Powered by Deep Web Technologies
Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Aeromagnetic Survey At Kilauea Southwest Rift And South Flank Area (Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,SaveWhiskeyEnergyAd-VentaAddisonInformationInformation1986)


Direct-Current Resistivity At Kilauea Southwest Rift And South Flank Area  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie County,|Open Energy(Thomas,


Mercury Vapor At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonaldInformation Lahaina-Kaanapali Area1979)


Mercury Vapor At Lahaina-Kaanapali Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonaldInformation Lahaina-Kaanapali Area (Thomas,


Water Sampling At Kauai Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt LakeWashtenaw County, Michigan:OpenInformationArea


NREL: Biomass Research - Thomas Foust  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Photo of Thomas Foust Dr. Thomas Foust is an internationally recognized expert in the biomass field. His areas of expertise include feedstock production, biomass-to-fuels...


Aeromagnetic Survey At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergy Information Lightning Dock Area (Cunniff & Bowers,


Gas Flux Sampling At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewickiMaui Area (DOE GTP)


Gas Flux Sampling At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewickiMaui Area


Gas Flux Sampling At Olowalu-Ukumehame Canyon Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewickiMaui AreaEnergy


Optical Diagnostics Thomas Tsang  

E-Print Network [OSTI]

Optical Diagnostics Thomas Tsang · tight environment · high radiation area · non-serviceable area · passive components · optics only, no active electronics · transmit image through flexible fiber bundle #12;New imaging fiber bundle Core size: 12 µm, diameter: 1/8" Optical Diagnostics Total fiber counts ~50

McDonald, Kirk


Thomas Davis  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLas ConchasPassiveSubmittedStatus TomAboutManusScienceThe43068 -Vanadium25,RenewableThomThomas


Plasma Transport at the Magnetospheric Flank Boundary. Final report  

SciTech Connect (OSTI)

Progress is highlighted in these areas: 1. Model of magnetic reconnection induced by three-dimensional Kelvin Helmholtz (KH) modes at the magnetospheric flank boundary; 2. Quantitative evaluation of mass transport from the magnetosheath onto closed geomagnetic field for northward IMF; 3. Comparison of mass transfer by cusp reconnection and Flank Kelvin Helmholtz modes; 4. Entropy constraint and plasma transport in the magnetotail - a new mechanism for current sheet thinning; 5. Test particle model for mass transport onto closed geomagnetic field for northward IMF; 6. Influence of density asymmetry and magnetic shear on (a) the linear and nonlinear growth of 3D Kelvin Helmholtz (KH) modes, and (b) three-dimensional KH mediated mass transport; 7. Examination of entropy and plasma transport in the magnetotail; 8. Entropy change and plasma transport by KH mediated reconnection - mixing and heating of plasma; 9. Entropy and plasma transport in the magnetotail - tail reconnection; and, 10. Wave coupling at the magnetospheric boundary and generation of kinetic Alfven waves.

Otto, Antonius



Western Area Power Administration (WFP) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

future. Western Area Power Administration Responsible Contacts Thomas Wheeler Director, Workforce Analysis & Planning Division E-mail thomas.wheeler@hq.doe.gov Phone (202)...


Kilauea Southwest Rift And South Flank Geothermal Area | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6Kentwood, Michigan: EnergyKesonaKeystone,Kiel is a


Kilauea Southwest Rift And South Flank Geothermal Area | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6Kentwood, Michigan: EnergyKesonaKeystone,Kiel is


Magnetotellurics At Kilauea Southwest Rift And South Flank Area (Laney,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAKGalway Bay(Held & Henderson, 2012)Information|


Thomas Dixon's War Prayers  

E-Print Network [OSTI]

on pp. 236-37). New Perspectives on The War-Prayer Essayson The War-Prayer Thomas Dixon, Jr. , Dixons Sermons:New Perspectives on The War-Prayer Essays on The War-

Capozzola, Christopher



Thomas Reddinger Director, Steam  

E-Print Network [OSTI]

Thomas Reddinger Director, Steam Operations Steven Richards Assistant Manager of Maintenance (Distribution) Deborah Moorhead Office Coordinator III Martin Bower Steam Plant Operator Richard Redfield Steam Plant Operator Bohdan Sawa Steam Plant Operator Robert Tedesco Steam Plant Operator James Bradley

Raina, Ramesh


Thomas Reddinger Director, Steam  

E-Print Network [OSTI]

Thomas Reddinger Director, Steam Operations Steven Richards Assistant Manager of Maintenance Bourdon Steam Plant Operator Vincent Massara Steam Plant Operator Cliff Lescenski Steam Plant Operator Robert Tedesco Steam Plant Operator James Bradley Equipment Maintenance Robert Earle Equipment

Mather, Patrick T.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Open Energy Info (EERE)

as part of a continuing effort to better understand how the rocks will behave during hydraulic and thermal stimulation. Well 34A-9 is the hottest well at depth in the East Flank,...


St. Thomas More College St. Thomas More College (STM)  

E-Print Network [OSTI]

leaders that will, in turn, build a more just and sustainable society. For those who so desire, we offerSt. Thomas More College #12;St. Thomas More College (STM) You can take STM classes as part of your U of S degree program even if you are not an STM student. 2 | St. Thomas More College University

Saskatchewan, University of


The Terry Thomas  

High Performance Buildings Database

Seattle, WA The Terry Thomas was designed to provide a healthy and creative work environment that would illustrate the possibilities of sustainable design. The project was driven by a future tenant who needed a new office space to accommodate a rapidly expanding architectural practice. The firm wanted to remain in the same neighborhood where it had operated for seventeen years, yet in a building that would exemplify commitment to sustainable design. The Terry Thomas is located in Seattle's up-and-coming South Lake Union neighborhood, adjacent to downtown.


Thomas Weaver art director  

E-Print Network [OSTI]

, G'04, Jeff Wakefield photography Steven Alvarez, Raj Chawla, Alain Denis, Michael Lewis, Shayne Lynn Theresa Miller Vermont Quarterly 86 South Williams Street Burlington, VT 05401 (802) 656-1100 theresa South Williams Street Burlington, VT 05401 (802) 656-2005 thomas.weaver@uvm.edu vermont Quarterly

Hayden, Nancy J.


Thomas Reddinger Director, Steam  

E-Print Network [OSTI]

Thomas Reddinger Director, Steam Operations Steven Richards Assistant Manager of Maintenance Supervisor (Distribution) Deborah Moorhead Office Coordinator III Martin Bower Steam Plant Operator Richard Redfield Steam Plant Operator SU Steam Station/Chilled Water Plant Bohdan Sawa Steam Plant Operator Robert

McConnell, Terry


Automatic Fracture Reduction Thomas Albrecht and Thomas Vetter  

E-Print Network [OSTI]

Automatic Fracture Reduction Thomas Albrecht and Thomas Vetter University of Basel Abstract. We segmented from CT scans. The result of this virtual fracture reduction is intended to be used an operation plan. We propose to achieve automatic fracture reduction by fitting the bone fragments

Vetter, Thomas


Thomas Johnson, Jr | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Thomas Johnson, Jr About Us Thomas Johnson, Jr, Director - Office of Environmental Management's Recovery Act Program Most Recent Celebrating Successes of Environmental Management...


Thomas Wallner | Argonne National Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3,ScienceThomas P.ThomasThomas


Thomas M. Stricker Currivitae Page 1 of 4 Name: Thomas Martin Stricker  

E-Print Network [OSTI]

Thomas M. Stricker Currivitae Page 1 of 4 Name: Thomas Martin Stricker Born: June 6, 1963 supercomputer, developed as a joint project of CMU, ARPA, SPAWAR and Intel Corporation. Thomas M. Stricker­2580 tomstr@cs.cmu.edu Curriculum vitae March 5, 1996 #12; Thomas M. Stricker Currivitae Page 2 of 4 1991

Shewchuk, Jonathan


M.T. Thomas Recipient Named | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

M.T. Thomas Recipient Named M.T. Thomas Recipient Named EMSL Recognizes Patrick Roach for Postdoc Achievement Dr. Patrick Roach Patrick Roach, now an environmental scientist at...



Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergy Cooperation |South Valley ResponsibleSubmissionofDepartmentNo.7-052 ofFocusAREA FAQ #


Thomas Wallner | Argonne National Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3,ScienceThomas P.Thomas


Caribbean House Hilory Thomas, `14  

E-Print Network [OSTI]

Caribbean House Hilory Thomas, `14 College of Arts and Sciences Biochemistry #12;Overview of the Program The aim of the Caribbean House is to better inform and enhance individual's knowledge about the Caribbean islands and their characteristics. The program also aims to bring together diverse individuals

Hayden, Nancy J.


VEE-0032- In the Matter of Thomas Oil Company  

Broader source: Energy.gov [DOE]

On September 13, 1996, Thomas Oil Company (Thomas Oil) filed an Application for Exception with the Office of Hearings and Appeals (OHA) of the Department of Energy (DOE). In its application, Thomas...


Thomas Jefferson High School for Science & Technology National...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Thomas Jefferson High School for Science & Technology National Science Bowl Champion Thomas Jefferson High School for Science & Technology National Science Bowl Champion May 2,...


Thomas Jefferson High School takes regional Science Bowl competition...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Science Bowl Results: Thomas Jefferson High School for Science and Technology The Thomas Jefferson High School for Science and Technology Science Bowl 2005 team includes (front...


Dynamic Complexity Theory Revisited Volker Weber Thomas Schwentick  

E-Print Network [OSTI]

Dynamic Complexity Theory Revisited Volker Weber Thomas Schwentick Fachbereich Informatik, Universit¨at Dortmund D-44227 Dortmund, Germany {Volker.Weber,Thomas.Schwentick}@udo.edu Abstract Dynamic

Schwentick, Thomas


Thomas Edison vs. Nikola Tesla | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Thomas Edison vs. Nikola Tesla Thomas Edison vs. Nikola Tesla Addthis Duration 46:00 Topic Alternative Fuel Vehicles Renewables Smart Grid Transmission Innovation...



Open Energy Info (EERE)

FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF THE COSO GEOTHERMAL FIELD Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Proceedings: IN SITU STRESS,...


Time-Domain Electromagnetics At Kilauea Southwest Rift And South Flank Area  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump JumpAl., 1978)Tillman County, Oklahoma:Open

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Optical Diagnostics Hg_jet_meeting, 01-18-05 Thomas Tsang  

E-Print Network [OSTI]

Optical Diagnostics Hg_jet_meeting, 01-18-05 Thomas Tsang · tight environment · high radiation area · non-serviceable area · passive components · optics only, no active electronics · back illuminated with a single fiber laser - pulsed laser X · transmit image through flexible fiber bundle #12;Optical

McDonald, Kirk


Thomas Johnson | Department of Energy  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of Energyof theRestorationAdvisoryManagement and on theof EnergyBowl®Thomas


NREL: Energy Analysis - Thomas Jenkin  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the Contributions and Achievements ofLiz Torres Photo of LizSchwabeTechnologyThomas


Thomas Peterka | Argonne National Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3,ScienceThomas P.


Profile for Thomas Charles Terwilliger  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1 - SeptemberMicroneedles for4-16Hamada wins Gerald HahnThomas Charles Terwilliger


Independent Oversight Inspection, Thomas Jefferson National Accelerator Facility- August 2008  

Broader source: Energy.gov [DOE]

Inspection of Environment, Safety and Health Programs at the Thomas Jefferson National Accelerator Facility


A Poisson Fishing Model1 Thomas S. Ferguson, 08/30/942  

E-Print Network [OSTI]

A Poisson Fishing Model1 Thomas S. Ferguson, 08/30/942 Abstract: A fishing model of Starr, Wardrop an arbitrary joint distribution of capture times and fish sizes. Implications to the foraging models of Oaten, the fishing problem, the proofreading problem, auditing, foraging, search, etc. Authors in different areas

Ferguson, Thomas S.



E-Print Network [OSTI]

in the American option valuation. We illustrate that the proposed method on aver- age solves a discretized problem curve. American option valuation has been an active research area; many methods have been proposedA NEWTON METHOD FOR AMERICAN OPTION PRICING THOMAS F. COLEMAN, YUYING LI, AND ARUN VERMA December

Li, Yuying


Off-Policy Actor-Critic Thomas Degris thomas.degris@inria.fr  

E-Print Network [OSTI]

Off-Policy Actor-Critic Thomas Degris thomas.degris@inria.fr Flowers Team, INRIA, Talence, ENSTA the first actor-critic al- gorithm for off-policy reinforcement learning. Our algorithm is online work on actor-critic algorithms is lim- ited to the on-policy setting and does not take advantage

Paris-Sud XI, Université de


Genetic diversity in chlorella viruses flanking kcv, a gene that encodes a potassium ion channel protein  

E-Print Network [OSTI]

Genetic diversity in chlorella viruses flanking kcv, a gene that encodes a potassium ion channel Received 23 March 2004; accepted 27 May 2004 Abstract The chlorella virus PBCV-1 encodes a 94-amino acid additional chlorella viruses and transcription in two of these viruses, as well as the effect of the three

Graves, Michael V.



E-Print Network [OSTI]

Chapter GS FORT UNION COAL IN THE GREATER GREEN RIVER BASIN, EAST FLANK OF THE ROCK SPRINGS UPLIFT 1999 Resource assessment of selected Tertiary coal beds and zones in the Northern Rocky in the toolbar to return. 1999 Resource assessment of selected Tertiary coal beds and zones in the Northern Rocky


Thomas Jefferson National Accelerator Facility  

SciTech Connect (OSTI)

The Thomas Jefferson National Accelerator Facility (Jefferson Lab) in Newport News, Virginia, USA, is one of ten national laboratories under the aegis of the Office of Science of the U.S. Department of Energy (DOE). It is managed and operated by Jefferson Science Associates, LLC. The primary facility at Jefferson Lab is the Continuous Electron Beam Accelerator Facility (CEBAF) as shown in an aerial photograph in Figure 1. Jefferson Lab was created in 1984 as CEBAF and started operations for physics in 1995. The accelerator uses superconducting radio-frequency (srf) techniques to generate high-quality beams of electrons with high-intensity, well-controlled polarization. The technology has enabled ancillary facilities to be created. The CEBAF facility is used by an international user community of more than 1200 physicists for a program of exploration and study of nuclear, hadronic matter, the strong interaction and quantum chromodynamics. Additionally, the exceptional quality of the beams facilitates studies of the fundamental symmetries of nature, which complement those of atomic physics on the one hand and of high-energy particle physics on the other. The facility is in the midst of a project to double the energy of the facility and to enhance and expand its experimental facilities. Studies are also pursued with a Free-Electron Laser produced by an energy-recovering linear accelerator.

Joseph Grames, Douglas Higinbotham, Hugh Montgomery



A model-dye comparison experiment in the tidal mixing front zone on the southern flank of Georges Bank  

E-Print Network [OSTI]

A model-dye comparison experiment in the tidal mixing front zone on the southern flank of Georges; revised 8 June 2007; accepted 30 October 2007; published 9 February 2008. [1] A process-oriented model-dye the observed movement of dye across the tidal mixing front on the southern flank of Georges Bank during 22

Chen, Changsheng


Direct Deposit When Message Passing meets Shared Thomas M. Stricker  

E-Print Network [OSTI]

Direct Deposit ­ When Message Passing meets Shared Memory Thomas M. Stricker May 19, 2000 CMU-CS-96 Copyright c by Thomas M. Stricker Supported in part by the Defense Advanced Research Projects Agency


Direct Deposit --When Message Passing meets Shared Thomas M. Stricker  

E-Print Network [OSTI]

Direct Deposit -- When Message Passing meets Shared Memory Thomas M. Stricker May 19, 2000 CMU Copyright c flby Thomas M. Stricker Supported in part by the Defense Advanced Research Projects Agency


2012 Annual Planning Summary for Thomas Jefferson Site Office  

Broader source: Energy.gov [DOE]

The ongoing and projected Environmental Assessments and Environmental Impact Statements for 2012 and 2013 within Thomas Jefferson Site Office.


Self Potential At Haleakala Volcano Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation, search Name:Open Energy InformationInformation


Self Potential At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation, search Name:Open Energy| Open


Soil Sampling At Molokai Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation,PvtSouthInformationIInformation1979) |


Mercury Vapor At Haleakala Volcano Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonald isMelletteEnclosed

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mercury Vapor At Kawaihae Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonald isMelletteEnclosedInformation


Mercury Vapor At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonaldInformationEnergy Information Mickey


Aeromagnetic Survey At Kawaihae Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,SaveWhiskeyEnergyAd-VentaAddisonInformationInformation


Water Sampling At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt LakeWashtenaw County,Energy Information


Water Sampling At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt LakeWashtenaw County,Energy


Geothermometry At Kawaihae Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformation Mexico - AInformation Hot Springs


Geothermometry At Kilauea East Rift Geothermal Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformation Mexico - AInformation Hot SpringsEnergy


Geothermometry At Lahaina-Kaanapali Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformation Mexico - AInformation Hot


Geothermometry At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformation Mexico - AInformation Hot2010)


Refraction Survey At Kilauea East Rift Geothermal Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, search RAPIDColoradosourceRausWyoming:Reeves County,Ltd,Al.,1979) |


Aeromagnetic Survey At Hualalai Northwest Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 SouthWaterBrasil Jump to:IowaResource(Nannini, 1986) JumpEnergyEnergy


Aeromagnetic Survey At Kilauea East Rift Geothermal Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 SouthWaterBrasil Jump to:IowaResource(Nannini, 1986) JumpEnergyEnergy1995)


Aeromagnetic Survey At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 SouthWaterBrasil Jump to:IowaResource(Nannini, 1986)Information Mokapu


Field Mapping At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 NoSanEnergy Information 4) JumpJemez Pueblo


Field Mapping At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 NoSanEnergy Information 4) JumpJemezInformation


Ground Gravity Survey At Mokapu Penninsula Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place:Net Jump to: navigation,2004) | OpenEnergy


Static Temperature Survey At Molokai Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd JumpGTZHolland,0162112°,St.StanlyEnergy InformationEpp,


Thermal Gradient Holes At Hualalai Northwest Rift Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to:InformationTheInformationAl.,Open Energy


Time-Domain Electromagnetics At Haleakala Volcano Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump JumpAl., 1978)Tillman County, Oklahoma:Open Energy


Brain Evolution Relevant to P. Thomas Schoenemann  

E-Print Network [OSTI]

Brain Evolution Relevant to Language P. Thomas Schoenemann James Madison University 1. Introduction The evolution of language obviously presupposes a brain that made language possible. At the same time, given of the human brain must have been language. Given that language is at least as much a cultural

Schoenemann, P. Thomas

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Manufacturing Thomas W. Eagar, Guest Editor  

E-Print Network [OSTI]

Materials Manufacturing Thomas W. Eagar, Guest Editor The bth.n-ior of succl'ssful manufac- tunn;imos., tmironment for mate- nab manufacturing changes, so too does our mla~un ol mattrials performance~(vtr. as shown by Figure 1, there are senral additional dimensions to perfor- mann. In particular, successful

Eagar, Thomas W.


On Infinitely Nested Radicals Brian Thomas  

E-Print Network [OSTI]

On Infinitely Nested Radicals Brian Thomas 1. Introduction #12;In "On Infinitely Nested Radicals nested radicals are explored. One example of a nested radical is the Golden Ratio, , which can be written as: (1.1) . . . Many questions arise from the study of nested radicals, such as: 1. What can we say

Morrow, James A.


Conformal Mapping in Wing Aerodynamics Thomas Johnson  

E-Print Network [OSTI]

Conformal Mapping in Wing Aerodynamics Thomas Johnson June 4, 2013 Contents 1 Introduction 1 2 the first complete treatment of conformal mapping in aerodynamics. Near the beginning of the twentieth and aerodynamics. The purpose of this exposition is to give the reader an elementary intro- duction to the use

Morrow, James A.


Scientific Foundations of Computer Graphics Thomas Larsson  

E-Print Network [OSTI]

Scientific Foundations of Computer Graphics Thomas Larsson Department of Computer Engineering M It is apparent that computer graphics has become a well-known tech- nology that is used in a broad spectra and medical science the importance of computer graphics is evident. But what are the scientific foundations

Larsson, Thomas


aBubbleTree? Thomas H. Parker  

E-Print Network [OSTI]

on Rn \\ {0}. That limit loses energy. A bubble tree is a way of recovering the lost energy by keepingaBubbleTree? Thomas H. Parker 666 NOTICES OF THE AMS VOLUME 50, NUMBER 6 Some of the most important for functions u on a domain in R2, which arises as the variational equation of the energy (2) E(u) = |du|2 dvol

Parker, Thomas H.


Thomas H. Cormen Charles E. Leiserson  

E-Print Network [OSTI]

-0-262-03384-8 (hardcover : alk. paper)--ISBN 978-0-262-53305-8 (pbk. : alk. paper) 1. Computer programming. 2. Computer algorithms. I. Cormen, Thomas H. QA76.6.I5858 2009 005.1--dc22 2009008593 10 9 8 7 6 5 4 3 2 1 #12 implementation in practice. Parallel computers--computers with multiple processing units--have become

Leiserson, Charles E.


Thomas Jefferson High School for Science & Technology Wins...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wins Virginia Regional Science Bowl; St. Christopher's School, Richmond, Takes Second NEWPORT NEWS, Va., Feb. 27, 2010 - The Thomas Jefferson High School for Science and Technology...


Thomas Jefferson High School for Science & Technology wins...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Science Bowl. Winning the daylong academic competition was the Thomas Jefferson High School for Science and Technology, from Alexandria, Va. Following in second place was the...


Thomas Jefferson High School for Science & Technology Takes 2015...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Takes 2015 Virginia Science Bowl 2014 Virginia High School Science Bowl The team from Thomas Jefferson High School for Science and Technology, Alexandria, swept through the...


Thomas Jefferson High School for Science and Technology from...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of science and math questions and answers, the winning team was Thomas Jefferson High School for Science and Technology from Alexandria. Team captain and high school senior,...


10 Questions for an Automotive Engineer: Thomas Wallner | Department...  

Broader source: Energy.gov (indexed) [DOE]

Argonne mechanical engineer Thomas Wallner adjusts Argonne's "omnivorous engine," an automobile engine that Wallner and his colleagues have tailored to efficiently run on blends of...


Thomas J. Impelluso Professor, Bergen University College, Norway  

E-Print Network [OSTI]

Thomas J. Impelluso Professor, Bergen University College, Norway Math, Motion, and Visualization and in Norway. Center for Research in Mathematics and Science Education #12;

Gallo, Linda C.


VBH-0005- In the Matter of Thomas Dwyer  

Broader source: Energy.gov [DOE]

This Decision involves a whistleblower complaint filed by Thomas Dwyer under the Department of Energy's (DOE) Contractor Employee Protection Program. From January 1996 to October 1997, Mr. Dwyer...


