Powered by Deep Web Technologies
Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Electric car Gasoline car  

E-Print Network (OSTI)

ENAC/ Electric car (Renault) Gasoline car (competitors) Gasoline car (Renault) Market shares of an electric vehicle? Electric car (Renault) Gasoline car (competitors) Gasoline car (Renault) Market shares preference survey with choice situation contexts involving gasoline cars (Renault and competitors


Bons Ventos Geradora de Energia S A | Open Energy Information  

Open Energy Info (EERE)

Bons Ventos Geradora de Energia S A Bons Ventos Geradora de Energia S A Jump to: navigation, search Name Bons Ventos Geradora de Energia S.A. Place Fortaleza, Ceara, Brazil Sector Wind energy Product Brazilian-based wind project developer, subsidiary of Grupo Servtec. Coordinates -3.718404°, -38.542924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-3.718404,"lon":-38.542924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

solvents solvents B-6 Pre-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 Co 2 CaPture from igCC gas streams using aC-abC ProCess primary project goals SRI International is developing, for integrated gasification combined cycle (IGCC)-based power plants, a carbon dioxide (CO 2 ) capture technology based on the use of a high-ca- pacity and low-cost aqueous ammoniated solution containing ammonium carbonate (AC), which reacts with CO 2 to form ammonium bicarbonate (ABC).


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

solvents solvents B-198 Post-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 DeveloPment anD Demonstration of Waste heat integration With solvent ProCess for more effiCient Co 2 removal from Coal-fireD flue gas primary project goals Southern Company Services is developing viable heat integration methods for the capture of carbon dioxide (CO 2 ) produced from pulverized coal (PC) combustion. The project will quantify energy-efficiency improvements to the CO 2 capture process by utilizing a waste heat recovery technology, High-Efficiency System (HES). technical goals * Reduction of the amount of extraction steam required for sensible heat load in the


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

sorbents sorbents B-302 Post-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 benCh-sCale DeveloPment anD testing of raPiD Pressure swing absorPtion for Carbon DioxiDe CaPture primary project goals WR Grace and the University of South Carolina are developing a rapid pressure swing adsorption (PSA) process to evaluate concept cost and performance benefits by testing a bench-scale system using a low-cost, structured adsorbent with low-pressure drop, high mass-transfer rates, high capacity, and high availability that will enable large feed through- puts. technical goals * Develop an attrition-resistant and low-pressure drop structured adsorbent based on a


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

sorbents sorbents B-14 Pre-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 aDvanCeD Carbon DioxiDe CaPture teChnology for low-rank Coal integrateD gasifiCation CombineD CyCle (igCC) systems primary project goals TDA will investigate the technical and economic advantages of using an integrated carbon dioxide (CO 2 ) sorbent and water-gas shift (WGS) catalyst system in an integrated gasifi- cation combined cycle (IGCC) power plant, fueled with low-rank coal, and designed to capture more than 90% of the CO 2 emissions. technical goals * TDA will evaluate the physical mix of the sorbent and catalyst pellets within the same


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

AdvAnced compression AdvAnced compression B-540 AdvAnced compression U.s. depArtment of energy AdvAnced cArbon dioxide cAptUre r&d progrAm: technology UpdAte, mAy 2013 novel concepts for the compression of lArge volUmes of co 2 primary project goals Southwest Research Institute (SwRI) is developing novel compression technology concepts to reduce carbon dioxide (CO 2 ) compression power requirements by 10% compared to conventional compressor designs. The basic concept is a semi-isothermal compression pro- cess where the CO 2 is continually cooled using an internal cooling jacket rather than using conventional interstage cooling. The project has completed thermodynamic (Phase I) and prototype testing (Phase II). A full-scale demonstration of a multi-stage, internally cooled


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

membranes membranes B-370 Post-Combustion membranes u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 eleCtroChemiCal membrane for Carbon DioxiDe CaPture & Power generation primary project goals FuelCell Energy, Inc. (FCE) is developing an electrochemical membrane (ECM)-based Combined Electric Power and Carbon Dioxide Separation (CEPACS) system for carbon dioxide (CO 2 ) capture that also provides additional electrical power generation. The project includes bench-scale testing of an 11.7 m 2 -area ECM (molten carbonate fuel cell) system for CO 2 capture, purification, and compression. technical goals * Perform contaminant effect testing to establish maximum permissible concentrations of


Bon Homme County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bon Homme County, South Dakota: Energy Resources Bon Homme County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9814835°, -97.87216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9814835,"lon":-97.87216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Small Cars In Neighborhoods  

E-Print Network (OSTI)

Sperling, quoted in Electric Car Goals Called Feasible,automobile- like electric cars; a much longer and morethose eligible to own electric cars. Because the (eventually

Bosselmann, Peter C.; Cullinane, Daniel; Garrison, William L.; Maxey, Carl M.




