Yang; Y. Yang; C. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; X. P. Zhang; J. B. Zhang; Y. Zhang; J. Zhang; Z. Zhang; J. L. Zhang; S. Zhang; J. Zhao; F. Zhao; C. Zhong; L. Zhou; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-03-13T23:59:59.000Z

    We report the measurement of the phi(1020) meson production via the leptonic decay channel in Au+Au collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV from the STAR (Solenoidal Tracker at RHIC) experiment. The transverse momentum ($p_{\\rm T}$) spectrum is measured for 0.1 $\\le p_{\\rm T} \\le 2.5$ GeV/$c$ at mid-rapidity ($|y|\\le1$) with a similar detector setup of corresponding measurements via the hadronic decay channel. We obtain the $p_{\\rm T}$-integrated phi(1020) mass $M_{\\phi}=1017.7\\pm0.8 (\\rm {stat.}) \\pm0.9 (\\rm {sys.})$ MeV/$c^{2}$ and width $\\Gamma_{\\phi} = 8.0\\pm 2.5(\\rm {stat.}) \\pm 2.3(\\rm {sys.}) \\textrm{MeV/}c^{2}$, which are within 1.5 $\\sigma$ and 1.1 $\\sigma$ of the vacuum values, respectively. No significant difference is observed in the reconstructed phi(1020) $p_{\\rm T}$ spectrum, $dN/dy$, or $\\left$ between the leptonic and hadronic decay channels. The experimental results are compared to a theoretical model including the medium-modified phi(1020).

  9. Disc evolution and the relationship between $L_{\\rm acc}$ and $L_\\ast$ in T Tauri stars

    E-Print Network [OSTI]

    I. Tilling; C. J. Clarke; J. E. Pringle; C. A. Tout

    2008-01-14T23:59:59.000Z

    We investigate the evolution of accretion luminosity $L_{\\rm acc}$ and stellar luminosity ${L_\\ast}$ in pre-mainsequence stars. We make the assumption that when the star appears as a Class II object, the major phase of accretion is long past, and the accretion disc has entered its asymptotic phase. We use an approximate stellar evolution scheme for accreting pre-mainsequence stars based on Hartmann, Cassen & Kenyon, 1997. We show that the observed range of values $k = L_{\\rm acc}/L_\\ast$ between 0.01 and 1 can be reproduced if the values of the disc mass fraction $M_{\\rm disc}/M_*$ at the start of the T Tauri phase lie in the range 0.01 -- 0.2, independent of stellar mass. We also show that the observed upper bound of $L_{\\rm acc} \\sim L_\\ast$ is a generic feature of such disc accretion. We conclude that as long as the data uniformly fills the region between this upper bound and observational detection thresholds, then the degeneracies between age, mass and accretion history severely limit the use of this data for constraining possible scalings between disc properties and stellar mass.

  10. Accounting strategy of tritium inventory in the heavy water detritiation pilot plant from ICIT Rm. Valcea

    SciTech Connect (OSTI)

    Bidica, N.; Stefanescu, I. [Inst. of Cryogenics and Isotopes Technologies, Uzinei Str. No. 4, Rm. Valcea (Romania); Cristescu, I. [TLK, Forschungszentrum Karlsruhe, Postfach 3640, D76021 Karlsruhe (Germany); Bornea, A.; Zamfirache, M.; Lazar, A.; Vasut, F.; Pearsica, C.; Stefan, I. [Inst. of Cryogenics and Isotopes Technologies, Uzinei Str. No. 4, Rm. Valcea (Romania); Prisecaru, I.; Sindilar, G. [Univ. Politehnica of Bucharest, Splaiul Independentei 313, Bucharest (Romania)

    2008-07-15T23:59:59.000Z

    In this paper we present a methodology for determination of tritium inventory in a tritium removal facility. The method proposed is based on the developing of computing models for accountancy of the mobile tritium inventory in the separation processes, of the stored tritium and of the trapped tritium inventory in the structure of the process system components. The configuration of the detritiation process is a combination of isotope catalytic exchange between water and hydrogen (LPCE) and the cryogenic distillation of hydrogen isotopes (CD). The computing model for tritium inventory in the LPCE process and the CD process will be developed basing on mass transfer coefficients in catalytic isotope exchange reactions and in dual-phase system (liquid-vapour) of hydrogen isotopes distillation process. Accounting of tritium inventory stored in metallic hydride will be based on in-bed calorimetry. Estimation of the trapped tritium inventory can be made by subtraction of the mobile and stored tritium inventories from the global tritium inventory of the plant area. Determinations of the global tritium inventory of the plant area will be made on a regular basis by measuring any tritium quantity entering or leaving the plant area. This methodology is intended to be applied to the Heavy Water Detritiation Pilot Plant from ICIT Rm. Valcea (Romania) and to the Cernavoda Tritium Removal Facility (which will be built in the next 5-7 years). (authors)

  11. Measurement of the time-dependent CP asymmetries in $B_s^0\\rightarrow J/\\psi K_{\\rm S}^0$

    E-Print Network [OSTI]

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Blake, Thomas; Blanc, Frdric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casanova Mohr, Raimon; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Dlage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Surez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Frber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garca Pardias, Julin; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gastaldi, Ugo; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Geraci, Angelo; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gian, Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Gbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gndara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugs, Eugeni; Graverini, Elena; Graziani, Giacomo

    2015-01-01T23:59:59.000Z

    The first measurement of decay-time-dependent CP asymmetries in the decay $B_s^0\\rightarrow J/\\psi K_{\\rm S}^0$ and an updated measurement of the ratio of branching fractions $\\mathcal{B}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0)/\\mathcal{B}(B_d^0\\rightarrow J/\\psi K_{\\rm S}^0)$ are presented. The results are obtained using data corresponding to an integrated luminosity of 3.0 fb$^{-1}$ of proton-proton collisions recorded with the LHCb detector at centre-of-mass energies of 7 and 8 TeV. The results on the CP asymmetries are $A_{\\Delta\\Gamma}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0) = 0.49_{-0.65}^{+0.77}(stat) \\pm 0.06(syst)$, $C_{\\rm dir}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0) = -0.28 \\pm 0.41(stat) \\pm 0.08(syst)$ and $S_{\\rm mix}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0) = -0.08 \\pm 0.40(stat) \\pm 0.08(syst)$. The ratio $\\mathcal{B}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0)/\\mathcal{B}(B_d^0\\rightarrow J/\\psi K_{\\rm S}^0)$ is measured to be $0.0431 \\pm 0.0017(stat) \\pm 0.0012(syst) \\pm 0.0025(f_s/f_d)$, where the last uncerta...

  12. Permanent Magnet Assisted Synchronous Reluctance Machine (PMa-SynRM) Design and Performance Analysis for Fan and Pump Applications

    E-Print Network [OSTI]

    Vartanian, Robert

    2014-08-13T23:59:59.000Z

    -5: Different synchronous machines: (a) Permanent Magnet Synchronous Machine (PMSM), (b) Interior Permanent Magnet (IPM), (c) Synchronous Reluctance Machine (SynRM), (d) Axially Laminated Synchronous Reluctance Machine, (e) Permanent Magnet assisted Syn... and assembling the laminations on the shaft axially[11, 20-22]. 6 (a) (b) (c) (d) (e) Fig 1-5: Different synchronous machines: (a) Permanent Magnet Synchronous Machine (PMSM), (b) Interior Permanent Magnet (IPM), (c) Synchronous...

  13. Measurement of jet suppression in central Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-02-05T23:59:59.000Z

    The transverse momentum ($p_{\\rm T}$) spectrum and nuclear modification factor ($R_{\\rm AA}$) of reconstructed jets in 0-10% and 10-30% central Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}=2.76$ TeV were measured. Jets were reconstructed from charged and neutral particles, utilizing the ALICE tracking detectors and Electromagnetic Calorimeter (EMCal), with the anti-$k_{\\rm T}$ jet algorithm with a resolution parameter of R=0.2. The jet $p_{\\rm T}$ spectra are reported in the pseudorapidity interval of $|{\\eta}_{\\rm jet}|5$ GeV/$c$ to suppress jets constructed from the combinatorial background in Pb-Pb collisions. The effect of the leading charged particle requirement has been studied in both pp and Pb-Pb collisions and has been shown to have negligible effects on the $R_{\\rm AA}$ within the uncertainties of the measurement. The nuclear modification factor is obtained by dividing the jet spectrum measured in Pb-Pb by that in pp collisions scaled by the number of independent nucleon-nucleon collisions estimated using a Glauber model. $R_{\\rm AA}$ is found to be $0.28\\pm0.04$ in 0-10% and $0.35\\pm0.04$ in 10-30% collisions, independent of $p_{\\rm T,jet}$ within the uncertainties of the measurement. The observed suppression is in fair agreement with expectations from two model calculations with different approaches to jet quenching.

  14. $\\phi$-meson production at forward rapidity in p-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV and in pp collisions at $\\sqrt{s}$ = 2.76 TeV

    E-Print Network [OSTI]

    Adam, Jaroslav; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahn, Sang Un; Aimo, Ilaria; Aiola, Salvatore; Ajaz, Muhammad; Akindinov, Alexander; Alam, Sk Noor; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Millan Almaraz, Jesus Roberto; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Armesto Perez, Nestor; Arnaldi, Roberta; Arsene, Ionut Cristian; Arslandok, Mesut; Audurier, Benjamin; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Baltasar Dos Santos Pedrosa, Fernando; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Barth, Klaus; Bartke, Jerzy Gustaw; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Belmont Iii, Ronald John; Belmont Moreno, Ernesto; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biswas, Rathijit; Biswas, Saikat; Bjelogrlic, Sandro; Blair, Justin Thomas; Blanco, Fernando; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botta, Elena; Boettger, Stefan; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Bashir Butt, Jamila; Buxton, Jesse Thomas; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Carnesecchi, Francesca; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Cerkala, Jakub; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Chochula, Peter; Choi, Kyungeon; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Chunhui, Zhang; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Deisting, Alexander; Deloff, Andrzej; Denes, Ervin Sandor; D'Erasmo, Ginevra; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin

    2015-01-01T23:59:59.000Z

    The first measurement of $\\phi$-meson production in p-Pb collisions at a nucleon-nucleon centre-of-mass energy $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV has been performed with the ALICE apparatus at the LHC. The $\\phi$-mesons have been identified in the dimuon decay channel in the transverse momentum ($p_{\\rm T}$) range $1 p_{\\rm T} p-going ($2.03 p_{\\rm T}$ dependence within the uncertainties. The $p_{\\rm T}$ dependence of the $\\phi$ nuclear modification factor $R_{\\rm pPb}$ exhibits an enhancement up to a factor 1.6 at $p_{\\rm T}$ = 3-4 GeV/$c$ in the Pb-going direction. The $p_{\\rm T}$ dependence...

  15. 1. Solve the foIIowing linear system and write your solut.ion in parametric vectorform. (12) 2. For each of the following matrices, either find its inver:w or explain why it is

    E-Print Network [OSTI]

    Argerami, Martin

    01 '". :r (10) 1. Solve the foIIowing linear system and write your solut.ion in parametric\\()') -=-. ~;;L (b) Find det(A3 B). ? ckt\\A '} I))-=. (drtA) , dtst\\~ ~ -= ~ ((()(2'ftX\\)) '3 ::: (~) (2) 3

  16. Revisiting Modes of energy generation in sulfate reducing bacteria

    E-Print Network [OSTI]

    Joachimiak, Marcin

    2010-01-01T23:59:59.000Z

    ro ge Py Py r rm H Energy Production and Conversion: NumberGenes Up- regulated Energy Production and Conversion: NumberFo rm Py Fo yd ro Energy Production and ate uv La ate La

  17. Production of charged pions, kaons and protons at large transverse momenta in pp and Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-10-29T23:59:59.000Z

    Transverse momentum spectra of $\\pi^{\\pm}$, $\\rm K^{\\pm}$ and p($\\bar{\\rm p}$) up to $p_{\\rm T}$ = 20 GeV/$c$ at mid-rapidity in pp and Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}=$ 2.76 TeV have been measured using the ALICE detector at the Large Hadron Collider. The proton-to-pion and the kaon-to-pion ratios both show a distinct peak at $p_{\\rm T} \\approx 3 GeV/c$ in central Pb-Pb collisions. Below the peak, $p_{\\rm T}$ agreement with hydrodynamical calculations, suggesting that the peak itself is dominantly the result of radial flow rather than anomalous hadronization processes. For $p_{\\rm T}$ > 10 GeV/$c$ particle ratios in pp and Pb-Pb collisions are in agreement and the nuclear modification factors for $\\pi^{\\pm}$, $\\rm K^{\\pm}$ and $\\rm p$($\\bar{\\rm p}$) indicate that, within the systematic and statistical uncertainties, the suppression is the same. This suggests that the chemical composition of leading particles from jets in the medium is similar to that of vacuum jets.

  18. The energy production rate density of cosmic rays in the local universe is $\\sim10^{44-45}\\rm erg~Mpc^{-3}~yr^{-1}$ at all particle energies

    E-Print Network [OSTI]

    Katz, Boaz; Thompson, Todd; Loeb, Abraham

    2013-01-01T23:59:59.000Z

    The energy output (per logarithmic interval of particle energies) of Cosmic Rays (CRs) with energies $10{\\rm GeV}\\lesssim\\varepsilon_p\\lesssim100{\\rm GeV}$ is $\\sim 10^{47}\\rm erg$ per solar mass of star$-$formation, based on the CR production rate in the Milky Way and in starburst galaxies, implying a generation rate of $\\varepsilon_p^2Q\\sim 10^{45}\\rm erg~Mpc^{-3}~yr^{-1}$ in the local universe. It is only $\\sim 10$ times larger than the output, $\\varepsilon_p^2 Q=0.5\\pm0.2\\times 10^{44}\\rm erg~Mpc^{-3}~yr^{-1}$, of Ultra High Energy CRs (UHECRs) at energies $10^{10.5}{\\rm GeV}<\\varepsilon_p<10^{12}\\rm GeV$ (obtained assuming they are mostly protons), which in turn is comparable to the lower limit of $\\varepsilon_p^2 Q\\ge 0.5\\times 10^{44}\\rm erg~Mpc^{-3}~yr^{-1}$ of high energy CRs with $10^6{\\rm GeV}\\lesssim\\varepsilon_p\\lesssim 10^{8}\\rm GeV$ implied by the saturation of the Waxman-Bahcall bound by the neutrino excess recently discovered by IceCube. These similarities are consistent with a flat pro...

  19. Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy

    E-Print Network [OSTI]

    Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy edited by MoRteN JastRup #12;Energy for the future #12;Energy for the future with Ris from nuclear power to sustainable energy Translated from 'Energi til fremtiden med Ris fra

  20. New measurement of $\\rm S_{bare}(E)$ factor of the d(d,p)t reaction at astrophysical energies via the Trojan-horse method

    E-Print Network [OSTI]

    Li, Chengbo; Fu, Yuanyong; Zhou, Jing; Zhou, Shuhua; Meng, Qiuying; Spitaleri, C; Tumino, A; Pizzone, R G; Lamia, L

    2015-01-01T23:59:59.000Z

    The study of d(d,p)t reaction is very important for the nucleosynthesis in both standard Big Bang and stellar evolution, as well as for the future fusion reactor planning of energy production. The d(d,p)t bare nucleus astrophysical S(E) factor has been measured indirectly at energies from about 400 keV down to several keV by means of the Trojan horse method applied to the quasi-free process $\\rm {}^2H({}^6Li,pt){}^4He$ induced at the lithium beam energy of 9.5 MeV, which is closer to the zero quasi-free energy point, in CIAE HI-13 tandem accelerator laboratory. An accurate analysis leads to the determination of the d(d,p)t $\\rm S(E)$ factor $\\rm S_{bare}(0)=56.7 \\pm 2.0 keV*b$ and of the corresponding electron screening potential $\\rm U_e = 13.2 \\pm 4.3 eV$. In addition, this work also gives an updated test for the Trojan horse nucleus invariance comparing with previous indirect investigations using $\\rm {}^3He=(d+p)$ breakup.

  1. New measurement of $\\rm S_{bare}(E)$ factor of the d(d,p)t reaction at astrophysical energies via the Trojan-horse method

    E-Print Network [OSTI]

    Chengbo Li; Qungang Wen; Yuanyong Fu; Jing Zhou; Shuhua Zhou; Qiuying Meng; C. Spitaleri; A. Tumino; R. G. Pizzone; L. Lamia

    2015-04-08T23:59:59.000Z

    The study of d(d,p)t reaction is very important for the nucleosynthesis in both standard Big Bang and stellar evolution, as well as for the future fusion reactor planning of energy production. The d(d,p)t bare nucleus astrophysical S(E) factor has been measured indirectly at energies from about 400 keV down to several keV by means of the Trojan horse method applied to the quasi-free process $\\rm {}^2H({}^6Li,pt){}^4He$ induced at the lithium beam energy of 9.5 MeV, which is closer to the zero quasi-free energy point, in CIAE HI-13 tandem accelerator laboratory. An accurate analysis leads to the determination of the d(d,p)t $\\rm S(E)$ factor $\\rm S_{bare}(0)=56.7 \\pm 2.0 keV*b$ and of the corresponding electron screening potential $\\rm U_e = 13.2 \\pm 4.3 eV$. In addition, this work also gives an updated test for the Trojan horse nucleus invariance comparing with previous indirect investigations using $\\rm {}^3He=(d+p)$ breakup.

  2. Sapienza Univ Area Offerta Fo

    E-Print Network [OSTI]

    Guidoni, Leonardo

    (+39) 06 4 12968 it ZIONE COLL RAZIONE CO O FIXO S&U ento all'avviso e continuativa ti candidati son

  3. MEMORANDUM FO~~~ ATE DIRECTORS FROM:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12electron 9November 6, In this3,Office of Science Washington,

  4. Grazing incidence angle based sensing approach integrated with fiber-optic Fourier transform infrared (FO-FTIR) spectroscopy for remote and label-free detection of medical device contaminations

    SciTech Connect (OSTI)

    Hassan, Moinuddin, E-mail: moinuddin.hassan@fda.hhs.gov; Ilev, Ilko [Optical Therapeutics and Medical Nanophotonics Laboratory, Division of Biomedical Physics, Office of Science and Engineering Laboratories, Center for Devices and Radiological Health, U.S. Food and Drug Administration, Silver Spring, Maryland 20993 (United States)

    2014-10-15T23:59:59.000Z

    Contamination of medical devices has become a critical and prevalent public health safety concern since medical devices are being increasingly used in clinical practices for diagnostics, therapeutics and medical implants. The development of effective sensing methods for real-time detection of pathogenic contamination is needed to prevent and reduce the spread of infections to patients and the healthcare community. In this study, a hollow-core fiber-optic Fourier transform infrared spectroscopy methodology employing a grazing incidence angle based sensing approach (FO-FTIR-GIA) was developed for detection of various biochemical contaminants on medical device surfaces. We demonstrated the sensitivity of FO-FTIR-GIA sensing approach for non-contact and label-free detection of contaminants such as lipopolysaccharide from various surface materials relevant to medical device. The proposed sensing system can detect at a minimum loading concentration of approximately 0.7 ?g/cm{sup 2}. The FO-FTIR-GIA has the potential for the detection of unwanted pathogen in real time.

  5. Centrality dependence of particle production in p-Pb collisions at $\\sqrt{s_{\\rm NN} }$= 5.02 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-12-21T23:59:59.000Z

    We report measurements of the primary charged particle pseudorapidity density and transverse momentum distributions in p-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV, and investigate their correlation with experimental observables sensitive to the centrality of the collision. Centrality classes are defined using different event activity estimators, i.e. charged particle multiplicities measured in three disjunct pseudorapidity regions as well as the energy measured at beam rapidity (zero-degree). The procedures to determine the centrality, quantified by the number of participants ($N_{\\rm part}$), or the number of nucleon-nucleon binary collisions ($N_{\\rm coll}$), are described. We show that, in contrast to Pb-Pb collisions, in p-Pb collisions large multiplicity fluctuations together with the small range of participants available, generate a dynamical bias in centrality classes based on particle multiplicity. We propose to use the zero-degree energy, which we expect not to introduce a dynamical bias, as an alternative event-centrality estimator. Based on zero-degree energy centrality classes, the $N_{\\rm part}$ dependence of particle production is studied. Under the assumption that the multiplicity measured in the Pb-going rapidity region scales with the number of Pb-participants, an approximate independence of the multiplicity per participating nucleon measured at mid-rapitity of the number of participating nucleons is observed. Furthermore, at high-$p_{\\rm T}$ the p-Pb spectra are found to be consistent with the pp spectra scaled by $N_{\\rm coll}$ for all centrality classes. Our results represent valuable input for the study of the event activity dependence of hard probes in p-Pb collision and, hence, help to establish baselines for the interpretation of the Pb-Pb data.

  6. Sensor Consortium, Rm 214 Old Chemistry Building, State University of New York at Stony Brook, Stony Brook NY 11794-3717

    E-Print Network [OSTI]

    Luryi, Serge

    Sensor Consortium, Rm 214 Old Chemistry Building, State University of New York at Stony Brook twice won the NYS Advisor of the Year Award. The seminar will cover the following topics: Statement and rationales Lunch will be served at 12:30 PM The NYS SBDC is partially funded by the U.S. Small Business

  7. Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu

    E-Print Network [OSTI]

    Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu - 1 - What Can I Do With A Major In INFORMATION SYSTEMS? This handout will provide education. You'll gain a solid foundation in the various business disciplines and gain an understanding

  8. Evaluation of Cu as an interlayer in Be/F82H diffusion bonds for ITER TBM R.M. Hunt a,

    E-Print Network [OSTI]

    Abdou, Mohamed

    expansion in the region. Prior diffusion bonding research has shown that titanium is a good bonding aidEvaluation of Cu as an interlayer in Be/F82H diffusion bonds for ITER TBM R.M. Hunt a, , S.H. Goods has been investigated as a potential interlayer material for diffusion bonds between beryllium

  9. 230 GHz VLBI observations of M87: event-horizon-scale structure at the enhanced very-high-energy $\\rm \\gamma$-ray state in 2012

    E-Print Network [OSTI]

    Akiyama, Kazunori; Fish, Vincent L; Doeleman, Sheperd S; Broderick, Avery E; Dexter, Jason; Hada, Kazuhiro; Kino, Motoki; Nagai, Hiroshi; Honma, Mareki; Johnson, Michael D; Algaba, Juan C; Asada, Keiichi; Brinkerink, Christiaan; Blundell, Ray; Bower, Geoffrey C; Cappallo, Roger; Crew, Geoffrey B; Dexter, Matt; Dzib, Sergio A; Freund, Robert; Friberg, Per; Gurwell, Mark; Ho, Paul T P; Inoue, Makoto; Krichbaum, Thomas P; Loinard, Laurent; MacMahon, David; Marrone, Daniel P; Moran, James M; Nakamura, Masanori; Nagar, Neil M; Ortiz-Leon, Gisela; Plambeck, Richard; Pradel, Nicolas; Primiani, Rurik A; Rogers, Alan E E; Roy, Alan L; SooHoo, Jason; Tavares, Jonathan-Leon; Tilanus, Remo P J; Titus, Michael; Wagner, Jan; Weintroub, Jonathan; Yamaguchi, Paul; Young, Ken H; Zensus, Anton; Ziurys, Lucy M

    2015-01-01T23:59:59.000Z

    We report on 230 GHz (1.3 mm) VLBI observations of M87 with the Event Horizon Telescope using antennas on Mauna Kea in Hawaii, Mt. Graham in Arizona and Cedar Flat in California. For the first time, we have acquired 230 GHz VLBI interferometric phase information on M87 through measurement of closure phase on the triangle of long baselines. Most of the measured closure phases are consistent with 0$^{\\circ}$ as expected by physically-motivated models for 230 GHz structure such as jet models and accretion disk models. The brightness temperature of the event-horizon-scale structure is $\\sim 1 \\times 10^{10}$ K derived from the compact flux density of $\\sim 1$ Jy and the angular size of $\\sim 40 $ $\\rm \\mu$as $\\sim$ 5.5 $R_{{\\rm s}}$, which is broadly consistent with the peak brightness of the radio cores at 1-86 GHz located within $\\sim 10^2$ $R_{{\\rm s}}$. Our observations occurred in the middle of an enhancement in very-high-energy (VHE) $\\rm \\gamma$-ray flux, presumably originating in the vicinity of the centr...

  10. Sampling and analyses report for June 1992 semiannual postburn sampling at the RM1 UCG site, Hanna, Wyoming

    SciTech Connect (OSTI)

    Lindblom, S.R.

    1992-08-01T23:59:59.000Z

    The Rocky Mountain 1 (RMl) underground coal gasification (UCG) test was conducted from November 16, 1987 through February 26, 1988 (United Engineers and Constructors 1989) at a site approximately one mile south of Hanna, Wyoming. The test consisted of dual module operation to evaluate the controlled retracting injection point (CRIP) technology, the elongated linked well (ELW) technology, and the interaction of closely spaced modules operating simultaneously. The test caused two cavities to be formed in the Hanna No. 1 coal seam and associated overburden. The Hanna No. 1 coal seam is approximately 30 ft thick and lays at depths between 350 ft and 365 ft below the surface in the test area. The coal seam is overlain by sandstones, siltstones and claystones deposited by various fluvial environments. The groundwater monitoring was designed to satisfy the requirements of the Wyoming Department of Environmental Quality (WDEQ) in addition to providing research data toward the development of UCG technology that minimizes environmental impacts. The June 1992 semiannual groundwater.sampling took place from June 10 through June 13, 1992. This event occurred nearly 34 months after the second groundwater restoration at the RM1 site and was the fifteenth sampling event since UCG operations ceased. Samples were collected for analyses of a limited suite set of parameters as listed in Table 1. With a few exceptions, the groundwater is near baseline conditions. Data from the field measurements and analysis of samples are presented. Benzene concentrations in the groundwater were below analytical detection limits.

  11. Sampling and analyses report for December 1991 semiannual postburn sampling at the RM1 UCG site, Hanna, Wyoming

    SciTech Connect (OSTI)

    Lindblom, S.R.

    1992-01-01T23:59:59.000Z

    The Rocky Mountain 1 (RM1) underground coal gasification (UCG) test was conducted from November 16, 1987, through February 26, 1988 at a site approximately one mile south of Hanna, Wyoming. The test consisted of a dual-module operation to evaluate the controlled retracting injection point (CRIP) technology, the elongated linked well (ELW) technology, and the interaction of closely spaced modules operating simultaneously. The test caused two cavities to form in the Hanna No. 1 coal seam and associated overburden. The Hanna No. 1 coal seam was approximately 30 ft thick and lay at depths between 350 and 365 ft below the surface in the test area. The coal seam was overlain by sandstones, siltstones, and claystones deposited by various fluvial environments. The groundwater monitoring was designed to satisfy the requirements of the Wyoming Department of Environmental Quality (WDEQ) in addition to providing research data toward the development of UCG technology that minimizes environmental impacts. Further background material and the sampling and analytical procedures associated with the sampling task are described in the Rocky Mountain 1 Postburn Groundwater Monitoring Quality Assurance Plan (Mason and Johnson 1988).

  12. Dielectron Mass Spectra from Au+Au Collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; H. Bichsel; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bltmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderndze la Barca Snchez; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; S. Dhamija; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; L. Eun; O. Evdokimov; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; E. Finch; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; O. Hajkova; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; M. J. LeVine; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. M. M. D. Madagodagettige Don; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; M. Pachr; B. S. Page; S. K. Pal; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; W. Peryt; P. Pile; M. Planinic; J. Pluta; N. Poljak; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; P. R. Pujahari; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. N. Singaraju; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbk; Y. P. Viyogi; S. Vokal; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; Y. Zawisza; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-07-15T23:59:59.000Z

    We report the STAR measurements of dielectron ($e^+e^-$) production at midrapidity ($|y_{ee}|<$1) in Au+Au collisions at $\\sqrt{s_{\\rm NN}}$ = 200\\,GeV. The measurements are evaluated in different invariant mass regions with a focus on 0.30-0.76 ($\\rho$-like), 0.76-0.80 ($\\omega$-like), and 0.98-1.05 ($\\phi$-like) GeV/$c^{2}$. The spectrum in the $\\omega$-like and $\\phi$-like regions can be well described by the hadronic cocktail simulation. In the $\\rho$-like region, however, the vacuum $\\rho$ spectral function cannot describe the shape of the dielectron excess. In this range, an enhancement of 1.77$\\pm$0.11(stat.)$\\pm$0.24(sys.)$\\pm$0.33(cocktail) is determined with respect to the hadronic cocktail simulation that excludes the $\\rho$ meson. The excess yield in the $\\rho$-like region increases with the number of collision participants faster than the $\\omega$ and $\\phi$ yields. Theoretical models with broadened $\\rho$ contributions through interactions with constituents in the hot QCD medium provide a consistent description of the dilepton mass spectra for the measurement presented here and the earlier data at the Super Proton Synchrotron energies.

  13. RM Power Projects

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    rate-setting functions were integrated in 1990. The projects serve Colorado, Kansas, Nebraska and Wyoming with 830 MW of installed capacity and 3,360 miles of transmission line....

  14. RM Environmental Review (NEPA)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    San Juan County, NM (8-30-13) Lusk Rural Substation Control Building Construction Niobrara County, WY (1-16-13) Malta-Mt. Elbert 230-kV Danger Tree Management, Lake...