Characterization of a geothermal system in the Upper Arkansas Valley, CO Thomas Blum*, Kasper van Wijk and Lee Liberty, Boise State University  

E-Print Network [OSTI]

Characterization of a geothermal system in the Upper Arkansas Valley, CO Thomas Blum*, Kasper van a geothermal system in the Mt. Princeton area. We conclude that a shallow orthogonal fault system in this area appears to be responsible for the local geothermal signature at and near the surface. The extent to which


Single element changes in electrical networks Thomas Berger,  

E-Print Network [OSTI]

University of Technology Page 2 / 13 #12;Example: electrical RLC network Z(s)i(s) = vs(s), Z(s) = s-1 1 C1Single element changes in electrical networks Thomas Berger, George Halikias and Nicos Karcanias, 2012 Single element changes in electrical networks Thomas Berger, George Halikias and Nicos Karcanias



Single element changes in electrical networks Thomas Berger,  

E-Print Network [OSTI]

, Ilmenau University of Technology Page 2 / 13 #12;Example: electrical RLC network Z(s)i(s) = vs(s), ZSingle element changes in electrical networks Thomas Berger, George Halikias and Nicos Karcanias, February 23, 2012 Single element changes in electrical networks Thomas Berger, George Halikias and Nicos



Outdoor Virtual Reality Bruce H. Thomas and Wayne Piekarski  

E-Print Network [OSTI]

Outdoor Virtual Reality Bruce H. Thomas and Wayne Piekarski Wearable Computer Laboratory University of South Australia Mawson Lakes, SA 5095 Australia Bruce.Thomas@unisa.edu.au Wayne@cs.unisa.edu.au ABSTRACT or augmented beyond the user's normal experience, and increase understanding 226Copyright held by the author

Thomas, Bruce


Iterative Detection and Channel Estimation for Thomas Zemen  

E-Print Network [OSTI]

Iterative Detection and Channel Estimation for MC­CDMA Thomas Zemen Siemens Austria, PSE PRO RCD Erdbergerl?ande 26 A­1031 Vienna, Austria E­mail: thomas.zemen@siemens.com Joachim Wehinger, Christoph wireless communication systems. Their equalization is based on the fast Fourier transform, allowing

Müller, Ralf R.


Iterative Detection and Channel Estimation for Thomas Zemen  

E-Print Network [OSTI]

Iterative Detection and Channel Estimation for MC-CDMA Thomas Zemen Siemens Austria, PSE PRO RCD Erdbergerl¨ande 26 A-1031 Vienna, Austria E-mail: thomas.zemen@siemens.com Joachim Wehinger, Christoph communication systems. Their equalization is based on the fast Fourier transform, allowing for an efficient

Zemen, Thomas


Interacting viscous instabilities in microfluidic systems Thomas Cubaud*a  

E-Print Network [OSTI]

Interacting viscous instabilities in microfluidic systems Thomas Cubaud*a and Thomas G. Mason, evolution, and stability of microfluidic flows involving two or more miscible fluids that have different viscosities. When two liquids that have widely different viscosities are injected into a rigid microfluidic

Cubaud, Thomas

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thomas selected as American Chemical Society Fellow  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLas ConchasPassiveSubmittedStatus TomAboutManusScienceThe43068G. Thundat (2005)>Thomas


ORISE: Faculty Research Experiences - Dr. Thomas Liu  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the ContributionsArms Control R&DNuclear fuelOPTICS FORJoetheCareersThomas Liu


Evolution of the Size and Functional Areas  

E-Print Network [OSTI]

Evolution of the Size and Functional Areas of the Human Brain P. Thomas Schoenemann Department-6570/06/1021-0379$20.00 Key Words neuroanatomy, encephalization, behavior, adaptation, selection Abstract The human brain to understand basic principles of brain evolution that appear to operate across broad classes of organisms

Schoenemann, P. Thomas


Dissolved inorganic carbon isotopic composition of low-temperature axial and ridge-flank hydrothermal fluids of the Juan de Fuca Ridge  

E-Print Network [OSTI]

carbon isotopic composition of low-temperature axial and ridge-flank hydrothermal fluids of the Juan deDissolved inorganic carbon isotopic composition of low-temperature axial and ridge-flank hydrothermal fluids of the Juan de Fuca Ridge Brett D. Walker a,, Matthew D. McCarthy a , Andrew T. Fisher b

Fisher, Andrew


VBA-0005- In the Matter of Thomas Dwyer  

Broader source: Energy.gov [DOE]

This Decision considers an Appeal of an Initial Agency Decision (IAD) issued on May 2, 2000, involving a complaint filed by Thomas Dwyer (Dwyer or the complainant) under the Department of Energy ...


Thomas Jefferson High School for Science & Technology Snaps Up...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Up Virginia Science Bowl Championship; Virginia Beach Schools Take 2nd, 3rd Place High School Science Bowl 1st Place The Thomas Jefferson High School for Science and Technology...


Thomas Jefferson High School for Science & Technology wins...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Bowl February 15, 2006 TJHSST Finishing in first place at the Virginia Regional High School Science Bowl was the team from the Thomas Jefferson High School for Science and...



Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site



Thomas Carlyle and the making of Frederick the Great  

E-Print Network [OSTI]

Thomas Carlyles History of Friedrich II. of Prussia, called Frederick the Great was published in six volumes between 1858 and 1865 and was his last major work. Carlyle had a specific purpose in mind when he began writing ...

Stewart, Linda Clark



A taxonomy of granular partitions Thomas Bittner and Barry Smith  

E-Print Network [OSTI]

A taxonomy of granular partitions Thomas Bittner and Barry Smith Qualitative Reasoning Group. In Smith and Brogaard (2000) the notion of granular partition was introduced as a generalization of David

Forbus, Kenneth D.


A Theory of Granular Partitions Thomas Bittner and Barry Smith  

E-Print Network [OSTI]

CHAPTER 7 A Theory of Granular Partitions Thomas Bittner and Barry Smith Institute for Formal of part and whole relations (Smith, 1998) as a framework for ontological theorizing. Mereology is better

Bittner, Thomas


VWA-0018- In the Matter of Thomas T. Tiller  

Broader source: Energy.gov [DOE]

This Decision concerns two whistleblower complaints filed by Thomas T. Tiller (Tiller) under the Department of Energys (DOE) Contractor Employee Protection Program, 10 C.F.R. Part 708. At all...


Thermal cracking in disc brakes Thomas J. Mackin *,1  

E-Print Network [OSTI]

Thermal cracking in disc brakes Thomas J. Mackin *,1 , Steven C. Noe, K.J. Ball, B.C. Bedell, D, or hub, which is connected to the wheel and axle, and an inboard and outboard braking surface

Salvaggio, Carl


Exhumation, rift-flank uplift, and the thermal evolution of the Rwenzori Mountains determined by combined (U-Th)/He and U-Pb thermochronometry  

E-Print Network [OSTI]

Rising over 5 km along the border of Uganda and the Democratic Republic of the Congo, the Rwenzori Mountains represent an extreme example of basement rift-flank uplift in the western branch of the East African Rift, a ...

MacPhee, Daniel



The evolution of nuclear microsatellite DNA markers and their flanking regions using reciprocal comparisons within the African mole-rats (Rodentia: Bathyergidae)  

E-Print Network [OSTI]

and molecular data. Using mitochondrial and nuclear DNA, a robust phylogeny was generated for the Bathyergidae. From my results, I proposed the new genus, Coetomys. I designed species-specific genotyping and microsatellite flanking sequence (MFS) primers...

Ingram, Colleen Marie



Wind Power Opportunities in St. Thomas, USVI: A Site-Specific...  

Energy Savers [EERE]

Wind Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis Wind Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis Utilizes...


Bounded-Variable Fragments of Hybrid Logics Thomas Schwentick and Volker Weber  

E-Print Network [OSTI]

Bounded-Variable Fragments of Hybrid Logics Thomas Schwentick and Volker Weber Fachbereich Informatik, Universit¨at Dortmund, Germany {thomas.schwentick,volker.weber}@udo.edu Abstract. Hybrid logics

Schwentick, Thomas


Modeling atmospheric effects of the September 1859 solar flare B. C. Thomas,1  

E-Print Network [OSTI]

], as well as much higher energy events such as gamma-ray bursts [Thomas et al., 2005]. We briefly describe

Jackman, Charles H.


Museum security and the Thomas Crown Affair.  

SciTech Connect (OSTI)

Over the years, I've daydreamed about stealing a Vermeer, a Picasso, or Rembrandt. It tickles me, as much as watching the reboot of The Thomas Crown Affair. Why is it, do you suppose, so much fun to think about stealing a world renowned piece off the wall of a major metropolitan museum? Is it the romantic thoughts of getting away with it, walking past infrared detectors, and pressure sensors ala Indiana Jones with the sack of sand to remove the idol without triggering the security system? Is it the idea of snatching items with such fantastic prices, where the romance of possessing an item of such value is less intoxicating than selling it to a private collector for it to never be seen again? I suspect others share my daydreams as they watch theater or hear of a brazen daylight heist at museums around the world, or from private collections. Though when reality sets in, the mind of the security professional kicks in. How could one do it, why would one do it, what should you do once it's done? The main issue a thief confronts when acquiring unique goods is how to process or fence them. They become very difficult to sell because they are one-of-a-kind, easy to identify, and could lead to the people involved with the theft. The whole issue of museum security takes up an ironic twist when one considers the secretive British street artist 'Banksy'. Banksy has made a name for himself by brazenly putting up interesting pieces of art in broad daylight (though many critics don't consider his work to be art) on building walls, rooftops, or even museums. I bring him up for a interesting take on what may become a trend in museum security. In March of 2005, Banksy snuck a piece of his called 'Vandalized Oil Painting' into the Brooklyn Museum's Great Historical Painting Wing, plus 3 other pieces into major museums in New York. Within several days, 2 paintings had been torn down, but 2 stayed up much longer. In his home country of the UK, a unauthorized piece he created and placed in the British Museum known as 'Early Man Goes to Market' received different treatment when placed inside the walls. It was adopted into the permanent collection! I like his story because it's so counter-intuitive. Who would have thought that modern museum security might involve preventing people not just from stealing art, but from sneaking 'unauthorized' art into museums? What is next, tampering with the archive records in order to make it look like the piece in question has always been there? To learn more about museum security, I interviewed multiple experts in the field. It turns out that the glamorous lifestyle of Thomas Crown is not particularly relevant. In fact, usually nobody can point to a Mr. Big of the underworld coordinating thefts, though some organized crime families have been known to use stolen art as black market chips to trade. The common consensus among experts in the field of art theft is that, instead of most high-value pieces being stolen by outsiders with a blue print in hand and rappelling from a ceiling skylight, in reality, 80 percent of art thefts involve insiders or accomplices that execute the crime over a period of time while working or volunteering in the museum. Indeed, according to FBI statistics, between 70 and 80 percent of all solved art theft cases involve insider participation of some kind, yet according to Tom Cremers of the Musuem Security Network, 'Having been involved in risk assessments in over hundreds of museums over the past ten years, it is quite astonishing how rarely the risk of insider participation is discussed.' In regards to the insider threat, a museum is not much different from any corporation or other organization. There are directors, employees, interns, and cleaning staff (very often outsourced), security guards (again outsourced, typically with very high turnover rates). Unlike corporations, most museums also have volunteer staff, docents, and authorized visiting scholars. All these people can potentially take advantage of their position, or to be exploited by a clever attacker on the outside or insid

Michaud, E. C. (Nuclear Engineering Division)



A Synthetic Approach to Stop Codon Scanning Mutagenesis Lihua Nie, Jason Lavinder, Mohosin Sarkar, Kimberly Stephany and Thomas J. Magliery*  

E-Print Network [OSTI]

Sarkar, Kimberly Stephany and Thomas J. Magliery* Departments of Chemistry and Biochemistry, The Ohio

Magliery, Thomas J.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Human Factors Aspects of Power System Voltage Visualizations Douglas A. Wiegmann Aaron M. Rich Thomas J. Overbye Yan Sun  

E-Print Network [OSTI]

Thomas J. Overbye Yan Sun Institute of Aviation Institute of Aviation Elect. & Comp. Eng. Elect. & Comp


Online Learning of Spacecraft Simulation Models Justin Thomas  

E-Print Network [OSTI]

Online Learning of Spacecraft Simulation Models Justin Thomas United Space Alliance 600 Gemini to the dynamic and complex behav- ior of the International Space Station (ISS). To address this problem, this paper introduces a unique and efficient method for continuously learning highly accurate models from

Eick, Christoph F.


Greenland's Pressure Drag and the Atlantic Storm Track THOMAS JUNG  

E-Print Network [OSTI]

Greenland's Pressure Drag and the Atlantic Storm Track THOMAS JUNG European Centre for Medium of Greenland on the Northern Hemisphere wintertime circulation are discussed. Inviscid pressure drag on Greenland's slopes, calculated from reanalysis data, is related to circulation patterns. Greenland lies


On the singularity of valuating IT security investments Thomas Neubauer  

E-Print Network [OSTI]

On the singularity of valuating IT security investments Thomas Neubauer Secure Business Austria identifies criteria for proper IT security evaluation methods from literature and evaluates some selected methods in order to show their applicability in practice. A focus of this evaluation lies


Dr. Thomas A. Siewert IN-SPACE WELDING  

E-Print Network [OSTI]

) ) Dr. Thomas A. Siewert IN-SPACE WELDING Visions & Realities presented to Thirtieth Space This paperestablishes the value of having an in-space welding capability and identifies its applications, both near, Plasma Arc, and Laser Beam, are examined against the criteria for an in-space welding system. Research

Eagar, Thomas W.


Tamara I. Ahrens & Thomas H. Lee Center for Integrated Systems  

E-Print Network [OSTI]

of Electrical Engineering Stanford University Ring Oscillator vs. LC Oscillator Ring Oscillator: Dissipates allTamara I. Ahrens & Thomas H. Lee Center for Integrated Systems Department of Electrical Engineering Stanford University Tamara I. Ahrens Center for Integrated Systems Department of Electrical Engineering

Lee, Thomas H.


Learning to Rank and Quadratic Assignment Thomas Mensink  

E-Print Network [OSTI]

Learning to Rank and Quadratic Assignment Thomas Mensink TVPA - XRCE & LEAR - INRIA Grenoble NICTA Sydney, Australia Abstract In this paper we show that the optimization of several ranking of quadratic assignment problems. Both the task of test-time predic- tion of the best ranking and the task

Paris-Sud XI, Université de


Geodesic Regression on Riemannian Manifolds P. Thomas Fletcher  

E-Print Network [OSTI]

Geodesic Regression on Riemannian Manifolds P. Thomas Fletcher School of Computing, University a manifold-valued random variable and a real-valued independent parameter. The principle is to fit a geodesic is evaluated as the sum-of-squared geodesic distances from the model to the data, and this provides

Boyer, Edmond


Weighted Parametric Operational Hydrology Forecasting Thomas E. Croley II1  

E-Print Network [OSTI]

1 Weighted Parametric Operational Hydrology Forecasting Thomas E. Croley II1 1 Great Lakes forecasts in operational hydrology builds a sample of possibilities for the future, of climate series from-parametric method can be extended into a new weighted parametric hydrological forecasting technique to allow


Statement of Thomas E. Mason Director, Oak Ridge National Laboratory  

E-Print Network [OSTI]

Statement of Thomas E. Mason Director, Oak Ridge National Laboratory Before the Subcommittee Director of the U.S. Department of Energy's Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, the Oak Ridge fusion program has drawn on the diverse resources afforded by ORNL's standing


Environmental Governance: An Economic Perspective Thomas P. Lyon  

E-Print Network [OSTI]

1 Environmental Governance: An Economic Perspective Thomas P. Lyon Forthcoming in Magali Delmas University Press. 1. Introduction From an economic perspective, it is natural to think of the "demand of as coming from government in the form of legislation and regulation, outcomes of the political process

Lyon, Thomas P.


Discriminative frequent subgraph mining with optimality guarantees Marisa Thoma  

E-Print Network [OSTI]

processes, such as active or inactive in an anti- cancer screen, toxic or non-toxic to human beings [21Discriminative frequent subgraph mining with optimality guarantees Marisa Thoma Hong Cheng Arthur July 7, 2010 Abstract The goal of frequent subgraph mining is to detect subgraphs that frequently occur

Kriegel, Hans-Peter


ELECTRONIC ATTACKS Thomas M. Chen, Southern Methodist University  

E-Print Network [OSTI]

1 Chapter 74 ELECTRONIC ATTACKS Thomas M. Chen, Southern Methodist University Matthew C. Elder An understanding of electronic attacks is an essential prerequisite to building strong cyber defenses. This chapter gives an overview of the major electronic attacks encountered today, proceeding through the basic steps

Chen, Thomas M.


Human-Automation Interaction By Thomas B. Sheridan & Raja Parasuraman  

E-Print Network [OSTI]

89 CHAPTER 2 Human-Automation Interaction By Thomas B. Sheridan & Raja Parasuraman Automation does with automation in complex and typically large-scale systems, including aircraft and air traffic control, nuclear-free task for either the system designer or the human operator/automation supervisor, especially as computer

Parasuraman, Raja


Updated 1-12 Thomas H. Killion, Ph.D.  

E-Print Network [OSTI]

of Transition in July 2012. Dr. Killion is responsible for policy, planning, resourcing and execution managementUpdated 1-12 Thomas H. Killion, Ph.D. Director of Transition Office of Naval Research Initially joining ONR, Dr. Killion was the Director, Biometrics Identity Management Agency (BIMA), staring


Harvesting to Get a Eucalyptus Coppice Thomas F Geary2  

E-Print Network [OSTI]

Harvesting to Get a Eucalyptus Coppice Crop1 Thomas F Geary2 When eucalyptus trees are felled, new stems often grow from the stumps to produce another crop of trees. This new crop is called the coppice crop to distinguish it from the seed- ling crop. Coppice crops can be important in growing eucalypts

Standiford, Richard B.


Thomas Banks Santa Cruz Institue for Particle Physics (SCIPP)  

E-Print Network [OSTI]

PROFESSIONAL PREPARATION Reed College Physics/Math B.A. 1969 Massachusetts Institute of Technology Physics PhThomas Banks Santa Cruz Institue for Particle Physics (SCIPP) UC Santa Cruz Department of Physics of Physics, University of California, Santa Cruz 1989-present Professor of Physics, Rutgers University 1986

California at Santa Cruz, University of


Just War and Robots' Killings Thomas W. Simpson  

E-Print Network [OSTI]

1 Just War and Robots' Killings Thomas W. Simpson Associate Professor of Philosophy and Public Policy, Blavatnik School of Government, University of Oxford Vincent C. Müller Professor of Philosophy the technology can satisfy the requirements of a fair re-distribution of risk. #12;2 1. Introduction Rich

Wallace, Mark


Deep Web Integration with VisQI Thomas Kabisch  

E-Print Network [OSTI]

Deep Web Integration with VisQI Thomas Kabisch Humboldt-Universit¨at zu Berlin Berlin, Germany of Deep Web sources. Building sys- tems which would be able to automatically use all or a large fraction of all Deep Web sources of a given domain, such as airline reservation in the USA, would offer great

Meng, Weiyi


Compound and Elemental Analysis At Kilauea Southwest Rift And South Flank  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD)2010)2008)|Zealand|Area

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Teleseismic-Seismic Monitoring At Kilauea Southwest Rift And South Flank  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump to:Taos County,Tees Valley BiofuelsEnergyInformationArea


Updated 1-12 Thomas L. Frankfurt  

E-Print Network [OSTI]

Executive Officers and the Director of the Naval Nuclear Propulsion Program. From 2004 to 2006, he in the areas of government contract law, fiscal law, civilian personnel law, ethics, FOIA/Privacy Act, #12;Updated 1-12 environmental law, and litigation relating to the procurement and maintenance of the Navy


A review of "Thomas Browne" edited by Kevin Killeen  

E-Print Network [OSTI]

marks an important contribution to the revival of interest in a writer whose work, while long admired, had been largely relegated by the academy to the category of literary curiosity (according to the editors of Sir Thomas Browne: The World Proposed... unto me at nights till she read them all out (in Keynes (ed.), Miscellaneous Writings (1931), 29596). Recent work on book and reading history has made such documents far more interesting than they were once considered, and this (rather dauntingly...

Black, Joseph L.



INSIDE Waitt Advanced Biophotonics Center Grand Opening One on One with...Thomas Albright REMEMBERINGWylie  

E-Print Network [OSTI]

INSIDE Waitt Advanced Biophotonics Center Grand Opening One on One with...Thomas Albright Discovery of plant proteins may boost agricultural yields and biofuel production 20 Complex wiring

Bellugi, Ursula


E-Print Network 3.0 - anthony thomas address Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

. Anthony Kay (School of Mathematics, University of Loughborough) 6 th Feb. How Cyclones Form in Rotating... . Peter J. Thomas (School of Engineering, ext. 22200, email:...


Generalized charge-screening in relativistic ThomasFermi model  

SciTech Connect (OSTI)

In this paper, we study the charge shielding within the relativistic Thomas-Fermi model for a wide range of electron number-densities and the atomic-number of screened ions. A generalized energy-density relation is obtained using the force-balance equation and taking into account the Chandrasekhar's relativistic electron degeneracy pressure. By numerically solving a second-order nonlinear differential equation, the Thomas-Fermi screening length is investigated, and the results are compared for three distinct regimes of the solid-density, warm-dense-matter, and white-dwarfs (WDs). It is revealed that our nonlinear screening theory is compatible with the exponentially decaying Thomas-Fermi-type shielding predicted by the linear response theory. Moreover, the variation of relative Thomas-Fermi screening length shows that extremely dense quantum electron fluids are relatively poor charge shielders. Calculation of the total number of screening electrons around a nucleus shows that there is a position of maximum number of screening localized electrons around the screened nucleus, which moves closer to the point-like nucleus by increase in the plasma number density but is unaffected due to increase in the atomic-number value. It is discovered that the total number of screening electrons, (N{sub s}?r{sub TF}{sup 3}/r{sub d}{sup 3} where r{sub TF} and r{sub d} are the Thomas-Fermi and interparticle distance, respectively) has a distinct limit for extremely dense plasmas such as WD-cores and neutron star crusts, which is unique for all given values of the atomic-number. This is equal to saying that in an ultrarelativistic degeneracy limit of electron-ion plasma, the screening length couples with the system dimensionality and the plasma becomes spherically self-similar. Current analysis can provide useful information on the effects of relativistic correction to the charge screening for a wide range of plasma density, such as the inertial-confined plasmas and compact stellar objects.

Akbari-Moghanjoughi, M. [Department of Physics, Faculty of Sciences, Azarbaijan Shahid Madani University, 51745-406 Tabriz, Iran and International Centre for Advanced Studies in Physical Sciences and Institute for Theoretical Physics, Ruhr University Bochum, D-44780 Bochum (Germany)



Geology of the Middle Beaver Creek area, Mason and Gillespie Counties, Texas  

E-Print Network [OSTI]

AREA, NASGR AEG GILhNPIR COGRTIES, TEIAB ABSTRACT The Middle Beaver Creek area is situated on the soutlwsst flank of the Llano ?plift region in Mason and Gillespie Counties, Texas Hooks of Presa?brian, Psleosoie, Mesosois, and Genosois age... ' Figure 1. ? Map of' part of Mason and Gillespie Counties, Texass showing location of' the Middle Beaver Creek Area, on aoetats oosered aerial photographs. In order to aoourateIp locate and plot the oontaots asd faults, the photographs vere studies...

