Powered by Deep Web Technologies
Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Aeromagnetic Survey At Kilauea Southwest Rift And South Flank Area (Thomas,  

Open Energy Info (EERE)

Thomas, Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Aeromagnetic Survey At Kilauea Southwest Rift And South Flank Area (Thomas, 1986) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness useful DOE-funding Unknown Notes Aeromagnetic data (Godson et al., 1981) for the southwest rift appears to substantiate the presence of a thermal resource; there is a marked bipolar magnetic anomaly paralleling the rift zone from the summit to the lower rift near the coast suggesting either that intense hydrothermal alteration has occurred or that subsurface temperatures exceed the Curie temperature. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

2

Time-Domain Electromagnetics At Kilauea Southwest Rift And South Flank Area  

Open Energy Info (EERE)

And South Flank Area And South Flank Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Time-Domain Electromagnetics At Kilauea Southwest Rift And South Flank Area (Thomas, 1986) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Time-Domain Electromagnetics Activity Date Usefulness useful DOE-funding Unknown Notes The assessment effort consisted of a reexamination of existing Schlumberger sounding (Hussong and Cox, 1967; Adams et al., 1970) and time-domain electromagnetic (Klein and Kauahikaua, 1975) data for the rift area (Kauahikaua and Mattice, 1981) The electrical resistivity data acquired on the southwest rift delineated two distinct basement resistivity structures northwest of the rift zone: a high-resistivity basement at approximately 60

3

Direct-Current Resistivity At Kilauea Southwest Rift And South Flank Area  

Open Energy Info (EERE)

Direct-Current Resistivity At Kilauea Southwest Rift And South Flank Area Direct-Current Resistivity At Kilauea Southwest Rift And South Flank Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity At Kilauea Southwest Rift And South Flank Area (Thomas, 1986) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes The electrical resistivity data acquired on the southwest rift delineated two distinct basement resistivity structures northwest of the rift zone: a high-resistivity basement at approximately 60 m a.s.l, and located north of a prehistoric fissure, and a low-resistivity deep basement (20 m a.s.1.) to the south and east of this fissure (Figs 48, 49). These data suggest that a

4

Kilauea Southwest Rift And South Flank Geothermal Area | Open Energy  

Open Energy Info (EERE)

Kilauea Southwest Rift And South Flank Geothermal Area Kilauea Southwest Rift And South Flank Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Kilauea Southwest Rift And South Flank Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

5

Kilauea Southwest Rift And South Flank Geothermal Area | Open Energy  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Kilauea Southwest Rift And South Flank Geothermal Area (Redirected from Kilauea Southwest Rift And South Flank Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Kilauea Southwest Rift And South Flank Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: Hawaii

6

Magnetotellurics At Kilauea Southwest Rift And South Flank Area (Laney,  

Open Energy Info (EERE)

Laney, Laney, 2005) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Magnetotellurics At Kilauea Southwest Rift And South Flank Area (Laney, 2005) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Magnetotellurics Activity Date Usefulness not indicated DOE-funding Unknown Notes Magnetotelluric Imaging, G. Michael Hoversten. The project title derived from its inception. The project however moved from the application of MT on Kilauea in 2003 to the use of combined SP and conductivity mapping (MT) in 2004. The beginning of 2004 saw the completions of the Kilauea MT experiment by the acquisition of an additional 45 MT stations on Kilauea. We therefore decided to use the funds available to work at the Fort Bidwell

7

Thermal Gradient Holes At Hualalai Northwest Rift Area (Thomas, 1986) |  

Open Energy Info (EERE)

Hualalai Northwest Rift Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Thermal Gradient Holes Activity Date Usefulness not useful DOE-funding Unknown Notes Although not part of the current effort, two deep (approximately 2000 m) exploratory wells were drilled on the north flank of Hualalai near Puu Waawaa cinder cone. The geophysical data used for siting these wells were proprietary and hence unavailable for publication; however, the temperatures measured at the bottoms of the wells were reported to be below 20degrees C. Chemical analysis of water samples taken from these wells did not provide useful geothermal data due to contamination of the well water with drilling muds References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

8

Mercury Vapor At Hualalai Northwest Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mercury Vapor At Hualalai Northwest Rift Area (Thomas, 1986) Mercury Vapor At Hualalai Northwest Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Mercury Vapor Activity Date Usefulness not indicated DOE-funding Unknown Notes The Hualalai lower northwest rift and southern flank were sampled for soil mercury concentration and radon emanation rates (Cox and Cuff, 1981d). The data generated by these surveys yielded complex patterns of mercury concentrations and radon emanation rates that generally did not show coincident anomalies (Figs 42, 43). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

9

Gas Flux Sampling At Hualalai Northwest Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Hualalai Northwest Rift Area (Thomas, 1986) Hualalai Northwest Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Gas Flux Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes The Hualalai lower northwest rift and southern flank were sampled for soil mercury concentration and radon emanation rates (Cox and Cuff, 1981d). The data generated by these surveys yielded complex patterns of mercury concentrations and radon emanation rates that generally did not show coincident anomalies (Figs 42, 43). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

10

Self Potential At Hualalai Northwest Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Self Potential At Hualalai Northwest Rift Area (Thomas, 1986) Self Potential At Hualalai Northwest Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Self Potential At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Self Potential Activity Date Usefulness not indicated DOE-funding Unknown Notes Self-potential surveys conducted over the summit and flank of Hualalai (Jackson and Sako, 1982; D. B. Jackson, pers. commun., 1983) indicate an elongate self-potential anomaly extending across the summit and down the northwest rift to Kaupulehu Crater. The positively polarized anomaly extends over an area of approximately 6 km 2 and has been interpreted to be the result of one or more buried high-temperature intrusive bodies (Jackson

11

Direct-Current Resistivity At Kilauea East Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Kilauea East Rift Area (Thomas, 1986) Kilauea East Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes Electrical resistivity studies performed on the Kilauea East Rift Zone have employed a variety of techniques. Bipole mapping was conducted by Keller et al. (1977a) as part of the Hawaii Geothermal Project (HGP) geoscience program and was able to provide data on the regional resistivity structure of the summit and eastern flank of Kilauea. The model developed indicated several different types of resistivity sections depending on the location

12

Direct-Current Resistivity Survey At Kilauea East Rift Area (Thomas, 1986)  

Open Energy Info (EERE)

Kilauea East Rift Area (Thomas, 1986) Kilauea East Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes Electrical resistivity studies performed on the Kilauea East Rift Zone have employed a variety of techniques. Bipole mapping was conducted by Keller et al. (1977a) as part of the Hawaii Geothermal Project (HGP) geoscience program and was able to provide data on the regional resistivity structure of the summit and eastern flank of Kilauea. The model developed indicated several different types of resistivity sections depending on the location

13

Geothermometry At Honokowai Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

Geothermometry At Honokowai Area (Thomas, 1986) Geothermometry At Honokowai Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Honokowai Area (Thomas, 1986) Exploration Activity Details Location Honokowai Area Exploration Technique Geothermometry Activity Date Usefulness not indicated DOE-funding Unknown Notes Temperature and groundwater chemistry analyses were performed on three wells along the alluvial fan above Honokowai. Water temperatures were approximately 20degrees C and normal basal aquifer water chemistry was observed (Table 4). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Geothermometry_At_Honokowai_Area_(Thomas,_1986)&oldid=387033"

14

Geothermometry At Lahaina-Kaanapali Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Lahaina-Kaanapali Area (Thomas, 1986) Lahaina-Kaanapali Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Lahaina-Kaanapali Area (Thomas, 1986) Exploration Activity Details Location Lahaina-Kaanapali Area Exploration Technique Geothermometry Activity Date Usefulness not indicated DOE-funding Unknown Notes Groundwater temperature and chemistry surveys were similarly unable to identify any detectable thermal influence on the basal groundwaters. Silica concentrations and water temperatures (Table 4) were within the normal range expected for basal groundwaters receiving a limited amount of irrigation return water; chloride/magnesium ratios ranged downward from normal seawater values. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

15

Gas Flux Sampling At Kilauea East Rift Geothermal Area (Thomas...  

Open Energy Info (EERE)

1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Kilauea East Rift Geothermal Area (Thomas, 1986) Exploration Activity...

16

Field Mapping At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Field Mapping At Kilauea East Rift Area (Thomas, Field Mapping At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Field Mapping Activity Date Usefulness useful DOE-funding Unknown Notes Geologic mapping on the East Rift Zone (ERZ) conducted by Peterson (1967), J. Moore (1971), and Wright and Fiske (1971) detailed historic lava flows originating in the ERZ and developed structural models of the rift based on the locations and progressions of recorded eruptive cycles. These studies have more recently been expanded by Holcomb (1980, 1981) and R. Moore (1982, 1983) who have presented more detailed mapping of all surface flows (historic and prehistoric), fissures and faulting on the eastern flank of the Kilauea shield. The model developed from these studies is of a rift

17

Self Potential At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Self Potential At Kilauea East Rift Area (Thomas, Self Potential At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Self Potential Activity Date Usefulness useful DOE-funding Unknown Notes An extensive network of self-potential surveys have been performed over the summit and flanks of Kilauea as part of the HGP exploration surveys and in separate studies of the source mechanism for the potential anomalies observed (Zablocki, 1976, 1977). The geothermal exploration surveys were performed primarily on the lower East Rift Zone and identified four separate self-potential anomalies (Fig. 59) (Zablocki, 1977). The source mechanism for the anomalies observed was inferred to be the result of electrokinetic phenomena; thermal groundwater escaping from a geothermal

18

Aeromagnetic Survey At Kawaihae Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Kawaihae Area (Thomas, 1986) Kawaihae Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Aeromagnetic Survey At Kawaihae Area (Thomas, 1986) Exploration Activity Details Location Kawaihae Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness useful DOE-funding Unknown Notes The aeromagnetic data noted above refer to a low-level aeromagnetic survey that was flown over the entire island of Hawaii at an altitude of approximately 300 m. The results of the survey over Kawaihae clearly indicate an anomalously magnetized body between the town of Waimea and Kawaihae Bay to the west. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Aeromagnetic_Survey_At_Kawaihae_Area_(Thomas,_1986)&oldid=402415

19

Mercury Vapor At Haleakala Volcano Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mercury Vapor At Haleakala Volcano Area (Thomas, 1986) Mercury Vapor At Haleakala Volcano Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Haleakala Volcano Area (Thomas, 1986) Exploration Activity Details Location Haleakala Volcano Area Exploration Technique Mercury Vapor Activity Date Usefulness not indicated DOE-funding Unknown Notes The field survey program on the northwest rift zone consisted of soil mercury and radon emanometry surveys, groundwater temperature and chemistry studies, Schlumberger resistivity soundings and self-potential profiles. Geophysical and geochemical surveys along this rift (southwest) were limited by difficult field conditions and access limitations. The geophysical program consisted of one Schlumberger sounding, one

20

Geothermometry At Haleakala Volcano Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Geothermometry At Haleakala Volcano Area (Thomas, 1986) Geothermometry At Haleakala Volcano Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Haleakala Volcano Area (Thomas, 1986) Exploration Activity Details Location Haleakala Volcano Area Exploration Technique Geothermometry Activity Date Usefulness not indicated DOE-funding Unknown Notes The field survey program on the northwest rift zone consisted of soil mercury and radon emanometry surveys, groundwater temperature and chemistry studies, Schlumberger resistivity soundings and self-potential profiles. Geophysical and geochemical surveys along this rift (southwest) were limited by difficult field conditions and access limitations. The geophysical program consisted of one Schlumberger sounding, one

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Mercury Vapor At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mercury Vapor At Lualualei Valley Area (Thomas, 1986) Mercury Vapor At Lualualei Valley Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location Lualualei Valley Area Exploration Technique Mercury Vapor Activity Date Usefulness useful DOE-funding Unknown Notes Soil mercury and radon emanation surveys were performed over much of the accessible surface of Lualualei Valley (Cox and Thomas, 1979). The results of these surveys (Figs 7 and 8) delineated several areas in which soil mercury concentrations or radon emanation rates were substantially above normal background values. Some of these areas were apparently coincident with the mapped fracture systems associated with the caldera boundaries.

22

Field Mapping At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Field Mapping At Mokapu Penninsula Area (Thomas, Field Mapping At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Field Mapping Activity Date Usefulness useful DOE-funding Unknown Notes Geological mapping on Mokapu (Cox and Sinton, 1982) identified at least three separate volcanic vents within the study area and several other vents forming small islets around Mokapu. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Field_Mapping_At_Mokapu_Penninsula_Area_(Thomas,_1986)&oldid=510748" Category: Exploration Activities What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)

23

Geothermometry At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Geothermometry At Lualualei Valley Area (Thomas, 1986) Geothermometry At Lualualei Valley Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location Lualualei Valley Area Exploration Technique Geothermometry Activity Date Usefulness useful DOE-funding Unknown Notes Yhe extensive set of groundwater chemical data compiled for the wells in the valley (Table 1) showed that two of the primary indicators that have been commonly used in Hawaii for identifying geothermal potential (i.e. silica concentration and chloride to magnesium ion ratios) were anomalous in the groundwater of this survey area (Cox and Thomas, 1979). Several wells located on the caldera boundaries were found to have both

24

Water Sampling At Kauai Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

Kauai Area (Thomas, 1986) Kauai Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Kauai Area (Thomas, 1986) Exploration Activity Details Location Kauai Area Exploration Technique Water Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Groundwater geochemical data compiled for Kauai during the preliminary assessment identified a few very weak water chemistry anomalies, and although these anomalies could be interpreted to be the result of residual heat associated with Kauai's late-stage volcanism, the great age of this activity as well as the absence of any other detectable thermal effects suggests that this is very unlikely. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

25

Geothermometry At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Geothermometry At Mauna Loa Northeast Rift Area (Thomas, 1986) Geothermometry At Mauna Loa Northeast Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Mauna Loa Northeast Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Northeast Rift Area Exploration Technique Geothermometry Activity Date Usefulness useful DOE-funding Unknown Notes A reexamination of all groundwater sources in the Keaau area was undertaken in an effort to confirm the chemical and temperature anomalies that formed the primary basis on which the Keaau area was identified during the preliminary assessment survey. The data generated by this survey (Table 9) determined that all of the anomalous data present in the earlier data base were spurious and that the groundwater chemistry and temperatures in this

26

Mercury Vapor At Kawaihae Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

Mercury Vapor At Kawaihae Area (Thomas, 1986) Mercury Vapor At Kawaihae Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Kawaihae Area (Thomas, 1986) Exploration Activity Details Location Kawaihae Area Exploration Technique Mercury Vapor Activity Date Usefulness not useful DOE-funding Unknown Notes The soil geochemistry yielded quite complex patterns of mercury concentrations and radonemanation rates within the survey area (Cox and Cuff, 1981c). Mercury concentrations (Fig. 38) showed a general minimum along the Kawaihae-Waimea roads and a broad trend of increasing mercury concentrations toward both the north and south. There is no correlation apparent between the mercury patterns and either the resistivity sounding data or the surface geology in the area. The radon emanometry data (Fig.

27

Compound and Elemental Analysis At Kilauea Southwest Rift And South Flank  

Open Energy Info (EERE)

Flank Flank Area (Coombs, Et Al., 2006) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Compound and Elemental Analysis At Kilauea Southwest Rift And South Flank Area (Coombs, Et Al., 2006) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Compound and Elemental Analysis Activity Date Usefulness not indicated DOE-funding Unknown References Michelle L. Coombs, Thomas W. Sisson, Peter W. Lipman (2006) Growth History Of Kilauea Inferred From Volatile Concentrations In Submarine-Collected Basalts Retrieved from "http://en.openei.org/w/index.php?title=Compound_and_Elemental_Analysis_At_Kilauea_Southwest_Rift_And_South_Flank_Area_(Coombs,_Et_Al.,_2006)&oldid=510423"

28

Geothermometry At Kawaihae Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

Geothermometry At Kawaihae Area (Thomas, 1986) Geothermometry At Kawaihae Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Kawaihae Area (Thomas, 1986) Exploration Activity Details Location Kawaihae Area Exploration Technique Geothermometry Activity Date Usefulness useful DOE-funding Unknown Notes Groundwater chemical data are limited due to the small number of wells near Kawaihae; however, the data that are available strongly substantiate the presence of a thermal resource. A measured water temperature of 31 degrees C in one well is clearly above normal ambient temperatures, and the chloride/magnesium ion ratio in the same well is elevated substantially above the normal range (Table 8). Both of these data provide strong evidence that at least a low-level thermal anomaly is present in the area.

29

Mercury Vapor At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mokapu Penninsula Area (Thomas, 1986) Mokapu Penninsula Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Mercury Vapor Activity Date Usefulness not useful DOE-funding Unknown Notes The high degree of cultural activity (e.g. residential areas, streets, jet runways, etc.) on Mokapu both limited the extent of the soil geochemical surveys performed and rendered their interpretation much more difficult. Soil mercury concentrations and radon emanometry data on the peninsula showed a few localized high values (Figs 13, 14), but no consistent correlation between the anomalous zones and geologic features could be

30

Aeromagnetic Survey At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Aeromagnetic Survey At Mokapu Penninsula Area (Thomas, 1986) Aeromagnetic Survey At Mokapu Penninsula Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Aeromagnetic Survey At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes A separate geophysical analysis performed on the Koolau caldera area (Kauahikaua, 1981 a) synthesized existing self-potential, gravity, seismic and aeromagnetic data with recently acquired resistivity soundings. An analysis of the observed remnant magnetization within the caldera complex suggested that subsurface temperatures ranged from less than 300degrees C to no more than 540degrees C. The resistivity data indicated that the

31

Soil Sampling At Molokai Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

Soil Sampling At Molokai Area (Thomas, 1986) Soil Sampling At Molokai Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Soil Sampling At Molokai Area (Thomas, 1986) Exploration Activity Details Location Molokai Area Exploration Technique Soil Sampling Activity Date Usefulness useful DOE-funding Unknown Notes Due to the very small potential market on the island of Molokai for geothermal energy, only a limited effort was made to confirm a resource in the identified PGRA. An attempt was made to locate the (now abandoned) water well that was reported to have encountered warm saline fluids. The well was located but had caved in above the water table and thus no water sampling was possible. Temperature measurements in the open portion of the well were performed, but no temperatures significantly above ambient were

32

Static Temperature Survey At Molokai Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Molokai Area (Thomas, 1986) Molokai Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Static Temperature Survey At Molokai Area (Thomas, 1986) Exploration Activity Details Location Molokai Area Exploration Technique Static Temperature Survey Activity Date Usefulness useful DOE-funding Unknown Notes Due to the very small potential market on the island of Molokai for geothermal energy, only a limited effort was made to confirm a resource in the identified PGRA. An attempt was made to locate the (now abandoned) water well that was reported to have encountered warm saline fluids. The well was located but had caved in above the water table and thus no water sampling was possible. Temperature measurements in the open portion of the well were performed, but no temperatures significantly above ambient were

33

Self Potential At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Self Potential At Mokapu Penninsula Area (Thomas, Self Potential At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Self Potential Activity Date Usefulness not indicated DOE-funding Unknown Notes A separate geophysical analysis performed on the Koolau caldera area (Kauahikaua, 1981 a) synthesized existing self-potential, gravity, seismic and aeromagnetic data with recently acquired resistivity soundings. An analysis of the observed remnant magnetization within the caldera complex suggested that subsurface temperatures ranged from less than 300degrees C to no more than 540degrees C. The resistivity data indicated that the electrical basement, to a depth of 900 m, had resistivities ranging from 42 ohm.m to more than 1000 ohm.m, which is considered to be within the

34

Water Sampling At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Water Sampling At Mokapu Penninsula Area (Thomas, Water Sampling At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Water Sampling Activity Date Usefulness could be useful with more improvements DOE-funding Unknown Notes Chemical analysis of groundwater from Mokapu was severely restricted by the absence of drilled wells; the only groundwater sources present were five shallow, brackish ponds, Chemical data indicated that all of the ponds consisted of seawater diluted by varying amounts of fresh surface water; no thermal alteration was revealed by the water chemistry (Table 2). Available temperature and water chemistry data on the Koolau caldera area were also assessed as part of the Mokapu study. The results of this analysis (Table

35

Direct-Current Resistivity Survey At Hualalai Northwest Rift Area (Thomas,  

Open Energy Info (EERE)

Hualalai Northwest Rift Area (Thomas, Hualalai Northwest Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes A total of seven Schlumberger soundings were performed on Hualalai. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Direct-Current_Resistivity_Survey_At_Hualalai_Northwest_Rift_Area_(Thomas,_1986)&oldid=510528" Category: Exploration Activities What links here Related changes

36

Ground Gravity Survey At Mokapu Penninsula Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Ground Gravity Survey At Mokapu Penninsula Area Ground Gravity Survey At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Ground Gravity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes A separate geophysical analysis performed on the Koolau caldera area (Kauahikaua, 1981 a) synthesized existing self-potential, gravity, seismic and aeromagnetic data with recently acquired resistivity soundings. An analysis of the observed remnant magnetization within the caldera complex suggested that subsurface temperatures ranged from less than 300degrees C to no more than 540degrees C. The resistivity data indicated that the electrical basement, to a depth of 900 m, had resistivities ranging from 42 ohm.m to more than 1000 ohm.m, which is considered to be within the

37

Aeromagnetic Survey At Hualalai Northwest Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Aeromagnetic Survey At Hualalai Northwest Rift Area Aeromagnetic Survey At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness useful DOE-funding Unknown Notes Aeromagnetic survey data for Hualalai (Godson et al., 1981) clearly indicate an elongate northwest to southeast trending zone of extremely low total magnetic field over the summit region of Hualalai that extends into the upper northwest rift zone. It is extremely unlikely that the summit region is underlain by intrusive material old enough (greater than 700,000 years of age) to have been emplaced during a period of reversed magnetic field; therefore, the only alternative explanation possible (presuming the data are accurate) is that this region is underlain by material with very

38

Direct-Current Resistivity At Lualualei Valley Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Lualualei Valley Area (Thomas, 1986) Lualualei Valley Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location Lualualei Valley Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes Three Schlumberger resistivity soundings were performed in Lualualei Valley (Mattice and Kauahikaua, 1979). K840 Interpretation of the resistivity soundings suggests that the source of the warm water layer within the valley was the dense dike complex associated with the ancient magma chamber of Waianae volcano. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from

39

Direct-Current Resistivity Survey At Lualualei Valley Area (Thomas, 1986) |  

Open Energy Info (EERE)

Lualualei Valley Area (Thomas, 1986) Lualualei Valley Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location Lualualei Valley Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes Three Schlumberger resistivity soundings were performed in Lualualei Valley (Mattice and Kauahikaua, 1979). K840 Interpretation of the resistivity soundings suggests that the source of the warm water layer within the valley was the dense dike complex associated with the ancient magma chamber of Waianae volcano. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii

40

Time-Domain Electromagnetics At Haleakala Volcano Area (Thomas, 1986) |  

Open Energy Info (EERE)

Time-Domain Electromagnetics At Haleakala Volcano Time-Domain Electromagnetics At Haleakala Volcano Area (Thomas, 1986) Exploration Activity Details Location Haleakala Volcano Area Exploration Technique Time-Domain Electromagnetics Activity Date Usefulness useful DOE-funding Unknown Notes Controlled-source electromagnetic soundings were found to be substantially more successful in the southwest rift than either the Schlumberger or the self-potential studies. This was largely due to the ability of time-domain methods to penetrate high-resistivity surface layers and thus to define lower-resistivity sections at depth. The results of this sounding study, which was conducted at elevations ranging from 75 to 497 m a.s.l., generally indicated moderate- to lowresistivity (6 - 7 ohm.m) sections to depths of 1 km on the lower rift zone and higher resistivities (12-16

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Direct-Current Resistivity Survey At Kilauea Southwest Rift And South Flank  

Open Energy Info (EERE)

Direct-Current Resistivity Survey At Kilauea Southwest Rift And South Flank Direct-Current Resistivity Survey At Kilauea Southwest Rift And South Flank Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Kilauea Southwest Rift And South Flank Area (Thomas, 1986) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes The electrical resistivity data acquired on the southwest rift delineated two distinct basement resistivity structures northwest of the rift zone: a high-resistivity basement at approximately 60 m a.s.l, and located north of a prehistoric fissure, and a low-resistivity deep basement (20 m a.s.1.) to

42

Self Potential At Mauna Loa Southwest Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Southwest Rift Area (Thomas, 1986) Southwest Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Self Potential At Mauna Loa Southwest Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Southwest Rift Area Exploration Technique Self Potential Activity Date Usefulness not indicated DOE-funding Unknown Notes Field surveys in the South Point area were limited to a series of Schlumberger soundings and a self-potential traverse across the rift zone. The absence of groundwater wells and time and funding constraints precluded any geochemical field surveys. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Self_Potential_At_Mauna_Loa_Southwest_Rift_Area_(Thomas,_1986)&oldid=389751

43

Direct-Current Resistivity Survey At Mauna Loa Southwest Rift Area (Thomas,  

Open Energy Info (EERE)

Area (Thomas, Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Mauna Loa Southwest Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Southwest Rift Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Field surveys in the South Point area were limited to a series of Schlumberger soundings and a self-potential traverse across the rift zone. The absence of groundwater wells and time and funding constraints precluded any geochemical field surveys. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Direct-Current_Resistivity_Survey_At_Mauna_Loa_Southwest_Rift_Area_(Thomas,_1986)&oldid=510541"

44

Field Mapping At Lualualei Valley Area (Thomas, 1986) | Open...  

Open Energy Info (EERE)

primarily toward identifying the lithology and structure of the Waianae caldera (Sinton, 1979). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment...

45

Refraction Survey At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Kilauea East Rift Area (Thomas, 1986) Kilauea East Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction Survey At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Refraction Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Seismic refraction surveys conducted by Broyles and Furumoto (1978) and Suyenaga et al. (1978) developed a cross-sectional model of the rift zone near the present site of HGP-A that proposed a 12- 17 km wide dike complex lying at a depth of 2 to 3 km (Fig. 51). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Refraction_Survey_At_Kilauea_East_Rift_Area_(Thomas,_1986)&oldid=386690"

46

Mercury Vapor At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mauna Loa Northeast Rift Area (Thomas, 1986) Mauna Loa Northeast Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Mauna Loa Northeast Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Northeast Rift Area Exploration Technique Mercury Vapor Activity Date Usefulness not indicated DOE-funding Unknown Notes Soil mercury and radon emanometry sampling conducted in the Keaau prospect were similarly unable to define any anomalies that could reasonably be interpreted to be due to subsurface thermal effects. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Mercury_Vapor_At_Mauna_Loa_Northeast_Rift_Area_(Thomas,_1986)&oldid=390060

47

Aeromagnetic Survey At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Rift Area (Thomas, 1986) Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Aeromagnetic Survey At Mauna Loa Northeast Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Northeast Rift Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness useful DOE-funding Unknown Notes Aeromagnetic data (Godson et al., 1981) for the lower northeast rift of Mauna Loa tend to substantiate this conclusion as well. The lower extension of the rift zone does not exhibit any significant magnetic features that would correspond to a thermal source within the inferred trace of the rift zone. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Aeromagnetic_Survey_At_Mauna_Loa_Northeast_Rift_Area_(Thomas,_1986)&oldid=40242

48

Gas Flux Sampling At Mauna Loa Northeast Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Gas Flux Sampling At Mauna Loa Northeast Rift Area (Thomas, 1986) Gas Flux Sampling At Mauna Loa Northeast Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Mauna Loa Northeast Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Northeast Rift Area Exploration Technique Gas Flux Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Soil mercury and radon emanometry sampling conducted in the Keaau prospect were similarly unable to define any anomalies that could reasonably be interpreted to be due to subsurface thermal effects. References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii Retrieved from "http://en.openei.org/w/index.php?title=Gas_Flux_Sampling_At_Mauna_Loa_Northeast_Rift_Area_(Thomas,_1986)&oldid=389039"

49

Gas Flux Sampling At Haleakala Volcano Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Gas Flux Sampling At Haleakala Volcano Area (Thomas, 1986) Gas Flux Sampling At Haleakala Volcano Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Haleakala Volcano Area (Thomas, 1986) Exploration Activity Details Location Haleakala Volcano Area Exploration Technique Gas Flux Sampling Activity Date Usefulness useful DOE-funding Unknown Notes The field survey program on the northwest rift zone consisted of soil mercury and radon emanometry surveys, groundwater temperature and chemistry studies, Schlumberger resistivity soundings and self-potential profiles. Geophysical and geochemical surveys along this rift (southwest) were limited by difficult field conditions and access limitations. The geophysical program consisted of one Schlumberger sounding, one

50

Gas Flux Sampling At Lualualei Valley Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Gas Flux Sampling At Lualualei Valley Area (Thomas, 1986) Gas Flux Sampling At Lualualei Valley Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location Lualualei Valley Area Exploration Technique Gas Flux Sampling Activity Date Usefulness useful DOE-funding Unknown Notes Soil mercury and radon emanation surveys were performed over much of the accessible surface of Lualualei Valley (Cox and Thomas, 1979). The results of these surveys (Figs 7 and 8) delineated several areas in which soil mercury concentrations or radon emanation rates were substantially above normal background values. Some of these areas were apparently coincident with the mapped fracture systems associated with the caldera boundaries.

51

Direct-Current Resistivity At Honokowai Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Honokowai Area (Thomas, 1986) Honokowai Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity At Honokowai Area (Thomas, 1986) Exploration Activity Details Location Honokowai Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not useful DOE-funding Unknown Notes Three Schlumberger resistivity surveys were attempted on the alluvial plain around Honokowai (Fig. 22). Two of the soundings penetrated to a moderate-resistivity basement, interpreted to be seawater-saturated basalt, whereas the other sounding encountered a high-resistivity intermediate layer which could not be adequately penetrated to allow resolution of the basement resistivity (Mattice, 1981). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

52

Direct-Current Resistivity Survey At Honokowai Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Honokowai Area (Thomas, 1986) Honokowai Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Honokowai Area (Thomas, 1986) Exploration Activity Details Location Honokowai Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not useful DOE-funding Unknown Notes Three Schlumberger resistivity surveys were attempted on the alluvial plain around Honokowai (Fig. 22). Two of the soundings penetrated to a moderate-resistivity basement, interpreted to be seawater-saturated basalt, whereas the other sounding encountered a high-resistivity intermediate layer which could not be adequately penetrated to allow resolution of the basement resistivity (Mattice, 1981). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

53

Aeromagnetic Survey At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Thomas, 1986) Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Aeromagnetic Survey At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness useful DOE-funding Unknown Notes More recent aeromagnetic data (Godson et al., 1981) generally substantiate the presence of a nearly continuous rift zone from the Kilauea summit down to sea level; the apparent width of the magnetic anomaly does not appear to match that projected by Furumoto (1978a) or Broyles et al. (1979); however, to date, no detailed analysis of the more recent data has been completed (R. B. Moore, pers. commun., 1984). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

54

Mercury Vapor At Lahaina-Kaanapali Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mercury Vapor At Lahaina-Kaanapali Area (Thomas, 1986) Mercury Vapor At Lahaina-Kaanapali Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Lahaina-Kaanapali Area (Thomas, 1986) Exploration Activity Details Location Lahaina-Kaanapali Area Exploration Technique Mercury Vapor Activity Date Usefulness not indicated DOE-funding Unknown Notes The soil mercury concentration and radon emanometry patterns observed for the Lahaina prospect were similar to those found in Olowalu. Several localized zones of high mercury concentration or enhanced radon emanation were observed, but showed little relationship to each other or to the recognized geologic structure in the area. The data were interpreted to suggest that there might be a small thermal anomaly to the northeast of the

55

Gas Flux Sampling At Lahaina-Kaanapali Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Gas Flux Sampling At Lahaina-Kaanapali Area (Thomas, 1986) Gas Flux Sampling At Lahaina-Kaanapali Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Lahaina-Kaanapali Area (Thomas, 1986) Exploration Activity Details Location Lahaina-Kaanapali Area Exploration Technique Gas Flux Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes The soil mercury concentration and radon emanometry patterns observed for the Lahaina prospect were similar to those found in Olowalu. Several localized zones of high mercury concentration or enhanced radon emanation were observed, but showed little relationship to each other or to the recognized geologic structure in the area. The data were interpreted to suggest that there might be a small thermal anomaly to the northeast of the

56

Gas Flux Sampling At Mokapu Penninsula Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Gas Flux Sampling At Mokapu Penninsula Area (Thomas, 1986) Gas Flux Sampling At Mokapu Penninsula Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Gas Flux Sampling Activity Date Usefulness not useful DOE-funding Unknown Notes The high degree of cultural activity (e.g. residential areas, streets, jet runways, etc.) on Mokapu both limited the extent of the soil geochemical surveys performed and rendered their interpretation much more difficult. Soil mercury concentrations and radon emanometry data on the peninsula showed a few localized high values (Figs 13, 14), but no consistent correlation between the anomalous zones and geologic features could be

57

Gas Flux Sampling At Olowalu-Ukumehame Canyon Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Gas Flux Sampling At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Gas Flux Sampling At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Exploration Activity Details Location Olowalu-Ukumehame Canyon Area Exploration Technique Gas Flux Sampling Activity Date Usefulness could be useful with more improvements DOE-funding Unknown Notes Soil mercury concentration and radon emanometry surveys were conducted along the stream beds in both Olowalu and Ukumehame Canyons and on the coastal alluvial fans (Cox and Cuff, 1981a). The results of these surveys indicated that a few minor -nomalies might be present. However, the extreme topographic relief in the area did not permit sufficient coverage of the

58

Direct-Current Resistivity At Kawaihae Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Kawaihae Area (Thomas, 1986) Kawaihae Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity At Kawaihae Area (Thomas, 1986) Exploration Activity Details Location Kawaihae Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes In addition to the aeromagnetic data, the field survey program in Kawaihae included six Schlumberger resistivity soundings between Kawaihae and Waimea (Kauahikaua and Mattice, 1981). The results of these sounding (Fig. 35) detected apparent resistivity differences in the surface rock depending on whether the soundings were done on Kohala or Mauna Kea lavas (Figs 36, 37), whereas uniform resistivities of 650- 850 ohm.m were found at depths of

59

Thermal Gradient Holes At Kilauea East Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Thermal Gradient Holes At Kilauea East Rift Area (Thomas, 1986) Thermal Gradient Holes At Kilauea East Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Thermal Gradient Holes At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Thermal Gradient Holes Activity Date Usefulness useful DOE-funding Unknown Notes Two separate phases of geothermal exploratory drilling have occurred on the lower East Rift. The first was essentially a wildcat venture with relatively little surface exploratory data having been gathered, whereas the second was initiated after somewhat more geoscience information had been acquired under the Hawaii Geothermal Project. The results of the successful exploratory drilling program on the Kilauea

60

Field Mapping At Olowalu-Ukumehame Canyon Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Field Mapping At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Exploration Activity Details Location Olowalu-Ukumehame Canyon Area Exploration Technique Field Mapping Activity Date Usefulness not useful DOE-funding Unknown Notes Geologic mapping (Diller, 1982) in this area has identified several trachitic and alkalic dikes, plugs, and vents within the area bounded by the canyons (Fig. 21). The frequency distribution of those dikes in the two

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Direct-Current Resistivity At Lahaina-Kaanapali Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

At Lahaina-Kaanapali Area At Lahaina-Kaanapali Area (Thomas, 1986) Exploration Activity Details Location Lahaina-Kaanapali Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Four Schlumberger soundings were performed along the coastal strip adjacent to Lahaina town (Fig. 22). Three of the four soundings were able to detect a moderate to low-resistivity basement that was interpreted to be basalt saturated with seawater at 20degrees C (Mattice, 1981). None of the resistivity sounding data in this area indicated subsurface resistivities lower than could be accounted for by local ambient temperatures (Mattice and Lienert, 1980). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In Hawaii

62

Gas Flux Sampling At Kawaihae Area (Thomas, 1986) | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Gas Flux Sampling At Kawaihae Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Kawaihae Area (Thomas, 1986) Exploration Activity Details Location Kawaihae Area Exploration Technique Gas Flux Sampling Activity Date Usefulness not useful DOE-funding Unknown Notes The soil geochemistry yielded quite complex patterns of mercury concentrations and radonemanation rates within the survey area (Cox and Cuff, 1981c). Mercury concentrations (Fig. 38) showed a general minimum along the Kawaihae-Waimea roads and a broad trend of increasing mercury

63

Mercury Vapor At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Mercury Vapor At Kilauea East Rift Area (Thomas, Mercury Vapor At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Mercury Vapor Activity Date Usefulness not indicated DOE-funding Unknown Notes The sampling network for soil mercury concentrations undertaken by Cox (1981) identified a complicated pattern of mercury concentrations throughout the lower Puna area (Fig. 60). The highest soil mercury concentrations found were generally located within the rift zone, but an analysis of the data showed that soil type and soil pH also had a marked impact on mercury concentration. Making corrections for these effects improved the correspondence between the surface geological expression of the rift zone and the mercury concentrations observed; interpretation of

64

Micro-Earthquake At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Micro-Earthquake At Kilauea East Rift Area (Thomas, Micro-Earthquake At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Micro-Earthquake Activity Date Usefulness not indicated DOE-funding Unknown Notes Microseismic and ground noise studies were performed along the East Rift Zone in an effort to identify areas in which earthquake activity might suggest rock fracturing as a result of cold water coming into contact with heated reservoir rocks (Furumoto, 1978a). One of the microseismic surveys utilized an array of seven seismometers to monitor earthquake activity in the vicinity of the then proposed site of the HGP-A well (Fig. 53) (Suyenaga and Furumoto, 1978). The second microearthquake study utilized only two seismometers located near the junction of the Pahoa-Kalapana and

65

Mercury Vapor At Olowalu-Ukumehame Canyon Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Mercury Vapor At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Mercury Vapor At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Exploration Activity Details Location Olowalu-Ukumehame Canyon Area Exploration Technique Mercury Vapor Activity Date Usefulness could be useful with more improvements DOE-funding Unknown Notes Soil mercury concentration and radon emanometry surveys were conducted along the stream beds in both Olowalu and Ukumehame Canyons and on the coastal alluvial fans (Cox and Cuff, 1981a). The results of these surveys

66

Gas Flux Sampling At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Gas Flux Sampling At Kilauea East Rift Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Gas Flux Sampling At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Gas Flux Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Radon emanometry data for the same locality (Fig. 61) (Cox, 1980) similarly presented a complicated pattern of radon outgassing along the lower rift zone. Even though complexities are present within the rift zone, there

67

Direct-Current Resistivity At Haleakala Volcano Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Direct-Current Resistivity At Haleakala Volcano Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity At Haleakala Volcano Area (Thomas, 1986) Exploration Activity Details Location Haleakala Volcano Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes The field survey program on the northwest rift zone consisted of soil mercury and radon emanometry surveys, groundwater temperature and chemistry studies, Schlumberger resistivity soundings and self-potential profiles.