  15. Commissioning Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment. CashDay-JuneOffice of EnvironmentalCheckout,

  16. Conceptual Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.Attachment FY2011-40(10 CFR Parts

  17. Conceptual Safety Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.Attachment FY2011-40(10 CFR PartsOil, and

  18. Construction Readiness RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.AttachmentEnergyGeneratingConstruction

  19. Final Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Departmentof Ohio Environmental Protection Agency

  20. Preliminary Safety Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie Croft SeniorDepartment2015NEA-2011-02

  1. Prelminary Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie CroftPRELIMINARY TECHNOLOGYPreliminary

  2. Project Execution Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring Solar forProject Develops

  3. Readiness Review RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo.FrequencyEO-05-01:Regulatory

  4. Risk Management RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR -DepartmentRetail DemandEnergyRisk Management Review

  5. Acquisition Strategy RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613Portsmouth SitePresentations |State Wind EnergyEnergy26.17AcquisitionNo. AL

  6. Decommissioning Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesvilleAboutStatement993 SEAB Meeting December 3, 2013 SEABEnergy

  7. Integrated Project Team RM

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment of EnergyIndustry Research ProjectIntegrated Project Team (IPT)

  8. Evidence on the absence of critical transition in AMPT for Pb-Pb collisions at $sqrt{s_{\\rm{NN}}}$ = 2.76 TeV

    E-Print Network [OSTI]

    Ramni Gupta; Rohni Sharma

    2015-01-28T23:59:59.000Z

    Event-by-event fluctuations in the spatial patterns in charged particles generated in Pb--Pb collisions at the center-of-mass energy $\\sqrt{S_{\\rm{NN}}}$ = 2.76 TeV are studied within A MultiPhase Transport (AMPT) model. The spatial patterns of the particles generated in the ($\\eta, \\phi$) space for $|\\eta| \\le 0.8$ are studied using the methodology of intermittency and erraticity analysis. We find negative intermittency for charged particles generated in a range of $p_{\\rm{T}}$ windows. This result contrasts sharply from what is expected for a quark-gluon plasma undergoing hadronization by a second-order phase transition. Appropriate scaling behavior is examined, resulting in definitive scaling exponent $\

  9. Exclusive $\\mathrm{J/}?$ photoproduction off protons in ultra-peripheral p-Pb collisions at $\\sqrt{s_{\\rm NN}}=5.02$ TeV

    E-Print Network [OSTI]

    The ALICE Collaboration

    2014-06-30T23:59:59.000Z

    We present the first measurement at the LHC of exclusive J/$\\psi$ photoproduction off protons, in ultra-peripheral proton-lead collisions at $\\sqrt{s_{\\rm NN}}=5.02$ TeV. Events are selected with a dimuon pair produced either in the rapidity interval, in the laboratory frame, $2.5power law dependence of the $J/\\psi$ photoproduction cross section in $\\gamma {\\rm p}$ energies from about 20 to 700 GeV, or equivalently, from Bjorken-$x$ between $\\sim 2\\times 10^{-2}$ to $\\sim 2\\times 10^{-5}$, thus indicating no significant change in the gluon density behaviour of the proton between HERA and LHC energies.

  10. J/$?$ production and nuclear effects in p-Pb collisions at $\\sqrt{s_{\\rm NN}}=5.02$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-11-20T23:59:59.000Z

    Inclusive J/$\\psi$ production has been studied with the ALICE detector in p-Pb collisions at the nucleon-nucleon center of mass energy $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV at the CERN LHC. The measurement is performed in the center of mass rapidity domains $2.03nuclear modification factor $R_{\\rm pPb}$ for the rapidities under study are presented. While at forward rapidity, corresponding to the proton direction, a suppression of the J/$\\psi$ yield with respect to binary-scaled pp collisions is observed, in the backward region no suppression is present. The ratio of the forward and backward yields is also measured differentially in rapidity and transverse momentum. Theoretical predictions based on nuclear shadowing, as well as on models including, in addition, a contribution from partonic energy loss, are in fair agreement with the experimental results.

  11. Event-plane dependent dihadron correlations with harmonic $v_n$ subtraction in Au+Au Collisions at $\\sqrt{s_{_{\\rm NN}}}=200$ GeV

    E-Print Network [OSTI]

    STAR Collaboration

    2014-04-03T23:59:59.000Z

    STAR measurements of dihadron azimuthal correlations ($\\Delta\\phi$) are reported in mid-central (20-60\\%) Au+Au collisions at $\\sqrt{s_{_{\\rm NN}}}=200$ GeV as a function of the trigger particle's azimuthal angle relative to the event plane, $\\phi_{s}=|\\phi_{t}-\\psi_{\\rm EP}|$. The elliptic ($v_2$), triangular ($v_3$), and quadratic ($v_4$) flow harmonic backgrounds are subtracted using the Zero Yield At Minimum (ZYAM) method. The results are compared to minimum-bias d+Au collisions. It is found that a finite near-side ($|\\Delta\\phi|\\pi/2$) correlation shows a modification from d+Au data, varying with $\\phi_{s}$. The modification may be a consequence of pathlength-dependent jet-quenching and may lead to a better understanding of high-density QCD.

  12. Event shape engineering for inclusive spectra and elliptic flow in Pb-Pb collisions at $\\sqrt{s_\\rm{NN}}=2.76$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-07-22T23:59:59.000Z

    We report on results obtained with the Event Shape Engineering technique applied to Pb-Pb collisions at $\\sqrt{s_\\rm{NN}}=2.76$ TeV. By selecting events in the same centrality interval, but with very different average flow, different initial state conditions can be studied. We find the effect of the event-shape selection on the elliptic flow coefficient $v_2$ to be almost independent of transverse momentum $p_\\rm{T}$, as expected if this effect is due to fluctuations in the initial geometry of the system. Charged hadron, pion, kaon, and proton transverse momentum distributions are found to be harder in events with higher-than-average elliptic flow, indicating an interplay between radial and elliptic flow.

  13. A Roadmap to Control Penguin Effects in $B^0_d\\to J/?K_{\\rm S}^0$ and $B^0_s\\to J/??$

    E-Print Network [OSTI]

    Kristof De Bruyn; Robert Fleischer

    2015-03-30T23:59:59.000Z

    Measurements of CP violation in $B^0_d\\to J/\\psi K_{\\rm S}^0$ and $B^0_s\\to J/\\psi \\phi$ decays play key roles in testing the quark-flavour sector of the Standard Model. The theoretical interpretation of the corresponding observables is limited by uncertainties from doubly Cabibbo-suppressed penguin topologies. With continuously increasing experimental precision, it is mandatory to get a handle on these contributions, which cannot be calculated reliably in QCD. In the case of the measurement of $\\sin2\\beta$ from $B^0_d\\to J/\\psi K_{\\rm S}^0$, the $U$-spin-related decay $B^0_s\\to J/\\psi K_{\\rm S}^0$ offers a tool to control the penguin effects. As the required measurements are not yet available, we use data for decays with similar dynamics and the $SU(3)$ flavour symmetry to constrain the size of the expected penguin corrections. We predict the CP asymmetries of $B^0_s\\to J/\\psi K_{\\rm S}^0$ and present a scenario to fully exploit the physics potential of this decay, emphasising also the determination of hadronic parameters and their comparison with theory. In the case of the benchmark mode $B^0_s\\to J/\\psi \\phi$ used to determine the $B^0_s$-$\\bar B^0_s$ mixing phase $\\phi_s$ the penguin effects can be controlled through $B^0_d\\to J/\\psi \\rho^0$ and $B^0_s\\to J/\\psi \\bar{K}^{*0}$ decays. The LHCb collaboration has recently presented pioneering results on this topic. We analyse their implications and present a roadmap for controlling the penguin effects.

  14. Effect of event selection on jetlike correlation measurement in $d$+Au collisions at $\\sqrt{s_{\\rm{NN}}}=200$ GeV

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calder'on de la Barca S'anchez; J. M. campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; J. Cheng; M. Cherney; W. Christie; M. J. M. Codrington; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Feng; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; S. Gupta; A. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; H. Z. Huang; X. Huang; B. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; S. R. Klein; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; X. Li; C. Li; X. Li; W. Li; Z. M. Li; Y. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; L. Ma; G. L. Ma; Y. G. Ma; R. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; M. K. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. J. Summa; Z. Sun; Y. Sun; X. Sun; X. M. Sun; B. Surrow; D. N. Svirida; M. A. Szelezniak; J. Takahashi; Z. Tang; A. H. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbaek; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; J. S. Wang; Y. Wang; F. Wang; Y. Wang; G. Wang; H. Wang; J. C. Webb; G. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; Q. H. Xu; H. Xu; N. Xu; Y. F. Xu; Z. Xu; W. Yan; Y. Yang; Q. Yang; Y. Yang; C. Yang; S. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; X. P. Zhang; S. Zhang; Z. Zhang; Y. Zhang; J. L. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-03-03T23:59:59.000Z

    Dihadron correlations are analyzed in $\\sqrt{s_{_{\\rm NN}}} = 200$ GeV $d$+Au collisions classified by forward charged particle multiplicity and zero-degree neutral energy in the Au-beam direction. It is found that the jetlike correlated yield increases with the event multiplicity. After taking into account this dependence, the non-jet contribution on the away side is minimal, leaving little room for a back-to-back ridge in these collisions.

  15. Growth of cubic GaN on nano-patterned 3C-SiC/Si (0 0 1) substrates R.M. Kemper n

    E-Print Network [OSTI]

    As, Donat Josef

    Growth of cubic GaN on nano-patterned 3C-SiC/Si (0 0 1) substrates R.M. Kemper n , M. Weinl, C matched nano- patterned substrates. In hexagonal GaN inherent spontaneous and piezoelectric polarization conditions to achieve heteroepitaxial growth of cubic GaN [8]. The most ade- quate substrate is 3C-SiC (0 0 1

  16. Measurements of Dielectron Production in Au$+$Au Collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV from the STAR Experiment

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Caldern de la Barca Snchez; J. M. Campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; X. Chen; J. Cheng; M. Cherney; W. Christie; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Z. Feng; P. Filip; Y. Fisyak; C. E. Flores; L. Fulek; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; S. Gupta; A. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; X. Huang; H. Z. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; K. Jiang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; L. Kochenda; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; X. Li; C. Li; W. Li; Z. M. Li; Y. Li; X. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; Y. G. Ma; G. L. Ma; L. Ma; R. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; K. Meehan; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. Olvitt Jr.; B. S. Page; R. Pak; Y. X. Pan; Y. Pandit; Y. Panebratsev; B. Pawlik; H. Pei; C. Perkins; A. Peterson; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; M. Posik; A. M. Poskanzer; N. K. Pruthi; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; M. K. Sharma; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. Sikora; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; M. Stepanov; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. Summa; X. Sun; Z. Sun; X. M. Sun; Y. Sun; B. Surrow; N. Svirida; M. A. Szelezniak; A. H. Tang; Z. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; A. N. Vasiliev; R. Vertesi; F. Videbk; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; G. Wang; Y. Wang; F. Wang; Y. Wang; H. Wang; J. S. Wang; J. C. Webb; G. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. G. Xiao; W. Xie; K. Xin; Q. H. Xu; Z. Xu; H. Xu; N. Xu; Y. F. Xu; Q. Yang; Y. Yang; S. Yang; Y. Yang; C. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; X. P. Zhang; J. Zhang; Y. Zhang; J. Zhang; J. B. Zhang; S. Zhang; Z. Zhang; J. Zhao; C. Zhong; L. Zhou; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-04-06T23:59:59.000Z

    We report on measurements of dielectron ($e^+e^-$) production in Au$+$Au collisions at a center-of-mass energy of 200 GeV per nucleon-nucleon pair using the STAR detector at RHIC. Systematic measurements of the dielectron yield as a function of transverse momentum ($p_{\\rm T}$) and collision centrality show an enhancement compared to a cocktail simulation of hadronic sources in the low invariant-mass region ($M_{ee}<$ 1 GeV/$c^2$). This enhancement cannot be reproduced by the $\\rho$-meson vacuum spectral function. In minimum-bias collisions, in the invariant-mass range of 0.30 $-$ 0.76 GeV/$c^2$, integrated over the full $p_{\\rm T}$ acceptance, the enhancement factor is 1.76 $\\pm$ 0.06 (stat.) $\\pm$ 0.26 (sys.) $\\pm$ 0.29 (cocktail). The enhancement factor exhibits weak centrality and $p_{\\rm T}$ dependence in STAR's accessible kinematic regions, while the excess yield in this invariant-mass region as a function of the number of participating nucleons follows a power-law shape with a power of 1.44 $\\pm$ 0.10. Models that assume an in-medium broadening of the $\\rho$ meson spectral function consistently describe the observed excess in these measurements. Additionally, we report on measurements of $\\omega$ and $\\phi$-meson production through their $e^+e^-$ decay channel. These measurements show good agreement with Tsallis Blast-Wave model predictions as well as, in the case of the $\\phi$-meson, results through its $K^+K^-$ decay channel. In the intermediate invariant-mass region (1.1$

  17. Charge correlations using the balance function in Pb-Pb collisions at $\\sqrt{s_{\\rm NN}} = 2.76$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-09-08T23:59:59.000Z

    In high-energy heavy-ion collisions, the correlations between the emitted particles can be used as a probe to gain insight into the charge creation mechanisms. In this Letter, we report the first results of such studies using the electric charge balance function in the relative pseudorapidity ($\\Delta\\eta$) and azimuthal angle ($\\Delta\\varphi$) in Pb--Pb collisions at $\\sqrt{s_{\\rm NN}}=2.76$ TeV with the ALICE detector at the Large Hadron Collider. The width of the balance function decreases with growing centrality (i.e. for more central collisions) in both projections. This centrality dependence is not reproduced by HIJING, while AMPT, a model which incorporates strings and parton rescattering, exhibits qualitative agreement with the measured correlations in $\\Delta\\varphi$ but fails to describe the correlations in $\\Delta\\eta$. A thermal blast-wave model incorporating local charge conservation and tuned to describe the $p_{\\rm T}$ spectra and v$_2$ measurements reported by ALICE, is used to fit the centrality dependence of the width of the balance function and to extract the average separation of balancing charges at freeze-out. The comparison of our results with measurements at lower energies reveals an ordering with $\\sqrt{s_{\\rm NN}}$: the balance functions become narrower with increasing energy for all centralities. This is consistent with the effect of larger radial flow at the LHC energies but also with the late stage creation scenario of balancing charges. However, the relative decrease of the balance function widths in $\\Delta\\eta$ and $\\Delta\\varphi$ with centrality from the highest SPS to the LHC energy exhibits only small differences. This observation cannot be interpreted solely within the framework where the majority of the charge is produced at a later stage in the evolution of the heavy--ion collision.

  18. Dijet asymmetry in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV within a multiphase transport model

    E-Print Network [OSTI]

    Guo-Liang Ma

    2013-06-04T23:59:59.000Z

    Within a multi-phase transport (AMPT) model, dijet asymmetry is studied in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV. It is found that a large dijet asymmetry ($A_{J}$) is produced by strong interactions between jets and partonic matter. It is demonstrated that hadronization and final-state hadronic rescatterings have little effects on $A_{J}$. The final $A_{J}$ is found to be driven by both initial $A_{J}$ and partonic jet energy loss, which is consistent with an increasing jet energy loss in a hot and strongly interacting partonic medium in more central Pb+Pb collisions.

  19. Medium modifications of jet shapes in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV within a multiphase transport model

    E-Print Network [OSTI]

    Guo-Liang Ma

    2014-02-06T23:59:59.000Z

    Within a multiphase transport model, medium modifications of differential jet shapes are investigated in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV. The differential jet shapes are significantly modified by the strong interactions between jets and a partonic medium in Pb+Pb collisions relative to that in p+p collisions. The modifications are slightly weakened by the hadronization of coalescence, but strengthened by resonance decays in hadronic rescatterings. Subleading jets display larger medium modifications than leading jets, especially in central Pb+Pb collisions with large dijet asymmetries. These behaviors of medium modifications of differential jet shapes reflect a dynamical evolution of redistribution of jet energy inside a quenched jet cone in high-energy heavy-ion collisions.

  20. Single Spin Asymmetries in Charged Kaon Production from Semi-Inclusive Deep Inelastic Scattering on a Transversely Polarized $^3{\\rm{He}}$ Target

    E-Print Network [OSTI]

    Y. X. Zhao; Y. Wang; K. Allada; K. Aniol; J. R. M. Annand; T. Averett; F. Benmokhtar; W. Bertozzi; P. C. Bradshaw; P. Bosted; A. Camsonne; M. Canan; G. D. Cates; C. Chen; J. -P. Chen; W. Chen; K. Chirapatpimol; E. Chudakov; E. Cisbani; J. C. Cornejo; F. Cusanno; M. M. Dalton; W. Deconinck; C. W. de Jager; R. De Leo; X. Deng; A. Deur; H. Ding; P. A. M. Dolph; C. Dutta; D. Dutta; L. El Fassi; S. Frullani; H. Gao; F. Garibaldi; D. Gaskell; S. Gilad; R. Gilman; O. Glamazdin; S. Golge; L. Guo; D. Hamilton; O. Hansen; D. W. Higinbotham; T. Holmstrom; J. Huang; M. Huang; H. F Ibrahim; M. Iodice; X. Jiang; G. Jin; M. K. Jones; J. Katich; A. Kelleher; W. Kim; A. Kolarkar; W. Korsch; J. J. LeRose; X. Li; Y. Li; R. Lindgren; N. Liyanage; E. Long; H. -J. Lu; D. J. Margaziotis; P. Markowitz; S. Marrone; D. McNulty; Z. -E. Meziani; R. Michaels; B. Moffit; C. Muoz Camacho; S. Nanda; A. Narayan; V. Nelyubin; B. Norum; Y. Oh; M. Osipenko; D. Parno; J. -C. Peng; S. K. Phillips; M. Posik; A. J. R. Puckett; X. Qian; Y. Qiang; A. Rakhman; R. Ransome; S. Riordan; A. Saha; B. Sawatzky; E. Schulte; A. Shahinyan; M. H. Shabestari; S. irca; S. Stepanyan; R. Subedi; V. Sulkosky; L. -G. Tang; A. Tobias; G. M. Urciuoli; I. Vilardi; K. Wang; B. Wojtsekhowski; X. Yan; H. Yao; Y. Ye; Z. Ye; L. Yuan; X. Zhan; Y. Zhang; Y. -W. Zhang; B. Zhao; X. Zheng; L. Zhu; X. Zhu; X. Zong

    2014-04-29T23:59:59.000Z

    We report the first measurement of target single spin asymmetries of charged kaons produced in semi-inclusive deep inelastic scattering of electrons off a transversely polarized $^3{\\rm{He}}$ target. Both the Collins and Sivers moments, which are related to the nucleon transversity and Sivers distributions, respectively, are extracted over the kinematic range of 0.1$<$$x_{bj}$$<$0.4 for $K^{+}$ and $K^{-}$ production. While the Collins and Sivers moments for $K^{+}$ are consistent with zero within the experimental uncertainties, both moments for $K^{-}$ favor negative values. The Sivers moments are compared to the theoretical prediction from a phenomenological fit to the world data. While the $K^{+}$ Sivers moments are consistent with the prediction, the $K^{-}$ results differ from the prediction at the 2-sigma level.

  1. ternational Centre fo vernance and Developm

    E-Print Network [OSTI]

    Peak, Derek

    . The combination of uranium mining, diamond exploration and the possibility of a major oil sands project have North The provincial North is crucial to Saskatchewan's economic future. Thevastmajorityoftheprovince'sfutureenergyresources--uranium

  2. Operational Effectiveness in Use fo BAS

    E-Print Network [OSTI]

    Bobker, M.; Joseph, M.; Ascazubi, M.; Brown, T.; Thorpe, K.; Essman, J.

    2013-01-01T23:59:59.000Z

    ?to??suck?out?the?data?? ? Database?Feudalism? ? proliferation?without? shared?standard ? Re?creating?the?inter? operability?situation ? More?complex??optimizing??control? routines?? challenges?for?the?human? operators ICEBO?2013???????????????????????????CITY...

  3. Operational Effectiveness in Use fo BAS

    E-Print Network [OSTI]

    Bobker, M.; Joseph, M.; Ascazubi, M.; Brown, T.; Thorpe, K.; Essman, J.

    2013-01-01T23:59:59.000Z

    , making it an under-utilized resource. We do not have an established industry baseline of how operators use BAS nor what best practices might be. An ASHRAE research project is surveying operators to investigate desirable ?dashboard? interfaces...-to-machine feedback is most advanced in the area of Demand Response, where initiation of a special mode activates prioritized load-shedding to meet a pre- determined kw level. The major controls manufacturers have prototypes for machine-to- machine oversight...

  4. COMM-OPINION-ORDER, 76 FERC 61,347, Promoting Wholesale Competition Through Open-Access Non-discriminatory Transmission Services by Public Utilities, Docket No. RM95-8-000, Recovery of Stranded Costs by

    E-Print Network [OSTI]

    Laughlin, Robert B.

    COMM-OPINION-ORDER, 76 FERC ¶61,347, Promoting Wholesale Competition Through Open-Access Non Incorporated Promoting Wholesale Competition Through Open-Access Non-discriminatory Transmission Services Utilities, Docket No. RM94-7-001 [62,646] [¶61,347] Promoting Wholesale Competition Through Open-Access Non

  5. [Smu68] R.M. Smullyan. First-order logic. Berlin: Springer-Verlag, 1968. [Ull88] J.D. Ullman. Principles of Database and Knowledge-Base Systems. Computer Science Press,

    E-Print Network [OSTI]

    Truszczynski, Miroslaw

    [Smu68] R.M. Smullyan. First-order logic. Berlin: Springer-Verlag, 1968. [Ull88] J.D. Ullman of the least model of the Horn logic program [Smu68, AN78]. We #12;rst need some de#12;nit

  6. Quasi-Differential Neutron Scattering Measurements of 238 A.M. Daskalakis, R.M. Bahran, E.J. Blain, B.J. McDermott, S. Piela, and Y. Danon

    E-Print Network [OSTI]

    Danon, Yaron

    Quasi-Differential Neutron Scattering Measurements of 238 U A.M. Daskalakis, R.M. Bahran, E between evaluations through the energy-angle distribution of neutrons from scattering and fission of 238 U using the Rensselaer Polytechnic Institute (RPI) neutron scattering system. Differential neutron

  7. Tulane Neurophenotyping Platform, Rm. 3731, SL-83, Tulane University Medical Center 1430 Tulane Avenue New Orleans, LA 70112, USA Tel: 1 (504)-988-3353 Fax: 1 (504)-988-5283

    E-Print Network [OSTI]

    Kalueff, Allan V.

    Tulane Neurophenotyping Platform, Rm. 3731, SL-83, Tulane University Medical Center 1430 Tulane@gmail.com Tulane Neurophenotyping Platform Behavioral Core Facility and Learning Resource Center serving Tulane a new transgenic mouse strain? - Tulane Neurophenotyping Platform (TNP) will be glad to help

  8. Sampling and analyses report for December 1991 semiannual postburn sampling at the RM1 UCG site, Hanna, Wyoming. [Quarterly report, January--March 1992

    SciTech Connect (OSTI)

    Lindblom, S.R.

    1992-01-01T23:59:59.000Z

    The Rocky Mountain 1 (RM1) underground coal gasification (UCG) test was conducted from November 16, 1987, through February 26, 1988 at a site approximately one mile south of Hanna, Wyoming. The test consisted of a dual-module operation to evaluate the controlled retracting injection point (CRIP) technology, the elongated linked well (ELW) technology, and the interaction of closely spaced modules operating simultaneously. The test caused two cavities to form in the Hanna No. 1 coal seam and associated overburden. The Hanna No. 1 coal seam was approximately 30 ft thick and lay at depths between 350 and 365 ft below the surface in the test area. The coal seam was overlain by sandstones, siltstones, and claystones deposited by various fluvial environments. The groundwater monitoring was designed to satisfy the requirements of the Wyoming Department of Environmental Quality (WDEQ) in addition to providing research data toward the development of UCG technology that minimizes environmental impacts. Further background material and the sampling and analytical procedures associated with the sampling task are described in the Rocky Mountain 1 Postburn Groundwater Monitoring Quality Assurance Plan (Mason and Johnson 1988).

  9. Azimuthal anisotropies of reconstructed jets in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV in a multiphase transport model

    E-Print Network [OSTI]

    Mao-Wu Nie; Guo-Liang Ma

    2014-07-28T23:59:59.000Z

    Azimuthal anisotropies of reconstructed jets [$v_{n}^{jet} (n=2, 3)$] have been investigated in Pb+Pb collisions at the center of mass energy $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV within a framework of a multiphase transport (AMPT) model. The $v_{2}^{jet}$ is in good agreement with the recent ATLAS data. However, the $v_{3}^{jet}$ shows a smaller magnitude than $v_{2}^{jet}$, and approaches zero at a larger transverse momentum. It is attributed to the path-length dependence in which the jet energy loss fraction depends on the azimuthal angles with respect to different orders of event planes. The ratio $v_{n}^{jet}/\\varepsilon_{n}$ increases from peripheral to noncentral collisions, and $v_{n}^{jet}$ increases with the initial spatial asymmetry ($\\varepsilon_{n}$) for a given centrality bin. These behaviors indicate that the $v_{n}^{jet}$ is produced by the strong interactions between jet and the partonic medium with different initial geometry shapes. Therefore, azimuthal anisotropies of reconstructed jet are proposed as a good probe to study the initial spatial fluctuations, which are expected to provide constraints on the path-length dependence of jet quenching models.

  10. Long-range pseudorapidity dihadron correlations in $d$+Au collisions at $\\sqrt{s_{\\rm NN}}=200$ GeV

    E-Print Network [OSTI]

    L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calder'on de la Barca S'anchez; J. M. campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; X. Chen; J. Cheng; M. Cherney; W. Christie; M. J. M. Codrington; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Feng; P. Filip; Y. Fisyak; C. E. Flores; L. Fulek; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; S. Gupta; A. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; H. Z. Huang; X. Huang; B. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; K. Jiang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; X. Li; X. Li; W. Li; Z. M. Li; Y. Li; C. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; L. Ma; R. Ma; G. L. Ma; Y. G. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; K. Meehan; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; A. Peterson; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; M. Posik; A. M. Poskanzer; N. K. Pruthi; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; M. K. Sharma; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. Sikora; M. Simko; M. J. Skoby; N. Smirnov; D. Smirnov; D. Solanki; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. J. Summa; Y. Sun; Z. Sun; X. M. Sun; X. Sun; B. Surrow; D. N. Svirida; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; A. N. Vasiliev; R. Vertesi; F. Videbaek; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; Y. Wang; F. Wang; H. Wang; J. S. Wang; G. Wang; Y. Wang; J. C. Webb; G. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; Z. Xu; Q. H. Xu; N. Xu; H. Xu; Y. F. Xu; Y. Yang; C. Yang; S. Yang; Q. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; X. P. Zhang; S. Zhang; J. Zhang; Z. Zhang; Y. Zhang; J. L. Zhang; F. Zhao; J. Zhao; C. Zhong; L. Zhou; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-02-26T23:59:59.000Z

    Dihadron angular correlations in $d$+Au collisions at $\\sqrt{s_{\\rm NN}}=200$ GeV are reported as a function of the measured zero-degree calorimeter neutral energy and the forward charged hadron multiplicity in the Au-beam direction. A finite correlated yield is observed at large relative pseudorapidity ($\\Delta\\eta$) on the near side (i.e. relative azimuth $\\Delta\\phi\\sim0$). This correlated yield as a function of $\\Delta\\eta$ appears to scale with the dominant, primarily jet-related, away-side ($\\Delta\\phi\\sim\\pi$) yield. The Fourier coefficients of the $\\Delta\\phi$ correlation, $V_{n}=\\langle\\cos n\\Delta\\phi\\rangle$, have a strong $\\Delta\\eta$ dependence. In addition, it is found that $V_{1}$ is approximately inversely proportional to the mid-rapidity event multiplicity, while $V_{2}$ is independent of it with similar magnitude in the forward ($d$-going) and backward (Au-going) directions.