Peterson, Don Hamilton



UBC Social Ecological Economic Development Studies (SEEDS) Student Report Derek Guo, Drew Willms, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton  

E-Print Network [OSTI]

, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton UBC Botanical Garden Traffic System Re Group 19 Stuart Armstrong Thomas Denton Derek Guo KlimentKuzmanovski Ralph


Web Indexing on a Diet: Template Removal with the Sandwich Algorithm Tom Rowlands, Paul Thomas, and Stephen Wan  

E-Print Network [OSTI]

, and Stephen Wan CSIRO ICT Centre tom.rowlands@csiro.au, paul.thomas@csiro.au, stephen.wan@csiro.au AbstractWeb Indexing on a Diet: Template Removal with the Sandwich Algorithm Tom Rowlands, Paul Thomas

Thomas, Paul


A Reflexive Extension to Arachne's Aspect Language Nicolas Loriant Marc Segura-Devillechaise Thomas Fritz Jean-Marc Menaud  

E-Print Network [OSTI]

´egura-Devillechaise Thomas Fritz Jean-Marc Menaud OBASCO research group, EMN/INRIA - LINA, Nantes, France Software

Paris-Sud XI, Université de


Paul Thomas, TOFE, Nashville, August 2012 Page 1 The Impact of Burning Plasma on  

E-Print Network [OSTI]

Fuel Cycle Have tried to illustrate general effects using ITER design work. Will not talk about physics&CD and diagnostics #12;Page 4Paul Thomas, TOFE, Nashville, August 2012 Q = 10 vol. av. 66% alpha heating compared pass (thin pipe) low energy welding. #12;Page 7Paul Thomas, TOFE, Nashville, August 2012 Blanket Design


Michael O. Rabin Thomas J. Watson Sr. Research Professor of Computer Science  

E-Print Network [OSTI]

Michael O. Rabin Thomas J. Watson Sr. Research Professor of Computer Science Harvard University 1964-66 Chairman, Institute of Mathematics, Hebrew University 1970-71 Chairman, Computer Science Science, Harvard University 1983-2012 Thomas J. Watson Sr. Professor of Computer Science, Harvard


Usability and Playability Issues for ARQuake Bruce Thomas, Nicholas Krul, Benjamin Close and Wayne Piekarski  

E-Print Network [OSTI]

1 Usability and Playability Issues for ARQuake Bruce Thomas, Nicholas Krul, Benjamin Close: #12;2 Bruce Thomas, Nicholas Krul, Benjamin Close and Wayne Piekarski the see-through display allows to walk through the information space. 5) The user interface additionally requires only a simple hand-held

Thomas, Bruce


Mawl: Integrated Web and Telephone Service Creation David Atkins, Thomas Ball*  

E-Print Network [OSTI]

Mawl: Integrated Web and Telephone Service Creation David Atkins, Thomas Ball* Thomas Baran in a device- independent manner. PML is a markup language and middleware for controlling and pro- gramming language separates the speci cation of service logic from the speci cation of the user interface

Atkins, David


A Comparison of Methods for Sizing Energy Storage Devices in Renewable Energy Systems Thomas Bailey  

E-Print Network [OSTI]

A Comparison of Methods for Sizing Energy Storage Devices in Renewable Energy Systems by Thomas of Methods for Sizing Energy Storage Devices in Renewable Energy Systems by Thomas Bailey B.Eng, University, storage technologies are proposed as a means to increase the penetration of renewable energy, to minimize

Victoria, University of


Security for Downloadable Automotive Services Stephan Merk*, Kathrin Scheidemann*, Michael Rudorfer*, Thomas Stauner*,  

E-Print Network [OSTI]

*, Thomas Stauner*, Johannes Grünbauer**, Gerhard Popp**, Guido Wimmel** *BMW Car IT GmbH, Petuelring 116, 80809 München, Germany [stephan.merk,kathrin.scheidemann,michael.rudorfer,thomas.stauner]@bmw to their environment and are even able to alter the whole system: adaptiveness can change the whole structure

Cengarle, María Victoria


Partially Implicit Motion of a Sharp Interface in Navier-Stokes Flow J. Thomas Beale  

E-Print Network [OSTI]

Partially Implicit Motion of a Sharp Interface in Navier-Stokes Flow J. Thomas Beale Department, Lowengrub and Shelley. This modified step is combined with the method of [J. T. Beale, A. T. Layton, 36]. Email address: beale@math.duke.edu (J. Thomas Beale) URL: www.math.duke.edu/faculty/beale (J


Thomas P. D'Agostino | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy Usage »of EnergyThe EnergyDepartment7 th , 2007 Anthony J. ComoFanSteam37Thomas


Thomas Harrison Middle School Wind Project | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark JumpDetective JumpInc., 2010) |Thesee JumpTholen &Thomas


M.T. Thomas Award Call for Nominations | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and InterfacesAdministration -Lowell L. Wood, 1981Future4: WellsM.T. Thomas

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


M.T. Thomas Award for Outstanding Postdoctoral Achievement | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLas Conchas recovery challenge fund Las ConchasTrail of a martian20085816M.T. Thomas Award


Retrieval of subpixel snow covered area, grain size, and albedo from MODIS Thomas H. Painter a,  

E-Print Network [OSTI]

the energy and mass balance of the snow cover are its spatial extent and albedo (Blschl, 1991; Dozier a Department of Geography, University of Utah, Salt Lake City, UT 84112, USA b Donald Bren School

Dozier, Jeff


Direct-Current Resistivity At Haleakala Volcano Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie County,| OpenEnergy


Direct-Current Resistivity At Honokowai Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie County,|


Direct-Current Resistivity At Hualalai Northwest Rift Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie County,|Open Energy


Direct-Current Resistivity Survey At Honokowai Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie County,|OpenOpenAl.,Energy


Direct-Current Resistivity Survey At Kawaihae Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie


Direct-Current Resistivity Survey At Mauna Loa Northeast Rift Area (Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie(FURUMOTO, 1976) |2005)1986) |


Direct-Current Resistivity Survey At Mokapu Penninsula Area (Thomas, 1986)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1Dering Harbor, NewRidge,Dinwiddie(FURUMOTO, 1976) |2005)1986)


Ground Gravity Survey At Kilauea East Rift Geothermal Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:Greer County is a county inAl., 1979) | Open EnergyOpen Energy


Groundwater Sampling At Kilauea East Rift Geothermal Area (Cox & Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:Greer County is a county inAl., 1979) |Haar,ManagementClimate


Micro-Earthquake At Kilauea East Rift Geothermal Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: Energy Resources JumpMicrel Inc JumpOpen Energy2010) | Open


Self Potential At Hualalai Northwest Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation, search Name:Open Energy


Self Potential At Mauna Loa Southwest Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation, search Name:Open Energy| Open EnergyEnergy


Mercury Vapor At Hualalai Northwest Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonald isMelletteEnclosedInformation Hualalai


Mercury Vapor At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonald


Mercury Vapor At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonaldInformation Lahaina-Kaanapali


Mercury Vapor At Olowalu-Ukumehame Canyon Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowellisMcDonaldInformationEnergy Information


Water Sampling At Hualalai Northwest Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt LakeWashtenaw County, Michigan:Open EnergyInformation


Water Sampling At Kilauea East Rift Geothermal Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt LakeWashtenaw County,

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gas Flux Sampling At Haleakala Volcano Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewicki &| Open


Gas Flux Sampling At Hualalai Northwest Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewicki &| OpenEnergy


Gas Flux Sampling At Kawaihae Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewicki &| OpenEnergyKawaihae


Gas Flux Sampling At Kilauea East Rift Geothermal Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewicki &|


Gas Flux Sampling At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, search Equivalent6894093° Loading69. ItLewicki


Direct-Current Resistivity At Kawaihae Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type Term


Direct-Current Resistivity At Lahaina-Kaanapali Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen Energy Information


Direct-Current Resistivity At Lualualei Valley Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen Energy InformationEnergy


Direct-Current Resistivity Survey At Haleakala Volcano Area (Thomas, 1986)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen EnergyEnergy2002) || Open


Direct-Current Resistivity Survey At Hualalai Northwest Rift Area (Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen EnergyEnergy2002) || Open1986)


Direct-Current Resistivity Survey At Lahaina-Kaanapali Area (Thomas, 1986)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen EnergyEnergy2002) ||1979) ||


Direct-Current Resistivity Survey At Lualualei Valley Area (Thomas, 1986) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen EnergyEnergy2002) ||1979)Open


Direct-Current Resistivity Survey At Mauna Loa Southwest Rift Area (Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has Type TermOpen EnergyEnergy2002)


Field Mapping At Olowalu-Ukumehame Canyon Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 NoSanEnergy Information 4)Open


Thermal Gradient Holes At Kilauea East Rift Geothermal Area (Thomas, 1986)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to:InformationTheInformationAl.,Open Energy|


Time-Domain Electromagnetics At Hualalai Northwest Rift Area (Thomas, 1986)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump JumpAl., 1978)Tillman County, Oklahoma:Open Energy| Open


Time-Domain Electromagnetics At Kilauea East Rift Geothermal Area (Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump JumpAl., 1978)Tillman County, Oklahoma:Open Energy|1974)


Time-Domain Electromagnetics At Mauna Loa Northeast Rift Area (Thomas,  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump JumpAl., 1978)Tillman County, Oklahoma:Open(Nordquist,


Field Mapping At Kilauea East Rift Geothermal Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37.California: EnergyFeilden Clegg BradleyFerrotec68-1971)OpenEnergy

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Geology of the Salt Creek area, Mason County, Texas  

E-Print Network [OSTI]

and to the entrapment of. surface water in the fractures. GEOLXiBPBOLOGY The Salt Creek area in @aeon County, Texas is located on the southwestern flank of the Llano Uplift, a structural dome which has been reduced to a topographic basin by erosional processes.... STSUCT "SALCEOL00Y IIegional Structure The Llano region, which includes the Salt Creek area, is a structural dome which has been reduced to a topographic basin by erosional processes. The dose is roughly elliptical with a maximum diameter...

Harwood, William Eugene



A Tony Thomas-Inspired Guide to INSPIRE  

SciTech Connect (OSTI)

The SPIRES database was created in the late 1960s to catalogue the high energy physics preprints received by the SLAC Library. In the early 1990s it became the first database on the web and the first website outside of Europe. Although indispensible to the HEP community, its aging software infrastructure is becoming a serious liability. In a joint project involving CERN, DESY, Fermilab and SLAC, a new database, INSPIRE, is being created to replace SPIRES using CERN's modern, open-source Invenio database software. INSPIRE will maintain the content and functionality of SPIRES plus many new features. I describe this evolution from the birth of SPIRES to the current day, noting that the career of Tony Thomas spans this timeline.

O'Connell, Heath B.; /Fermilab



Is Artificial Intelligence (AI) possible? Thomas Bolander, Associate Professor, DTU Informatics  

E-Print Network [OSTI]

Alan Turing 1950 paper: · Can machines think? · How are we to check? · Difficult, but this we can check. · Task of the judge: who's who among computer and human? Alan Turing, 1954 Thomas Bolander, Science

Bolander, Thomas


Implication of Tsallis entropy in the ThomasFermi model for self-gravitating fermions  

SciTech Connect (OSTI)

The ThomasFermi approach for self-gravitating fermions is revisited within the theoretical framework of the q-statistics. Starting from the q-deformation of the FermiDirac distribution function, a generalized ThomasFermi equation is derived. It is shown that the Tsallis entropy preserves a scaling property of this equation. The q-statistical approach to Jeans instability in a system of self-gravitating fermions is also addressed. The dependence of the Jeans wavenumber (or the Jeans length) on the parameter q is traced. It is found that the q-statistics makes the Fermionic system unstable at scales shorter than the standard Jeans length. -- Highlights: ThomasFermi approach for self-gravitating fermions. A generalized ThomasFermi equation is derived. Nonextensivity preserves a scaling property of this equation. Nonextensive approach to Jeans instability of self-gravitating fermions. It is found that nonextensivity makes the Fermionic system unstable at shorter scales.

Ourabah, Kamel; Tribeche, Mouloud, E-mail: mouloudtribeche@yahoo.fr



STAMP-Based Analysis of a Refinery Overflow Accident Nancy Leveson, Margaret Stringfellow, and John Thomas  

E-Print Network [OSTI]

1 STAMP-Based Analysis of a Refinery Overflow Accident Nancy Leveson, Margaret Stringfellow, and John Thomas As an example of STAMP, we have taken an accident report produced for a real refinery

Leveson, Nancy


Communicated by P. M. A. Tigerstedt B. R. Thomas ( ) ' S. E. Macdonald  

E-Print Network [OSTI]

Communicated by P. M. A. Tigerstedt B. R. Thomas ( ) ' S. E. Macdonald Department of Renewable. E. Macdonald ' M. Hicks D. L. Adams ' R. B. Hodgetts Effects of reforestation methods on genetic

Macdonald, Ellen


Thomas Jefferson High School Wins Virginia Science Bowl for 7th...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NEWPORT NEWS, Va., Feb. 20, 2008 - The Thomas Jefferson High School for Science and Technology team pummeled its competition at the Virginia Regional Science Bowl held Feb. 2 at...


VWA-0018- Deputy Secretary Decision- In the Matter of Thomas T. Tiller  

Broader source: Energy.gov [DOE]

This is a request for review by complainant Thomas T. Tiller of an Initial Agency Decision, issued by the Office of Hearings and Appeals (OHA), denying the two reprisal complaints that he filed...


Adaptive Temporal Tone Mapping Shaun David Ramsey, J. Thomas Johnson III, Charles Hansen  

E-Print Network [OSTI]

University of Utah, Salt Lake City, Utah, USA Abstract Monitor intensity ranges are much lower than the rangeAdaptive Temporal Tone Mapping Shaun David Ramsey, J. Thomas Johnson III, Charles Hansen

Utah, University of


Nearly Singular Integrals in 3D Stokes Flow Svetlana Tlupova1,, J. Thomas Beale2  

E-Print Network [OSTI]

Nearly Singular Integrals in 3D Stokes Flow Svetlana Tlupova1,, J. Thomas Beale2 1 Department. Email addresses: stlupova@umich.edu (S. Tlupova), beale@math.duke.edu (J. T. Beale) http



E-Print Network [OSTI]

A METHOD FOR COMPUTING NEARLY SINGULAR INTEGRALS J. THOMAS BEALE AND MING-CHIH LAI SIAM J. NUMER Department, Duke University, Durham, NC 27708-0320 (beale@math.duke.edu). The research of this author

Lai, Ming-Chih


Thomas Rotation and Polarised Light: A non-Abelian Geometric Phase in Optics  

E-Print Network [OSTI]

We describe a non-Abelian Berry phase in polarisation optics, suggested by an analogy due to Nityananda between boosts in special relativity and the effect of elliptic dichroism on polarised light. The analogy permits a simple optical realization of the non-Abelian gauge field describing Thomas rotation. We also show how Thomas rotation can be understood geometrically on the Poincar\\'{e} sphere in terms of the Pancharatnam phase.

Joseph Samuel; Supurna Sinha



Providing a Digital Voice for Storytellers in Africa Gary Marsden, Ilda Ladeira, Thomas Reitmaier, Nicola J Bidwell and Edwin  

E-Print Network [OSTI]

Providing a Digital Voice for Storytellers in Africa Gary Marsden, Ilda Ladeira, Thomas Reitmaier, Nicola J Bidwell and Edwin Blake Abstract

Blake, Edwin


UBC Social Ecological Economic Development Studies (SEEDS) Student Report Derek Guo, Drew Willms, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton  

E-Print Network [OSTI]

, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton UBC Botanical Garden Development Plan Plan CIVL 445 Engineering Design and Analysis I Group 19 Stuart Armstrong Thomas Denton Derek Guo


An Architecture for Optimal AlltoAll Personalized Communication Susan Hinrichs, Corey Kosak, David R. O'Hallaron, Thomas M. Stricker, and Riichiro Take # \\Lambda  

E-Print Network [OSTI]

, David R. O'Hallaron, Thomas M. Stricker, and Riichiro Take # \\Lambda School of Computer Science Carnegie

Shewchuk, Jonathan


A review of "Borders and Travellers in Early Modern Europe" edited by Thomas Betteridge  

E-Print Network [OSTI]

worked from very similar assumptions about the need for hermeneutic stability. Thomas Betteridge, ed. Borders and Travellers in Early Modern Europe. Aldershot:: Ashgate, 2007. vi + 196 pp. $99.95. Review by Li n d a McJa n n e t , Be n t L e y un i v... e r s i t y . As described by editor Thomas Betteridge, Borders and Travellers in Early Modern Europe provides ?a trans-European interdisciplinary inter- rogation of borders and travel in early modern Europe? (12). Of the eleven essays...

McJannet, Linda



Thomas Jefferson National Accelerator Facility | U.S. DOE Office of Science  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticutPhotos of AECSign Up for(SC) Thomas(SC) Thomas


Research Areas  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearch Welcome toResearch Areas Our Vision National User Facilities


Research Areas  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearch Welcome toResearch Areas Our Vision National User


Limit theory for the sample autocorrelations and extremes of a GARCH(1,1) Thomas Mikosch  

E-Print Network [OSTI]

Limit theory for the sample autocorrelations and extremes of a GARCH(1,1) process Thomas Mikosch theory for the sample autocorrelations and extremes of a GARCH(1; 1) process is provided. Special attention is given to the case when the sum of the ARCH and GARCH parameters is close to one, i.e. when one

Mikosch, Thomas

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Limit theory for the sample autocorrelations and extremes of a GARCH(1,1) Thomas Mikosch  

E-Print Network [OSTI]

Limit theory for the sample autocorrelations and extremes of a GARCH(1,1) process Thomas Mikosch for the sample autocorrelations and extremes of a GARCH(1;1) process is provided. Special attention is given to the case when the sum of the ARCH and GARCH parameters is close to one, i.e. when one is close

Mikosch, Thomas


UAV Formation Flight using 3D Potential Field Tobias Paul Thomas R. Krogstad Jan Tommy Gravdahl  

E-Print Network [OSTI]

UAV Formation Flight using 3D Potential Field Tobias Paul Thomas R. Krogstad Jan Tommy Gravdahl ESG aerial vehicles (UAVs). Based on a virtual leader approach, combined with an extended local potential a group of UAVs based on a simplified small-scale helicopter, which is simulated in MATLABTM /Simulink

Gravdahl, Jan Tommy


MEASURING REACTIVE MARKET POWER Fernando L. Alvarado Thomas Overbye Peter Sauer  

E-Print Network [OSTI]

MEASURING REACTIVE MARKET POWER Fernando L. Alvarado Thomas Overbye Peter Sauer The University-Hirschman Index) can be used to measure reactive power market concentration. The proposed method is illustrated by means of a simple example. Keywords: Electric power transmission, monopoly, mar- ket concentration. 1


Stroke amplifier for deformable mirrors Robert H. Webb, Marc J. Albanese, Yaopeng Zhou, Thomas Bifano, and  

E-Print Network [OSTI]

Stroke amplifier for deformable mirrors Robert H. Webb, Marc J. Albanese, Yaopeng Zhou, Thomas stroke of a deformable mirror. By arranging for the wavefront to traverse the deformable mirror more than to produce lower- cost mirrors. Unfortunately, most commercial MEMS mirrors have only a limited stroke


Top Stroke Rehabil 2013;20(4):299307 2013 Thomas Land Publishers, Inc.  

E-Print Network [OSTI]

299 Top Stroke Rehabil 2013;20(4):299­307 © 2013 Thomas Land Publishers, Inc. www stimulation (NMES) for recovery of hand function after stroke are not known. This clinical pilot study thenar muscles of 16 persons with chronic stroke. Participants were identified a priori as having a low

Griffin, Lisa


Meter Any Wire, Anywhere by Virtualizing the Voltage Channel Thomas Schmid, David Culler, Prabal Dutta  

E-Print Network [OSTI]

Meter Any Wire, Anywhere by Virtualizing the Voltage Channel Thomas Schmid, David Culler, Prabal}@eecs.umich.edu culler@cs.berkeley.edu Abstract AC power meters require both voltage and current to be sampled physical proximity and fed into a single power metering de- vice. In this paper, we explore the viability

Dutta, Prabal


The Java Machine Learning Library Thomas Abeel, Yvan Saeys and Yves Van de Peer  

E-Print Network [OSTI]

The Java Machine Learning Library Thomas Abeel, Yvan Saeys and Yves Van de Peer Department of Plant.abeel@psb.ugent.be What is Java-ML? Motivation Code & Documentation Applications 1. Machine learning techniques: · 18 style, no GUI 6. Open Source · Lack of a (good) machine learning library: · Reference implementations

Gent, Universiteit


"Self-Regulating Electricity Markets?" Nodir Adilov, Thomas Light, Richard Schuler, William Schulze, David Toomey &  

E-Print Network [OSTI]

"Self-Regulating Electricity Markets?" by Nodir Adilov, Thomas Light, Richard Schuler, William in electricity markets who can substitute part of their usage between day and night. Each customer's demand electricity markets be more self-regulating if we encourage customers to enter the game as active participants


INVERTIBLE FILTER BANKS ON THE 2-SPHERE B.T. Thomas Yeo Wanmei Ou Polina Golland  

E-Print Network [OSTI]

INVERTIBLE FILTER BANKS ON THE 2-SPHERE B.T. Thomas Yeo Wanmei Ou Polina Golland Computer Science to the sphere, many key challenges remain. In this paper, we develop conditions for the invertibility be incorpo- rated into the design of self-invertible axis-symmetric wavelets. Self- invertibility

Golland, Polina


Carbon Dioxide Information Analysis Center (CDIAC) PRINCIPAL INVESTIGATOR: Thomas A Boden (CDIAC Di-  

E-Print Network [OSTI]

Carbon Dioxide Information Analysis Center (CDIAC) PRINCIPAL INVESTIGATOR: Thomas A Boden (CDIAC Di of Biological and Environmental Research (BER) PARTNERS: National Aeronautic and Space Administra- tion's (NASA://cdiac.ornl.gov/ PROJECT DESCRIPTION The Carbon Dioxide Information Analysis Center (CDIAC) is the primary climate -change


Opportune maintenance and predictive maintenance decision support douard Thomas, ric Levrat, Benoit Iung, Pierre Cocheteux  

E-Print Network [OSTI]

: When to perform a particular maintenance action? What components should benefit from a preventive maintenance action? Which components should first benefit from a preventive maintenance interventionOpportune maintenance and predictive maintenance decision support ?douard Thomas, ?ric Levrat

Paris-Sud XI, Université de


Corrosion Damage Detection with Piezoelectric Wafer Active Sensors Dustin Thomas, John Welter  

E-Print Network [OSTI]

1 Corrosion Damage Detection with Piezoelectric Wafer Active Sensors Dustin Thomas, John Welter Air a priority issue for today's Air Force. One of the most critical structural problems is corrosion. In fact the KC-135 now costs $1.2 billion a year to repair corrosion. In this paper, we plan to show the use

Giurgiutiu, Victor


Biomass, Condition of Western Lake Erie Dreissenids Primary Investigator: Thomas Nalepa -NOAA GLERL (Emeritus)  

E-Print Network [OSTI]

Biomass, Condition of Western Lake Erie Dreissenids Primary Investigator: Thomas Nalepa - NOAA of dreissenid biomass but there are no current, accurate estimates of biomass in this portion of the lake. Biomass is calculated from abundances, size- frequencies, and length-weights. The goal of this project


Ignacio Corder, Universidad Catlica del Uruguay Thomas Schwarz,S.J., Universidad Catlica del Uruguay  

E-Print Network [OSTI]

Ignacio Corderí, Universidad Católica del Uruguay Thomas Schwarz,S.J., Universidad Católica del Uruguay AhmedAmer, Santa Clara University Darrell D. E. Long, UC Santa Cruz J.F. Pâris, University

Pâris, Jehan-François


Reaction-Diffusion Patterns in Smart Sensor Thomas C. Henderson, Ramya Venkataraman and Gyounghwa Choikim  

E-Print Network [OSTI]

Reaction-Diffusion Patterns in Smart Sensor Networks Thomas C. Henderson, Ramya Venkataraman and Gyounghwa Choikim School of Computing and Dept of Bioengineering University of Utah Salt lake City, Utah formation to support high-level tasks in smart sensor networks (S-Nets). This has led us to explore various

Henderson, Thomas C.