68

Ground Gravity Survey At Kilauea East Rift Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

Ground Gravity Survey At Kilauea East Rift Area Ground Gravity Survey At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Ground Gravity Survey Activity Date Usefulness useful DOE-funding Unknown Notes This model was later expanded through the examination of detailed and regional gravity data (Krivoy and Eaton, 1961) and regional aeromagnetic data (Malahoff and Woollard, 1966) to a three-dimensional map of the rift zone (Furumoto, 1978b). This model projected a dike complex (presumably at high temperatures) which has a width of approximately 20 km near the summit of Kilauea that narrows to approximately 12 km at the lower quarter of the subaerial portion of the rift (Fig. 52). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

69

Water Sampling At Kilauea East Rift Area (Thomas, 1986) | Open Energy  

Open Energy Info (EERE)

Water Sampling At Kilauea East Rift Area (Thomas, Water Sampling At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Water Sampling Activity Date Usefulness useful DOE-funding Unknown Notes Studies of groundwater and coastal spring- sources that have identified thermal fluids on the lower East Rift Zone date back to the early part of this century (Guppy, 1906). More recent investigations of temperature and groundwater chemistry were performed for the HGP geoscience program (Macdonald, 1977; McMurtry et al., 1977; Epp and Halunen, 1979). Epp and Halunen (1979) identified several warm water wells, one having a temperature in excess of 90degrees C, and coastal springs in lower Puna; temperature profiles obtained by this study indicated that in some

70

Direct-Current Resistivity Survey At Lahaina-Kaanapali Area (Thomas, 1986)  

Open Energy Info (EERE)

Survey At Survey At Lahaina-Kaanapali Area (Thomas, 1986) Exploration Activity Details Location Lahaina-Kaanapali Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Four Schlumberger soundings were performed along the coastal strip adjacent to Lahaina town (Fig. 22). Three of the four soundings were able to detect a moderate to low-resistivity basement that was interpreted to be basalt saturated with seawater at 20degrees C (Mattice, 1981). None of the resistivity sounding data in this area indicated subsurface resistivities lower than could be accounted for by local ambient temperatures (Mattice and Lienert, 1980). References Donald M. Thomas (1 January 1986) Geothermal Resources Assessment In

71

Direct-Current Resistivity Survey At Kawaihae Area (Thomas, 1986) | Open  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Direct-Current Resistivity Survey At Kawaihae Area (Thomas, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Direct-Current Resistivity Survey At Kawaihae Area (Thomas, 1986) Exploration Activity Details Location Kawaihae Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes In addition to the aeromagnetic data, the field survey program in Kawaihae included six Schlumberger resistivity soundings between Kawaihae and Waimea (Kauahikaua and Mattice, 1981). The results of these sounding (Fig. 35)

72

Direct-Current Resistivity Survey At Mokapu Penninsula Area (Thomas, 1986)  

Open Energy Info (EERE)

Direct-Current Resistivity Survey At Mokapu Direct-Current Resistivity Survey At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu Penninsula Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Geophysical surveys on Mokapu were restricted to three Schlumberger soundings (Fig. 17). The results of these soundings appeared to indicate a highly resistive surface section underlain by one or more layers of intermediate to low resistivity (Fig. 18). Basement resistivities in all cases were less than 3 ohm.m and were interpreted to correspond to alluvial layers saturated with cold seawater (Lienert, 1982). --- A separate geophysical analysis performed on the Koolau caldera area (Kauahikaua, 1981 a) synthesized existing self-potential, gravity, seismic and aeromagnetic

73

Time-Domain Electromagnetics At Kilauea East Rift Area (Thomas, 1986) |  

Open Energy Info (EERE)

Time-Domain Electromagnetics At Kilauea East Rift Time-Domain Electromagnetics At Kilauea East Rift Area (Thomas, 1986) Exploration Activity Details Location Kilauea East Rift Area Exploration Technique Time-Domain Electromagnetics Activity Date Usefulness useful DOE-funding Unknown Notes A series of time-domain electromagnetic (TDEM) soundings were also performed in the lower East Rift Zone as part of the HGP exploration program (Klein and Kauahikaua, 1975; Kauahikaua and Klein, 1977); this work was recently expanded to include additional TDEM and vertical electrical soundings, and the entire data set was reinterpreted (Kauahikaua, 1981b; Kauahikaua and Mattice, 1981). The resistivity model presented by Kauahikaua (1981b) suggests that moderate to high basement resistivities, corresponding to cold freshwater saturated basalts, are present north of

74

Direct-Current Resistivity Survey At Mauna Loa Northeast Rift Area (Thomas,  

Open Energy Info (EERE)

Direct-Current Resistivity Survey At Mauna Loa Direct-Current Resistivity Survey At Mauna Loa Northeast Rift Area (Thomas, 1986) Exploration Activity Details Location Mauna Loa Northeast Rift Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness useful DOE-funding Unknown Notes The vertical electrical sounding surveys encountered few difficulties and were able to resolve basement resistivities in all locations. The resistivity sections derived indicated a 3000- 20,000 ohm.m surface layer underlain by a 500- 900 ohm-m cold freshwatersaturated layer and a basement layer of less than 100 ohm.m (Kauahikaua and Mattice, 1981). The depth of penetration of these soundings was estimated to be about 800 m to 900 m b.s.1. and thus the basement resistivities probably correspond to basalts

75

Time-Domain Electromagnetics At Hualalai Northwest Rift Area (Thomas, 1986)  

Open Energy Info (EERE)

Time-Domain Electromagnetics At Hualalai Northwest Time-Domain Electromagnetics At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details Location Hualalai Northwest Rift Area Exploration Technique Time-Domain Electromagnetics Activity Date Usefulness useful DOE-funding Unknown Notes Three time-domain electromagnetic soundings were conducted on the middle northwest rift at elevations of 280-320 m (Fig. 40) (Kauahikaua and Mattice, 1981). These soundings penetrated to a greater depth than the Schlumberger soundings and two of them were able to resolve basement resistivities ranging from 9 to 12 ohm-m at depths of 1500 to 1800 m. One sounding detected a 9 ohm.m layer at 600 m depth that was underlain by a more resistive basement. These results suggest that thermal fluids may be responsible for the low-resistivity basement, whereas the high-resistivity

76

Direct-Current Resistivity Survey At Haleakala Volcano Area (Thomas, 1986)  

Open Energy Info (EERE)

Direct-Current Resistivity Survey At Haleakala Direct-Current Resistivity Survey At Haleakala Volcano Area (Thomas, 1986) Exploration Activity Details Location Haleakala Volcano Area Exploration Technique Direct-Current Resistivity Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes The field survey program on the northwest rift zone consisted of soil mercury and radon emanometry surveys, groundwater temperature and chemistry studies, Schlumberger resistivity soundings and self-potential profiles. Geophysical and geochemical surveys along this rift (southwest) were limited by difficult field conditions and access limitations. The geophysical program consisted of one Schlumberger sounding, one self-potential profile and one controlled-source electromagnetic sounding. The geochemical data collected included a reconnaissance soil mercury and

77

GEOLOGIC FRAMEWORK OF THE EAST FLANK, COSO GEOTHERMAL FIELD: IMPLICATIONS  

Open Energy Info (EERE)

GEOLOGIC FRAMEWORK OF THE EAST FLANK, COSO GEOTHERMAL FIELD: IMPLICATIONS GEOLOGIC FRAMEWORK OF THE EAST FLANK, COSO GEOTHERMAL FIELD: IMPLICATIONS FOR EGS DEVELOPMENT Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: GEOLOGIC FRAMEWORK OF THE EAST FLANK, COSO GEOTHERMAL FIELD: IMPLICATIONS FOR EGS DEVELOPMENT Details Activities (1) Areas (1) Regions (0) Abstract: The Coso Geothermal Field is a large, high temperature system located in eastern California on the western edge of the Basin and Range province. The East Flank of this field is currently under study as a DOE-funded Enhanced Geothermal Systems (EGS) project. This paper summarizes petrologic and geologic investigations on two East Flank wells, 34A-9 and 34-9RD2 conducted as part of a continuing effort to better understand how the rocks will behave during hydraulic and thermal stimulation. Well 34A-9

78

Chemical and isotopic characteristics of the coso east flank hydrothermal  

Open Energy Info (EERE)

isotopic characteristics of the coso east flank hydrothermal isotopic characteristics of the coso east flank hydrothermal fluids: implications for the location and nature of the heat source Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: Chemical and isotopic characteristics of the coso east flank hydrothermal fluids: implications for the location and nature of the heat source Details Activities (1) Areas (1) Regions (0) Abstract: Fluids have been sampled from 9 wells and 2 fumaroles from the East Flank of the Coso hydrothermal system with a view to identifying, if possible, the location and characteristics of the heat source inflows into this portion of the geothermal field. Preliminary results show that there has been extensive vapor loss in the system, most probably in response to

79

NREL: Biomass Research - Thomas Foust  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas Foust Thomas Foust Photo of Thomas Foust Dr. Thomas Foust is an internationally recognized expert in the biomass field. His areas of expertise include feedstock production, biomass-to-fuels conversion technologies, and environmental and societal sustainability issues associated with biofuels. He has more than 20 years of research and research management experience, specializing in biomass feedstocks and conversion technologies. As National Bioenergy Center Director, Dr. Foust guides and directs NREL's research efforts to develop biomass conversion technologies via biochemical and thermochemical routes, as well as critical research areas addressing the sustainability of biofuels. This research focuses on developing the necessary science and technology for converting biomass to biofuels,

80

Optical Diagnostics Thomas Tsang  

E-Print Network (OSTI)

Optical Diagnostics Thomas Tsang · tight environment · high radiation area · non-serviceable area · passive components · optics only, no active electronics · transmit image through flexible fiber bundle #12;New imaging fiber bundle Core size: 12 µm, diameter: 1/8" Optical Diagnostics Total fiber counts ~50

McDonald, Kirk

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Teleseismic-Seismic Monitoring At Kilauea Southwest Rift And South Flank  

Open Energy Info (EERE)

Teleseismic-Seismic Monitoring At Kilauea Southwest Rift And South Flank Teleseismic-Seismic Monitoring At Kilauea Southwest Rift And South Flank Area (Wyss, Et Al., 2001) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Teleseismic-Seismic Monitoring At Kilauea Southwest Rift And South Flank Area (Wyss, Et Al., 2001) Exploration Activity Details Location Kilauea Southwest Rift And South Flank Area Exploration Technique Teleseismic-Seismic Monitoring Activity Date Usefulness could be useful with more improvements DOE-funding Unknown Notes In spite of the complications discovered in this b-value analysis of Kilauea's South Flank, there are many similarities with the case histories of the other volcanoes we have studied, and the correlation of high b-value anomalies withmagma reservoirs is confirmed.

82

NREL: Energy Analysis - Thomas Jenkin  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas Jenkin Thomas Jenkin Photo of Thomas Jenkin. Thomas Jenkin is a member of the Washington D.C. Office in the Strategic Energy Analysis Center. Senior Energy Analyst On staff since August 2004 Phone number: 202-488-2219 E-mail: thomas.jenkin@nrel.gov Areas of expertise Valuation and risk management Market structure and operation of natural gas and power markets Economic analysis of storage technologies Research and development (R&D) Primary research interests R&D and commercialization of energy technologies Risk and uncertainty The value of storage Economic and market analysis of renewable energy technologies Education and background training MPPM, Yale School of Management D.Phil. in physics, University of Oxford B.Sc. in physics, University of Bristol Teaching experience

83

Thomas Kirchstetter  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas Kirchstetter Thomas Kirchstetter Sustainable Energy Systems Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 70R0108B Berkeley CA 94720 Office Location: 90-2024J (Office), 70-215 (Lab) (510) 486-7071 TWKirchstetter@lbl.gov Dr. Kirchstetter is a Staff Scientist at Lawrence Berkeley National Laboratory, where he is a Deputy Leader in the Sustainable Energy Systems Group and a member of the Heat Island Group. He studies the role of particulate matter in the environment as it relates to energy use, climate, and air quality. He has more than 50 refereed archival journal papers and holds a concurrent appointment at the University of California, Berkeley as an Associate Adjunct Professor in the Civil and Environmental Engineering Department. Tom's current research interests include:

84

Monroe Thomas, Mechanical Technician  

NLE Websites -- All DOE Office Websites (Extended Search)

Monroe Thomas, Mechanical Technician Print The weekend before the ALS was scheduled to start up again after the most recent shutdown, mechanical technician Monroe Thomas kept...

85

Thomas Richardson  

NLE Websites -- All DOE Office Websites (Extended Search)

Richardson Richardson Electrochemical Technologies Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 62-0203 Berkeley CA 94720 Office Location: 62-0321 (510) 486-8619 TJRichardson@lbl.gov This publications database is an ongoing project, and not all Division publications are represented here yet. Publications 2012 Liu, Xiaosong, Jun Liu, Ruimin Qiao, Yan Yu, Hong Li, Liumin Suo, Yong-sheng Hu, Yi-De Chuang, Guojiun Shu, Fangcheng Chou et al. "Phase Transformation and Lithiation Effect on Electronic Structure of LixFePO4: An In-Depth Study by Soft X-ray and Simulations." Journal of the American Chemical Society 134, no. 33 (2012): 13708-13715. 2011 Chen, Guoying, Alpesh K. Shukla, Xiangyun Song, and Thomas J. Richardson. "Improved Kinetics and Stabilities in Mg-Sybstained Li-MnPO4." J. of

86

NREL: Energy Analysis - Thomas R. Schneider  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas R. Schneider Thomas R. Schneider Photo of Thomas R. Schneider Thomas R. Schneider is a member of the Washington D.C. Office in the Strategic Energy Analysis Center. Principal Analyst - Strategic Energy Analysis On staff since March 2009 Phone number: 202-488-2206 E-mail: thomas.schneider@nrel.gov Areas of expertise Distributed generation and storage Advanced power generation and transmission technologies Technology assessment Strategic and scenario planning R&D policy and management Primary research interests Variable renewable resources and the grid Role of electrification in society Energy efficiency and demand response Energy storage Education and background training Ph.D. in physics, University of Pennsylvania B.S., Stevens Institute of Technology (High Honors) Prior work experience

87

Anomalously High B-Values In The South Flank Of Kilauea Volcano, Hawaii-  

Open Energy Info (EERE)

Anomalously High B-Values In The South Flank Of Kilauea Volcano, Hawaii- Anomalously High B-Values In The South Flank Of Kilauea Volcano, Hawaii- Evidence For The Distribution Of Magma Below Kilauea'S East Rift Zone Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Anomalously High B-Values In The South Flank Of Kilauea Volcano, Hawaii- Evidence For The Distribution Of Magma Below Kilauea'S East Rift Zone Details Activities (1) Areas (1) Regions (0) Abstract: The pattern of b-value of the frequency-magnitude relation, or mean magnitude, varies little in the Kaoiki-Hilea area of Hawaii, and the b-values are normal, with b=0.8 in the top 10 km and somewhat lower values below that depth. We interpret the Kaoiki-Hilea area as relatively stable, normal Hawaiian crust. In contrast, the b-values beneath Kilauea's South

88

IN SITU STRESS, FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF THE COSO  

Open Energy Info (EERE)

IN SITU STRESS, FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF THE COSO IN SITU STRESS, FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF THE COSO GEOTHERMAL FIELD Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: IN SITU STRESS, FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF THE COSO GEOTHERMAL FIELD Details Activities (1) Areas (1) Regions (0) Abstract: High rock temperatures, a high degree of fracturing, high tectonic stresses, and low permeability are the combination of qualities that define an ideal candidate-Enhanced Geothermal System (EGS) reservoir. The Coso Geothermal Field is an area where fluid temperatures exceeding 300°C have been measured at depths less than 10,000 feet and the reservoir is both highly fractured and tectonically stressed. Some of the wells within this portion of the reservoir are relatively impermeable,

89

Piggyback Tectonics- Long-Term Growth Of Kilauea On The South Flank Of  

Open Energy Info (EERE)

Piggyback Tectonics- Long-Term Growth Of Kilauea On The South Flank Of Piggyback Tectonics- Long-Term Growth Of Kilauea On The South Flank Of Mauna Loa Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Piggyback Tectonics- Long-Term Growth Of Kilauea On The South Flank Of Mauna Loa Details Activities (0) Areas (0) Regions (0) Abstract: Compositional and age data from offshore pillow lavas and volcaniclastic sediments, along with on-land geologic, seismic, and deformation data, provide broad perspectives on the early growth of Kilauea Volcano and the long-term geometric evolution of its rift zones. Sulfur-rich glass rinds on pillow lavas and volcaniclastic sediments derived from them document early underwater growth of a large compositionally diverse alkalic edifice. The alkalic rocks yield 40Ar / 39Ar ages as old as about 275 ka; transitional-composition lavas, which

90

Age And Nature Of Deposits On The Submarine Flanks Of Piton De La Fournaise  

Open Energy Info (EERE)

Age And Nature Of Deposits On The Submarine Flanks Of Piton De La Fournaise Age And Nature Of Deposits On The Submarine Flanks Of Piton De La Fournaise (Reunion Island) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Age And Nature Of Deposits On The Submarine Flanks Of Piton De La Fournaise (Reunion Island) Details Activities (0) Areas (0) Regions (0) Abstract: Debris-avalanche deposits are by far the most extensive and voluminous formations in the submarine domain around Reunion Island. 21 sites sampled offshore of Piton de la Fournaise were studied. All the dredged rocks have a volcanic origin and often consist of blocks buried in a finer-grained matrix. Both massive and vesiculated samples were found, but only rare fragments of pillow lavas were encountered. All the lavas are basalts with variable amounts of olivine. A few plagioclase-bearing basalts

91

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

Thursday, December 6, 2012 11:00 am Iran Thomas Auditorium, 8600 1000 Shapes and 1000 Uses of Designer Carbon Nanostructures David Tomnek Physics and Astronomy Department,...

92

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

February 17, 2011 2:00 pm Iran Thomas Auditorium, 8600 Field-Based Simulations for the Design of Polymer Nanostructures Glenn H. Fredrickson Mitsubishi Professor of Chemical...

93

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

April 19, 2013 11:00 am Iran Thomas Auditorium, 8600 New Methods for Controlling the Structures and Functions of Synthetic Polymers Christopher Bielawski University of Texas at...

94

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

August 27, 2010 11:00 am Iran Thomas Auditorium, 8600 Theory of dielectric and ferroelectric properties of ultrathin films and superlattices David Vanderbilt Department of Physics...

95

Western Area Power Administration (WFP) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

future. Western Area Power Administration Responsible Contacts Thomas Wheeler Director, Workforce Analysis & Planning Division E-mail thomas.wheeler@hq.doe.gov Phone (202)...

96

Thomas Johnson | Department of Energy  

Office of Environmental Management (EM)

Thomas Johnson About Us Thomas Johnson - Technical Writer for the Office of Fossil Energy Most Recent An Important Step Forward for CCUS November 20...

97

OPTICAL FLANK WEAR MONITORING OF CUTTING TOOLS BY IMAGE PROCESSING  

E-Print Network (OSTI)

zone; zone B, a plateau, a more or less uniform wear land, falling between the two grooves. Two toolOPTICAL FLANK WEAR MONITORING OF CUTTING TOOLS BY IMAGE PROCESSING J. U. JEON and S. W. KIM An optoelectronic method for in situ monitoring of the flank wear of cutting tools is presented. The method is based

Kim, Yong Jung

98

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

September 27, 2012 2:00 pm Iran Thomas Auditorium, 8600 Exploring the Physics of Graphene with Local Probes Joseph A. Stroscio Center for Nanoscale Science and Technology, NIST...

99

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

May 3, 2012 4:00 pm Iran Thomas Auditorium, 8600 Understanding the Behavior of Nanoscale Magnetic Heterostructures: How Microscopy Can Help Amanda K. Petford-Long Center for...

100

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

October 5, 2012 11:00 am Iran Thomas Auditorium, 8600 Role of van der Waals Interactions in Physics, Chemistry, and Biology Matthias Scheffler Fritz-Haber-Institut der...

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Pilar Thomas | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pilar Thomas Pilar Thomas About Us Pilar Thomas - Deputy Director, Office of Indian Energy Policy and Programs Pilar Thomas Pilar Thomas (Pascua Yaqui) is the Deputy Director in the Office of Indian Energy Policy and Programs. As Deputy Director, Ms. Thomas assists the Director in developing national energy policy and programs related to Indian energy development. Ms. Thomas is also responsible for developing and implementing policy efforts within the Department and federal government to achieve the Office's Indian Energy policy objectives. Prior to joining the Department, Ms. Thomas served as the Deputy Solicitor for Indian Affairs in the U.S. Department of the Interior. Appointed as Deputy Solicitor in September 2009, Ms. Thomas was responsible for providing day to day legal advice and counsel to the Secretary, the

102

St. Thomas More College St. Thomas More College (STM)  

E-Print Network (OSTI)

leaders that will, in turn, build a more just and sustainable society. For those who so desire, we offerSt. Thomas More College #12;St. Thomas More College (STM) You can take STM classes as part of your U of S degree program even if you are not an STM student. 2 | St. Thomas More College University

Saskatchewan, University of

103

Thomas Wheeler | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Description Departmental staffing budget; PMA scorecard; hiring metrics Last Name Wheeler First Name THomas Title Director, Workforce Analysis & Planning Division...

104

The Terry Thomas  

Seattle, WA The Terry Thomas was designed to provide a healthy and creative work environment that would illustrate the possibilities of sustainable design. The project was driven by a future tenant who needed a new office space to accommodate a rapidly expanding architectural practice. The firm wanted to remain in the same neighborhood where it had operated for seventeen years, yet in a building that would exemplify commitment to sustainable design. The Terry Thomas is located in Seattle's up-and-coming South Lake Union neighborhood, adjacent to downtown.

105

Thomas Weaver art director  

E-Print Network (OSTI)

, G'04, Jeff Wakefield photography Steven Alvarez, Raj Chawla, Alain Denis, Michael Lewis, Shayne Lynn Theresa Miller Vermont Quarterly 86 South Williams Street Burlington, VT 05401 (802) 656-1100 theresa South Williams Street Burlington, VT 05401 (802) 656-2005 thomas.weaver@uvm.edu vermont Quarterly

Hayden, Nancy J.

106

Thomas Reddinger Director, Steam  

E-Print Network (OSTI)

Thomas Reddinger Director, Steam Operations Steven Richards Assistant Manager of Maintenance Supervisor (Distribution) Deborah Moorhead Office Coordinator III Martin Bower Steam Plant Operator Richard Redfield Steam Plant Operator SU Steam Station/Chilled Water Plant Bohdan Sawa Steam Plant Operator Robert

McConnell, Terry

107

Mr. Thomas Dwyer  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Dwyer Thomas Dwyer 5007 Clarevalley Drive Cincinnati, OH 45238 Dear Mr. Dwyer: Department of Energy Washington, DC 20585 OCT -4 2000 Re: OHA Case No. VBB-0005 This letter concerns the complaint of reprisal that you submitted to the Department of Energy under 10 C.F.R. Part 708. You have filed a petition for Secretarial review of the appeal decision issued to you on July 24, 2000. The Part 708 regulations applicable to the petition provide that the Secretary will reverse or revise an appeal decision by the Director of the Office of Hearings and Appeals only under extraordinary circumstances. 10 C.F.R. § 708.35(d). After fully evaluating all the issues that you raised in your filing dated September 8, 2000, I have determined that you have not shown that

108

Thomas B. Watson | BNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas B. Watson Thomas B. Watson Chemist Watson is a Chemist and has been the leader of the Tracer Technology Group for 7 years. He has more than 21 years experience in atmospheric transport and dispersion research using intentionally released tracer compounds. His research has been focused on the processes of short- and long-range atmospheric diffusion, dispersion, and transport, and on the chemical transformation of natural and anthropogenic compounds in the atmosphere. Most of his work has been in the design, execution, and interpretation of field measurement programs and has been used in the development of predictive tools for the national security and emergency response communities. He has supervised tracer, release, sampling, and analysis for two field campaigns for Urban Dispersion Program and four programs for the

109

BNL | Thomas Roser  

NLE Websites -- All DOE Office Websites (Extended Search)

Roser Roser Thomas Roser Chair of the Collider-Accelerator Department photo of Thomas Roser With about 400 employees and an annual budget of $140 million, C-AD develops, improves and operates a suite of accelerators used for experiments by an international community of about 1,500 scientists. The department also designs and constructs new accelerators in support of the Laboratory's and national missions. Roser earned a Ph.D. in physics from the Swiss Federal Institute of Technology in Zurich in 1984. He became a research fellow at the University of Michigan in the same year and was appointed assistant professor of physics at the university in 1990. He joined Brookhaven Lab as an associate physicist in 1991, and, in 1994, he became the head of the Accelerator Division for Brookhaven's Alternating Gradient Synchrotron Department,

110

Automatic Fracture Reduction Thomas Albrecht and Thomas Vetter  

E-Print Network (OSTI)

Automatic Fracture Reduction Thomas Albrecht and Thomas Vetter University of Basel Abstract. We segmented from CT scans. The result of this virtual fracture reduction is intended to be used an operation plan. We propose to achieve automatic fracture reduction by fitting the bone fragments

Vetter, Thomas

111

Thomas Jefferson National Accelerator Facility Technology Marketing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas Jefferson National Accelerator Facility Technology Marketing Summaries Here you'll find marketing summaries for technologies available for licensing from the Thomas...

112

Thomas Johnson, Jr | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Johnson, Jr About Us Thomas Johnson, Jr, Director - Office of Environmental Management's Recovery Act Program Most Recent Celebrating Successes of Environmental Management...

113

NREL: Energy Sciences - Thomas Gennett  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas Gennett Thomas Gennett Senior Scientist Photo of Thomas Gennett Phone: (303) 384-6628 Email: thomas.gennett@nrel.gov Thomas Gennett is currently a senior scientist at NREL and holds Professor Emeritus of Chemistry and Materials Science status with the Rochester Institute of Technology (RIT). At NREL, Dr. Gennett leads three distinct projects. One focuses on the mechanism of room temperature hydrogen adsorption for carbon based sorbents, the second on the development of advanced materials for direct methanol fuel cell anode catalysts, and the third on development of next generation transparent conductive oxides (TCOs) for photovoltaic applications. Previously, while a Professor at RIT, he was co-founder and director (2001-2003) of the highly successful NanoPower Research Laboratory. Dr. Gennett has had a strong collaboration

114

Thomas Edison | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Edison Thomas Edison Tesla vs. Edison 62 likes Thomas Edison Inventor Known as "The Wizard of Menlo Park," Edison was an American inventor who developed the first commercially practical incandescent light bulb. A savvy businessman, he invented a number of other technologies that are still in use today -- including the an early stock ticker, a sound-recording phonograph and a two-way telegraph -- and holds the record for the most patents, ever. Learn more interesting facts about Edison in our Top 8 Things You Didn't Know About Thomas Alva Edison. Innovators Sort by: Random | Alphabetical | Rating (High to Low) | Rating (Low to High) Nikola Tesla Inventor 435 likes Nikola Tesla was born in the Austrian Empire (now Croatia) but moved to the United States to work for Thomas Edison

115

Thomas D. Williams Assistant Administrator  

Gasoline and Diesel Fuel Update (EIA)

Thomas D. Williams Thomas D. Williams Assistant Administrator for Resource and Tecnology Management Duties Thomas D. Williams is the Assistant Administrator for Resource & Technology Management. He provides leadership and direction to oversee the management and operation of EIA's employee services, information technology policy and operations, and integrated planning, budget, procurement, evaluation and project management activity. Biography Thom is a career member of the Senior Executive Service with more than 27 years of professional experience in developing, linking, and implementing successful strategic, financial, human capital, operational, technology, and administrative policies and plans for federal research, science, engineering, and regulatory programs.

116

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

1, 2012 1, 2012 4:00 pm Iran Thomas Auditorium, 8600 Simulating the Formation of Carbonate Minerals: The Role of Nanoscale Phenomena in Non-Classical Nucleation Julian Gale Nanochemistry Research Institute Department of Chemistry, Curtin University, Australia CNMS D D I I S S C C O O V V E E R R Y Y SEMINAR SERIES Abstract: Calcium carbonate is an abundant mineral that exhibits three crystalline polymorphs, as well as an amorphous form, and represents a natural form of sequestered carbon. While the most stable calcite polymorph can grow as macroscopic single crystals, the process of biomineralisation can alternatively lead to complex polycrystalline assembles that serve as functional materials in nature. As such, the

117

AREA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AREA AREA FAQ # Question Response 316 vs DCAA FAQ 1 An inquiry from CH about an SBIR recipient asking if a DCAA audit is sufficient to comply with the regulation or if they need to add this to their audit they have performed yearly by a public accounting firm. 316 audits are essentially A-133 audits for for-profit entities. They DO NOT replace DCAA or other audits requested by DOE to look at indirect rates or incurred costs or closeouts. DCAA would never agree to perform A-133 or our 316 audits. They don't do A-133 audits for DOD awardees. The purpose of the audits are different, look at different things and in the few instances of overlap, from different perspectives. 316

118

Thomas M. Stricker Currivitae Page 1 of 4 Name: Thomas Martin Stricker  

E-Print Network (OSTI)

Thomas M. Stricker Currivitae Page 1 of 4 Name: Thomas Martin Stricker Born: June 6, 1963 supercomputer, developed as a joint project of CMU, ARPA, SPAWAR and Intel Corporation. Thomas M. Stricker­2580 tomstr@cs.cmu.edu Curriculum vitae March 5, 1996 #12; Thomas M. Stricker Currivitae Page 2 of 4 1991

Shewchuk, Jonathan

119

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

Dieter Richter Jlich Centre for Neutron Science, Institute for Complex Systems, Germany Filling soft polymer matrices with nanoparticles with high specific surface area...