  11. Facility Disposition Safety Strategy RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of.pdf6-OPAMDepartment6 FY 2007FY 2014Facilities

  12. MJJ RM Handbook-new

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment ofLetterEconomyDr. ErnestMID-CAREER RETIREMENTMISS-1-NMISUSE OF

  13. National Environmental Policy Act RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_Cost Estimating35.docMusings on|EnergyEnergy

  14. Earned Value Management System RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan Department ofNotices |Notice The Crystal CityofVehicles ||3 -3Earned Value

  15. Anomalous centrality evolution of two-particle angular correlations from Au-Au collisions at $\\sqrt{s_{\\rm NN}}$ = 62 and 200 GeV

    E-Print Network [OSTI]

    STAR Collaboration; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; A. V. Alakhverdyants; I. Alekseev; J. Alford; B. D. Anderson; C. D. Anson; D. Arkhipkin; G. S. Averichev; J. Balewski; D. R. Beavis; R. Bellwied; M. J. Betancourt; R. R. Betts; A. Bhasin; A. K. Bhati; H. Bichsel; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; E. Braidot; A. V. Brandin; S. G. Brovko; E. Bruna; S. Bueltmann; I. Bunzarov; T. P. Burton; X. Z. Cai; H. Caines; M. Calderon; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; S. Chattopadhyay; H. F. Chen; J. H. Chen; J. Y. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; P. Chung; M. J. M. Codrington; R. Corliss; J. G. Cramer; H. J. Crawford; X. Cui; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; L. Didenko; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; J. C. Dunlop; L. G. Efimov; M. Elnimr; J. Engelage; G. Eppley; M. Estienne; L. Eun; O. Evdokimov; R. Fatemi; J. Fedorisin; R. G. Fersch; P. Filip; E. Finch; V. Fine; Y. Fisyak; C. A. Gagliardi; D. R. Gangadharan; F. Geurts; P. Ghosh; Y. N. Gorbunov; A. Gordon; O. G. Grebenyuk; D. Grosnick; A. Gupta; S. Gupta; W. Guryn; B. Haag; O. Hajkova; A. Hamed; L-X. Han; J. W. Harris; J. P. Hays-Wehle; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; B. Huang; H. Z. Huang; T. J. Humanic; L. Huo; G. Igo; W. W. Jacobs; C. Jena; J. Joseph; E. G. Judd; S. Kabana; K. Kang; J. Kapitan; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; D. Kettler; D. P. Kikola; J. Kiryluk; A. Kisiel; V. Kizka; S. R. Klein; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. Koroleva; W. Korsch; L. Kotchenda; P. Kravtsov; K. Krueger; L. Kumar; M. A. C. Lamont; J. M. Landgraf; S. LaPointe; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; W. Leight; M. J. LeVine; C. Li; L. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; L. M. Lima; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; R. S. Longacre; Y. Lu; E. V. Lukashov; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; O. I. Mall; R. Manweiler; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; A. Meschanin; R. Milner; N. G. Minaev; S. Mioduszewski; M. K. Mitrovski; Y. Mohammed; B. Mohanty; M. M. Mondal; B. Morozov; D. A. Morozov; M. G. Munhoz; M. K. Mustafa; M. Naglis; B. K. Nandi; Md. Nasim; T. K. Nayak; L. V. Nogach; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; R. A. N. Oliveira; D. Olson; M. Pachr; B. S. Page; S. K. Pal; Y. Pandit; Y. Panebratsev; T. Pawlak; H. Pei; T. Peitzmann; C. Perkins; W. Peryt; P. Pile; M. Planinic; J. Pluta; D. Plyku; N. Poljak; J. Porter; C. B. Powell; D. Prindle; C. Pruneau; N. K. Pruthi; P. R. Pujahari; J. Putschke; H. Qiu; R. Raniwala; S. Raniwala; R. L. Ray; R. Redwine; R. Reed; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; L. Ruan; J. Rusnak; N. R. Sahoo; I. Sakrejda; S. Salur; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; J. Schaub; A. M. Schmah; N. Schmitz; T. R. Schuster; J. Seele; J. Seger; I. Selyuzhenkov; P. Seyboth; N. Shah; E. Shahaliev; M. Shao; M. Sharma; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; F. Simon; R. N. Singaraju; M. J. Skoby; N. Smirnov; D. Solanki; P. Sorensen; U. G. de Souza; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; S. G. Steadman; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; A. A. P. Suaide; M. C. Suarez; M. Sumbera; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; A. Szanto de Toledo; J. Takahashi; A. H. Tang; Z. Tang; L. H. Tarini; T. Tarnowsky; D. Thein; J. H. Thomas; J. Tian; A. R. Timmins; D. Tlusty; M. Tokarev; T. A. Trainor; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; F. Videbaek; Y. P. Viyogi; S. Vokal; M. Wada; M. Walker; F. Wang; G. Wang; H. Wang; J. S. Wang; Q. Wang; X. L. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; C. Whitten Jr.; H. Wieman; S. W. Wissink; R. Witt; W. Witzke; Y. F. Wu; Z. Xiao; W. Xie; H. Xu; N. Xu; Q. H. Xu; W. Xu; Y. Xu; Z. Xu; L. Xue; Y. Yang; Y. Yang; P. Yepes; K. Yip; I-K. Yoo; M. Zawisza; H. Zbroszczyk; W. Zhan; J. B. Zhang; S. Zhang; W. M. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva

    2012-06-13T23:59:59.000Z

    We present two-dimensional (2D) two-particle angular correlations on relative pseudorapidity $\\eta$ and azimuth $\\phi$ for charged particles from Au-Au collisions at $\\sqrt{s_{\\rm NN}} = 62$ and 200 GeV with transverse momentum $p_t \\geq 0.15$ GeV/$c$, $|\\eta| \\leq 1$ and $2\\pi$ azimuth. Observed correlations include a {same-side} (relative azimuth $< \\pi/2$) 2D peak, a closely-related away-side azimuth dipole, and an azimuth quadrupole conventionally associated with elliptic flow. The same-side 2D peak and away-side dipole are explained by semihard parton scattering and fragmentation (minijets) in proton-proton and peripheral nucleus-nucleus collisions. Those structures follow N-N binary-collision scaling in Au-Au collisions until mid-centrality where a transition to a qualitatively different centrality trend occurs within a small centrality interval. Above the transition point the number of same-side and away-side correlated pairs increases rapidly {relative to} binary-collision scaling, the $\\eta$ width of the same-side 2D peak also increases rapidly ($\\eta$ elongation) and the $\\phi$ width actually decreases significantly. Those centrality trends are more remarkable when contrasted with expectations of jet quenching in a dense medium. Observed centrality trends are compared to {\\sc hijing} predictions and to the expected trends for semihard parton scattering and fragmentation in a thermalized opaque medium. We are unable to reconcile a semihard parton scattering and fragmentation origin for the observed correlation structure and centrality trends with heavy ion collision scenarios which invoke rapid parton thermalization. On the other hand, if the collision system is effectively opaque to few-GeV partons the observations reported here would be inconsistent with a minijet picture.

  16. Charmonium and $e^+e^-$ pair photoproduction at mid-rapidity in ultra-peripheral Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$=2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-11-07T23:59:59.000Z

    The ALICE Collaboration at the LHC has measured the J/$\\psi$ and $\\psi^{'}$ photoproduction at mid-rapidity in ultra-peripheral Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}=2.76$ TeV. The charmonium is identified via its leptonic decay for events where the hadronic activity is required to be minimal. The analysis is based on an event sample corresponding to an integrated luminosity of about 23 $\\mu\\rm{b}^{-1}$. The cross section for coherent and incoherent J/$\\psi$ production in the rapidity interval $-0.9agreement with those models incorporating moderate nuclear gluon shadowing, such as EPS09 parametrization. In addition the cross section for the process $\\gamma\\gamma\\rightarrow e^+ e^-$ has been measured and found to be in agreement with models implementing QED at leading order.

  17. Energy Dependence of $K/?$, $p/?$, and $K/p$ Fluctuations in Au+Au Collisions from $\\rm \\sqrt{s_{NN}}$ = 7.7 to 200 GeV

    E-Print Network [OSTI]

    STAR Collaboration; N. M. Abdelwahab; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bltmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Caldern de la Barca Snchez; J. M. Campbell; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; R. Esha; L. Eun; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; A. Hamad; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbk; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-10-21T23:59:59.000Z

    A search for the quantum chromodynamics (QCD) critical point was performed by the STAR experiment at the Relativistic Heavy Ion Collider, using dynamical fluctuations of unlike particle pairs. Heavy-ion collisions were studied over a large range of collision energies with homogeneous acceptance and excellent particle identification, covering a significant range in the QCD phase diagram where a critical point may be located. Dynamical $K/\\pi$, $p/\\pi$, and $K/p$ fluctuations as measured by the STAR experiment in central 0-5% Au+Au collisions from center-of-mass collision energies $\\rm \\sqrt{s_{NN}}$ = 7.7 to 200 GeV are presented. The observable $\\rm \

  18. Isolation of Flow and Nonflow Correlations by Two- and Four-Particle Cumulant Measurements of Azimuthal Harmonics in $\\sqrt{s_{_{\\rm NN}}} =$ 200 GeV Au+Au Collisions

    E-Print Network [OSTI]

    N. M. Abdelwahab; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bltmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderndela Barca Snchez; J. M. Campbell; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; L. Eun; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbk; Y. P. Viyogi; S. Vokal; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; H. Wieman; S. W. Wissink; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-09-06T23:59:59.000Z

    A data-driven method was applied to measurements of Au+Au collisions at $\\sqrt{s_{_{\\rm NN}}} =$ 200 GeV made with the STAR detector at RHIC to isolate pseudorapidity distance $\\Delta\\eta$-dependent and $\\Delta\\eta$-independent correlations by using two- and four-particle azimuthal cumulant measurements. We identified a component of the correlation that is $\\Delta\\eta$-independent, which is likely dominated by anisotropic flow and flow fluctuations. It was also found to be independent of $\\eta$ within the measured range of pseudorapidity $|\\eta| 0.7$.

  19. FO:AFWC/2012/9 January 2012 E

    E-Print Network [OSTI]

    file of the manual "The biometrics of Non Wood Forest Products resource assessment: a review of current. 6. English, French and Spanish versions of NWFP Series 13: Resource assessment of non-wood forest and testing practical guidelines for the assessment of forest resources providing NWFP. Such guidelines enable

  20. Sensor System Fo4r Buried Waste Containment Sites

    DOE Patents [OSTI]

    Smith, Ann Marie (Pocatello, ID); Gardner, Bradley M. (Idaho Falls, ID); Kostelnik, Kevin M. (Idaho Falls, ID); Partin, Judy K. (Idaho Falls, ID); Lancaster, Gregory D. (Idaho Falls, ID); Pfeifer, Mary Catherine (San Antonio, NM)

    2005-09-27T23:59:59.000Z

    A sensor system for a buried waste containment site having a bottom wall barrier and/or sidewall barriers, for containing hazardous waste. The sensor system includes one or more sensor devices disposed in one or more of the barriers for detecting a physical parameter either of the barrier itself or of the physical condition of the surrounding soils and buried waste, and for producing a signal representing the physical parameter detected. Also included is a signal processor for receiving signals produced by the sensor device and for developing information identifying the physical parameter detected, either for sounding an alarm, displaying a graphic representation of a physical parameter detected on a viewing screen and/or a hard copy printout. The sensor devices may be deployed in or adjacent the barriers at the same time the barriers are deployed and may be adapted to detect strain or cracking in the barriers, leakage of radiation through the barriers, the presence and leaking through the barriers of volatile organic compounds, or similar physical conditions.

  1. Seismic and Rockphysics Diagnostics fo Multiscale Reservoir Textures

    SciTech Connect (OSTI)

    Gary Mavko

    2005-02-01T23:59:59.000Z

    We have continued to finish up our work on analyzing relationships between elastic properties and rock microstructure. We have worked on theoretical models for the effects of sorting and packing on elastic moduli and seismic velocities. After analyzing the scanning acoustic images of shales to quantify textures at different scales, we are now using theoretical inclusion models to quantify the elastic property variation with texture. In the closing phases of this project most of our efforts are now focused on writing up the results and preparing the final reports.

  2. CarolinaFoCus University of South Carolina

    E-Print Network [OSTI]

    Almor, Amit

    and limited physical barriers. Our responsibility, as leaders of higher education, is to equip our students economy. Our Carolinian Creed demands a life of civility and character manifested in a culture retention program and an on-time graduation program. · Enhancing graduate education and increasing

  3. College of Engineering Newsletter -Spirit fo Helios Spring 2009

    E-Print Network [OSTI]

    Berdichevsky, Victor

    breakthroughs at the 11th Biennial International Conference on Energy and the Environment in Hurghada, Egypt of the Society of Women Engineers (SWE). WSU plays key role at energy conference Wayne State University was a key of Engineering Technology wants to demonstrate how the university can be energy-independent. "The windmill

  4. FoMD E-Bulletin January 7, 2012

    E-Print Network [OSTI]

    MacMillan, Andrew

    Opportunities (CRIO) Project: Cancer Competition www.aihealthsolutions.ca/grants/crio/project/ January 28, 2013

  5. FoMD Research E-Bulletin November 7, 2013

    E-Print Network [OSTI]

    MacMillan, Andrew

    =654097953 &qz=7e4ce3 Information AIHS - 2013 CRIO Project - Cancer Competition http://www.aihealthsolutions.ca/grants/crio

  6. FoMD Research E-Bulletin December 19, 2013

    E-Print Network [OSTI]

    MacMillan, Andrew

    .rso.ualberta.ca/en/FormsCabinet.aspx Information AIHS - 2013 CRIO Project - Cancer Competition www.aihealthsolutions.ca/grants/crio/project/ 4

  7. 2013 guidance fo real Property Inventory Reporting | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartment ofCBFO-13-3322(EE) |2Department ofDepartmentDepartment3Template

  8. I RADIOLOGICAL SCOPING SURVEY OF FO,RMER MONSANTO' FACILITIES

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF INDUSTRIES,L? .-I I ,Is I I THEI) -I

  9. Laboratory Location (Bldg & Rm #): Principle Investigator

    E-Print Network [OSTI]

    Movileanu, Liviu

    of Hazardous Waste Management Manual (HWMM). Chemical(s) remaining in active lab or to different lab, EHO contacted for a Hazardous Waste Pick-up (Sec. 6.8 HWMM). Properly prepared (Sec.6.0 HWMM) any disposed. Removed all chemicals from shared storage areas (i.e. refrigerators, cold rooms) and properly

  10. Colorado Highlands Wind Project, Western's RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Colorado Highlands Wind Project Western Area Power Administration, Rocky Mountain Region (Western) has received a request from Colorado Highlands Wind to modify its Interconnection...

  11. Power Marketing and Contracts in RM

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    requirements for FERC Order 890 as outlined in Western's Open Access Transmission Tariff. Final Agenda - Meeting Transmission Challenges in the Rocky Mountain Region...

  12. RM methods for multiple fare structure environments

    E-Print Network [OSTI]

    Kayser, Matthew R. (Matthew Russell)

    2008-01-01T23:59:59.000Z

    The rapid growth of Low Cost Carriers (LCC) and their simplified fare structures has created "semi-restricted" fare structures where lower classes are undifferentiated except for price, while higher fare classes are still ...

  13. Commercial Grade Dedication RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube platformBuildingCoal CombustionSmart Grid RFI:onConsortiumCommercial Grade

  14. Final Design RM | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2: FinalOffers New Training on Energy6 Federalof EnergyThorium, and PotassiumFinal

  15. Construction Project Safety and Health Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.AttachmentEnergyGenerating

  16. Risk Management RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy at Waste-to-Energy usingofRetrofittingFundA l i c e L i p p e r t S e

  17. Safety Design Strategy RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy atLLC - FE DKT. 10-160-LNG - ORDERSTATE0-1 CHAPTER1the1-2009 MaySafetySafety

  18. Quality Assurance for Critical Decision Reviews RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo. 195 -Pueblo de 2011NewslettersQuality

  19. Readiness Review RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo.FrequencyEO-05-01:RegulatoryReadiness

  20. Safeguards and Security and Cyber Security RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSARDevelopmental AssignmentAprilAND POWERADVANCEDSafeguards and

  1. Integrated Project Team RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732on ArmedManufacturing | Department

  2. Acquisition Strategy RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartmentDepartment of2 ofEmergency AcquisitionsAUTHORITY13,April

  3. Commercial Grade Dedication RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs the Department ofAARP,CommercialFebruaryThe

  4. Conceptual Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary 24,ofOctober 2013 PeerThis Review

  5. Conceptual Safety Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary 24,ofOctober 2013 PeerThisOil,

  6. Construction Readiness RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary09 FY1,The Construction

  7. Decommissioning Plan RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732 DOE F 243.2Dashboards Dashboards PublicDavidDeclaration

  8. Preliminary Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA Administrativeof Excellence BuildingDepartment ofSolutions -PD

  9. Preliminary Safety Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA AdministrativeofDepartment of-Department|EA-97-12

  10. Readiness Review RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010In addition to 1National Broadband

  11. Microsoft Word - RM Procedures.doc

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovemberi CONTENTS Executive U.S. Department of Energy,Records

  12. High Performance Sustainable Building Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM Flash2011-12Approved on 24 July 2008 1 Office ofHigh Performance

  13. Integrated Project Team RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment of EnergyIndustry Research ProjectIntegrated Project Team

  14. InteRventIonAL PAIn FoR MoRe InFoRMAtIon

    E-Print Network [OSTI]

    Thompson, Michael

    , SGB, Suprascapular, Piriformis, Ilioinguinal nerve, Joint block ­ Philip Peng 12:30-1:10 LuncH 01:10-02:00 Interventional cancer pain management ­ Celiac plexus, superior hypogastric plexus, Ganglion of impar block lumbar and cervical medial branch block ­ Anuj Bhatia, Howard Intrater 03:20-03:40 BReAk 03:40-04:30 SIJ

  15. Sta te a n d E v e n ts fo r W e b Se r v ic e s: A C o m p a r iso n o f F iv e W S-R e so u r c e F r a m e w o r k a n d W S-N o tific a tio n

    E-Print Network [OSTI]

    Humphrey, Marty

    Sta te a n d E v e n ts fo r W e b Se r v ic e s: A C o m p a r iso n o f F iv e W S-R e so u r c e F r a m e w o r k a n d W S-N o tific a tio n Im p le m e n ta tio n s M a rty H u m p h re y , G le n n W a sso n D e p a rtm e n t o f C o m p u te r S c ie n c e , U n iv e rsity o f V irg in ia , C

  16. Revised 6/1/14 SHIP PD Alp NU Ship to CoInstituti DEPT Name Address Line 1 Address Line 2

    E-Print Network [OSTI]

    Shull, Kenneth R.

    NORTHWATHLETICS DEPT 2701 ASHLAND AVE ANDERSON HALL AT1 ATH ATH2703EQ NORTHWATHLETICS DEPT 2703 ASHLAND AVE EQUIPMENT RM AT6 ATH ATH2703TR NORTHWATHLETICS DEPT 2703 ASHLAND AVE TRAINING RM AT4 ATH ATH2705MC NORTHWATHLETICS DEPT 2705 ASHLAND AVE MCGAW HALL AT8 ATH ATH617FO NORTHWATHLETICS/RECREATION 617 FOSTER ATS ATS

  17. Publications of R.M. Kashaev Peer-reviewed articles.

    E-Print Network [OSTI]

    Genève, Université de

    of the dilogarithm. (Russian) Exactly solvable models in mathematical physics (Russian) (Chelyabinsk, 1998). Teoret

  18. Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

    SciTech Connect (OSTI)

    Yu, Y. H.; Jenne, D. S.; Thresher, R.; Copping, A.; Geerlofs, S.; Hanna, L. A.

    2015-01-01T23:59:59.000Z

    This report is an addendum to SAND2013-9040: Methodology for Design and Economic Analysis of Marine Energy Conversion (MEC) Technologies. This report describes an Oscillating Water Column Wave Energy Converter (OSWEC) reference model design in a complementary manner to Reference Models 1-4 contained in the above report. A conceptual design for a taut moored oscillating surge wave energy converter was developed. The design had an annual electrical power of 108 kilowatts (kW), rated power of 360 kW, and intended deployment at water depths between 50 m and 100 m. The study includes structural analysis, power output estimation, a hydraulic power conversion chain system, and mooring designs. The results were used to estimate device capital cost and annual operation and maintenance costs. The device performance and costs were used for the economic analysis, following the methodology presented in SAND2013-9040 that included costs for designing, manufacturing, deploying, and operating commercial-scale MEC arrays up to 100 devices. The levelized cost of energy estimated for the Reference Model 5 OSWEC, presented in this report, was for a single device and arrays of 10, 50, and 100 units, and it enabled the economic analysis to account for cost reductions associated with economies of scale. The baseline commercial levelized cost of energy estimate for the Reference Model 5 device in an array comprised of 10 units is $1.44/kilowatt-hour (kWh), and the value drops to approximately $0.69/kWh for an array of 100 units.

  19. Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    has a gently sloping seabed, free of irregularities that could disturb the local wave field. Thus, it is likely that the wave field is homogeneous over the deployment area of...

  20. 5:00-7:00 pm Humanities 1, Rm 210

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    Venezuela contest, on the well-traveled Caracas avenue where transgender women (transformistas) project-fashioning and identity. Venezuela has won more international beauty contests than any other. e femininity performedTransformistas,Beauty Queens,and the Performance of Femininity inVenezuela A chapter from the book will be available to read

  1. Facility Disposition Safety Strategy RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy Chinaof EnergyImpactOnSTATEMENT OF DAVID GEISEREnergy1 of 3 PPG Score MaturityThe

  2. Microsoft Word - RM 5 final June 2014.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE LMI-EFRCAddendumNo. 1REPRHUBC, Revision3412

  3. Microsoft Word - SANDIA REPORT - final RM6.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE LMI-EFRCAddendumNo.1-1303342 Unlimited311

  4. High Performance Sustainable Building Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To:Department of Energy CompletingPresentedGenerationBuilding

  5. Checkout, Testing, and Commissioning Plan RM | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO OverviewAttachments4 Chairs Meeting - April 2014 ENVIRONMENTALChapter2ChartCheckout,

  6. Facility Software Quality Assurance for Capital Project Decisions RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of.pdf6-OPAMDepartment6 FY 2007FYFacility Software Quality

  7. Safeguards and Security and Cyber Security RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy atLLC - FE DKT. 10-160-LNG - ORDERSTATE0-1 CHAPTER1the1-2009 May

  8. National Environmental Policy Act RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732onMake Your NextHowNQA-1.pdf

  9. Construction Project Safety and Health Plan RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary09 FY1,The Construction Project

  10. Earned Value Management System RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732 DOE FOrders ConcerningCleanupI ~ r hMayEnergyII) -Earned

  11. Preparation for Facility Operations RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA AdministrativeofDepartment DOE-STD-3009-94 July 1994A coolingThe

  12. Project Execution Plan Review Module (RM) | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010 | Department ofPlant |InterconnectionRecoveryThe

  13. Quality Assurance for Critical Decision Reviews RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010In addition to analysis3EnergyThe purpose of

  14. Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection RadiationRecord-SettingHead ofReference-Documents Sign InReference

  15. Microsoft Word - RM Handbook September 2006 final 1

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005 atthe DistrictIndependentDepartment4.doc Improving Project Management

  16. United States Department of the Interior - RM-53 - Reference Manual -

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown of Ladoga, IndianaTurtleCooperative Place: Beaver Redirect page JumpSpecial

  17. MOD By Date/Time Thursday Lisa 7/23/2014 Lec Rm A Lec Rm B

    E-Print Network [OSTI]

    Maczka William Serrano Michelle Helsel 10:00 Matthew Wade Sonia Dermer Jonathon Michelson Thomas Oeste 10 Moderator Tabbetha Dobbins Chris Kassner Brandi Toliver Isabel Beichl, ITL Cameron Miller C. White Moderator

  18. US Army Saves$44Million in ResidentialGHp Retrofit At Fo*Porrc Luisiana,

    E-Print Network [OSTI]

    Ground Source HeatPump Association Oklahoma StateUniversity 490Cordell South Stillwater,OK 74078-8018 Fax

  19. Quartes Jornades d'Investigacio i Fo-ment de la Multidisciplinarietat

    E-Print Network [OSTI]

    Colominas, Ignasi

    ~no Asistido por Ordenador de Tomas de Tierra para Subestaciones Electricas* I. Colominas, F. Navarrina y M por ordenador de tomas de tierra que es aplicable a un amplio rango de instalaciones electricas se entierra bajo una instalacion electrica. Los objetivos de un sistema de toma de tierra son

  20. Determining Flexible Capacit Needs fo theCapacity Needs for the

    E-Print Network [OSTI]

    resources to meet 33% RPS in 2022 E3 has developed the Renewable Energy Flexibility Model (REFLEX resources, given the characteristics of the existing fleet of conventional and renewable resources?renewable resources to make space for renewables can createrenewables can create upward ramping challenges when

  1. APPLICATION FO FLOW FORMING FOR USE IN RADIOACTIVE MATERIAL PACKAGING DESIGNS

    SciTech Connect (OSTI)

    Blanton, P.; Eberl, K.; Abramczyk, G.

    2012-07-11T23:59:59.000Z

    This paper reports on the development and testing performed to demonstrate the use of flow forming as an alternate method of manufacturing containment vessels for use in radioactive material shipping packaging designs. Additionally, ASME Boiler and Pressure Vessel Code, Section III, Subsection NB compliance along with the benefits compared to typical welding of containment vessels will be discussed. SRNL has completed fabrication development and the testing on flow formed containment vessels to demonstrate the use of flow forming as an alternate method of manufacturing a welded 6-inch diameter containment vessel currently used in the 9975 and 9977 radioactive material shipping packaging. Material testing and nondestructive evaluation of the flow formed parts demonstrate compliance to the minimum material requirements specified in applicable parts of ASME Boiler and Pressure Vessel Code, Section II. Destructive burst testing shows comparable results to that of a welded design. The benefits of flow forming as compared to typical welding of containment vessels are significant: dimensional control is improved due to no weld distortion; less final machining; weld fit-up issues associated with pipes and pipe caps are eliminated; post-weld non-destructive testing (i.e., radiography and die penetrant tests) is not necessary; and less fabrication steps are required. Results presented in this paper indicate some of the benefits in adapting flow forming to design of future radioactive material shipping packages containment vessels.

  2. "Lagring av Solenergi" Kasper Moth-Poulsen, PhD, FoAss

    E-Print Network [OSTI]

    Lemurell, Stefan

    Solar Thermal Solar Energy Storage "closed cycle" = 0 emission Long Term Energy Storage (months-Poulsen ,,Photon Upconversion Facilitated Molecular Solar Thermal Energy Storage" (submitted) With up. A., Energy Environ. Sci. 5, 8534-8537, 2012. Molecular Solar Thermal Device #12;Solar Lamp (AM 1

  3. WC_1990_014_CLASS_ADVANCE_WAIVER_of_US_and_Foreign_Rights_fo...

    Broader source: Energy.gov (indexed) [DOE]

    4CLASSADVANCEWAIVERofUSandForeignRightsfo.pdf WC1990014CLASSADVANCEWAIVERofUSandForeignRightsfo.pdf WC1990014CLASSADVANCEWAIVERofUSandForeignRightsfo...

  4. Geomagnetic control of the foF2 long-term trends A. V. Mikhailov1

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    in recent publications due to the problem of global climate changes (see reviews by Danilov, 1997, 1998 of Terrestrial Magnetism, Ionosphere and Radio Wave Propagation, Troitsk, Moscow Region 142092, Russia 2 National indication that F2-layer trends might be related to the long-term changes in geomagnetic activity. Further

  5. First Principles Simulations fo the Supercritical Behavior of Ore Forming Fluids

    SciTech Connect (OSTI)

    Weare, John H

    2013-04-19T23:59:59.000Z

    Abstract of Selected Research Progress: I. First-principles simulation of solvation structure and deprotonation reactions of ore forming metal ions in very nonideal solutions: Advances in algorithms and computational performance achieved in this grant period have allowed the atomic level dynamical simulation of complex nanoscale materials using interparticle forces calculated directly from an accurate density functional solution to the electronic Schr???????????????¶dinger equation (ab-initio molecular dynamics, AIMD). Focus of this program was on the prediction and analysis of the properties of environmentally important ions in aqueous solutions. AIMD methods have provided chemical interpretations of these very complex systems with an unprecedented level of accuracy and detail. The structure of the solvation region neighboring a highly charged metal ion (e.g., 3+) in an aqueous solution is very different from that of bulk water. The many-body behaviors (polarization, charge transfer, etc.) of the ion-water and water-water interactions in this region are difficult to capture with conventional empirical potentials. However, a large numbers of waters (up to 128 waters) are required to fully describe chemical events in the extended hydrations shells and long simulation times are needed to reliably sample the system. Taken together this makes simulation at the 1st principles level a very large computational problem. Our AIMD simulation results using these methods agree with the measured octahedral structure of the 1st solvation shell of Al3+ at the 1st shell boundary and a calculated radius of 1.937???????????????? (exp. 1.9????????????????). Our calculated average 2nd shell radius agrees remarkably well with the measured radius, 4.093 ???????????????? calculated vs. the measured value of 4.0-4.15 ????????????????. Less can be experimentally determined about the structure of the 2nd shell. Our simulations show that this shell contains roughly 12 water molecules, which are trigonally coordinated to the 1st shell waters. This structure cannot be measured directly. However, the number of 2nd shell water molecules predicted by the simulation is consistent with experimental estimates. Tetrahedral bulk water coordination reappears just after the 2nd shell. Simulations with 128 waters are close to the maximum size that can effectively be performed with present day methods. While the time scale of our simulation are not long enough to observe transfers of waters from the 1st to the 2nd shell, we do see transfers occurring on a picosecond time scale between the 2nd shell and 3rd shell via an associative mechanism. This is faster than, but consistent with, the results of measurements on the more tightly bound Cr3+ system. For high temperature simulations, proton transfers occur in the solvation shells leading to transient hydrolysis species. The reaction coordinate for proton transfer involves the coordinates of neighboring solvent waters as in the Grotis mechanism for proton transfer in bulk water. Directly removing a proton from the hexaqua Al3+ ion leads to a much more labile solvation shell and to a five coordinated Al3+ ion. This is consistent with very recent rate measurements of ligand exchange and the conjugate base labilization effect. For the Al3+-H2O system results for high but subcritical temperatures are qualitatively similar to room temperature simulations. However, preliminary simulations for supercritical temperatures (750K) suggest that there may be a dramatic change in be

  6. ITP Steel: Energy and Environmental Profile fo the U.S. Iron and Steel

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To:Department ofOralGovernmentStandards forand Opportunities forIndustry |

  7. http://www.blm.gov/nv/st/en/fo/lvfo/blm_programs/energy/propose

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. Hirsch SNLMaythemeansIHome * About *AboutTHE

  8. Visitor Tours at TA-53 TA53-FO-121-001A

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening aTurbulenceUtilize AvailableMedia1.1 The HistoryVisitingVisitor

  9. DE-EE0005449 High-Voltage Solid Polymer Batteries fo r Electric Drive Vehicles

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration would likeConstitution4Customer-Comments Sign8SeeBottomMechanical Testing

  10. WA_00_022_CARGILL_DOW_POLYMERS_LLC_Waiver_of_Domestic_and_Fo.pdf |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your DensityEnergy U.S.-China Electric Vehicle and03/02Report |to 40% Whole-House2007

  11. WA_98_023_McDERMOTT_TECHNOLOGY_INC_Waiver_of_Domestic_and_Fo.pdf |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your DensityEnergy U.S.-China Electric Vehicle and03/02Report |to 40%Department ofDepartment of Energy

  12. ITP Steel: Energy and Environmental Profile fo the U.S. Iron and Steel

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(Fact Sheet),Energy Petroleum Technology Vision 2020 ITP

  13. ITP Steel: Energy and Environmental Profile fo the U.S. Iron and Steel Industry

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(Fact Sheet),Energy Petroleum Technology Vision 2020 ITPand Environmental

  14. EXPERIMENTING WITH FLUIDS OC-569a Winter 2010 GFD lab: Ocean Sciences Bldg. Rm 107; teaching lab: Ocean Teaching Building Rm 206

    E-Print Network [OSTI]

    , interactions of fluids with solid boundaries, with gases, or with membranes (opening on a vast topic might want to experiment with turbulence, or with fluid energy devices, like hydrogen fuel cells or basic Stirling engines. There are so few fluid dynamics labs in the world that meaningful and unique

  15. Site characterization plan: Conceptual design report: Volume 4, Appendices F-O: Nevada Nuclear Waste Storage Investigations Project

    SciTech Connect (OSTI)

    MacDougall, H R; Scully, L W; Tillerson, J R [comps.] [comps.

    1987-09-01T23:59:59.000Z

    The site for the prospective repository is located at Yucca Mountain in southwestern Nevada, and the waste emplacement area will be constructed in the underlying volcanic tuffs. The target horizon for waste emplacement is a sloping bed of densely welded tuff more than 650 ft below the surface and typically more than 600 ft above the water table. The conceptual design described in this report is unique among repository designs in that it uses ramps in addition to shafts to gain access to the underground facility, the emplacement horizon is located above the water table, and it is possible that 300- to 400-ft-long horizontal waste emplacement boreholes will be used. This report summarizes the design bases, design and performance criteria, and the design analyses performed. The current status of meeting the preclosure performance objectives for licensing and of resolving the repository design and preclosure issues is presented. The repository design presented in this report will be expanded and refined during the advanced conceptual design, the license application design, and the final procurement and construction design phases. Volume 4 contains Appendices F to O.