Smart Sensor Snow Thomas C. Henderson, Mohamed Dekhil, Scott Morris, Yu Chen and William B. Thompson  

E-Print Network [OSTI]

Smart Sensor Snow Thomas C. Henderson, Mohamed Dekhil, Scott Morris, Yu Chen and William B. Thompson Department of Computer Science University of Utah Salt Lake City, Utah 84112 Abstract We propose to them automat- ically and by means of a distributed algorithm. For ex- ample, given a 200 by 200 grid

Henderson, Thomas C.


Chaos in a Three-Species Food Chain Author(s): Alan Hastings and Thomas Powell  

E-Print Network [OSTI]

Chaos in a Three-Species Food Chain Author(s): Alan Hastings and Thomas Powell Source: Ecology, Vol on the screen or printed page of such transmission. JSTOR is a not-for-profit service that helps scholars(3), 1991, pp. 896-903 ?3 1991 bytheEcological SocietyofAmerica CHAOS IN A THREE-SPECIES FOOD CHAIN' ALAN

de Aguiar, Marcus A. M.



E-Print Network [OSTI]

NET FEEDING IN MESOPELAGIC FISHES THOMAS L. HOPKINS AND RONALD C. BAIRD! ABSTRACT In an investigation of n'et feeding, 11 species of fish (5 gonostomatids, 6 myctophids) captured in a double-net Tucker trawl were examined. Stomach contents of fish retained by a coarse mesh "fish- catcher" in one net


Zero electron kinetic energy spectroscopy of the ArCl anion Thomas Lenzer,a)  

E-Print Network [OSTI]

and the neutral complexes are observed in the ZEKE spectra. From our spectroscopic data we construct modelZero electron kinetic energy spectroscopy of the ArCl anion Thomas Lenzer,a) Ivan Yourshaw, Berkeley, California 94720 Received 19 January 1999; accepted 23 February 1999 Zero electron kinetic energy

Neumark, Daniel M.


Zero electron kinetic energy spectroscopy of the XeCl Thomas Lenzer,a)  

E-Print Network [OSTI]

measurements for the neutral state we construct a Morse­Morse-switching­van der Waals model potential functionZero electron kinetic energy spectroscopy of the XeCl? anion Thomas Lenzer,a) Ivan Yourshaw, Berkeley, California 94720 Received 9 November 2001; accepted 21 December 2001 Zero electron kinetic energy

Neumark, Daniel M.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Advancing beyond current generation dye-sensitized solar cells Thomas W. Hamann,ab  

E-Print Network [OSTI]

Advancing beyond current generation dye-sensitized solar cells Thomas W. Hamann,ab Rebecca A The most efficient dye-sensitized solar cells (DSSCs) have had essentially the same configuration on the fabrication and character- ization of new architectures for dye-sensitized solar cells. He now holds


Representing the past: fiction and history in Thomas Carlyle's Past and Present  

E-Print Network [OSTI]

In 1843-42 Thomas Carlyle wrote Past and Present in direct response to the political and social problems of his time. However, this book is by no means a straightforward social tract or political treatise. Instead, the presence of similar concerns...

Correll, Lori Lynne



Fraunhofer FOKUSCompetence Center NGNI Prof. Dr.-Ing. habil Thomas Magedanz  

E-Print Network [OSTI]

Fraunhofer FOKUSCompetence Center NGNI Overview ?berblick 1 Prof. Dr.-Ing. habil Thomas Magedanz Berlin, Germany Internet: www.av.tu-berlin.de Email: tm@cs.tu-berlin.de #12;Fraunhofer FOKUSCompetence and IT is fueling the innovation in Service Delivery Platforms and underlying networking infrastructures · IP

Wichmann, Felix


Multi Criteria Analysis for bioenergy systems assessments Thomas Buchholz a,, Ewald Rametsteiner b  

E-Print Network [OSTI]

Multi Criteria Analysis for bioenergy systems assessments Thomas Buchholz a,?, Ewald Rametsteiner b Available online 11 November 2008 Keywords: Multi Criteria Analysis Bioenergy Sustainability a b s t r a c t Sustainable bioenergy systems are, by definition, embedded in social, economic, and environmental contexts

Vermont, University of


A Review of "Sir Thomas Browne: The World Proposed" edited by Reid Barbour and Claire Preston  

E-Print Network [OSTI]

passage into what is surely one of the most important topics for readers of Milton. Reid Barbour and Claire Preston, eds. Sir Thomas Browne: The World Proposed. Oxford: Oxford University Press, 2008. xii + 368 pp. + 3 illus. $120.00. Review by joseph...

Black, Joseph



Capstone Senior Design 2012-13 EcoCAR2: Mechanical (1) Thomas Bradley  

E-Print Network [OSTI]

CAR2: Energy Storage (5) Thomas Bradley Formula SAE (6) Jack Clark/ Mitchell Stansloski Human Powered:Contin.Flow Ultrasonic Microalgae Harvesting Sys. (24)Anthony Marchese HydroTechnologies: Remote Operated Vehicle (25, construct, test, and install a vehicle control system Optimize energy management strategy while


Radiative heat transfer in a hydrous mantle transition zone Sylvia-Monique Thomas a,n  

E-Print Network [OSTI]

Radiative heat transfer in a hydrous mantle transition zone Sylvia-Monique Thomas a,n , Craig R contribute significantly to heat transfer in the mantle and demonstrate the importance of radiative heat, radiative heat transfer was considered relatively unimportant in the mantle. Earlier experimental work

Jacobsen, Steven D.


Breaking POET Authentication with a Single Query Jian Guo, Jeremy Jean, Thomas Peyrin, and Lei Wang  

E-Print Network [OSTI]

Breaking POET Authentication with a Single Query Jian Guo, J´er´emy Jean, Thomas Peyrin, and Lei article, we describe a very practical and simple attack on the au- thentication part of POET authenticated encryption mode proposed at FSE 2014. POET is a provably secure scheme that was designed to resist various


Augmented Foam Sculpting for Capturing 3D Models Michael R. Marner Bruce H. Thomas  

E-Print Network [OSTI]

Augmented Foam Sculpting for Capturing 3D Models Michael R. Marner Bruce H. Thomas University. A designer physically sculpts a 3D model from foam using a hand-held hot wire foam cut- ter. Both the foamD model from foam using a hand-held hot wire foam cutter. Both the foam and cutting tool are tracked

Thomas, Bruce


Speech Enhancement based on Smoothing of Spectral Noise HyoungGook Kim, Thomas Sikora  

E-Print Network [OSTI]

Speech Enhancement based on Smoothing of Spectral Noise Floor Hyoung­Gook Kim, Thomas Sikora presents robust speech enhancement using noise estimation based on smoothing of spectral noise floor (SNF for a nonstationary noise. Its enhanced speech is free of musical tones and reverberation artifacts and sounds very

Wichmann, Felix


The Energy Flux of Internal Gravity Waves in the Lower Solar Thomas Straus1  

E-Print Network [OSTI]

The Energy Flux of Internal Gravity Waves in the Lower Solar Atmosphere Thomas Straus1 , Bernhard waves as a key mediator of energy into the solar atmosphere. Subject headings: hydrodynamics ­ waves, can support and propagate gravity waves. On Earth these waves, which can transport energy and momentum


On the duration of the Paleocene-Eocene thermal maximum Ursula Rohl and Thomas Westerhold  

E-Print Network [OSTI]

On the duration of the Paleocene-Eocene thermal maximum (PETM) Ursula Ro¨hl and Thomas Westerhold of California, Santa Cruz, California 95064, USA [1] The Paleocene-Eocene thermal maximum (PETM) is one of global warming and a massive perturbation of the global carbon cycle from injection of isotopically light

Zachos, James


Multicomponent density-functional theory for electrons and nuclei Thomas Kreibich  

E-Print Network [OSTI]

Multicomponent density-functional theory for electrons and nuclei Thomas Kreibich Institut für a general multicomponent density-functional theory in which electrons and nuclei are treated completely , 71.10. w I. INTRODUCTION Density-functional theory DFT is among the most suc- cessful approaches

Gross, E.K.U.


On the computational power of photosynthesis Niall Murphy, Damien Woods and Thomas J. Naughton  

E-Print Network [OSTI]

On the computational power of photosynthesis Niall Murphy, Damien Woods and Thomas J. Naughton County Kildare, Ireland #12;Abstract We describe a simplified explanation of photosynthesis. We charac- terise the complexity of photosynthesis by interpreting its chemical equa- tion as a language acceptance

Murphy, Niall


Friction, Frontogenesis, and the Stratification of the Surface Mixed Layer LEIF THOMAS*  

E-Print Network [OSTI]

Friction, Frontogenesis, and the Stratification of the Surface Mixed Layer LEIF THOMAS* Department restratification resulting from frontogenesis in regions of confluent flow. Frictional forces acting of friction versus frontogenesis in the restratification of the mixed layer and are tested using numerical

Thompson, Andrew


Fiber coupling with adaptive optics for free-space optical communication Thomas Weyraucha  

E-Print Network [OSTI]

Fiber coupling with adaptive optics for free-space optical communication Thomas Weyraucha , Mikhail, Department of Manufacturing Engineering, Brookline, MA 02446 ABSTRACT We describe an adaptive optical fiber coupling system for free-space optical communication comprising a micro- electromechanical deformable


Thermodynamics and Kinetics of a Molecular Motor Ensemble Josh E. Baker* and David D. Thomas  

E-Print Network [OSTI]

Thermodynamics and Kinetics of a Molecular Motor Ensemble Josh E. Baker* and David D. Thomas is transferred to work is accelerated by the free energy of a motor-catalyzed reaction. This thermodynamic model cargo at useful rates along long polymer tracks, and, in this paper, we develop a minimal thermodynamic

Thomas, David D.


The new woman punished: Thomas Hardy's heroines and happiness in Victorian England  

E-Print Network [OSTI]

It is the task of every literary critic to determine the author's intent and the reasons for his intent with his writings when analyzing a work. Thomas Hardy deals with women in many harsh manners in his novels. His harshness stems from a lifetime...

Potter, Kerri L



Self-assembling DNA Nanostructures for Patterned Molecular Assembly Thomas H. LaBeana  

E-Print Network [OSTI]

1 Self-assembling DNA Nanostructures for Patterned Molecular Assembly Thomas H. LaBeana , Kurt V@cs.duke.edu; Tel: (919)660-65685 Abstract The Chapter describes the use of DNA for molecular-scale self-assembly with a discussion of DNA-nanostructures, starting with the self-assembly of various building-blocks known as DNA

Reif, John H.


Great Lakes Spatially Distributed Watershed Model of Water and Materials Runoff Thomas E. Croley II  

E-Print Network [OSTI]

Great Lakes Spatially Distributed Watershed Model of Water and Materials Runoff Thomas E. Croley II.S. Environmental Protection Agency (EPA) has identified contaminated sediments, urban runoff and storm sewers there are no integrated spatially distributed physically based watershed-scale hydrological/water quality models available

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Solar-powered WirelessMesh Networksfor Environmental Monitoring Torsten Braun, Thomas Staub, Benjamin Nyffenegger  

E-Print Network [OSTI]

unit, an 80 W solar panel as well as directional antennas. The 5GHz frequency band has been used environments. Deployment of the node hardware and solar panels was quite challenging, but successful whenSolar-powered WirelessMesh Networksfor Environmental Monitoring Torsten Braun, Thomas Staub

Braun, Torsten


FIA-12-0023- In the Matter of Thomas R. Thielen  

Broader source: Energy.gov [DOE]

The Department of Energys (DOE) Office of Hearings and Appeals (OHA) Director granted in part and denied in all other respects a Privacy Act Appeal filed by Thomas R. Thielen. Mr. Thielen filed a request with the DOEs Richland Operations Office for documents regarding a safety concern he raised to CH2M Hill Plateau Remediation Company (CHPRC).


Learning Grasp Affordances with Variable Tool Point Offsets Thomas J. Palmer and Andrew H. Fagg  

E-Print Network [OSTI]

Learning Grasp Affordances with Variable Tool Point Offsets Thomas J. Palmer and Andrew H. Fagg.D. student and University of Oklahoma Foun- dation Fellow, University of Oklahoma, Norman, OK 73019, USA, University of Oklahoma, Norman, OK 73019, USA fagg@cs.ou.edu In this paper, we examine the grasp affordance

Fagg, Andrew H.


New Methods for the Visualization of Electric Power System Information Thomas J. Overbye  

E-Print Network [OSTI]

visualization is electric power system operation and analysis. Most people give little thought to the sourceNew Methods for the Visualization of Electric Power System Information Thomas J. Overbye University of Illinois at Urbana-Champaign overbye@ece.uiuc.edu Jamie D. Weber PowerWorld Corporation weber


A Privacy-Aware Architecture For Demand Response Systems Stephen Wicker, Robert Thomas  

E-Print Network [OSTI]

A Privacy-Aware Architecture For Demand Response Systems Stephen Wicker, Robert Thomas School architectures that realize the benefits of demand response without requiring that AMI data be centrally-based demand response efforts in the face of public outcry. We also show that Trusted Platform Modules can

Wicker, Stephen


Perspectives and Integration in SOLAS Science Veronique C. Garcon, Thomas G. Bell, Douglas Wallace,  

E-Print Network [OSTI]

Perspectives and Integration in SOLAS Science 5 Veronique C. Garcon, Thomas G. Bell, Douglas, and Franziska Ziska Abstract Why a chapter on Perspectives and Integration in SOLAS Science in this book? SOLAS the remarkable diversity of cross-cutting approaches and tools in the gigantic puzzle of the SOLAS realm. Here we

Fennel, Katja


Arduino Remote Infrared Network Adapter Rene Neff, Thomas Trimborn and Matthias Wubbeling  

E-Print Network [OSTI]

ARINA: Arduino Remote Infrared Network Adapter Ren´e Neff, Thomas Trimborn and Matthias W}@cs.uni-bonn.de Abstract In this paper we present ARINA, a light-weight Arduino based system for forwarding infrared signals via Ethernet. Short introductions on infrared communication and Arduino as a development platform

Behnke, Sven


Relationship between protein folding thermodynamics and the energy landscape Jaegil Kim,* Thomas Keyes,  

E-Print Network [OSTI]

Relationship between protein folding thermodynamics and the energy landscape Jaegil Kim,* Thomas Received 23 September 2008; published 4 March 2009 The origin of protein folding thermodynamics is examined.15.Cc, 05.70. a, 87.15.A Protein folding--i.e., how a polypeptide chain reaches a unique native state

Straub, John E.



E-Print Network [OSTI]

1 SEISMIC RISK MAPS FOR EUROCODE-8 DESIGNED BUILDINGS Thomas Ulrich1 , John Douglas2 , Caterina Negulescu3 There is currently a move towards seismic design maps that are risk-targeted (e.g. Luco et al of such maps relies on three independent inputs: a) seismic hazard curves derived using probabilistic seismic


Using Infrared Sensors to Follow an Infrared Beam Scott Sobieski, Thomas Richards, David Peacock,  

E-Print Network [OSTI]

Using Infrared Sensors to Follow an Infrared Beam Scott Sobieski, Thomas Richards, David Peacock, Computer Science Department The second robot follows the infrared beam from the first robot. These sensors infrared sensors produce a value between 0 and 255 depending on their distance from the emitting beam

Kay, Jennifer S.


The Agile Research Penultimatum Thomas Way, Sandhya Chandrasekhar and Arun Murthy  

E-Print Network [OSTI]

thomas.way@villanova.edu Abstract - Agile software development is a widely used and successful Unified Process, Rational Unified Process, Agile Modeling, and most recently, Lean Software Development methodology for organizing and managing software product development in an industry setting. For academic

Way, Thomas


Rewriting Shakespeare: Thomas Otway's Venice Preserv'd and Edward Young's The Revenge  

E-Print Network [OSTI]

the early eighteenth century. Thomas Otway's Venice Preserv'd, first performed in 1682, is an example of the approach taken by most Restoration adapters of Shakespeare. Otway took from Shakespeare that which he wanted to use and discarded the rest. Edward...

Lovan, Gary Eugene



Taking Control of Green Speed Thomas A. Nikolai, Ph.D.  

E-Print Network [OSTI]

to know about green speed A lot of green speed misinformation Poor communication cited #1 problem GreenTaking Control of Green Speed Thomas A. Nikolai, Ph.D. The Doctor of Green Speed nikolait finds when requesting green speed help are.... #12;The 3 most common answers a superintendent finds when


Understanding open source in an industrial context Sven Ziemer, yvind Hauge and Thomas sterlie  

E-Print Network [OSTI]

of software development that will revolution- ize the software industry [2]. A recent addition to the onUnderstanding open source in an industrial context Sven Ziemer, ?yvind Hauge and Thomas ?sterlie source in an industrial context. Building a grounded theory from an industry-driven R&D project, our


An Efficient Intrusion Detection System Design Thomas Holz, Michael Meier, Hartmut Koenig  

E-Print Network [OSTI]

mechanisms (e.g. authentication, encryption, or access control) they provide an automatic detection1 An Efficient Intrusion Detection System Design Thomas Holz, Michael Meier, Hartmut Koenig Mail:{thh,mm,koenig}@informatik.tu-cottbus.de Abstract: Intrusion detection systems have proved

Meier, Michael


FDR3 --A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong,  

E-Print Network [OSTI]

FDR3 -- A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong, Alexandre.roscoe}@cs.ox.ac.uk Abstract. FDR3 is a complete rewrite of the CSP refinement checker FDR2, incorporating a significant number describe the new algorithm that FDR3 uses to construct its in- ternal representation of CSP processes

Oxford, University of


FDR3 --A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong,  

E-Print Network [OSTI]

FDR3 -- A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong, Alexandre.roscoe}@cs.ox.ac.uk Abstract. FDR3 is a complete rewrite of the CSP refinement checker FDR2, incorporating a significant number describe the new algorithm that FDR3 uses to construct its internal representation of CSP processes

Oxford, University of


Blue Noise Sampling with Controlled Aliasing DANIEL HECK and THOMAS SCHL OMER and OLIVER DEUSSEN  

E-Print Network [OSTI]

Blue Noise Sampling with Controlled Aliasing DANIEL HECK and THOMAS SCHL ¨OMER and OLIVER DEUSSEN University of Konstanz In this paper we revisit the problem of blue noise sampling with a strong focus types of blue noise patterns: step blue noise with a power spectrum in the form of a step function

Deussen, Oliver


Laser Excitation of a Fracture Source for Elastic Waves Thomas E. Blum* and Kasper van Wijk  

E-Print Network [OSTI]

Laser Excitation of a Fracture Source for Elastic Waves Thomas E. Blum* and Kasper van Wijk a transparent sample by focusing laser light directly onto this fracture. The associated displacement field, measured by a laser interferometer, has pronounced waves that are diffracted at the fracture tips. We

Snieder, Roel


Impact of EPS on Digestion of Waste Activate Sludge Thomas Gostanian  

E-Print Network [OSTI]

Impact of EPS on Digestion of Waste Activate Sludge Thomas Gostanian Faculty Mentor: Professor Chul Park, Civil & Environmental Engineering Digestion by bacteria is a widely used method for organic is by either aerobic or anaerobic self-digestion, in which the bacteria consume their own mass. Currently

Mountziaris, T. J.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network [OSTI]

Statics ISE 211 Engineering Economics General Education Elective (A) Spring Math 304 Linear Algebra ISE Engineering Industrial and systems engineering is integral to American industry and economic growth. Its major3/24/2009 State University of New York at Binghamton Thomas J. Watson School of Engineering

Suzuki, Masatsugu


State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network [OSTI]

211 Engineering Economics General Education Elective (A) Spring Math 304 Linear Algebra ISE 231 Human and systems engineering is integral to American industry and economic growth. Its major focus is on the design3/24/2009 State University of New York at Binghamton Thomas J. Watson School of Engineering

Suzuki, Masatsugu


State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network [OSTI]

Engineering Economics & Project Management General Education Elective (H) Year 4 Fall ISE 420 Optimization and systems engineering is integral to American industry and economic growth. Its major focus is on the design8/27/2012 State University of New York at Binghamton Thomas J. Watson School of Engineering

Suzuki, Masatsugu


State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network [OSTI]

Science BS in BioEngineering-Four Year Program SUNY Application Center Curriculum Code: 1532 (If undecided (Probability with Statistical Methods), MATH 447 (Introduction to Probability and Statistics I), ECON 366State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied

Suzuki, Masatsugu



E-Print Network [OSTI]

ASSESSMENT OF AUDIO FEATURES FOR AUTOMATIC COUGH DETECTION Thomas Drugman, Jerome Urbain, Thierry://tcts.fpms.ac.be/drugman/ ABSTRACT This paper addresses the issue of cough detection using only audio recordings, with the ultimate. 1. INTRODUCTION For children as well as for adults, cough is in pneumology the commonest syndrom

Dupont, Stéphane


Instinct and Learning Synergy in Simulated Foraging Using a Neural Network Thomas E. Portegys  

E-Print Network [OSTI]

Instinct and Learning Synergy in Simulated Foraging Using a Neural Network Thomas E. Portegys simple animals learn, and is therefore a useful approach to simulating them. The way this works and experience are shown to form a potent combination to achieve effective foraging in a simulated environment

Portegys, Thomas E.