120

Curriculum Vitae THOMAS K. GREEN  

E-Print Network (OSTI)

Curriculum Vitae THOMAS K. GREEN Professor of Chemistry ADDRESS PERSONAL Department of Chemistry SUPPORT Principal Investigator 1985 "Coal Swelling in Amine Solvents" Exxon Education Foundation, $15,000, 1985. 1986 "Thermodynamics of Coal-Solvent Interactions" Research Corporation, $17,600, 1986. 1987

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Feedback processes between magmatic events and flank movement at Mount Etna (Italy) during the 20022003 eruption  

E-Print Network (OSTI)

. The models suggest that the 2002­2003 events are the result of interrelated processes consisting of (1Feedback processes between magmatic events and flank movement at Mount Etna (Italy) during the 2002 and southeastern flanks. Understanding the precise interconnectivity of these processes may help to forecast

Amelung, Falk

122

Mr. Thomas Mahl Granite City Steel Company  

Office of Legacy Management (LM)

8&v/ 8&v/ Mr. Thomas Mahl Granite City Steel Company 20th and State Streets Granite City, IL 62040 Dear Mr. Mahl: This is to notify you that the U.S. Department of Energy (DOE) has designated your company's facility for remedial action as a part of the Formerly Utilized Sites Remedial Action Program. Remedial activities are managed by the DOE Oak Ridge Field Office, and Ms. Teresa Perry (615-576-8956) will be the site manager. As a result of the designation decision, Ms. Perry will be the appropriate point of contact in the future. If you have any questions, please call me at 301-903-8149. W. Alexander Williams, PhD Designation and Certification Manager Division of Off-Site Programs Office of Eastern Area Programs Office of Environmental Restoration

123

John Thomas - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

John Thomas John Thomas R&D Staff Member Specialty: Automotive Fuel Economy, Emissions, and Aftertreatment John began his career at Oak Ridge National Laboratory in 1978 and has broad experience in fossil energy technology, fuels, combustion, energy conversion, combined heat and power and power generation systems. His most recent R&D efforts include the effects of intermediate ethanol fuel blends on the legacy vehicle fleet and non-road engines, ethanol/gasoline blend engine and vehicle performance and exploring emerging fuel and/or petroleum saving technologies on vehicles. Other recent work includes R&D involving a range of diesel exhaust emissions aftertreatment technologies including soot filters, NOx adsorber catalysts, hydrocarbon SCR, and urea

124

Independent Oversight Inspection, Thomas Jefferson National Accelerator  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Jefferson National Thomas Jefferson National Accelerator Facility - August 2008 Independent Oversight Inspection, Thomas Jefferson National Accelerator Facility - August 2008 August 2008 Inspection of Environment, Safety and Health Programs at the Thomas Jefferson National Accelerator Facility The U.S. Department of Energy (DOE) Office of Independent Oversight, within the Office of Health, Safety and Security (HSS), inspected environment, safety, and health (ES&H) programs at the DOE Thomas Jefferson Site Office (TJSO) and the Thomas Jefferson National Accelerator Facility (TJNAF) during May through July 2008. The ES&H inspection was performed by Independent Oversight's Office of Environment, Safety and Health Evaluations. In coordination with TJSO, TJNAF has taken a number of actions to develop a

125

Thomas selected as American Chemical Society Fellow  

NLE Websites -- All DOE Office Websites (Extended Search)

Chemistry Division. Thomas received degrees from Middlebury College and-as a student of Glenn Seaborg, Nobel Prize winner and discoverer or codiscoverer of many of the actinide...

126

Info-Exch 2012- Thomas Johnson Presentation  

Energy.gov (U.S. Department of Energy (DOE))

EM Recovery Act Program Director Thomas Johnson gave a presentation on Recovery Act lessons learned at the 2012 Recovery Act Information Exchange.

127

Iran Thomas Auditorium, 8600 Environmental Transmission Electron...  

NLE Websites -- All DOE Office Websites (Extended Search)

April 26, 2012 11:00 am Iran Thomas Auditorium, 8600 Environmental Transmission Electron Microscopy for Catalysis Research: The Example of Carbon Nanotubes Eric A. Stach Center for...

128

Independent Oversight Inspection, Thomas Jefferson National Accelerato...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Jefferson National Accelerator Facility - August 2008 August 2008 Inspection of Environment, Safety and Health Programs at the Thomas Jefferson National Accelerator Facility...

129

VEE-0032- In the Matter of Thomas Oil Company  

Energy.gov (U.S. Department of Energy (DOE))

On September 13, 1996, Thomas Oil Company (Thomas Oil) filed an Application for Exception with the Office of Hearings and Appeals (OHA) of the Department of Energy (DOE). In its application, Thomas...

130

IN SITU STRESS, FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF...  

Open Energy Info (EERE)

FRACTURE AND FLUID FLOW ANALYSIS-EAST FLANK OF THE COSO GEOTHERMAL FIELD Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Proceedings: IN SITU STRESS,...

131

Surface and bottom boundary layer dynamics on a shallow submarine bank : southern flank of Georges Bank  

E-Print Network (OSTI)

The thesis investigates the circulation at a 76-m deep study site on the southern flank of Georges Bank, a shallow submarine bank located between the deeper Gulf of Maine and the continental slope. Emphasis is placed on ...

Werner, Sandra R. (Sandra Regina)

1999-01-01T23:59:59.000Z

132

Thomas Jefferson High School for Science & Technology National...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Jefferson High School for Science & Technology National Science Bowl Champion Thomas Jefferson High School for Science & Technology National Science Bowl Champion May 2,...

133

Thomas Edison vs. Nikola Tesla | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Thomas Edison vs. Nikola Tesla Thomas Edison vs. Nikola Tesla Addthis Duration 46:00 Topic Alternative Fuel Vehicles Renewables Smart Grid Transmission...

134

Optical Diagnostics Hg_jet_meeting, 01-18-05 Thomas Tsang  

E-Print Network (OSTI)

Optical Diagnostics Hg_jet_meeting, 01-18-05 Thomas Tsang · tight environment · high radiation area · non-serviceable area · passive components · optics only, no active electronics · back illuminated with a single fiber laser - pulsed laser X · transmit image through flexible fiber bundle #12;Optical

McDonald, Kirk

135

Independent Oversight Inspection, Thomas Jefferson National Accelerator Facility- August 2008  

Energy.gov (U.S. Department of Energy (DOE))

Inspection of Environment, Safety and Health Programs at the Thomas Jefferson National Accelerator Facility

136

Cuttings Analysis At Coso Geothermal Area (2005) | Open Energy Information  

Open Energy Info (EERE)

5) 5) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Cuttings Analysis Activity Date 2005 Usefulness not indicated DOE-funding Unknown Exploration Basis EGS well analysis for fractures to determine the geologic framework of the east flank of the field Notes This paper summarizes petrologic and geologic investigations on two East Flank wells, 34A-9 and 34-9RD2 conducted as part of a continuing effort to better understand how the rocks will behave during hydraulic and thermal stimulation. Well 34A-9 is the hottest well at depth in the East Flank, reaching nearly 350 0C. The reservoir on the East Flank is dominated by diorite and granodiorite. References Kovac, K.M.; Moore, J.N.; Lutz, S.J. (1 January 2005) GEOLOGIC FRAMEWORK OF THE EAST FLANK, COSO GEOTHERMAL FIELD: IMPLICATIONS FOR EGS

137

ORISE: Faculty Research Experiences - Dr. Thomas Liu  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas Liu Thomas Liu Professor and student team develops flexible, free alternative to proprietary data analytics software Dr. Thomas Liu and Monty Bains Dr. Thomas Liu and Monty Bains research free web-based data analysis and visualization application as an alternative to common fee-based software. They are participating in the U.S. Department of Homeland Security's Summer Research Team Program for Minority Serving Institutions. The program is administered by the Oak Ridge Institute for Science and Education. Photo courtesy of Tamra Carpenter, Rutgers University. Click image to enlarge. Fifteen years ago people could not imagine the capabilities they would soon have through the Internet and supporting programs. The evolution of web technology moves at such a fast pace that most people focus on keeping pace

138

Thomas G. Hinton | Savannah River Ecology Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Hinton Curriculum Vitae Faculty & Scientists SREL Home Thomas G. Hinton Savannah River Ecology Laboratory P O Drawer E, Aiken, SC 29802 (803) 725-7454 office (803) 725-3309 fax...

139

Genetic diversity in chlorella viruses flanking kcv, a gene that encodes a potassium ion channel protein  

E-Print Network (OSTI)

Genetic diversity in chlorella viruses flanking kcv, a gene that encodes a potassium ion channel Received 23 March 2004; accepted 27 May 2004 Abstract The chlorella virus PBCV-1 encodes a 94-amino acid additional chlorella viruses and transcription in two of these viruses, as well as the effect of the three

Graves, Michael V.

140

Microbial Community in Black Rust Exposed to Hot Ridge Flank Crustal Fluids  

Science Journals Connector (OSTI)

...discharged fluids of the borehole was extremely low...rust deposit on a CORK borehole observatory on the eastern...Hydrothermal circulation of large volumes of seawater...During Integrated Ocean Drilling Program Expedition 301...CORK) observatory at a borehole on the eastern flank...

Satoshi Nakagawa; Fumio Inagaki; Yohey Suzuki; Bjrn Olav Steinsbu; Mark Alexander Lever; Ken Takai; Bert Engelen; Yoshihiko Sako; Charles Geoffrey Wheat; Koki Horikoshi; Integrated Ocean Drilling Program Expedition 301 Scientists

2006-08-18T23:59:59.000Z

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

FORT UNION COAL IN THE GREATER GREEN RIVER BASIN, EAST FLANK OF THE ROCK SPRINGS UPLIFT,  

E-Print Network (OSTI)

Chapter GS FORT UNION COAL IN THE GREATER GREEN RIVER BASIN, EAST FLANK OF THE ROCK SPRINGS UPLIFT 1999 Resource assessment of selected Tertiary coal beds and zones in the Northern Rocky in the toolbar to return. 1999 Resource assessment of selected Tertiary coal beds and zones in the Northern Rocky

142

Building Shape Models from Lousy Data Marcel Luthi, Thomas Albrecht, and Thomas Vetter  

E-Print Network (OSTI)

Building Shape Models from Lousy Data Marcel L¨uthi, Thomas Albrecht, and Thomas Vetter Department information. We propose a method for building a statistical shape model from such "lousy" data sets all the intact parts are included in the model. The model building is then performed using the EM

Vetter, Thomas

143

Off-Policy Actor-Critic Thomas Degris thomas.degris@inria.fr  

E-Print Network (OSTI)

Off-Policy Actor-Critic Thomas Degris thomas.degris@inria.fr Flowers Team, INRIA, Talence, ENSTA the first actor-critic al- gorithm for off-policy reinforcement learning. Our algorithm is online work on actor-critic algorithms is lim- ited to the on-policy setting and does not take advantage

Paris-Sud XI, Université de

144

Journal of Materials Processing Technology 189 (2007) 192198 Modelling of surface finish and tool flank wear in turning  

E-Print Network (OSTI)

flank wear in turning of AISI D2 steel with ceramic wiper inserts Tugrul ¨Ozela,, Yigit Karpata, Lu, Piscataway, NJ 08854, USA b Department of Mechanical Engineering, University of Aveiro, Campus Santiago, 3810 processes. Surface finishing and tool flank wear have been investigated in finish turning of AISI D2 steels

Ozel, Tugrul

145

Ion beam figuring of small optical components Thomas W. Drueding  

E-Print Network (OSTI)

Ion beam figuring of small optical components Thomas W. Drueding Boston University College of Engineering Aerospace and Mechanical Engineering Department Boston, Massachusetts 02215 Steven C. Fawcett Albuquerque, New Mexico 87107 Thomas G. Bifano Boston University College of Engineering Aerospace

146

Direct Deposit When Message Passing meets Shared Thomas M. Stricker  

E-Print Network (OSTI)

Direct Deposit ­ When Message Passing meets Shared Memory Thomas M. Stricker May 19, 2000 CMU-CS-96 Copyright c by Thomas M. Stricker Supported in part by the Defense Advanced Research Projects Agency

147

Direct Deposit --When Message Passing meets Shared Thomas M. Stricker  

E-Print Network (OSTI)

Direct Deposit -- When Message Passing meets Shared Memory Thomas M. Stricker May 19, 2000 CMU Copyright c flby Thomas M. Stricker Supported in part by the Defense Advanced Research Projects Agency

148

Thomas R. Cech, RNA, and Ribozymes  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas R. Cech, RNA, and Ribozymes Resources with Additional Information · Videos Thomas Cech Courtesy of Glenn Asakawa/ University of Colorado Thomas R. Cech conducted ground-breaking research that ‘established that RNA, like a protein, can act as a catalyst in living cells.'1 'Prior to Cech's research, most scientists believed that proteins were the only catalysts in living cells. In 1982, his research group showed that an RNA molecule from Tetrahymena, a single-celled pond organism, cut and rejoined chemical bonds in the complete absence of proteins. This discovery of self-splicing RNA provided the first exception to the long-held belief that biological reactions are always catalyzed by proteins. In 1989, Cech was awarded the Nobel Prize in Chemistry.'2

149

2012 Annual Planning Summary for Thomas Jefferson Site Office  

Energy.gov (U.S. Department of Energy (DOE))

The ongoing and projected Environmental Assessments and Environmental Impact Statements for 2012 and 2013 within Thomas Jefferson Site Office.

150

Conformal Mapping in Wing Aerodynamics Thomas Johnson  

E-Print Network (OSTI)

Conformal Mapping in Wing Aerodynamics Thomas Johnson June 4, 2013 Contents 1 Introduction 1 2 the first complete treatment of conformal mapping in aerodynamics. Near the beginning of the twentieth and aerodynamics. The purpose of this exposition is to give the reader an elementary intro- duction to the use

Morrow, James A.

151

On Infinitely Nested Radicals Brian Thomas  

E-Print Network (OSTI)

On Infinitely Nested Radicals Brian Thomas 1. Introduction #12;In "On Infinitely Nested Radicals nested radicals are explored. One example of a nested radical is the Golden Ratio, , which can be written as: (1.1) . . . Many questions arise from the study of nested radicals, such as: 1. What can we say

Morrow, James A.

152

LATTICES IN HYPERBOLIC BUILDINGS ANNE THOMAS  

E-Print Network (OSTI)

LATTICES IN HYPERBOLIC BUILDINGS ANNE THOMAS Introduction This survey is intended as a brief introduction to the theory of hyperbolic buildings and their lattices. Hyperbolic buildings are negatively of these buildings and the lattices in their automorphism groups involves a fascinating mixture of techniques from

Sydney, University of

153

Engineering Light Course instructor: Dr. Thomas Bifano  

E-Print Network (OSTI)

the semester, to untwinkle the stars with adaptive telescopes, to measure the speed of light using parts hacked Experiment: Measuring the speed of light 11/14/12 TBA 11/19/12 No Class 11/26/12 Project interim progressEngineering Light Course instructor: Dr. Thomas Bifano Office: PHO 936 E-mail: tgb@bu.edu Office

Guenther, Frank

154

Extraction of flank wear growth models that correlates cutting edge integrity of ball nose end mills while machining titanium  

Science Journals Connector (OSTI)

The application of titanium alloys are increasingly seen at aerospace, marine, bio-medical and precision engineering due to ... initial working period, the growth of flank wear facilitates higher cutting forces f...

K. Ramesh; Lim Beng Siong

2011-02-01T23:59:59.000Z

155

MEMORANDUM FROM: THOMAS E. BROWN, DIRECTOR OFFICE OF CONTRACT MANAGEMENT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

,2008 ,2008 MEMORANDUM FROM: THOMAS E. BROWN, DIRECTOR OFFICE OF CONTRACT MANAGEMENT OFFICE OF PROCUREMENT AND ASSISTANCE MANAGEMENT SUBJECT: Contract Change Order Administration of Department of Energy Prime Contracts The purpose of this memorandum is to highlight the need for good contract administration of Department of Energy (DOE) contracts (non management and operating contracts) including those covered by DOE Order 413.3A, Program and Project Management for the Acquisition of Capital Assets. One of the focus areas of the DOE's efforts to improve contract and project management is the recopition that effectrve contract change order administration is critical to ensuring that contract and project requirements are met. Fundamentally, the award of an appropriate contract type that best

156

Thomas H. Cormen Charles E. Leiserson  

E-Print Network (OSTI)

-0-262-03384-8 (hardcover : alk. paper)--ISBN 978-0-262-53305-8 (pbk. : alk. paper) 1. Computer programming. 2. Computer algorithms. I. Cormen, Thomas H. QA76.6.I5858 2009 005.1--dc22 2009008593 10 9 8 7 6 5 4 3 2 1 #12 implementation in practice. Parallel computers--computers with multiple processing units--have become

Leiserson, Charles E.

157

aBubbleTree? Thomas H. Parker  

E-Print Network (OSTI)

on Rn \\ {0}. That limit loses energy. A bubble tree is a way of recovering the lost energy by keepingaBubbleTree? Thomas H. Parker 666 NOTICES OF THE AMS VOLUME 50, NUMBER 6 Some of the most important for functions u on a domain in R2, which arises as the variational equation of the energy (2) E(u) = |du|2 dvol

Parker, Thomas H.

158

Thomas-Fermi model: The leading correction  

Science Journals Connector (OSTI)

The correct treatment of strongly bound electrons is grafted smoothly onto the Thomas-Fermi computation of the total binding energy of neutral atoms. This provides a clearcut demonstration of the leading correction of relative order Z-13 which, with effects of relative order Z-23, gives an accurate account of the binding energy over a wide range of Z values. There is a brief discussion of relativistic corrections, with results that are somewhat at variance with previous numerical estimates.

Julian Schwinger

1980-11-01T23:59:59.000Z

159

Thomas-Fermi model: The second correction  

Science Journals Connector (OSTI)

A simple derivation is given for the first quantum correction to the Thomas-Fermi kinetic energy. Its application to the total binding energy of neutral atoms exploits the technique for handling strongly bound electrons that was developed in a preceding paper, and justifies the numerical value of the second correction adopted there. A proposal is made for extrapolating this improved description to the outer regions of the atom.

Julian Schwinger

1981-11-01T23:59:59.000Z

160

10 Questions for an Automotive Engineer: Thomas Wallner | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 Questions for an Automotive Engineer: Thomas Wallner 10 Questions for an Automotive Engineer: Thomas Wallner 10 Questions for an Automotive Engineer: Thomas Wallner June 17, 2011 - 3:30pm Addthis Argonne mechanical engineer Thomas Wallner adjusts Argonne's "omnivorous engine," an automobile engine that Wallner and his colleagues have tailored to efficiently run on blends of gasoline, ethanol and butanol. | Courtesy of: Argonne National Laboratory. Argonne mechanical engineer Thomas Wallner adjusts Argonne's "omnivorous engine," an automobile engine that Wallner and his colleagues have tailored to efficiently run on blends of gasoline, ethanol and butanol. | Courtesy of: Argonne National Laboratory. Niketa Kumar Niketa Kumar Public Affairs Specialist, Office of Public Affairs Meet Thomas Wallner - automotive engineer extraordinaire, who hails from

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Interacting viscous instabilities in microfluidic systems Thomas Cubaud*a  

E-Print Network (OSTI)

Interacting viscous instabilities in microfluidic systems Thomas Cubaud*a and Thomas G. Mason, evolution, and stability of microfluidic flows involving two or more miscible fluids that have different viscosities. When two liquids that have widely different viscosities are injected into a rigid microfluidic

Cubaud, Thomas

162

Single element changes in electrical networks Thomas Berger,  

E-Print Network (OSTI)

University of Technology Page 2 / 13 #12;Example: electrical RLC network Z(s)i(s) = vs(s), Z(s) = s-1 1 C1Single element changes in electrical networks Thomas Berger, George Halikias and Nicos Karcanias, 2012 Single element changes in electrical networks Thomas Berger, George Halikias and Nicos Karcanias

Knobloch,Jürgen

163

Single element changes in electrical networks Thomas Berger,  

E-Print Network (OSTI)

, Ilmenau University of Technology Page 2 / 13 #12;Example: electrical RLC network Z(s)i(s) = vs(s), ZSingle element changes in electrical networks Thomas Berger, George Halikias and Nicos Karcanias, February 23, 2012 Single element changes in electrical networks Thomas Berger, George Halikias and Nicos

Knobloch,Jürgen

164

Outdoor Virtual Reality Bruce H. Thomas and Wayne Piekarski  

E-Print Network (OSTI)

Outdoor Virtual Reality Bruce H. Thomas and Wayne Piekarski Wearable Computer Laboratory University of South Australia Mawson Lakes, SA 5095 Australia Bruce.Thomas@unisa.edu.au Wayne@cs.unisa.edu.au ABSTRACT or augmented beyond the user's normal experience, and increase understanding 226Copyright held by the author

Thomas, Bruce

165

Hydrogen Storage -Overview George Thomas, Hydrogen Consultant to SNL*  

E-Print Network (OSTI)

Hydrogen Storage - Overview George Thomas, Hydrogen Consultant to SNL* and Jay Keller, Hydrogen volumetric density of gaseous fuels requires a storage method which compacts the fuel. Hence, hydrogen and cost-effective hydrogen storage? #12;4/14/03 3 Sandia National Laboratories From George Thomas, BES

166

Thomas P. D'Agostino | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas P. D'Agostino Thomas P. D'Agostino About Us Thomas P. D'Agostino - Under Secretary for Nuclear Security & Administrator, National Nuclear Security Administration Photo of Thomas D’Agostino Mr. Thomas Paul D'Agostino was sworn in on August 30, 2007, as the Under Secretary for Nuclear Security and Administrator of the National Nuclear Security Administration (NNSA). On September 3, 2009, President Obama announced that Mr. D'Agostino was his choice to continue serving as the Under Secretary for Nuclear Security and NNSA Administrator. The NNSA plays a critical role in ensuring the security of our Nation by maintaining the safety, security, and effectiveness of the U.S. nuclear weapons stockpile without nuclear testing; reducing the global danger from the proliferation of nuclear weapons and materials; providing the U.S. Navy

167

Dissolved inorganic carbon isotopic composition of low-temperature axial and ridge-flank hydrothermal fluids of the Juan de Fuca Ridge  

E-Print Network (OSTI)

carbon isotopic composition of low-temperature axial and ridge-flank hydrothermal fluids of the Juan deDissolved inorganic carbon isotopic composition of low-temperature axial and ridge-flank hydrothermal fluids of the Juan de Fuca Ridge Brett D. Walker a,, Matthew D. McCarthy a , Andrew T. Fisher b

Fisher, Andrew

168

Administrator Thomas D'Agostino, National Nuclear Security  

NLE Websites -- All DOE Office Websites (Extended Search)

Thomas D'Agostino, National Nuclear Security Thomas D'Agostino, National Nuclear Security Administration, Addresses United Nations on Nuclear Disarmament | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > Administrator Thomas D'Agostino, National Nuclear Security Administration, ... Speech Administrator Thomas D'Agostino, National Nuclear Security

169

Administrator Thomas D'Agostino, National Nuclear Security  

National Nuclear Security Administration (NNSA)

Thomas D'Agostino, National Nuclear Security Thomas D'Agostino, National Nuclear Security Administration, Addresses United Nations on Nuclear Disarmament | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > Administrator Thomas D'Agostino, National Nuclear Security Administration, ... Speech Administrator Thomas D'Agostino, National Nuclear Security

170

Thomas Jefferson High School for Science & Technology National Science  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Jefferson High School for Science & Technology National Thomas Jefferson High School for Science & Technology National Science Bowl® Champion Thomas Jefferson High School for Science & Technology National Science Bowl® Champion May 2, 2005 - 12:40pm Addthis WASHINGTON, DC -- "The Incompleteness Theorem" was the answer to a question on mathematics that today clinched the 2005 National Science Bowl® championship for the Thomas Jefferson High School for Science & Technology team from Alexandria, Va. The team received its championship trophy after triumphing over 62 other regional team champions this weekend. The team members are: Logan Kearsley, Matthew Isakowitz, Sam Lederer, Lisa Marrone, Charlotte Seid and coach Sharon Baker. The team also won a research trip to Alaska, three Computer Based Laboratories and $1,000 for their school's science

171

DURBIN, EDWARD G., ANN G. DURBIN, THOMAS J. SMAYDA ...  

Science Journals Connector (OSTI)

Jun 24, 1982 ... Edward G. Durbin, Ann G. Durbin, Thomas J. Smayda, and Peter G. Verity .... Egg production in Acartia. 1201. 0. 0. 26 d: 23. E. 20 t? 17. 0. I lz. 2.

2000-02-09T23:59:59.000Z

172

Thermal cracking in disc brakes Thomas J. Mackin *,1  

E-Print Network (OSTI)

Thermal cracking in disc brakes Thomas J. Mackin *,1 , Steven C. Noe, K.J. Ball, B.C. Bedell, D, or hub, which is connected to the wheel and axle, and an inboard and outboard braking surface

Salvaggio, Carl

173

Choice of Weapons for the Truel Thomas S. Ferguson, UCLA  

E-Print Network (OSTI)

Choice of Weapons for the Truel Thomas S. Ferguson, UCLA 1. Truels. The truel is the extension at each other's. 2. Choosing Weapons for the Shubik Truel 1 #12;In the Shubik truel, contestants A, B

Ferguson, Thomas S.

174

TBU-0082- In the Matter of Thomas L. Townsend  

Energy.gov (U.S. Department of Energy (DOE))

Thomas L. Townsend (Townsend) appeals the dismissal of his complaint of retaliation and request for investigation filed under 10 C.F.R. Part 7081 by the Oak Ridge Operations Office (OR) of the...

175

MEMORANDUM FOR ELIZABETH MONTOYA TRANSITION TEAM FROM THOMAS...  

Energy Savers (EERE)

g December 1, 200S MEMORANDUM FOR ELIZABETH MONTOYA TRANSITION TEAM FROM THOMAS N. PYKE, J CHIEF INFORMATION OFFICER SUBJECT: Follow-up to our meeting this morning Carl Staton...

176

Iran Thomas Auditorium, 8600 Materials For Energy: In Situ Synchrotron...  

NLE Websites -- All DOE Office Websites (Extended Search)

December 15, 2011 4:00 pm Iran Thomas Auditorium, 8600 Materials For Energy: In Situ Synchrotron X-Ray Studies for Materials Design and Discovery Stephen K. Streiffer Deputy...

177

Iran Thomas Auditorium, 8600 Determination of CO, H  

NLE Websites -- All DOE Office Websites (Extended Search)

February 9, 2012 4:00 pm Iran Thomas Auditorium, 8600 Determination of CO, H 2 and H 2 O Coverage by XANES on Pt and Au During Water Gas Shift Reaction: Experiment and DFT Modeling...

178

Iran Thomas Auditorium, 8600 Fighting Cancer with Nanoparticle...  

NLE Websites -- All DOE Office Websites (Extended Search)

October 13, 2011 4:00 pm Iran Thomas Auditorium, 8600 Fighting Cancer with Nanoparticle Medicines Mark E. Davis Chemical Engineering California Institute of Technology CNMS D D I I...

179

A taxonomy of granular partitions Thomas Bittner and Barry Smith  

E-Print Network (OSTI)

A taxonomy of granular partitions Thomas Bittner and Barry Smith Qualitative Reasoning Group. In Smith and Brogaard (2000) the notion of granular partition was introduced as a generalization of David

Forbus, Kenneth D.

180

A Theory of Granular Partitions Thomas Bittner and Barry Smith  

E-Print Network (OSTI)

CHAPTER 7 A Theory of Granular Partitions Thomas Bittner and Barry Smith Institute for Formal of part and whole relations (Smith, 1998) as a framework for ontological theorizing. Mereology is better

Bittner, Thomas

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

The use of narrative during the Clarence Thomas-Anita Hill hearings October 11, 12, 13, 1991  

E-Print Network (OSTI)

fulfillment of the requirements for the degree of MASTER OF ARTS Approved as to style and content by: John H. Powers (Chair of Committee) Tarla R. Peterson (Member) Valerie Balester (Member) Martin J. Medhurst (Interim Head of Department) August.... John H. Powers There are any number of approaches that could be taken with subject matter with the richness and complexity of the Thomas-Hill Hearings. Therefore, I have limited this study to three main areas, they are: 1) the apparent turning over...

Willson, Marilee

2012-06-07T23:59:59.000Z

182

A Large-Scale Deforestation Experiment: Effects of Patch Area  

E-Print Network (OSTI)

A Large-Scale Deforestation Experiment: Effects of Patch Area and Isolation on Amazon Birds Gonçalo,4 Thomas E. Lovejoy1,5 As compared with extensive contiguous areas, small isolated habitat patches lack many species. Some species disappear after isolation; others are rarely found in any small patch

Stouffer, Phil

183

The Nuclear Thomas-Fermi Model  

DOE R&D Accomplishments (OSTI)

The statistical Thomas-Fermi model is applied to a comprehensive survey of macroscopic nuclear properties. The model uses a Seyler-Blanchard effective nucleon-nucleon interaction, generalized by the addition of one momentum-dependent and one density-dependent term. The adjustable parameters of the interaction were fitted to shell-corrected masses of 1654 nuclei, to the diffuseness of the nuclear surface and to the measured depths of the optical model potential. With these parameters nuclear sizes are well reproduced, and only relatively minor deviations between measured and calculated fission barriers of 36 nuclei are found. The model determines the principal bulk and surface properties of nuclear matter and provides estimates for the more subtle, Droplet Model, properties. The predicted energy vs density relation for neutron matter is in striking correspondence with the 1981 theoretical estimate of Friedman and Pandharipande. Other extreme situations to which the model is applied are a study of Sn isotopes from {sup 82}Sn to {sup 170}Sn, and the rupture into a bubble configuration of a nucleus (constrained to spherical symmetry) which takes place when Z{sup 2}/A exceeds about 100.

Myers, W. D.; Swiatecki, W. J.

1994-08-01T23:59:59.000Z

184

The evolution of nuclear microsatellite DNA markers and their flanking regions using reciprocal comparisons within the African mole-rats (Rodentia: Bathyergidae)  

E-Print Network (OSTI)

and molecular data. Using mitochondrial and nuclear DNA, a robust phylogeny was generated for the Bathyergidae. From my results, I proposed the new genus, Coetomys. I designed species-specific genotyping and microsatellite flanking sequence (MFS) primers...

Ingram, Colleen Marie

2006-10-30T23:59:59.000Z

185

Wind Power Opportunities in St. Thomas, USVI: A Site-Specific...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis Wind Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis Utilizes a...

186

Remarks by Administrator Thomas D'Agostino, National Nuclear Security  

NLE Websites -- All DOE Office Websites (Extended Search)

on NRC International Regulators Conference on Nuclear on NRC International Regulators Conference on Nuclear Security | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > Remarks by Administrator Thomas D'Agostino, National Nuclear ... Speech Remarks by Administrator Thomas D'Agostino, National Nuclear Security

187

Remarks by Administrator Thomas D'Agostino, National Nuclear Security  

National Nuclear Security Administration (NNSA)

on NRC International Regulators Conference on Nuclear on NRC International Regulators Conference on Nuclear Security | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > Remarks by Administrator Thomas D'Agostino, National Nuclear ... Speech Remarks by Administrator Thomas D'Agostino, National Nuclear Security

188

Labs at-a-Glance: Thomas Jefferson National Accelerator Facility | U.S. DOE  

Office of Science (SC) Website

Thomas Jefferson Thomas Jefferson National Accelerator Facility Laboratories Ames Laboratory Argonne National Laboratory Brookhaven National Laboratory Fermi National Accelerator Laboratory Lawrence Berkeley National Laboratory Oak Ridge National Laboratory Pacific Northwest National Laboratory Princeton Plasma Physics Laboratory SLAC National Accelerator Laboratory Thomas Jefferson National Accelerator Facility Laboratory Policy and Evaluation Safety, Security and Infrastructure Laboratory Science Highlights Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 Labs at-a-Glance: Thomas Jefferson National Accelerator Facility Print Text Size: A A A RSS Feeds FeedbackShare Page Thomas Jefferson National Accelerator Facility Logo

189

Updated 1-12 Thomas H. Killion, Ph.D.  

E-Print Network (OSTI)

of Transition in July 2012. Dr. Killion is responsible for policy, planning, resourcing and execution managementUpdated 1-12 Thomas H. Killion, Ph.D. Director of Transition Office of Naval Research Initially joining ONR, Dr. Killion was the Director, Biometrics Identity Management Agency (BIMA), staring

190

Thomas P. Dee Deputy Assistant Secretary of the Navy  

E-Print Network (OSTI)

in the Office of the Under Secretary of Defense Acquisition, Technology and Logistics. While there he oversaw2/28/2013 Thomas P. Dee Deputy Assistant Secretary of the Navy (Expeditionary Programs and Logistics Management) Office of the Assistant Secretary of the Navy (Research, Development & Acquisition) Mr

191

Geodesic Regression on Riemannian Manifolds P. Thomas Fletcher  

E-Print Network (OSTI)

Geodesic Regression on Riemannian Manifolds P. Thomas Fletcher School of Computing, University a manifold-valued random variable and a real-valued independent parameter. The principle is to fit a geodesic is evaluated as the sum-of-squared geodesic distances from the model to the data, and this provides

Boyer, Edmond

192

Statement of Thomas E. Mason Director, Oak Ridge National Laboratory  

E-Print Network (OSTI)

Statement of Thomas E. Mason Director, Oak Ridge National Laboratory Before the Subcommittee Director of the U.S. Department of Energy's Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, the Oak Ridge fusion program has drawn on the diverse resources afforded by ORNL's standing

193

Thomas Banks Santa Cruz Institue for Particle Physics (SCIPP)  

E-Print Network (OSTI)

PROFESSIONAL PREPARATION Reed College Physics/Math B.A. 1969 Massachusetts Institute of Technology Physics PhThomas Banks Santa Cruz Institue for Particle Physics (SCIPP) UC Santa Cruz Department of Physics of Physics, University of California, Santa Cruz 1989-present Professor of Physics, Rutgers University 1986

California at Santa Cruz, University of

194

The `summation hack' as an outlier model Thomas P. Minka  

E-Print Network (OSTI)

The `summation hack' as an outlier model Thomas P. Minka August 22, 2003 (revised) Abstract The `summation hack' is the ad-hoc replacement of a product by a sum in a probabilistic expression. This hack that the hack does make sense probabilistically, and can be best thought of as replacing an outlier

Minka,Tom

195

Tamara I. Ahrens & Thomas H. Lee Center for Integrated Systems  

E-Print Network (OSTI)

of Electrical Engineering Stanford University Ring Oscillator vs. LC Oscillator Ring Oscillator: Dissipates allTamara I. Ahrens & Thomas H. Lee Center for Integrated Systems Department of Electrical Engineering Stanford University Tamara I. Ahrens Center for Integrated Systems Department of Electrical Engineering

Lee, Thomas H.