  16. The Path of Carbon in Photosynthesis IV. The Identity and Sequence fo the Intermediates in Sucrose Synthesis

    E-Print Network [OSTI]

    Calvin, M.; Benson, A.

    2008-01-01T23:59:59.000Z

    B&TH OF CARBON IN PHOTOSYNTHESIS IV. THE IDENTITY Alii'])eigl, AMS Monograph on Photosynthesis, .in press. UCRL-254in a 9O-second photosynthesis, an activity of 30,000 cpm is

  17. Psychiatric Bulletin (2006), 30,1^2 COLIN O'GA R A A ND MA RCU S MUNA FO'

    E-Print Network [OSTI]

    of cigarette smoking and tobacco addiction. Smoking in schizophrenia and depression is thought in part to repre with such high smoking rates, we have a duty of care to protect them from the ill effects of tobacco smoke. Our efforts should include informing patients of the best treatments available and directing them

  18. Revolutionising tRee bReeding p.13 FoRest development in 3d p.14

    E-Print Network [OSTI]

    to restore and recreate lost natural values, all during an ongoing process of climate change. this task can is good for the climate 21 Mapping the ultrastructure of wood 21 Forests at centre of global tug of war 22 of Communication, Box 7077, SE-750 07 Uppsala, Sweden. Editorial staff: Nora Adelsköld (project leader, editor

  19. The relation of fO?, ferric-ferrous ratio (R), and physical properties of four natural clinoamphiboles

    E-Print Network [OSTI]

    Clowe, Celia Ann

    1987-01-01T23:59:59.000Z

    by powder X-ray diffraction. The value a sing was found to decrease with increasing R and was the most sensitive indicator of an increased Fe + content. The unit cell volume was found to decrease with increasing R, reflecting an overall decrease... in the unit cell para- meters in response to an increase in the smaller Fe3+ cation content. The b uni t cell parameter was essentially unaffected by increased Fe3+ content, and the c unit cell parameter was unaffected in tschermakitic hornblende...

  20. Western University Spencer Engineering Building, Rm. 3002 London, ON, Canada N6A 5B9

    E-Print Network [OSTI]

    Sinnamon, Gordon J.

    on synthesis and characterization of nanomaterials for fuel cell and Li battery applications. The successful

  1. BLDG. 80 (SU), RM. 106 561.297.1208 WWW.FAU.EDU/GOABROAD FFuukkuuookkaa,, JJaappaann

    E-Print Network [OSTI]

    Fernandez, Eduardo

    and is located on the northern shore of the island of Kyushu. It is a young, user-friendly city made up of seven of program, group transportation for excursions, homestay visit, admission fees and proposed group activities, Akihabara, Tokyo Oedo Museum), three group meals, language books, some group supplies, pre

  2. BREA Minutes Meeting Date and Place: Tuesday, July 10, 2012; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    had received from a representative of the Savannah River Site Retiree Association (SRSRA) Board of Directors. Apparently the Savannah River Site Contractor is in the process of significantly changing retirees' medical benefits and the SRSRA would like to know what is happening at other National Labs

  3. Interdisciplinary Requirements Analysis Using the Model-based RM Tool AUTORAID

    E-Print Network [OSTI]

    or airbag-control systems from the automotive do- main or, in addition, production systems in the automation

  4. BREA Minutes Meeting Date and Place: Tuesday, Dec 11, 2012; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    at two other National Labs Savannah River and Lawrence Livermore were mentioned. Dave Cox said that Savannah River retirees have contacted one of their US Senators, and he has been responsive. Steve). Their retirees' organization has declared its independence from the laboratory, citing concerns over

  5. Institute for Systems Research A.V. Williams Bldg. Rm. 3111

    E-Print Network [OSTI]

    Justh, Eric

    the Intelligent Servosystems Lab (ISL) within the Institute for Systems Research and the Electronic Warfare for a class of signals of importance in electronic surveillance. The resulting system would be sufficiently

  6. DRAFT Walla Walla Subbasin Aquatic RM&E Plan 1 Developed by: WDFW

    E-Print Network [OSTI]

    . This plan will therefore, serve as an interim set of guidelines that will assure a systematic approach should provide data of known quality (accuracy and precision) - Validate EDT model as a reliable measure

  7. Walla Walla Subbasin DRAFT Aquatic RM&E Plan Prepared by: CTUIR

    E-Print Network [OSTI]

    as an interim set of guidelines that will assure a systematic approach to directing and funding RME. Further as a reliable measure of habitat and population response to recovery actions taken in the Walla Walla subbasin

  8. Microsoft Word - EE Tech RM Mar 2013 Appx B - pt 1b - front matter...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    sheets of thin nanonmaterial for practical applications such as flexible organic solar cells. Associated R&D strategy References Brookhaven National Laboratory (2010, Nov. 3)....

  9. Communicating Complex Systems Peter H. Welch, Frederick R.M. Barnes

    E-Print Network [OSTI]

    Kent, University of

    or their simulated equivalent, boids. Our example case study operates at a finer level of granularity: a nanite

  10. ULTRA HIGH ENERGY COSMIC RAY SPECTRUM Baltrusaitis, R.M., Cady7

    E-Print Network [OSTI]

    ' energy by the relation Figure 1. Raw Energy Distribution of Fly's Eye Data. Eem = å0/X0 f Ne(x)dx where å

  11. BREA Minutes Meeting Date and Place: Tuesday, Dec. 13, 2011; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    Engineering employees who took early retirement when it was offered in 1995. They remember meetings with department supervisors who assured people that if they accepted early retirement, they would not have to pay

  12. A Sub-$\\rm ?^{3}$-Volume Cantilever-based Fabry-Prot Cavity

    E-Print Network [OSTI]

    Hrishikesh Kelkar; Daqing Wang; Diego Martn-Cano; Bjrn Hoffmann; Silke Christiansen; Stephan Gtzinger; Vahid Sandoghdar

    2015-02-09T23:59:59.000Z

    We report on the realization of an open plane-concave Fabry-P\\'erot resonator with a mode volume of $\\lambda^3/2$ at optical frequencies. We discuss some of the unconventional features of this new microcavity regime and show that the ultrasmall mode volume allows us to detect cavity resonance shifts induced by single nanoparticles even at quality factors as low as $120$. Being based on low-reflectivity micromirrors fabricated on a silicon cantilever, our experimental arrangement provides broadband operation, tunability of the cavity resonance, lateral scanning and promise for optomechanical studies.

  13. Building Rm Last Name First Name Department Extension Armington (PEC) 135 Love Tom Athletic Trainer 2184

    E-Print Network [OSTI]

    Wilson, Mark A.

    Stephanie AdministrativeCoordinator 2575 214 Maclean Robert English 1907 215 Salerno Ali English 1929 216 Karen Biology Technician 2556 201 Boes Katie Biology 1950 205 Steven Craig Biology 1982 206 Lehtinen

  14. Microsoft Word - RM1_Tidal Turbine_NREL Lawson, Li Y, Sale_2011...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Proceedings of the 30th International Conference on Ocean, Offshore, and Arctic Engineering OMAE2011 June 19-24, 2011, Rotterdam, The Netherlands OMAE2011-49863 DEVELOPMENT AND...

  15. BREA Minutes Meeting Date and Place: Tuesday, Oct. 11, 2011; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    . The first order of business was a Powerpoint presentation on "Preserving Nikola Tesla's Historic the property that once comprised Nikola Tesla's Long Island laboratory in Shoreham (at that time, Shoreham Wardenclyffe Laboratory" by Christopher Wesselborg, Tesla Science Center at Wardenclyffe. The Tesla Science

  16. Nuclear Forensic Reference Materials (RM) for Attribution of Urban Nuclear Terrorism

    E-Print Network [OSTI]

    Perkins, Richard A.

    Transport Target Event Nonproliferation- Counterproliferation Respond to illicit trafficking Detection of illicit programs Cooperative Threat Reduction Nuclear Materials Fuel cycles Limit fissile material Identify transit routes Monitor choke points Monitor smuggling gaps Nuclear detection programs

  17. Technical Basis Agreement Document for UGTA CAU 99 RM/SM

    National Nuclear Security Administration (NNSA)

    D.L. Finnegan, J.L. Thompson, C.M. Miller, P.L. Baca, L.F. Olivas, C.G. Geoffrion, D.K. Smith, W. Goishi, B.K. Esser, J.W. Meadows, N. Namboodiri, J.F. Wild. 2001. Nevada Test Site...

  18. BREA Minutes Meeting Date and Place: Tuesday, June 14, 2011; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    for the fall, to include a visit to the Solar Farm and an NSLS II update. A "lesson learned" from the May

  19. Microsoft Word - EE Tech RM Mar 2013 Appx B - pt 1b - front matter...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    power supply (UPS) interface hardware and control protocols to accept power from photovoltaic (PV) and other DC distributed generation sources. Capability Gap(s) Need for...

  20. U.S. Department of Energy Reference Model Program RM1: Experimental Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2,EHSS A-Zandofpoint motional%^6 Annual

  1. U.S. Department of Energy Reference Model Program RM2: Experimental Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2,EHSS A-Zandofpoint motional%^6 AnnualReference Model

  2. Sensorless Speed Control of Permanent Magnet-Assisted Synchronous Reluctance Motor (PMa-SynRM)

    E-Print Network [OSTI]

    Chakali, Anil K.

    2011-02-22T23:59:59.000Z

    synchronous AC machines in variable speed applications where previously asynchronous machines have been used [1-6]. Among the AC drives, the permanent magnet synchronous machine (PMSM) drives have been increasingly applied in a wide variety of industrial... applications. The reason comes from the advantages of PMSM which are high power density and efficiency, high torque to inertia ratio and high reliability. However, recently the high cost of magnet materials (e.g., samarium cobalt and neodymium-boron iron...

  3. Technical Basis Agreement Document for UGTA CAU 99 RM/SM

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. Hirsch SNLMay 20102 | NationalThis1QA:2 42 45

  4. http://www.nrc.gov/reading-rm/doc-collections/cfr/part020/full-

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. HirschOccurrence Reporting and2. TheAirA

  5. http://www.nrc.gov/reading-rm/doc-collections/cfr/part061/full-

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. HirschOccurrence Reporting and2.

  6. 10 CFR 850, Request for Information - Docket Number: HS-RM-10-CBDPP - Marc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: The Future of BadTHE U.S. DEPARTMENT OF ENERGY' SChapter

  7. U.S. Department of Energy Reference Model Program RM1: Experimental Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening aTurbulence may be key topatentMay 2015September 29, 2014 Prepared

  8. Microsoft Word - DOE_RM_DM-#100066-v1-Sitewide_Quarterly_Oct-Dec_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim

  9. Microsoft Word - DOE_RM_DM-#100069-v1-NAPL_Quarterly_Oct-Dec_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1 U.S.

  10. Microsoft Word - DOE_RM_DM-#101996-v1-Sitewide_jan_-_march_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1

  11. Microsoft Word - DOE_RM_DM-#341474-v1-NAPL_Quarterly_April_-_June_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166 2005

  12. Microsoft Word - DOE_RM_DM-#343505-v1-Sitewide_July_September_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166

  13. Microsoft Word - DOE_RM_DM-#345139-v1-NAPL_Quarterly_Oct-Dec_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1661 20055

  14. Microsoft Word - DOE_RM_DM-#345149-v1-Sitewide_Oct_Dec_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact

  15. Microsoft Word - DOE_RM_DM-#348497-v1-Sitewide_Semiannual_Report_January-Maƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuary through May

  16. Microsoft Word - DOE_RM_DM-#350832-v1-NAPL_Quarterly_April-June_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuary

  17. Microsoft Word - DOE_RM_DM-#359194-v1-Sitewide_report_June-Nov_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuarythrough

  18. Microsoft Word - DOE_RM_DM-#98960-v1-Sitewide_July_-_September_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official

  19. Microsoft Word - RM 1-3 Environmental Assessment_PNNL-Abstract.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The

  20. Microsoft Word - RM 1-3 Final Report Nov 2011 final.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The Prepared

  1. Microsoft Word - RM1_Tidal Turbine_ARL_PTO_OMAE_Paper-Abstract.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The Preparedxx

  2. Microsoft Word - RM1_Tidal Turbine_NREL Bir, Lawson, Li_2011 1.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The

  3. Microsoft Word - RM1_Tidal Turbine_NREL Lawson, Li Y, Sale_2011-Abstract.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form TheProceedings

  4. Microsoft Word - RM1_Tidal Turbine_UW Tidal Resource-Abstract.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form

  5. FO:EFC/2006/2.3 For reasons of economy, this document is produced in a limited number of copies. Delegates and observers are kindly requested to

    E-Print Network [OSTI]

    for products that cannot be validated as legally sourced. 4. The G8 Forestry Action Programme, agreed by G8 for its presidency of the G8, and the topic was discussed at the meeting of G8 environment and development

  6. Distributed H{sub 2} Supply for Fuel Cell Utility Vehicles Year 6 - Activity 3.5 - Development fo a National Center for Hydrogen Technology

    SciTech Connect (OSTI)

    Almlie, Jay

    2012-04-15T23:59:59.000Z

    The Energy & Environmental Research Center (EERC) has developed a high-pressure hydrogen production system that reforms a liquid organic feedstock and water at operating pressures up to 800 bar (~12,000 psig). The advantages of this system include the elimination of energy-intensive hydrogen compression, a smaller process footprint, and the elimination of gaseous or liquid hydrogen transport. This system could also potentially enable distributed hydrogen production from centralized coal. Processes have been investigated to gasify coal and then convert the syngas into alcohol or alkanes. These alcohols and alkanes could then be easily transported in bulk to distributed high-pressure water-reforming (HPWR)-based systems to deliver hydrogen economically. The intent of this activity was to utilize the EERCs existing HPWR hydrogen production process, previously designed and constructed in a prior project phase, as a basis to improve operational and production performance of an existing demonstration unit. Parameters to be pursued included higher hydrogen delivery pressure, higher hydrogen production rates, and the ability to refill within a 5-minute time frame.

  7. Modeling the interplay of fO2 and fS2 along the FeS-silicate melt equilibrium Roberto Moretti a,

    E-Print Network [OSTI]

    Long, Bernard

    , , Don R. Baker b,c a Istituto Nazionale di Geofisica e Vulcanologia, sezione Osservatorio Vesuviano, Via Geofisica e Vulcanologia, sezione Roma 1, via di Vigna Murata 605, 00143 Roma, Italy a b s t r a c ta r t i

  8. The Journal of Neuroscience, February 1990, fO(2): 420-435 Head-Direction Cells Recorded from the Postsubiculum in Freely

    E-Print Network [OSTI]

    Sereno, Martin

    /computer system monitored cell discharge while simultaneously tracking the position of 2 colored light emitting diodes (LEDs) secured to the animal's head. The animal's location was calculated from the position of one

  9. Validation fo the International Code Compliant Calculator (IC3) v3. 10.3 Using the RESNET Verification Procedures (No. 07-003)

    E-Print Network [OSTI]

    Kim, H.; Baltazar, J.C.; Haberl, J.

    2011-01-01T23:59:59.000Z

    Vegas, NV ..................................... 6? Figure 3: Percent Heating/Cooling Energy Use Change Using IC3 for HVAC Test Cases ....................................... 10? Figure 4: Percent Heating/Cooling Energy Use Change Using IC3 for DSE Test... Cases ............................................ 12? Figure 5: Percent Change in DHW Energy Use Using IC3 for Hot Water System Performance Test Cases .............. 14? LIST OF TABLES Table 1: Acceptance Criteria for IECC Code...

  10. Frit Development Efforts for Sludge Batch 4 (SB4): Operating Window Assessments fo Scenarios Leading Up to the Selected Preparation Plan for SB4

    SciTech Connect (OSTI)

    Peeler, D

    2006-03-21T23:59:59.000Z

    The objective of this report is to document technical information that has been provided to Defense Waste Processing Facility (DWPF) and Closure Business Unit (CBU) personnel as part of the frit development support for Sludge Batch 4 (SB4). The information presented in this report includes projected operating windows (expressed in terms of waste loading) for various sludge blending and/or washing options coupled with candidate frits of interest. Although the Nominal Stage assessment serves as the primary tool for these evaluations, select systems were also evaluated using a Variation Stage assessment in which compositional variations were introduced. In addition, assessments of the impacts of nepheline formation potential and the SO{sub 4}{sup -} solubility limit on the projected operating windows are also provided. Although this information was used as part of the technical basis leading to CBU's development of the preferred SB4 preparation plan, none of the options presented in this report was selected as the preferred plan. Therefore, the information is presented without significant interpretation of the resulting operating windows, but the projected windows are provided so additional insight can be explored if desired. Detailed assessments of the projected operating windows (using both Nominal and Variation Stage assessments) of the preferred sludge preparation plan with candidate frits are to be documented elsewhere. The information provided in this report is focused solely on model-based projections of the operating windows for various SB4 blending strategies of interest. Although nepheline formation potential is monitored via model predictions as a part of this assessment, experimental work investigating the impact of nepheline on glass quality is also being addressed in a parallel study. The results of this paper study and the experimental assessments of melt rate, SO{sub 4} solubility, and/or nepheline formation potential are all critical components of the inputs into the frit selection process for SB4.

  11. 270 ANGKLA C:. MtmROW K I AL. This work was supported in part by Air Force Ccjiitraci FO8635-

    E-Print Network [OSTI]

    Morel, François M. M.

    . Hasle, G. A. 1973. The mucilage pore of pennate diatoms. Nova Hedwigia Beih. 45:167-94. 3. Hohn, M. H 02139 ABSTRACl The toxicity of Cu to Thalassiosira pseudonana (Hustedt) Hasle and Heim

  12. UCSF Fo Undation AnnuAl RepoR t on pRivAte SuppoR t 20062007 Building for

    E-Print Network [OSTI]

    Soloveichik, David

    . Goodman Kathryn A. Hall Mary E. Hamilton Eric T. Herfindal, PharmD Aileen Clarke Hernandez William D. Clarke Swanson, Jr. Myron E. Ullman III John S. Wadsworth, Jr. Diane B. Wilsey Dennis J. Wong Barbara

  13. Validation fo the International Code Compliant Calculator (IC3) v3. 10.3 Using the RESNET Verification Procedures (No. 07-003)

    E-Print Network [OSTI]

    Kim, H.; Baltazar, J.C.; Haberl, J.

    Performance Standards (TBEPS) (i.e., the 2000 International Energy Conservation Code (IECC) with the 2001 Supplement, the 2006 National Appliance Energy Conservation Act (NAECA) revisions, and the 2009 IECC). The user-interface of IC3 was designed to ensure....3 and v3.10. The IC3 software is a web-based tool to demonstrate compliance of single and multifamily residences with the Texas Building Energy Performance Standards (TBEPS) ? i.e., the 2000 International Energy Conservation Code (IECC) with the 2001...

  14. Design & development fo a 20-MW flywheel-based frequency regulation power plant : a study for the DOE Energy Storage Systems program.

    SciTech Connect (OSTI)

    Rounds, Robert (Beacon Power, Tyngsboro, MA); Peek, Georgianne Huff

    2009-01-01T23:59:59.000Z

    This report describes the successful efforts of Beacon Power to design and develop a 20-MW frequency regulation power plant based solely on flywheels. Beacon's Smart Matrix (Flywheel) Systems regulation power plant, unlike coal or natural gas generators, will not burn fossil fuel or directly produce particulates or other air emissions and will have the ability to ramp up or down in a matter of seconds. The report describes how data from the scaled Beacon system, deployed in California and New York, proved that the flywheel-based systems provided faster responding regulation services in terms of cost-performance and environmental impact. Included in the report is a description of Beacon's design package for a generic, multi-MW flywheel-based regulation power plant that allows accurate bids from a design/build contractor and Beacon's recommendations for site requirements that would ensure the fastest possible construction. The paper concludes with a statement about Beacon's plans for a lower cost, modular-style substation based on the 20-MW design.

  15. Il teatro come denuncia e strumento di espressione del popolo: " I Dialoghi" di Ruzzante e "Morte accidentale di un anarchico" di Dario Fo

    E-Print Network [OSTI]

    Zamboni, Camilla

    2011-01-01T23:59:59.000Z

    la descrizione del campo di battaglia agghiacciante:nella descrizione della battaglia: RUZANTE Oh, compare, seagghiaccianti dei campi di battaglia spogliano la guerra

  16. IY}1f+ ~ /fo M.{W' 7(;+()Ja rI-t tn L6n s , de.r 00

    E-Print Network [OSTI]

    Golwala, Sunil

    J , .Ifif"J 'roJ ~ -,1.4,. .R d I ~- :x+ vi s tIiJJir \\~ ~ { ~ -+ 1("" ~~~~ .::?;> wti-"'-+ me Y

  17. A measurement of the ratio of inclusive cross sections $\\sigma(p\\bar{p}\\rightarrow Z+b{\\rm\\, jet})/ \\sigma(p\\bar{p}\\rightarrow Z+{\\rm jet})$ at $\\sqrt{s}=1.96$ TeV

    SciTech Connect (OSTI)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls; Alverson, George O.; /Northeastern U.; Alves, Gilvan Augusto; /Rio de Janeiro, CBPF; Ancu, Lucian Stefan; /Nijmegen U. /Fermilab

    2010-10-01T23:59:59.000Z

    The ratio of the cross section for p{bar p} interactions producing a Z boson and at least one b quark jet to the inclusive Z+jet cross section is measured using 4.2 fb{sup -1} of p{bar p} collisions collected with the D0 detector at the Fermilab Tevatron collider at {radical}s = 1.96 TeV. The Z {yields} {ell}{sup +}{ell}{sup -} candidate events with at least one b jet are discriminated from Z+ charm and light jet(s) events by a novel technique that exploits the properties of the tracks associated to the jet. The measured ratio is 0.0193 {+-} 0.0027 for events having a jet with transverse momentum p{sub T} > 20 GeV and pseudorapidity |{eta}| {le} 2.5, which is the most precise to date and is consistent with theoretical predictions.

  18. The effects of the meat binding agent, Activa[TM] TG-RM, on fresh beef at the retail level

    E-Print Network [OSTI]

    Kolle, Dusty Shane

    2001-01-01T23:59:59.000Z

    Ribeye rolls and top blade roasts were fabricated from corresponding sides of twenty-four beef carcasses varying in USDA quality and yield grades. The kernel fat that lies between the Spinalis dorsi and the Longissimus thoracis was removed...

  19. RM12-2703 Advanced Rooftop Unit Control Retrofit Kit Field Demonstration: Hawaii and Guam Energy Improvement Technology Demonstration Project

    SciTech Connect (OSTI)

    Doebber, I.; Dean, J.; Dominick, J.; Holland, G.

    2014-03-01T23:59:59.000Z

    As part of its overall strategy to meet its energy goals, the Naval Facilities Engineering Command (NAVFAC) partnered with U.S. Department of Energy's (DOE) National Renewable Energy Laboratory (NREL) to rapidly demonstrate and deploy cost-effective renewable energy and energy efficiency technologies. This was one of several demonstrations of new and underutilized commercial energy efficiency technologies. The consistent year-round demand for air conditioning and dehumidification in Hawaii provides an advantageous demonstration location for advanced rooftop control (ARC) retrofit kits to packaged rooftop units (RTUs). This report summarizes the field demonstration of ARCs installed on nine RTUs serving a 70,000-ft2 exchange store (large retail) and two RTUs, each serving small office buildings located on Joint Base Pearl Harbor-Hickam (JBPHH).

  20. River Influences on Shelf Ecosystems: Introduction and Synthesis1 , B.M. and R.M. Kudela2

    E-Print Network [OSTI]

    Hickey, Barbara

    .M. Kudela2 , J.D. Nash3 , K.W. Bruland2 , W.T. Peterson4 , P.4 MacCready1 , E.J. Lessard1 , D.A. Jay5 , N

  1. Microsoft Word - EE Tech RM Mar 2013 Appx B - pt 1b - front matter - ELECTRONIC.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE SWPAURTeC:8CO 2Dances done at English NATIONAL

  2. OC)elRM(o-T/^ DOE/PC/60810-TIO TITLE: Superacid Catalyzed Coal Conversion Chemistry DE86 015045

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for Renewable Energy:Nanowire3627 Federal RegisterImplementation3DPhotostatLBL - 5

  3. Microsoft Word - DOE_RM_DM-#101993-v1-4_5_Acre_Quarterly_Jan-March_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1 U.S.5

  4. Microsoft Word - DOE_RM_DM-#102768-v1-NAPL_Quarterly_Report_Jan-March_2005.ƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim16 U.S.

  5. Microsoft Word - DOE_RM_DM-#103356-v1-4_5_Acre_Quarterly_Apr-June_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim16

  6. Microsoft Word - DOE_RM_DM-#103356-v1-4_5_Acre_Quarterly_Apr-June_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166 2005 -

  7. Microsoft Word - DOE_RM_DM-#343504-v1-4_5_Quarterly_July_Sept_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166 20050

  8. Microsoft Word - DOE_RM_DM-#344133-v1-Final_NAPL_Quarterly_July-Sept_2005.Dƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1661 2005

  9. Microsoft Word - DOE_RM_DM-#345141-v1-4_5_Quarterly_Oct_Dec_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1661

  10. Microsoft Word - DOE_RM_DM-#348500-v1-4_5_Acre_Semiannual_Jan-May_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuary through

  11. Microsoft Word - DOE_RM_DM-#359195-v1-4_5_Acre_final_Jun-Nov_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuarythroughthrough

  12. Microsoft Word - DOE_RM_DM-#98971-v1-4_5_Acre_July_-_September_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF OfficialJuly Through September 2004

  13. Microsoft Word - DOE_RM_DM-#99768-v1-NAPL_Quarterly_Report_for_July-Sept_20ƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF OfficialJuly Through September

  14. Microsoft Word - DOE_RM_DM-#99942-v1-4_5_Acre_Quarterly_October_-_December_ƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF OfficialJuly Through September0 U.S.

  15. Juan de Oate in Quivira, 1601: the "Relacin cierta y verdadera" and the Valverde Interrogatory

    E-Print Network [OSTI]

    Craddock, Jerry R.; Polt, John H. R.

    2013-01-01T23:59:59.000Z

    abra poblados y pacificos Calidad de gente y su traxe Que enfo. 145 fo. 146 fo. 146 Calidad de gente y su traxe Que abrafo. 155 fo. 155 fo. 156 Calidad de gente y su traxe Que abra

  16. Nutrient Needs at a Glance

    E-Print Network [OSTI]

    Bielamowicz, Mary K.

    2003-02-10T23:59:59.000Z

    gninibmoc retfa :seulaV yliaD :)sVD( denimreted sa yliad dedeen tneirtun a fo tnuoma eht gurD dna dooF eht yb )ADF( noitartsinimdA :sititamreD niks eht fo noitammalfni :noitamauqseD niks fo reyal a fo ssol :amezcE deziretcarahc niks eht fo noitidnoc... yrotammalfni na gnihcti dna ssender yb :amedE ydob eht ni diulf fo noitalumucca lamronba esoculG ecnareloT nilusni fo noitcaer eht setatilicaf taht tnega yrateid a :)FTG( rotcaF ahrromeH :cig slessev doolb morf doolb fo ssol :sisoteK ni taf fo gninrub lamronba...

  17. Hard T ask s fo r W eak Ro bo ts: T he Ro le o f C o m m o n K no w ledg e in P attern

    E-Print Network [OSTI]

    Prencipe, Giuseppe

    of the fundam ental algorithm ic lim itations on w hat a set of autonom ous m obile robots can or cannot achiev e. W e study a hard task for a set of w eak robots. T he task is for the robots in the plane to form any arbitrary pattern that is giv en in advance. T he robots are w eak in sev eral aspects. T hey

  18. EA-1472: Commercial Demonstration fo the Low Nox Burner/Separated Over-Fire Air (LNB/SOFA) Integration System Emission Reduction Technology, Holcolm Station, Sunflower Electric Power Corporation Finnety County, Kansas

    Broader source: Energy.gov [DOE]

    The DOE has prepared an Environmental Assessment (EA), to analyze the potential impacts of the commercial application of the Low-NOx Burner/Separated Over-Fire Air (LNB/SOFA) integration system to achieve nitrogen oxide (NOx) emissions reduction at Sunflowers Holcomb Unit No. 1 (Holcomb Station), located near Garden City, in Finney County, Kansas. The Holcomb Station would be modified in three distinct phases to demonstrate the synergistic effect of layering NOx control technologies.

  19. ECEEE 2011 SUMMER STUDY EnERgY EffiCiEnCY fiRST: ThE foUnDaTion of a low-CaRbon SoCiETY 2037 The significance of difference

    E-Print Network [OSTI]

    Hazas, Mike

    The significance of difference: Understanding variation in household energy consumption Janine Morley School@comp.lancs.ac.uk Keywords socio-technical, energy behaviour, interaction, consumption dynamics, demand patterns, domestic energy, electricity use, households, end-use consumption, practices, practice theory Abstract Studies

  20. Student Career Centre Agora : Rm 7-153 Tel: 250-960-6598 hirestudents@unbc.ca www.unbc.ca/careercentre Revised: Oct 2007

    E-Print Network [OSTI]

    Northern British Columbia, University of

    and consultant for matters dealing with the management and preservation of cultural differences. SKILLS YOU.unbc.ca/careercentre Revised: Oct 2007 COMMUNICATION SKILLS INFORMATION MANAGEMENT The ability to communicate ideas clearly, and Special skills in communicating, generating, and defending apply knowledge. approaches to the subject

  1. Grant Title: NIH DIRECTOR'S EARLY INDEPENDENCE AWARDS (DP5) Funding Opportunity Number: RFA-RM-12-018. CFDA Number(s): 93.310.