Smallmouth Bass Seasonal Dynamics in Northeastern South Dakota Glacial Lakes Thomas D. Bacula  

E-Print Network [OSTI]

Department of Game, Fish and Parks, and South Dakota State University. #12;iv ABSTRACT Smallmouth BassSmallmouth Bass Seasonal Dynamics in Northeastern South Dakota Glacial Lakes BY Thomas D. Bacula and Fisheries Science (Fisheries Option) South Dakota State University 2009 #12;11 Smallmouth Bass Seasonal


Improving Ice Cover and Evaporation Estimates Primary Investigator: Thomas E. Croley (Emeritus), Raymond Assel (Emeritus) -NOAA  

E-Print Network [OSTI]

Improving Ice Cover and Evaporation Estimates Primary Investigator: Thomas E. Croley (Emeritus. For example, ice cover is projected to be significantly less under global warming, air temperature higher, and precipitation greater (Lofgren, et al, in press). Improved long-range ice forecasts would be of interest


A Multi-HMM Approach to ECG Segmentation Julien Thomas, Cedric Rose and Francois Charpillet  

E-Print Network [OSTI]

A Multi-HMM Approach to ECG Segmentation Julien Thomas, C´edric Rose and Franc¸ois Charpillet INRIA studies require to analyze thousands of ECGs in order to evaluate the side effects of a new drug. In this paper we present a new approach to automatic ECG segmentation based on hierarchic continuous density hid

Boyer, Edmond


SYLLABUS FOR MATH 2250 Text: Hass, Weir, and Thomas,  

E-Print Network [OSTI]

: Integration 5.1­5.2 Area and Estimating with Finite Sums, Sigma Notation and Limits of Finite Sums 2 §5.1: #1, 55, 61, 63, 73 5.6 Substitution and Area Between Curves 2 §5.6: #1, 3, 7, 13, 25, 27, 31, 39, 47, 51, 45, 51, 53, 55, 56, 59, 72, 76, 77 3.4 The Derivative as a Rate of Change 2 §3.4: #1, 5, 7, 10, 11

Smith, Roy


Thomas A. Munroe Systematics Laboratory. National Marine Fisheries Service. NOAA  

E-Print Network [OSTI]

to Uruguay, and a second species, S. civitatium Gins- burg 1951, occurring in inshore areas along in nearshore, estuarine, and neritic waters throughout the Carib- bean southwards to Uruguay. Two new species Atlantic, from North Carolina, U.S.A., to Uruguay (Gins- burg 1951, Menezes and Benvegnl1 1976, Munroe 1987


Southeast Idaho Area Links  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Area Attractions and Events Area Geography Area History Area Links Driving Directions Idaho Falls Attractions and Events INL History INL Today Research Park Sagebrush Steppe...


Strontium Substitution for Calcium in Lithogenesis Sarah D. Blaschko, Thomas Chi, Joe Miller, Lawrence Flechner, Sirine Fakra,  

E-Print Network [OSTI]

Strontium Substitution for Calcium in Lithogenesis Sarah D. Blaschko, Thomas Chi, Joe Miller, AK), Novato, California Purpose: Strontium has chemical similarity to calcium, which enables the replace- ment of calcium by strontium in biomineralization processes. Incorporating stron- tium into human


Fractal Interrelationships in Field and Seismic Data Thomas H. Wilson (wilson @wvugeo.wvnet.edu; 304-293-5603)  

E-Print Network [OSTI]

Fractal Interrelationships in Field and Seismic Data Thomas H. Wilson (wilson @wvugeo Size scaling interrelationships are evaluated in this study using a fractal model. Fractal models relief, drainage, topographic relief and active fault patterns. The fractal properties of structural

Wilson, Thomas H.


Thomas-Ehrman effect in a three-body model: $^{16}$Ne case  

E-Print Network [OSTI]

The dynamic mechanism of the Thomas-Ehrman shift is studied in three-cluster systems by example of $^{16}$Ne and $^{16}$C isobaric mirror partners. We predict configuration mixings for $0^+$ and $2^+$ states in $^{16}$Ne and $^{16}$C. Large isospin symmetry breaking on the level of wave function component weights is demonstrated for these states and discussed as three-body mechanism of Thomas-Ehrman shift. It is shown that the description of the Coulomb displacement energies requires a consistency among three parameters: the $^{16}$Ne decay energy $E_T$, the $^{15}$F ground state energy $E_r$, and the configuration mixing parameters for the $^{16}$Ne/$^{16}$C $0^+$ and $2^+$ states. Basing on this analysis we infer the $^{15}$F $1/2^+$ ground state energy to be $E_r=1.39-1.42$ MeV.

L. V. Grigorenko; T. A. Golubkova; M. V. Zhukov



Exfoliation of layered rutile and perovskite tungstates Raymond E. Schaak and Thomas E. Mallouk*  

E-Print Network [OSTI]

Exfoliation of layered rutile and perovskite tungstates Raymond E. Schaak and Thomas E. Mallouk perovskite H2W2O7 (synthesized by acid leaching of Bi2W2O9) were exfoliated into nanoscale colloids,2 and layered perovskites such as the DionJacobson phases HCa2Nb3O10 and HLaNb2O7,3 are well known to exfoliate


Dust acoustic solitary and shock excitations in a Thomas-Fermi magnetoplasma  

SciTech Connect (OSTI)

The linear and nonlinear properties of dust-acoustic waves are investigated in a collisionless Thomas-Fermi magnetoplasma, whose constituents are electrons, ions, and negatively charged dust particles. At dust time scale, the electron and ion number densities follow the Thomas-Fermi distribution, whereas the dust component is described by the classical fluid equations. A linear dispersion relation is analyzed to show that the wave frequencies associated with the upper and lower modes are enhanced with the variation of dust concentration. The effect of the latter is seen more strongly on the upper mode as compared to the lower mode. For nonlinear analysis, we obtain magnetized Korteweg-de Vries (KdV) and Zakharov-Kuznetsov (ZK) equations involving the dust-acoustic solitary waves in the framework of reductive perturbation technique. Furthermore, the shock wave excitations are also studied by allowing dissipation effects in the model, leading to the Korteweg-de Vries-Burgers (KdVB) and ZKB equations. The analysis reveals that the dust-acoustic solitary and shock excitations in a Thomas-Fermi plasma are strongly influenced by the plasma parameters, e.g., dust concentration, dust temperature, obliqueness, magnetic field strength, and dust fluid viscosity. The present results should be important for understanding the solitary and shock excitations in the environments of white dwarfs or supernova, where dust particles can exist.

Rahim, Z.; Qamar, A. [Institute of Physics and Electronics, University of Peshawar, Peshawar 25000 (Pakistan); National Center for Physics (NCP) at QAU Campus, Shahdra Valley Road, Islamabad 44000 (Pakistan); Ali, S. [National Center for Physics (NCP) at QAU Campus, Shahdra Valley Road, Islamabad 44000 (Pakistan)



Site Monitoring Area Maps  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to the Site Monitoring Area (SMA) The Site Monitoring Area sampler Control measures (best management practices) installed at the Site Monitoring Area Structures such as...


Wildlife Management Areas (Minnesota)  

Broader source: Energy.gov [DOE]

Certain areas of the State are designated as wildlife protection areas and refuges; new construction and development is restricted in these areas.


Wildlife Management Areas (Florida)  

Broader source: Energy.gov [DOE]

Certain sites in Florida are designated as wildlife management areas, and construction and development is heavily restricted in these areas.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On Some Computations of Higher Rank Refined Donaldson-Thomas Invariants  

E-Print Network [OSTI]

We present some computations of higher rank refined Donaldson-Thomas invariants on local curve geometries, corresponding to local D6-D2-D0 or D4-D2-D0 configurations. A refined wall-crossing formula for invariants with higher D6 or D4 ranks is derived and verified to agree with the existing formulas under the unrefined limit. Using the formula, refined invariants on the $(-1,-1)$ and $(-2,0)$ local rational curve with higher D6 or D4 ranks are computed.

Wu-yen Chuang; Chien-Hsun Wang



A review of "The Works of Thomas Traherne: Volume I." by Jan Ross ed.  

E-Print Network [OSTI]

and admiration for its commitment to this ongoing project. Jan Ross, ed. The Works of Thomas Traherne: Volume I. Cambridge: D. S. Brewer. 2005. xxiv + 571 pp. + 5 illus. $145.00. Review by JACOB BLEVINS, MCNEESE STATE UNIVERSITY. Jan Ross has edited..., notes, and marginal glosses found in the manuscript. She also includes a glossary of unusual words and usages at the end of the volume. Ross seems to cover all her editorial bases without ever ?intruding? on the text. This does appear to be the first...

Jacob Blevins



A review of "The Works of Thomas Traherne. Vols. 2 and 3" edited by Jan Ross  

E-Print Network [OSTI]

i n s , Mcne e s e st a t e un i v e r s i t y . Under the editorship of Jan Ross, Boydell and Brewer has pub- lished Volumes 2 and 3 of The Works of Thomas Traherne, an ongoing project that promises to be the complete and authoritative... accounts for the physical nature of the manuscripts themselves. Ross gives substantial notes on textual emen- dations and provides good introductions to the works. In addition, the long term planning of this project is well thought out; Ross...

Blevins, Jacob



Thomas Jefferson National Accelerator Facility | U.S. DOE Office of Science  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticutPhotos of AECSign Up for(SC) Thomas Jefferson


Thomas Jefferson National Accelerator Facility | U.S. DOE Office of Science  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticutPhotos of AECSign Up for(SC) Thomas


Thomas Jefferson National Accelerator Facility | U.S. DOE Office of Science  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticutPhotos of AECSign Up for(SC) Thomas(SC)


Thomas Jefferson National Accelerator Facility | U.S. DOE Office of Science  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticutPhotos of AECSign Up for(SC) Thomas(SC)(SC)


Thomas E. Wainwright, 1973 | U.S. DOE Office of Science (SC)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3, 20114,0,24,ThisThomas E.


Thomas Jefferson High School Wins Virginia Science Bowl for 7th Year  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3, 20114,0,24,ThisThomas


Thomas Jefferson High School for Science & Technology Snaps Up Virginia  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3, 20114,0,24,ThisThomasScience


Thomas P. Guilderson, 2011 | U.S. DOE Office of Science (SC)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3,ScienceThomas P. Guilderson,


The use of narrative during the Clarence Thomas-Anita Hill hearings October 11, 12, 13, 1991  

E-Print Network [OSTI]

THE USE OF NARRATIVE DURING THE CLARENCE THOMAS-ANITA HILL HEARINGS OCTOBER 11, 12, 13, 1991 A Thesis by MARILEE WILLSON Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of' Master of Arts August 1993 Major Subject: Speech Communication THE USE OF NARRATIVE DUING THE CLARENCE THOMAS-ANITA HILL HEARINGS OCTOBER 1 1 ~ 12 ' 13 g 1991 A Thesis by MARILEE WILLSON Submitted to Texas A&M University in partial...

Willson, Marilee



Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)



Wind Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis  

SciTech Connect (OSTI)

This NREL technical report utilizes a development framework originated by NREL and known by the acronym SROPTTC to assist the U.S. Virgin Islands in identifying and understanding concrete opportunities for wind power development in the territory. The report covers each of the seven components of the SROPTTC framework: Site, Resource, Off-take, Permitting, Technology, Team, and Capital as they apply to wind power in the USVI and specifically to a site in Bovoni, St. Thomas. The report concludes that Bovoni peninsula is a strong candidate for utility-scale wind generation in the territory. It represents a reasonable compromise in terms of wind resource, distance from residences, and developable terrain. Hurricane risk and variable terrain on the peninsula and on potential equipment transport routes add technical and logistical challenges but do not appear to represent insurmountable barriers. In addition, integration of wind power into the St. Thomas power system will present operational challenges, but based on experience in other islanded power systems, there are reasonable solutions for addressing these challenges.

Lantz, E.; Warren, A.; Roberts, J. O.; Gevorgian, V.



Tin-Based Reactive Solders for Ceramic/Metal Joints RAKESH R. KAPOOR and THOMAS W . EAGAR  

E-Print Network [OSTI]

( { ) Tin-Based Reactive Solders for Ceramic/Metal Joints RAKESH R. KAPOOR and THOMAS W . EAGAR engine com- ponents), wear parts, tool materials, electrical feed- throughs, and metal contacts on ceramics. To overcome this problem, reactive metals are added to the filler metai.11- 181These reactive

Eagar, Thomas W.


Analysis and Visualization of Market Power in Electric Power Systems Thomas J. Overbye Jamie D. Weber Kollin J. Patten  

E-Print Network [OSTI]

Analysis and Visualization of Market Power in Electric Power Systems Thomas J. Overbye Jamie D discusses the assessment and visualization of market power in bulk electricity markets, with the explicit structure being replaced by competitive markets in unbundled electricity services with disaggregated


Stray Current Corrosion in Electrified Rail Systems --Final Report Dr. Thomas J. Barlo, formerly of Northwestern University  

E-Print Network [OSTI]

Stray Current Corrosion in Electrified Rail Systems -- Final Report Dr. Thomas J. Barlo, formerly SUMMARY Despite a relatively mature technology for its control, corrosion caused by stray current from of that cost is the result of corrosion of the electrified rapid-transit system itself, and part is the result


X-ray diffraction study of the static strength of tungsten to 69 GPa Duanwei He* and Thomas S. Duffy  

E-Print Network [OSTI]

X-ray diffraction study of the static strength of tungsten to 69 GPa Duanwei He* and Thomas S of tungsten was determined under static high pressures to 69 GPa using x-ray diffraction techniques strength of tungsten increases with compression, reaching a value of 5.3 GPa at the highest pressure

Duffy, Thomas S.


The Systems Science & Industrial Engineering (SSIE) Department and The Thomas J. Watson School of Engineering and Applied  

E-Print Network [OSTI]

The Systems Science & Industrial Engineering (SSIE) Department and The Thomas J. Watson School professionals, we will open the doors to demonstrate what industrial and systems engineers can contribute to any. We offer the BS degree in industrial and systems engineering (ISE), MEng degree in industrial

Suzuki, Masatsugu


Manifold modeling for brain population analysis Samuel Gerber *, Tolga Tasdizen, P. Thomas Fletcher, Sarang Joshi, Ross Whitaker, and the Alzheimers  

E-Print Network [OSTI]

of the population. We evaluate the proposed method on the OASIS and ADNI brain databases of head MR images in twoManifold modeling for brain population analysis Samuel Gerber *, Tolga Tasdizen, P. Thomas Fletcher Brain MRI Manifold learning Computer aided clinical diagnosis a b s t r a c t This paper describes

Utah, University of

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Transient Stability Constrained Optimal Power Flow Deqiang Gan (M) Robert J. Thomas (F) Ray D. Zimmerman (M)  

E-Print Network [OSTI]

1 A Transient Stability Constrained Optimal Power Flow Deqiang Gan (M) Robert J. Thomas (F) Ray D. The methodology involves a stability constrained Optimal Power Flow (OPF). The theoretical development between controllable generation dispatch and indices such as an energy margin, rotor angles, etc


Condition on the KohnSham kinetic energy and modern parametrization of the ThomasFermi density  

E-Print Network [OSTI]

; published online 20 January 2009 We study the asymptotic expansion of the neutral-atom energy as the atomic-correlation energy, EXC n , must be approximated. But a direct, orbital-free DFT could be constructed if onlyCondition on the Kohn­Sham kinetic energy and modern parametrization of the Thomas­Fermi density

Burke, Kieron


Sustainability criteria for bioenergy systems: results from an expert survey Thomas Buchholz*, Valerie A. Luzadis, Timothy A. Volk  

E-Print Network [OSTI]

Sustainability criteria for bioenergy systems: results from an expert survey Thomas Buchholz in revised form 10 April 2009 Accepted 24 April 2009 Available online 9 May 2009 Keywords: Bioenergy and concerns about regional and national security are driving the development and use of biomass for bioenergy

Vermont, University of



E-Print Network [OSTI]

i ...) P~!ETRIC STUDY OF HEAT FLOW DURING RESISTANCE SPOT WELDING Euiwhan Kim and Thomas W. Eagar case of resistance welding to see the effects of each parameter on the lobe shape. The parameters include material proper- ties, geometry of electrodes and work piece, weld time and current

Eagar, Thomas W.


How do communication systems emerge? Thomas C. Scott-Phillips1,*, Richard A. Blythe2, Andy Gardner3,4  

E-Print Network [OSTI]

How do communication systems emerge? Thomas C. Scott-Phillips1,*, Richard A. Blythe2, Andy Gardner3, Oxford OX1 3BJ, UK Communication involves a pair of behaviours--a signal and a response--that are functionally interdepen- dent. Consequently, the emergence of communication involves a chicken-and-egg problem

West, Stuart


Efficient Energy-Balancing in Multipath RPL Oana Iova1, Fabrice Theoleyre 1 and Thomas Noel1  

E-Print Network [OSTI]

Efficient Energy-Balancing in Multipath RPL Oana Iova1, Fabrice Theoleyre 1 and Thomas Noel1 1ICube the global energy consumption, we aim here at designing an energy-balancing routing protocol: each node. Keywords: RPL, multipath, energy efficiency, energy-balancing, WSN, network lifetime 1 Introduction Routing

Paris-Sud XI, Université de


Multi-Focused Geospatial Analysis Using Probes Thomas Butkiewicz, Wenwen Dou, Zachary Wartell, William Ribarsky, and Remco Chang  

E-Print Network [OSTI]

Multi-Focused Geospatial Analysis Using Probes Thomas Butkiewicz, Wenwen Dou, Zachary Wartell, William Ribarsky, and Remco Chang Abstract--Traditional geospatial information visualizations often be incorporated into a variety of geospatial visualizations to empower users with the ability to observe

Wartell, Zachary


Thomas and Mack Concourse Take time before Career Day to find out which companies are represented. Go to the Career  

E-Print Network [OSTI]

Thomas and Mack Concourse Take time before Career Day to find out which companies are represented of attending employers. Maximize your time by planning a strategy for companies you most want to visit. Make sure you visit companies you are planning on interviewing with after Career Day. Check the websites

Hemmers, Oliver


Network-based Root of Trust for Installation Joshua Schiffman, Thomas Moyer, Trent Jaeger and Patrick McDaniel  

E-Print Network [OSTI]

Department, Pennsylvania State University Administrators of large data centers often require network be automated for the administrator. The result is that secure network installation, even over an untrustedNetwork-based Root of Trust for Installation Joshua Schiffman, Thomas Moyer, Trent Jaeger

Yener, Aylin


Adaptive Substrate for Enhanced Spatial Augmented Reality Contrast and Markus Broecker Ross T. Smith Bruce H. Thomas  

E-Print Network [OSTI]

Ross T. Smith Bruce H. Thomas Wearable Computer Lab University of South Australia ABSTRACT This paper employ hand-held displays or head-mounted displays with optical or video see through technologies for the appearance fidelity e-mail:Markus.Broecker@unisa.edu.au e-mail:ross@r-smith.net e-mail:Bruce

Thomas, Bruce


Hybrid Indoor and Outdoor Tracking for Mobile 3D Mixed Reality Wayne Piekarski, Ben Avery, Bruce H. Thomas, Pierre Malbezin  

E-Print Network [OSTI]

Hybrid Indoor and Outdoor Tracking for Mobile 3D Mixed Reality Wayne Piekarski, Ben Avery, Bruce H@tinmith.net, bruce.thomas@unisa.edu.au, pierre@tinmith.net Abstract This paper describes a new hybrid tracking system, in most cases an arrow navigation cue and a hand held World-in-Miniature model are used to provide

Thomas, Bruce


Ralph Waldo Emerson L'Amrique L'essai. THOMAS CONSTANTINESCO. Paris: Editions de la Rue d'Ulm,  

E-Print Network [OSTI]

reader, Thomas Constantinesco's new book is a Gallic aperçu of Emerson's thought and his art, his self-construction in his prologue that while Emer- son was a luminary in his own generation, he and others of his time went


NAME EMAIL SUPERVISOR NAME EMAIL SUPERVISOR Alrehaily, Leena lalrehai@uwo.ca JCW Gungor, Thomas tgungor@uwo.ca ERG  

E-Print Network [OSTI]

NAME EMAIL SUPERVISOR NAME EMAIL SUPERVISOR Alrehaily, Leena lalrehai@uwo.ca JCW Gungor, Thomas tgungor@uwo.ca ERG Armstrong, Erin earmstr6@uwo.ca MAK Guo, Dan dguo24@uwo.ca JCW Azizpoor Fard, Mahmood mazizpoo@uwo.ca JFC Guo, Jiacheng jguo52@uwo.ca KMB Barbon, Stephanie sbarbon@uwo.ca JBG Guo, Xiaoxuan xguo

Lennard, William N.



E-Print Network [OSTI]

METAL COATING OF POROUS SILICON GAS SENSORS FOR IMPROVED SENSITIVITY & SELECTIVITY Thomas Osburn Introduction Gas sensors on the market today have many limitations that prevent real world applications. The current standard, metal oxide sensors, are highly temperature dependant and work at high temperatures

Li, Mo


WEtransport: A Context-based Ride Sharing Platform Alireza Sahami Shirazi, Thomas Kubitza, Florian Alt, Bastian Pfleging, Albrecht Schmidt  

E-Print Network [OSTI]

themselves to share cars (car pooling), taxis or (group) tickets for trains. However, ad-hoc situations (e a modular platform supporting ride sharing for different means of transport (e.g., taxi, car, or train). ByWEtransport: A Context-based Ride Sharing Platform Alireza Sahami Shirazi, Thomas Kubitza, Florian


Supporting Systolic and Memory Communication in iWarp Shekhar Borkar, Robert Cohn, George Cox, Thomas Gross,  

E-Print Network [OSTI]

Supporting Systolic and Memory Communication in iWarp Shekhar Borkar, Robert Cohn, George Cox, Thomas Gross, H. T. Kung, Monica Lam, Margie Levine, Brian Moore, Wire Moore, Craig Peterson, Jim Susman/CMO under Contract MDA972­90­C­0035. Authors' affiliations: R. Cohn, T. Gross, H. T. Kung, and J. Webb

Shewchuk, Jonathan


Path Prediction for High Issue-Rate Processors Kishore N. Menezes Sumedh W. Sathaye Thomas M. Conte  

E-Print Network [OSTI]

Path Prediction for High Issue-Rate Processors Kishore N. Menezes Sumedh W. Sathaye Thomas M. Conte predict a single branch at a time. Performance improvement is possible by predicting multiple branches in a single cycle. This paper presents a technique to predict paths in a single access. The correlation

Conte, Thomas M.


Onset of Metallic Behavior in Magnesium Clusters Owen C. Thomas, Weijun Zheng, Shoujun Xu, and Kit H. Bowen, Jr.  