196

Learning to Rank and Quadratic Assignment Thomas Mensink  

E-Print Network (OSTI)

Learning to Rank and Quadratic Assignment Thomas Mensink TVPA - XRCE & LEAR - INRIA Grenoble NICTA Sydney, Australia Abstract In this paper we show that the optimization of several ranking of quadratic assignment problems. Both the task of test-time predic- tion of the best ranking and the task

Paris-Sud XI, Université de

197

SIR THOMAS BROWNE: HIS SKULL, PORTRAITS, AND ANCESTRY: INTRODUOTORY NOTE  

Science Journals Connector (OSTI)

......was given in 17.23 by Mr Benjamin Mackerell, Author of the History...Doctor comes from the pen of Mr Benjamin Mackerell, who copied the...following*: "The Late Dr. Jeffery gave notice to Sr. Thomas...this Ins. M.S. Johannis Jeffery S.T.P. etc . Aprilis JErae......

M. L. TILDESLEY; ARTHUR KEITH

1923-08-01T23:59:59.000Z

198

Workshop-based Security Safeguard Selection with AURUM Thomas Neubauer  

E-Print Network (OSTI)

Workshop-based Security Safeguard Selection with AURUM Thomas Neubauer Vienna University functionality by introducing the AURUM Workshop, which allows the selection of efficient safeguards based approach is used for selecting safeguards. This paper extends the functionality of AURUM by introducing

199

Environmental Governance: An Economic Perspective Thomas P. Lyon  

E-Print Network (OSTI)

1 Environmental Governance: An Economic Perspective Thomas P. Lyon Forthcoming in Magali Delmas University Press. 1. Introduction From an economic perspective, it is natural to think of the "demand of as coming from government in the form of legislation and regulation, outcomes of the political process

Lyon, Thomas P.

200

Discriminative frequent subgraph mining with optimality guarantees Marisa Thoma  

E-Print Network (OSTI)

processes, such as active or inactive in an anti- cancer screen, toxic or non-toxic to human beings [21Discriminative frequent subgraph mining with optimality guarantees Marisa Thoma Hong Cheng Arthur July 7, 2010 Abstract The goal of frequent subgraph mining is to detect subgraphs that frequently occur

Kriegel, Hans-Peter

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

ELECTRONIC ATTACKS Thomas M. Chen, Southern Methodist University  

E-Print Network (OSTI)

1 Chapter 74 ELECTRONIC ATTACKS Thomas M. Chen, Southern Methodist University Matthew C. Elder An understanding of electronic attacks is an essential prerequisite to building strong cyber defenses. This chapter gives an overview of the major electronic attacks encountered today, proceeding through the basic steps

Chen, Thomas M.

202

Curriculum Vitae Donald Thomas Lysle, Ph.D.  

E-Print Network (OSTI)

Curriculum Vitae Donald Thomas Lysle, Ph.D. Kenan Distinguished Professor Behavioral Neuroscience-962-2537 University of North Carolina Email: dlysle@email.unc.edu Chapel Hill, NC 27599-3270 Education Ph.D Abuse Research Grant (Renewal of R01-DA-13371): Behavioral Factors in Heroin's Effect on Nitric Oxide

Crews, Stephen

203

Thomas Drugman PhD student -FNRS research Fellow  

E-Print Network (OSTI)

Thomas Drugman PhD student - FNRS research Fellow Affiliation TCTS Lab - FPMs Mons Belgium/emotive speech production from the initial trained system. The key idea of a HMM-based synthesizer is to generate situations. Indeed contextual factors such as stress-related, locational, syntaxical or phone identity

Dupont, Stéphane

204

Deep Web Integration with VisQI Thomas Kabisch  

E-Print Network (OSTI)

Deep Web Integration with VisQI Thomas Kabisch Humboldt-Universit¨at zu Berlin Berlin, Germany of Deep Web sources. Building sys- tems which would be able to automatically use all or a large fraction of all Deep Web sources of a given domain, such as airline reservation in the USA, would offer great

Meng, Weiyi

205

INTRINSIC DISORDER WITHIN AND FLANKING THE DNA-BINDING DOMAINS OF HUMAN TRANSCRIPTION FACTORS  

E-Print Network (OSTI)

disordered. The role these intrinsically disordered regions (IDRs) play in protein function is an area of rigidity. Rather, a protein may sample an ensemble of global conformations; parts of the protein may across the ensemble. These latter regions are sometimes termed `intrinsically disordered regions' (IDRs

Bulyk, Martha L.

206

Human Factors Aspects of Power System Voltage Visualizations Douglas A. Wiegmann Aaron M. Rich Thomas J. Overbye Yan Sun  

E-Print Network (OSTI)

Thomas J. Overbye Yan Sun Institute of Aviation Institute of Aviation Elect. & Comp. Eng. Elect. & Comp

207

Tsunami deposits related to flank collapse in oceanic volcanoes: The Agaete Valley evidence, Gran Canaria, Canary Islands  

Science Journals Connector (OSTI)

Enigmatic marine conglomerates are attached at 41188 m asl to the walls of the valley of Agaete, on the northwest coast of Gran Canaria (Canary Islands). They are formed by heterogeneous, angular to rounded heterometric volcanic clasts (roundness and maximal size decreasing with altitude), and fossils (rhodolites and marine shells), never found in growth position and often broken. The deposits are internally stratified into several layers, most of them showing very poor sorting, matrix-supported and reverse grading. They present lenticular morphologies with poor lateral continuity in transversal and longitudinal sections. Slopes show values and orientations similar to those of the relief of the substratum to which they seem to adapt. Although they show clear evidence of erosive contact with the substratum (rip up clasts), they do not tend to form horizontal terraces. Soft materials (soils and colluviums) are preserved in the contact with the substratum in outcrops with deposit slopes of up to 15. The age of the deposits is constrained between 1.75 Ma and 32 ka. Their altitude and slope distributions are not related to Pleistocene interglacial sea level changes, storm deposits or isostatic movements. All the above suggests that the Agaete marine deposits were generated by tsunami waves, the most probable source being a flank failure, at least nine major such events having occurred in the Canary Islands during the Pleistocene. The Gmar sector collapse (east coast of Tenerife,30 km3) is the closest possible source for the tsunami and the sole flank failure that is directed towards another island in the Canaries.

Francisco J. Prez-Torrado; Raphal Paris; Mara C. Cabrera; Jean-Luc Schneider; Patrick Wassmer; Juan-Carlos Carracedo; ngel Rodrguez-Santana; Francisco Santana

2006-01-01T23:59:59.000Z

208

Remarks by Administrator Thomas D'Agostino, National Nuclear Security  

National Nuclear Security Administration (NNSA)

to the Energy Facility Contractors Group | National Nuclear to the Energy Facility Contractors Group | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > Remarks by Administrator Thomas D'Agostino, National Nuclear ... Speech Remarks by Administrator Thomas D'Agostino, National Nuclear Security Administration, to the Energy Facility Contractors Group

209

Mr. Richard T. Thomas General Counsel for Petroleum Operations  

Office of Legacy Management (LM)

j&,J"[Di-' JAQ--- j&,J"[Di-' JAQ--- hl 3. ) :j .I Y ' ! <' Department of Energy Washington, D.C. 20545 NOV 1 1984 Mr. Richard T. Thomas General Counsel for Petroleum Operations P.O. Box 391 Ashland, Kentucky 41114 Dear Mr. Thomas: I am enclosing a copy of the radiological survey report for the Ashland Oil Company (former Haist property), Tonawanda, New York (Enclosure l), which was conducted in July 1976 (copies were sent to your Buffalo, New York, office on August 17, 1978). The results of the survey indicate levels of radioactive contamination above current guidelines. As noted in the report, the radioactive residues on the site do not pose a health hazard provided they (the residues) were not disturbed in the past or will not be disturbed in the future; i.e.,

210

Thomas County, Georgia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Thomas County, Georgia: Energy Resources Thomas County, Georgia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 30.8417409°, -83.8473015° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.8417409,"lon":-83.8473015,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

211

Geology of the Middle Beaver Creek area, Mason and Gillespie Counties, Texas  

E-Print Network (OSTI)

AREA, NASGR AEG GILhNPIR COGRTIES, TEIAB ABSTRACT The Middle Beaver Creek area is situated on the soutlwsst flank of the Llano ?plift region in Mason and Gillespie Counties, Texas Hooks of Presa?brian, Psleosoie, Mesosois, and Genosois age... ' Figure 1. ? Map of' part of Mason and Gillespie Counties, Texass showing location of' the Middle Beaver Creek Area, on aoetats oosered aerial photographs. In order to aoourateIp locate and plot the oontaots asd faults, the photographs vere studies...

Peterson, Don Hamilton

2012-06-07T23:59:59.000Z

212

Thomas Jefferson Site Office Homepage | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Home Home Thomas Jefferson Site Office (TJSO) TJSO Home About Current Projects Contract Management Environment, Safety and Health (ES&H) Resources Contact Information Thomas Jefferson Site Office U.S. Department of Energy 12000 Jefferson Avenue Newport News, VA 23606 P: (757) 269-7140 Thomas Jefferson Site Office Pictured Right: Thomas Jefferson Site Office Staff TJSO Staff Photo 1 of 2 Print Text Size: A A A RSS Feeds FeedbackShare Page The Thomas Jefferson Site Office (TJSO) is an organization within the U.S. Department of Energy's Office of Science with responsibility to oversee and manage the Management and Operating (M&O) contract for the Thomas Jefferson National Accelerator Facility (TJNAF) in Newport News, Virginia. TJNAF is one of ten Office of Science Laboratories and is a single program

213

Generalized charge-screening in relativistic ThomasFermi model  

SciTech Connect

In this paper, we study the charge shielding within the relativistic Thomas-Fermi model for a wide range of electron number-densities and the atomic-number of screened ions. A generalized energy-density relation is obtained using the force-balance equation and taking into account the Chandrasekhar's relativistic electron degeneracy pressure. By numerically solving a second-order nonlinear differential equation, the Thomas-Fermi screening length is investigated, and the results are compared for three distinct regimes of the solid-density, warm-dense-matter, and white-dwarfs (WDs). It is revealed that our nonlinear screening theory is compatible with the exponentially decaying Thomas-Fermi-type shielding predicted by the linear response theory. Moreover, the variation of relative Thomas-Fermi screening length shows that extremely dense quantum electron fluids are relatively poor charge shielders. Calculation of the total number of screening electrons around a nucleus shows that there is a position of maximum number of screening localized electrons around the screened nucleus, which moves closer to the point-like nucleus by increase in the plasma number density but is unaffected due to increase in the atomic-number value. It is discovered that the total number of screening electrons, (N{sub s}?r{sub TF}{sup 3}/r{sub d}{sup 3} where r{sub TF} and r{sub d} are the Thomas-Fermi and interparticle distance, respectively) has a distinct limit for extremely dense plasmas such as WD-cores and neutron star crusts, which is unique for all given values of the atomic-number. This is equal to saying that in an ultrarelativistic degeneracy limit of electron-ion plasma, the screening length couples with the system dimensionality and the plasma becomes spherically self-similar. Current analysis can provide useful information on the effects of relativistic correction to the charge screening for a wide range of plasma density, such as the inertial-confined plasmas and compact stellar objects.

Akbari-Moghanjoughi, M. [Department of Physics, Faculty of Sciences, Azarbaijan Shahid Madani University, 51745-406 Tabriz, Iran and International Centre for Advanced Studies in Physical Sciences and Institute for Theoretical Physics, Ruhr University Bochum, D-44780 Bochum (Germany)

2014-10-15T23:59:59.000Z

214

Thomas Jefferson Site Office CX Determinations | U.S. DOE Office...  

Office of Science (SC) Website

Thomas Jefferson Site Office CX Determinations Safety and Security Policy (SSP) SSP Home About Frequently Used Resources Categorical Exclusion Determinations Continuity of...

215

UBC Social Ecological Economic Development Studies (SEEDS) Student Report Derek Guo, Drew Willms, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton  

E-Print Network (OSTI)

, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton UBC Botanical Garden Traffic System Re Group 19 Stuart Armstrong Thomas Denton Derek Guo KlimentKuzmanovski Ralph

216

Cuttings Analysis At Coso Geothermal Area (2003) | Open Energy Information  

Open Energy Info (EERE)

3) 3) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Cuttings Analysis Activity Date 2003 Usefulness not indicated DOE-funding Unknown Exploration Basis 1) Fracture/stress analysis 2) Determine the EGS potential of Coso Geothermal Region Notes 1) Petrologic analyses of cuttings from several wells are used to construct a vein-mineral paragenesis of the Coso east flank. 2) Cuttings collected during the drilling of each of the four east-flank study wells are used to determine the lithologies of the hydrothermally altered zones, the characteristics of the vein fillings, and the extent of large-scale faulting. References Rose, P.; Barton, C.; McCulloch, J.; Moore, J.N.; Kovac, K.; Sheridan, J.; Spielman, P.; Berard, B. (1 January 2003) The Coso EGS

217

Implementation of DOE NPH Requirements at the Thomas Jefferson National Accelerator Facility (TJNAF), a Non-Nuclear DOE Lab  

Energy.gov (U.S. Department of Energy (DOE))

Implementation of DOE NPH Requirements at the Thomas Jefferson National Accelerator Facility (TJNAF), a Non-Nuclear DOE Lab David Luke, DOE, Thomas Jefferson Site Office Stephen McDuffie, DOE, Office of the Chief of Nuclear Safety

218

SBOT VIRGINIA THOMAS JEFFERSON LAB POC Danny Llyod Telephone  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VIRGINIA VIRGINIA THOMAS JEFFERSON LAB POC Danny Llyod Telephone (757) 269-7121 Email lloyd@jlab.org ADMINISTATIVE / WASTE / REMEDIATION Facilities Support Services 561210 Employment Placement Agencies 561311 Travel Agencies 561510 Locksmiths 561622 Exterminating and Pest Control Services 561710 Janitorial Services 561720 Landscaping Services 561730 Carpet and Upholstery Cleaning Services 561740 Hazardous Waste Collection 562112 CONSTRUCTION Industrial Building Construction 236210 Commercial and Institutional Building Construction 236220 Water and Sewer Line and Related Structures Construction 237110 Power and Communication Line and Related Structures Construction 237130 Highway, Street, and Bridge Construction 237310 Other Heavy and Civil Engineering Construction 237990 Other Foundation, Structure, and Building Exterior Contractors

219

GenomeView: a next-generation genome browser Thomas Abeel1,2,3,  

E-Print Network (OSTI)

GenomeView: a next-generation genome browser Thomas Abeel1,2,3, *, Thomas Van Parys1,2 , Yvan Saeys GenomeView, a stand-alone genome browser specifically designed to visualize and manipulate a multitude of genomics data. GenomeView enables users to dynamically browse high volumes of aligned short-read data

Gent, Universiteit

220

Usability and Playability Issues for ARQuake Bruce Thomas, Nicholas Krul, Benjamin Close and Wayne Piekarski  

E-Print Network (OSTI)

1 Usability and Playability Issues for ARQuake Bruce Thomas, Nicholas Krul, Benjamin Close: #12;2 Bruce Thomas, Nicholas Krul, Benjamin Close and Wayne Piekarski the see-through display allows to walk through the information space. 5) The user interface additionally requires only a simple hand-held

Thomas, Bruce

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Studienleiter Chemie und Molekulare Wissenschaften Sekretariat Studienleitung Prof. Thomas Wandlowski Sandra Zbinden  

E-Print Network (OSTI)

Studienleiter Chemie und Molekulare Wissenschaften Sekretariat Studienleitung Prof. Thomas Wandlowski Sandra Zbinden Departement für Chemie und Biochemie Departement für Chemie und Biochemie 6318057 e-mail: thomas.wandlowski@dcb.unibe.ch e-mail: sandra.zbinden@dcb.unibe.ch Bachelor in Chemie und

Mühlemann, Oliver

222

Thomas Ridder Dresdner Forum 2006 June 23, 2006 1 Modeling Dependency in Credit Portfolios  

E-Print Network (OSTI)

;Thomas Ridder · Dresdner Forum 2006 · June 23, 2006 · 2 outline 1 why does dependency matter? 2 · Dresdner Forum 2006 · June 23, 2006 · 3 outline 1 why does dependency matter? 2 correlation drivers 3 two;why does dependency matter? Thomas Ridder · Dresdner Forum 2006 · June 23, 2006 · 5 focus 2: credit

Schmidt, Klaus D.

223

Mawl: Integrated Web and Telephone Service Creation David Atkins, Thomas Ball*  

E-Print Network (OSTI)

Mawl: Integrated Web and Telephone Service Creation David Atkins, Thomas Ball* Thomas Baran in a device- independent manner. PML is a markup language and middleware for controlling and pro- gramming language separates the speci cation of service logic from the speci cation of the user interface

Atkins, David

224

Partially Implicit Motion of a Sharp Interface in Navier-Stokes Flow J. Thomas Beale  

E-Print Network (OSTI)

Partially Implicit Motion of a Sharp Interface in Navier-Stokes Flow J. Thomas Beale Department, Lowengrub and Shelley. This modified step is combined with the method of [J. T. Beale, A. T. Layton, 36]. Email address: beale@math.duke.edu (J. Thomas Beale) URL: www.math.duke.edu/faculty/beale (J

225

VBH-0005 - In the Matter of Thomas Dwyer | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VBH-0005 - In the Matter of Thomas Dwyer VBH-0005 - In the Matter of Thomas Dwyer VBH-0005 - In the Matter of Thomas Dwyer This Decision involves a whistleblower complaint filed by Thomas Dwyer under the Department of Energy's (DOE) Contractor Employee Protection Program. From January 1996 to October 1997, Mr. Dwyer was employed as a pipefitter by Fluor Daniel Fernald (FDF), a DOE contractor responsible for the cleanup of the Fernald Environmental Management Project, a former DOE uranium production facility located about 18 miles northwest of Cincinnati, Ohio. Mr. Dwyer alleges that FDF first suspended him and then terminated him in retaliation for taking certain actions and making health and safety disclosures. vbh0005.pdf More Documents & Publications VBA-0005 - In the Matter of Thomas Dwyer

226

VWA-0018 - Deputy Secretary Decision - In the Matter of Thomas T. Tiller |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Deputy Secretary Decision - In the Matter of Thomas T. Deputy Secretary Decision - In the Matter of Thomas T. Tiller VWA-0018 - Deputy Secretary Decision - In the Matter of Thomas T. Tiller This is a request for review by complainant Thomas T. Tiller of an Initial Agency Decision, issued by the Office of Hearings and Appeals (OHA), denying the two reprisal complaints that he filed pursuant to 10 C.F.R. Part 708, the regulation establishing the DOE Contractor Employee Protection Program. Mr. Tiller was employed by Wackenhut Services, Inc. (Wackenhut), a DOE contractor that provides paramilitary security support services at DOE's Savannah River Site in Aiken, South Carolina. Deputy Secretary Decision Affirming VWA-0018 Decision and Order More Documents & Publications OHA Whistleblower Cases Archive File VWA-0018 - In the Matter of Thomas T. Tiller

227

Geology of the Salt Creek area, Mason County, Texas  

E-Print Network (OSTI)

and to the entrapment of. surface water in the fractures. GEOLXiBPBOLOGY The Salt Creek area in @aeon County, Texas is located on the southwestern flank of the Llano Uplift, a structural dome which has been reduced to a topographic basin by erosional processes.... STSUCT "SALCEOL00Y IIegional Structure The Llano region, which includes the Salt Creek area, is a structural dome which has been reduced to a topographic basin by erosional processes. The dose is roughly elliptical with a maximum diameter...

Harwood, William Eugene

1959-01-01T23:59:59.000Z

228

Aeromagnetic Survey At Blue Mountain Area (Fairbank Engineering, 2003) |  

Open Energy Info (EERE)

Blue Mountain Area (Fairbank Blue Mountain Area (Fairbank Engineering, 2003) Exploration Activity Details Location Blue Mountain Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes The airborne magnetometer and VLF-EM surveys carried out by Aerodat Limited, in 1988, covered the western flank of Blue Mountain including most of the geothermal lease area. The interpreted data (total field magnetic contours; calculated vertical magnetic gradient) indicate parallel sets of northerly, northeasterly, and northwesterly-trending structures that correspond well with the major fault sets identified from geologic mapping and interpreted drilling sections. Also, an elongate northerly-trending area of low magnetic gradient coincides closely with the area of intense

229

A LIMITED LIABILITY PARTNERSHIP 1050 Thomas Jefferson Street, NW  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A LIMITED LIABILITY PARTNERSHIP A LIMITED LIABILITY PARTNERSHIP 1050 Thomas Jefferson Street, NW Seventh Floor Washington, DC 20007 (202) 298-1800 Phone (202) 338-2416 Fax MEMORANDUM TO: DOE Office of General Counsel FROM: Doug Smith DATE: August 29, 2013 RE: Record of Communication Concerning Ceiling Fan and Ceiling Fan Light Kit Framework Document-Docket No. EERE-2012-BT-STD-0045 This memo provides an overview of communications made to DOE staff on the subject of possible changes to standards and test procedures for ceiling fans and ceiling fan light kits. The communications occurred at a meeting held at 10:30 a.m. on August 20, 2013, following the close of the comment period on the initial framework document for ceiling fans and light kits. The meeting attendees included:

230

Mr. Thomas A. Dickerson Supervisor of Environmental Affairs  

Office of Legacy Management (LM)

3 3 932. . . - ,_ ' ,;. Department of Energy Washinglon.DC 20545 tie c"rT SEP 05 1990 pff, (>-.I Mr. Thomas A. Dickerson Supervisor of Environmental Affairs Carpenter Technology Corporation Engineering and Construction P. 0. Box 14662 Reading, Pennsylvania 19612-4662 Dear Mr. Dickerson: The Department of Energy (DOE) has completed its review of the preliminary radiological data from the surveys of your facility in Reading, Pennsylvania, completed in July and August 1988. We are pleased to inform you that the survey has verified that the radiological condition of your facility is in compliance with applicable DOE Guidelines and that no remedial action or further investigations are necessary. I am enclosing a copy of the survey report prepared by our

231

Commander, Seneca Army Depot Attention: Thomas Stincic, Safety Officer  

Office of Legacy Management (LM)

9 1986 9 1986 Department of Energy Washington, D .C. 20545 . Commander, Seneca Army Depot Attention: Thomas Stincic, Safety Officer Romulus, New York 14541 Dear Mr. Stincic: As you are aware, the Department of Energy is evaluating the radiological condition of sites formerly used by Department predecessors during the early years of nuclear energy development , and a portion of the Seneca Army Depot was identified as one such site. While our preliminary inves-tiga- tions did identify residual radioactive material on the site, it is our understanding that the Department of Army assumed responsibility for this residual radioactivity and has completed remedial action. We have not received a final report of this work and would appreciate receiving a copy

232

A Tony Thomas-Inspired Guide to INSPIRE  

SciTech Connect

The SPIRES database was created in the late 1960s to catalogue the high energy physics preprints received by the SLAC Library. In the early 1990s it became the first database on the web and the first website outside of Europe. Although indispensible to the HEP community, its aging software infrastructure is becoming a serious liability. In a joint project involving CERN, DESY, Fermilab and SLAC, a new database, INSPIRE, is being created to replace SPIRES using CERN's modern, open-source Invenio database software. INSPIRE will maintain the content and functionality of SPIRES plus many new features. I describe this evolution from the birth of SPIRES to the current day, noting that the career of Tony Thomas spans this timeline.

O'Connell, Heath B.; /Fermilab

2010-04-01T23:59:59.000Z

233

VWA-0018 - In the Matter of Thomas T. Tiller | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

In the Matter of Thomas T. Tiller In the Matter of Thomas T. Tiller VWA-0018 - In the Matter of Thomas T. Tiller This Decision concerns two whistleblower complaints filed by Thomas T. Tiller (Tiller) under the Department of Energy's (DOE) Contractor Employee Protection Program, 10 C.F.R. Part 708. At all times relevant to this proceeding, Tiller was employed by Wackenhut Services, Incorporated (Wackenhut), a DOE contractor that provides paramilitary security support services at the DOE's Savannah River Site in Aiken, South Carolina. Tiller contends in his first complaint that Wackenhut demoted him after he alleged that a senior level manager at Wackenhut had engaged in unethical and possible criminal conduct. In his second complaint, Tiller charges that Wackenhut retaliated against him after learning he had filed a Part 708

234

Remarks by NNSA Administrator Thomas P. D'Agostino, 12th Annual Small  

NLE Websites -- All DOE Office Websites (Extended Search)

NNSA Administrator Thomas P. D'Agostino, 12th Annual Small NNSA Administrator Thomas P. D'Agostino, 12th Annual Small Business Conference & Expo, Kansas City, Missouri | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > Remarks by NNSA Administrator Thomas P. D'Agostino, ... Speech Remarks by NNSA Administrator Thomas P. D'Agostino, 12th Annual Small

235

VBA-0005 - In the Matter of Thomas Dwyer | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VBA-0005 - In the Matter of Thomas Dwyer VBA-0005 - In the Matter of Thomas Dwyer VBA-0005 - In the Matter of Thomas Dwyer This Decision considers an Appeal of an Initial Agency Decision (IAD) issued on May 2, 2000, involving a complaint filed by Thomas Dwyer (Dwyer or the complainant) under the Department of Energy (DOE) Contractor Employee Protection Program, 10 C.F.R. Part 708. In his complaint, Dwyer claims that Fluor Daniel Fernald (FDF), a DOE contractor, suspended and then terminated his employment in retaliation for his making disclosures that are protected under Part 708. In the IAD, however, the Hearing Officer determined that FDF had shown that it would have terminated the complainant for his misconduct, even in the absence of the protected disclosures. As set forth in this decision, I have determined that Dwyer's Appeal must be

236

FIA-12-0023 - In the Matter of Thomas R. Thielen | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

23 - In the Matter of Thomas R. Thielen 23 - In the Matter of Thomas R. Thielen FIA-12-0023 - In the Matter of Thomas R. Thielen The Department of Energy's (DOE) Office of Hearings and Appeals (OHA) Director granted in part and denied in all other respects a Privacy Act Appeal filed by Thomas R. Thielen. Mr. Thielen filed a request with the DOE's Richland Operations Office for documents regarding a safety concern he raised to CH2M Hill Plateau Remediation Company (CHPRC). Richland issued a determination letter which stated that, according to CHPRC's contract with DOE, CHPRC's employee concern records are the property of the contractor and not subject to the provisions of the Freedom of Information Act or Privacy Act. Richland released a copy of Mr. Thielen's DOE employee concern file, but withheld portions of the

237

Adaptive Temporal Tone Mapping Shaun David Ramsey, J. Thomas Johnson III, Charles Hansen  

E-Print Network (OSTI)

University of Utah, Salt Lake City, Utah, USA Abstract Monitor intensity ranges are much lower than the rangeAdaptive Temporal Tone Mapping Shaun David Ramsey, J. Thomas Johnson III, Charles Hansen

Utah, University of

238

Communicated by P. M. A. Tigerstedt B. R. Thomas ( ) ' S. E. Macdonald  

E-Print Network (OSTI)

Communicated by P. M. A. Tigerstedt B. R. Thomas ( ) ' S. E. Macdonald Department of Renewable. E. Macdonald ' M. Hicks D. L. Adams ' R. B. Hodgetts Effects of reforestation methods on genetic

Macdonald, Ellen

239

Gareth Thomas, 1977 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

1970's Gareth Thomas, 1977 Print Text Size: A A A FeedbackShare Page Chemistry & Metallurgy: For his contributions to the study of diffusion and defects in solids,...

240

E-Print Network 3.0 - africa 1887-1889 thomas Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Search Powered by Explorit Topic List Advanced Search Sample search results for: africa 1887-1889 thomas Page: << < 1 2 3 4 5 > >> 1 The Burke Library Archives (Columbia...

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Nearly Singular Integrals in 3D Stokes Flow Svetlana Tlupova1,, J. Thomas Beale2  

E-Print Network (OSTI)

Nearly Singular Integrals in 3D Stokes Flow Svetlana Tlupova1,, J. Thomas Beale2 1 Department. Email addresses: stlupova@umich.edu (S. Tlupova), beale@math.duke.edu (J. T. Beale) http

242

A METHOD FOR COMPUTING NEARLY SINGULAR INTEGRALS J. THOMAS BEALE AND MING-CHIH LAI  

E-Print Network (OSTI)

A METHOD FOR COMPUTING NEARLY SINGULAR INTEGRALS J. THOMAS BEALE AND MING-CHIH LAI SIAM J. NUMER Department, Duke University, Durham, NC 27708-0320 (beale@math.duke.edu). The research of this author

Lai, Ming-Chih

243

Research Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Areas Areas Research Areas Print Scientists from a wide variety of fields come to the ALS to perform experiements. Listed below are some of the most common research areas covered by ALS beamlines. Below each heading are a few examples of the specific types of topics included in that category. Click on a heading to learn more about that research area at the ALS. Energy Science Photovoltaics, photosynthesis, biofuels, energy storage, combustion, catalysis, carbon capture/sequestration. Bioscience General biology, structural biology. Materials/Condensed Matter Correlated materials, nanomaterials, magnetism, polymers, semiconductors, water, advanced materials. Physics Atomic, molecular, and optical (AMO) physics; accelerator physics. Chemistry Surfaces/interfaces, catalysts, chemical dynamics (gas-phase chemistry), crystallography, physical chemistry.

244

Thomas Jefferson's administration as viewed by his contemporaries in New England  

E-Print Network (OSTI)

THOMAS JEPZERSON'S ADMINISTRATION AS VIEWED BY HIS CONTEMPORARIES IN NZW ENGLAND A . Thesis by MARILYN ELAINE JARCHOW Submitted to the Graduate College of Texas AkM University in partial fulfillment of the requirement for the degree...(M ea o epar men em er August 1970 ABSTRACT Thomas Jefferson's Administration as Viewed by His Contemporaries in New England. (August 1970) Marilyn Elaine Jarohow, B. A. , California State College at Fullerton; Direoted by& Dr. Joseph M. Nance...

Jarchow, Marilyn Elaine

2012-06-07T23:59:59.000Z

245

Implementation of an iterative technique for a solution of the Thomas-Fermi equation  

E-Print Network (OSTI)

IMPLEMENTATION OF AN ITERATIVE TECHNIQUE FOR A SOLUTION OF THE THOMAS-FERMI EQUATION A Thesis by RAYMOND CALVERT FLAGG Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE August 1978 Major Subject: Mathematics IMPLEMENTATION OF AN ITERATIVE TECHNIQUE FOR A SOLUTION OF THE THOMAS-FERMI EQUATION A Thesis by RAYMOND CALVERT FLAGG Approved as to sryle and content by: (Chairman of Committeeee ( ead...

Flagg, Raymond Calvert

2012-06-07T23:59:59.000Z

246

Research Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Areas Print Research Areas Print Scientists from a wide variety of fields come to the ALS to perform experiements. Listed below are some of the most common research areas covered by ALS beamlines. Below each heading are a few examples of the specific types of topics included in that category. Click on a heading to learn more about that research area at the ALS. Energy Science Photovoltaics, photosynthesis, biofuels, energy storage, combustion, catalysis, carbon capture/sequestration. Bioscience General biology, structural biology. Materials/Condensed Matter Correlated materials, nanomaterials, magnetism, polymers, semiconductors, water, advanced materials. Physics Atomic, molecular, and optical (AMO) physics; accelerator physics. Chemistry Surfaces/interfaces, catalysts, chemical dynamics (gas-phase chemistry), crystallography, physical chemistry.

247

coherence area  

Science Journals Connector (OSTI)

1....In an electromagnetic wave, such as a lightwave or a radio wave, the area of a surface (a) every point on which the surface is perpendicular to the direction of propagation, (b) over which the e...