Science Journals Connector (OSTI)

STREET CARS IN GLASGOW 10.1126/science.12.300.491-a STREET CARS IN GLASGOW. | Journal Article...ocelots, orang-outangs, panthers, raccoons, rhinoceroses...delivery of the property. STREET CARS IN GLASGOW. THE street car...




E-Print Network (OSTI)

are therefore embedding such mechanisms into our autonomous electric car developed at INRIA (CyCab). NEMO

Boyer, Edmond


Find and Compare Cars  

NLE Websites -- All DOE Office Websites (Extended Search)

You are here: Find a Car - Home You are here: Find a Car - Home Find and Compare Cars Browse by Model Go Need help choosing a car? woman shopping for car Search by MPG, price, make, body style, and much more with our Power Search Search by Class 2015 2014 2013 2012 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000 1999 1998 1997 1996 1995 1994 Small Cars Family Sedans Upscale Sedans Luxury Sedans Large Sedans Hatchbacks Coupes Convertibles Sports/Sporty Cars Station Wagons Pickup Trucks Sport Utility Vehicles Minivans Vans Combined MPG >= 45 40 35 30 25 20 15 10 Go Browse New Cars sedan Small Cars sedan Sedans coupe Coupes hatchback Hatchbacks sporty car Sporty Cars luxury car Luxury Cars station wagon Wagons minivan Minivans truck Trucks SUV SUVs hybrid Hybrid Vehicles diesel Diesel Vehicles flex-fuel vehicle


Bon Homme Yankton El Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Yankton El Assn, Inc Yankton El Assn, Inc Jump to: navigation, search Name Bon Homme Yankton El Assn, Inc Place South Dakota Utility Id 1898 Utility Location Yes Ownership C NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Coincidental Peak Billing Industrial Demand & Energy Billing 75-350 kva Commercial Farm Single-Phase Residential Interruptible Commercial Irrigation Single-Phase Uncontrolled Industrial Irrigation, Off Season Industrial Irrigation, Single-Phase Controlled Industrial Irrigation, Single-Phase Controlled Pivot Energy Only Commercial


Hybrid Cars Now, Fuel Cell Cars Later  

Science Journals Connector (OSTI)

...Cars Now, Fuel Cell Cars...manufacturer of diesel engines) and an advisor...Power, a fuel cell manufacturer...2). This consumption resulted in...vehicles and fuel cell (FC...combustion engine (ICE) drive...gasoline, or diesel). For each...

Nurettin Demirdven; John Deutch



Appendix B: CArBon dioxide CApture teChnology SheetS R&D CollaboRations  

NLE Websites -- All DOE Office Websites (Extended Search)

R&D CollaboRations R&D CollaboRations B-556 R&D CollaboRations U.s. DepaRtment of eneRgy aDvanCeD CaRbon DioxiDe CaptURe R&D pRogRam: teChnology UpDate, may 2013 paRtneRship foR Co 2 CaptURe primary project goals The University of North Dakota Energy and Environmental Research Center (UNDEERC) is conducting pilot-scale testing to demonstrate and evaluate a range of carbon dioxide (CO 2 ) capture technologies to develop key technical and economic information that can be used to examine the feasibility of capture technologies as a function of fuel type and system configuration. technical goals * Integrate a high-efficiency flexible capture system with existing pilot-scale combustion


Appendix B: CArBon dioxide CApture teChnology SheetS Oxy-COmbustiOn  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-COmbustiOn Oxy-COmbustiOn B-424 Oxy-COmbustiOn u.s. Department Of energy aDvanCeD CarbOn DiOxiDe Capture r&D prOgram: teChnOlOgy upDate, may 2013 Oxygen transpOrt membranes fOr inDustrial appliCatiOns primary project goals Praxair is optimizing oxygen transport membrane (OTM) performance, materials, and process configurations leading to subsequent development-scale testing of OTM technology for synthesis gas (syngas) production applications, providing valuable experience needed to develop commercial OTM technology in industrial applications and future utility-scale