    E-Print Network [OSTI]

    Farritor, Shane

    -018. CFDA Number(s): 93.310. Agency/Department: Department of Health and Human Services, Office of Strategic

  2. Session 6: Integrated Product Development and Project Management Hotel Monaco (Vienna rm) 501 Geary St San Francisco, CA April 14-17, 2014

    E-Print Network [OSTI]

    Soloveichik, David

    Sciences, Endo 8:35 am 60 Decision Analysis Tools and Techniques Patricia Evans, PhD, Independent Consultant 9:35 am 50 Product Development Decision Making John Celona, JD, Independent Consultant 10:25 am 15 Risk and Return in Portfolio Management Patricia Evans, PhD, Independent Consultant 2:35 pm 60 Role

  3. Student Career Centre Agora : Rm 7-153 Tel: 250-960-6598 hirestudents@unbc.ca www.unbc.ca/careercentre Revised: Oct 2007

    E-Print Network [OSTI]

    Northern British Columbia, University of

    companies achieve production goals. Determines methods of cutting and removing timber with minimum waste forestation and reforestation projects. Maps forest areas, estimates standing timber and future growth, and manages timber sales. Plans cutting programs to assure continuous production of timber or to assist timber

  4. Draft Title 40 CFR 191 compliance certification application for the Waste Isolation Pilot Plant. Volume 9: Appendices RM, SCR, SER, SUM, WRAC

    SciTech Connect (OSTI)

    NONE

    1995-03-31T23:59:59.000Z

    The Rock Mechanics Program is important to the establishment of a radioactive waste repository in salt because rock mechanics deals with the prediction of creep closure and eventual encapsulation of the waste. The intent of this paper is to give the current status of the program. This program consists of three major modeling efforts: continuum creep, fracture, and the disturbed rock zone. These models, together with laboratory material parameters, plastic flow potentials, initial and boundary input data, and other peripheral information forms the predictive technology. The extent to which the predictive technology is validated against in situ test data adds certainty to the method. Application of the technology is through simulations of the test results, design, or performance using numerical codes. In summary, the predictive capabilities are technically sound and reasonable. The current status of the program is that which would be advanced for compliance.

  5. IEMS 305 Statistical Methods for Quality Improvement Instructor: Prof. Daniel Apley; Rm. C150; 491-2397; apley@northwestern.edu; office

    E-Print Network [OSTI]

    Hazen, Gordon

    .g. financial services or health care. Six-sigma programs, the focus of which is reducing variability methods used in six-sigma, with the material covered at a level consistent with the strong analytical.5 weeks) Process Optimization and Robust Design (Ch. 14, ~ 1 week) Other Useful Six Sigma topics (~ 1 week

  6. Date Days OCE Title Presenter / Sponsoring Organization Time Location 1 1/23/13 Wednesday Classroom Success Kate Forynna 6:00PM Downtown Library Rm. 104 Yes

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    Unconventional Shale R&D: Flow back/Produced Water Treatment," MAE/ Jason Trembly 1:30PM ESB 201 Yes 36 3

  7. The Sloan Bright Arcs Survey : Discovery of Seven New Strongly Lensed Galaxies from $\\rm{z}=0.66-2.94$

    SciTech Connect (OSTI)

    Kubo, Jeffrey M.; Allam, Sahar S.; Annis, James; Buckley-Geer, Elizabeth J.; Diehl, H.Thomas; Drabek, Emily; Frieman, Joshua A.; Hao, Jiangang; Kubik, Donna; Lin, Huan; Soares-Santos, Marcelle

    2010-10-01T23:59:59.000Z

    We report the discovery of seven new, very bright gravitational lens systems from our ongoing gravitational lens search, the Sloan Bright Arcs Survey (SBAS). Two of the systems are confirmed to have high source redshifts z = 2.19 and z = 2.94. Three other systems lie at intermediate redshift with z = 1.33, 1.82, 1.93 and two systems are at low redshift z = 0.66, 0.86. The lensed source galaxies in all of these systems are bright, with i-band magnitudes ranging from 19.73-22.06. We present the spectrum of each of the source galaxies in these systems along with estimates of the Einstein radius for each system. The foreground lens in most systems is identified by a red sequence based cluster finder as a galaxy group; one system is identified as a moderately rich cluster. In total the SBAS has now discovered nineteen strong lens systems in the SDSS imaging data, eight of which are among the highest surface brightness z {approx_equal} 2-3 galaxies known.

  8. THE STRUCTURE OF EAS AT E > 0.1 EeV Baltrusaitis, R.M., Cassiday, G.L., Cooper, R., Elbert, J.W.,

    E-Print Network [OSTI]

    in the electromagnetic channel (Eem) to the size of the shower at maximum development (Nmax) from a direct measurement-electromagnetic channel. We present below the results of the Eem vs Nmax relationship obtained from a direct integration trajectories(1). Electromagnetic shower energy, Eem, and shower size at maximum Nmax is determined by fits made

  9. ENERGY CALIBRATION OF THE FLY'S EYE DETECTOR Baltrusaitis, R.M., Cassiday, G.L., Cooper, R., Elbert, J.W.,

    E-Print Network [OSTI]

    integrals of observed shower development curves(1). eg Eem = å0/X0 Ne(x)dx where Eem is the total energy

  10. Student Career Centre Agora : Rm 7-153 Tel: 250-960-6598 hirestudents@unbc.ca www.unbc.ca/careercentre Revised: Oct 2007

    E-Print Network [OSTI]

    Northern British Columbia, University of

    of museums, gallery exhibitions, and historical/heritage sites. Answers inquiries and provides information of historical material. Conducts tours and gives lectures and presentations on historical topics. Works for libraries, historical museums, and historical sites. MUSEUM INTERPRETER Museum interpreters conduct tours

  11. Elliptic flow of non-photonic electrons in Au+Au collisions at $\\sqrt{s_{\\rm NN}} = $ 200, 62.4 and 39 GeV

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; H. Bichsel; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bltmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Caldern de la Barca Snchez; J. M. Campbell; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; L. Eun; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbk; Y. P. Viyogi; S. Vokal; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; W. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-05-24T23:59:59.000Z

    We present the measurements of elliptic flow ($v_2$) of non-photonic electrons (NPE) by the STAR experiment using 2- and 4-particle correlations, $v_2${2} and $v_2${4}, and the event plane method in Au+Au collisions at $\\sqrt{s_{NN}} = 200$ GeV, and $v_2${2} at 62.4 and 39 GeV. $v_2${2} and $v_2${4} are non-zero at low and intermediate transverse momentum ($p_T$) at 200 GeV, and $v_2${2} is consistent with zero at low $p_T$ at other energies. For Au+Au collisions at $p_T<1$ GeV/c, there is a statistically significant difference between $v_2${2} at 200 GeV and $v_2${2} at the two lower beam energies.

  12. Search for $WH$ associated production in $p \\bar{p}$ collisions at $\\sqrt{s}=1.96\\,{\\rm TeV}$

    SciTech Connect (OSTI)

    Abazov, Victor Mukhamedovich; Abbott, Braden Keim; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Alexeev, Guennadi D.; Alkhazov, Georgiy D.; Alton, Andrew K.; Alverson, George O.; Aoki, Masato; Askew, Andrew Warren

    2012-03-01T23:59:59.000Z

    This report describes a search for associated production of W and Higgs bosons based on data corresponding to an integrated luminosity of L {approx} 5.3 fb{sup -1} collected with the D0 detector at the Fermilab Tevatron p{bar p} Collider. Events containing a W {yields} {ell}{nu} candidate (with {ell} corresponding to e or {mu}) are selected in association with two or three reconstructed jets. One or two of the jets are required to be consistent with having evolved from a b quark. A multivariate discriminant technique is used to improve the separation of signal and backgrounds. Expected and observed upper limits are obtained for the product of the WH production cross section and branching ratios and reported in terms of ratios relative to the prediction of the standard model as a function of the mass of the Higgs boson (M{sub H}). The observed and expected 95% C.L. upper limits obtained for an assumed M{sub H} = 115 GeV are, respectively, factors of 4.5 and 4.8 larger than the value predicted by the standard model.

  13. Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu

    E-Print Network [OSTI]

    Production Managers Industry Relations Specialist Insurance Agent/Broker Inventory Control Specialist management, administrative theory, and international management emphasizes the processes of planning, organizing, leading and controlling organizations. The program is intended to help you develop

  14. Growth of cubic GaN on 3CSiC/Si (001) nanostructures R.M. Kemper a,n

    E-Print Network [OSTI]

    As, Donat Josef

    ) substrate. These anti-phase domains strongly influence the optimum growth of GaN layers in these regions are due to the lattice mismatch with the substrate. For c-GaN, 3CSiC is the preferred substrate of GaN on post shaped nanostructures and analyze the influence of substrate domains on the defect

  15. Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu

    E-Print Network [OSTI]

    Management and Pricing Procurement and Supply Management Materials Planning Inventory Management-5591 | www.business.ku.edu - 1 - What Can I Do With A Major In SUPPLY CHAIN MANAGEMENT? What is Supply Chain Management? Supply Chain Management (SCM) consists of a set of approaches to efficiently integrate the flow

  16. Department of Computer Science, University of Toronto, 10 King's College Road, Rm.3303, Toronto, Ontario CANADA M5S 3G4 www.cs.toronto.edu

    E-Print Network [OSTI]

    Zandstra, Peter W.

    -stream position in Computational Biology or Bioinformatics. The appointment is at the rank of Assistant Professor's strengths in biology and bioinformatics---and computational, medical and biological sciences more broadly, computational biology and quantitative biology), exceptional candidates with recent or imminently-expected Ph

  17. Does Nursing Student Self-efficacy Correlate with Knowledge When Using Human Patient Simulation?

    E-Print Network [OSTI]

    Shinnick, MA; Woo, MA

    2014-01-01T23:59:59.000Z

    at Los Angeles, 700 Tiverton Ave. , Factor Building Rm. 3-at Los Angeles, 700 Tiverton Ave. , Factor Building Rm. 3-

  18. Total Cross Section Measurements of Highly Enriched Isotopic Mo in the Resolved and Unresolved Energy Regions R.M. Bahran, A.M. Daskalakis, B.J. McDermott, E.J. Blain and Y. Danon

    E-Print Network [OSTI]

    Danon, Yaron

    Total Cross Section Measurements of Highly Enriched Isotopic Mo in the Resolved and Unresolved providing an evacuated pathway for the neutrons to travel. Isotopically-enriche advanced fuel [1,2]. High resolution neutron time-of-flight transmission measurements on highly enriched

  19. 1 V.A. Andreev, E.J. Barnes, R.M. Carey, W. Gohn, V.A. Ganzha, A. Gardestig, T. Gorringe, F.E. Gray, D.W. Hertzog,

    E-Print Network [OSTI]

    Titov, Anatoly

    Meeting of the APS Division of Nuclear Physics and the Physical Society of Japan Volume 59, Number 10 Help to Increase the Energy Output of Fusion Reactors? The 21st International Symposium on Spin Physics «- 2014», 1-4 2014, Book of abstracts, p. 218 2 .. - MUSUN 64 «- 2014», 1-4 2014, Book

  20. Nuclear Data for Criticality Safety and Reactor Applications at the Gaerttner LINAC Center Y. Danon, R.M. Bahran, E.J. Blain, A.M. Daskalakis, B.J. McDermott, D.G. Williams

    E-Print Network [OSTI]

    Danon, Yaron

    Nuclear Data for Criticality Safety and Reactor Applications at the Gaerttner LINAC Center Y. Danon used in reactor and nuclear criticality safety applications. The goal of this program is to provide to nuclear criticality, neutron shielding applications, nuclear reactor design, and to better understand

  1. PRECISION MEASUREMENT OF SINGLET CAPTURE IN HYDROGEN V.A. Andreev , T. Banks , L. Bonnet , R.M. Carey , T.A. Case , D. Chitwood , S.M. Clayton , K.M. Crowe , P.T. Debevec ,

    E-Print Network [OSTI]

    Kammel, Peter

    magnet which is a specially designed coil wound closely around the Alu vessel containing the TPC well-known of the nucleon charged current form factors, the induced pseudo- scalar "$# , to 7%. Mu detector (Aluminium pressure vessel housing the TPC) with magnetic field coil is retracted for preparing

  2. Automated ligand fitting by core-fragment fitting and extensioninto density

    SciTech Connect (OSTI)

    Terwilliger, Thomas C.; Klei, Herbert; Adams, Paul D.; Moriarty,Nigel W.; Cohn, Judith D.

    2006-08-01T23:59:59.000Z

    A procedure for fitting of ligands to electron- density mapsby first fitting a core fragment of the ligand to density and thenextending the remainder of the ligand into density is presented. Theapproach was tested by fitting 9327 ligands over a wide range ofresolutions ( most are in the range 0.8-4.8 angstrom) from the ProteinData Bank (PDB) into (F-o - F-c) exp(i phi(c)) difference densitycalculated using entries from the PDB without these ligands. Theprocedure was able to place 58 percent of these 9327 ligands within 2angstrom (r.m. s.d.) of the coordinates of the atoms in the original PDBentry for that ligand. The success of the fitting procedure wasrelatively insensitive to the size of the ligand in the range 10 -100non-H atoms and was only moderately sensitive to resolution, with thepercentage of ligands placed near the coordinates of the original PDBentry for fits in the range 58 - 73 percent over all resolution rangestested.

  3. Pediatric Intestinal Failure Associated Liver Disease is Revered with Six Months of Intravenous Fish Oil

    E-Print Network [OSTI]

    Calkins, Kara

    2013-01-01T23:59:59.000Z

    3. Secondary and tertiary outcomes for the fish oil (FO)and soybean oil (SO) group. Results are either as medianserror of the mean for the fish oil (FO) and soybean oil (SO)

  4. J.Feltesse 1 Direct measurement of the

    E-Print Network [OSTI]

    · We get radiative events fo free ! · Need a huge statistics (~200 pb-1) [Krasny, Placzek, Spiesberger

  5. WA_04_033_CARGILL_Waiver_of_Patent_Rights_to_CARGILL_DOWN_L.pdf...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    tentRightstoCARGILLDOWNL.pdf More Documents & Publications WA00022CARGILLDOWPOLYMERSLLCWaiverofDomesticandFo.pdf WA05022DOWCHEMICALCOMPANYWaiverofdomestica...

  6. Wetland Plant Influence on Sediment Ecosystem Structure and Trophic Function

    E-Print Network [OSTI]

    Whitcraft, Christine R.

    2007-01-01T23:59:59.000Z

    energy and structure Spartina foJiosa, Sarcocornia pacifica (aka Sacorma wgmra) Tamarix spp 7 / X microalgae

  7. 11,23,1,3,2,19,30,"BANGOR HYDRO ELECTRIC CO","MEDWAY",0,"LIGHT OIL",50159,0,"A",1299,,,2000,0,0,1e+15,1474,6,01179,"FO2","IC"

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes;98,,,1999,0,0,1e+15,1469,6,01179,"WAT","HY"

  8. Minireview R67 ATP synthase: two motors, two fuels

    E-Print Network [OSTI]

    Oster, George

    Minireview R67 ATP synthase: two motors, two fuels George Oster* and Hongyun Wang FoF1 ATPase is the universal protein responsible for ATP synthesis. The enzyme comprises two reversible rotary motors: Fo and signaling events throughout the cell. ATP synthase, also known as FoF1 ATPase, is the principle

  9. Undergraduate All Previous

    E-Print Network [OSTI]

    Mechanical Engineering Bioengineering Chemical Technology Chemical Engineering Joint Mathematics,150.00 Earth Science and Engineering FoNS FoM Overseas Students FoE Home/EU Students Aeronautics Course *** Years 1, 2 & 3 ** Materials Electrical and Electronic Engineering 1,310.003,290.00 21,850.00 21

  10. Pressure-Volume-Temperature Studies of Metal-Oxide Pairs [1] Cottrell E. et al. (2007) This meeting.

    E-Print Network [OSTI]

    Campbell, Andrew

    2007-01-01T23:59:59.000Z

    for the two phases. fO2 Buffers at High Pressure For the general metal-oxide reaction M + x/2 O2 = MOx, the fO2 is related to the Gibbs energies (G) by x/2 RT ln fO2 = G(MOx) G(M). The pressure effect

  11. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    CT)^8 A Range Repeat HO HE PIC Locus Sequence BOOB-RM2-F07U GTTTGCTAATCCCCTGGTGCAAGTG BOOB-RM2-F07 LAAAG)^35 (AAAG) ^5 BOOB-RM3-D07 U GTTTGGCCTACTGCCATCCAGGG

  12. DEPARTMENT: SESS CAT COMP START/END TIMES FACILITY

    E-Print Network [OSTI]

    Schulte, Mike

    302246108A1 W 25 0000 GA RM12:5512:05 25DIS304246108A1 F 25 0000 GA RM17:2516:35 245LEC001306108A1 M W 245 0000 GA RM08:3507:45 47DIS301306108A1 T 42 0000 GA RM15:1514:25 46DIS302306108A1 W 42 0000 GA RM15 RM16:1014:25 20LAB301370604A1 W 30 0000 GA RM10:4509:45 38LAB001414604A1 T R 38 0000 GA RM14

  13. Surgical resectability of pancreatic adenocarcinoma: CTA

    E-Print Network [OSTI]

    Wong, Jimmie C.; Raman, Steven

    2010-01-01T23:59:59.000Z

    2. Lu DSK, Vedantham S, Krasny RM, et al. (1996) Two-phaseMD 17. Lu DSK, Reber HA, Krasny RM, et al. (1997) Local

  14. An inter-laboratory study to test the ability of amendments to reduce the availability of Cd, Pb, and Zn in situ

    E-Print Network [OSTI]

    Brown, Sally

    (RM), cyclonic ashes (CA), biosolids (BIO), and water treatment residuals (WTR). Both soil solution Abbreviations: BIO, biosolids; WTR, water treatment residuals; RM, red mud; KAD, kaolin amorphous derivatives

  15. Solar variability of four sites across the state of Colorado

    E-Print Network [OSTI]

    Lave, Matthew; Kleissl, Jan

    2010-01-01T23:59:59.000Z

    and Technology 2005; 39: 1903 Denholm P, Margolis RM. Evaluating the limits of solar photovoltaics (PV)

  16. TEXAS A&M UNIVERSITY CHANGE ORDER REQUEST

    E-Print Network [OSTI]

    Behmer, Spencer T.

    /Parking Easterwood Airport SOFC MSC Rm 221 Other ______________________________ For SBS and FMO use only

  17. Hadronic contributions to the muon anomalous magnetic moment Workshop. $(g-2)_?$: Quo vadis? Workshop. Mini proceedings

    E-Print Network [OSTI]

    Maurice Benayoun; Johan Bijnens; Tom Blum; Irinel Caprini; Gilberto Colangelo; Henryk Czy?; Achim Denig; Cesareo A. Dominguez; Simon Eidelman; Christian S. Fischer; Paolo Gauzzi; Yuping Guo; Andreas Hafner; Masashi Hayakawa; Gregorio Herdoiza; Martin Hoferichter; Guangshun Huang; Karl Jansen; Fred Jegerlehner; Benedikt Kloss; Bastian Kubis; Zhiqing Liu; William Marciano; Pere Masjuan; Harvey B. Meyer; Tsutomu Mibe; Andreas Nyffeler; Vladimir Pascalutsa; Vladyslav Pauk; Michael R. Pennington; Santiago Peris; Christoph F. Redmer; Pablo Sanchez-Puertas; Boris Shwartz; Evgeny Solodov; Dominik Stoeckinger; Thomas Teubner; Marc Unverzagt; Marc Vanderhaeghen; Magnus Wolke

    2014-07-21T23:59:59.000Z

    We present the mini-proceedings of the workshops Hadronic contributions to the muon anomalous magnetic moment: strategies for improvements of the accuracy of the theoretical prediction and $(g-2)_{\\mu}$: Quo vadis?, both held in Mainz from April 1$^{\\rm rst}$ to 5$^{\\rm th}$ and from April 7$^{\\rm th}$ to 10$^{\\rm th}$, 2014, respectively.

  18. Joint CQSE and CASTS Seminar Weekly Seminar

    E-Print Network [OSTI]

    Wu, Yih-Min

    -Ming Lu National Center for High Performance Computing PLACE Rm716, CCMS & New Physics Building, NTU

  19. arXiv:1106.3780v1[math.AP]19Jun2011 Energy Quantization for Willmore Surfaces

    E-Print Network [OSTI]

    Rivière, Tristan

    into Rm3 . We denote by g := gRm the pull back by of the flat canonical metric gRm of Rm , also called the first fundamental form of , and we let dvolg be its associated volume form. The Gauss map as the Dirichlet Energy of the Gauss map n with respect to the induced metric g. The Gauss Bonnet theorem implies

  20. A Compromise between Neutrino Masses and Collider Signatures in the Type-II Seesaw Model

    E-Print Network [OSTI]

    Wei Chao; Shu Luo; Zhi-zhong Xing; Shun Zhou

    2007-09-07T23:59:59.000Z

    A natural extension of the standard $SU(2)_{\\rm L} \\times U(1)_{\\rm Y}$ gauge model to accommodate massive neutrinos is to introduce one Higgs triplet and three right-handed Majorana neutrinos, leading to a $6\\times 6$ neutrino mass matrix which contains three $3\\times 3$ sub-matrices $M_{\\rm L}$, $M_{\\rm D}$ and $M_{\\rm R}$. We show that three light Majorana neutrinos (i.e., the mass eigenstates of $\

  1. CTR-S: A Logic for Specifying Contracts in Semantic Web Services

    E-Print Network [OSTI]

    Davulcu, Hasan

    Logic for Services Contracting Extension of classical FO-Logic Well defined model theoretic semantics in service contracting ... #12;Questions ? #12;

  2. Faculty of Design L04810 Bachelor of Communication / Bachelor of Social Science

    E-Print Network [OSTI]

    Liley, David

    at the Faculty of Design (FoD) in Prahran, and the Faculty of Business (FBE) at the Hawthorn campus, the course

  3. "De film is beter" Felix van groeningen over

    E-Print Network [OSTI]

    UltUUr 20 Cultuuragenda 21 Film 21 Schamper Bits 22 Young@Heart 22 uFo 24 SKO: de muziek 25 2 Fabiola 26

  4. ACADEMIC ExCEllEnCE EConoMIC IMpACt

    E-Print Network [OSTI]

    Suzuki, Masatsugu

    Tier. A vEnUE foR vIsItoRs. The University's Events Center infuses the local economy with entertainment

  5. Thermal stability of thin disk with magnetically driven winds

    E-Print Network [OSTI]

    Li, Shuang-Liang

    2014-01-01T23:59:59.000Z

    The absence of thermal instability in the high/soft state of black hole X-ray binaries, in disagreement with the standard thin disk theory, is a long-standing riddle for theoretical astronomers. We have tried to resolve this question by studying the thermal stability of a thin disk with magnetically driven winds in the $\\dot{M}- \\Sigma$ plane. It is found that disk winds can greatly decrease the disk temperature and thus help the disk become more stable at a given accretion rate. The critical accretion rate $\\dot{M}_{\\rm crit}$ corresponding to the thermal instability threshold is increased significantly in the presence of disk winds. For $\\alpha=0.01$ and $B_{\\rm \\phi}=10B_{\\rm _p}$, the disk is quite stable even for a very weak initial poloidal magnetic field [$\\beta_{\\rm p,0}\\sim 2000, \\beta_{\\rm p}=(P_{\\rm {gas}}+P_{\\rm rad})/(B_{\\rm p}^2/8\\pi)$]. But when $B_{\\rm \\phi}=B_{\\rm _p}$ or $B_{\\rm \\phi}=0.1B_{\\rm _p}$, a somewhat stronger (but still weak) field ($\\beta_{\\rm p,0}\\sim 200$ or $\\beta_{\\rm p,0}\\si...

  6. SOLAR SEMINAR SERIESS P R I N G 2 0 1 3 P H O T O V O L T A I C S E M I N A R S E R I E S YI CUIBirck Rm. 2001

    E-Print Network [OSTI]

    Ginzel, Matthew

    Energy Center Abstract Advanced photon management using nanostructures provides exciting opportunities for enhancing solar cell device performance. In this talk, I will present examples of photon management and Engineering at Stanford in 2005. He currently investigates nanomaterials for energy storage, photovoltaics

  7. Yager, P.L., R.M. Sherrell, S.E. Stammerjohn, A.-C. Alderkamp, O. Schofield, E.P. Abrahamsen, K.R. Arrigo, S. Bertilsson, D.L. Garay, R. Guerrero, K.E. Lowry, P.-O. Moksnes, K. Ndungu,

    E-Print Network [OSTI]

    for dramatic heat and air-sea gas exchange, greater light penetra- tion, and air-sea access for birds;Oceanography | September 2012 41 Sarmiento et al., 2004). The efficiency of the biological pump in high

  8. Optical isotope shift and hyperfine structure measurements in preparation of the ultra-sensitive detection of krypton atoms using stepwise laser excitation and field ionization

    E-Print Network [OSTI]

    Lassen, Jens

    1996-01-01T23:59:59.000Z

    of the laser and a Gaussian distribution the numerical value of the time of flight bmadening differs slightly [I 8]. T A ?& ? f d t[E, exp( ? 2r / d) cos(to, t)] exp( ? i mt) 0 I(?& ? AA* = C*expI ? (fo ? m, )d/(2v~2)' J E:=E, cos(fo, t) Svfa~-:5. 6...

  9. jk"Vh; izfrj{kkfoKku laLFkku NATIONAL INSTITUTE OF IMMUNOLOGY

    E-Print Network [OSTI]

    Udgaonkar, Jayant B.

    ....................................... #12;foRr ,oa ys[kk foHkkx }kjk ctV izko/kkuksa ds fy, miyC/krk fjiksVZ C. Budget provisions-------------------------------------fnukad--------------------------dks------------------------------cSad }kjk HkqxrkuA Paid Cheque No........................................Dt. .....................on

  10. Phylogenetics and Taxonomy of the Fungal Vascular Wilt Pathogen Verticillium, with the Descriptions of Five New Species

    E-Print Network [OSTI]

    Subbarao, Krishna V

    2011-01-01T23:59:59.000Z

    alfalfae Inderb. , H. W. Platt, R. M. Bostock, R. M. Davis &RM, Davis RM, Usami T, Platt HW, et al. (2011) Phylogeneticsnonalfalfae Inderb. , H. W. Platt, R. M. Bostock, R. M.

  11. Use of green fluorescent protein for the analysis of protein-protein and protein-DNA interactions

    E-Print Network [OSTI]

    Chen, Kai

    2011-01-01T23:59:59.000Z

    Restriction modification (RM) systems play a crucial role in preventing the entry of foreign DNA into the bacterial cell. The best studied Type I RM system is EcoKI from Escherichia coli K12. Both bacteriophage and ...

  12. Boundary lubrication of articular cartilage : contribution of hyaluronan in health and injury

    E-Print Network [OSTI]

    Antonacci, Jennifer M.

    2011-01-01T23:59:59.000Z

    J Vet Res 43:1096-9, 1982. Saari H, Konttinen YT, Tulamo RM,J Vet Res 43:1096-9, 1982. Saari H, Konttinen YT, Tulamo RM,

  13. Intercomparison of 14C Analysis of Carbonaceous Aerosols: Exercise 2009

    E-Print Network [OSTI]

    2013-01-01T23:59:59.000Z

    Laboratory D applied water extraction before the thermalAll Milan/Ispra Milan/Ispra Acid fumigation Water extractionWater extraction E F F G RM 8785 RM 8785 Milan/Ispra All

  14. Investigating genetic determinants of phenotypic variation in natural isolates of Saccharomyces cerevisiae

    E-Print Network [OSTI]

    Lee, Hana

    2012-01-01T23:59:59.000Z

    UWOPS05.227.2; WE1, RM11-1; WE2, BC187); each row shows dataUWOPS05.217.3; WE1, RM11-1; WE2, BC187), and each row shows

  15. An Efficient Augmented Lagrangian Method with Applications to ...

    E-Print Network [OSTI]

    2012-08-13T23:59:59.000Z

    Aug 13, 2012 ... x at pixel i, A ? Rmn (mRm is the ..... [2] S. Becker, J. Bobin and E. Cand`es, NESTA: A fast and accurate...

  16. Foran Hall Directory PLANT BIOLOGY & PATHOLOGY

    E-Print Network [OSTI]

    Neimark, Alexander V.

    Miller, Stephen 26290 273 Minnis, Andrew (301) 504-5364 Molnar, Tom 26330 164 Morath, Shannon 26375. Office: Ext. Rm. Lab: Ext. Rm. 12/5/2011 Maliga, Pal 5-5329 Waksman Manning, Tom (908) 310-0244 Mansue

  17. Constraints on the primordial gravitational waves with variable sound speed from current CMB data

    E-Print Network [OSTI]

    Cheng Cheng; Qing-Guo Huang; Xiao-Dong Li; Yin-Zhe Ma

    2012-10-26T23:59:59.000Z

    We make a comprehensive investigation of the observational effect of the inflation consistency relation. We focus on the general single-field inflation model with the consistency relation $r=-8c_s n_t$, and investigate the observational constraints of sound speed $c_s$ by using the Seven-Year WMAP data, the BICEP tensor power spectrum data, and the constraints on $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$ from the Five-Year WMAP observations. We find that the constraints on the tensor-to-scalar ratio $r$ is much tighter if $c_s$ is small, since a large tilt $n_t$ is strongly constrained by the observations. We obtain $rsound speed $c_s$, it is not well constrained if only the CMB power spectrum data is used, while the constraints are obtainable by taking $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$ priors into account. With the constraining data of $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$, we find that, $c_s\\lesssim 0.01$ region is excluded at 99.7% CL, and the $c_s=1$ case (the single-field slow-roll inflation) is slightly disfavored at 68.3% CL. In addition, the inclusion of $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$ into the analysis can improve the constraints on $r$ and $n_s$. We further discuss the implications of our constraints on the test of inflation models.