E-Print Network [OSTI]

Onset of Metallic Behavior in Magnesium Clusters Owen C. Thomas, Weijun Zheng, Shoujun Xu, and Kit-selected magnesium cluster anions, Mgn ÿ , over the size range, n 3­35. Their s-p band gaps were observed to close in the finite size re- gime for the case of magnesium. Magnesium is a particu- larly instructive case because

Simons, Jack


Managing Plug-Loads for Demand Response within Buildings Thomas Weng, Bharathan Balaji, Seemanta Dutta, Rajesh Gupta, Yuvraj Agarwal  

E-Print Network [OSTI]

Managing Plug-Loads for Demand Response within Buildings Thomas Weng, Bharathan Balaji, Seemanta managers can per- form active energy management, especially during demand response situations that require, allowing them to deal with demand response situations through user- specified actuation policies. At its

Gupta, Rajesh


Mechanical reorganization of cross-linked F-actin networks at the air-buffer Thomas Boatwright,a  

E-Print Network [OSTI]

Mechanical reorganization of cross-linked F-actin networks at the air-buffer interface Thomas compression is studied. We observe two distinct classes of behavior: a mechanically induced structural reorganization of the monolayer and a subsequent reversible, nonlinear mechanical response. Measurements

Dennin, Michael

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Didactical Issues of a Remote Network Laboratory Marc-Alain Steinemann, Stefan Zimmerli, Thomas Jampen, Torsten Braun  

E-Print Network [OSTI]

Didactical Issues of a Remote Network Laboratory Marc-Alain Steinemann, Stefan Zimmerli, Thomas Mathematik, Universität Bern Neubrückstr. 10, CH-3012 Bern KEYWORDS: remote laboratory, didactical issues 1-learning environments seem to get more and more accepted, there is still a strong need for advanced didactical concepts

Braun, Torsten


Minimization of energy per particle among Bravais lattices in R2 Lennard-Jones and Thomas-Fermi cases  

E-Print Network [OSTI]

that the global min- imizer of the total energy is the triangular lattice of length one. His method was adapted. The problem is to find the configuration of the points which minimizes the total energy of interaction, calledMinimization of energy per particle among Bravais lattices in R2 : Lennard-Jones and Thomas


Automatic Layout Optimization of an EMC filter Thomas DE OLIVEIRA, Jean-Luc SCHANEN, Jean-Michel GUICHON, Laurent GERBAUD  

E-Print Network [OSTI]

Automatic Layout Optimization of an EMC filter Thomas DE OLIVEIRA, Jean-Luc SCHANEN, Jean France Abstract- The transfer function of an EMC (Electro-Magnetic Compatibility) filter is strongly for embedded applications. When looking on a power converter, the EMC filter represents 30% of the volume

Paris-Sud XI, Université de


Thomas J. Watson School of Engineering and Applied Science at Binghamton University BS in Computer Engineering-Four-Year Program  

E-Print Network [OSTI]

5/12/2011 Thomas J. Watson School of Engineering and Applied Science at Binghamton University BS-AS in engineering science 2009 Fall Spring BU Course No. Course Name Transfer Course BU Course No. Course Name Project II Technical Elective I Technical Elective II General Ed Elective (A) Thea, Art, Mus, Cinema

Suzuki, Masatsugu


Woody Plant Inventories, CVSEEP Protocol Thomas R. Wentworth, Robert K. Peet, Michael T. Lee, Steven D. Roberts  

E-Print Network [OSTI]

1 Woody Plant Inventories, CVSEEP Protocol Thomas R. Wentworth, Robert K. Peet, Michael T. Lee, Steven D. Roberts Version 4.2 2008 Woody plants are typically inventoried in all five levels of the CVSEEP protocol, although such inventory is optional in Levels 3 and 4. Woody plants fall into two

Peet, Robert K.


RECYCLING OF LATEX BASED PAINT AS POLYMER FEEDSTOCK MATERIALS Jennifer K. Lynch, Thomas J. Nosker, Robert Hamill, Richard L. Lehman  

E-Print Network [OSTI]

RECYCLING OF LATEX BASED PAINT AS POLYMER FEEDSTOCK MATERIALS Jennifer K. Lynch, Thomas J. Nosker investigates the recycling of used latex paints into non-paint products. Waste latex paint was collected, dried container cost for either recycling or hazardous waste disposal, is very high for the retailer. Much


CONTROLLED VARIABLES IN SENTENCE INTONATION* Carole E. Gelfer,t Katherine S. Harris,t and Thomas Haer  

E-Print Network [OSTI]

CONTROLLED VARIABLES IN SENTENCE INTONATION* Carole E. Gelfer,t Katherine S. Harris,t and Thomas realization (Atkinson, 1973; Collier, 1975; Gelfer, Harris, Collier, & Baer, 1985; Maeda, 1976). Unfortunately characteristics of utterances (Klatt, Stevens, & Mead, 1968). For example, because of the reduced airflow


Hydrologically Sensitive Areas: Variable Source Area Hydrology  

E-Print Network [OSTI]

Hydrologically Sensitive Areas: Variable Source Area Hydrology Implications for Water Quality Risk hydrology was developed and applied to the New York City (NYC) water supply watersheds. According and are therefore hydrologically sensitive with respect to their potential to transport contaminants to perennial

Walter, M.Todd



E-Print Network [OSTI]

AREA COORDINATOR RESIDENTIAL EDUCATION VANDERBILT UNIVERSITY, NASHVILLE, TENNESSEE The Office of Housing and Residential Education at Vanderbilt University is seeking applicants for an Area Coordinator. The Area Coordinator is responsible for assisting in the management and operation of a residential area

Bordenstein, Seth


A review of "Thomas Rainborowe (c. 1610-1648): Civil War Seaman, Siegemaster and Radical." by Whitney R.D. Jones,  

E-Print Network [OSTI]

REVIEWS 31 Whitney R.D. Jones. Thomas Rainborowe (c. 1610-1648): Civil War Seaman, Siegemaster and Radical. Rochester, NY: Boydell Press, 2005. x + 154 pp. $75.00. Review by ELLEN J. JENKINS, ARKANSAS TECH UNIVERSITY. When Thomas Rainborowe... Civil Wars and earned a position for himself in the history of political theory. His role in the wars and the role of his affiliation to the Levellers are the subjects of Whitney R.D. Jones?s work, Thomas Rainborowe (c. 1610-1648): Civil War Seaman...

Jenkins, Ellen J.



Geothermal br Resource br Area Geothermal br Resource br Area...  

Open Energy Info (EERE)

Basalt K Eburru Geothermal Area Eburru Geothermal Area East African Rift System Kenya Rift Basalt Fukushima Geothermal Area Fukushima Geothermal Area Northeast Honshu Arc...



E-Print Network [OSTI]

METROPOLITAN STATISTICAL AREA OUTLOOK MORGANTOWN COLLEGE OF BUSINESS AND ECONOMICS Bureau to be repeated over the next five years. The Morgantown Metropolitan Statistical Area (MSA) had an average annual

Mohaghegh, Shahab


Wetland Preservation Areas (Minnesota)  

Broader source: Energy.gov [DOE]

A wetland owner can apply to the host county for designation of a wetland preservation area. Once designated, the area remains designated until the owner initiates expiration, except where a state...


Wildlife Management Areas (Maryland)  

Broader source: Energy.gov [DOE]

Wildlife Management Areas exist in the State of Maryland as wildlife sanctuaries, and vehicles, tree removal, and construction are severely restricted in these areas. Some of these species are also...


Modeling vertical beta-diversity in tropical butterfly communities Thomas R. Walla, Steinar Engen, Philip J. DeVries and Russell Lande  

E-Print Network [OSTI]

Modeling vertical beta-diversity in tropical butterfly communities Thomas R. Walla, Steinar Engen vertical beta- diversity in tropical butterfly communities. Á/ Oikos 107: 610Á/618. We present a novel of structure present. Beta-diversity (MacArthur

Devries, Philip J.


Thomas W. Lester, Ph. D., is Dean of the College of Engineering; Richard J. Sweigard, Ph.D., is Associate Dean  

E-Print Network [OSTI]

Thomas W. Lester, Ph. D., is Dean of the College of Engineering; Richard J. Sweigard, Ph Programs; Bruce L. Walcott is Associate Dean for Economic Development and Innovations Management. The College of Engineering offers programs leadingtoundergraduateandgraduatedegreesin

MacAdam, Keith


Protected Areas Stacy Philpott  

E-Print Network [OSTI]

Convention of Biological Diversity, 1992 #12;IUCN Protected Area Management Categories Ia. Strict Nature. Protected Landscape/ Seascape VI. Managed Resource Protected Area #12;Ia. Strict Nature Preserves and Ib. Wilderness Areas Natural preservation Research No No #12;II. National Parks Ecosystem protection

Gottgens, Hans


A stratigraphic study of the Georgetown Formation (Washita Division, Lower Cretaceous) on the north flank of the San Marcos Platform, south-central Texas  

E-Print Network [OSTI]

shale. The majority of the thinning of the Georgetown Formation can be attributed to the southward thinning of these shale beds. This thinning suggests a northern source area with occasional periods of erosion. Subsurface work by Tucker ( 1962... renam1ng by Vaughan. Adkins and Lozo (1951) used the Brazos River as the arbitrary line between the Grayson shale to the north and the Del Rio clay to the south. The Grayson shale is a brownish-gray shale to marl with many limestone beds in the upper...

Dowling, Sharron Lea



A review of "Thomas and Rebecca Vaughans Aqua Vit: Non Vitis" by Donald R. Dickson, ed.  

E-Print Network [OSTI]

to contemporary Anglican sufferings, is an important contribution to understanding. Donald R. Dickson, ed. Thomas and Rebecca Vaughan?s Aqua Vit?: Non Vitis (British Library MS, Sloane 1741). Tempe: Arizona Center for Medieval and Renaissance Studies, 2001... is to be congratulated and thanked for this volume. Nothing by Tho- mas Vaughan has ever appeared in so handsome a format. Donald Dickson, too, is to be congratulated and thanked. Sloane MS 1741, if not quite in the Aubrey league, still has its difficulties...

Alan Rudrum




National Nuclear Security Administration (NNSA)

TRU material in the trench because there is no groundwater pathway under foreseeable climate conditions. The Area 5 RWMS probabilistic PA model can be modified and used to...

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Groundwater Management Areas (Texas)  

Broader source: Energy.gov [DOE]

This legislation authorizes the Texas Commission on Environmental Quality and the Texas Water Development Board to establish Groundwater Management Areas to provide for the conservation,...


Self Potential At Blue Mountain Geothermal Area (Fairbank Engineering...  

Open Energy Info (EERE)

geothermal activity which could be linked to faults that serve as pathways for geothermal fluids. Notes This survey was conducted on the western flank of Blue Mountain. SP Profile...


Hydrodynamic effects on Mission Canyon (Mississippian) oil accumulations, Billings Nose area, North Dakota  

SciTech Connect (OSTI)

Mission Canyon oil production on the south flank of the Williston basin provides an example of an area in the mature stage of exploration that shows significant hydrodynamic effects on oil accumulations related to stratigraphic traps. The effects are illustrated by the Billings Nose fields and the Elkhorn Ranch field. The reservoirs have low hydraulic gradients of about 2 m/km (10 ft/mi), tilted oil-water contacts with gradients of 5 m/km (25 ft/mi), and variable formation-water salinities that range from brackish to highly saline. Oil accumulations in some zones are displayed off structure and downdip to the northeast, parallel to porosity pinch-outs. Other zones are pure hydrodynamic closure. Future success in exploration and development in the play will depend on recognizing the hydrodynamic effects and predicting oil displacement. 34 refs., 15 figs., 1 tab.

Berg, R.R. (Texas A M Univ., College Station, TX (United States)); DeMis, W.D. (Marathon Oil Co., Houston, TX (United States)); Mitsdarffer, A.R. (Dupont Environmental Remediation Services, Houston, TX (United States))



Decontamination & decommissioning focus area  

SciTech Connect (OSTI)

In January 1994, the US Department of Energy Office of Environmental Management (DOE EM) formally introduced its new approach to managing DOE`s environmental research and technology development activities. The goal of the new approach is to conduct research and development in critical areas of interest to DOE, utilizing the best talent in the Department and in the national science community. To facilitate this solutions-oriented approach, the Office of Science and Technology (EM-50, formerly the Office of Technology Development) formed five Focus AReas to stimulate the required basic research, development, and demonstration efforts to seek new, innovative cleanup methods. In February 1995, EM-50 selected the DOE Morgantown Energy Technology Center (METC) to lead implementation of one of these Focus Areas: the Decontamination and Decommissioning (D & D) Focus Area.




Geographic Area Month  

U.S. Energy Information Administration (EIA) Indexed Site

Fuels by PAD District and State (Cents per Gallon Excluding Taxes) - Continued Geographic Area Month No. 1 Distillate No. 2 Distillate a No. 4 Fuel b Sales to End Users Sales for...


300 Area Disturbance Report  

SciTech Connect (OSTI)

The objective of this study was to define areas of previous disturbance in the 300 Area of the U.S. Department of Energy (DOE) Hanford Site to eliminate these areas from the cultural resource review process, reduce cultural resource monitoring costs, and allow cultural resource specialists to focus on areas where subsurface disturbance is minimal or nonexistent. Research into available sources suggests that impacts from excavations have been significant wherever the following construction activities have occurred: building basements and pits, waste ponds, burial grounds, trenches, installation of subsurface pipelines, power poles, water hydrants, and well construction. Beyond the areas just mentioned, substrates in the' 300 Area consist of a complex, multidimen- sional mosaic composed of undisturbed stratigraphy, backfill, and disturbed sediments; Four Geographic Information System (GIS) maps were created to display known areas of disturbance in the 300 Area. These maps contain information gleaned from a variety of sources, but the primary sources include the Hanford GIS database system, engineer drawings, and historic maps. In addition to these maps, several assumptions can be made about areas of disturbance in the 300 Area as a result of this study: o o Buried pipelines are not always located where they are mapped. As a result, cultural resource monitors or specialists should not depend on maps depicting subsurface pipelines for accurate locations of previous disturbance. Temporary roads built in the early 1940s were placed on layers of sand and gravel 8 to 12 in. thick. Given this information, it is likely that substrates beneath these early roads are only minimally disturbed. Building foundations ranged from concrete slabs no more than 6 to 8 in. thick to deeply excavated pits and basements. Buildings constructed with slab foundations are more numerous than may be expected, and minimally disturbed substrates may be expected in these locations. Historic black and white photographs provide a partial record of some excavations, including trenches, building basements, and material lay-down yards. Estimates of excavation depth and width can be made, but these estimates are not accurate enough to pinpoint the exact location where the disturbedhmdisturbed interface is located (e.g., camera angles were such that depths and/or widths of excavations could not be accurately determined or estimated). In spite of these limitations, these photographs provide essential information. Aerial and historic low-level photographs have captured what appears to be backfill throughout much of the eastern portion of the 300 Area-near the Columbia River shoreline. This layer of fill has likely afforded some protection for the natural landscape buried beneath the fill. This assumption fits nicely with the intermittent and inadvertent discoveries of hearths and stone tools documented through the years in this part of the 300 Area. Conversely, leveling of sand dunes appears to be substantial in the northwestern portion of the 300 Area during the early stages of development. o Project files and engineer drawings do not contain information on any impromptu but necessary adjustments made on the ground during project implementation-after the design phase. Further, many projects are planned and mapped but never implemented-this information is also not often placed in project files. Specific recommendations for a 300 Area cultural resource monitoring strategy are contained in the final section of this document. In general, it is recommended that monitoring continue for all projects located within 400 m of the Columbia River. The 400-m zone is culturally sensitive and likely retains some of the most intact buried substrates in the 300 Area.

LL Hale; MK Wright; NA Cadoret



A review of "The Eliot Tracts: With Letters from John Eliot to Thomas Thorowgood and Richard Baxter." by John Eliot  

E-Print Network [OSTI]

196 SEVENTEENTH-CENTURY NEWS John Eliot. The Eliot Tracts: With Letters from John Eliot to Thomas Thorowgood and Richard Baxter. Edited by Michael Clark. Westport, Conn.: Praeger Publishers, 2003. viii + 453 pp. $99.95. Review by WILLIAM J..., in John Milton?s words, ?the first [nation] that should set up a Standard for the [Ref- ormation] recovery of lost Truth, and blow the first Evangelick Trumpet to the Nations? (Of Reformation in England [1641], Book One). With great expec- tations of last...

William J. Scheick



Exact solutions and stability of rotating dipolar Bose-Einstein condensates in the Thomas-Fermi limit  

E-Print Network [OSTI]

We present a theoretical analysis of dilute gas Bose-Einstein condensates with dipolar atomic interactions under rotation in elliptical traps. Working in the Thomas-Fermi limit, we employ the classical hydrodynamic equations to first derive the rotating condensate solutions and then consider their response to perturbations. We thereby map out the regimes of stability and instability for rotating dipolar Bose-Einstein condensates and in the latter case, discuss the possibility of vortex lattice formation. We employ our results to propose several novel routes to induce vortex lattice formation in a dipolar condensate.

R. M. W. van Bijnen; A. J. Dow; D. H. J. O'Dell; N. G. Parker; A. M. Martin



OLED area illumination source  

DOE Patents [OSTI]

The present invention relates to an area illumination light source comprising a plurality of individual OLED panels. The individual OLED panels are configured in a physically modular fashion. Each OLED panel comprising a plurality of OLED devices. Each OLED panel comprises a first electrode and a second electrode such that the power being supplied to each individual OLED panel may be varied independently. A power supply unit capable of delivering varying levels of voltage simultaneously to the first and second electrodes of each of the individual OLED panels is also provided. The area illumination light source also comprises a mount within which the OLED panels are arrayed.

Foust, Donald Franklin (Scotia, NY); Duggal, Anil Raj (Niskayuna, NY); Shiang, Joseph John (Niskayuna, NY); Nealon, William Francis (Gloversville, NY); Bortscheller, Jacob Charles (Clifton Park, NY)




E-Print Network [OSTI]

) Common Use Areas All floored areas in the building for circulation and standard facilities provided and the like. These are extracts of NWPC standard method of measurement of building areas with an addition fromSection S ANNEXURE 4 MEASUREMENT OF BUILDING AREAS MEASUREMENT OF BUILDING AREAS 1. GROSS BUILDING

Wang, Yan


Subsurface contaminants focus area  

SciTech Connect (OSTI)

The US Department of Enregy (DOE) Subsurface Contaminants Focus Area is developing technologies to address environmental problems associated with hazardous and radioactive contaminants in soil and groundwater that exist throughout the DOE complex, including radionuclides, heavy metals; and dense non-aqueous phase liquids (DNAPLs). More than 5,700 known DOE groundwater plumes have contaminated over 600 billion gallons of water and 200 million cubic meters of soil. Migration of these plumes threatens local and regional water sources, and in some cases has already adversely impacted off-site rsources. In addition, the Subsurface Contaminants Focus Area is responsible for supplying technologies for the remediation of numerous landfills at DOE facilities. These landfills are estimated to contain over 3 million cubic meters of radioactive and hazardous buried Technology developed within this specialty area will provide efective methods to contain contaminant plumes and new or alternative technologies for development of in situ technologies to minimize waste disposal costs and potential worker exposure by treating plumes in place. While addressing contaminant plumes emanating from DOE landfills, the Subsurface Contaminants Focus Area is also working to develop new or alternative technologies for the in situ stabilization, and nonintrusive characterization of these disposal sites.





E-Print Network [OSTI]


Aalberts, Daniel P.


Plutonium focus area  

SciTech Connect (OSTI)

To ensure research and development programs focus on the most pressing environmental restoration and waste management problems at the U.S. Department of Energy (DOE), the Assistant Secretary for the Office of Environmental Management (EM) established a working group in August 1993 to implement a new approach to research and technology development. As part of this new approach, EM developed a management structure and principles that led to the creation of specific Focus Areas. These organizations were designed to focus the scientific and technical talent throughout DOE and the national scientific community on the major environmental restoration and waste management problems facing DOE. The Focus Area approach provides the framework for intersite cooperation and leveraging of resources on common problems. After the original establishment of five major Focus Areas within the Office of Technology Development (EM-50, now called the Office of Science and Technology), the Nuclear Materials Stabilization Task Group (EM-66) followed the structure already in place in EM-50 and chartered the Plutonium Focus Area (PFA). The following information outlines the scope and mission of the EM, EM-60, and EM-66 organizations as related to the PFA organizational structure.




WebOS: Operating System Services for Wide Area Applications \\Lambda Amin Vahdat y Thomas Anderson z Michael Dahlin x Eshwar Belani y David Culler y  

E-Print Network [OSTI]

of millions of users. Today, such replication is manually managed on both the server and the client side, including mechanisms for naming, persistent storage, remote process execution, resource management to build these abstractions themselves or to do without. This ad­hoc approach often re­ sults in individual

Anderson, Tom


DOE Designates Southwest Area and Mid-Atlantic Area National...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Interest Electric Transmission Corridors DOE Designates Southwest Area and Mid-Atlantic Area National Interest Electric Transmission Corridors October 2, 2007 - 11:12am Addthis...


Scientific and Natural Areas (Minnesota)  

Broader source: Energy.gov [DOE]

Certain scientific and natural areas are established throughout the state for the purpose of preservation and protection. Construction and new development is prohibited in these areas.


Periodically multilayered planar optical concentrator for photovoltaic solar cells Manuel E. Solano, Muhammad Faryad, Peter B. Monk, Thomas E. Mallouk, and Akhlesh Lakhtakia  

E-Print Network [OSTI]

Periodically multilayered planar optical concentrator for photovoltaic solar cells Manuel E. Solano concentrator for photovoltaic solar cells Manuel E. Solano,1 Muhammad Faryad,2 Peter B. Monk,1 Thomas E-Si solar cells due to embedded nanoparticles J. Appl. Phys. 102, 093713 (2007); 10.1063/1.2809368 Surface


Thomas, B. G., M. Langeneckert, L. Castell, M. Dziuba, G. Di Gresia, and W. Balante, Ironmaking and Steelmaking, Vol. 30, No. 3, 2003, pp. 235-239.  

E-Print Network [OSTI]

Thomas, B. G., M. Langeneckert, L. Castellá, M. Dziuba, G. Di Gresia, and W. Balante, Ironmaking, Ironmaking and Steelmaking, Vol. 30, No. 3, 2003, pp. 235-239. 2 OPTIMIZACION OF NARROW - FACE WATER SLOT, and W. Balante, Ironmaking and Steelmaking, Vol. 30, No. 3, 2003, pp. 235-239. 3 1. INTRODUCTION

Thomas, Brian G.