2001-01-01T23:59:59.000Z

248

Isotopic Analysis- Fluid At Coso Geothermal Area (2007) | Open Energy  

Open Energy Info (EERE)

Isotopic Analysis- Fluid At Coso Geothermal Area (2007) Isotopic Analysis- Fluid At Coso Geothermal Area (2007) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Fluid At Coso Geothermal Area (2007) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Isotopic Analysis- Fluid Activity Date 2007 Usefulness not indicated DOE-funding Unknown Exploration Basis Determine the location of the heat source Notes Fluids have been sampled from 9 wells and 2 fumaroles from the East Flank of the Coso hydrothermal system with a view to identifying, if possible, the location and characteristics of the heat source inflows into this portion of the geothermal field. Preliminary results show that there has been extensive vapor loss in the system, most probably in response to

249

Aeromagnetic Survey At Blue Mountain Area (Fairbank Engineering, 2004) |  

Open Energy Info (EERE)

4) 4) Exploration Activity Details Location Blue Mountain Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes The airborne magnetometer and VLF-EM surveys carried out by Aerodat Limited, in 1988, covered the western flank of Blue Mountain including most of the geothermal lease area. The interpreted data (total field magnetic contours; calculated vertical magnetic gradient) indicate parallel sets of northerly, northeasterly, and northwesterly-trending structures that correspond well with the major fault sets identified from geologic mapping and interpreted drilling sections. Also, an elongate northerly-trending area of low magnetic gradient coincides closely with the area of intense hydrothermal alteration associated with the prominent north-south range

250

Magnetotellurics At Truckhaven Area (Warpinski, Et Al., 2004) | Open Energy  

Open Energy Info (EERE)

Magnetotellurics At Truckhaven Area (Warpinski, Et Magnetotellurics At Truckhaven Area (Warpinski, Et Al., 2004) Exploration Activity Details Location Truckhaven Area Exploration Technique Magnetotellurics Activity Date Usefulness useful DOE-funding Unknown Notes The Truckhaven project, which is located on the west flank of the Salton Trough in southern California, is north and west of several existing geothermal power generation facilities in the trough. An extensive shallow geothermal anomaly is known to exist in this area and this region corresponds to a gravity high, which has been further delineated by the drilling of numerous shallow temperature gradient wells and one deep, abandoned, test well. Layman Energy Associates has performed Phase I exploration tasks to further constrain the anomaly, including a detailed

251

Radiological Areas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Revision to Clearance Policy Associated with Recycle of Scrap Metals Originating from Revision to Clearance Policy Associated with Recycle of Scrap Metals Originating from Radiological Areas On July 13, 2000, the Secretary of Energy imposed an agency-wide suspension on the unrestricted release of scrap metal originating from radiological areas at Department of Energy (DOE) facilities for the purpose of recycling. The suspension was imposed in response to concerns from the general public and industry groups about the potential effects of radioactivity in or on material released in accordance with requirements established in DOE Order 5400.5, Radiation Protection of the Public and Environment. The suspension was to remain in force until DOE developed and implemented improvements in, and better informed the public about, its release process. In addition, in 2001 the DOE announced its intention to prepare a

252

Fluid Inclusion Analysis At Coso Geothermal Area (2004) | Open Energy  

Open Energy Info (EERE)

Fluid Inclusion Analysis At Coso Geothermal Area Fluid Inclusion Analysis At Coso Geothermal Area (2004) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Fluid Inclusion Analysis Activity Date 2004 Usefulness not indicated DOE-funding Unknown Exploration Basis 1) To determine if analyses of fluid propene and propane species in fluid inclusions can be used to interpret fluid type, history, or process. 2) To evaluate the geology and thermal history of the East Flank, in order to better understand how the rocks will behave during hydro-fracturing. Notes 1) Analyses were performed on drill cuttings at 20ft intervals from four Coso geothermal wells. Two wells are good producers, one has cold-water entrants in the production zone, and the fourth is a non-producer. The ratios show distinct differences between producing and the non-producing

253

Magnetotellurics At Coso Geothermal Area (2004) | Open Energy Information  

Open Energy Info (EERE)

Magnetotellurics At Coso Geothermal Area (2004) Magnetotellurics At Coso Geothermal Area (2004) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Magnetotellurics Activity Date 2004 Usefulness not indicated DOE-funding Unknown Exploration Basis EGS potential of Coso Geothermal Region Notes A dense grid of magnetotelluric (MT) stations plus contiguous bipole array profiling centered over the east flank of the Coso geothermal system is being acquired. Acquiring good quality MT data in producing geothermal systems is a challenge due to production related electromagnetic (EM) noise and, in the case of Coso, due to proximity of a regional DC intertie power transmission line. To achieve good results, a remote reference completely outside the influence of the dominant source of EM noise must be

254

Magnetotellurics At Coso Geothermal Area (2006) | Open Energy Information  

Open Energy Info (EERE)

Magnetotellurics At Coso Geothermal Area (2006) Magnetotellurics At Coso Geothermal Area (2006) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Magnetotellurics Activity Date 2006 Usefulness useful DOE-funding Unknown Exploration Basis Use magnetotelluric data to model the reservoir. Notes Magnetotelluric (MT) data from 101 tensor stations over the East Flank of the Coso geothermal field, southeastern California, were inverted on a PC using a 3-D Gauss-Newton regularization algorithm based on a staggered-grid, finite difference forward problem and jacobians. Static shifts at each MT site can be included as additional parameters and solved for simultaneously. Recent modifications to the algorithm developed here include the addition of an LU solver to calculate the model parameter

255

UBC Social Ecological Economic Development Studies (SEEDS) Student Report Derek Guo, Drew Willms, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton  

E-Print Network (OSTI)

, Kliment Kuzmanovski, Ralph Mercado, Stuart Armstrong, Thomas Denton UBC Botanical Garden Development Plan Plan CIVL 445 Engineering Design and Analysis I Group 19 Stuart Armstrong Thomas Denton Derek Guo

256

Thomas B. Cook,1971 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Thomas B. Cook,1971 Thomas B. Cook,1971 The Ernest Orlando Lawrence Award Lawrence Award Home Nomination & Selection Guidelines Award Laureates 2000's 1990's 1980's 1970's 1960's Ceremony The Life of Ernest Orlando Lawrence Contact Information The Ernest Orlando Lawrence Award U.S. Department of Energy SC-2/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-9395 E: lawrence.award@science.doe.gov 1970's Thomas B. Cook,1971 Print Text Size: A A A RSS Feeds FeedbackShare Page Weapons: For his significant contributions to the study of nuclear weapons effects, for his original work in the translation of this knowledge into advanced technology for peaceful and military uses of atomic energy, and for his outstanding contributions to the nation through his service as an

257

Thomas P. Guilderson, 2011 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Thomas P. Guilderson, 2011 Thomas P. Guilderson, 2011 The Ernest Orlando Lawrence Award Lawrence Award Home Nomination & Selection Guidelines Award Laureates 2000's 1990's 1980's 1970's 1960's Ceremony The Life of Ernest Orlando Lawrence Contact Information The Ernest Orlando Lawrence Award U.S. Department of Energy SC-2/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-9395 E: lawrence.award@science.doe.gov 2000's Thomas P. Guilderson, 2011 Print Text Size: A A A RSS Feeds FeedbackShare Page Biological and Environmental Sciences: For ground-breaking radiocarbon measurements of corals, advancements in understanding the paleo-history of ocean currents and ocean processes revealing past climate variability, and the elucidation of how physical and biogeochemical oceanic processes affect

258

Thomas Jefferson Site Office CX Determinations | U.S. DOE Office of Science  

Office of Science (SC) Website

Thomas Jefferson Site Office CX Thomas Jefferson Site Office CX Determinations Integrated Support Center (ISC) ISC Home About Services Freedom of Information Act (FOIA) Privacy Act Categorical Exclusion Determinations Contact Information Integrated Support Center Roxanne Purucker U.S. Department of Energy 9800 S. Cass Avenue Argonne, IL 60439 P: (630) 252-2110 Larry Kelly U.S. Department of Energy 200 Administration Road Oak Ridge, TN 37830 P: (865) 576-0885 Categorical Exclusion (CX) Determinations Thomas Jefferson Site Office CX Determinations Print Text Size: A A A RSS Feeds FeedbackShare Page As of October 31, 2010, there have been no CX determinations made. Categorical Exclusion Determination Documents (CX Determinations): * Determination Date Name of Action: Description Categorical Exclusion Number External link

259

Microsoft PowerPoint - Ralph_Thomas Energy Teaming Agreement Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ralph C. Thomas III, Esquire Ralph C. Thomas III, Esquire Partner Barton Baker Thomas & Tolle LLP McLean, VA 10 th Annual U.S. Department of Energy Small Business Conference Small Businesses Leading the Way to Recovery and Reinvestment Presenters Name Page # 2 INTRODUCTION: WHAT IS A TEAMING AGREEMENT? ► "An arrangement pursuant to which . . . ► A. Two or more companies form a partnership or joint venture to act as a potential prime contractor; or ► B. A potential prime contractor agrees with one or more other companies to have them act as its subcontractor under a specified government contract or acquisition program" FAR 9.601 3 5 Reasons Why a Prime Would Be Interested in You Two Questions to Ask to Determine Which Reason Applies to You 4 SMALL BUSINESS'S OBJECTIVE IN NEGOTIATING

260

Thomas A. Weaver, 1985 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Thomas A. Weaver, 1985 Thomas A. Weaver, 1985 The Ernest Orlando Lawrence Award Lawrence Award Home Nomination & Selection Guidelines Award Laureates 2000's 1990's 1980's 1970's 1960's Ceremony The Life of Ernest Orlando Lawrence Contact Information The Ernest Orlando Lawrence Award U.S. Department of Energy SC-2/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-9395 E: lawrence.award@science.doe.gov 1980's Thomas A. Weaver, 1985 Print Text Size: A A A RSS Feeds FeedbackShare Page National Security: For his exceptional contributions to national security in the physics, design and leadership of x-ray laser experiments, which include work in atomic physics, radiate transfer and hydrodynamics, material science, and the development of complex diagnostics. These major

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Thomas E. Wainwright, 1973 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Thomas E. Wainwright, 1973 Thomas E. Wainwright, 1973 The Ernest Orlando Lawrence Award Lawrence Award Home Nomination & Selection Guidelines Award Laureates 2000's 1990's 1980's 1970's 1960's Ceremony The Life of Ernest Orlando Lawrence Contact Information The Ernest Orlando Lawrence Award U.S. Department of Energy SC-2/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-9395 E: lawrence.award@science.doe.gov 1970's Thomas E. Wainwright, 1973 Print Text Size: A A A RSS Feeds FeedbackShare Page Weapons: For fundamental and original contributions to the theory of design and outputs of nuclear explosives for the original development of computational methods for the calculation of statistical physics phenomena, and for many innovative advances in the study of transport and

262

Thomas Jefferson Site Office CX Determinations | U.S. DOE Office of Science  

Office of Science (SC) Website

Thomas Jefferson Site Office CX Determinations Thomas Jefferson Site Office CX Determinations Safety, Security and Infrastructure (SSI) SSI Home Facilities and Infrastructure Safeguards & Security Environment, Safety and Health (ES&H) Organization Chart .pdf file (82KB) Phone Listing .pdf file (129KB) SC HQ Continuity of Operations (COOP) Implementation Plan .pdf file (307KB) Categorical Exclusion Determinations SLI & SS Budget Contact Information Safety, Security and Infrastructure U.S. Department of Energy SC-31/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-4097 F: (301) 903-7047 Categorical Exclusion (CX) Determinations Thomas Jefferson Site Office CX Determinations Print Text Size: A A A RSS Feeds FeedbackShare Page As of October 31, 2010, there have been no CX determinations made.

263

VBB-0005 - In the Matter of Thomas Dwyer | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

05 - In the Matter of Thomas Dwyer 05 - In the Matter of Thomas Dwyer VBB-0005 - In the Matter of Thomas Dwyer This letter concerns the complaint of reprisal that you submitted to the Department of Energy under 10 C.F.R. Part 708. You have filed a petition for Secretarial review of the appeal decision issued to you on July 24, 2000. The Part 708 regulations applicable to the petition provide that the Secretary will reverse or revise an appeal decision by the Director of the Office of Hearings and Appeals only under extraordinary circumstances. 10 C.F.R. § 708.35(d). After fully evaluating all the issues that you raised in your filing dated September 8, 2000, I have determined that you have not shown that extraordinary circumstances warranting Secretarial review exist in this case. No modification to the appeal decision by the OHA Director is

264

Finding of No Significant Impact Improvements at the Thomas Jefferson National Accelerator Facility Newsport News, Virginia  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

IMPROVEMENTS AT THE THOMAS JEFFERSON NATIONAL ACCELERATOR FACILITY IMPROVEMENTS AT THE THOMAS JEFFERSON NATIONAL ACCELERATOR FACILITY NEWPORT NEWS, VIRGINIA AGENCY: U.S. DEPARTMENT OF ENERGY ACTION: FINDING OF NO SIGNIFICANT IMPACT SUMMARY: The U.S. Department of Energy (DOE) has completed an Environmental Assessment (DOE/EA-1384) for proposed Improvements at the Thomas Jefferson National Accelerator Facility (Jefferson Lab). Newport News, Virginia. Based on the results of the impacts analysis reported in the EA, DOE has determined that the proposed action is not a major Federal action that would significantly affect the quality of the human environment within the context of the National Environmental Policy Act of 1969 (NEPA). Therefore, preparation of an environmental impact statement (EIS) is not necessary, and DOE is issuing this Finding of No

265

An Architecture for Optimal AlltoAll Personalized Communication Susan Hinrichs, Corey Kosak, David R. O'Hallaron, Thomas M. Stricker, and Riichiro Take # \\Lambda  

E-Print Network (OSTI)

, David R. O'Hallaron, Thomas M. Stricker, and Riichiro Take # \\Lambda School of Computer Science Carnegie

Shewchuk, Jonathan

266

Symmetry energy of hot nuclei in the relativistic Thomas-Fermi approximation  

E-Print Network (OSTI)

We develop a self-consistent description of hot nuclei within the relativistic Thomas--Fermi approximation using the relativistic mean-field model for nuclear interactions. The temperature dependence of the symmetry energy and other physical quantities of a nucleus are calculated by employing the subtraction procedure in order to isolate the nucleus from the surrounding nucleon gas. It is found that the symmetry energy coefficient of finite nuclei is significantly affected by the Coulomb polarization effect. We also examine the dependence of the results on nuclear interactions and make a comparison between the results obtained from relativistic and nonrelativistic Thomas-Fermi calculations.

Zhang, Z W; Hu, J N; Shen, H

2014-01-01T23:59:59.000Z

267

A review of "Borders and Travellers in Early Modern Europe" edited by Thomas Betteridge  

E-Print Network (OSTI)

worked from very similar assumptions about the need for hermeneutic stability. Thomas Betteridge, ed. Borders and Travellers in Early Modern Europe. Aldershot:: Ashgate, 2007. vi + 196 pp. $99.95. Review by Li n d a McJa n n e t , Be n t L e y un i v... e r s i t y . As described by editor Thomas Betteridge, Borders and Travellers in Early Modern Europe provides ?a trans-European interdisciplinary inter- rogation of borders and travel in early modern Europe? (12). Of the eleven essays...

McJannet, Linda

2008-01-01T23:59:59.000Z

268

SYLLABUS FOR MATH 2250 Text: Hass, Weir, and Thomas,  

E-Print Network (OSTI)

: Integration 5.1­5.2 Area and Estimating with Finite Sums, Sigma Notation and Limits of Finite Sums 2 §5.1: #1, 55, 61, 63, 73 5.6 Substitution and Area Between Curves 2 §5.6: #1, 3, 7, 13, 25, 27, 31, 39, 47, 51, 45, 51, 53, 55, 56, 59, 72, 76, 77 3.4 The Derivative as a Rate of Change 2 §3.4: #1, 5, 7, 10, 11

Smith, Roy

269

Environmental Assessment Proposed Improvements at the Thomas Jefferson National Accelerator Facility Newport News, Virginia  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

84 84 Environmental Assessment Proposed Improvements at the Thomas Jefferson National Accelerator Facility Newport News, Virginia June 2002 U. S. Department of Energy Oak Ridge Operations Oak Ridge, Tennessee DOE/EA-1384 i TABLE OF CONTENTS Executive Summary.....................................................................................................................1 1. INTRODUCTION..................................................................................................................... 6 1.1 PREVIOUS ACTIONS ............................................................................................................................................. 6 1.2 SCOPE OF THIS PROPOSED ACTION..............................................................................................................

270

FDR3 --A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong,  

E-Print Network (OSTI)

FDR3 -- A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong, Alexandre.roscoe}@cs.ox.ac.uk Abstract. FDR3 is a complete rewrite of the CSP refinement checker FDR2, incorporating a significant number describe the new algorithm that FDR3 uses to construct its in- ternal representation of CSP processes

Oxford, University of

271

FDR3 --A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong,  

E-Print Network (OSTI)

FDR3 -- A Modern Refinement Checker for CSP Thomas Gibson-Robinson, Philip Armstrong, Alexandre.roscoe}@cs.ox.ac.uk Abstract. FDR3 is a complete rewrite of the CSP refinement checker FDR2, incorporating a significant number describe the new algorithm that FDR3 uses to construct its internal representation of CSP processes

Oxford, University of

272

Ising quantum chain and sequence evolution Holger Wagner 1) , Ellen Baake 2) , and Thomas Gerisch 1)  

E-Print Network (OSTI)

Ising quantum chain and sequence evolution Holger Wagner 1) , Ellen Baake 2) , and Thomas Gerisch 1 in molecular evolution is shown to be equivalent to an Ising quantum chain. Observable quantities, tailored and selection; Ising quantum chain; mean-#12;eld model; phase transition 1 Introduction Sequence space models

Baake, Ellen

273

Laser Excitation of a Fracture Source for Elastic Waves Thomas E. Blum* and Kasper van Wijk  

E-Print Network (OSTI)

Laser Excitation of a Fracture Source for Elastic Waves Thomas E. Blum* and Kasper van Wijk a transparent sample by focusing laser light directly onto this fracture. The associated displacement field, measured by a laser interferometer, has pronounced waves that are diffracted at the fracture tips. We

Snieder, Roel

274

State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network (OSTI)

Statics ISE 211 Engineering Economics General Education Elective (A) Spring Math 304 Linear Algebra ISE Engineering Industrial and systems engineering is integral to American industry and economic growth. Its major3/24/2009 State University of New York at Binghamton Thomas J. Watson School of Engineering

Suzuki, Masatsugu

275

State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network (OSTI)

211 Engineering Economics General Education Elective (A) Spring Math 304 Linear Algebra ISE 231 Human and systems engineering is integral to American industry and economic growth. Its major focus is on the design3/24/2009 State University of New York at Binghamton Thomas J. Watson School of Engineering

Suzuki, Masatsugu

276

State University of New York at Binghamton Thomas J. Watson School of Engineering and Applied Science  

E-Print Network (OSTI)

Engineering Economics & Project Management General Education Elective (H) Year 4 Fall ISE 420 Optimization and systems engineering is integral to American industry and economic growth. Its major focus is on the design8/27/2012 State University of New York at Binghamton Thomas J. Watson School of Engineering

Suzuki, Masatsugu

277

A Privacy-Aware Architecture For Demand Response Systems Stephen Wicker, Robert Thomas  

E-Print Network (OSTI)

A Privacy-Aware Architecture For Demand Response Systems Stephen Wicker, Robert Thomas School architectures that realize the benefits of demand response without requiring that AMI data be centrally-based demand response efforts in the face of public outcry. We also show that Trusted Platform Modules can

Wicker, Stephen

278

Corrosion Damage Detection with Piezoelectric Wafer Active Sensors Dustin Thomas, John Welter  

E-Print Network (OSTI)

1 Corrosion Damage Detection with Piezoelectric Wafer Active Sensors Dustin Thomas, John Welter Air a priority issue for today's Air Force. One of the most critical structural problems is corrosion. In fact the KC-135 now costs $1.2 billion a year to repair corrosion. In this paper, we plan to show the use

Giurgiutiu, Victor

279

On the duration of the Paleocene-Eocene thermal maximum Ursula Rohl and Thomas Westerhold  

E-Print Network (OSTI)

On the duration of the Paleocene-Eocene thermal maximum (PETM) Ursula Ro¨hl and Thomas Westerhold of California, Santa Cruz, California 95064, USA [1] The Paleocene-Eocene thermal maximum (PETM) is one of global warming and a massive perturbation of the global carbon cycle from injection of isotopically light

Zachos, James

280

Multicomponent density-functional theory for electrons and nuclei Thomas Kreibich  

E-Print Network (OSTI)

Multicomponent density-functional theory for electrons and nuclei Thomas Kreibich Institut für a general multicomponent density-functional theory in which electrons and nuclei are treated completely , 71.10. w I. INTRODUCTION Density-functional theory DFT is among the most suc- cessful approaches

Gross, E.K.U.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Multi Criteria Analysis for bioenergy systems assessments Thomas Buchholz a,, Ewald Rametsteiner b  

E-Print Network (OSTI)

Multi Criteria Analysis for bioenergy systems assessments Thomas Buchholz a,?, Ewald Rametsteiner b Available online 11 November 2008 Keywords: Multi Criteria Analysis Bioenergy Sustainability a b s t r a c t Sustainable bioenergy systems are, by definition, embedded in social, economic, and environmental contexts

Vermont, University of

282

Augmented Foam Sculpting for Capturing 3D Models Michael R. Marner Bruce H. Thomas  

E-Print Network (OSTI)

Augmented Foam Sculpting for Capturing 3D Models Michael R. Marner Bruce H. Thomas University. A designer physically sculpts a 3D model from foam using a hand-held hot wire foam cut- ter. Both the foamD model from foam using a hand-held hot wire foam cutter. Both the foam and cutting tool are tracked

Thomas, Bruce

283

Red Cloud with MATLAB case study Thomas Cleland Neural Algorithms: Understanding the Complex  

E-Print Network (OSTI)

Red Cloud with MATLAB case study Thomas Cleland ­ Neural Algorithms: Understanding the Complex resources and commonly requested software, e.g., MATLAB, make it most efficient to outsource to a cloud be completed in an interactive timeframe (minutes to hours) on Red Cloud with MATLAB. The results from

Walter, M.Todd

284

UAV Formation Flight using 3D Potential Field Tobias Paul Thomas R. Krogstad Jan Tommy Gravdahl  

E-Print Network (OSTI)

UAV Formation Flight using 3D Potential Field Tobias Paul Thomas R. Krogstad Jan Tommy Gravdahl ESG aerial vehicles (UAVs). Based on a virtual leader approach, combined with an extended local potential a group of UAVs based on a simplified small-scale helicopter, which is simulated in MATLABTM /Simulink

Gravdahl, Jan Tommy

285

Stroke amplifier for deformable mirrors Robert H. Webb, Marc J. Albanese, Yaopeng Zhou, Thomas Bifano, and  

E-Print Network (OSTI)

Stroke amplifier for deformable mirrors Robert H. Webb, Marc J. Albanese, Yaopeng Zhou, Thomas stroke of a deformable mirror. By arranging for the wavefront to traverse the deformable mirror more than to produce lower- cost mirrors. Unfortunately, most commercial MEMS mirrors have only a limited stroke

286

Top Stroke Rehabil 2013;20(4):299307 2013 Thomas Land Publishers, Inc.  

E-Print Network (OSTI)

299 Top Stroke Rehabil 2013;20(4):299­307 © 2013 Thomas Land Publishers, Inc. www stimulation (NMES) for recovery of hand function after stroke are not known. This clinical pilot study thenar muscles of 16 persons with chronic stroke. Participants were identified a priori as having a low

Griffin, Lisa

287

Meter Any Wire, Anywhere by Virtualizing the Voltage Channel Thomas Schmid, David Culler, Prabal Dutta  

E-Print Network (OSTI)

Meter Any Wire, Anywhere by Virtualizing the Voltage Channel Thomas Schmid, David Culler, Prabal}@eecs.umich.edu culler@cs.berkeley.edu Abstract AC power meters require both voltage and current to be sampled physical proximity and fed into a single power metering de- vice. In this paper, we explore the viability

Dutta, Prabal

288

The Java Machine Learning Library Thomas Abeel, Yvan Saeys and Yves Van de Peer  

E-Print Network (OSTI)

The Java Machine Learning Library Thomas Abeel, Yvan Saeys and Yves Van de Peer Department of Plant.abeel@psb.ugent.be What is Java-ML? Motivation Code & Documentation Applications 1. Machine learning techniques: · 18 style, no GUI 6. Open Source · Lack of a (good) machine learning library: · Reference implementations

Gent, Universiteit

289

INVERTIBLE FILTER BANKS ON THE 2-SPHERE B.T. Thomas Yeo Wanmei Ou Polina Golland  

E-Print Network (OSTI)

INVERTIBLE FILTER BANKS ON THE 2-SPHERE B.T. Thomas Yeo Wanmei Ou Polina Golland Computer Science to the sphere, many key challenges remain. In this paper, we develop conditions for the invertibility be incorpo- rated into the design of self-invertible axis-symmetric wavelets. Self- invertibility

Golland, Polina

290

ALTIMETER DATA FOR OPERATIONAL USE IN THE MARINE ENVIRONMENT Susan Digby, Thomas Antczak  

E-Print Network (OSTI)

ALTIMETER DATA FOR OPERATIONAL USE IN THE MARINE ENVIRONMENT Susan Digby, Thomas Antczak Jet Propulsion Laboratory, California Institute of Technology, Pasadena, California Robert Leben, George Born, Mississippi Nick Shay University of Miami, Rosentiel School of Marine and Atmospheric Science, Miami, Florida

291

Biomass, Condition of Western Lake Erie Dreissenids Primary Investigator: Thomas Nalepa -NOAA GLERL (Emeritus)  

E-Print Network (OSTI)

Biomass, Condition of Western Lake Erie Dreissenids Primary Investigator: Thomas Nalepa - NOAA of dreissenid biomass but there are no current, accurate estimates of biomass in this portion of the lake. Biomass is calculated from abundances, size- frequencies, and length-weights. The goal of this project

292

Zero electron kinetic energy spectroscopy of the ArCl anion Thomas Lenzer,a)  

E-Print Network (OSTI)

and the neutral complexes are observed in the ZEKE spectra. From our spectroscopic data we construct modelZero electron kinetic energy spectroscopy of the ArCl anion Thomas Lenzer,a) Ivan Yourshaw, Berkeley, California 94720 Received 19 January 1999; accepted 23 February 1999 Zero electron kinetic energy

Neumark, Daniel M.

293

Zero electron kinetic energy spectroscopy of the XeCl Thomas Lenzer,a)  

E-Print Network (OSTI)

measurements for the neutral state we construct a Morse­Morse-switching­van der Waals model potential functionZero electron kinetic energy spectroscopy of the XeCl? anion Thomas Lenzer,a) Ivan Yourshaw, Berkeley, California 94720 Received 9 November 2001; accepted 21 December 2001 Zero electron kinetic energy

Neumark, Daniel M.

294

Preempting Uncertain Regulatory Threats Thomas P. Lyon and John W. Maxwelly  

E-Print Network (OSTI)

Preempting Uncertain Regulatory Threats Thomas P. Lyon and John W. Maxwelly September 15, 2004 assume certainty regarding the likelihood of the regulatory threat. We examine industry voluntary self and credible regulatory threat is needed to induce industry to take voluntary self-regulatory actions. 1

Lyon, Thomas P.

295

Impact of EPS on Digestion of Waste Activate Sludge Thomas Gostanian  

E-Print Network (OSTI)

Impact of EPS on Digestion of Waste Activate Sludge Thomas Gostanian Faculty Mentor: Professor Chul of WAS is the make-up of the Extracellular Polymeric Substances (EPS) surrounding the cells, which acts as a glue/inorganics in influent, temperature, reactor flow types, etc). Certain EPS complexes are vulnerable to specific

Mountziaris, T. J.

296

Fraunhofer FOKUSCompetence Center NGNI Prof. Dr.-Ing. habil Thomas Magedanz  

E-Print Network (OSTI)

Fraunhofer FOKUSCompetence Center NGNI Overview ?berblick 1 Prof. Dr.-Ing. habil Thomas Magedanz Berlin, Germany Internet: www.av.tu-berlin.de Email: tm@cs.tu-berlin.de #12;Fraunhofer FOKUSCompetence and IT is fueling the innovation in Service Delivery Platforms and underlying networking infrastructures · IP

Wichmann, Felix

297

OPTIMAL INVESTMENT POLICIES FOR THE HORSE RACE MODEL Thomas S. Ferguson and C. Zachary Gilstein  

E-Print Network (OSTI)

OPTIMAL INVESTMENT POLICIES FOR THE HORSE RACE MODEL Thomas S. Ferguson and C. Zachary Gilstein UCLA and Bell Communications May 1985, revised 2004 Abstract. Optimal investment policies for maximizing the expected value of the utility of an investor's fortune are presented for investment models

Ferguson, Thomas S.

298

A GENERAL INVESTMENT MODEL Thomas S. Ferguson and C. Zachary Gilstein  

E-Print Network (OSTI)

A GENERAL INVESTMENT MODEL Thomas S. Ferguson and C. Zachary Gilstein UCLA and Bell Communications Revised May 1985 Abstract. A Bayesian approach to a general investment model is proposed based on knowledge of the probability distributions of possible investment re- turns (future market events

Ferguson, Thomas S.

299

SYMMETRIC ITERATED BETTI NUMBERS ERIC BABSON, ISABELLA NOVIK, AND REKHA THOMAS  

E-Print Network (OSTI)

SYMMETRIC ITERATED BETTI NUMBERS ERIC BABSON, ISABELLA NOVIK, AND REKHA THOMAS Abstract. We de#12 Betti numbers of I. We prove that for I , the Stanley-Reisner ideal of a simplicial complex , these numbers are the symmetric counterparts of the exterior iterated Betti numbers of introduced by Duval

Novik, Isabella

300

Friction, Frontogenesis, and the Stratification of the Surface Mixed Layer LEIF THOMAS*  

E-Print Network (OSTI)

Friction, Frontogenesis, and the Stratification of the Surface Mixed Layer LEIF THOMAS* Department restratification resulting from frontogenesis in regions of confluent flow. Frictional forces acting of friction versus frontogenesis in the restratification of the mixed layer and are tested using numerical

Thompson, Andrew

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Fiber coupling with adaptive optics for free-space optical communication Thomas Weyraucha  

E-Print Network (OSTI)

Fiber coupling with adaptive optics for free-space optical communication Thomas Weyraucha , Mikhail, Department of Manufacturing Engineering, Brookline, MA 02446 ABSTRACT We describe an adaptive optical fiber coupling system for free-space optical communication comprising a micro- electromechanical deformable

302

Self-assembling DNA Nanostructures for Patterned Molecular Assembly Thomas H. LaBeana  

E-Print Network (OSTI)

1 Self-assembling DNA Nanostructures for Patterned Molecular Assembly Thomas H. LaBeana , Kurt V@cs.duke.edu; Tel: (919)660-65685 Abstract The Chapter describes the use of DNA for molecular-scale self-assembly with a discussion of DNA-nanostructures, starting with the self-assembly of various building-blocks known as DNA

Reif, John H.

303

ASSESSMENT OF AUDIO FEATURES FOR AUTOMATIC COUGH DETECTION Thomas Drugman, Jerome Urbain, Thierry Dutoit  

E-Print Network (OSTI)

ASSESSMENT OF AUDIO FEATURES FOR AUTOMATIC COUGH DETECTION Thomas Drugman, Jerome Urbain, Thierry://tcts.fpms.ac.be/drugman/ ABSTRACT This paper addresses the issue of cough detection using only audio recordings, with the ultimate. 1. INTRODUCTION For children as well as for adults, cough is in pneumology the commonest syndrom

Dupont, Stéphane

304

Arduino Remote Infrared Network Adapter Rene Neff, Thomas Trimborn and Matthias Wubbeling  

E-Print Network (OSTI)

ARINA: Arduino Remote Infrared Network Adapter Ren´e Neff, Thomas Trimborn and Matthias W}@cs.uni-bonn.de Abstract In this paper we present ARINA, a light-weight Arduino based system for forwarding infrared signals via Ethernet. Short introductions on infrared communication and Arduino as a development platform

Behnke, Sven

305

Relationship between protein folding thermodynamics and the energy landscape Jaegil Kim,* Thomas Keyes,  

E-Print Network (OSTI)

Relationship between protein folding thermodynamics and the energy landscape Jaegil Kim,* Thomas Received 23 September 2008; published 4 March 2009 The origin of protein folding thermodynamics is examined.15.Cc, 05.70. a, 87.15.A Protein folding--i.e., how a polypeptide chain reaches a unique native state

Straub, John E.

306

The Agile Research Penultimatum Thomas Way, Sandhya Chandrasekhar and Arun Murthy  

E-Print Network (OSTI)

thomas.way@villanova.edu Abstract - Agile software development is a widely used and successful Unified Process, Rational Unified Process, Agile Modeling, and most recently, Lean Software Development methodology for organizing and managing software product development in an industry setting. For academic

Way, Thomas

307

Rewriting Shakespeare: Thomas Otway's Venice Preserv'd and Edward Young's The Revenge  

E-Print Network (OSTI)

the early eighteenth century. Thomas Otway's Venice Preserv'd, first performed in 1682, is an example of the approach taken by most Restoration adapters of Shakespeare. Otway took from Shakespeare that which he wanted to use and discarded the rest. Edward...

Lovan, Gary Eugene

1996-01-01T23:59:59.000Z

308

Taking Control of Green Speed Thomas A. Nikolai, Ph.D.  

E-Print Network (OSTI)

to know about green speed A lot of green speed misinformation Poor communication cited #1 problem GreenTaking Control of Green Speed Thomas A. Nikolai, Ph.D. The Doctor of Green Speed nikolait finds when requesting green speed help are.... #12;The 3 most common answers a superintendent finds when

309

A connectionist model of spatial learning in the rat Thomas Strosslin  

E-Print Network (OSTI)

A connectionist model of spatial learning in the rat Thomas Str¨osslin April 14, 2004 #12. In subsequent visits, they can recall this information and thus avoid dangerous places or find again a food". In the late 1940s, theoretical considerations have led researchers to the conclusion that rats establish

Gerstner, Wulfram

310

Understanding open source in an industrial context Sven Ziemer, yvind Hauge and Thomas sterlie  

E-Print Network (OSTI)

of software development that will revolution- ize the software industry [2]. A recent addition to the onUnderstanding open source in an industrial context Sven Ziemer, ?yvind Hauge and Thomas ?sterlie source in an industrial context. Building a grounded theory from an industry-driven R&D project, our

311

The Nachos Instructional Operating System Wayne A. Christopher, Steven J. Procter, and Thomas E. Anderson  

E-Print Network (OSTI)

The Nachos Instructional Operating System Wayne A. Christopher, Steven J. Procter, and Thomas E operating systems at an undergraduate level, it is very important to provide a project that is realistic enough to show how real operating systems work, yet simple enough that the students can understand

Anderson, Tom

312

STAMP-Based Analysis of a Refinery Overflow Accident Nancy Leveson, Margaret Stringfellow, and John Thomas  

E-Print Network (OSTI)

1 STAMP-Based Analysis of a Refinery Overflow Accident Nancy Leveson, Margaret Stringfellow, and John Thomas As an example of STAMP, we have taken an accident report produced for a real refinery failures and operator actions (or missing actions) related to the loss. But stopping after identifying

Leveson, Nancy

313

A Multi-HMM Approach to ECG Segmentation Julien Thomas, Cedric Rose and Francois Charpillet  

E-Print Network (OSTI)

A Multi-HMM Approach to ECG Segmentation Julien Thomas, C´edric Rose and Franc¸ois Charpillet INRIA studies require to analyze thousands of ECGs in order to evaluate the side effects of a new drug. In this paper we present a new approach to automatic ECG segmentation based on hierarchic continuous density hid

Boyer, Edmond

314

On the computational power of photosynthesis Niall Murphy, Damien Woods and Thomas J. Naughton  

E-Print Network (OSTI)

On the computational power of photosynthesis Niall Murphy, Damien Woods and Thomas J. Naughton County Kildare, Ireland #12;Abstract We describe a simplified explanation of photosynthesis. We charac- terise the complexity of photosynthesis by interpreting its chemical equa- tion as a language acceptance

Murphy, Niall

315

Microsoft Word - Omak-Area-3G-CX.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9, 2011 9, 2011 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Roger Thomas Project Manager - TECT-CSB-1 Proposed Action: Omak Area 3G Radio Site Upgrades Budget Information: Work Orders 197229, 197230, & 197231; Task 03 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.19 "Siting, construction, and operation of microwave and radio communication towers and associated facilities..." Location: Okanogan and Douglas counties, Washington Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to upgrade communication equipment at three existing BPA facilities in Okanogan and Douglas counties, Washington. The work would occur at two

316

Southeast Idaho Area Links  

NLE Websites -- All DOE Office Websites (Extended Search)

Area Attractions and Events Area Geography Area History Area Links Driving Directions Idaho Falls Attractions and Events INL History INL Today Research Park Sagebrush Steppe...