  18. Rulemaking, Public Hearing in Oak Ridge, TN (2/3/1999)

    Broader source: Energy.gov [DOE]

    Chronic Beryllium Diease Prevention Program Notice of Proposed Rulemaking (NOPR) Docket Number EH-RM-98-BRYLM

  19. AHDELUETTELO L AHDELUETTELO

    E-Print Network [OSTI]

    Kurimo, Mikko

    . [Linde et al. 1980] Y. Linde, A. Buzo, R.M. Gray. An algorithm for vector quan tizer design. IEEE

  20. Exploring the Texture of Ocean-Atmosphere Redox Evolution on the Early Earth

    E-Print Network [OSTI]

    Reinhard, Christopher Thomas

    2012-01-01T23:59:59.000Z

    1989) Geochemistry and sedimentology of a facies transitionML, Bustin RM (1998) Sedimentology and sequence stratigraphy

  1. Academic Resources UNIVERSITY CLASSROOM INVENTORY

    E-Print Network [OSTI]

    Academic Resources UNIVERSITY CLASSROOM INVENTORY Capacity Order Spring 2014 BLDG RM CAP. ENH. AV UNIVERSITY CLASSROOM INVENTORY Capacity Order Spring 2014 BLDG RM CAP. ENH. AV(01)* TAB ARM(02) GEOG MAP(03/28/2014 #12;Academic Resources UNIVERSITY CLASSROOM INVENTORY Capacity Order Spring 2014 BLDG RM CAP. ENH. AV

  2. Rapidity and transverse-momentum dependence of the inclusive J/$\\mathbf{\\psi}$ nuclear modification factor in p-Pb collisions at $\\mathbf{\\sqrt{\\textit{s}_{NN}}}=5.02$ TeV

    E-Print Network [OSTI]

    Adam, Jaroslav; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahmed, Ijaz; Ahn, Sang Un; Aimo, Ilaria; Aiola, Salvatore; Ajaz, Muhammad; Akindinov, Alexander; Alam, Sk Noor; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Armesto Perez, Nestor; Arnaldi, Roberta; Aronsson, Tomas; Arsene, Ionut Cristian; Arslandok, Mesut; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Baltasar Dos Santos Pedrosa, Fernando; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Bartke, Jerzy Gustaw; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Belmont Iii, Ronald John; Belmont Moreno, Ernesto; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biswas, Saikat; Bjelogrlic, Sandro; Blanco, Fernando; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botje, Michiel; Botta, Elena; Boettger, Stefan; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Buxton, Jesse Thomas; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Chochula, Peter; Choi, Kyungeon; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Deisting, Alexander; Deloff, Andrzej; Denes, Ervin Sandor; D'Erasmo, Ginevra; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Dobrowolski, Tadeusz Antoni; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent

    2015-01-01T23:59:59.000Z

    We have studied the transverse-momentum ($p_{\\rm T}$) dependence of the inclusive J/$\\psi$ production in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 5.02$ TeV, in three center-of-mass rapidity ($y_{\\rm cms}$) regions, down to zero $p_{\\rm T}$. Results in the forward and backward rapidity ranges ($2.03 < y_{\\rm cms} < 3.53$ and $-4.46 rm cms}< -2.96$) are obtained by studying the J/$\\psi$ decay to $\\mu^+\\mu^-$, while the mid-rapidity region ($-1.37 < y_{\\rm cms} < 0.43$) is investigated by measuring the ${\\rm e}^+{\\rm e}^-$ decay channel. The $p_{\\rm T}$ dependence of the J/$\\psi$ production cross section and nuclear modification factor are presented for each of the rapidity intervals, as well as the J/$\\psi$ mean $p_{\\rm T}$ values. Forward and mid-rapidity results show a suppression of the J/$\\psi$ yield, with respect to pp collisions, which decreases with increasing $p_{\\rm T}$. At backward rapidity no significant J/$\\psi$ suppression is observed. Theoretical models including a combinatio...

  3. ISV FACT SHEET SINGLE ENSUITE: 198 sq.ft.

    E-Print Network [OSTI]

    Southampton, University of

    ISV FACT SHEET SINGLE ENSUITE: 198 sq.ft. STANDARD ROOM: (NO AIRCOND, NO WATER HEATER, FREE WIFI): RM 590 PER MONTH PER BED PREMIER ROOM: : (AIRCOND WITH WATER HEATER, FREE WIFI) : RM740 PER MONTH PER BED TWIN SHARING: 283 sq.ft. STANDARD ROOM: (NO AIRCOND, NO WATER HEATER, FREE WIFI): RM 490 PER MONTH

  4. Quantum Searches in a Hard 2SAT Ensemble

    E-Print Network [OSTI]

    Neuhaus Thomas

    2014-12-17T23:59:59.000Z

    Using a recently constructed ensemble of hard 2SAT realizations, that has a unique ground-state we calculate for the quantized theory the median gap correlation length values $\\xi_{GAP}$ along the direction of the quantum adiabatic control parameter $\\lambda$. We use quantum annealing (QA) with transverse field and a linear time schedule in the adiabatic control parameter $\\lambda$. The gap correlation length diverges exponentially $\\xi_{\\rm GAP} \\propto {\\rm exp} [+r_{\\rm GAP}N]$ in the median with a rate constant $r_{\\rm GAP}=0.553(6)$, while the run time diverges exponentially $\\tau_{\\rm QA} \\propto {\\rm exp} [+r_{\\rm QA}N]$ with $r_{\\rm QA}=1.184(16)$. Simulated classical annealing (SA) exhibits a run time rate constant $r_{\\rm SA}=0.340(5)$ that is small and thus finds ground-states exponentially faster than QA. There are no quantum speedups in ground state searches on constant energy surfaces that have exponentially large volume. We also determine gap correlation length distribution functions $P(\\xi_{\\rm GAP})d\\xi_{\\rm GAP} \\approx W_k$ over the ensemble that at $N=18$ are close to Weibull functions $W_k$ with $k \\approx 1.2$ i.e., the problems show thin catastrophic tails in $\\xi_{\\rm GAP}$. The inferred success probability distribution functions of the quantum annealer turn out to be bimodal.

  5. Confirmation of the $\\eps$ -- $\\eiso$ (Amati) relation from the X-ray flash XRF 050416A observed by Swift/BAT

    E-Print Network [OSTI]

    Sakamoto, T; Barthelmy, S D; Cummings, J R; Fenimore, E E; Gehrels, N; Hullinger, D; Krimm, H A; Markwardt, C B; Palmer, D M; Parsons, A M; Sato, G; Tller, J

    2006-01-01T23:59:59.000Z

    We report Swift Burst Alert Telescope (BAT) observations of the X-ray Flash (XRF) XRF 050416A. The fluence ratio between the 15-25 keV and 25-50 keV energy bands of this event is 1.5, thus making it the softest gamma-ray burst (GRB) observed by BAT so far. The spectrum is well fitted by the Band function with E^{\\rm obs}_{\\rm peak} of 15.0_{-2.7}^{+2.3} keV. Assuming the redshift of the host galaxy (z = 0.6535), the isotropic-equivalent radiated energy E_{\\rm iso} and the peak energy at the GRB rest frame (E^{\\rm src}_{\\rm peak}) of XRF 050416A are not only consistent with the correlation found by Amati et al. and extended to XRFs by Sakamoto et al., but also fill-in the gap of this relation around the 30 - 80 keV range of E^{\\rm src}_{\\rm peak}. This result tightens the validity of the E^{\\rm src}_{\\rm peak} - E_{\\rm iso} relation from XRFs to GRBs. We also find that the jet break time estimated using the empirical relation between E^{\\rm src}_{\\rm peak} and the collimation corrected energy E_{\\gamma} is inc...

  6. NEW CLASSIFICATION METHODS FOR GATHERING PATTERNS IN THE CONTEXT OF GENETIC

    E-Print Network [OSTI]

    Fernandez, Thomas

    approaches: Repository Method (RM), Evolv- ing Decision Rules (EDR) and Scenario Method (SM). We use Genetic of RM and EDR are: to predict the minority class in imbalanced environ- ments, to generate a range for achieving our goals. RM and EDR were compared to a standard Genetic Programming, EDDIE-Arb and C5

  7. Energy Quantization for Willmore Surfaces and Applications

    E-Print Network [OSTI]

    Rivière, Tristan

    := gRm the pull back by of the flat canonical metric gRm of Rm , also called the first fundamental form of , and we let dvolg be its associated volume form. The Gauss map of the immersion is the map ) is independent of this extension. 1 #12;The energy E may accordingly be seen as the Dirichlet Energy of the Gauss

  8. SMT CO (2-1) Observations of Nearby Star-Forming Galaxies

    E-Print Network [OSTI]

    Jiang, Xue-Jian; Gu, Qiusheng; Wang, Junzhi; Zhang, Zhi-Yu

    2014-01-01T23:59:59.000Z

    We present CO $J$=2-1 observations towards 32 nearby gas-rich star-forming galaxies selected from the ALFALFA and WISE catalogs, using the Sub-millimeter Telescope. Our sample is selected to be dominated by intermediate-$M_{\\rm *}$ galaxies. The scaling-relations between molecular gas, atomic gas and galactic properties (stellar mass, NUV$- r$ and WISE color W3$-$W2) are examined and discussed. Our results show that (1). In the galaxies with stellar mass $M_{\\rm *}$ $\\leqslant 10^{10}$ $M_{\\odot}$, HI fraction ($f_{\\rm HI}$ $\\equiv$ $M_{\\rm HI}$/$M_{\\rm *}$) is significantly higher than that of more massive galaxies, while H$_2$ gas fraction ($f_{\\rm H_2}$ $\\equiv$ $M_{\\rm H_2}$/$M_{\\rm *}$) remain nearly unchanged. (2). Comparing with $f_{\\rm H_2}$, $f_{\\rm HI}$ correlates better with both $M_{\\rm *}$ and NUV$- r$. (3). A new parameter, WISE color W3$-$W2 (12\\,$\\mu$m$-$4.6\\,$\\mu$m) is introduced, which is similar to NUV$- r$ in tracing star formation activity, and we find that W3$-$W2 has a tighter anti-corr...

  9. Measurement of the Proton-Air Cross Section with Telescope Array's Middle Drum Detector and Surface Array in Hybrid Mode

    E-Print Network [OSTI]

    R. U. Abbasi; M. Abe; T. Abu-Zayyad; M. Allen; R. Anderson; R. Azuma; E. Barcikowski; J. W. Belz; D. R. Bergman; S. A. Blake; R. Cady; M. J. Chae; B. G. Cheon; J. Chiba; M. Chikawa; W. R. Cho; T. Fujii; M. Fukushima; T. Goto; W. Hanlon; Y. Hayashi; N. Hayashida; K. Hibino; K. Honda1; D. Ikeda; N. Inoue; T. Ishii; R. Ishimori; H. Ito; D. Ivanov; C. C. H. Jui; K. Kadota; F. Kakimoto; O. Kalashev; K. Kasahara; H. Kawai; S. Kawakami; S. Kawana; K. Kawata; E. Kido; H. B. Kim; J. H. Kim; J. H. Kim; S. Kitamura; Y. Kitamura; V. Kuzmin; Y. J. Kwon; J. Lan1; S. I. Lim; J. P. Lundquist; K. Machida; K. Martens; T. Matsuda; T. Matsuyama; J. N. Matthews; M. Minamino; K. Mukai; I. Myers; K. Nagasawa; S. Nagataki1; T. Nakamura; T. Nonaka; A. Nozato; S. Ogio; J. Ogura; M. Ohnishi; H. Ohoka; K. Oki; T. Okuda; M. Ono; A. Oshima; S. Ozawa; I. H. Park; M. S. Pshirkov; D. C. Rodriguez; G. Rubtsov; D. Ryu; H. Sagawa; N. Sakurai; A. L. Sampson; L. M. Scott; P. D. Shah; F. Shibata; T. Shibata; H. Shimodaira; B. K. Shin; J. D. Smith; P. Sokolsky; R. W. Springer; B. T. Stokes; S. R. Stratton; T. A. Stroman; T. Suzawa; M. Takamura; M. Takeda; R. Takeishi; A. Taketa; M. Takita; Y. Tameda; H. Tanaka; K. Tanaka; M. Tanaka; S. B. Thomas; G. B. Thomson; P. Tinyakov; I. Tkachev; H. Tokuno; T. Tomida; S. Troitsky; Y. Tsunesada; K. Tsutsumi; Y. Uchihori; S. Udo; F. Urban; G. Vasiloff; T. Wong; R. Yamane; H. Yamaoka; K. Yamazaki; J. Yang; K. Yashiro; Y. Yoneda; S. Yoshida; H. Yoshii; R. Zollinger; Z. Zundel

    2015-05-07T23:59:59.000Z

    In this work we are reporting on the measurement of the proton-air inelastic cross section $\\sigma^{\\rm inel}_{\\rm p-air}$ using the Telescope Array (TA) detector. Based on the measurement of the $\\sigma^{\\rm inel}_{\\rm p-air}$ the proton-proton cross section $\\sigma_{\\rm p-p}$ value is also determined at $\\sqrt{s} = 95$ TeV. Detecting cosmic ray events at ultra high energies with Telescope Array enables us to study this fundamental parameter that we are otherwise unable to access with particle accelerators. The data used in this report is collected over five years using hybrid events observed by the Middle Drum fluorescence detector together with the surface array detector. The value of the $\\sigma^{\\rm inel}_{\\rm p-air}$ is found to be equal to $ 567.0 \\pm 70.5 [{\\rm Stat.}] ^{+25}_{-29} [{\\rm Sys.}]$ mb. The total proton-proton cross section is subsequently inferred from Glauber Formalism and Block, Halzen and Stanev QCD inspired fit and is found to be equal to $170_{-44}^{+48} [{\\rm Stat.}] \\pm _{-19}^{+17} [{\\rm Sys.}] $mb.

  10. 11,23,1,3,2,19,30,"BANGOR HYDRO ELECTRIC CO","MEDWAY",0,"LIGHT OIL",50159,0,"A",1299,,,2000,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,0,0,99999999,1474,6,01179,"FO2","IC"

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes;98,,,1999,0,0,1e+15,1469,6,01179,"WAT","HY"3,2,19,30,"BANGOR HYDRO

  11. 1.1.1.1.1.1 AP 1.1.1.1.2.1

    E-Print Network [OSTI]

    Ladkin, Peter B.

    . Ladkin, K. Loer 0 AC crashes into landing zone near E1 taxiway 1 AC stalls since 2 CRW unable to recover stall 1.1.1.1.1.1 AP engaged 1.1.1.1.2.1 F/O (PF) triggers GA­lever 1.1.1.1.2.1.2 F/O moves hand on throttles 1.1.1.1.2.1.1 position of GA­lever 1.1.1.1.2.2.1.1 F/O (PF) tries to go direct into LAND mode 1.1.1.1

  12. Fresnel-transform's quantum correspondence and quantum optical ABCD Law

    E-Print Network [OSTI]

    Fan Hongyi; Hu Liyun

    2007-05-29T23:59:59.000Z

    Corresponding to Fresnel transform there exists a unitary operator in quantum optics theory, which could be named Fresnel operator (FO). We show that the multiplication rule of FO naturally leads to the quantum optical ABCD law. The canonical operator methods as mapping of ray-transfer ABCD matrix is explicitly shown by FO's normally ordered expansion through the coherent state representation and the technique of integration within an ordered product of operators. We show that time evolution of the damping oscillator embodies the quantum optical ABCD law.

  13. Slaughter and carcass characteristics of finewool vs crossbred lambs

    E-Print Network [OSTI]

    Bland, Bobby J

    1960-01-01T23:59:59.000Z

    OL Nod 2 lou. ar e h &'a Wf a XS 8431 fo ~ P+ ko ~ 8 0 o 7 of aN boos fo lac r ~ of leg fo oh b . 49 ~ of La& ( l~zz r 9 B~gh ok ~ /th ~ RS - ' ? tm WMt8x shou u& 6 ruffle af 'S XafL~. Pi b @erg mart ee Cmi' l. '. f a ause 'f0 Rl... w Since very 1. ittle carcass worh has been reported on sheep, this study was initiated to give s basis and direction for further worh in this area. Specifically there were three avagor points for which answers were desired. These ware...

  14. Films for a New Germany: British Documentaries and the Reeducation of West Germany

    E-Print Network [OSTI]

    August-Schmidt, Tatiana

    2014-01-01T23:59:59.000Z

    why foreign films shown in Germany were almost always dubbedDevelopment of Press in Germany. Kelson, Catalogue ofCinema in Democratizing Germany, 2. Brown, FO 946/8 Films,

  15. A New Model of Intonation for Use with Speech Synthesis and Recognition

    E-Print Network [OSTI]

    Taylor, Paul A; Isard, Stephen

    This paper describes a synthesis from analysis scheme for producing natural sounding intonation for speech synthesis. The paper presents a new method of describing Fo contours in terms of three basic phonetic intonation ...

  16. artery disease potential: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    fo... Yi, Li Ting 2013-01-01 56 Association of Common Polymorphisms in GLUT9 Gene with Gout but Not with Coronary Artery Disease in a Large Case-Control Study CiteSeer Summary:...

  17. Ann. For. Sci. 67 (2010) 503 Available online at: c INRA, EDP Sciences, 2010 www.afs-journal.org

    E-Print Network [OSTI]

    Boyer, Edmond

    2010-01-01T23:59:59.000Z

    for carbon sequestration strategies, particularly in the perspective of the current climate change. However fo- rts est fondamental pour les stratgies de pigeage du carbone, en particulier dans la

  18. Copyrighted Material INTRODUCTION

    E-Print Network [OSTI]

    Landweber, Laura

    in eastern Bosnia where, on a hot August day in 2000, I stood witness to the first day that fo rensics lated bodies and missing souls of girls, boys, women, and men of Bosnia, Rwanda, eastern Congo

  19. Page 1 Page 2 .Effort 'zzatbe Cnmpa, cara-egaal, Notwithiianding ...

    E-Print Network [OSTI]

    yet becaule we proceed i mam'mrr .ed enferma, fo [itil dividing, and [he more dtminil'hing this error, the further we proceed; it will in the end1l when we come to

  20. Jasper Ridge Biological Preserve Annual Report 2000 -01 Stanford University

    E-Print Network [OSTI]

    previously unmet Jasper Ridge needs, but also represents our ef- fort to lighten the load we place gifts, both large and small. Each gesture of support reflects a shared commitment to support due to sedimentation, finding methods fo

  1. reprinted from International Journal of

    E-Print Network [OSTI]

    Texas at Arlington, University of

    hydraulic diameter Fo = t/L2 c Fourier number based on the characteristic length, defined as the ratio efficiency over conventional gas turbine engines and their simplicity in construction and operation, amongst

  2. Immunosuppressive dietary n-3 polyunsaturated fatty acids differentially modulate costimulatory regulation of murine CD4+ T-cell function

    E-Print Network [OSTI]

    Ly, Lan H.

    2005-02-17T23:59:59.000Z

    Consumption of fish oils (FO) enriched with the n-3 polyunsaturated fatty acids (PUFA), docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), is beneficial to a variety of inflammatory disorders due, in part, to the ...

  3. Precision absolute frequency laser spectroscopy of argon II in parallel and antiparallel geometry using a frequency comb for calibration

    E-Print Network [OSTI]

    Lioubimov, Vladimir

    2010-01-14T23:59:59.000Z

    Change in anode voltage of the ion source operation parameters. . . . 110 XII Ar II 2G7/2-2Fo5/2 transition frequency. . . . . . . . . . . . . . . . . . 116 XIII Condesor lens system parameters. . . . . . . . . . . . . . . . . . . . . 133 XIV...

  4. Presentation 2.4: Forest biorefining and implications for future wood energy scenarios Jack N. Saddler

    E-Print Network [OSTI]

    Germ Corn oil 152 #12;Forest Products Biotechnology at UBC Bioethanol Production 0 5,000 10,000 15 (000,000 litres/a) Brazil World Bioethanol Production USA & Canada Asia EU Sources: (1) FO Licht. 2005

  5. Relational correspondence in tone sandhi

    E-Print Network [OSTI]

    Hsieh, Feng-fan

    2007-01-01T23:59:59.000Z

    This dissertation proposes that the constraint component of OT grammars should be expanded to include a family of faithfulness constraints that evaluate input-output/output-output mappings for the preservation of gross Fo ...

  6. PUBLICATION 460-133 Introduction

    E-Print Network [OSTI]

    Liskiewicz, Maciej

    Environmental Sciences, Virginia Tech J. Skousen, Extension Specialist, Land Reclamation, West VirginiaR PRojec t Reclamation Guidelines foR suRface mined land www.ext.vt.edu Produced by Communications

  7. Design and implementation of a fiber optic doppler optical coherence microscopy system for cochlear imaging

    E-Print Network [OSTI]

    Williams, Logan P

    2014-01-01T23:59:59.000Z

    In this thesis, the design and implementation of a fiber optic Doppler optical coherence microscopy (FO-DOCM) system for cochlear imaging applications is presented. The use of a fiber optic design significantly reduces ...

  8. Climate forcings and the nonlinear dynamics of grassland ecosystems

    E-Print Network [OSTI]

    Petrie, Matthew D.

    2010-04-28T23:59:59.000Z

    are not determined (Brunsell and Gillies, 2003). Scale misrepresentation limits the characterization of landscape features and eco- hydrologic relationships and can subjugate understanding to arbitrary spatial fo- cus (Alessandri and Navarra, 2008; Brunsell, 2006...

  9. Roger L. Nielsen B.S., Geology, University of Arizona, 1976

    E-Print Network [OSTI]

    Kurapov, Alexander

    . Petrol., 152, #2, 201-221 59 Rowe, M. C., Nielsen, R.L., and Kent., A. J.,2006, Anomalous Fe contents in high-An feldspar and high-Fo olivine in anhydrous mafic silicate liquids. Contrib. Mineral. Petrol

  10. Comment.Math.Univ.Carolinae 31,2(1990)283-293 Existence and limiting behaviour for damped nonlinear

    E-Print Network [OSTI]

    Sevcovic, Daniel

    1990-01-01T23:59:59.000Z

    ,2,3; and 9 is the Nemitzky's operator from HHO) n H2(0) into L2(0). For the case where f(O) ~ 0, 9 == 0, #12

  11. actual key success: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    key exchange over an insecure channel. The security of the proposed algorithm grows as NPm, where M, P are the size of the key and the computational commplexity fo the linear...

  12. access technologies key: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    key exchange over an insecure channel. The security of the proposed algorithm grows as NPm, where M, P are the size of the key and the computational commplexity fo the linear...

  13. alteration technique based: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    key exchange over an insecure channel. The security of the proposed algorithm grows as NPm, where M, P are the size of the key and the computational commplexity fo the linear...

  14. acid based techniques: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    key exchange over an insecure channel. The security of the proposed algorithm grows as NPm, where M, P are the size of the key and the computational commplexity fo the linear...

  15. assessment techniques based: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    key exchange over an insecure channel. The security of the proposed algorithm grows as NPm, where M, P are the size of the key and the computational commplexity fo the linear...

  16. Smyrna's Ashes: Humanitarianism, Genocide, and the Birth of the Middle East

    E-Print Network [OSTI]

    Tusan, Michelle

    2012-01-01T23:59:59.000Z

    to High Commissioner for Egypt, May 11, 1919, FO 141/580.Florence. Letters from Egypt. London: Spottiswoode, 1854.spent much of his life in Egypt. His work as head of the

  17. Placental malaria among HIV-infected and uninfected women receiving anti-folates in a high transmission area of Uganda

    E-Print Network [OSTI]

    2009-01-01T23:59:59.000Z

    Steketee RW, Nahlen BL, Parise ME, Menendez C: The burden of284-291. ter Kuile FO, Parise ME, Verhoeff FH, UdhayakumarPeters PJ, Thigpen MC, Parise ME, Newman RD: Safety and

  18. ORIGINAL PAPER Titanium-and water-rich metamorphic olivine in high-pressure

    E-Print Network [OSTI]

    Jung, Haemyeong

    ORIGINAL PAPER Titanium- and water-rich metamorphic olivine in high-pressure serpentinites from 2013 Springer-Verlag Berlin Heidelberg 2014 Abstract Titanium- and water-rich metamorphic olivine (Fo

  19. Pitch perception and harmonic resolvability in normal-hearing and hearing-impaired listeners

    E-Print Network [OSTI]

    Bernstein, Joshua G. W

    2006-01-01T23:59:59.000Z

    Listeners with sensorineural hearing loss are often impaired in their ability to perceive the pitch associated with the fundamental frequency (FO) of complex harmonic sounds. Four studies investigated the relationship ...

  20. ~thtV\\~ I\\br1i\\~C\\MSof\\ ~oJl aoI':l.

    E-Print Network [OSTI]

    +hC\\V\\Y Abru.~ctMsoV\\ fo. (( aOIa M.~t\\\\C\\{03 Y ~d ~\\lrnctl l' :5 130cl:~a ~ k* ca,\\4PMI "'i(e~e'1

  1. Facing the Sunrise: Cultural Worldview Underlying Intrinsic-Based Encoding of Absolute Frames of

    E-Print Network [OSTI]

    Nuez, Rafael

    '') scene, as in the glass is to the left of the bottle. To describe this tabletop scene, however, speakers FoR using an expression equivalent to the glass is north of the bottle (Haviland, 1993). Over the last

  2. Categorical Exclusion Determination Form It Submit by E-_

    Broader source: Energy.gov (indexed) [DOE]

    It Submit by E- I'llail - Proposed Action Title: (0672- 1610) Eaton Corporation - Highly Efficient, Nea r-Isothermal Liquid-Piston Compressor fo r Low Cost At-Home Natural Gas...

  3. Cooperative Fish and Wildlife

    E-Print Network [OSTI]

    .............................................................................................................. sCienCe FoR ResoURCe management ...................................................2 Contemporary .......................................................................................6 U.S. Geological Survey Initiatives....................................................................8 Site-Specific Research Supporting Federal Resource Management...............................9

  4. CHARACTERIZATION OF FERRITIC G.M.A. WELD DEPOSITS IN 9percentNi STEEL FOR CRYOGENIC APPLICATIONS

    E-Print Network [OSTI]

    Mahin, Kim Walker

    2013-01-01T23:59:59.000Z

    Welding Electrode Div . Kobe Steel, Japan, 1974, 51 pages;337s. 102. T. Ohwa: Kobe Steel vJorks Welding Lab. Rep. ,fo~ and Tough. Charac. and Steels, ed. P. L Mangonon, Jr. ,

  5. Sustainability. Systems integration for global sustainability.

    E-Print Network [OSTI]

    2015-01-01T23:59:59.000Z

    study of the energy-water nexus. Sustainability 2, 945962 (sustainability studies have fo- cused on flows of real material and energysustainability have been place- based even if they look at coupled systems [for example, the energy-

  6. Designing Professional Development around the Common Core

    E-Print Network [OSTI]

    Belding, Juliana

    arithmetic Exploration of the CCSS Standards for Mathematical Practice #12;The Opening Problem: Treasure Island Does the location of the treasure depend on the secret location? #12;The Island #12;FoM Summer

  7. Carlsbad Field Office P. O. Box 3090 Carlsbad

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Field Office S. Holmes, NMED * ED T. Kliphuis , NMED ED R. Maestas, NMED ED C. Walker, Trinity Eng ineering ED CB FO M&RC 'EO denotes electronic distribution CB...

  8. Simulations of Vibrational Frequencies of Carbon

    E-Print Network [OSTI]

    Adler, Joan

    analytical model Euler-Bernoulli theory Frequencies of the modes of the lateral vibration 8 fn ~ 1/L2 fn close to global or local buckling instabilities. 19 The results of this study are relevant fo

  9. advanced aqueous reprocessing: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    transport of ices from the midplane to the disk surface and (2) transport of atomic hydrogen from the surface to the midplane. The fo... Furuya, Kenji 2014-01-01 31 AN EXPERIENCE...

  10. Nutrient Limitation in Northern Gulf of Mexico (NGOM): Phytoplankton Communities and Photosynthesis Respond to Nutrient Pulse

    E-Print Network [OSTI]

    Zhao, Yan; Quigg, Antonietta

    2014-02-14T23:59:59.000Z

    and Relaxation (FIRe) system were combined to observe changes in the phytoplankton community structure and photosynthetic activity. Major fluorescence parameters (Fo, Fv/Fm) performed well to reveal the stimulating effect of the treatments with nitrogen (N...

  11. Measurement of the Proton-Air Cross Section with Telescope Array's Middle Drum Detector and Surface Array in Hybrid Mode

    E-Print Network [OSTI]

    Abbasi, R U; Abu-Zayyad, T; Allen, M; Anderson, R; Azuma, R; Barcikowski, E; Belz, J W; Bergman, D R; Blake, S A; Cady, R; Chae, M J; Cheon, B G; Chiba, J; Chikawa, M; Cho, W R; Fujii, T; Fukushima, M; Goto, T; Hanlon, W; Hayashi, Y; Hayashida, N; Hibino, K; Honda1, K; Ikeda, D; Inoue, N; Ishii, T; Ishimori, R; Ito, H; Ivanov, D; Jui, C C H; Kadota, K; Kakimoto, F; Kalashev, O; Kasahara, K; Kawai, H; Kawakami, S; Kawana, S; Kawata, K; Kido, E; Kim, H B; Kim, J H; Kitamura, S; Kitamura, Y; Kuzmin, V; Kwon, Y J; Lan1, J; Lim, S I; Lundquist, J P; Machida, K; Martens, K; Matsuda, T; Matsuyama, T; Matthews, J N; Minamino, M; Mukai, K; Myers, I; Nagasawa, K; Nagataki1, S; Nakamura, T; Nonaka, T; Nozato, A; Ogio, S; Ogura, J; Ohnishi, M; Ohoka, H; Oki, K; Okuda, T; Ono, M; Oshima, A; Ozawa, S; Park, I H; Pshirkov, M S; Rodriguez, D C; Rubtsov, G; Ryu, D; Sagawa, H; Sakurai, N; Sampson, A L; Scott, L M; Shah, P D; Shibata, F; Shibata, T; Shimodaira, H; Shin, B K; Smith, J D; Sokolsky, P; Springer, R W; Stokes, B T; Stratton, S R; Stroman, T A; Suzawa, T; Takamura, M; Takeda, M; Takeishi, R; Taketa, A; Takita, M; Tameda, Y; Tanaka, H; Tanaka, K; Tanaka, M; Thomas, S B; Thomson, G B; Tinyakov, P; Tkachev, I; Tokuno, H; Tomida, T; Troitsky, S; Tsunesada, Y; Tsutsumi, K; Uchihori, Y; Udo, S; Urban, F; Vasiloff, G; Wong, T; Yamane, R; Yamaoka, H; Yamazaki, K; Yang, J; Yashiro, K; Yoneda, Y; Yoshida, S; Yoshii, H; Zollinger, R; Zundel, Z

    2015-01-01T23:59:59.000Z

    In this work we are reporting on the measurement of the proton-air inelastic cross section $\\sigma^{\\rm inel}_{\\rm p-air}$ using the Telescope Array (TA) detector. Based on the measurement of the $\\sigma^{\\rm inel}_{\\rm p-air}$ the proton-proton cross section $\\sigma_{\\rm p-p}$ value is also determined at $\\sqrt{s} = 95$ TeV. Detecting cosmic ray events at ultra high energies with Telescope Array enables us to study this fundamental parameter that we are otherwise unable to access with particle accelerators. The data used in this report is collected over five years using hybrid events observed by the Middle Drum fluorescence detector together with the surface array detector. The value of the $\\sigma^{\\rm inel}_{\\rm p-air}$ is found to be equal to $ 567.0 \\pm 70.5 [{\\rm Stat.}] ^{+25}_{-29} [{\\rm Sys.}]$ mb. The total proton-proton cross section is subsequently inferred from Glauber Formalism and Block, Halzen and Stanev QCD inspired fit and is found to be equal to $170_{-44}^{+48} [{\\rm Stat.}] \\pm _{-19}^{+1...