Contribution to Thomas D. & G. S. Dieckmann (eds.): SEA ICE -AN INTRODUCTION TO ITS PHYSICS, BIOLOGY , CHEMISTRY AND GEOLOGY, Blackwell Science, London, 2003, pp. 22-81  

E-Print Network [OSTI]

1 Contribution to Thomas D. & G. S. Dieckmann (eds.): SEA ICE - AN INTRODUCTION TO ITS PHYSICS to the macroscopic to the regional scale: Growth, microstructure and properties of sea ice1 Hajo Eicken 2 of the importance of sea ice over a wide range of scales in time and space. Considering the degree to which the ice

Eicken, Hajo


PID+ TRACKING IN A LEADER-FOLLOWER SPACECRAFT FORMATION Raymond Kristiansen1, Thomas R. Krogstad2, Per J. Nicklasson1, and Jan T. Gravdahl2  

E-Print Network [OSTI]

PID+ TRACKING IN A LEADER-FOLLOWER SPACECRAFT FORMATION Raymond Kristiansen1, Thomas R. Krogstad2, Norway, Email: {thomakro, tommy.gravdahl}@itk.ntnu.no ABSTRACT In this paper we present two PID words: Spacecraft formation; integrator backstep- ping; PID+ control. 1. INTRODUCTION Synchronization

Gravdahl, Jan Tommy

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


China: Future Customer or Competitor in Livestock Markets? Thomas Hertel, Professor; Alejandro Nin, Graduate Research Assistant; Allan Rae, Professor at Massey  

E-Print Network [OSTI]

China: Future Customer or Competitor in Livestock Markets? Thomas Hertel, Professor; Alejandro Nin livestock trade, which has been relatively neglected. China is a net exporter of livestock products of total trade reflects a steady deterioration of China's com- parative advantage in pork and poul- try


The Use of Commingled Plastic Lumber as Construction Materials Thomas J. Nosker, Ph.D., Richard W. Renfree, Ph.D.  

E-Print Network [OSTI]

The Use of Commingled Plastic Lumber as Construction Materials Thomas J. Nosker, Ph.D., Richard W at avoiding land filling post-industrial and post-consumer plastics. This has resulted in creating a supply of impure plastics at much reduced prices with respect to virgin plastics. The possibility exists to clean


CAVERN: The CAVE Research Network Andrew E. Johnson, Jason Leigh, Thomas A. DeFanti, Maxine D. Brown, and Daniel J. Sandin  

E-Print Network [OSTI]

CAVERN: The CAVE Research Network Andrew E. Johnson, Jason Leigh, Thomas A. DeFanti, Maxine D CAVERN, the CAVE Research Network, is an alliance of industrial and research institutions equipped, to at least six in 1997 , so now EVL turns its attention to the design and implementation of CAVERN, the CAVE

Johnson, Andrew


Office of Purchasing 213 Thomas Boyd Hall -Baton Rouge -Louisiana -70803-3001 -225/578-2176 -FAX 225/578-2292  

E-Print Network [OSTI]

Office of Purchasing 213 Thomas Boyd Hall - Baton Rouge - Louisiana - 70803-3001 - 225 the Purchasing Office; payments will be made through the Office of Accounting Services. Attached is a certificate stands behind our transactions. Our chief business officer is Dr. Jerry J. Baudin, Vice Chancellor

Harms, Kyle E.


G.-L. THOMAS and SYDNEY YOUNG. -The vapour pressures, specific volumes, and critical constants of normal hexane (Tensions de vapeur, volumes spci-  

E-Print Network [OSTI]

propyle, puis purifi et distill onze fois. Toutes les fractions tudies avaient des proprits retir par distillation fractionne - par MM. Young et Thomas - d'un produit qualifi pentane prove- nant de la distillation du ptrole d'Amrique. Le point d'bullition ramen 760 millimtres est 36

Paris-Sud XI, Universit de


Progressive Perceptual Audio Rendering of Complex Scenes Thomas Moeck1,2 Nicolas Bonneel1 Nicolas Tsingos1 George Drettakis1  

E-Print Network [OSTI]

Progressive Perceptual Audio Rendering of Complex Scenes Thomas Moeck1,2 Nicolas Bonneel1 Nicolas sound sources. Audio is rendered in realtime with our progressive lossy processing technique using 15 and per- ceptual auditory masking, high quality rendering of complex virtual scenes with thousands

Paris-Sud XI, Universit de


PEEC-Models for EMC filter layout optimization Thomas De Oliveira, Jean-Michel Guichon, Jean-Luc Schanen, Laurent Gerbaud  

E-Print Network [OSTI]

PEEC-Models for EMC filter layout optimization Thomas De Oliveira, Jean-Michel Guichon, Jean France Abstract The subject of this paper is related to EMC filter integration. Due to stray interactions components. On the EMC Filter point of view, which represents usually 30% of the con- verter volume

Paris-Sud XI, Université de


Self-Sustaining Process through Streak Generation in a Flat-Plate Boundary Layer Thomas Duriez, Jean-Luc Aider, and Jose Eduardo Wesfreid  

E-Print Network [OSTI]

Self-Sustaining Process through Streak Generation in a Flat-Plate Boundary Layer Thomas Duriez July 2009; published 28 September 2009) The existence of a self-sustaining process between streamwise-bounded turbulence. The existence of a self- sustaining process (SSP) between these two flow structures has been

Wesfreid, José Eduardo


R/V Thomas G. Thompson Hazardous Material Storage and Inventory Sheet All hazardous material must be inventoried and accounted for by a Marine Technician BEFORE being  

E-Print Network [OSTI]

R/V Thomas G. Thompson Hazardous Material Storage and Inventory Sheet · All hazardous material must be inventoried and accounted for by a Marine Technician BEFORE being loaded aboard the vessel. · The correct inventory forms. · All safety equipment such as eye protection, aprons, gloves, respirators, etc. must

Wilcock, William


PowerWeb Testing of Various Auction Clearing Mechanisms for Electricity Robert J. Thomas, Fellow Timothy D. Mount , Ray D. Zimmerman, Member  

E-Print Network [OSTI]

PowerWeb Testing of Various Auction Clearing Mechanisms for Electricity Robert J. Thomas, Fellow. The Experimental Setup The Cornell group developed PowerWeb as a flexible web-based platform for performing it is difficult to study the actual, complex market rules analytically. · PowerWeb experiments are inexpensive


Large area bulk superconductors  

DOE Patents [OSTI]

A bulk superconductor having a thickness of not less than about 100 microns is carried by a polycrystalline textured substrate having misorientation angles at the surface thereof not greater than about 15.degree.; the bulk superconductor may have a thickness of not less than about 100 microns and a surface area of not less than about 50 cm.sup.2. The textured substrate may have a thickness not less than about 10 microns and misorientation angles at the surface thereof not greater than about 15.degree.. Also disclosed is a process of manufacturing the bulk superconductor and the polycrystalline biaxially textured substrate material.

Miller, Dean J. (Darien, IL); Field, Michael B. (Jersey City, NJ)



Western Area Power Administration  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun Deng Associate ResearchWestern Area Power


700 Area - Hanford Site  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies |November 2011 Mon, Next2025Steps to MakingImportance of700 Area


CEES - Focus Areas  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation InInformationCenterResearchCASL Symposium: Celebrating the Past - VisualizingFocus Areas


100 Area - Hanford Site  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies | BlandinePrincetonOPT Optics MetrologyDepartment of00 Area


T-1 Training Area  

SciTech Connect (OSTI)

Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.




T-1 Training Area  

ScienceCinema (OSTI)

Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.




Solar heat storages in district heating Klaus Ellehauge Thomas Engberg Pedersen  

E-Print Network [OSTI]

July 2007 . #12;#12;Solar heat storages in district heating networks July 2007 Klaus Ellehauge 97 22 11 tep@cowi.dk www.cowi.com #12;#12;Solar heat storages in district heating networks 5 in soil 28 5.3 Other experienced constructions: 30 6 Consequences of establishing solar heat in CHP areas


A Summary of Machine Learning Papers From IJCAI-85 Thomas G. Dietterich  

E-Print Network [OSTI]

learning apprentice systems and methods of explanation-based learning, although virtually all areas of ma apprentice systems". The paper by Mitchell, Mahade- van, and Steinberg discusses the notion of a learning apprentice as a learning system that watches an expert use a knowledge-based problem solving system


A Case for Bufferless Routing in On-Chip Networks Thomas Moscibroda  

E-Print Network [OSTI]

significant energy, occupy chip area, and increase design complexity. In this paper, we make a case for a new or flow control. We describe new algorithms for routing without using buffers in router input/output ports that rout- ing without buffers significantly reduces the energy consumption of the on-chip cache

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Bicycle Tracking Using Ellipse Extraction Tohid Ardeshiri, Fredrik Larsson, Fredrik Gustafsson, Thomas B. Schon, Michael Felsberg  

E-Print Network [OSTI]

Bicycle Tracking Using Ellipse Extraction Tohid Ardeshiri, Fredrik Larsson, Fredrik Gustafsson bicycles from imagery sensor data is proposed. It is based on detecting ellipsoids in the images, and treat these pair-wise using a dynamic bicycle model. One important application area is in automotive collision

Schön, Thomas


Surface Water Management Areas (Virginia)  

Broader source: Energy.gov [DOE]

This legislation establishes surface water management areas, geographically defined surface water areas in which the State Water Control Board has deemed the levels or supply of surface water to be...


Communication in Home Area Networks  

E-Print Network [OSTI]

used in area like smart buildings, street light controls andbuilding. This section focuses on HAN design to address two smart

Wang, Yubo



A review of "The Christian Soldier: Religious Tracts Published for Soldiers on Both Sides During and After the English Civil Wars." by Robert Thomas Fallon ed.  

E-Print Network [OSTI]

and historical studies pertaining to religious literature, censorship, the Civil War, and the history of the Church of England. Finally, it has much to say about the actual influence of Laud and his policies, the significance of religion and ideas... in historical causation, and the mechanisms by which effective censorship may occur. Robert Thomas Fallon, ed. The Christian Soldier: Religious Tracts Published for Soldiers on Both Sides During and After the English Civil Wars, 1642-1648. Tempe: Arizona...

Ellen J. Jenkins



Thomas-Fermi for Al+ Following the discusions on the positive ions in the lecture notes, we need to find c'(0) so that  

E-Print Network [OSTI]

Thomas-Fermi for Al+ Following the discusions on the positive ions in the lecture notes, we need to find c'(0) so that x0 c' Hx0 L = -HZ - NLê Z = -1 ê13 for Al+ . After some trial-and-error, I find c' H.7649 Now make sure x0 c' Hx0 L = -1 ê13, AlTF.nb 1 #12;In[4]:= Z x c'@xD ê. chisol ê. 8x ? x0

Murayama, Hitoshi


Fire Hazards Analysis for the 200 Area Interim Storage Area  

SciTech Connect (OSTI)

This documents the Fire Hazards Analysis (FHA) for the 200 Area Interim Storage Area. The Interim Storage Cask, Rad-Vault, and NAC-1 Cask are analyzed for fire hazards and the 200 Area Interim Storage Area is assessed according to HNF-PRO-350 and the objectives of DOE Order 5480 7A. This FHA addresses the potential fire hazards associated with the Interim Storage Area (ISA) facility in accordance with the requirements of DOE Order 5480 7A. It is intended to assess the risk from fire to ensure there are no undue fire hazards to site personnel and the public and to ensure property damage potential from fire is within acceptable limits. This FHA will be in the form of a graded approach commensurate with the complexity of the structure or area and the associated fire hazards.




Jerry and Jean Thomas: Thomas Farm  

E-Print Network [OSTI]

to the advent of cold storage and controlled-atmosphereIve forgotten now, in a cold storage before they could be

Farmer, Ellen



Northwest Area Foundation Horizons Program  

E-Print Network [OSTI]

Northwest Area Foundation Horizons Program Final Evaluation Report ­ Executive Summary Diane L by the Northwest Area Foundation in partnership with two national organizations and delivered by a number to remember that Horizons was not designed to reduce poverty, but instead to contribute to the Foundations

Amin, S. Massoud


Unscaled Scaled (% / km) Geographic Area /  

E-Print Network [OSTI]

226 Unscaled Scaled (% / km) Geographic Area / Assessment Unit DI Prod. N(eq) Sum Total Cumu subbasin, Washington. Geographic Area / Assessment Unit IntegratedPriorityRestoration Category Habitat% (unscaled results) of the combined protection benefit for summer steelhead within the Methow basin, and 51


tight environment high radiation area  

E-Print Network [OSTI]

#12;Irradiation Studies of Optical Components - II CERN, week of Oct. 24, 2005 1.4 GeV proton beam 4 x· tight environment · high radiation area · non-serviceable area · passive components · optics only, no active electronics · transmit image through flexible fiber bundle Optical Diagnostics 01-13-2006 1 #12

McDonald, Kirk


High-intensity positron microprobe at the Thomas Jefferson National Accelerator Facility  

SciTech Connect (OSTI)

We present a conceptual design for a novel continuous wave electron-linac based high-intensity high-brightness slow-positron production source with a projected intensity on the order of 10{sup 10?}e{sup +}/s. Reaching this intensity in our design relies on the transport of positrons (T{sub +} below 600?keV) from the electron-positron pair production converter target to a low-radiation and low-temperature area for moderation in a high-efficiency cryogenic rare gas moderator, solid Ne. This design progressed through Monte Carlo optimizations of: electron/positron beam energies and converter target thickness, transport of the e{sup +} beam from the converter to the moderator, extraction of the e{sup +} beam from the magnetic channel, a synchronized raster system, and moderator efficiency calculations. For the extraction of e{sup +} from the magnetic channel, a magnetic field terminator plug prototype has been built and experimental results on the effectiveness of the prototype are presented. The dissipation of the heat away from the converter target and radiation protection measures are also discussed.

Golge, S., E-mail: serkan.golge@nasa.gov; Vlahovic, B. [North Carolina Central University, Durham, North Carolina 27707 (United States); Wojtsekhowski, B. [Jefferson Laboratory, 12000 Jefferson Ave., Newport News, Virginia 23606 (United States)



Hanford 200 Areas Development Plan  

SciTech Connect (OSTI)

The purpose of the Hanford 200 Areas Development Plan (Development Plan) is to guide the physical development of the 200 Areas (which refers to the 200 East Area, 200 West Area, and 200 Area Corridor, located between the 200 East and 200 West Areas) in accordance with US Department of Energy (DOE) Order 4320.lB (DOE 1991a) by performing the following: Establishing a land-use plan and setting land-use categories that meet the needs of existing and proposed activities. Coordinating existing, 5-year, and long-range development plans and guiding growth in accordance with those plans. Establishing development guidelines to encourage cost-effective development and minimize conflicts between adjacent activities. Identifying site development issues that need further analysis. Integrating program plans with development plans to ensure a logical progression of development. Coordinate DOE plans with other agencies [(i.e., Washington State Department of Ecology (Ecology) and US Environmental Protection Agency (EPA)]. Being a support document to the Hanford Site Development Plan (DOE-RL 1990a) (parent document) and providing technical site information relative to the 200 Areas.

Rinne, C.A.; Daly, K.S.



Research Areas | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

High Energy Density Laboratory Plasmas Research Areas Research Areas High Energy Density Laboratory Plasmas (HEDLP) Research Areas During open solicitations proposals are sought...


Geology of the Wallula Gap Area, Washington. [Grande Ronde, Wanapum, and Saddle Mountains basalts  

SciTech Connect (OSTI)

This study focuses on the structure and stratigraphy of an 80-km/sup 2/ area at the southern margin of the Pasco Basin in Wallula Gap. Field stratigraphy, petrography, natural remanent magnetism, and major-element chemistry indicate that the tholeiitic basalt flows of the Wallula Gap area correlate with units of the Grande Ronde, Wanapum, and Saddle Mountains Formations of the Yakima Subgroup of the Columbia River Basalt Group. Flows of the Frenchman Springs, Umatilla, Pomona, Elephant Mountain, and Ice Harbor Mmebers are present in the area. The Frenchman Springs Member exposed in the Wallula Gap is more than 185 m thick and consists of eight to nine flows. Its thickness and possible contemporaneous structural deformation apparently prevented emplacement of both the Roza and Priest Rapids Members at this locality. Structural uplift of the Horse Heaven Hills began prior to extrusion of the Pomona flow. Both the Pomona and Elephant Mountain Members thin and pinch out over the crest of the uplift near Mound Pond. The Ice Harbor flow was apparently confined to the basin north of the Horse Heaven uplift, but an exposure at Mound Pond suggests it flowed through Wallula Gap as an intracanyon flow. The Wallula Gap fault zone trends N65/sup 0/W and can be traced for at least 11 km along the north flank of the Horse Heaven Hills uplift. Where the fault intersects the Olympic-Wallowa Lineament at Van Sycle Canyon 8 km east of Wallula Gap, it is a broad zone of normal faulting, 300 m wide, with as much as 310 m of displacement of the basalt stratigraphy. Two faults occur in the northern portion of Van Sycle Canyon and define a graben trending N45/sup 0/W. A third fault, roughly parallel to the Wallula Gap fault, transects the The Nub and offsets 14 m of Ice Harbor basalt.

Gardner, J.N.; Snow, M.G.; Fecht, K.R.



Progress Update: M Area Closure  

ScienceCinema (OSTI)

A progress update of the Recovery Act at work at the Savannah River Site. The celebration of the first area cleanup completion with the help of the Recovery Act.

Cody, Tom



Wellhead Protection Area Act (Nebraska)  

Broader source: Energy.gov [DOE]

This section regulates activities which can occur on or below the land surface of the area surrounding a wellhead. The purpose of these regulations is to limit well contamination and preserve...


Controlling Bats in Urban Areas  

E-Print Network [OSTI]

to avoid obstacles and capture insects. Bats also emit audible sounds that may be used for communi- cation. L-1913 4-08 Controlling BATS Damage In urban areas, bats may become a nuisance becauseoftheirsqueaking,scratchingandcrawl- inginattics...

Texas Wildlife Services



Protected Water Area System (Iowa)  

Broader source: Energy.gov [DOE]

The Natural Resource Commission maintains a state plan for the design and establishment of a protected water area system and those adjacent lands needed to protect the integrity of that system. A...


The Program Area Committee Chairperson.  

E-Print Network [OSTI]

worksheets and others. Prepared by Mary G. Marshall and Burl B. RichardsQ Extension program development specialists, The Texas A&M University System. THE PROGRAM AREA COMMITTEE CHAIRPERSON You Hold an Important Position! Whenever people gather...

Marshall, Mary; Richardson, Burl B.



Security Area Vouching and Piggybacking  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

Establishes requirements for the Department of Energy (DOE) Security Area practice of "vouching" or "piggybacking" access by personnel. DOE N 251.40, dated 5-3-01, extends this directive until 12-31-01.


Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Focus Area Tax Credits (Maryland)  

Broader source: Energy.gov [DOE]

Focus Area Tax Credits for businesses in Baltimore City or Prince Georges County enterprise zones include: (1) Ten-year, 80% credit against local real property taxes on a portion of real property...


Transforming Parks and Protected Areas  

E-Print Network [OSTI]

Transforming Parks and Protected Areas Policy and governance in a changing world Edited by Kevin S from the British Library Library of Congress Cataloging In Publication Data Transforming parks

Bolch, Tobias


Cuttings Analysis At International Geothermal Area, Philippines...  

Open Energy Info (EERE)

Cuttings Analysis At International Geothermal Area, Philippines (Laney, 2005) Exploration Activity Details Location International Geothermal Area Philippines Exploration Technique...


Biological Inventory Colorado Canyons National Conservation Area  

E-Print Network [OSTI]

Biological Inventory of the Colorado Canyons National Conservation Area Prepared by: Joe Stevens .............................. 12 Identify Targeted Inventory Areas


A review of "Hope and Healing: Painting in Italy in a Time of Plague" by Gauvin Alexander Bailey, Pamela M. Jones, Franco Mormando, and Thomas W. Worcester, eds.  

E-Print Network [OSTI]

. Worcester, eds. Hope and Healing: Painting in Italy in a Time of Plague, 1500- 1800. Worcester, Mass.: Clark University, College of the Holy Cross, Worcester Art Museum, 2005. viii + 264 pp. + 43 color and 68 b/w illus. $39.95. Review by JEFFREY... of the show, Thomas Worcester: ?This exhibition has sought to explore how early modern people (especially in Italy) thought about life and death, illness and health, plague and piety. It has sought to show how painting was a privileged expression of metaphors...

Fontana, Jeffrey



100 Areas CERCLA ecological investigations  

SciTech Connect (OSTI)

This document reports the results of the field terrestrial ecological investigations conducted by Westinghouse Hanford Company during fiscal years 1991 and 1992 at operable units 100-FR-3, 100-HR-3, 100-NR-2, 100-KR-4, and 100-BC-5. The tasks reported here are part of the Remedial Investigations conducted in support of the Comprehensive Environmental Response, compensation, and Liability Act of 1980 studies for the 100 Areas. These ecological investigations provide (1) a description of the flora and fauna associated with the 100 Areas operable units, emphasizing potential pathways for contaminants and species that have been given special status under existing state and/or federal laws, and (2) an evaluation of existing concentrations of heavy metals and radionuclides in biota associated with the 100 Areas operable units.

Landeen, D.S.; Sackschewsky, M.R.; Weiss, S.



Plutonium focus area: Technology summary  

SciTech Connect (OSTI)

To ensure research and development programs focus on the most pressing environmental restoration and waste management problems at the U.S. Department of Energy (DOE), the Assistant Secretary for the Office of Environmental Management (EM) established a working group in August 1993 to implement a new approach to research and technology development. As part of this approach, EM developed a management structure and principles that led to creation of specific focus areas. These organizations were designed to focus scientific and technical talent throughout DOE and the national scientific community on major environmental restoration and waste management problems facing DOE. The focus area approach provides the framework for inter-site cooperation and leveraging of resources on common problems. After the original establishment of five major focus areas within the Office of Technology Development (EM-50), the Nuclear Materials Stabilization Task Group (NMSTG, EM-66) followed EM-50`s structure and chartered the Plutonium Focus Area (PFA). NMSTG`s charter to the PFA, described in detail later in this book, plays a major role in meeting the EM-66 commitments to the Defense Nuclear Facilities Safety Board (DNFSB). The PFA is a new program for FY96 and as such, the primary focus of revision 0 of this Technology Summary is an introduction to the Focus Area; its history, development, and management structure, including summaries of selected technologies being developed. Revision 1 to the Plutonium Focus Area Technology Summary is slated to include details on all technologies being developed, and is currently planned for release in August 1996. The following report outlines the scope and mission of the Office of Environmental Management, EM-60, and EM-66 organizations as related to the PFA organizational structure.




EA-1177: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants, Richland, Washington  

Broader source: Energy.gov [DOE]

This EA evaluates the environmental impacts for the proposal to salvage and demolish the 200 West Area, 200 East Area, and 300 Area steam plants and their associated steam distribution piping...


Variable area light reflecting assembly  

DOE Patents [OSTI]

Device for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles.

Howard, Thomas C. (Raleigh, NC)



Variable area light reflecting assembly  

DOE Patents [OSTI]

Device is described for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles. 9 figs.

Howard, T.C.