317

Day 2 - Thurs Plenary 3 - Dave Thomas.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

DEAD IN 7 MINUTES DEAD IN 7 MINUTES "But, it can't happen to me." TAKE-AWAY MINDFULNESS IS A "PRACTICAL" TOOL IN FOREST FIREFIGHTING OBJECTIVES v Mindfulness v Up's and down's v Practical Tips South Canyon Fatality Area, August 1994 Shame & Stupidity WEICK & SUTCLIFFE Disconfirm Expectations If we just follow our procedures, checklists, plans, events will unfold as we think they should. "H2 would not be a great risk...light fuels & rocky areas in Cache Bar..." 1. Preoccupation with failure "Any lapse is seen as symptom that something could be wrong with the larger system." Weick/Sutcliffe 2. Reluctance to Simplify Relentless attack on simplification. 3. Sensitivity to Operations Seeing what is actually going on: the "Big Picture"

318

F-Race and Iterated F-Race: An Overview Mauro Birattari, Zhi Yuan, Prasanna Balaprakash, and Thomas Sttzle  

E-Print Network (OSTI)

Chapter 13 F-Race and Iterated F-Race: An Overview Mauro Birattari, Zhi Yuan, Prasanna Balaprakash search algorithms in Mauro Birattari · Zhi Yuan · Prasanna Balaprakash · Thomas Stützle IRIDIA, Co

Birattari, Mauro

319

Review of Natural Phenomena Hazards (NPH) Requirements Currently Applied to the Thomas Jefferson National Accelerator Facility (TJNAF)  

Energy.gov (U.S. Department of Energy (DOE))

Review of Natural Phenomena Hazards (NPH) Requirements Currently Applied to the Thomas Jefferson National Accelerator Facility (TJNAF) By: Integrated NPH Team: David Luke, Lead, TJSO Rusty Sprouse, JSA Michael A. Epps, TJSO Richard Korynta, TJSO

320

Strontium Substitution for Calcium in Lithogenesis Sarah D. Blaschko, Thomas Chi, Joe Miller, Lawrence Flechner, Sirine Fakra,  

E-Print Network (OSTI)

Strontium Substitution for Calcium in Lithogenesis Sarah D. Blaschko, Thomas Chi, Joe Miller, AK), Novato, California Purpose: Strontium has chemical similarity to calcium, which enables the replace- ment of calcium by strontium in biomineralization processes. Incorporating stron- tium into human

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Questions and Answers - What did Thomas Jefferson do as a scientist?  

NLE Websites -- All DOE Office Websites (Extended Search)

Who invented magnets? Who invented magnets? Previous Question (Who invented magnets?) Questions and Answers Main Index Next Question (Why does the U.S. use Fahrenheit instead of Celsius?) Why does the U.S. useFahrenheit instead of Celsius? What did Thomas Jefferson do as a scientist? It's true that Thomas Jefferson contributed some new knowledge directly to science and technology. But his main scientific contribution was as a statesman of science. For half a century in public office and in private life, he led the growth of American optimism about science, technology, and the future. Jefferson wished he could be a scientist all the time. When he was leaving the presidency in early 1809, he wrote, "Nature intended me for the tranquil pursuits of science, by rendering them my supreme delight." In

322

Wind Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Opportunities in Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis E. Lantz, A. Warren, J.O. Roberts, and V. Gevorgian Technical Report NREL/TP-7A20-55415 September 2012 NREL is a national laboratory of the U.S. Department of Energy, Office of Energy Efficiency & Renewable Energy, operated by the Alliance for Sustainable Energy, LLC. National Renewable Energy Laboratory 15013 Denver West Parkway Golden, Colorado 80401 303-275-3000 * www.nrel.gov Contract No. DE-AC36-08GO28308 Wind Power Opportunities in St. Thomas, USVI: A Site-Specific Evaluation and Analysis E. Lantz, A. Warren, J.O. Roberts, and V. Gevorgian Prepared under Task No. IDVI.1020 Technical Report NREL/TP-7A20-55415 September 2012 NOTICE This report was prepared as an account of work sponsored by an agency of the United States government.

323

Thomas-Ehrman effect in a three-body model: $^{16}$Ne case  

E-Print Network (OSTI)

The dynamic mechanism of the Thomas-Ehrman shift is studied in three-cluster systems by example of $^{16}$Ne and $^{16}$C isobaric mirror partners. We predict configuration mixings for $0^+$ and $2^+$ states in $^{16}$Ne and $^{16}$C. Large isospin symmetry breaking on the level of wave function component weights is demonstrated for these states and discussed as three-body mechanism of Thomas-Ehrman shift. It is shown that the description of the Coulomb displacement energies requires a consistency among three parameters: the $^{16}$Ne decay energy $E_T$, the $^{15}$F ground state energy $E_r$, and the configuration mixing parameters for the $^{16}$Ne/$^{16}$C $0^+$ and $2^+$ states. Basing on this analysis we infer the $^{15}$F $1/2^+$ ground state energy to be $E_r=1.39-1.42$ MeV.

Grigorenko, L V; Zhukov, M V

2014-01-01T23:59:59.000Z

324

Thomas-Ehrman effect in a three-body model: $^{16}$Ne case  

E-Print Network (OSTI)

The dynamic mechanism of the Thomas-Ehrman shift is studied in three-cluster systems by example of $^{16}$Ne and $^{16}$C isobaric mirror partners. We predict configuration mixings for $0^+$ and $2^+$ states in $^{16}$Ne and $^{16}$C. Large isospin symmetry breaking on the level of wave function component weights is demonstrated for these states and discussed as three-body mechanism of Thomas-Ehrman shift. It is shown that the description of the Coulomb displacement energies requires a consistency among three parameters: the $^{16}$Ne decay energy $E_T$, the $^{15}$F ground state energy $E_r$, and the configuration mixing parameters for the $^{16}$Ne/$^{16}$C $0^+$ and $2^+$ states. Basing on this analysis we infer the $^{15}$F $1/2^+$ ground state energy to be $E_r=1.39-1.42$ MeV.

L. V. Grigorenko; T. A. Golubkova; M. V. Zhukov

2014-11-07T23:59:59.000Z

325

A review of "Verzeichnis der gedruckten Briefe deutscher Autoren des 17. Jahrhunderts" by Thomas Brger, ed.  

E-Print Network (OSTI)

jewels: Europe?s great cities. Thomas B?rger, ed. Verzeichnis der gedruckten Briefe deutscher Autoren des 17. Jahrhunderts. Teil 2: Drucke zwischen 1751 und 1980. 4 vols. Series: Repertorien zur Erforschung der fr?hen Neuzeit, Vol. 12.2. Wiesbaden... history studies of intellectual networks in Europe following the pioneering work in this regard by Wolfgang Reinhard. The primary utility of this tool, however, appears to be three-fold. First, it has the potential of providing a summary...

Susan R. Boettcher

2003-01-01T23:59:59.000Z

326

Accurate calculation of the solutions to the Thomas-Fermi equations  

E-Print Network (OSTI)

We obtain highly accurate solutions to the Thomas-Fermi equations for atoms and atoms in very strong magnetic fields. We apply the Pad\\'e-Hankel method, numerical integration, power series with Pad\\'e and Hermite-Pad\\'e approximants and Chebyshev polynomials. Both the slope at origin and the location of the right boundary in the magnetic-field case are given with unprecedented accuracy.

Paolo Amore; John P. Boyd; Francisco M. Fernndez

2012-05-08T23:59:59.000Z

327

Thomas Jefferson National Accelerator Facility Site Tour - Accelerator Map  

NLE Websites -- All DOE Office Websites (Extended Search)

Counting House Free Electron Accelerator Facility Machine Control Center Physics Storage Building North Linear Accelerator South Linear Accelerator VEPCO Substation Machine Control Center Annex Machine Control Center Annex II North Access Building South Access Building Central Helium Liquefier Injector Hall A Truck Ramp Hall B Truck Ramp Hall C Truck Ramp Experimental Hall A Experimental Hall B Experimental Hall C East Arc West Arc Counting House Free Electron Accelerator Facility Machine Control Center Physics Storage Building North Linear Accelerator South Linear Accelerator VEPCO Substation Machine Control Center Annex Machine Control Center Annex II North Access Building South Access Building Central Helium Liquefier Injector Hall A Truck Ramp Hall B Truck Ramp Hall C Truck Ramp Experimental Hall A Experimental Hall B Experimental Hall C East Arc West Arc Science Education Jefferson Lab Jefferson Lab Home Search Jefferson Lab Contact Jefferson Lab Science Education Home Teacher Resources Student Zone Games and Puzzles Science Cinema Programs and Events Search Education Privacy and Security Notice Jefferson Lab Site Tour Guided Tour Site Map Accelerator Area Map Administrative Area Map Tour Index

328

Dust acoustic solitary and shock excitations in a Thomas-Fermi magnetoplasma  

SciTech Connect

The linear and nonlinear properties of dust-acoustic waves are investigated in a collisionless Thomas-Fermi magnetoplasma, whose constituents are electrons, ions, and negatively charged dust particles. At dust time scale, the electron and ion number densities follow the Thomas-Fermi distribution, whereas the dust component is described by the classical fluid equations. A linear dispersion relation is analyzed to show that the wave frequencies associated with the upper and lower modes are enhanced with the variation of dust concentration. The effect of the latter is seen more strongly on the upper mode as compared to the lower mode. For nonlinear analysis, we obtain magnetized Korteweg-de Vries (KdV) and Zakharov-Kuznetsov (ZK) equations involving the dust-acoustic solitary waves in the framework of reductive perturbation technique. Furthermore, the shock wave excitations are also studied by allowing dissipation effects in the model, leading to the Korteweg-de Vries-Burgers (KdVB) and ZKB equations. The analysis reveals that the dust-acoustic solitary and shock excitations in a Thomas-Fermi plasma are strongly influenced by the plasma parameters, e.g., dust concentration, dust temperature, obliqueness, magnetic field strength, and dust fluid viscosity. The present results should be important for understanding the solitary and shock excitations in the environments of white dwarfs or supernova, where dust particles can exist.

Rahim, Z.; Qamar, A. [Institute of Physics and Electronics, University of Peshawar, Peshawar 25000 (Pakistan); National Center for Physics (NCP) at QAU Campus, Shahdra Valley Road, Islamabad 44000 (Pakistan); Ali, S. [National Center for Physics (NCP) at QAU Campus, Shahdra Valley Road, Islamabad 44000 (Pakistan)

2014-07-15T23:59:59.000Z

329

Site Monitoring Area Maps  

NLE Websites -- All DOE Office Websites (Extended Search)

to the Site Monitoring Area (SMA) The Site Monitoring Area sampler Control measures (best management practices) installed at the Site Monitoring Area Structures such as...

330

Time-Domain Electromagnetics At Truckhaven Area (Warpinski, Et Al., 2004) |  

Open Energy Info (EERE)

Time-Domain Electromagnetics At Truckhaven Area Time-Domain Electromagnetics At Truckhaven Area (Warpinski, Et Al., 2004) Exploration Activity Details Location Truckhaven Area Exploration Technique Time-Domain Electromagnetics Activity Date Usefulness useful DOE-funding Unknown Notes The Truckhaven project, which is located on the west flank of the Salton Trough in southern California, is north and west of several existing geothermal power generation facilities in the trough. An extensive shallow geothermal anomaly is known to exist in this area and this region corresponds to a gravity high, which has been further delineated by the drilling of numerous shallow temperature gradient wells and one deep, abandoned, test well. Layman Energy Associates has performed Phase I exploration tasks to further constrain the anomaly, including a detailed

331

Ground Gravity Survey At Truckhaven Area (Warpinski, Et Al., 2004) | Open  

Open Energy Info (EERE)

Gravity Survey At Truckhaven Area (Warpinski, Gravity Survey At Truckhaven Area (Warpinski, Et Al., 2004) Exploration Activity Details Location Truckhaven Area Exploration Technique Ground Gravity Survey Activity Date Usefulness useful DOE-funding Unknown Notes The Truckhaven project, which is located on the west flank of the Salton Trough in southern California, is north and west of several existing geothermal power generation facilities in the trough. An extensive shallow geothermal anomaly is known to exist in this area and this region corresponds to a gravity high, which has been further delineated by the drilling of numerous shallow temperature gradient wells and one deep, abandoned, test well. Layman Energy Associates has performed Phase I exploration tasks to further constrain the anomaly, including a detailed

332

On Some Computations of Higher Rank Refined Donaldson-Thomas Invariants  

E-Print Network (OSTI)

We present some computations of higher rank refined Donaldson-Thomas invariants on local curve geometries, corresponding to local D6-D2-D0 or D4-D2-D0 configurations. A refined wall-crossing formula for invariants with higher D6 or D4 ranks is derived and verified to agree with the existing formulas under the unrefined limit. Using the formula, refined invariants on the $(-1,-1)$ and $(-2,0)$ local rational curve with higher D6 or D4 ranks are computed.

Wu-yen Chuang; Chien-Hsun Wang

2014-09-08T23:59:59.000Z

333

Bakamjian-Thomas mass operator for the few-nucleon system from chiral dynamics  

E-Print Network (OSTI)

We present an exploratory study consisting in the formulation of a relativistic quantum mechanics to describe the few-nucleon system at low energy, starting from the quantum field theoretical chiral Lagrangian involving pions and nucleons. To this aim we construct a Bakamjian-Thomas mass operator and perform a truncation of the Fock space which respects at each stage the relativistic covariance. Such truncation is justified, at sufficiently low energy, in the framework of a systematic chiral expansion. As an illustration we discuss the bound state observables and low-energy phaseshifts of the nucleon-nucleon and pion-nucleon scattering at the leading order of our scheme.

L. Girlanda; W. H. Klink; M. Viviani

2007-02-07T23:59:59.000Z

334

Micro-Earthquake At Coso Geothermal Area (2007) | Open Energy Information  

Open Energy Info (EERE)

Coso Geothermal Area (2007) Coso Geothermal Area (2007) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Micro-Earthquake Activity Date 2007 Usefulness not indicated DOE-funding Unknown Exploration Basis Develop and test a tool to better analyze microearthquake data Notes A GUI-based interface was developed to use inversion software that greatly increases its ease of use and makes feasible analyzing larger numbers of earthquakes than previously was practical. Examples are shown from an injection experiment conducted in well 34-9RD2, on the East Flank. This tight well was re-drilled February - March 2005. Pervasive porosity and fractures were encountered at about 2660 m depth. These mud losses induced a 50-minute swarm of 44 microearthquakes, with magnitudes in the range -0.3

335

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)

2012-04-18T23:59:59.000Z

336

On Raviart-Thomas and VMS formulations for flow in heterogeneous materials.  

SciTech Connect

It is well known that the continuous Galerkin method (in its standard form) is not locally conservative, yet many stabilized methods are constructed by augmenting the standard Galerkin weak form. In particular, the Variational Multiscale (VMS) method has achieved popularity for combating numerical instabilities that arise for mixed formulations that do not otherwise satisfy the LBB condition. Among alternative methods that satisfy local and global conservation, many employ Raviart-Thomas function spaces. The lowest order Raviart-Thomas finite element formulation (RT0) consists of evaluating fluxes over the midpoint of element edges and constant pressures within the element. Although the RT0 element poses many advantages, it has only been shown viable for triangular or tetrahedral elements (quadrilateral variants of this method do not pass the patch test). In the context of heterogenous materials, both of these methods have been used to model the mixed form of the Darcy equation. This work aims, in a comparative fashion, to evaluate the strengths and weaknesses of either approach for modeling Darcy flow for problems with highly varying material permeabilities and predominantly open flow boundary conditions. Such problems include carbon sequestration and enhanced oil recovery simulations for which the far-field boundary is typically described with some type of pressure boundary condition. We intend to show the degree to which the VMS formulation violates local mass conservation for these types of problems and compare the performance of the VMS and RT0 methods at boundaries between disparate permeabilities.

Turner, Daniel Zack

2010-11-01T23:59:59.000Z

337

Thomas Roser  

NLE Websites -- All DOE Office Websites (Extended Search)

Roser Roser ! NSAC Subcommittee on Scientific Facilities ! February 15, 2013 ! eRHIC Project! ! ! Performance requirements! ! eRHIC design! ! R&D for eRHIC! ! Cost and schedule! 2 Performance requirements! ! ! Highly polarized (> 70%) electron, proton and neutron (He-3) beams! ! Ion beams from deuteron to the heaviest nuclei (uranium) ! ! Center of mass energy range: ~ 20 GeV to ~ 150 GeV ! ! Non-zero crossing angle to minimize synchrotron radiation background! ! Possibility to have multiple interaction regions ! ! High luminosity: 10 33 - 10 34 cm -2 s -1 ! ! First stage to reach CM energy of ≳ 70 GeV and luminosity of 
 10 32 - 10 34 cm -2 s -1 ! ! 3 RHIC! NSRL! LINAC! Booster! AGS! Tandems! STAR! 6:00 o'clock! PHENIX! 8:00 o'clock! 10:00 o'clock! Polarized Jet Target! 12:00 o'clock! RF! 4:00 o'clock!

338

Sustainability criteria for bioenergy systems: results from an expert survey Thomas Buchholz*, Valerie A. Luzadis, Timothy A. Volk  

E-Print Network (OSTI)

Sustainability criteria for bioenergy systems: results from an expert survey Thomas Buchholz in revised form 10 April 2009 Accepted 24 April 2009 Available online 9 May 2009 Keywords: Bioenergy and concerns about regional and national security are driving the development and use of biomass for bioenergy

Vermont, University of

339

Managing Plug-Loads for Demand Response within Buildings Thomas Weng, Bharathan Balaji, Seemanta Dutta, Rajesh Gupta, Yuvraj Agarwal  

E-Print Network (OSTI)

Managing Plug-Loads for Demand Response within Buildings Thomas Weng, Bharathan Balaji, Seemanta managers can per- form active energy management, especially during demand response situations that require, allowing them to deal with demand response situations through user- specified actuation policies. At its

Gupta, Rajesh

340

Adaptive Substrate for Enhanced Spatial Augmented Reality Contrast and Markus Broecker Ross T. Smith Bruce H. Thomas  

E-Print Network (OSTI)

Ross T. Smith Bruce H. Thomas Wearable Computer Lab University of South Australia ABSTRACT This paper employ hand-held displays or head-mounted displays with optical or video see through technologies for the appearance fidelity e-mail:Markus.Broecker@unisa.edu.au e-mail:ross@r-smith.net e-mail:Bruce

Thomas, Bruce

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Hybrid Indoor and Outdoor Tracking for Mobile 3D Mixed Reality Wayne Piekarski, Ben Avery, Bruce H. Thomas, Pierre Malbezin  

E-Print Network (OSTI)

Hybrid Indoor and Outdoor Tracking for Mobile 3D Mixed Reality Wayne Piekarski, Ben Avery, Bruce H@tinmith.net, bruce.thomas@unisa.edu.au, pierre@tinmith.net Abstract This paper describes a new hybrid tracking system, in most cases an arrow navigation cue and a hand held World-in-Miniature model are used to provide

Thomas, Bruce

342

P~!ETRIC STUDY OF HEAT FLOW DURING RESISTANCE SPOT WELDING Euiwhan Kim and Thomas W. Eagar  

E-Print Network (OSTI)

pieces , electrical contact resistance, material properties, phase changes and heat dissipationi ...) P~!ETRIC STUDY OF HEAT FLOW DURING RESISTANCE SPOT WELDING Euiwhan Kim and Thomas W. Eagar Department of Materials Science and Engineering Hassachusetts Institute of Technology Cambridge, MA 02139

Eagar, Thomas W.

343

The Systems Science & Industrial Engineering (SSIE) Department and The Thomas J. Watson School of Engineering and Applied  

E-Print Network (OSTI)

The Systems Science & Industrial Engineering (SSIE) Department and The Thomas J. Watson School professionals, we will open the doors to demonstrate what industrial and systems engineers can contribute to any. We offer the BS degree in industrial and systems engineering (ISE), MEng degree in industrial

Suzuki, Masatsugu

344

Condition on the KohnSham kinetic energy and modern parametrization of the ThomasFermi density  

E-Print Network (OSTI)

; published online 20 January 2009 We study the asymptotic expansion of the neutral-atom energy as the atomic-correlation energy, EXC n , must be approximated. But a direct, orbital-free DFT could be constructed if onlyCondition on the Kohn­Sham kinetic energy and modern parametrization of the Thomas­Fermi density

Burke, Kieron

345

Airpath Control of a SI Engine with Variable Valve Timing Actuators Thomas Leroy, Jonathan Chauvin and Nicolas Petit  

E-Print Network (OSTI)

Airpath Control of a SI Engine with Variable Valve Timing Actuators Thomas Leroy, Jonathan Chauvin with Variable Valve Timing (VVT) actuators. VVT devices are used to produce internal exhaust gas recirculation actuators affect the fresh air charge in the cylinders. This has an impact on the torque output (leading

346

Manifold modeling for brain population analysis Samuel Gerber *, Tolga Tasdizen, P. Thomas Fletcher, Sarang Joshi, Ross Whitaker, and the Alzheimers  

E-Print Network (OSTI)

Manifold modeling for brain population analysis Samuel Gerber *, Tolga Tasdizen, P. Thomas Fletcher Brain MRI Manifold learning Computer aided clinical diagnosis a b s t r a c t This paper describes a method for building efficient representations of large sets of brain images. Our hypothesis

Utah, University of

347

RECYCLING OF LATEX BASED PAINT AS POLYMER FEEDSTOCK MATERIALS Jennifer K. Lynch, Thomas J. Nosker, Robert Hamill, Richard L. Lehman  

E-Print Network (OSTI)

RECYCLING OF LATEX BASED PAINT AS POLYMER FEEDSTOCK MATERIALS Jennifer K. Lynch, Thomas J. Nosker investigates the recycling of used latex paints into non-paint products. Waste latex paint was collected, dried container cost for either recycling or hazardous waste disposal, is very high for the retailer. Much

348

NAME EMAIL SUPERVISOR NAME EMAIL SUPERVISOR Alrehaily, Leena lalrehai@uwo.ca JCW Gungor, Thomas tgungor@uwo.ca ERG  

E-Print Network (OSTI)

NAME EMAIL SUPERVISOR NAME EMAIL SUPERVISOR Alrehaily, Leena lalrehai@uwo.ca JCW Gungor, Thomas tgungor@uwo.ca ERG Armstrong, Erin earmstr6@uwo.ca MAK Guo, Dan dguo24@uwo.ca JCW Azizpoor Fard, Mahmood mazizpoo@uwo.ca JFC Guo, Jiacheng jguo52@uwo.ca KMB Barbon, Stephanie sbarbon@uwo.ca JBG Guo, Xiaoxuan xguo

Lennard, William N.

349

METAL COATING OF POROUS SILICON GAS SENSORS FOR IMPROVED SENSITIVITY & SELECTIVITY Thomas Osburn, Georgia Tech Physics, MSE SURF 2009 Fellow  

E-Print Network (OSTI)

METAL COATING OF POROUS SILICON GAS SENSORS FOR IMPROVED SENSITIVITY & SELECTIVITY Thomas Osburn Introduction Gas sensors on the market today have many limitations that prevent real world applications. The current standard, metal oxide sensors, are highly temperature dependant and work at high temperatures

Li, Mo

350

Supporting Systolic and Memory Communication in iWarp Shekhar Borkar, Robert Cohn, George Cox, Thomas Gross,  

E-Print Network (OSTI)

Supporting Systolic and Memory Communication in iWarp Shekhar Borkar, Robert Cohn, George Cox, Thomas Gross, H. T. Kung, Monica Lam, Margie Levine, Brian Moore, Wire Moore, Craig Peterson, Jim Susman/CMO under Contract MDA972­90­C­0035. Authors' affiliations: R. Cohn, T. Gross, H. T. Kung, and J. Webb

Shewchuk, Jonathan

351

Onset of Metallic Behavior in Magnesium Clusters Owen C. Thomas, Weijun Zheng, Shoujun Xu, and Kit H. Bowen, Jr.  

E-Print Network (OSTI)

Onset of Metallic Behavior in Magnesium Clusters Owen C. Thomas, Weijun Zheng, Shoujun Xu, and Kit-selected magnesium cluster anions, Mgn ÿ , over the size range, n 3­35. Their s-p band gaps were observed to close in the finite size re- gime for the case of magnesium. Magnesium is a particu- larly instructive case because

Simons, Jack

352

On the ratio between shifts in the eddy-driven jet and the Hadley Paul W. Staten Thomas Reichler  

E-Print Network (OSTI)

On the ratio between shifts in the eddy-driven jet and the Hadley cell edge Paul W. Staten · Thomas and in the Hadley cell edge as depicted in models and reanalyses. We cal- culate an interannual shift ratio of approximately 1.5:1 between the eddy-driven jet and the Hadley cell edge over the Southern Hemisphere during

Reichler, Thomas

353

Bubble Dynamics, Shock Waves and Sonoluminescence Author(s): Claus-Dieter Ohl, Thomas Kurz, Reinhard Geisler, Olgert Lindau, Werner  

E-Print Network (OSTI)

Bubble Dynamics, Shock Waves and Sonoluminescence Author(s): Claus-Dieter Ohl, Thomas Kurz, Physical and Engineering Sciences. http://www.jstor.org #12;THE ROYAL SOCIETY Bubble dynamics, shock waves emission by bubbles is studied experimentally. Single bubbles kept in a bubble trap and single laser

Ohl, Claus-Dieter

354

CONTROLLED VARIABLES IN SENTENCE INTONATION* Carole E. Gelfer,t Katherine S. Harris,t and Thomas Haer  

E-Print Network (OSTI)

CONTROLLED VARIABLES IN SENTENCE INTONATION* Carole E. Gelfer,t Katherine S. Harris,t and Thomas realization (Atkinson, 1973; Collier, 1975; Gelfer, Harris, Collier, & Baer, 1985; Maeda, 1976). Unfortunately characteristics of utterances (Klatt, Stevens, & Mead, 1968). For example, because of the reduced airflow

355

Mechanical reorganization of cross-linked F-actin networks at the air-buffer Thomas Boatwright,a  

E-Print Network (OSTI)

Mechanical reorganization of cross-linked F-actin networks at the air-buffer interface Thomas compression is studied. We observe two distinct classes of behavior: a mechanically induced structural reorganization of the monolayer and a subsequent reversible, nonlinear mechanical response. Measurements

Dennin, Michael

356

Minimization of energy per particle among Bravais lattices in R2 Lennard-Jones and Thomas-Fermi cases  

E-Print Network (OSTI)

that the global min- imizer of the total energy is the triangular lattice of length one. His method was adapted. The problem is to find the configuration of the points which minimizes the total energy of interaction, calledMinimization of energy per particle among Bravais lattices in R2 : Lennard-Jones and Thomas

357

Field Mapping At Reese River Area (Henkle, Et Al., 2005) | Open Energy  

Open Energy Info (EERE)

Field Mapping At Reese River Area (Henkle, Et Al., Field Mapping At Reese River Area (Henkle, Et Al., 2005) Exploration Activity Details Location Reese River Area Exploration Technique Field Mapping Activity Date Usefulness useful DOE-funding Unknown References William R. Henkle Jr., Wayne C. Gundersen, Thomas D. Gundersen (2005) Mercury Geochemical, Groundwater Geochemical, And Radiometric Geophysical Signatures At Three Geothermal Prospects In Northern Nevada Retrieved from "http://en.openei.org/w/index.php?title=Field_Mapping_At_Reese_River_Area_(Henkle,_Et_Al.,_2005)&oldid=510756" Categories: Exploration Activities DOE Funded Activities What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load)

358

Bioavailable organic carbon in wetland soils across a broad climogeographic area  

E-Print Network (OSTI)

for the degree of MASTER OF SCIENCE Approved as to style and content by; David A. Zuberer (Co-Chair of Committee) Larry P. Wilding (Co-Chair of Committee) Thomas W. Boutton (Member) Mark A s ey (Head of Department) May 2002 Major Subject: Soil Science... ABSTRACT Bioavailable Organic Carbon in Wetland Soils Across a Broad Climogeographic Area. (May 2002) Andrew Dwight Baker, B. S. , Texas A&M University Co-Chairs of Advisory Committee. Dr. David A. Zuberer Dr. Larry P. Wilding Soils from a broad...

Baker, Andrew Dwight

2012-06-07T23:59:59.000Z

359

UNITED STATES DEPARTMENT OF ENERGY (DOE) THOMAS JEFFERSON NATIONAL ACCELERATOR FACILITY (JEFFERSON LAB)  

NLE Websites -- All DOE Office Websites (Extended Search)

- 2014 JSAT Application Package - 2014 JSAT Application Package Page 1 of 6 UNITED STATES DEPARTMENT OF ENERGY (DOE) THOMAS JEFFERSON NATIONAL ACCELERATOR FACILITY (JEFFERSON LAB) JLAB SCIENCE ACTIVITIES FOR TEACHERS (JSAT) ATTENTION ALL 5 th , 6 th AND 8 th GRADE MIDDLE SCHOOL SCIENCE TEACHERS! THIS PROGRAM IS FOR YOU! What is it? JSAT is an after school program for 5 th , 6 th and 8 th grade science teachers designed to build teachers' skills in the physical sciences, funded by the Jefferson Science Associates Initiatives Fund. What will I do? The 2013-2014 program will include interactive activities to enhance physical science instruction at the middle school level and lectures by Jefferson Lab staff on the applications of science. And, yes, teachers WILL receive class sets of some activities!

360

CO2 EMISSION CALCULATIONS AND TRENDS Thomas A. Boden and Gregg Marland  

NLE Websites -- All DOE Office Websites (Extended Search)

EMISSION CALCULATIONS AND TRENDS EMISSION CALCULATIONS AND TRENDS Thomas A. Boden and Gregg Marland Environmental Sciences Division Oak Ridge National Laboratory Oak Ridge, Tennessee 37830-6335 Robert J. Andres Institute of Northern Engineering School of Engineering University of Alaska-Fairbanks Fairbanks, Alaska 99775-5900 ABSTRACT FEB 05 ZS3 OSTI The submitted manuscript has been authored by a contractor of the U.S. Government under contract No. DE- ACO5-840R21400. Accordingly, the U.S. Government retains a nonexclusive, royalty-free license to publish or reproduce the published form of this contribution, or allow others to do so. for U.S. Government purposes." This paper describes the compilation, calculation, and availability of the most comprehensive CO2 emissions database currently available. The database offers global, regional, and national annual

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

MEMORANDUM FOR ELIZABETH MONTOYA TRANSITION TEAM FROM THOMAS N. PYKE, J  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

^ g December 1, 200S ^ g December 1, 200S MEMORANDUM FOR ELIZABETH MONTOYA TRANSITION TEAM FROM THOMAS N. PYKE, J CHIEF INFORMATION OFFICER SUBJECT: Follow-up to our meeting this morning Carl Staton and I appreciated the opportunity to brief you this morning on our office's activities, including the cyber security issue. We noted four follow-up actions: 1. The breakdown ofOCIO Federal and contracting FTE at all of our sites is: Federal Contractor a. Forrestal 51 144 b. Germantown 85 213 c. Albuquerque 1 39 d. Pittsburgh 1 0 c. Linthicum, Maryland 0 8 f. Las Vegas 3 39 Total: 141 443 2. The number of Federal FTE in the OCIO cyber security office is 16. 3. We have some additional infbrmation about the detailee from NNSA that we mentioned. The detailee, Mr. Robbie Green, is in the process of being

362

Radiation Transport Thomas A. Brunner Joint Russian-American Five-Laboratory Conference on  

National Nuclear Security Administration (NNSA)

Forms of Approximate Forms of Approximate Radiation Transport Thomas A. Brunner Joint Russian-American Five-Laboratory Conference on Computational Mathematics/Physics 19-23 June 2005 Vienna, Austria Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. The Diffusion Approximation * Taylor Expand Intensity in Angle * Fast, robust, and accurate numerical solutions * Flux can be larger than energy density - More stuff moving than is there to move * Flux Limited Diffusion improves robustness - Limits flux so that it's not larger than energy density - Many different flux limiters Spherical Harmonics (PN) * Intensity expanded further in angle than diffusion

363

CRANE CO. 757 THIRD AVENUE NEW YORK. N.Y. THOMAS UNGERLAND ASSOCIATE GENERAL COUNSEL  

Office of Legacy Management (LM)

? ? z _ - c 0-e . CRANE CO. 757 THIRD AVENUE NEW YORK. N.Y. THOMAS UNGERLAND ASSOCIATE GENERAL COUNSEL December 14, 1987 James J. Fiore Director Office of Nuclear Energy Department of Energy Washington, D.C. Re: Crane - Indian Orchard Dear M r. Fiore: W e acknowledge receipt of your letter to Paul Hundt, dated September 29, 1987, which requests certain information about Crane's plant site in Indian Orchard, Massachusetts. The plant is not currently operating. Crane was unable to locate any records concerning the machining of uranium in the 1947-48 period for a customer, Brookhaven Labs, at the Indian Orchard, facility. It is believed that the records, which were kept on the second floor at 305 Hamshire Street, Indian Orchard, Massachusetts were moved ten or fifteen years ago

364

Thomas Mason Oak Ridge National Lab July 10 2012 SB Summit  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

National Laboratory Presented to the DOE/NNSA Regional Small Business Summit Thomas E. Mason Director, Oak Ridge National Laboratory Knoxville, Tennessee July 10, 2012 2 Managed by UT-Battelle for the U.S. Department of Energy RegionalSummit_1207 ORNL is DOE's largest science and energy laboratory 2 Managed by UT-Battelle for the U.S. Department of Energy $1.65B budget World's most intense neutron source 4,400 employees World-class research reactor 3,000 research guests annually $500M modernization investment Nation's largest materials research portfolio Most powerful open scientific computing facility Nation's most diverse energy portfolio Managing billion-dollar U.S. ITER project 3 Managed by UT-Battelle for the U.S. Department of Energy RegionalSummit_1207

365

Microphysics of Neutron Star Outer Envelopes in the Periodized, Magnetic Thomas-Fermi Model  

E-Print Network (OSTI)

Observations of several types of neutron stars indicate surface temperature inhomogeneities. In recent years magneto-thermal simulations have supported the idea that the magnetic field and anisotropic heat conduction play important roles in generating these inhomogeneities. Simulations rely on crustal microphysics input heretofore calculated at the level of a plasma model -- neglecting lattice structure and electron polarizability. We focus on the low density outer envelope, treating both of these elements by a proper periodization of the magnetic Thomas-Fermi model. Our solution method involves a novel domain decomposition and we describe a scalable implementation using \\textit{Hypre}. The method may be seen as a prototype for the general class of problems involving nonlinear charge screening of periodic, quasi-low-dimensionality structures, e.g. liquid crystals. Findings include low density $c'<0$ elastic instabilities for both bcc and fcc lattices, reminiscent of the situation in some light actinides, a...