  12. Development of High Sensitive Micro-Kerr Magnetometer H_^E` '

    E-Print Network [OSTI]

    Otani, Yoshichika

    ,ê,?,¢,éZ¥CX,ð·\\·¬,·,éZå--v·"·ª,?,,é·D ,±,ê,ç,?fo CX,?'á·Á"ï"d--Í»·C `å--e--?»,â·,`¬"®·ì»,?OE¾,Á,½foCX ¥·«`?,?Z¥CX

  13. Student: Fernando O Mardones, PhD candidate Major Professor: Andres M. Perez, Tim E. Carpenter

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    Student: Fernando O Mardones, PhD candidate Major Professor: Andres M. Perez, Tim E. Carpenter, Perez AM, Mardones FO, Pérez-Sancho M, García-Seco T, Pagés E, Mirat F, Díaz R, Carpintero J, Domínguez 23(1): 9-18. - Mardones FO, Perez AM, Valdes-Donoso P, Carpenter TE. 2011. Farm-level reproduction

  14. The beat Cepheids in the Magellanic Clouds: an analysis from the EROS-2 database

    E-Print Network [OSTI]

    Marquette, J B; Buchler, J R; Szab, R; Tisserand, P; Belghith, S; Fouqu, P; Lesquoy, E; Milsztajn, A; Schwarzenberg-Czerny, A; Afonso, C; Albert, J N; Andersen, J; Ansari, R; Aubourg, E; Bareyre, P; Charlot, X; Coutures, C; Ferlet, R; Glicenstein, J F; Goldman, B; Gould, A; Graff, D; Gros, M; Hassinski, J; Hamadache, C; De Kat, J; Guillou, L Le; Loup, C; Magneville, C; Maurice, E; Maury, A; Moniez, M; Palanque-Delabrouille, Nathalie; Perdereau, O; Rahal, Y R; Rich, J; Spiro, M; Vidal-Madjar, A

    2009-01-01T23:59:59.000Z

    A number of microlensing dark-matter surveys have produced tens of millions of light curves of individual background stars. These data provide an unprecedented opportunity for systematic studies of whole classes of variable stars and their host galaxies. We aim to use the EROS-2 survey of the Magellanic Clouds to detect and study the population of beat Cepheids (BCs) in both Clouds. BCs pulsating simultaneously in the first overtone and fundamental modes (FO/F) or in the second and first overtone modes (SO/FO) are of particular interest. Using special software designed to search for periodic variables, we have scanned the EROS-2 data base for variables in the typical period range of Cepheids. Metallicities of FO/F objects were then calculated from linear nonadiabatic convective stellar models. We identify 74 FO/F BCs in the LMC and 41 in the SMC, and 173 and 129 SO/FO pulsators in the LMC and SMC, respectively; 185 of these stars are new discoveries. For nearly all the FO/F objects we determine minimum, mean,...

  15. Convection and convective overshooting in stars more massive than 10 $M_\\odot$

    E-Print Network [OSTI]

    Jie, Jin; Lv, Guoliang

    2015-01-01T23:59:59.000Z

    In this paper, four sets of evolutionary models are computed with different values of the mixing length parameter $\\alpha_{\\rm p}$ and the overshooting parameter $\\delta_{\\rm ov}$. The properties of the convective cores and the convective envelopes are studied in the massive stars. We get three conclusions: First, the larger $\\alpha_{\\rm p}$ leads to enhancing the convective mixing, removing the chemical gradient, and increasing the convective heat transfer efficiency. Second, core potential $\\phi_{\\rm c} = M_{\\rm c} / R_{\\rm c}$ describes sufficiently the evolution of a star, whether it is a red or blue supergiant at central helium ignition. Third, the discontinuity of hydrogen profile above the hydrogen burning shell seriously affect the occurrence of blue loops in the Hertzsprung--Russell diagram.

  16. Search for a Light Sterile Neutrino at Daya Bay

    E-Print Network [OSTI]

    F. P. An; A. B. Balantekin; H. R. Band; W. Beriguete; M. Bishai; S. Blyth; I. Butorov; G. F. Cao; J. Cao; Y. L. Chan; J. F. Chang; L. C. Chang; Y. Chang; C. Chasman; H. Chen; Q. Y. Chen; S. M. Chen; X. Chen; X. Chen; Y. X. Chen; Y. Chen; Y. P. Cheng; J. J. Cherwinka; M. C. Chu; J. P. Cummings; J. de Arcos; Z. Y. Deng; Y. Y. Ding; M. V. Diwan; E. Draeger; X. F. Du; D. A. Dwyer; W. R. Edwards; S. R. Ely; J. Y. Fu; L. Q. Ge; R. Gill; M. Gonchar; G. H. Gong; H. Gong; M. Grassi; W. Q. Gu; M. Y. Guan; X. H. Guo; R. W. Hackenburg; G. H. Han; S. Hans; M. He; K. M. Heeger; Y. K. Heng; P. Hinrichs; Y. K. Hor; Y. B. Hsiung; B. Z. Hu; L. M. Hu; L. J. Hu; T. Hu; W. Hu; E. C. Huang; H. Huang; X. T. Huang; P. Huber; G. Hussain; Z. Isvan; D. E. Jaffe; P. Jaffke; K. L. Jen; S. Jetter; X. P. Ji; X. L. Ji; H. J. Jiang; J. B. Jiao; R. A. Johnson; L. Kang; S. H. Kettell; M. Kramer; K. K. Kwan; M. W. Kwok; T. Kwok; W. C. Lai; K. Lau; L. Lebanowski; J. Lee; R. T. Lei; R. Leitner; A. Leung; J. K. C. Leung; C. A. Lewis; D. J. Li; F. Li; G. S. Li; Q. J. Li; W. D. Li; X. N. Li; X. Q. Li; Y. F. Li; Z. B. Li; H. Liang; C. J. Lin; G. L. Lin; P. Y. Lin; S. K. Lin; Y. C. Lin; J. J. Ling; J. M. Link; L. Littenberg; B. R. Littlejohn; D. W. Liu; H. Liu; J. L. Liu; J. C. Liu; S. S. Liu; Y. B. Liu; C. Lu; H. Q. Lu; K. B. Luk; Q. M. Ma; X. Y. Ma; X. B. Ma; Y. Q. Ma; K. T. McDonald; M. C. McFarlane; R. D. McKeown; Y. Meng; I. Mitchell; J. Monari Kebwaro; Y. Nakajima; J. Napolitano; D. Naumov; E. Naumova; I. Nemchenok; H. Y. Ngai; Z. Ning; J. P. Ochoa-Ricoux; A. Olshevski; S. Patton; V. Pec; J. C. Peng; L. E. Piilonen; L. Pinsky; C. S. J. Pun; F. Z. Qi; M. Qi; X. Qian; N. Raper; B. Ren; J. Ren; R. Rosero; B. Roskovec; X. C. Ruan; B. B. Shao; H. Steiner; G. X. Sun; J. L. Sun; Y. H. Tam; X. Tang; H. Themann; K. V. Tsang; R. H. M. Tsang; C. E. Tull; Y. C. Tung; B. Viren; V. Vorobel; C. H. Wang; L. S. Wang; L. Y. Wang; M. Wang; N. Y. Wang; R. G. Wang; W. Wang; W. W. Wang; X. Wang; Y. F. Wang; Z. Wang; Z. Wang; Z. M. Wang; D. M. Webber; H. Y. Wei; Y. D. Wei; L. J. Wen; K. Whisnant; C. G. White; L. Whitehead; T. Wise; H. L. H. Wong; S. C. F. Wong; E. Worcester; Q. Wu; D. M. Xia; J. K. Xia; X. Xia; Z. Z. Xing; J. Y. Xu; J. L. Xu; J. Xu; Y. Xu; T. Xue; J. Yan; C. C. Yang; L. Yang; M. S. Yang; M. T. Yang; M. Ye; M. Yeh; Y. S. Yeh; B. L. Young; G. Y. Yu; J. Y. Yu; Z. Y. Yu; S. L. Zang; B. Zeng; L. Zhan; C. Zhang; F. H. Zhang; J. W. Zhang; Q. M. Zhang; Q. Zhang; S. H. Zhang; Y. C. Zhang; Y. M. Zhang; Y. H. Zhang; Y. X. Zhang; Z. J. Zhang; Z. Y. Zhang; Z. P. Zhang; J. Zhao; Q. W. Zhao; Y. Zhao; Y. B. Zhao; L. Zheng; W. L. Zhong; L. Zhou; Z. Y. Zhou; H. L. Zhuang; J. H. Zou

    2014-10-08T23:59:59.000Z

    A search for light sterile neutrino mixing was performed with the first 217 days of data from the Daya Bay Reactor Antineutrino Experiment. The experiment's unique configuration of multiple baselines from six 2.9~GW$_{\\rm th}$ nuclear reactors to six antineutrino detectors deployed in two near (effective baselines 512~m and 561~m) and one far (1579~m) underground experimental halls makes it possible to test for oscillations to a fourth (sterile) neutrino in the $10^{\\rm -3}~{\\rm eV}^{2} < |\\Delta m_{41}^{2}| < 0.3~{\\rm eV}^{2}$ range. The relative spectral distortion due to electron antineutrino disappearance was found to be consistent with that of the three-flavor oscillation model. The derived limits on $\\sin^22\\theta_{14}$ cover the $10^{-3}~{\\rm eV}^{2} \\lesssim |\\Delta m^{2}_{41}| \\lesssim 0.1~{\\rm eV}^{2}$ region, which was largely unexplored.

  17. Thermo-elastic induced phase noise in the LISA Pathfinder spacecraft

    E-Print Network [OSTI]

    Ferran Gibert; Miquel Nofrarias; Nikolaos Karnesis; Llus Gesa; Vctor Martn; Ignacio Mateos; Alberto Lobo; Reinhold Flatscher; Domenico Gerardi; Johannes Burkhardt; Ruediger Gerndt; David Robertson; Henry Ward; Paul William McNamara; Felipe Guzmn; Martin Hewitson; Ingo Diepholz; Jens Reiche; Gerhard Heinzel; Karsten Danzmann

    2014-12-12T23:59:59.000Z

    During the On-Station Thermal Test campaign of the LISA Pathfinder the data and diagnostics subsystem was tested in nearly space conditions for the first time after integration in the satellite. The results showed the compliance of the temperature measurement system, obtaining temperature noise around $10^{-4}\\,{\\rm K}\\, {\\rm Hz}^{-1/2}$ in the frequency band of $1-30\\;{\\rm mHz}$. In addition, controlled injection of heat signals to the suspension struts anchoring the LISA Technology Package (LTP) Core Assembly to the satellite structure allowed to experimentally estimate for the first time the phase noise contribution through thermo-elastic distortion of the LTP interferometer, the satellite's main instrument. Such contribution was found to be at $10^{-12}\\,{\\rm m}\\, {\\rm Hz}^{-1/2}$, a factor of 30 below the measured noise at the lower end of the measurement bandwidth ($1\\,{\\rm mHz}$).

  18. Synchrotron spectral index and interstellar medium densities of star-forming galaxies

    E-Print Network [OSTI]

    Basu, Aritra; Schmidt, Philip; Roy, Subhashis

    2015-01-01T23:59:59.000Z

    The spectral index of synchrotron emission is an important parameter in understanding the properties of cosmic ray electrons (CREs) and the interstellar medium (ISM). We determine the synchrotron spectral index ($\\alpha_{\\rm nt}$) of four nearby star-forming galaxies, namely NGC 4736, NGC 5055, NGC 5236 and NGC 6946 at sub-kpc linear scales. The $\\alpha_{\\rm nt}$ was determined between 0.33 and 1.4 GHz for all the galaxies. We find the spectral index to be flatter ($\\gtrsim -0.7$) in regions with total neutral (atomic + molecular) gas surface density, $\\Sigma_{\\rm gas} \\gtrsim \\rm 50~M_\\odot pc^{-2}$, typically in the arms and inner parts of the galaxies. In regions with $\\Sigma_{\\rm gas} \\lesssim \\rm 50~M_\\odot pc^{-2}$, especially in the interarm and outer regions of the galaxies, the spectral index steepens sharply to $emitting a...

  19. The exponentiated Hencky-logarithmic strain energy. Part III: Coupling with idealized isotropic finite strain plasticity

    E-Print Network [OSTI]

    Patrizio Neff; Ionel-Dumitrel Ghiba

    2014-10-08T23:59:59.000Z

    We investigate an immediate application in finite strain multiplicative plasticity of the family of isotropic volumetric-isochoric decoupled strain energies \\begin{align*} F\\mapsto W_{_{\\rm eH}}(F):=\\hat{W}_{_{\\rm eH}}(U):=\\{\\begin{array}{lll} \\frac{\\mu}{k}\\,e^{k\\,\\|{\\rm dev}_n\\log {U}\\|^2}+\\frac{\\kappa}{{\\text{}}{2\\, {\\hat{k}}}}\\,e^{\\hat{k}\\,[{\\rm tr}(\\log U)]^2}&\\text{if}& {\\rm det}\\, F>0,\\\\ +\\infty &\\text{if} &{\\rm det} F\\leq 0, \\end{array}.\\quad \\end{align*} based on the Hencky-logarithmic (true, natural) strain tensor $\\log U$. Here, $\\mu>0$ is the infinitesimal shear modulus, $\\kappa=\\frac{2\\mu+3\\lambda}{3}>0$ is the infinitesimal bulk modulus with $\\lambda$ the first Lam\\'{e} constant, $k,\\hat{k}$ are dimensionless fitting parameters, $F=\

  20. FORESTRY 347 MULTIPLE RESOURCE SILVICULTURE

    E-Print Network [OSTI]

    Vonessen, Nikolaus

    FORESTRY 347 MULTIPLE RESOURCE SILVICULTURE Autumn 2008 Instructor: John Goodburn Office: Rm. 409 Science Complex Telephone: 243-4295 Email: goodburn@forestry.umt.edu Office hours: Mon. 3:00 - 5:00 pm.m. Rm. 301 Forestry Bldg. Lab/Field Work Wed or Thur. 2:10 - 6:00 p.m. In Field or Rm. 106 (W) & 206(H

  1. NEUTRON-RICH NUCLEAR STUDIES 1. M.W. Simon, C.Y. Wu, D. Cline, R.W. Gray, M.A. Stoyer, K. Vetter, A. Macchiavelli, K. Gregorich, R.W.

    E-Print Network [OSTI]

    Cline, Douglas

    , Ed Paul Fallon, LBNL-41700 1998 4. H. Hua, C.Y. Wu, D. Cline, A.B. Hayes, R. Teng, R.M. Clark, P.J. Barton, M. Shawcross, A. Aprahamian, C.W. Beausang, M.A. Caprio, R.F. Casten, W,T. Chou, R.M. Clark, D,T. Chou, R.M. Clark, D. Cline, M. Cromaz, A.A.Hecht, A.O. Macchiavelli, N. Pietralla, M.A. Stoyer, C.Y. Wu

  2. Detection of Ks-excess stars in the 14Myr open cluster NGC4755

    E-Print Network [OSTI]

    Bonatto, C; Ortolani, S; Barbuy, B

    2006-01-01T23:59:59.000Z

    We derive the structure, distribution of MS and PMS stars and dynamical state of the young open cluster NGC 4755. We explore the possibility that, at the cluster age, some MS and PMS stars still present infrared excesses related to dust envelopes and proto-planetary discs. The radial density profile follows King's law with a core radius $\\rm\\rc=0.7\\pm0.1 pc$ and a limiting radius $\\rm\\rl=6.9\\pm0.1 pc$; the cluster age is $\\rm14\\pm2 Myr$. Field-star decontamination reveals a low-MS limit at $\\rm\\approx1.4 \\ms$. The core MF ($\\chi=0.94\\pm0.16$) is flatter than the halo's ($\\chi=1.58\\pm0.11$). NGC 4755 contains $\\rm\\sim285$ candidate PMS stars of age $\\rm\\sim1 - 15 Myr$, and a few evolved stars. The mass locked up in PMS, MS and evolved stars amounts to $\\rm\\sim1150 \\ms$. Proper motions show that \\ks-excess MS and PMS stars are cluster members. \\ks-excess fractions in PMS and MS stars are $\\rm5.4\\pm2.1%$ and $\\rm3.9\\pm1.5%$ respectively, consistent with the cluster age. The core is deficient in PMS stars, as com...

  3. Rocky Mountain's Home page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RM sells power in Colorado, most of Wyoming, Nebraska and northeastern Kansas to wholesale customers such as towns, rural electric cooperatives, public utility and irrigation...

  4. Sandia Energy - EC Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    but are expected to have minimal effects on surface mounted devices like the vertical axis turbine device designed for RM2. A simple methodology for obtaining an approximate...

  5. Three dimensional magnetic field structure of six parsec-scale active galactic nuclei jets

    E-Print Network [OSTI]

    Shane P. O'Sullivan; Denise C. Gabuzda

    2009-02-11T23:59:59.000Z

    The parsec-scale Faraday rotation measure (RM) distribution of six "blazars" is investigated using multi-frequency (4.6--43 GHz) polarization observations taken on 2006 July 2 with the VLBA. Analysis of the RM provides the direction of the line-of-sight (LoS) magnetic field component, as well as the intrinsic 2-D polarization distribution on the plane of the sky. Our results show that the magnitude of the core RM increases systematically with frequency, and is well described by a power-law, where |RM_{core}| \\propto \

  6. PERSONAL CON NOMBRAMIENTO VIGENTE Calificacin

    E-Print Network [OSTI]

    Rapaport, Iván

    Zorricueta Luis 11 Sin Información Conservador De Inventarios RM 01-06-2006 31-12-2099 Planta Administrativo

  7. Cytomegalovirus pp65 limits dissemination but is dispensable...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    effect of natural infection. Citation: Malouli D, SG Hansen, ES Nakayasu, EE Marshall, CM Hughes, AB Ventura, RM Gilbride, MS Lewis, G Xu, CN Kreklywich, N Whizin, M...

  8. APS COLLOQUIUM 2008

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Presentation (47:02), video (rm) (47:02), Poster (jpg) dresselhaus New Composite Thermoelectric Materials for Macro-size Applications SPETEMBER 3, 2008 Mildred Dresselhaus, MIT...

  9. EV Guideline Assessment Templates | Department of Energy

    Energy Savers [EERE]

    EV Guideline Assessment Templates More Documents & Publications EV Guideline Assessment Templates NDIAPMSCEVMSIntentGuideNov2006.pdf Earned Value Management System RM...

  10. ash deposition propensities: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Environments (>3.5 km), banded iron, volcanic ashes Summary diagrams available Clastic depositional environments Harbor, David 57 Ash Dump Site Manager: EHS&RM Biology and...

  11. area space telescope: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    telescope. Stellar-image data in a typical exposure determines secondary-mirror positions as precisely as 20 rm nm. The PSF ellipticities and size, which are...

  12. Universality in W+Multijet Production

    E-Print Network [OSTI]

    Z. Bern; L. J. Dixon; F. Febres Cordero; S. Hoeche; H. Ita; D. A. Kosower; D. Maitre; K. J. Ozeren

    2014-07-24T23:59:59.000Z

    We study $W$-boson production accompanied by multiple jets at 7 TeV at the LHC. We study the jet-production ratio, of total cross sections for $W$+$n$- to $W$+($n-1$)-jet production, and the ratio of distributions in the total transverse hadronic jet energy $H_{\\rm T}^{\\rm jets}$. We use the ratios to extrapolate the total cross section, and the differential distribution in $H_{\\rm T}^{\\rm jets}$, to $W$+6-jet production. We use the BlackHat software library in conjunction with SHERPA to perform the computations.

  13. Proposed rule for Interconnection for Wind Energy and Other Alternativ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ENERGY REGULATORY COMMISSION 18 CFR Part 35 (Docket No. RM05-4-000) Interconnection for Wind Energy and Other Alternative Technologies (January 24, 2005) AGENCY: Federal Energy...

  14. Do Investors Forecast Fat Firms? Evidence from the Gold Mining Industry

    E-Print Network [OSTI]

    Borenstein, Severin; Farrell, Joseph

    2006-01-01T23:59:59.000Z

    2002). When are Real Options Exercised? An Empirical Studya simple application of real option theory; it requires noprices, consistent with real-option analysis. Since the ?rm

  15. Origin of atmospheric aerosols at the Pierre Auger Observatory using studies of air mass trajectories in South America

    E-Print Network [OSTI]

    Curci, Gabriele

    2014-01-01T23:59:59.000Z

    The Pierre Auger Observatory is making significant contributions towards understanding the nature and origin of ultra-high energy cosmic rays. One of its main challenges is the monitoring of the atmosphere, both in terms of its state variables and its optical properties. The aim of this work is to analyze aerosol optical depth $\\tau_{\\rm a}(z)$ values measured from 2004 to 2012 at the observatory, which is located in a remote and relatively unstudied area of the Pampa Amarilla, Argentina. The aerosol optical depth is in average quite low - annual mean $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.04$ - and shows a seasonal trend with a winter minimum - $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.03$ -, and a summer maximum - $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.06$ -, and an unexpected increase from August to September - $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.055$). We computed backward trajectories for the years 2005 to 2012 to interpret the air mass origin. Winter nights with low aerosol concentrations show air masses originating from t...

  16. Office of the Chief Information Officer DOERM@hq.doe.gov

    Office of Environmental Management (EM)

    a Records Management Field Officer (RMFO) to represent each Field site or office to support their respective RM processes. RMFOs are officials at the Field level who provide...

  17. Passenger Name Record Data Mining Based Cancellation ...

    E-Print Network [OSTI]

    2008-04-16T23:59:59.000Z

    Apr 16, 2008 ... Revenue management (RM) enhances the revenues of a company by ... A revenue management system collects and stores booking records...

  18. S-semigoodness for Low-Rank Semidefinite Matrix Recovery

    E-Print Network [OSTI]

    2013-01-14T23:59:59.000Z

    Jan 14, 2013 ... ensemble) and b ? Rm (known measurement), X ? 0 says that X is .... Gross, Liu, Flammia, Becker, and Eisert [11] successfully used SDP.

  19. SEAS Peer Review Lab Inspection Report Nov. 20, 2013

    E-Print Network [OSTI]

    bins and broken glass container blocking access to emergency shower control bottle of tetrahydrofuran dating back to 2005; may require disposal. Rm 329a

  20. Quasi-normal modes of Pop III binary black holes can confirm or refute the Einstein theory in the strong gravity region

    E-Print Network [OSTI]

    Tomoya Kinugawa; Akinobu Miyamoto; Nobuyuki Kanda; Takashi Nakamura

    2015-05-26T23:59:59.000Z

    Using our population synthesis code, we found that the typical chirp mass defined by $(m_1m_2)^{3/5}/(m_1+m_2)^{1/5}$ of Pop III binary black holes (BH-BHs) is $\\sim30~\\rm M_{\\odot}$ with the total mass of $\\sim60~\\rm M_{\\odot}$ so that the inspiral chirp signal as well as quasi normal mode (QNM) of the merged black hole (BH) are interesting targets of KAGRA, Adv. LIGO, Adv. Virgo and GEO network. The detection rate of the coalescing Pop III BH-BHs is 262 $\\rm events~yr^{-1}$$(\\rm SFR_P/(10^{-2.5}~\\rm M_{\\odot} \\rm~yr^{-1}~Mpc^{-3}))\\cdot Err_{sys}$ in our standard model where $\\rm SFR_{p}$ and $\\rm Err_{sys}$ are the peak value of the Pop III star formation rate and the systematic error with $\\rm Err_{sys}=1$ for our standard model, respectively. To evaluate the robustness of chirp mass distribution and the range of $\\rm Err_{sys}$, we examine the dependence of the results on the unknown parameters and the distribution functions in the population synthesis code. We found that the chirp mass has a peak at $\\sim 30 ~\\rm M_{\\odot}$ in most of parameters and distribution functions as well as $\\rm Err_{sys}$ ranges from 0.05577 to 2.289. Therefore, the detection rate of the coalescing Pop III BH-BHs ranges $14.6-599.3\\ {\\rm events~yr^{-1} ~(SFR_p/(10^{-2.5}~M_{\\odot}~yr^{-1}~Mpc^{-3}))}$. The minimum rate corresponds to the worst model which we think unlikely so that unless $ {\\rm ~(SFR_p/(10^{-2.5}~M_{\\odot}~yr^{-1}~Mpc^{-3})) \\ll 0.1}$, we expect the Pop III BH-BHs merger rate of at least one event per year by KAGRA, Adv. LIGO, Adv. Virgo and GEO network. Since the expected frequency of the QNM of the merged BH of mass $\\sim60~\\rm M_{\\odot}$ is $\\sim 200~{\\rm Hz}$ where the interferometers have good sensitivity, there is a good chance to check if the Einstein theory is correct or not in the strong gravity region.

  1. Northwestern Charles Deering McCormick University Library Library of Special Collections

    E-Print Network [OSTI]

    .d. Hitler's American ambitions. n.d. R.M. Hutchins. America and the war. January 23, 1941. E. Lundeen. Six

  2. Subduction Controls of Hf and Nd Isotopes in Lavas of the Aleutian Island Arc

    E-Print Network [OSTI]

    Yogodzinski, Gene

    2011-01-01T23:59:59.000Z

    Pratt, R.M. , 1973. Petrology of volcanic rocks recovered onGlassley, W.R. , 1973. Petrology of Volcanic Rocks Recovered

  3. Dynamic analysis in productivity, oil shock, and recession

    E-Print Network [OSTI]

    Katayama, Munechika

    2008-01-01T23:59:59.000Z

    displays the share of oil consumption in the transportationis a major source of oil consumption. Any investigation ofrepresents ?rm is oil consumption for capital utilization

  4. Variability in Ultrasound Education among Emergency Medicine Residencies

    E-Print Network [OSTI]

    Ahern, Matthew; Mallin, Michael P; Weitzel, Scott; Madsen, Troy; Hunt, Pat

    2010-01-01T23:59:59.000Z

    Journal of Emergency Medicine Variability in UltrasoundDivision of Emergency Medicine, 30 South 1500 East Rm1C026,Training in Emergency Medicine Resideny Programs. Acad Emerg

  5. Determination of the 3He+alpha\\to 7Be asymp. normalization coefficients (nucl. vertex constants) and their application for extrapolation of the 3He(alpha,gamma)7Be astroph. S-factors to the solar energy region

    E-Print Network [OSTI]

    S. B. Igamov; K. I. Tursunmakhatov; R. Yarmukhamedov

    2008-05-28T23:59:59.000Z

    A new analysis of the precise experimental astrophysical $S$-factors for the direct capture $^3He(\\alpha,\\gamma)^7{\\rm {Be}}$ reaction [B.S. Nara Singh et al., Phys.Rev.Lett. {\\bf 93} (2004) 262503; D. Bemmerer et al., Phys.Rev.Lett. {\\bf 97} (2006) 122502; F.Confortola et al., Phys.Rev. {\\bf C 75} (2007) 065803 and T.A.D.Brown et al., Phys.Rev. {\\bf C 76} (2007) 055801] populating to the ground and first excited states of $^7{\\rm Be}$ is carried out based on the modified two - body potential approach in which the direct astrophysical $S$-factor, $S_{34}(E)$, is expressed in terms of the asymptotic normalization constants for $^3{\\rm {He}}+\\alpha\\to ^7{\\rm {Be}}$ and two additional conditions are involved to verify the peripheral character of the reaction under consideration. The Woods--Saxon potential form is used for the bound ($\\alpha+^3{\\rm {He}}$)- state and the $^3{\\rm {He}}\\alpha$- scattering wave functions. New estimates are obtained for the "indirectly measured", values of the asymptotic normalization constants (the nuclear vertex constants) for $^3{\\rm {He}}+\\alpha\\to^7{\\rm {Be}}(g.s.)$ and $^3{\\rm {He}}+\\alpha\\to^7{\\rm {Be}}(0.429 MeV)$ as well as the astrophysical $S$-factors $S_{34}(E)$ at E$\\le$ 90 keV, including $E$=0. The values of asymptotic normalization constants have been used for getting information about the $\\alpha$-particle spectroscopic factors for the mirror ($^7Li^7{\\rm {Be}}$)-pair.

  6. Price Differences in a Durable Products Secondary Market: A Hedonic Price Analysis

    E-Print Network [OSTI]

    Fumasi, Roland J

    2013-07-22T23:59:59.000Z

    DFtuDrLoFtrsyJuyyuisorseoeuyFtuObFuisousStryFtbDFbt oFUtibNUoxgc8o nCuyU toxgcgRhooBaoxg9gYoFU o L DFtuDobFuLuFaousebyFtaoduLLos eoFioJrH oroFiFrLo usStryFtbDFbt ousM yFJ sFoiSoBch8oFioBxhgoFtuLLuisonfUbmHro ForLoxgg1Rh PsoreeuFuisoFioyDU ebL eous...FtbDHoJrsbSrDFbt tyoeiosiFoUrM oro DiJmt U syuM oe rL tos FditHhoo= doObDH FoFtbDHyort osiFoJrsbSrDFbt eousoJryyYorseo FU soyUumm eoFioe rL toyrL yoLiFy&oe rL toLiFyoeiosiFo .uyFhooBbDH FoFtbDHyort oFamuDrLLao ite t eYom toym DuSuDrFuisYoeut DFLaoStiJoFU oECAh ECAo Ibum...

  7. Water treatment capacity of forward osmosis systems utilizing power plant waste heat

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhou, Xingshi; Gingerich, Daniel B.; Mauter, Meagan S.