Montana Natural Areas Act of 1974 (Montana)  

Broader source: Energy.gov [DOE]

The Montana Natural Areas Act of 1974 provides for the designation and establishment of a system of natural areas in order to preserve the natural ecosystems of these areas. Designated natural...


DAC-board based X-band EPR Spectrometer with Arbitrary Waveform Control Thomas Kaufmann1, Timothy J. Keller1, John M. Franck1, Ryan P. Barnes1, Steffen J.  

E-Print Network [OSTI]

DAC-board based X-band EPR Spectrometer with Arbitrary Waveform Control Thomas Kaufmann1, Timothy J; EPR; X-band; arbitrary waveform generation; transfer function; excitation profile Abstract We present resonance (EPR) spectrometer operating at 8­10 GHz (X-band) and controlled by a 1 GHz arbitrary waveform

Martinis, John M.


Optical Characterization ofMEMS Deformable Mirror Array Structures Soe-Mie F. Nee*a, Lewis F. DeSandrea, Thomas Bifano**b, Linda F. johnsona and Mark B. Morana  

E-Print Network [OSTI]

Sandrea, Thomas Bifano**b, Linda F. johnsona and Mark B. Morana aResearch Department, Naval Air Warfare Center. The mirror arrays are micro-electronic-mechanical system (MEMS) devices which were fabricated by Boston and electronic elements were fabricated through conventional surface micro-machining using polycrystalline


Innovation investment area: Technology summary  

SciTech Connect (OSTI)

The mission of Environmental Management`s (EM) Office of Technology Development (OTD) Innovation Investment Area is to identify and provide development support for two types of technologies that are developed to characterize, treat and dispose of DOE waste, and to remediate contaminated sites. They are: technologies that show promise to address specific EM needs, but require proof-of-principle experimentation; and (2) already proven technologies in other fields that require critical path experimentation to demonstrate feasibility for adaptation to specific EM needs. The underlying strategy is to ensure that private industry, other Federal Agencies, universities, and DOE National Laboratories are major participants in developing and deploying new and emerging technologies. To this end, about 125 different new and emerging technologies are being developed through Innovation Investment Area`s (IIA) two program elements: RDDT&E New Initiatives (RD01) and Interagency Agreements (RD02). Both of these activities are intended to foster research and development partnerships so as to introduce innovative technologies into other OTD program elements for expedited evaluation.

Not Available



World Lessons Thomas Turrentine  

E-Print Network [OSTI]

) ­ The Clinton Initiative ­ Rocky Mountain Institute ­ IEA Task 18 ­ UC Davis PH&EV Center (the WECE website) #12-4% till 2007, now 15% in 2012 ­ Early experiments prepared market, strategic timing of sales tax reduction waiting to buy) Lessons Learned in the Deployment of EVs during the 1990s · Annex 14 of the Implementation

California at Davis, University of


MATHEMATICAL Thomas L. Vincent  

E-Print Network [OSTI]

Alistair I. Mees Mathematics Depanment University of Western Australia Nedlands 6009 Western Australia Australia PREFACE Leslie S. Jennings Mathematics Depanmenl University of Western Australia Nedlands 6009 Western Australia Australia Library of Congress Cataloging-in-Publication Data Dynamics of complex

Maini, Philip K.


Meeting Recognition Thomas Hain  

E-Print Network [OSTI]

in the same room w In general, two interaction observers are used in o check on reliability. Two Interaction interaction observers are used in o check on reliability. Two Interaction Recorders are av numbers on holders;Meeting capture Illustration 1. Discussion group from observers' vantage point. Illustration 2. Discussion

Hain, Thomas


Interview of Keith Thomas  

E-Print Network [OSTI]

at knowing what you should read up to the age of nine, so I read works like 'The Wind in the Willows' and 'Treasure Island', classic children's stories; I then started reading a lot of popular history such as Marshall's 'Our Island Story' and 'The Boys Book...

Thomas, Keith



Thomas Campbell Christopher Williams  

E-Print Network [OSTI]

is gaining traction that may change the world. 3D Printing/Additive Manufacturing (AM) is a revolutionary as a written document can be emailed as a PDF and printed in 2D, an "STL" STrATEGIC FOrESIGhT report Could 3D Printing Change the World? Technologies, Potential, and Implications of Additive Manufacturing STr

Beex, A. A. "Louis"


Mohammad Azari Thomas Perkins  

E-Print Network [OSTI]

Microturbine 1mW/cm2 microelectromechanical turbine at 30 liters/min Heel Strike W with dielectric elastomer, 250700 mW with hydraulic piezoelectric actuator, 10 mW with piezoelectric insole

Nasipuri, Asis

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickrinformation for andFuel-Efficient Engines | ornl.gov


Monroe Thomas, Mechanical Technician  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment SurfacesResource ProgramModification andinterface of water.OrganicNov 4||


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions and IonEnergyIonsIowaIowa's


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions and IonEnergyIonsIowaIowa's8, 2012


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions and IonEnergyIonsIowaIowa's8,


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions and IonEnergyIonsIowaIowa's8,1,


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions and IonEnergyIonsIowaIowa's8,1,May


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions and


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions andOctober 5, 2012 11:00 am Iran


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions andOctober 5, 2012 11:00 am


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions andOctober 5, 2012 11:00


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions andOctober 5, 2012 11:00Thursday,


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions andOctober 5, 2012


Iran Thomas Auditorium, 8600  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfrared LandResponsesIon/Surface Reactions andOctober 5, 2012December 10,


Aquifer Protection Area Land Use Regulations (Connecticut)  

Broader source: Energy.gov [DOE]

These regulations describe allowable activities within aquifer protection areas, the procedure by which such areas are delineated, and relevant permit requirements. The regulations also describe...


Geothermal Literature Review At International Geothermal Area...  

Open Energy Info (EERE)

Latera area, Tuscany, re: Heat Flow References G. Ranalli, L. Rybach (2005) Heat Flow, Heat Transfer And Lithosphere Rheology In Geothermal Areas- Features And Examples...


Geothermal Literature Review At International Geothermal Area...  

Open Energy Info (EERE)

Hvalfjordur Fjord area, re: Heat flow References G. Ranalli, L. Rybach (2005) Heat Flow, Heat Transfer And Lithosphere Rheology In Geothermal Areas- Features And Examples...


Chickasaw National Recreational Area, Chickasaw, Oklahoma | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Chickasaw National Recreational Area, Chickasaw, Oklahoma Chickasaw National Recreational Area, Chickasaw, Oklahoma Photo of Comfort Station at the Chickasaw National Recreation...


RHIC | New Areas of Physics  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLas ConchasPassive Solar HomePromising Science for1 20115, 2001 MediaBrookhavenBlackA New Area of


History of 100-B Area  

SciTech Connect (OSTI)

The initial three production reactors and their support facilities were designated as the 100-B, 100-D, and 100-F areas. In subsequent years, six additional plutonium-producing reactors were constructed and operated at the Hanford Site. Among them was one dual-purpose reactor (100-N) designed to supply steam for the production of electricity as a by-product. Figure 1 pinpoints the location of each of the nine Hanford Site reactors along the Columbia River. This report documents a brief description of the 105-B reactor, support facilities, and significant events that are considered to be of historical interest. 21 figs.

Wahlen, R.K.


Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Surrounding Area Restaurants...Hungry  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of Energyof theRestoration at Young -Final»EnergySupportSurrounding Area


Resource Areas of Texas: Land.  

E-Print Network [OSTI]

Prairie (Coastal ~~~(l), soils are less acid and some are calcareous. Main series: lrictoria, Orelia, Clareville. ~ight, acid sands and darker, loamy to clayey soils-some $;dine and sodic-lie in a narrow band along the coast. Main aeries: Harris...). Mai series: Truce, Waurika, Brown, moderately deep 11 shallow, calcareous, clay1 a1 oils are alg common. Main series: (: 1 to alk nts; somt Bonti. ey soils >wens. over sh Bottomlands-minor areas or brown to clam gray, loam1 1 Main senes 3...

Godfrey, Curtis L.; Carter, Clarence R.; McKee, Gordon S.



Carlsbad Area Office strategic plan  

SciTech Connect (OSTI)

This edition of the Carlsbad Area Office Strategic Plan captures the U.S. Department of Energy`s new focus, and supercedes the edition issued previously in 1995. This revision reflects a revised strategy designed to demonstrate compliance with environmental regulations earlier than the previous course of action; and a focus on the selected combination of scientific investigations, engineered alternatives, and waste acceptance criteria for supporting the compliance applications. An overview of operations and historical aspects of the Waste Isolation Pilot Plant near Carlsbad, New Mexico is presented.




Geothermal resource evaluation of the Yuma area  

SciTech Connect (OSTI)

This report presents an evaluation of the geothermal potential of the Yuma, Arizona area. A description of the study area and the Salton Trough area is followed by a geothermal analysis of the area, a discussion of the economics of geothermal exploration and exploitation, and recommendations for further testing. It was concluded economic considerations do not favor geothermal development at this time. (ACR)

Poluianov, E.W.; Mancini, F.P.



Ashland Area Support Substation Project  

SciTech Connect (OSTI)

The Bonneville Power Administration (BPA) provides wholesale electric service to the City of Ashland (the City) by transferring power over Pacific Power Light Company's (PP L) 115-kilovolt (kV) transmission lines and through PP L's Ashland and Oak Knoll Substations. The City distributes power over a 12.5-kV system which is heavily loaded during winter peak periods and which has reached the limit of its ability to serve peak loads in a reliable manner. Peak loads under normal winter conditions have exceeded the ratings of the transformers at both the Ashland and Oak Knoll Substations. In 1989, the City modified its distribution system at the request of PP L to allow transfer of three megawatts (MW's) of electric power from the overloaded Ashland Substation to the Oak Knoll Substation. In cooperation with PP L, BPA installed a temporary 6-8 megavolt-amp (MVA) 115-12.5-kV transformer for this purpose. This additional transformer, however, is only a temporary remedy. BPA needs to provide additional, reliable long-term service to the Ashland area through additional transformation in order to keep similar power failures from occurring during upcoming winters in the Ashland area. The temporary installation of another 20-MVA mobile transformer at the Ashland Substation and additional load curtailment are currently being studied to provide for sustained electrical service by the peak winter period 1992. Two overall electrical plans-of-service are described and evaluated in this report. One of them is proposed for action. Within that proposed plan-of-service are location options for the substation. Note that descriptions of actions that may be taken by the City of Ashland are based on information provided by them.

Not Available



Safety analysis, 200 Area, Savannah River Plant: Separations area operations  

SciTech Connect (OSTI)

The nev HB-Line, located on the fifth and sixth levels of Building 221-H, is designed to replace the aging existing HB-Line production facility. The nev HB-Line consists of three separate facilities: the Scrap Recovery Facility, the Neptunium Oxide Facility, and the Plutonium Oxide Facility. There are three separate safety analyses for the nev HB-Line, one for each of the three facilities. These are issued as supplements to the 200-Area Safety Analysis (DPSTSA-200-10). These supplements are numbered as Sup 2A, Scrap Recovery Facility, Sup 2B, Neptunium Oxide Facility, Sup 2C, Plutonium Oxide Facility. The subject of this safety analysis, the, Plutonium Oxide Facility, will convert nitrate solutions of {sup 238}Pu to plutonium oxide (PuO{sub 2}) powder. All these new facilities incorporate improvements in: (1) engineered barriers to contain contamination, (2) barriers to minimize personnel exposure to airborne contamination, (3) shielding and remote operations to decrease radiation exposure, and (4) equipment and ventilation design to provide flexibility and improved process performance.

Perkins, W.C.; Lee, R.; Allen, P.M.; Gouge, A.P.



Plutonium focus area. Technology summary  

SciTech Connect (OSTI)

The Assistant Secretary for the Office of Environmental Management (EM) at the U.S. Department of Energy (DOE) chartered the Plutonium Focus Area (PFA) in October 1995. The PFA {open_quotes}...provides for peer and technical reviews of research and development in plutonium stabilization activities...{close_quotes} In addition, the PFA identifies and develops relevant research and technology. The purpose of this document is to focus attention on the requirements used to develop research and technology for stabilization, storage, and preparation for disposition of nuclear materials. The PFA Technology Summary presents the approach the PFA uses to identify, recommend, and review research. It lists research requirements, research being conducted, and gaps where research is needed. It also summarizes research performed by the PFA in the traditional research summary format. This document encourages researchers and commercial enterprises to do business with PFA by submitting research proposals or {open_quotes}white papers.{close_quotes} In addition, it suggests ways to increase the likelihood that PFA will recommend proposed research to the Nuclear Materials Stabilization Task Group (NMSTG) of DOE.




Critical Areas of State Concern (Maryland)  

Broader source: Energy.gov [DOE]

This legislation designates the Chesapeake Bay, other Atlantic Coastal Bays, and their tributaries and adjacent lands as critical areas of state concern. It is state policy to protect these areas...


Local Area Networks - Applications to Energy Management  

E-Print Network [OSTI]

LOCAL AREA NETWORKS - APPLICATIONS TO MERCY MANAGmNT Advanced BRUCE M. BAKKEN Software bfanager Micro Syatems Corporation Milwaukee, WI ABSTRACT One of the newest advances in computer technology is the Local Area Network. Its many...

Bakken, B. M.



Electricity Suppliers' Service Area Assignments (Indiana)  

Broader source: Energy.gov [DOE]

To promote efficiency and avoid waste and duplication, rural and unincorporated areas of Indiana are divided into geographic areas, to be assigned to an electricity provider that will have the sole...


Game Preserves and Closed Areas (Montana)  

Broader source: Energy.gov [DOE]

Game preserves and closed areas exist within the state of Montana for the protection of all the game animals and birds. Construction and development is limited in these areas. Currently, only three...


Optimization Online - All Areas Submissions - February 2011  

E-Print Network [OSTI]

Stochastic Optimization for Power System Configuration with Renewable Energy in Remote Areas Ludwig Kuznia, Bo Zeng, Grisselle Centeno, Zhixin Miao.


Considering LEDs for Street and Area Lighting  

Broader source: Energy.gov [DOE]

View Jim Brodrick's keynote video from the September 2009 IES Street and Area Lighting Conference in Philadelphia.


Cuttings Analysis At International Geothermal Area, Indonesia...  

Open Energy Info (EERE)

Indonesia (Laney, 2005) Exploration Activity Details Location International Geothermal Area Indonesia Exploration Technique Cuttings Analysis Activity Date Usefulness not indicated...


D-Area Preliminary Hazards Analysis  

SciTech Connect (OSTI)

A comprehensive review of hazards associated with the D-Area was performed to identify postulated event scenarios.

Blanchard, A. [Westinghouse Savannah River Company, AIKEN, SC (United States); Paik, I.R. [Westinghouse Safety Management Solutions, , ()



Original article Photosynthesis, leaf area and productivity  

E-Print Network [OSTI]

Original article Photosynthesis, leaf area and productivity of 5 poplar clones during; The stem volume and biomass (stem + branches) production, net photosynthesis of mature leaves and leaf area found in volume production, woody biomass production, total leaf area and net photosynthesis. Above

Paris-Sud XI, Universit de


Introduction Marine protected areas (MPA's) are  

E-Print Network [OSTI]

67(1) 1 Introduction Marine protected areas (MPA's) are an important tool for managing fisheries protected area is "any area of the marine environ- ment that has been reserved by Federal, State, tribal, territorial, or local laws or regulations to provide lasting protection for part or all of the natural



E-Print Network [OSTI]

ADJUSTED. #12;WHAT IS THE BIGGEST PROBLEM IN THE HOUSTON AREA TODAY? (1982-2012) 51 47 25 1510 36 71 27 10THE 2012 KINDER HOUSTON AREA SURVEY: Perspectives on a City inTransition STEPHEN L. KLINEBERG The GHP-Kinder Institute Luncheon and Release of the Findings, 24 April 2012 #12;KINDER HOUSTON AREA


Local control of area-preserving maps  

E-Print Network [OSTI]

We present a method of control of chaos in area-preserving maps. This method gives an explicit expression of a control term which is added to a given area-preserving map. The resulting controlled map which is a small and suitable modification of the original map, is again area-preserving and has an invariant curve whose equation is explicitly known.

Cristel Chandre; Michel Vittot; Guido Ciraolo



West Central North East Area of Tucson  

E-Print Network [OSTI]

0 500 1000 1500 2000 2500 3000 West Central North East Area of Tucson #Individuals Anna Broad-billed Costa Rufous Black-chinned 0 500 1000 1500 2000 2500 3000 West Central North East Area of Tucson not be conflicting, and urban areas may actually provide valuable surrogates for degraded habitats. Our knowledge

Hall, Sharon J.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Chemical and isotopic characteristics of the coso east flank...  

Open Energy Info (EERE)

appear to reflect convective circulation and equilibration within rocks close to the plastic-brittle transition. 3He4He signatures,in conjunction with relative volatile...


Chemical and isotopic characteristics of the coso east flank hydrothermal  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarreis aCallahanWindSyracuse,CER.pngGreatChateaufluids:



Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6TheoreticalFuelCell Energy IncFOR EGS DEVELOPMENT | Open


The Ohio Community Reinvestment Area (Ohio)  

Broader source: Energy.gov [DOE]

The Ohio Community Reinvestment Area program is an economic development tool administered by municipal and county government that provides real property tax exemptions for property owners who...


Radiation-dominated area metric cosmology  

E-Print Network [OSTI]

We provide further crucial support for a refined, area metric structure of spacetime. Based on the solution of conceptual issues, such as the consistent coupling of fermions and the covariant identification of radiation fields on area metric backgrounds, we show that the radiation-dominated epoch of area metric cosmology is equivalent to that epoch in standard Einstein cosmology. This ensures, in particular, successful nucleosynthesis. This surprising result complements the previously derived prediction of a small late-time acceleration of an area metric universe.

Frederic P. Schuller; Mattias N. R. Wohlfarth



Geothermal Literature Review At International Geothermal Area...  

Open Energy Info (EERE)

Taupo, North Island, re: Heat Flow References G. Ranalli, L. Rybach (2005) Heat Flow, Heat Transfer And Lithosphere Rheology In Geothermal Areas- Features And Examples...


White Etch Areas: Metallurgical Characterization and Atomistic...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Atomistic Modeling Presented by R. Scott Hyde of Timken Company at the 2014 Wind Turbine Tribology Seminar Timken Hyde White Etch Areas ANL Presentation Oct 2014...


Management of Specific Flood Plain Areas (Iowa)  

Broader source: Energy.gov [DOE]

Floodplain management orders by the Iowa Department of Natural Resources as well as approved local ordinances designate an area as a regulated floodplain. These regulations establish minimum...


Geographic Information System At International Geothermal Area...  

Open Energy Info (EERE)

Area, Indonesia (Nash, Et Al., 2002) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geographic Information System At International Geothermal...


Redevelopment of Areas Needing Redevelopment Generally (Indiana)  

Broader source: Energy.gov [DOE]

Redevelopment commissions are responsible for developing plans and managing tools used to address conditions of blight (redevelopment areas) and underutilized land of economic significance ...


DFAS Wide-Area Workflow Issues  

Broader source: Energy.gov [DOE]

Presentation covers the DFAS wide-area workflow issues and is given at the Spring 2011 Federal Utility Partnership Working Group (FUPWG) meeting.


Solar Power for Deployment in Populated Areas.  

E-Print Network [OSTI]

??The thesis presents background on solar thermal energy and addresses the structural challenges associated with the deployment of concentrating solar power fields in urban areas. (more)

Hicks, Nathan Andrew



Faculty & Staff Areas of Specialization ENGINEERING  

E-Print Network [OSTI]

. . . . . . . . . . . . . . . . .8 Engineering Engagement for Student Success (ENG2 ) . . . . .9 Division of Engineering Services Services WARREN R. HULL Manager, Engineering Communication Studio MIMI LAVALLE Director of CommunicationsFaculty & Staff Areas of Specialization 2010-2011 COLLEGE OF ENGINEERING #12;Faculty & Staff Areas

Harms, Kyle E.


Industrial & Systems Engineering Areas of Engineering Interests  

E-Print Network [OSTI]

Industrial & Systems Engineering Areas of Engineering Interests The Department of Industrial and Systems Engineering understands our students may work as Industrial Engineers in other engineering industries, and to help prepare them for these careers, the ISE Areas of Interest was formulated. The courses

Berdichevsky, Victor


Pine Ridge Area Community Wildfire Protection Plan  

E-Print Network [OSTI]

Pine Ridge Area Community Wildfire Protection Plan Update 2013 West Ash Fire: Wednesday August 29 the boundary of the original plan to include all the area within the Upper Niobrara White Natural Resource, 2012 #12;Facilitated by: Nebraska Forest Service In cooperation with: Region 23 Fire Protection

Farritor, Shane


Postdoctoral Scholar position Area: Mathematics Education  

E-Print Network [OSTI]

with the City of Calgary's vibrant energy and diversity. The university is home to scholars in 14 facultiesPostdoctoral Scholar position Area: Mathematics Education Duration: 18 months Start date: January 1, invites applications for a Postdoctoral Fellowship in the area of mathematics education. This competition

de Leon, Alex R.


ARRA Proposed Award: Retrofit Bay Area  

E-Print Network [OSTI]

ARRA Proposed Award: Retrofit Bay Area Counties of Alameda, Contra Costa, Marin, San Francisco per year Prime contractor: Association of Bay Area Governments (ABAG) Sub contractors: Alameda County Waste Management Authority (StopWaste.org) County of Contra Costa County of Marin City


7, 66876718, 2007 Mexico City area  

E-Print Network [OSTI]

Discussions Emissions from forest fires near Mexico City R. Yokelson1 , S. Urbanski2 , E. Atlas3 , D. Toohey4ACPD 7, 6687­6718, 2007 Mexico City area mountain fires R. Yokelson et al. Title Page Abstract to: R. Yokelson (bob.yokelson@umontana.edu) 6687 #12;ACPD 7, 6687­6718, 2007 Mexico City area

Boyer, Edmond


Alamo Area Regional Public Transportation Coordination Plan  

E-Print Network [OSTI]

KFH GROUP, INC. ALAMO AREA REGIONAL PUBLIC TRANSPORTATION COORDINATION PLAN Developed for: The Alamo Area Council of Governments and the San Antonio-Bexar County Metropolitan Planning Organization By: KFH Group..............................................................................................................................4 SUMMARY OF TRAVEL PATTERNS IN THE ALAMO REGION...............................................9 COORDINATION AND SERVICE ALTERNATIVES .................................................................16 COORDINATED TRANSPORTATION: PLANNED...

Alamo Area Council of Governments




E-Print Network [OSTI]

OU III BUILDING 96 RECOMMENDATION FOR SOURCE AREA REMEDIATION FINAL Prepared by: Brookhaven FOR U.S. Department of Energy March 2009 #12;i OU III BUILDING 96 RECOMMENDATION FOR SOURCE AREA..................................................................................................................4 4.0 Building 96 ­ Operational Background