Engstrom, Tyler A; Owen, Benjamin J; Brannick, James; Hu, Xiaozhe

2014-01-01T23:59:59.000Z

366

Statistical and Realistic Numerical Model Investigations of Anthropogenic and Climatic Factors that Influence Hypoxic Area Variability in the Gulf of Mexico  

E-Print Network (OSTI)

, Steven DiMarco George Jackson Committee Members, Robert Hetland Thomas Bianchi Piers Chapman Steven Davis Head of Department, Piers Chapman May 2012 Major Subject: Oceanography iii ABSTRACT Statistical and Realistic Numerical Model... Investigations of Anthropogenic and Climatic Factors that Influence Hypoxic Area Variability in the Gulf of Mexico. (May 2012) Yang Feng, B. S., Ocean University of China; M.S., Ocean University of China Co?Chairs of Advisory Committee: Dr. Steven Di...

Feng, Yang

2012-07-16T23:59:59.000Z

367

Radiometrics At Reese River Area (Henkle, Et Al., 2005) | Open...  

Open Energy Info (EERE)

References William R. Henkle Jr., Wayne C. Gundersen, Thomas D. Gundersen (2005) Mercury Geochemical, Groundwater Geochemical, And Radiometric Geophysical Signatures At Three...

368

Handbook of Drug Metabolism Edited by Thomas F. Woolf. Marcel Dekker Inc.:? New York. 1999. xi + 596 pp. $225.00. ISBN 0-8247-0229-8.  

Science Journals Connector (OSTI)

Handbook of Drug Metabolism Edited by Thomas F. Woolf. ... Part 1 (Fundamentals of Drug Metabolism) lays the foundations from kinetic and physiological viewpoints, with thorough chapters on the pharmacokinetics of drug metabolites and on hepatic morphology, respectively. ...

Kevin S. Currie

1999-10-21T23:59:59.000Z

369

Dept. No. Dept. Name Analyst Dept. No. Dept. Name Analyst 107 Anthropology Franchesca Kim 375 Papers of Thomas Jefferson Maidul Begum  

E-Print Network (OSTI)

Papers of Thomas Jefferson Maidul Begum 108 Center for African American Studies Ami Patel 395 PPPL Contract Wendy Fang 109 Applied & Comp. Math Brad Johnson 396 PPPL Wendy Fang 110 Architecture Franchesca

Rowley, Clarence W.

370

Thomas W. Lester, Ph. D., is Dean of the College of Engineering; Richard J. Sweigard, Ph.D., is Associate Dean  

E-Print Network (OSTI)

Thomas W. Lester, Ph. D., is Dean of the College of Engineering; Richard J. Sweigard, Ph Programs; Bruce L. Walcott is Associate Dean for Economic Development and Innovations Management. The College of Engineering offers programs leadingtoundergraduateandgraduatedegreesin

MacAdam, Keith

371

Material Disposal Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Material Disposal Areas Material Disposal Areas Material Disposal Areas Material Disposal Areas, also known as MDAs, are sites where material was disposed of below the ground surface in excavated pits, trenches, or shafts. Contact Environmental Communication & Public Involvement P.O. Box 1663 MS M996 Los Alamos, NM 87545 (505) 667-0216 Email Material Disposal Areas at LANL The following are descriptions and status updates of each MDA at LANL. To view a current fact sheet on the MDAs, click on LA-UR-13-25837 (pdf). MDA A MDA A is a Hazard Category 2 nuclear facility comprised of a 1.25-acre, fenced, and radiologically controlled area situated on the eastern end of Delta Prime Mesa. Delta Prime Mesa is bounded by Delta Prime Canyon to the north and Los Alamos Canyon to the south.

372

Public Meeting on Oversight of Complex, High Hazard Nuclear Operations - Statement of Thomas P. DAgostino - May 12, 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

of Thomas P. D'Agostino of Thomas P. D'Agostino Administrator, National Nuclear Security Administration Defense Nuclear Facilities Safety Board Public Hearing on Line and Independent Oversight May 12, 2010 Mr. Chairman, members of the Board, thank you for this opportunity to meet with you in this public forum to discuss effective oversight of our nuclear facilities. You provided written lines of inquiry prior to this meeting, and my formal response is organized around them. Of course, I will also be happy to answer any additional questions you may have. Let me begin by describing our overall oversight approach as it currently exists. I will discuss its effectiveness, point out both its strengths and weaknesses, and use it as a basis for describing the changes we are considering. I will then discuss our approach to

373

area | OpenEI  

Open Energy Info (EERE)

area area Dataset Summary Description These estimates are derived from a composite of high resolution wind resource datasets modeled for specific countries with low resolution data originating from the National Centers for Environmental Prediction (United States) and the National Center for Atmospheric Research (United States) as processed for use in the IMAGE model. The high resolution datasets were produced by the National Renewable Energy Laboratory (United States), Risø DTU National Laboratory (Denmark), the National Institute for Space Research (Brazil), and the Canadian Wind Energy Association. The data repr Source National Renewable Energy Laboratory Date Released Unknown Date Updated Unknown Keywords area capacity clean energy international National Renewable Energy Laboratory

374

NSTB Summarizes Vulnerable Areas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NSTB Summarizes Vulnerable Areas NSTB Summarizes Vulnerable Areas Commonly Found in Energy Control Systems Experts at the National SCADA Test Bed (NSTB) discovered some common areas of vulnerability in the energy control systems assessed between late 2004 and early 2006. These vulnerabilities ranged from conventional IT security issues to specific weaknesses in control system protocols. The paper "Lessons Learned from Cyber Security Assessments of SCADA and Energy Management Systems" describes the vulnerabilities and recommended strategies for mitigating them. It should be of use to asset owners and operators, control system vendors, system integrators, and third-party vendors interested in enhancing the security characteristics of current and future products.

375

Self Potential At Blue Mountain Geothermal Area (Fairbank Engineering...  

Open Energy Info (EERE)

geothermal activity which could be linked to faults that serve as pathways for geothermal fluids. Notes This survey was conducted on the western flank of Blue Mountain. SP Profile...

376

Neutron Science Research Areas | ORNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Home | Science & Discovery | Neutron Science | Research Areas SHARE Research Areas Neutron scattering research at ORNL covers four broad research areas: biology and soft...

377

Western Area Power Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

Loveland Area Projects November 29-30, 2011 2 Agenda * Overview of Western Area Power Administration * Post-1989 Loveland Area Projects (LAP) Marketing Plan * Energy Planning and Management Program * Development of the 2025 PMI Proposal * 2025 PMI Proposal * 2025 PMI Comment Period & Proposal Information * Questions 3 Overview of Western Area Power Administration (Western) * One of four power marketing administrations within the Department of Energy * Mission: Market and deliver reliable, renewable, cost-based Federal hydroelectric power and related services within a 15-state region of the central and western U.S. * Vision: Provide premier power marketing and transmission services Rocky Mountain Region (RMR) is one of five regional offices 4 Rocky Mountain Region

378

Decontamination & decommissioning focus area  

SciTech Connect

In January 1994, the US Department of Energy Office of Environmental Management (DOE EM) formally introduced its new approach to managing DOE`s environmental research and technology development activities. The goal of the new approach is to conduct research and development in critical areas of interest to DOE, utilizing the best talent in the Department and in the national science community. To facilitate this solutions-oriented approach, the Office of Science and Technology (EM-50, formerly the Office of Technology Development) formed five Focus AReas to stimulate the required basic research, development, and demonstration efforts to seek new, innovative cleanup methods. In February 1995, EM-50 selected the DOE Morgantown Energy Technology Center (METC) to lead implementation of one of these Focus Areas: the Decontamination and Decommissioning (D & D) Focus Area.

NONE

1996-08-01T23:59:59.000Z

379

Honey Lake Geothermal Area  

Energy.gov (U.S. Department of Energy (DOE))

The Honey Lake geothermal area is located in Lassen County, California and Washoe County, Nevada. There are three geothermal projects actively producing electrical power. They are located at Wendel...

380

AREA 5 RWMS CLOSURE  

National Nuclear Security Administration (NNSA)

153 CLOSURE STRATEGY NEVADA TEST SITE AREA 5 RADIOACTIVE WASTE MANAGEMENT SITE Revision 0 Prepared by Under Contract No. DE-AC52-06NA25946 March 2007 DISCLAIMER Reference herein to...

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Geographic Area Month  

U.S. Energy Information Administration (EIA) Indexed Site

Fuels by PAD District and State (Cents per Gallon Excluding Taxes) - Continued Geographic Area Month No. 1 Distillate No. 2 Distillate a No. 4 Fuel b Sales to End Users Sales for...

382

Hydrodynamic effects on Mission Canyon (Mississippian) oil accumulations, Billings Nose area, North Dakota  

SciTech Connect

Mission Canyon oil production on the south flank of the Williston basin provides an example of an area in the mature stage of exploration that shows significant hydrodynamic effects on oil accumulations related to stratigraphic traps. The effects are illustrated by the Billings Nose fields and the Elkhorn Ranch field. The reservoirs have low hydraulic gradients of about 2 m/km (10 ft/mi), tilted oil-water contacts with gradients of 5 m/km (25 ft/mi), and variable formation-water salinities that range from brackish to highly saline. Oil accumulations in some zones are displayed off structure and downdip to the northeast, parallel to porosity pinch-outs. Other zones are pure hydrodynamic closure. Future success in exploration and development in the play will depend on recognizing the hydrodynamic effects and predicting oil displacement. 34 refs., 15 figs., 1 tab.

Berg, R.R. (Texas A M Univ., College Station, TX (United States)); DeMis, W.D. (Marathon Oil Co., Houston, TX (United States)); Mitsdarffer, A.R. (Dupont Environmental Remediation Services, Houston, TX (United States))

1994-04-01T23:59:59.000Z

383

Operational Area Monitoring Plan  

Office of Legacy Management (LM)

' ' SECTION 11.7B Operational Area Monitoring Plan for the Long -Term H yd rol og ical M o n i to ri ng - Program Off The Nevada Test Site S . C. Black Reynolds Electrical & Engineering, Co. and W. G. Phillips, G. G. Martin, D. J. Chaloud, C. A. Fontana, and 0. G. Easterly Environmental Monitoring Systems Laboratory U. S. Environmental Protection Agency October 23, 1991 FOREWORD This is one of a series of Operational Area Monitoring Plans that comprise the overall Environmental Monitoring Plan for the DOE Field Office, Nevada (DOEINV) nuclear and non- nuclear testing activities associated with the Nevada Test Site (NTS). These Operational Area Monitoring Plans are prepared by various DOE support contractors, NTS user organizations, and federal or state agencies supporting DOE NTS operations. These plans and the parent

384

Bay Area | Open Energy Information  

Open Energy Info (EERE)

Bay Area Bay Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Bay Area 1.1 Products and Services in the Bay Area 1.2 Research and Development Institutions in the Bay Area 1.3 Networking Organizations in the Bay Area 1.4 Investors and Financial Organizations in the Bay Area 1.5 Policy Organizations in the Bay Area Clean Energy Clusters in the Bay Area Products and Services in the Bay Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

385

Texas Area | Open Energy Information  

Open Energy Info (EERE)

Area Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Texas Area 1.1 Products and Services in the Texas Area 1.2 Research and Development Institutions in the Texas Area 1.3 Networking Organizations in the Texas Area 1.4 Investors and Financial Organizations in the Texas Area 1.5 Policy Organizations in the Texas Area Clean Energy Clusters in the Texas Area Products and Services in the Texas Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

386

Rockies Area | Open Energy Information  

Open Energy Info (EERE)

Rockies Area Rockies Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Rockies Area 1.1 Products and Services in the Rockies Area 1.2 Research and Development Institutions in the Rockies Area 1.3 Networking Organizations in the Rockies Area 1.4 Investors and Financial Organizations in the Rockies Area 1.5 Policy Organizations in the Rockies Area Clean Energy Clusters in the Rockies Area Products and Services in the Rockies Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

387

OLED area illumination source  

DOE Patents (OSTI)

The present invention relates to an area illumination light source comprising a plurality of individual OLED panels. The individual OLED panels are configured in a physically modular fashion. Each OLED panel comprising a plurality of OLED devices. Each OLED panel comprises a first electrode and a second electrode such that the power being supplied to each individual OLED panel may be varied independently. A power supply unit capable of delivering varying levels of voltage simultaneously to the first and second electrodes of each of the individual OLED panels is also provided. The area illumination light source also comprises a mount within which the OLED panels are arrayed.

Foust, Donald Franklin (Scotia, NY); Duggal, Anil Raj (Niskayuna, NY); Shiang, Joseph John (Niskayuna, NY); Nealon, William Francis (Gloversville, NY); Bortscheller, Jacob Charles (Clifton Park, NY)

2008-03-25T23:59:59.000Z

388

MEASUREMENT OF BUILDING AREAS MEASUREMENT OF BUILDING AREAS  

E-Print Network (OSTI)

) Common Use Areas All floored areas in the building for circulation and standard facilities provided and the like. These are extracts of NWPC standard method of measurement of building areas with an addition fromSection S ANNEXURE 4 MEASUREMENT OF BUILDING AREAS MEASUREMENT OF BUILDING AREAS 1. GROSS BUILDING

Wang, Yan

389

Subsurface contaminants focus area  

SciTech Connect

The US Department of Enregy (DOE) Subsurface Contaminants Focus Area is developing technologies to address environmental problems associated with hazardous and radioactive contaminants in soil and groundwater that exist throughout the DOE complex, including radionuclides, heavy metals; and dense non-aqueous phase liquids (DNAPLs). More than 5,700 known DOE groundwater plumes have contaminated over 600 billion gallons of water and 200 million cubic meters of soil. Migration of these plumes threatens local and regional water sources, and in some cases has already adversely impacted off-site rsources. In addition, the Subsurface Contaminants Focus Area is responsible for supplying technologies for the remediation of numerous landfills at DOE facilities. These landfills are estimated to contain over 3 million cubic meters of radioactive and hazardous buried Technology developed within this specialty area will provide efective methods to contain contaminant plumes and new or alternative technologies for development of in situ technologies to minimize waste disposal costs and potential worker exposure by treating plumes in place. While addressing contaminant plumes emanating from DOE landfills, the Subsurface Contaminants Focus Area is also working to develop new or alternative technologies for the in situ stabilization, and nonintrusive characterization of these disposal sites.

NONE

1996-08-01T23:59:59.000Z

390

Functional Area Dean's Office  

E-Print Network (OSTI)

Functional Area Dean's Office 1101 Ag & Resource Economics 1172 Animal Sciences 1171 Bio Ag Science and Pest Mgmt 1177 Hort & Landscape Architecture 1173 Soil & Crop Science 1170 Ag Colo Res Ctr 3046 Fiscal Officers Jessi Fuentes 1 1931 Val Parker 1 6953 Linda Moller 1 1441 Paula

391

Plutonium focus area  

SciTech Connect

To ensure research and development programs focus on the most pressing environmental restoration and waste management problems at the U.S. Department of Energy (DOE), the Assistant Secretary for the Office of Environmental Management (EM) established a working group in August 1993 to implement a new approach to research and technology development. As part of this new approach, EM developed a management structure and principles that led to the creation of specific Focus Areas. These organizations were designed to focus the scientific and technical talent throughout DOE and the national scientific community on the major environmental restoration and waste management problems facing DOE. The Focus Area approach provides the framework for intersite cooperation and leveraging of resources on common problems. After the original establishment of five major Focus Areas within the Office of Technology Development (EM-50, now called the Office of Science and Technology), the Nuclear Materials Stabilization Task Group (EM-66) followed the structure already in place in EM-50 and chartered the Plutonium Focus Area (PFA). The following information outlines the scope and mission of the EM, EM-60, and EM-66 organizations as related to the PFA organizational structure.

NONE

1996-08-01T23:59:59.000Z

392

A review of "The Ends of Life: Roads to Fulfilment in Early Modern England" by Keith Thomas  

E-Print Network (OSTI)

reviews 59 future of the humanities in general and seventeenth-century studies in particular, H?fer?s study reaffirms the centrality of the grand si?cle through a timely return to a larger concept of the humanities, before that other... of Life: Roads to Fulfilment in Early Modern England. Oxford and New York: Oxford University Press, 2009. xvi + 393 pp. + 14 illus. $60.00. Review by catherine patterson, university of houston In this wide-ranging and engaging book, Keith Thomas brings...

Patterson, Catherine

2010-01-01T23:59:59.000Z

393

A review of "Thomas and Rebecca Vaughans Aqua Vit: Non Vitis" by Donald R. Dickson, ed.  

E-Print Network (OSTI)

to contemporary Anglican sufferings, is an important contribution to understanding. Donald R. Dickson, ed. Thomas and Rebecca Vaughan?s Aqua Vit?: Non Vitis (British Library MS, Sloane 1741). Tempe: Arizona Center for Medieval and Renaissance Studies, 2001..., and the present reviewer. I am writing these words on April 17, the date on which Tho- mas Vaughan?s wife, Rebecca, died: ?My most deare wife sickened on Friday in the Evening, being the 16 of April, and dyed the Saturday following in the Evening, being the 17...

Alan Rudrum

2003-01-01T23:59:59.000Z

394

EA-1177: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7: Salvage/Demolition of 200 West Area, 200 East Area, and 7: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants, Richland, Washington EA-1177: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants, Richland, Washington SUMMARY This EA evaluates the environmental impacts for the proposal to salvage and demolish the 200 West Area, 200 East Area, and 300 Area steam plants and their associated steam distribution piping equipment, and ancillary facilities at the U.S. Department of Energy Hanford Site in Richland, Washington. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD October 21, 1996 EA-1177: Finding of No Significant Impact Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants October 21, 1996 EA-1177: Final Environmental Assessment

395

Focus Area Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

information provided was consolidated from the original five focus areas for the EM information provided was consolidated from the original five focus areas for the EM Corporate QA Board. The status of QAP/QIP approvals etc. was accurate at the time of posting; however, additional approvals may have been achieved since that time. If you have any questions about the information provided, please contact Bob Murray at robert.murray@em.doe.gov Task # Task Description Status 1.1 Develop a brief questionnaire to send out to both commercial and EM contractors to describe their current approach for identifying the applicable QA requirements for subcontractors, tailoring the requirements based upon risk, process for working with procurement to ensure QA requirements are incorporated into subcontracts, and implementing verification of requirement flow-down by their

396

Focus Area 3 Deliverables  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 - Commercial Grade item and Services 3 - Commercial Grade item and Services Dedication Implementation and Nuclear Services Office of Environmental Management And Energy Facility Contractors Group Quality Assurance Improvement Project Plan Project Focus Area Task # and Description Deliverable Project Area 3-Commercial Grade Item and Services Dedication 3.1-Complete a survey of selected EM contractors to identify the process and basis for their CGI dedication program including safety classification of items being dedicated for nuclear applications within their facilities Completed Survey Approvals: Yes/No/NA Project Managers: S. Waisley, D. Tuttel Yes Executive Committee: D. Chung, J. Yanek, N. Barker, D. Amerine No EM QA Corporate Board: No Energy Facility Contractors Group

397

Argonne area restaurants  

NLE Websites -- All DOE Office Websites (Extended Search)

area restaurants area restaurants Amber Cafe 13 N. Cass Ave. Westmont, IL 60559 630-515-8080 www.ambercafe.net Argonne Guest House Building 460 Argonne, IL 60439 630-739-6000 www.anlgh.org Ballydoyle Irish Pub & Restaurant 5157 Main Street Downers Grove, IL 60515 630-969-0600 www.ballydoylepub.com Bd's Mongolian Grill The Promenade Shopping Center Boughton Rd. & I-355 Bolingbrook, IL 60440 630-972-0450 www.gomongo.com Branmor's American Grill 300 Veterans Parkway Bolingbrook, IL 60440 630-226-9926 www.branmors.com Buca di Beppo 90 Yorktown Convenience Center Lombard, IL 60148 630-932-7673 www.bucadibeppo.com California Pizza Kitchen 551 Oakbrook Center Oak Brook, IL 60523 630-571-7800 www.cpk.com Capri Ristorante 5101 Main Street Downers Grove, IL 60516 630-241-0695 www.capriristorante.com Carrabba's Italian Grill

398

borrow_area.cdr  

Office of Legacy Management (LM)

information information at Weldon Spring, Missouri. This site is managed by the U.S. Department of Energy Office of Legacy Management. developed by the former WSSRAP Community Relations Department to provide comprehensive descriptions of key activities that took place throughout the cleanup process The Missouri Department of Conservation (MDC) approved a plan on June 9, 1995, allowing the U.S. Department of Energy (DOE) at the Weldon Spring Site Remedial Action Project (WSSRAP) to excavate nearly 2 million cubic yards of clay material from land in the Weldon Spring Conservation Area. Clay soil from a borrow area was used to construct the permanent disposal facility at the Weldon Spring site. Clay soil was chosen to construct the disposal facility because it has low permeability when

399

Discussion on the energy content of the galactic dark matter Bose-Einstein condensate halo in the Thomas-Fermi approximation  

E-Print Network (OSTI)

We show that the galactic dark matter halo, considered composed of an axionlike particles Bose-Einstein condensate \\cite{pir12} trapped by a self-graviting potential \\cite{boh07}, may be stable in the Thomas-Fermi approximation since appropriate choices for the dark matter particle mass and scattering length are made. The demonstration is performed by means of the calculation of the potential, kinetic and self-interaction energy terms of a galactic halo described by a Boehmer-Harko density profile. We discuss the validity of the Thomas-Fermi approximation for the halo system, and show that the kinetic energy contribution is indeed negligible.

J. C. C. de Souza; M. O. C. Pires

2014-01-23T23:59:59.000Z

400

Iraq: Eastern flank of the Arab world  

SciTech Connect

Iraq, holding oil reserves second only to those of Saudi Arabia in the Middle East, is locked in a war with Iran whose outcome will affect Western energy supplies and the prospects for stability in the Arabian Gulf. Yet Iraq even now remains little known to Western governments and publics. This study is intended to enlarge understanding of Iraqi behavior and of the concerns that motivate its leaders. Rather than selecting issues of importance to other countries, the author focuses on the forces that influence policy formulation in Iraq and evokes the perspective from which the Iraqi government itself views its problems and sets its priorities. Part 1 examines the country's evolution into modern Iraq, explaining why problems that have recurred throughout Iraqi history have bedeviled all recent Iraqi governments and created tension between ''Iraq the nation'' and ''Iraq the state.'' Part 2 discusses the Arab Ba'th Socialist party, which has dominated Iraqi political life since 1968. The author neither condemns nor praises this controversial party and its current leader, President Saddam Husain, but seeks to explain why they have adopted the positions and taken the actions that have characterized their rule. Part 3 analyzes the war between Iraq and Iran, its causes, and the decisions Iraq has made in light of its goals and its assumptions about Iran. The author finds that this is not simply ''a war over borders'' but a deeper conflict between Islamic conservatism and Arab nationalism. Looking beyond the war, the final chapter assesses Iraq's potential importance in the Middle East and to the world economy. 8 figs.

Helms, C.M.

1984-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Geothermal Areas | Open Energy Information  

Open Energy Info (EERE)

Geothermal Areas Geothermal Areas Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Areas Geothermal Areas are specific locations of geothermal potential (e.g., Coso Geothermal Area). The base set of geothermal areas used in this database came from the 253 geothermal areas identified by the USGS in their 2008 Resource Assessment.[1] Additional geothermal areas were added, as needed, based on a literature search and on projects listed in the GTP's 2011 database of funded projects. Add.png Add a new Geothermal Resource Area Map of Areas List of Areas Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":2500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

402

Western Area Power Administration  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

v*Zy- i , . v*Zy- i , . r ,v * -i S # Af [, (e- . - o -A tl }r- 0 v-" l^~4~S J l ^-)^ I^U^ck iM clti ^ Area Power Administration Follow-up to Nov. 25, 2008 Transition Meeting Undeveloped Transmission Right-of-Way Western has very little undeveloped transmission right-of-way. There is a 7-mile right- of-way between Folsom, CA and Roseville, CA where Western acquired a 250' wide right-of-way but is only using half of it. Another line could be built parallel to Western's line to relieve congestion in the Sacramento area. In addition, Western has rights-of- way for many transmission lines that could be rebuilt to increase transmission capacity. For example, Western's Tracy-Livermore 230-kV line is a single circuit line but the existing towers could support a double circuit line. These rights-of-way would have to

403

Conceptual Model At Dixie Valley Geothermal Area (Thompson, Et...  

Open Energy Info (EERE)

1984. References George A. Thompson, Laurent J. Meister, Alan T. Herring, Thomas E. Smith, Dennis B. Burke, Robert L. Kovach, Robert O. Burford, Iraj A. Salehi, M. Darroll Wood...

404

CAVERN: The CAVE Research Network Andrew E. Johnson, Jason Leigh, Thomas A. DeFanti, Maxine D. Brown, and Daniel J. Sandin  

E-Print Network (OSTI)

CAVERN: The CAVE Research Network Andrew E. Johnson, Jason Leigh, Thomas A. DeFanti, Maxine D CAVERN, the CAVE Research Network, is an alliance of industrial and research institutions equipped, to at least six in 1997 , so now EVL turns its attention to the design and implementation of CAVERN, the CAVE

Johnson, Andrew

405

The Use of Commingled Plastic Lumber as Construction Materials Thomas J. Nosker, Ph.D., Richard W. Renfree, Ph.D.  

E-Print Network (OSTI)

The Use of Commingled Plastic Lumber as Construction Materials Thomas J. Nosker, Ph.D., Richard W at avoiding land filling post-industrial and post-consumer plastics. This has resulted in creating a supply of impure plastics at much reduced prices with respect to virgin plastics. The possibility exists to clean

406

The limits of feed-forward processing in visual object recognition Gabriel Kreiman1,2, Thomas Serre3 and Tomaso Poggio3  

E-Print Network (OSTI)

The limits of feed-forward processing in visual object recognition Gabriel Kreiman1,2, Thomas Serre) The visual architecture includes forward and back-projections - There are massive back explain many physiological observations 2.1 A hierarchical feed-forward object recognition model (Felleman

Kreiman, Gabriel

407

Contribution to Thomas D. & G. S. Dieckmann (eds.): SEA ICE -AN INTRODUCTION TO ITS PHYSICS, BIOLOGY , CHEMISTRY AND GEOLOGY, Blackwell Science, London, 2003, pp. 22-81  

E-Print Network (OSTI)

1 Contribution to Thomas D. & G. S. Dieckmann (eds.): SEA ICE - AN INTRODUCTION TO ITS PHYSICS to the macroscopic to the regional scale: Growth, microstructure and properties of sea ice1 Hajo Eicken 2 of the importance of sea ice over a wide range of scales in time and space. Considering the degree to which the ice

Eicken, Hajo

408

Office of Purchasing 213 Thomas Boyd Hall -Baton Rouge -Louisiana -70803-3001 -225/578-2176 -FAX 225/578-2292  

E-Print Network (OSTI)

Office of Purchasing 213 Thomas Boyd Hall - Baton Rouge - Louisiana - 70803-3001 - 225 the Purchasing Office; payments will be made through the Office of Accounting Services. Attached is a certificate stands behind our transactions. Our chief business officer is Dr. Jerry J. Baudin, Vice Chancellor

Harms, Kyle E.

409

A GIS-LIKE TRAINING ALGORITHM FOR LOG-LINEAR MODELS WITH HIDDEN Georg Heigold, Thomas Deselaers, Ralf Schluter, and Hermann Ney  

E-Print Network (OSTI)

A GIS-LIKE TRAINING ALGORITHM FOR LOG-LINEAR MODELS WITH HIDDEN VARIABLES Georg Heigold, Thomas with Generalized Iterative Scal- ing (GIS). GIS offers, upon others, the immediate advantages that it is locally convergent, completely parameter free, and guarantees an improvement of the criterion in each step. GIS

Deselaers, Thomas

410

Western Area Power Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

Western Area Power Administration Customer Meeting The meeting will begin at 12:30 pm MST We have logged on early for connectivity purposes Please stand-by until the meeting begins Please be sure to call into the conference bridge at: 888-989-6414 Conf. Code 60223 If you have connectivity issues, please contact: 866-900-1011 1 Introduction  Welcome  Introductions  Purpose of Meeting ◦ Status of the SLCA/IP Rate ◦ SLCA/IP Marketing Plan ◦ Credit Worthiness Policy ◦ LTEMP EIS update ◦ Access to Capital  Handout Materials http://www.wapa.gov/crsp/ratescrsp/default.htm 2 SLCA/IP Rate 3 1. Status of Repayment 2. Current SLCA/IP Firm Power Rate (SLIP-F9) 3. Revenue Requirements Comparison Table 4.SLCA/IP Rate 5. Next Steps

411

T-1 Training Area  

SciTech Connect

Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

None

2014-11-07T23:59:59.000Z

412

T-1 Training Area  

ScienceCinema (OSTI)

Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

None

2015-01-09T23:59:59.000Z

413

Hydrate Test Well, Milne Pt. Alaska Thomas D. Lorenson* U.S. Geological Survey, 345 Middlefield Rd., MS/ 999  

NLE Websites -- All DOE Office Websites (Extended Search)

Assessment of Hydrocarbon Gas Sources from the Mt. Elbert No. 1 Gas Assessment of Hydrocarbon Gas Sources from the Mt. Elbert No. 1 Gas Hydrate Test Well, Milne Pt. Alaska Thomas D. Lorenson* U.S. Geological Survey, 345 Middlefield Rd., MS/ 999 Menlo Park, CA, 94025, USA tlorenson@usgs.gov Timothy S. Collett U.S. Geological Survey, Denver Federal Center Box 25046, MS-939 Denver CO, 80225, USA Robert B. Hunter ASRC Energy Services, 3900 C St., Suite 702 Anchorage, Alaska, 99503 USA ABSTRACT Hydrocarbon gases were collected from well cuttings and core at the MtElbert-01 gas hydrate stratigraphic test well, drilled within the Milne Point field on the Alaska North Slope. Regionally, the Eileen gas hydrate deposits overlie the more deeply buried Prudhoe Bay, Milne Point, and Kuparuk River oil fields and are

414

Surface Water Management Areas (Virginia)  

Energy.gov (U.S. Department of Energy (DOE))

This legislation establishes surface water management areas, geographically defined surface water areas in which the State Water Control Board has deemed the levels or supply of surface water to be...

415

Focus Areas | Critical Materials Institute  

NLE Websites -- All DOE Office Websites (Extended Search)

Focus Areas FA 1: Diversifying Supply FA 2: Developing Substitutes FA 3: Improving Reuse and Recycling FA 4: Crosscutting Research...

416

Solar heat storages in district heating Klaus Ellehauge Thomas Engberg Pedersen  

E-Print Network (OSTI)

July 2007 . #12;#12;Solar heat storages in district heating networks July 2007 Klaus Ellehauge 97 22 11 tep@cowi.dk www.cowi.com #12;#12;Solar heat storages in district heating networks 5 in soil 28 5.3 Other experienced constructions: 30 6 Consequences of establishing solar heat in CHP areas

417

Integrated Science and Computing Support for National Climate Service PRINCIPAL INVESTIGATOR: Thomas J. Wilbanks  

E-Print Network (OSTI)

Climate Office PROJECT DESCRIPTION The purpose of this project is to begin the development in coastal areas. More specifically, this project is intended to (a) link advanced computing with climate and technology (S&T), not only regarding climate data and projections but also regarding informatics, visu

418

A Case for Bufferless Routing in On-Chip Networks Thomas Moscibroda  

E-Print Network (OSTI)

significant energy, occupy chip area, and increase design complexity. In this paper, we make a case for a new or flow control. We describe new algorithms for routing without using buffers in router input/output ports that rout- ing without buffers significantly reduces the energy consumption of the on-chip cache

419

Bicycle Tracking Using Ellipse Extraction Tohid Ardeshiri, Fredrik Larsson, Fredrik Gustafsson, Thomas B. Schon, Michael Felsberg  

E-Print Network (OSTI)

Bicycle Tracking Using Ellipse Extraction Tohid Ardeshiri, Fredrik Larsson, Fredrik Gustafsson bicycles from imagery sensor data is proposed. It is based on detecting ellipsoids in the images, and treat these pair-wise using a dynamic bicycle model. One important application area is in automotive collision

Schön, Thomas

420

Property:AreaGeology | Open Energy Information  

Open Energy Info (EERE)

AreaGeology AreaGeology Jump to: navigation, search Property Name AreaGeology Property Type String Description A description of the area geology This is a property of type String. Subproperties This property has the following 22 subproperties: A Amedee Geothermal Area B Beowawe Hot Springs Geothermal Area Blue Mountain Geothermal Area Brady Hot Springs Geothermal Area C Chena Geothermal Area Coso Geothermal Area D Desert Peak Geothermal Area D cont. Dixie Valley Geothermal Area E East Mesa Geothermal Area G Geysers Geothermal Area K Kilauea East Rift Geothermal Area L Lightning Dock Geothermal Area Long Valley Caldera Geothermal Area R Raft River Geothermal Area Roosevelt Hot Springs Geothermal Area S Salt Wells Geothermal Area Salton Sea Geothermal Area San Emidio Desert Geothermal Area

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Fire Hazards Analysis for the 200 Area Interim Storage Area  

SciTech Connect

This documents the Fire Hazards Analysis (FHA) for the 200 Area Interim Storage Area. The Interim Storage Cask, Rad-Vault, and NAC-1 Cask are analyzed for fire hazards and the 200 Area Interim Storage Area is assessed according to HNF-PRO-350 and the objectives of DOE Order 5480 7A. This FHA addresses the potential fire hazards associated with the Interim Storage Area (ISA) facility in accordance with the requirements of DOE Order 5480 7A. It is intended to assess the risk from fire to ensure there are no undue fire hazards to site personnel and the public and to ensure property damage potential from fire is within acceptable limits. This FHA will be in the form of a graded approach commensurate with the complexity of the structure or area and the associated fire hazards.

JOHNSON, D.M.

2000-01-06T23:59:59.000Z

422

Field Mapping At Silver Peak Area (Henkle, Et Al., 2005) | Open...  

Open Energy Info (EERE)

References William R. Henkle Jr., Wayne C. Gundersen, Thomas D. Gundersen (2005) Mercury Geochemical, Groundwater Geochemical, And Radiometric Geophysical Signatures At Three...