    2015-06-11T23:59:59.000Z

    Forward osmosis (FO) has the potential to improve the energy efficiency of membrane-based water treatment by leveraging waste heat from steam electric power generation as the primary driving force for separation. In this study, we develop a comprehensive FO process model, consisting of membrane separation, heat recovery, and draw solute regeneration (DSR) models. We quantitatively characterize three alternative processes for DSR: distillation, steam stripping, and air stripping. We then construct a mathematical model of the distillation process for DSR that incorporates hydrodynamics, mass and heat transport resistances, and reaction kinetics, and we integrate this into a model for the fullmoreFO process. Finally, we utilize this FO process model to derive a first-order approximation of the water production capacity given the rejected heat quantity and quality available at U.S. electric power facilities. We find that the upper bound of FO water treatment capacity using low-grade heat sources at electric power facilities exceeds process water treatment demand for boiler water make-up and flue gas desulfurization wastewater systems.less

  8. Water treatment capacity of forward osmosis systems utilizing power plant waste heat

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhou, Xingshi [Carnegie Mellon Univ., Pittsburgh, PA (United States); Gingerich, Daniel B. [Carnegie Mellon Univ., Pittsburgh, PA (United States); Mauter, Meagan S. [Carnegie Mellon Univ., Pittsburgh, PA (United States)

    2015-06-11T23:59:59.000Z

    Forward osmosis (FO) has the potential to improve the energy efficiency of membrane-based water treatment by leveraging waste heat from steam electric power generation as the primary driving force for separation. In this study, we develop a comprehensive FO process model, consisting of membrane separation, heat recovery, and draw solute regeneration (DSR) models. We quantitatively characterize three alternative processes for DSR: distillation, steam stripping, and air stripping. We then construct a mathematical model of the distillation process for DSR that incorporates hydrodynamics, mass and heat transport resistances, and reaction kinetics, and we integrate this into a model for the full FO process. Finally, we utilize this FO process model to derive a first-order approximation of the water production capacity given the rejected heat quantity and quality available at U.S. electric power facilities. We find that the upper bound of FO water treatment capacity using low-grade heat sources at electric power facilities exceeds process water treatment demand for boiler water make-up and flue gas desulfurization wastewater systems.

  9. Black hole solutions to the $F_4$-model and their orbits (I)

    E-Print Network [OSTI]

    Chemissany, W; Ruggeri, D; Trigiante, M

    2012-01-01T23:59:59.000Z

    In this paper we continue the program of the classification of nilpotent orbits using the approach developed in arXiv:1107.5986, within the study of black hole solutions in D=4 supergravities. Our goal in this work is to classify static, single center black hole solutions to a specific N=2 four dimensional "magic" model, with special K\\"ahler scalar manifold ${\\rm Sp}(6,\\mathbb{R})/{\\rm U}(3)$, as orbits of geodesics on the pseudo-quaternionic manifold ${\\rm F}_{4(4)}/[{\\rm SL}(2,\\mathbb{R})\\times {\\rm Sp}(6,\\mathbb{R})]$ with respect to the action of the isometry group ${\\rm F}_{4(4)}$. Our analysis amounts to the classification of the orbits of the geodesic "velocity" vector with respect to the isotropy group $H^*={\\rm SL}(2,\\mathbb{R})\\times {\\rm Sp}(6,\\mathbb{R})$, which include a thorough classification of the \\emph{nilpotent orbits} associated with extremal solutions and reveals a richer structure than the one predicted by the $\\beta-\\gamma$ labels alone, based on the Kostant Sekiguchi approach. We prov...

  10. Study of the Higgs boson decaying to $WW^*$ produced in association with a weak boson with the ATLAS detector at the LHC

    E-Print Network [OSTI]

    The ATLAS collaboration

    2015-01-01T23:59:59.000Z

    The search for Higgs boson production in association with a $W$ or a $Z$ boson, in the decay channel $H \\to WW^*$, is performed with a data sample collected with the ATLAS detector at the LHC in proton-proton collisions at centre-of-mass energies $\\sqrt{s}=7~{\\rm TeV}$ and $8~{\\rm TeV}$, corresponding to integrated luminosities of 4.5 ${\\rm fb}^{-1}$ and 20.3 ${\\rm fb}^{-1}$, respectively. The $WH$ production mode is studied in three and two lepton final states, while a four lepton final state is used to search for $ZH$ production. The observed significance is of 2.5 standard deviations while a significance of 0.9 standard deviations is expected for a Standard Model Higgs boson. The ratio of the combined $WH$ and $ZH$ signal yield to the Standard Model expectation, $\\mu_{\\rm VH}$, is found to be $\\mu_{\\rm VH} =3.0^{+1.3}_{-1.1}{\\, {(\\rm stat.)}}^{+1.0}_{-0.7}{\\,{(\\rm sys.)}}$ for a Higgs boson mass of 125.36 GeV. The $WH$ and $ZH$ channels are also combined with the gluon-gluon fusion and vector boson fusion ...

  11. Search for a Standard Model-like Higgs boson decaying into WW to l nu qqbar in exclusive jet bins in pp collisions at sqrt s = 8 TeV

    E-Print Network [OSTI]

    CMS Collaboration

    2015-01-01T23:59:59.000Z

    A search for a Standard Model Higgs boson decaying into the WW final state is performed with an integrated luminosity of up to 19.3~${\\rm fb}^{-1}$ of pp collisions at $\\sqrt{s}$~=~8~TeV in the high mass region $600 < m_{\\rm H} < 1000$~GeV.

  12. SoilLitter Mixing Accelerates Decomposition in a Chihuahuan

    E-Print Network [OSTI]

    of Geography, University of California Los Angeles, 1255 Bunche Hall, Box 951524, Los Angeles, California 90095 the study; DH and RM performed the research and analyzed the data; DH, HT, SA, and RM wrote the paper that of mesic systems, where simple models based on climate variables such as actual evapotranspiration predict

  13. Academic Resources UNIVERSITY CLASSROOM INVENTORY

    E-Print Network [OSTI]

    Academic Resources UNIVERSITY CLASSROOM INVENTORY Building Order Spring 2014 BLDG RM CAP. ENH. AV;Academic Resources UNIVERSITY CLASSROOM INVENTORY Building Order Spring 2014 BLDG RM CAP. ENH. AV(01)* TAB_012814\\roomorder 2 of 4 1/28/2014 #12;Academic Resources UNIVERSITY CLASSROOM INVENTORY Building Order

  14. System Identification in Gaussian Process Dynamical Systems

    E-Print Network [OSTI]

    Ghahramani, Zoubin

    the GPs GPf and GPg for f and g, we parameterize them by pseudo training sets, which are similar = {i RM }N i=1. GPg is parameterized by kernel hyper-parameters, pseudo training inputs = {i RM }N i (xt-1|, i), ytj = gj(yt) + tj GPg(xt|, j) , where xti is the ith dimension of xt and ytj is the jth

  15. Inflationary Magnetogenesis in $R^{2}$-Inflation after Planck 2015

    E-Print Network [OSTI]

    AlMuhammad, Anwar Saleh

    2015-01-01T23:59:59.000Z

    We study the primordial magnetic field generated by the simple model $f^2 FF$ in Starobinsky, $R^2$-inflationary, model. The scale invariant PMF is achieved at relatively high power index of the coupling function, $\\left| \\alpha \\right| \\approx 7.44$. This model does not suffer from the backreaction problem as long as, the rate of inflationary expansion, $H$, is in the order of or less than the upper bound reported by Planck ($\\le 3.6 \\times 10^{-5} M_\\rm{Pl}$) in both de Sitter and power law expansion, which show similar results. We calculate the lower limit of the reheating parameter, $R_\\rm{rad} > 6.888$ in $R^2$-inflation. Based on the upper limit obtained from CMB, we find that the upper limits of magnetic field and reheating energy density as, $\\left(\\rho_{B_\\rm{end}} \\right)_\\rm{CMB} < 1.184 \\times 10^{-20} M_\\rm{Pl}^4$ and $\\left(\\rho_\\rm{reh} \\right)_\\rm{CMB} < 8.480 \\times 10^{-22} M_\\rm{Pl}^4$. All of foregoing results are well more than the lower limit derived from WMAP7 for both large and s...

  16. Constraints on black hole massess with timescales of variations in blazars

    E-Print Network [OSTI]

    Liu, H T

    2015-01-01T23:59:59.000Z

    In this paper, we investigated the issue of black hole masses and minimum timescales of jet emission for blazars. We proposed a sophisticated model that sets an upper limit to the central black hole masses $M_{\\bullet}$ with the minimum timescales $\\Delta t^{\\rm{ob}}_{\\rm{min}}$ of variations observed in blazars. The value of $\\Delta t^{\\rm{ob}}_{\\rm{min}}$ presents an upper limit to the size of blob in jet. The blob is assumed to be generated in the jet-production region in the vicinity of black hole, and then the expanding blob travels outward along the jet. We applied the model to 32 blazars, 29 of which were detected in gamma rays by satellites, and these $\\Delta t^{\\rm{ob}}_{\\rm{min}}$ are on the order of hours with large variability amplitudes. In general, these $M_{\\bullet}$ estimated with this method are not inconsistent with those masses reported in the literatures. This model is natural to connect $M_{\\bullet}$ with $\\Delta t^{\\rm{ob}}_{\\rm{min}}$ for blazars, and seems to be applicable to constrain...

  17. Nuclear Composition of Magnetized GRB Jets

    E-Print Network [OSTI]

    Shibata, Sanshiro

    2015-01-01T23:59:59.000Z

    We investigate the fraction of metal nuclei in the relativistic jets of gamma-ray bursts associated with core-collapse supernovae. We simulate the fallback in jet-induced explosions with two-dimensional relativistic hydrodynamics calculations and the jet acceleration with steady, radial, relativistic magnetohydrodynamics calculations, and derive detail nuclear composition of the jet by postprocessing calculation. We found that if the temperature at the jet launch site is above $4.7\\times 10^9$K, quasi-statistical equilibrium (QSE) is established and heavy nuclei are dissociated to light particles such as $^4$He during the acceleration of the jets. The criterion for the survival of metal nuclei is written in terms of the isotropic jet luminosity as $L_{\\rm j}^{\\rm iso} \\lesssim 3.9\\times 10^{50}(R_{\\rm i}/10^7{\\rm cm})^2 (1+\\sigma_{\\rm i})~{\\rm erg~s^{-1}}$, where $R_{\\rm i}$ and $\\sigma_{\\rm i}$ are the initial radius of the jets and the initial magnetization parameter, respectively. If the jet is initially d...

  18. Determination of the 3He+alpha\\to 7Be asymp. normalization coefficients (nucl. vertex constants) and their application for extrapolation of the 3He(alpha,gamma)7Be astroph. S-factors to the solar energy region

    E-Print Network [OSTI]

    S. B. Igamov; Q. I. Tursunmahatov; R. Yarmukhamedov

    2010-11-22T23:59:59.000Z

    A new analysis of the modern precise measured astrophysical $S$ factors for the direct capture $^3He(\\alpha,\\gamma)^7{\\rm {Be}}$ reaction [B.S. Nara Singh {\\it et al.}, Phys.Rev.Lett. {\\bf 93}, 262503 (2004); D. Bemmerer {\\it et al.}, Phys.Rev.Lett. {\\bf 97}, 122502 (2006); F.Confortola {\\it et al.}, Phys.Rev.C {\\bf 75}, 065803 (2007), T.A.D.Brown {\\it et al.}, Phys.Rev. C {\\bf 76}, 055801 (2007) and A Di Leva, {\\it et al.},Phys.Rev.Lett. {\\bf 102}, 232502 (2009)] populating to the ground and first excited states of $^7{\\rm Be}$ is carried out based on the modified two - body potential approach. New estimates are obtained for the $^{\\glqq}$indirectly determined\\grqq\\, values of the asymptotic normalization constants (the nuclear vertex constants) for $^3{\\rm {He}}+\\alpha\\to{\\rm {^7Be}}$(g.s.) and $^3{\\rm {He}}+\\alpha\\to{\\rm {^7Be}}$(0.429 MeV) as well as the astrophysical $S$ factors $S_{34}(E)$ at E$\\le$ 90 keV, including $E$=0. The values of asymptotic normalization constants have been used for getting information about the $\\alpha$-particle spectroscopic factors for the mirror (${\\rm{^7Li}}{\\rm {^7Be}}$)-pair.

  19. Many-body effects in tracer particle diffusion with applications for single-protein dynamics on DNA

    E-Print Network [OSTI]

    Sebastian Ahlberg; Tobias Ambjrnsson; Ludvig Lizana

    2015-02-07T23:59:59.000Z

    30% of the DNA in E. coli bacteria is covered by proteins. Such high degree of crowding affect the dynamics of generic biological processes (e.g. gene regulation, DNA repair, protein diffusion etc.) in ways that are not yet fully understood. In this paper, we theoretically address the diffusion constant of a tracer particle in a one dimensional system surrounded by impenetrable crowder particles. While the tracer particle always stays on the lattice, crowder particles may unbind to a surrounding bulk and rebind at another or the same location. In this scenario we determine how the long time diffusion constant ${\\cal D}$ (after many unbinding events) depends on (i) the unbinding rate of crowder particles $k_{\\rm off}$, and (ii) crowder particle line density $\\rho$, from simulations (Gillespie algorithm) and analytical calculations. For small $k_{\\rm off}$, we find ${\\cal D}\\sim k_{\\rm off}/\\rho^2$ when crowder particles are immobile on the line, and ${\\cal D}\\sim \\sqrt{D k_{\\rm off}}/\\rho$ when they are diffusing; $D$ is the free particle diffusion constant. For large $k_{\\rm off}$, we find agreement with mean-field results which do not depend on $k_{\\rm off}$. From literature values of $k_{\\rm off}$ and $D$, we show that the small $k_{\\rm off}$-limit is relevant for in vivo protein diffusion on a crowded DNA. Our results applies to single-molecule tracking experiments.

  20. bottle,bill,food OrangeWalkN

    E-Print Network [OSTI]

    Rosenthal, Jeffrey S.

    Room3 *** bottle,bill,food basket AlleyOne AlleyOneN ComputerRm ClosedDoor sign,slot Breezeway Hallway6 StorageRm guard[1],glass SteamTun1 SteamTun2 dark SteamTun3 SteamTun4 SteamTun5 SteamTun6 unit[2

  1. PROSPECTS FOR THE CHARACTERIZATION AND CONFIRMATION OF TRANSITING EXOPLANETS VIA THE ROSSITER-MCLAUGHLIN EFFECT

    E-Print Network [OSTI]

    Gaudi, B. Scott

    distortion of the RM effect is often manifested as an ``anomalous'' radial velocity, i.e., a Doppler shift will be detected by forthcoming satellite missions), the velocity anomaly produced by the RM effect can be much-MCLAUGHLIN EFFECT B. Scott Gaudi1 and Joshua N. Winn2 Received 2006 August 2; accepted 2006 October 3 ABSTRACT

  2. Small-scale dynamos on the solar surface: dependence on magnetic Prandtl number

    E-Print Network [OSTI]

    Thaler, I

    2015-01-01T23:59:59.000Z

    The question of possible small-scale dynamo action in the surface layers of the Sun is revisited with realistic 3D MHD simulations. As in other MHD problems, dynamo action is found to be a sensitive function of the magnetic Prandtl number ${\\rm P_{\\rm m} }=\

  3. STATE OF CALIFORNIA THE RESOURCES AGENCY ARNOLD SCHWARZENEGGER, Governor CALIFORNIA ENERGY COMMISSION

    E-Print Network [OSTI]

    of California's Water Conservation Standards for Residential Clothes Washers DOE Docket Number EERMPET100 Standards for Residential Clothes Washers DOE Docket Number EERMPET100 Dear Ms. Edwards-Jones, I enclose and the Rebuttal Comments to California.Petition@ee.doe.gov as well as to Messrs. Berringer, DePriest, and Mc

  4. Lipschitz conformal immersions from degenerating Riemann surfaces with L2

    E-Print Network [OSTI]

    Rivière, Tristan

    (I.1) we can define the Gauss map as being the following measurable map in L () taking values and |dn|2 g dvolg canonical metric gRm of Rm . This energy E can be hence seen as being the Dirichlet Energy of the Gauss map n with respect to the induced

  5. ROCKY MOUNTAIN Research Station

    E-Print Network [OSTI]

    proceedings Homes and wildfire Forest Service program descriptions . . . and much more Hot off the press://www.fs.fed.us/rm/main/pubs/ hotoffpress.html How to Order . . . With imprinted name label on order card: Without name label on order card: RMRS-GTR-105). label. 2. If ordering former INT or RM reports, 2. Follow steps 1, 2, and 3 previous

  6. Energy Data Sourcebook for the U.S. Residential Sector

    E-Print Network [OSTI]

    Wenzel, T.P.

    2010-01-01T23:59:59.000Z

    10 with: area in ft uvalue in Btu/hr-F-ft slope in F-day/yrperimeter in ft, uvalue in Btu/hr-F-ft slope in F-day/yrheater w/fan RM AFUE Btu/hr Gas RM 74 AFUE >42000

  7. Neutron star-black hole mergers with a nuclear equation of state and neutrino cooling: Dependence in the binary parameters

    E-Print Network [OSTI]

    Francois Foucart; M. Brett Deaton; Matthew D. Duez; Evan O'Connor; Christian D. Ott; Roland Haas; Lawrence E. Kidder; Harald P. Pfeiffer; Mark A. Scheel; Bela Szilagyi

    2014-06-19T23:59:59.000Z

    We present a first exploration of the results of neutron star-black hole mergers using black hole masses in the most likely range of $7M_\\odot-10M_\\odot$, a neutrino leakage scheme, and a modeling of the neutron star material through a finite-temperature nuclear-theory based equation of state. In the range of black hole spins in which the neutron star is tidally disrupted ($\\chi_{\\rm BH}\\gtrsim 0.7$), we show that the merger consistently produces large amounts of cool ($T\\lesssim 1\\,{\\rm MeV}$), unbound, neutron-rich material ($M_{\\rm ej}\\sim 0.05M_\\odot-0.20M_\\odot$). A comparable amount of bound matter is initially divided between a hot disk ($T_{\\rm max}\\sim 15\\,{\\rm MeV}$) with typical neutrino luminosity $L_\

  8. Time-Dependent CP Violation Effects in Partially Reconstructed $B^0 \\to D^* ?$ Decays

    E-Print Network [OSTI]

    T. Gershon; for the Belle Collaboration

    2005-07-08T23:59:59.000Z

    We report measurements of time-dependent decay rates for $B^0 \\to D^{*\\mp} \\pi^\\pm$ decays and extraction of CP violation parameters related to $\\phi_3$. We use a partial reconstruction technique, whereby signal events are identified using information only from the primary pion and the charged pion from the decay of the $D^{*\\mp}$. The analysis uses $140 {\\rm fb}^{-1}$ of data accumulated at the $\\Upsilon(4S)$ resonance with the Belle detector at the KEKB asymmetric-energy $e^{+}e^{-}$ collider. We measure the CP violation parameters $S^+ = 0.035 \\pm 0.041 ({\\rm stat}) \\pm 0.018 ({\\rm syst})$ and $S^- = 0.025 \\pm 0.041 ({\\rm stat}) \\pm 0.018 ({\\rm syst})$.

  9. MULTI-FREQUENCY POLARIMETRY TOWARD S5 0836+710: A POSSIBLE SPINE-SHEATH STRUCTURE FOR THE JET

    SciTech Connect (OSTI)

    Asada, Keiichi; Nagai, Hiroshi [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Sagamihara, Kanagawa 229-8510 (Japan); Nakamura, Masanori [Department of Physics and Astronomy, The Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States); Inoue, Makoto [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, Taipei 10617, Taiwan (China); Kameno, Seiji, E-mail: asada@asiaa.sinica.edu.t [Department of Physics, Faculty of Science, Kagoshima University, 1-21-35 Korimoto, Kagoshima 890-0065 (Japan)

    2010-09-01T23:59:59.000Z

    We perform multi-frequency polarimetry toward 0836+710 using data from the Very Long Baseline Array. These observations allow us to measure both the distributions of the polarization position angle and the Faraday rotation measure (RM). We find a systematic gradient in the RM distribution as has been reported in several observations of relativistic jets emanating from active galactic nuclei. The RM corresponds to the line-of-sight component of the magnetic field. Thus, a systematic gradient of the RM along the transverse direction of the jet implies the existence of helical magnetic components associated with the jet itself. We derive the pitch angle of the helical magnetic field independently from the distribution of the projected magnetic field and from the RM data. Their discrepancies can be understood in a spine/sheath structure of the jet.

  10. On the Common Envelope Efficiency

    E-Print Network [OSTI]

    Zuo, Zhao-Yu

    2014-01-01T23:59:59.000Z

    In this work, we try to use the apparent luminosity versus displacement (i.e., $L_{\\rm X}$ vs. $R$) correlation of high mass X-ray binaries (HMXBs) to constrain the common envelope (CE) efficiency $\\alpha_{\\rm CE}$, which is a key parameter affecting the evolution of the binary orbit during the CE phase. The major updates that crucial for the CE evolution include a variable $\\lambda$ parameter and a new CE criterion for Hertzsprung gap donor stars, both of which are recently developed. We find that, within the framework of the standard energy formula for CE and core definition at mass $X=10$\\%, a high value of $\\alpha_{\\rm CE}$, i.e., around 0.8-1.0, is more preferable, while $\\alpha_{\\rm CE}alpha_{\\rm CE}$. ...

  11. A low-$z$ test for interacting dark energy

    E-Print Network [OSTI]

    Goncalves, R S; Alcaniz, J S

    2015-01-01T23:59:59.000Z

    A non-minimal coupling between the dark matter and dark energy components may offer a way of solving the so-called coincidence problem. In this paper we propose a low-$z$ test for such hypothesis using measurements of the gas mass fraction $f_{\\rm{gas}}$ in relaxed and massive galaxy clusters. The test applies to any model whose dilution of dark matter is modified with respect to the standard $a^{-3}$ scaling, as usual in interacting models, where $a$ is the cosmological scale factor. We apply the test to current $f_{\\rm{gas}}$ data and perform Monte Carlo simulations to forecast the necessary improvements in number and accuracy of upcoming observations to detect a possible interaction in the cosmological dark sector. Our results show that improvements in the present relative error $\\sigma_{\\rm{gas}}/f_{\\rm{gas}}$ are more effective to achieve this goal than an increase in the size of the $f_{\\rm{gas}}$ sample.

  12. Towards the cosmological constant problem

    E-Print Network [OSTI]

    Eun Kyung Park; Pyung Seong Kwon

    2014-12-15T23:59:59.000Z

    We apply a new self-tuning mechanism to the well-known Kachru-Kallosh-Linde-Trivedi (KKLT) model to address the cosmological constant problem. In this mechanism the cosmological constant $\\lambda$ contains a supersymmetry breaking term ${\\mathcal E}_{\\rm SB}$ besides the usual scalar potential ${\\mathcal V}_{\\rm scalar}$ of the $N=1$ supergravity, which is distinguished from the usual theories where $\\lambda$ is directly identified with ${\\mathcal V}_{\\rm scalar}$ alone. Also in this mechanism, whether $\\lambda$ vanishes or not is basically determined by the tensor structure of the scalar potential density, not by the zero or nonzero values of the scalar potential itself. As a result of this application we find that the natural scenario for the vanishing $\\lambda$ of the present universe is to take one of the AdS (rather than dS) vacua of KKLT as the background vacuum of our present universe. This AdS vacuum scenario does not suffer from the problematics of the dS vacua of KKLT. The background vacuum is stable both classically and quantum mechanically (no tunneling instabilities), and the value $\\lambda =0$ is also stable against quantum corrections because in this scenario the perturbative corrections of ${\\mathcal V}_{\\rm scalar}$ and quantum fluctuations $\\delta_Q {\\hat I}_{\\rm brane}^{(NS)} + \\delta_Q {\\hat I}_{\\rm brane}^{(R)}$ on the branes are all gauged away by an automatic cancelation between ${\\mathcal V}_{\\rm scalar} + \\delta_Q {\\hat I}_{\\rm brane}^{(NS)} + \\delta_Q {\\hat I}_{\\rm brane}^{(R)}$ and ${\\mathcal E}_{\\rm SB}$.

  13. From data to analysis: linking NWChem and Avogadro with the syntax and semantics of Chemical Markup Language

    SciTech Connect (OSTI)

    De Jong, Wibe A.; Walker, Andrew M.; Hanwell, Marcus D.

    2013-05-24T23:59:59.000Z

    Background Multidisciplinary integrated research requires the ability to couple the diverse sets of data obtained from a range of complex experiments and computer simulations. Integrating data requires semantically rich information. In this paper the generation of semantically rich data from the NWChem computational chemistry software is discussed within the Chemical Markup Language (CML) framework. Results The NWChem computational chemistry software has been modified and coupled to the FoX library to write CML compliant XML data files. The FoX library was expanded to represent the lexical input files used by the computational chemistry software. Conclusions The production of CML compliant XML files for the computational chemistry software NWChem can be relatively easily accomplished using the FoX library. A unified computational chemistry or CompChem convention and dictionary needs to be developed through a community-based effort. The long-term goal is to enable a researcher to do Google-style chemistry and physics searches.

  14. The production of brailled instructional materials in Texas public schools

    E-Print Network [OSTI]

    Stough, Laura

    2007-01-01T23:59:59.000Z

    T o In te in c T . S A the ar ail w f C ha deq th ey go B fro fo vi of that they produced received little atten- tio th Ch me ab Si Am Te lut the tan Th be am ma ag Co tio stu (2 ment of braille transcribers throughoutn in the research literature... pe Th tea Ca M th fu Fo be sh wh re pr ca wh er m re Al of im re lar th wi M de of br as fluent as those of teachers who use br is a Fo wh fiv tra Th .5 an th ac Ba stu or of br Ho ter wh sk (2 br ce sc an pr of na Un m de Ag er fic br nories greatly...

  15. Multi Module Modeling of Ultra-Relativistic Heavy Ion Collisions.

    SciTech Connect (OSTI)

    Magas, V. K.; Csernai, L. P. (Lszl P.); Keranen, A.; Manninen, J.; Strottman, D. D. (Daniel D.)

    2002-01-01T23:59:59.000Z

    Multi Module Model is required for the realistic and detailed description of an ultrarelativistic heavy ion reaction. We are working in the framework of such a model: initial stages are described by Effective String Rope Model with expanding final streaks; hydrodynamical approach is used for the intermediate stages. This paper is mainly devoted to Third Module - the one dealing with Freeze Out (FO). Two possibilities are discussed in details: (A) freeze out at the constant time hypersurface, where the statistical production model is used to describe post FO particle species; and (B) simultaneous hadronization and freeze out from supercooled QGP. For the last case the ALCOR-like algorithm for calculation of the post FO particle species is presented, due to the fact that these do not have time to reach chemical equilibrium.

  16. Using DUSTRAN to Simulate Fog-Oil Dispersion and Its Impacts on Local Insect Populations at Ft. Hood: Final Report

    SciTech Connect (OSTI)

    Rishel, Jeremy P.; Chapman, Elaine G.; Rutz, Frederick C.; Allwine, K Jerry

    2006-12-29T23:59:59.000Z

    Smokes and obscurants (S&O) are important screening agents used during military training exercises on many military installations. Although the use of S&O is subject to environmental laws, the fate and effects of S&O on natural habitats are not well documented. One particular concern is the impact S&O may have on local insect populations, which can be important components of terrestrial food chains of endangered species. Fog-oil (FO) is an S&O that is of particular concern. An important part of assessing potential ecosystem impacts is the ability to predict downwind FO concentrations. This report documents the use of the comprehensive atmospheric dispersion modeling system DUST TRANsport (DUSTRAN) to simulate the downwind transport and diffusion of a hypothetical FO release on the U.S. Army installation at Ft. Hood, TX.

  17. Corn versus three sorghums grown under the same dryland conditions as feeds for growing-finishing swine

    E-Print Network [OSTI]

    Meadows, Doyle Gene

    1974-01-01T23:59:59.000Z

    ), received the same fertilisation rate and. were cleaned prior to feeding. The four gra, ins and the diets in which they werc used were designated. : corn, non-yellow sorghum (N-Y), hetero-yellow sorghum (H-Y) and yellow sorghum (Y). The grains...-Y sorghum to S. 02fo for the N-Y sorghum. Lysinc content was higher in corn than the average of the sorghums (0. 25 us. 0. 22fo). Corn had a. slightly higher gross energy value (8. 97 kcal/g) than the average of the sorghums (g. 94 kcal/g) which resulted...

  18. Investigation of the Texas inlay bark grafting procedure

    E-Print Network [OSTI]

    Drews, David Bruce

    1983-01-01T23:59:59.000Z

    comb1ned the use of alum- inum fo11 and polyethylene bags to cover graft wounds. This was pre- formed at the 0. S. Gray nursery in Arlington, Texas in the mid 1950's (12, 69). Hancock (30) 1n 1967 described in detail the use of aluminum foil and a.... The white pa1nt over wax, and Yellow Cap treatment had signi- R ficantly lower max1mum hourly temperatures, and were not significantly different from the alum1num fo11 and polyethylene bag covering. The temperature parameter with the greatest meaning...

  19. The Water Rights Analysis Package Users Manual, Version 2.0

    E-Print Network [OSTI]

    Wurbs, Ralph A.

    the voluminous naturalized streamflow inflow IN records and evaporation EV records are stored in separate hydrology files, named root.FLO and root.EVA. The root.FLO filename for the flow (or inflow) file may also have the old INF version of the extension, root... be read from a BES file (filename root.BES), and ending storages may be written to the BES file. WRAP-SIM file options are specified on the file option FO record described later. The FO record is required if the default set of input files (DAT, FLO, EVA...

  20. The effect of dietary n-3 polyunsaturated fatty acids on T cell subset activation-induced cell death

    E-Print Network [OSTI]

    Switzer, Kirsten Collette

    2004-11-15T23:59:59.000Z

    oil (FO), which is enriched with the two n-3 polyunsaturated fatty acids (PUFA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). The majority of clinical studies have focused on the use of FO supplementation in rheumatoid arthritis... the methyl end. Of the n-3 PUFA class, EPA (20:5n-3) and DHA are found in cold-water fatty fish while alphalinolenic acid (ALA, 18:3n-3) is found in green leafy vegetables, and walnut and flaxseed oils. n-6 PUFA are primarily found in animal fats...