423

Mercury Vapor At Silver Peak Area (Henkle, Et Al., 2005) | Open...  

Open Energy Info (EERE)

William R. Henkle Jr., Wayne C. Gundersen, Thomas D. Gundersen (2005) Mercury Geochemical, Groundwater Geochemical, And Radiometric Geophysical Signatures At Three Geothermal...

424

The 12 GeV CEBAF Upgrade Project at Thomas Jefferson National Accelerator Facility, OAS-RA-L-11-13  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12 GeV CEBAF Upgrade 12 GeV CEBAF Upgrade Project at Thomas Jefferson National Accelerator Facility OAS-RA-L-11-13 September 2011 Department of Energy Washington, DC 20585 September 30, 2011 MEMORANDUM FOR THE DEPUTY DIRECTOR FOR SCIENCE PROGRAMS, OFFICE OF SCIENCE DIRECTOR, OFFICE OF RISK MANAGEMENT AND FINANCIAL POLICY, OFFICE OF THE CHIEF FINANCIAL OFFICER FROM: David Sedillo, Director NNSA & Science Audits Division Office of Inspector General SUBJECT: INFORMATION: Audit Report on "The 12 GeV CEBAF Upgrade Project at Thomas Jefferson National Accelerator Facility" Audit Report Number: OAS-RA-L-11-13 BACKGROUND In September 2008, the Department of Energy's (Department) Office of Science approved a construction project to double the electron beam energy of the Continuous Electron Beam

425

Finding Technological Solutions to the Energy-Water Nexus by Lindsay M. Green, Thomas J. Feeley, III, and James T. Murphy  

NLE Websites -- All DOE Office Websites (Extended Search)

Technological Solutions to the Energy-Water Nexus by Lindsay M. Green, Thomas J. Feeley, III, and James T. Murphy Technological Solutions to the Energy-Water Nexus by Lindsay M. Green, Thomas J. Feeley, III, and James T. Murphy Energy Security Prepared by the Institute for the Analysis of Global Security August 29, 2005 Contact IAGS: info@iags.org To subscribe, send a blank email to subscribe@iags.org To unsubscribe, send a blank email to unsubscribe@iags.org Energy Security Current Issue What the 9/11 Commission missed One of the main conclusions of the 9/11 Commission is that in order for the U.S. to prevail in the war on terror it must develop a multidisciplinary, comprehensive, and balanced strategy, which integrates diplomacy, intelligence, covert action, law- enforcement, economic policy, foreign aid, homeland defense, and military strength. IAGS' Gal Luft argues that a

426

Final DOE Areas Feasibility Study  

Office of Legacy Management (LM)

the area California Office of Historic Preservation, Northwest Information Center, Lee Jordan, Coordinator June 26, 1998 and April 12, 2000 Historical and Cultural Resources...

427

Thomas-Fermi for Al+ Following the discusions on the positive ions in the lecture notes, we need to find c'(0) so that  

E-Print Network (OSTI)

Thomas-Fermi for Al+ Following the discusions on the positive ions in the lecture notes, we need to find c'(0) so that x0 c' Hx0 L = -HZ - NLê Z = -1 ê13 for Al+ . After some trial-and-error, I find c' H.7649 Now make sure x0 c' Hx0 L = -1 ê13, AlTF.nb 1 #12;In[4]:= Z x c'@xD ê. chisol ê. 8x ? x0

Murayama, Hitoshi

428

Northwest Area Foundation Horizons Program  

E-Print Network (OSTI)

Northwest Area Foundation Horizons Program Final Evaluation Report ­ Executive Summary Diane L by the Northwest Area Foundation in partnership with two national organizations and delivered by a number to remember that Horizons was not designed to reduce poverty, but instead to contribute to the Foundations

Amin, S. Massoud

429

Area Health Education Center of  

E-Print Network (OSTI)

Area Health Education Center of Eastern Washington Washington State University Extension's Area Health Education Center of Eastern Washington works with university and community allies to promote health for underserved and at-risk populations. It is part of a network of AHEC organiza- tions

Collins, Gary S.

430

Report Wildland Fire Area Hazard  

NLE Websites -- All DOE Office Websites (Extended Search)

Report Wildland Fire Area Hazard Report Wildland Fire Area Hazard Report Wildland Fire Area Hazard Report wildland fire area hazards or incidents that are non-life threatening only. Call 911 for all emergencies that require immediate assistance. How to report wildland fire hazard Use the following form to report any wildland fire area hazards or incidents that are non-life threatening only. Call 911 for all emergencies that require immediate assistance. Fill out this form as completely as possible so we can better assess the hazard. All submissions will be assessed as promptly as possible. For assistance with a non-emergency situation, contact the Operations Support Center at 667-6211. Name (optional): Hazard Type (check one): Wildlife Sighting (check box if animal poses serious threat) Trails (access/egress)

431

EM ARRA Best Practices and Lessons Learned Workshop: Overview from Thomas Johnson, Jr., Recovery Act Program Director  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EM ARRA BEST PRACTICES and LESSONS LEARNED WORKSHOP Presenter: Thomas Johnson, Jr. Recovery Act Program Director Waste Management Symposium Phoenix, AZ March 1, 2012 www.em.doe.gov 2 Recovery Act Benefits  $6B of Recovery Act funds supported 122 projects/activities; including 29 identified added buy-back projects: › 90 funded projects have been physically completed as of March 1st (74% of total) › Another 23 will be completed in FY 2012 (94% of total) › 7 will be completed in FY 2013 (100% of total)  Small Business: Over $2.1B › Prime: $671,119,367 › Subcontractors: $1,434,858,660  FTEs : 2,672.03 (1QFY2012)  Headcount of 36,787 (End of FY 2011) www.em.doe.gov 3 Recovery Act Funding Details Spend Plan Total does not include $ 10 million reprogrammed to DOE Departmental Administration

432

Nevada Geothermal Area | Department of Energy  

Energy Savers (EERE)

Nevada Geothermal Area Nevada Geothermal Area The extensive Steamboat Springs geothermal area contains three geothermal power-generating plants. The plants provide approximately...

433

The Geysers Geothermal Area | Department of Energy  

Energy Savers (EERE)

The Geysers Geothermal Area The Geysers Geothermal Area The Geysers Geothermal area, north of San Francisco, California, is the world's largest dry-steam geothermal steam field....

434

Research Areas | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

High Energy Density Laboratory Plasmas Research Areas Research Areas High Energy Density Laboratory Plasmas (HEDLP) Research Areas During open solicitations proposals are sought...

435

Pyrophyllite and pyrophyllite raw materials in the sulfide-bearing areas of the Urals  

Science Journals Connector (OSTI)

Pyrophyllite, Al2(Si4O10) (OH)2, was discovered for the first time in the Urals, in 1829, occurring in quartz veins of the Berezovsk gold-beresite deposit. At present, 6 types of pyrophyllite mineralization occurrences are known in the region. Pyrophyllite-containing metasomatites in areas with massive sulfide mineralization are the most interesting for practical purposes. They are confined to Devonian palaeo-island arcs formed on the margin of the Urals palaeo-ocean. While studying the Gay and Kul-Yurt-Tau deposits, it was discovered that productive metasomatites occur in the flanks and roofs of rhyolite-dacite domes. Depending on the ratio of pyrophyllite, diaspore, sericite, kaolinite and quartz, several types of pyrophyllite raw material can be distinguished. Quartz-sericite-pyrophyllitic rocks are the most suitable for ceramic production. They have an elevated content of alkalis that promote sintering in the range of 1100 to 1200C. Pyrophyllitic, pyrophyllite-diasporic, and pyrophyllite-quartz varieties can be used for production of fireproof materials. Sometimes, besides ordinary pyrophyllite of the 2M + 1Tc polytype, chromiferous pyrophyllite of the 1Tc polytype is present. Processes like synvolcanic metasomatism, dynamometamorphism and atmospheric weathering have played an important role in the formation of pyrophyllite ore bodies.

V.V. Zaykov; V.N. Udachin

1994-01-01T23:59:59.000Z

436

4853 recreation area planning [n  

Science Journals Connector (OSTI)

landsc. plan. pol. recr....(Development of policies, strategies and measures to make an area attractive for recreation users);splanificacin [f] de reas tursticas y de recreo (Planificacin y apli...

2010-01-01T23:59:59.000Z

437

Focus Area Tax Credits (Maryland)  

Energy.gov (U.S. Department of Energy (DOE))

Focus Area Tax Credits for businesses in Baltimore City or Prince Georges County enterprise zones include: (1) Ten-year, 80% credit against local real property taxes on a portion of real property...

438

Fire in a contaminated area  

SciTech Connect

This document supports the development and presentation of the following accident scenario in the TWRS Final Safety Analysis Report: Fire in Contaminated Area. The calculations needed to quantify the risk associated with this accident scenario are included within.

Ryan, G.W., Westinghouse Hanford

1996-08-02T23:59:59.000Z

439

Security Area Vouching and Piggybacking  

Directives, Delegations, and Requirements

Establishes requirements for the Department of Energy (DOE) Security Area practice of "vouching" or "piggybacking" access by personnel. DOE N 251.40, dated 5-3-01, extends this directive until 12-31-01.

2000-06-05T23:59:59.000Z

440

Controlling Bats in Urban Areas  

E-Print Network (OSTI)

to avoid obstacles and capture insects. Bats also emit audible sounds that may be used for communi- cation. L-1913 4-08 Controlling BATS Damage In urban areas, bats may become a nuisance becauseoftheirsqueaking,scratchingandcrawl- inginattics...

Texas Wildlife Services

2008-04-15T23:59:59.000Z

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Progress Update: M Area Closure  

ScienceCinema (OSTI)

A progress update of the Recovery Act at work at the Savannah River Site. The celebration of the first area cleanup completion with the help of the Recovery Act.

Cody, Tom

2012-06-14T23:59:59.000Z

442

Transforming Parks and Protected Areas  

E-Print Network (OSTI)

Transforming Parks and Protected Areas Policy and governance in a changing world Edited by Kevin S from the British Library Library of Congress Cataloging In Publication Data Transforming parks

Bolch, Tobias

443

Geology of the Wallula Gap Area, Washington. [Grande Ronde, Wanapum, and Saddle Mountains basalts  

SciTech Connect

This study focuses on the structure and stratigraphy of an 80-km/sup 2/ area at the southern margin of the Pasco Basin in Wallula Gap. Field stratigraphy, petrography, natural remanent magnetism, and major-element chemistry indicate that the tholeiitic basalt flows of the Wallula Gap area correlate with units of the Grande Ronde, Wanapum, and Saddle Mountains Formations of the Yakima Subgroup of the Columbia River Basalt Group. Flows of the Frenchman Springs, Umatilla, Pomona, Elephant Mountain, and Ice Harbor Mmebers are present in the area. The Frenchman Springs Member exposed in the Wallula Gap is more than 185 m thick and consists of eight to nine flows. Its thickness and possible contemporaneous structural deformation apparently prevented emplacement of both the Roza and Priest Rapids Members at this locality. Structural uplift of the Horse Heaven Hills began prior to extrusion of the Pomona flow. Both the Pomona and Elephant Mountain Members thin and pinch out over the crest of the uplift near Mound Pond. The Ice Harbor flow was apparently confined to the basin north of the Horse Heaven uplift, but an exposure at Mound Pond suggests it flowed through Wallula Gap as an intracanyon flow. The Wallula Gap fault zone trends N65/sup 0/W and can be traced for at least 11 km along the north flank of the Horse Heaven Hills uplift. Where the fault intersects the Olympic-Wallowa Lineament at Van Sycle Canyon 8 km east of Wallula Gap, it is a broad zone of normal faulting, 300 m wide, with as much as 310 m of displacement of the basalt stratigraphy. Two faults occur in the northern portion of Van Sycle Canyon and define a graben trending N45/sup 0/W. A third fault, roughly parallel to the Wallula Gap fault, transects the The Nub and offsets 14 m of Ice Harbor basalt.

Gardner, J.N.; Snow, M.G.; Fecht, K.R.

1981-12-01T23:59:59.000Z

444

Los Azufres Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

(0) 10 References Area Overview Geothermal Area Profile Location: Michoaciin, Mexico Exploration Region: Transmexican Volcanic Belt GEA Development Phase: Coordinates:...

445

Focus Areas | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mission » Focus Areas Mission » Focus Areas Focus Areas Safety With this focus on cleanup completion and risk reducing results, safety still remains the utmost priority. EM will continue to maintain and demand the highest safety performance. All workers deserve to go home as healthy as they were when they came to the job in the morning. There is no schedule or milestone worth any injury to the work force. Project Management EM is increasing its concentration on project management to improve its overall performance toward cost-effective risk reduction. This will involve review of validated project baselines, schedules, and assumptions about effective identification and management of risks. Instrumental in refining the technical and business approaches to project management are the senior

446

100 Areas CERCLA ecological investigations  

SciTech Connect

This document reports the results of the field terrestrial ecological investigations conducted by Westinghouse Hanford Company during fiscal years 1991 and 1992 at operable units 100-FR-3, 100-HR-3, 100-NR-2, 100-KR-4, and 100-BC-5. The tasks reported here are part of the Remedial Investigations conducted in support of the Comprehensive Environmental Response, compensation, and Liability Act of 1980 studies for the 100 Areas. These ecological investigations provide (1) a description of the flora and fauna associated with the 100 Areas operable units, emphasizing potential pathways for contaminants and species that have been given special status under existing state and/or federal laws, and (2) an evaluation of existing concentrations of heavy metals and radionuclides in biota associated with the 100 Areas operable units.

Landeen, D.S.; Sackschewsky, M.R.; Weiss, S.

1993-09-01T23:59:59.000Z

447

A review of "Hope and Healing: Painting in Italy in a Time of Plague" by Gauvin Alexander Bailey, Pamela M. Jones, Franco Mormando, and Thomas W. Worcester, eds.  

E-Print Network (OSTI)

. Worcester, eds. Hope and Healing: Painting in Italy in a Time of Plague, 1500- 1800. Worcester, Mass.: Clark University, College of the Holy Cross, Worcester Art Museum, 2005. viii + 264 pp. + 43 color and 68 b/w illus. $39.95. Review by JEFFREY... of the show, Thomas Worcester: ?This exhibition has sought to explore how early modern people (especially in Italy) thought about life and death, illness and health, plague and piety. It has sought to show how painting was a privileged expression of metaphors...

Fontana, Jeffrey

2007-01-01T23:59:59.000Z

448

Manhattan Project: Tech Area Gallery  

Office of Scientific and Technical Information (OSTI)

TECH AREA GALLERY (LARGE) TECH AREA GALLERY (LARGE) Los Alamos: The Laboratory Resources > Photo Gallery All of the photographs below are of the "Tech Area" at Los Alamos during or shortly after the wartime years. If this page is taking a long time to load, click here for a photo gallery with smaller versions of the same images. There is a map of the Tech Area at the top and again at the bottom. The first image below is courtesy the Los Alamos National Laboratory. All of the other photographs are reproduced from Edith C. Truslow, with Kasha V. Thayer, ed., Manhattan Engineer District: Nonscientific Aspects of Los Alamos Project Y, 1942 through 1946 (Los Alamos, NM: Manhattan Engineer District, ca. 1946; first printed by Los Alamos Scientific Laboratory as LA-5200, March 1973; reprinted in 1997 by the Los Alamos Historical Society). This is a reprint of an unpublished volume originally written in 1946 by 2nd Lieutenant Edith C. Truslow, a member of the Women's Army Corps, as a contribution to the Manhattan Engineer District History.

449

Blackfoot Reservoir Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Blackfoot Reservoir Geothermal Area Blackfoot Reservoir Geothermal Area (Redirected from Blackfoot Reservoir Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Blackfoot Reservoir Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (3) 10 References Area Overview Geothermal Area Profile Location: Idaho Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0

450

Wister Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Wister Geothermal Area Wister Geothermal Area (Redirected from Wister Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Wister Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

451

Teels Marsh Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Teels Marsh Geothermal Area Teels Marsh Geothermal Area (Redirected from Teels Marsh Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Teels Marsh Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Walker-Lane Transition Zone Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0

452

Truckhaven Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Truckhaven Geothermal Area Truckhaven Geothermal Area (Redirected from Truckhaven Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Truckhaven Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

453

Mokapu Penninsula Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Mokapu Penninsula Geothermal Area Mokapu Penninsula Geothermal Area (Redirected from Mokapu Penninsula Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Mokapu Penninsula Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

454

Kilauea Summit Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Kilauea Summit Geothermal Area Kilauea Summit Geothermal Area (Redirected from Kilauea Summit Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Kilauea Summit Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (12) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

455

Flint Geothermal Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Flint Geothermal Geothermal Area Flint Geothermal Geothermal Area (Redirected from Flint Geothermal Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Flint Geothermal Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: Colorado Exploration Region: Rio Grande Rift GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

456

RHIC | New Areas of Physics  

NLE Websites -- All DOE Office Websites (Extended Search)

A New Area of Physics A New Area of Physics RHIC has created a new state of hot, dense matter out of the quarks and gluons that are the basic particles of atomic nuclei, but it is a state quite different and even more remarkable than had been predicted. Instead of behaving like a gas of free quarks and gluons, as was expected, the matter created in RHIC's heavy ion collisions is more like a liquid. Quarks Gluons and quarks Ions Ions about to collide Impact Just after collision Perfect Liquid The "perfect" liquid hot matter Hot Nuclear Matter A review article in the journal Science describes groundbreaking discoveries that have emerged from RHIC, synergies with the heavy-ion program at the Large Hadron Collider, and the compelling questions that will drive this research forward on both sides of the Atlantic.

457

CENTRAL NEVPJJA SUPPLEMENTAL TEST AREA  

NLE Websites -- All DOE Office Websites (Extended Search)

r r r r r t r r t r r r * r r r r r r CENTRAL NEVPJJA SUPPLEMENTAL TEST AREA ,FACILITY RECORDS 1970 UNITED STATES ATOMIC ENERGY COMMlSSION NEVADA OPERATIONS OFFICE LAS VEGAS, NEVADA September 1970 Prepared By Holmes & Narver. Inc. On-Continent Test Division P.O. Box 14340 Las Vegas, Nevada 338592 ...._- _._--_ .. -- - - - - - - .. .. - .. - - .. - - - CENTRAL NEVPJJA SUPPLEMENTAL TEST AREA FACILITY RECORDS 1970 This page intentionally left blank - - .. - - - PURPOSE This facility study has been prepared in response to a request of the AEC/NVOO Property Management Division and confirmed by letter, W. D. Smith to L. E. Rickey, dated April 14, 1970, STS Program Administrative Matters. The purpose is to identify each facility, including a brief description, the acquisition cost either purchase and/or construction, and the AE costs if identi- fiable. A narrative review of the history of the subcontracts

458

Variable area light reflecting assembly  

DOE Patents (OSTI)

Device is described for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles. 9 figs.

Howard, T.C.

1986-12-23T23:59:59.000Z

459

Carlsbad Area Office Executive Summary  

NLE Websites -- All DOE Office Websites (Extended Search)

June 1998 June 1998 Carlsbad Area Office Executive Summary The mission of the Carlsbad Area Office (CAO) is to protect human health and the environment by opening and operating the Waste Isolation Pilot Plant (WIPP) for safe disposal of transuranic (TRU) waste and by establishing an effective system for management of TRU waste from generation to disposal. It includes personnel assigned to CAO, WIPP site operations, transportation, and other activities associated with the National TRU Program (NTP). The CAO develops and directs implementation of the TRU waste program, and assesses compliance with the program guidance, as well as the commonality of activities and assumptions among all TRU waste sites. A cornerstone of the Department of Energy's (DOE) national cleanup strategy, WIPP is

460

Nuclear criticality safety: 300 Area  

SciTech Connect

This Standard applies to the receipt, processing, storage, and shipment of fissionable material in the 300 Area and in any other facility under the control of the Reactor Materials Project Management Team (PMT). The objective is to establish practices and process conditions for the storage and handling of fissionable material that prevent the accidental assembly of a critical mass and that comply with DOE Orders as well as accepted industry practice.

Not Available

1991-07-31T23:59:59.000Z

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Innovation investment area: Technology summary  

SciTech Connect

The mission of Environmental Management`s (EM) Office of Technology Development (OTD) Innovation Investment Area is to identify and provide development support for two types of technologies that are developed to characterize, treat and dispose of DOE waste, and to remediate contaminated sites. They are: technologies that show promise to address specific EM needs, but require proof-of-principle experimentation; and (2) already proven technologies in other fields that require critical path experimentation to demonstrate feasibility for adaptation to specific EM needs. The underlying strategy is to ensure that private industry, other Federal Agencies, universities, and DOE National Laboratories are major participants in developing and deploying new and emerging technologies. To this end, about 125 different new and emerging technologies are being developed through Innovation Investment Area`s (IIA) two program elements: RDDT&E New Initiatives (RD01) and Interagency Agreements (RD02). Both of these activities are intended to foster research and development partnerships so as to introduce innovative technologies into other OTD program elements for expedited evaluation.

Not Available

1994-03-01T23:59:59.000Z

462

White Mountains Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

White Mountains Geothermal Area White Mountains Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: White Mountains Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: New Hampshire Exploration Region: Other GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

463

Truckhaven Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Truckhaven Geothermal Area Truckhaven Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Truckhaven Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

464

Honokowai Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Honokowai Geothermal Area Honokowai Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Honokowai Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (3) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

465

Blackfoot Reservoir Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Blackfoot Reservoir Geothermal Area Blackfoot Reservoir Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Blackfoot Reservoir Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (3) 10 References Area Overview Geothermal Area Profile Location: Idaho Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

466

Wister Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Wister Geothermal Area Wister Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Wister Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

467

Recommendation 199: Recommendation to Remove Uncontaminated Areas...  

Office of Environmental Management (EM)

9: Recommendation to Remove Uncontaminated Areas of the Oak Ridge Reservation from the National Priorities List Recommendation 199: Recommendation to Remove Uncontaminated Areas of...

468

Ahuachapan Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Activities (0) 10 References Area Overview Geothermal Area Profile Location: El Salvador Exploration Region: Central American Volcanic Arc Chain GEA Development Phase: Phase...

469

Berln Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Activities (0) 10 References Area Overview Geothermal Area Profile Location: El Salvador Exploration Region: Central American Volcanic Arc Chain GEA Development Phase: Phase...

470

Western Area Power Administration Borrowing Authority, Recovery...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Area Power Administration Borrowing Authority, Recovery Act Western Area Power Administration Borrowing Authority, Recovery Act Microsoft Word - PSRP May 15 2009 WAPA...

471

Aurora Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Aurora Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4...

472

Clean Energy Research Areas | Clean Energy | ORNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Tools & Resources Newsletters and Media News and Awards Supporting Organizations Clean Energy Home | Science & Discovery | Clean Energy | Research Areas SHARE Research Areas...

473

Aquifer Protection Area Land Use Regulations (Connecticut)  

Energy.gov (U.S. Department of Energy (DOE))

These regulations describe allowable activities within aquifer protection areas, the procedure by which such areas are delineated, and relevant permit requirements. The regulations also describe...

474

Imperial Valley Geothermal Area | Department of Energy  

Energy Savers (EERE)

Imperial Valley Geothermal Area Imperial Valley Geothermal Area The Imperial Valley Geothermal project consists of 10 generating plants in the Salton Sea Known Geothermal Resource...

475

Chicago Area Alternative Fuels Deployment Project (CAAFDP) |...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Meeting arravt061tibingham2012o.pdf More Documents & Publications Chicago Area Alternative Fuels Deployment Project (CAAFDP) Chicago Area Alternative Fuels Deployment Project...

476

Los Humeros Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

(0) 10 References Area Overview Geothermal Area Profile Location: Chignautla, Puebla, Mexico Exploration Region: Transmexican Volcanic Belt GEA Development Phase: Phase IV -...

477

Lualualei Valley Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Lualualei Valley Geothermal Area (Redirected from Lualualei Valley Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Lualualei Valley Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (7) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content

478

AREA USA LLC | Open Energy Information  

Open Energy Info (EERE)

AREA USA LLC Jump to: navigation, search Name: AREA USA LLC Place: Washington, DC Zip: 20004 Sector: Services Product: Washington, D.C.-based division of Fabiani & Company...

479

Fukushima Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Activities (0) 10 References Area Overview Geothermal Area Profile Location: Fukushima, Japan Exploration Region: Northeast Honshu Arc GEA Development Phase: Coordinates:...

480

Chena Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Chena Geothermal Area Chena Geothermal Area (Redirected from Chena Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Chena Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Future Plans 5 Exploration History 6 Well Field Description 7 Technical Problems and Solutions 8 Geology of the Area 9 Heat Source 10 Geofluid Geochemistry 11 NEPA-Related Analyses (1) 12 Exploration Activities (9) 13 References Map: Chena Geothermal Area Chena Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Fairbanks, Alaska Exploration Region: Alaska Geothermal Region GEA Development Phase: Operational"Operational" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.

Note: This page contains sample records for the topic "flank area thomas" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Tanks focus area. Annual report  

SciTech Connect

The U.S. Department of Energy Office of Environmental Management is tasked with a major remediation project to treat and dispose of radioactive waste in hundreds of underground storage tanks. These tanks contain about 90,000,000 gallons of high-level and transuranic wastes. We have 68 known or assumed leaking tanks, that have allowed waste to migrate into the soil surrounding the tank. In some cases, the tank contents have reacted to form flammable gases, introducing additional safety risks. These tanks must be maintained in the safest possible condition until their eventual remediation to reduce the risk of waste migration and exposure to workers, the public, and the environment. Science and technology development for safer, more efficient, and cost-effective waste treatment methods will speed up progress toward the final remediation of these tanks. The DOE Office of Environmental Management established the Tanks Focus Area to serve as the DOE-EM`s technology development program for radioactive waste tank remediation in partnership with the Offices of Waste Management and Environmental Restoration. The Tanks Focus Area is responsible for leading, coordinating, and facilitating science and technology development to support remediation at DOE`s four major tank sites: the Hanford Site in Washington State, Idaho National Engineering and Environmental Laboratory in Idaho, Oak Ridge Reservation in Tennessee, and the Savannah River Site in South Carolina. The technical scope covers the major functions that comprise a complete tank remediation system: waste retrieval, waste pretreatment, waste immobilization, tank closure, and characterization of both the waste and tank. Safety is integrated across all the functions and is a key component of the Tanks Focus Area program.

Frey, J.

1997-12-31T23:59:59.000Z

482

History of 100-B Area  

SciTech Connect

The initial three production reactors and their support facilities were designated as the 100-B, 100-D, and 100-F areas. In subsequent years, six additional plutonium-producing reactors were constructed and operated at the Hanford Site. Among them was one dual-purpose reactor (100-N) designed to supply steam for the production of electricity as a by-product. Figure 1 pinpoints the location of each of the nine Hanford Site reactors along the Columbia River. This report documents a brief description of the 105-B reactor, support facilities, and significant events that are considered to be of historical interest. 21 figs.

Wahlen, R.K.

1989-10-01T23:59:59.000Z

483

Carlsbad Area Office strategic plan  

SciTech Connect

This edition of the Carlsbad Area Office Strategic Plan captures the U.S. Department of Energy`s new focus, and supercedes the edition issued previously in 1995. This revision reflects a revised strategy designed to demonstrate compliance with environmental regulations earlier than the previous course of action; and a focus on the selected combination of scientific investigations, engineered alternatives, and waste acceptance criteria for supporting the compliance applications. An overview of operations and historical aspects of the Waste Isolation Pilot Plant near Carlsbad, New Mexico is presented.

NONE

1995-10-01T23:59:59.000Z

484

Abstract for Thomas Duguet  

NLE Websites -- All DOE Office Websites (Extended Search)

Duguet Duguet Physics Division, Argonne Bare vs effective pairing force. A microscopic pairing interaction for mean-field calculations of finite nuclei. The Hartree-Fock Bogolyubov method with effective forces and its recent extensions such as the Generator Coordinate Method on symmetry restored wave-functions are powerful methods to describe finite nuclei (almost) all over the mass table. However, the phenomenological interactions used so far need to be revisited to address on-going experimental challenges. In particular, the pairing channel of the interaction is poorly known. I will present a microscopic effective interaction proposed recently to treat pairing correlations in the 1S0 channel. This interaction is fully equivalent to the bare NN force at the mean-field level as regards pairing,

485

Thomas Wallner resume  

NLE Websites -- All DOE Office Websites (Extended Search)

Wallner Wallner Argonne National Laboratory Center for Transportation Research 9700 South Cass Avenue, Building 362 Argonne, IL 60439 phone: 630/252-3003, fax: 630/252-3443 e-mail: twallner@anl.gov Professional Experience  2006-Present. Staff employee at Argonne National Laboratory, Center for Transportation Research  2005-2006. Postdoctoral appointee at Argonne National Laboratory, Center for Transportation Research  2004-2005. Authorized contact person and Team leader for Graz University of Technology's European Integrated Project "Hydrogen Internal Combustion Engine"  2001-2004. Scientific assistant at the Institute of Internal Combustion Engines and Thermodynamics at Graz University of Technology, Engine Research/Combustion Process Department

486

Thomas A. Jaggar  

Science Journals Connector (OSTI)

...the passage of a cold front. It hes been...the com- plete weather picture at the time...been in continuous operation at Palisades for...satisfactory unattended operation. It is possible...amplifier. If battery operation is not desired...furnish the plate and heater voltages. The heaters...

487

Thomas Tremblay Publications  

E-Print Network (OSTI)

, T. A., and Zirczy, H. H., 2000, Expansion of gas reservoir data base, Permian Basin, Texas, in De and historical trends of selected estuarine and coastal habitats in the Corpus Christi Bay National Estuary

Yang, Zong-Liang

488

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

to the optimization of the properties of soft matter electronic, photonic, and optoelectronic materials. New, high performance organic electro-optic materials are integrated...

489

Meeting Recognition Thomas Hain  

E-Print Network (OSTI)

in the same room w In general, two interaction observers are used in o check on reliability. Two Interaction interaction observers are used in o check on reliability. Two Interaction Recorders are av numbers on holders;Meeting capture Illustration 1. Discussion group from observers' vantage point. Illustration 2. Discussion

Hain, Thomas

490

World Lessons Thomas Turrentine  

E-Print Network (OSTI)

;8/3/2012 2 Lessons from other fuel transitions · Keep fuel price lower than gasoline: ­ Diesel in Europe (30 (fuel prices, dual fuel); · Time vehicles subsidies to bridge to main market: ­ HEV market in Japan 3

California at Davis, University of

491

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

phase (nanoparticles) in dilute solutions: A point of view different from thermodynamics Chi Wu Department of Chemistry and Department of Physics The Chinese University of...

492

Thomas Henry Havelock  

Science Journals Connector (OSTI)

......15-20. 9. " The electric or magnetic polarisation...The dispersion of electric double refraction...The wave making resistance of ships: a theoretical...276-300. 15. Elementary mechanics (with C...160-168. 17. " Ship resistance; a numerical analysis......

P. H. Roberts

1970-07-01T23:59:59.000Z

493

Iran Thomas Auditorium, 8600  

NLE Websites -- All DOE Office Websites (Extended Search)

Guus Rijnders MESA+ Institute for Nanotechnology University of Twente, Enschede, the Netherlands CNMS D D I I S S C C O O V V E E R R Y Y SEMINAR SERIES Abstract: Complex oxides...

494

Spencer Thomas Short Story  

E-Print Network (OSTI)

inspection, he found a tiny label on the back of the seat. "Seating Unit Number 04409841? Oh, that's nice and braced himself against the chair to keep from falling over. He sat down and held on. There was no way one. 04409841 regained his senses and, once again, took stock of the situation. Had he just flipped

Walter, Frederick M.

495

Manhattan Project: Tech Area Gallery  

Office of Scientific and Technical Information (OSTI)

SMALL) SMALL) Los Alamos: The Laboratory Resources > Photo Gallery All of the photographs below are of the "Tech Area" at Los Alamos during or shortly after the wartime years. If you have a fast internet connection, you may wish to click here for a photo gallery with larger versions of the same images. There is a map of the Tech Area at the top and again at the bottom. The first image below is courtesy the Los Alamos National Laboratory. All of the other photographs are reproduced from Edith C. Truslow, with Kasha V. Thayer, ed., Manhattan Engineer District: Nonscientific Aspects of Los Alamos Project Y, 1942 through 1946 (Los Alamos, NM: Manhattan Engineer District, ca. 1946; first printed by Los Alamos Scientific Laboratory as LA-5200, March 1973; reprinted in 1997 by the Los Alamos Historical Society). This is a reprint of an unpublished volume originally written in 1946 by 2nd Lieutenant Edith C. Truslow, a member of the Women's Army Corps, as a contribution to the Manhattan Engineer District History.

496

DAC-board based X-band EPR Spectrometer with Arbitrary Waveform Control Thomas Kaufmann1, Timothy J. Keller1, John M. Franck1, Ryan P. Barnes1, Steffen J.  

E-Print Network (OSTI)

DAC-board based X-band EPR Spectrometer with Arbitrary Waveform Control Thomas Kaufmann1, Timothy J; EPR; X-band; arbitrary waveform generation; transfer function; excitation profile Abstract We present resonance (EPR) spectrometer operating at 8­10 GHz (X-band) and controlled by a 1 GHz arbitrary waveform

Martinis, John M.

497

Geothermal resource evaluation of the Yuma area  

SciTech Connect

This report presents an evaluation of the geothermal potential of the Yuma, Arizona area. A description of the study area and the Salton Trough area is followed by a geothermal analysis of the area, a discussion of the economics of geothermal exploration and exploitation, and recommendations for further testing. It was concluded economic considerations do not favor geothermal development at this time. (ACR)

Poluianov, E.W.; Mancini, F.P.

1985-11-29T23:59:59.000Z

498

Obsidian Cliff Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Obsidian Cliff Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Obsidian Cliff Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0

499

Southern CA Area | Open Energy Information  

Open Energy Info (EERE)

Southern CA Area Southern CA Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Southern CA Area 1.1 Products and Services in the Southern CA Area 1.2 Research and Development Institutions in the Southern CA Area 1.3 Networking Organizations in the Southern CA Area 1.4 Investors and Financial Organizations in the Southern CA Area 1.5 Policy Organizations in the Southern CA Area Clean Energy Clusters in the Southern CA Area Products and Services in the Southern CA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

500

Pumpernickel Valley Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Pumpernickel Valley Geothermal Area Pumpernickel Valley Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Pumpernickel Valley Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (0) 10 References Map: Pumpernickel Valley Geothermal Area Pumpernickel Valley Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Northwest Basin and Range Geothermal Region GEA Development Phase: none"None" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.