Appendix B: CArBon dioxide CApture teChnology SheetS Oxygen PrOductiOn  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxygen PrOductiOn Oxygen PrOductiOn B-500 Oxygen PrOductiOn u.S. dePartment Of energy advanced carbOn diOxide caPture r&d PrOgram: technOlOgy uPdate, may 2013 itm Oxygen technOlOgy fOr integratiOn in igcc and Other advanced POwer generatiOn SyStemS primary project goals Air Products and Chemicals set out to design and develop an ion transport membrane (ITM) based on ceramics that selectively transport oxygen (O 2 ) ions when operated at high temperature. This high-temperature process may be integrated with advanced power genera- tion processes that require O 2 as a feedstock, such as integrated gasification combined cycle (IGCC) and other clean energy and industrial applications. technical goals * Design, construct, and operate a 0.1-ton/day (TPD) technology development unit


Hybrid Cars Now, Fuel Cell Cars Later  

Science Journals Connector (OSTI)

...currently under consideration by Congress, would extend the time period for the hybrid car tax credit. 19 Quote taken from www.eere.energy.gov/vehiclesandfuels/. 20 T. Markel et al., J. Power Sources 110 , 225 ( 2002 ). 21 M. R. Cuddy , K. G...

Nurettin Demirdven; John Deutch



Hydrogen Cars and Water Vapor  

E-Print Network (OSTI)

. This cycle is currently under way with hydrogen fuel cells. As fuel cell cars are suggested as a solutionHydrogen Cars and Water Vapor D.W.KEITHANDA.E.FARRELL'S POLICY FORUM "Rethinking hydrogen cars" (18 misidentified as "zero-emissions vehicles." Fuel cell vehicles emit water vapor. A global fleet could have

Colorado at Boulder, University of

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Part Deux Part Deux Painless Physics Articles BEAM COOLING August 2, 1996 By Leila Belkora, Office of Public Affairs ACCELERATION August 16, 1996 By Dave Finley, Accelerator Division Head RF August 30, 1996 By Pat Colestock, Accelerator Division FIXED TARGET PHYSICS September 20, 1996 By Peter H. Garbincius, Physics Section FIXED TARGET PHYSICS PART DEUX October 16, 1996 By Peter H. Garbincius, Physics Section and Leila Belkora, Office of Public Affaris CROSS SECTION November 1, 1996 By Doreen Wackeroth, Theoretical Physics Edited by Leila Belkora, Office of Public Affaris MAGNETS PART I November 15, 1996 By Hank Glass, Technical Support Section Edited by Donald Sena, Office of Public Affairs MAGNETS PART II January 10, 1997 By Hank Glass, Technical Support Section Edited by Donald Sena, Office of Public Affairs


EcoCAR Challenge 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia Tech Wins EcoCAR Competition With an Extended-Range Electric Vehicle, The Ohio State University and the University of Waterloo Finish Second and Third Virginia Tech Wins EcoCAR Competition With an Extended-Range Electric Vehicle, The Ohio State University and the University of Waterloo Finish Second and Third EcoCAR logo VirginiaTech EcoCAR winner EcoCAR Winner Virginia Tech. View larger image. Students from Virginia Tech University learned last night that their teamwork, perseverance and hard work have led to top honors when they were named the overall winners of EcoCAR: The NeXt Challenge after designing and building an exceptional extended-range electric vehicle (EREV) using E85 (ethanol). Throughout the three-year competition, the Virginia Tech team hit incremental goals that helped the vehicle achieve fuel efficiency of 81.9 miles per gallon gasoline equivalent, or 70 percent over the stock vehicle,


Microsoft PowerPoint - UTSRWorkshop-Oct2010-Bons.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS FOR DEPOSITION RESISTANCE WITH 1400C COMBUSTOR EXIT TEMPERATURES AND SYNGAS WATER VAPOR LEVELS Ch i S ith B tt B k P h th Sh k Chris Smith, Brett Barker, Prashanth Shankaran Josh Webb, Brian Casaday Dr. Ali Ameri, Dr. Jeffrey Bons "THE" OHIO STATE UNIVERSITY THE OHIO STATE UNIVERSITY Robert Laycock, Dr. Thomas Fletcher "THE" BRIGHAM YOUNG UNIVERSITY "THE" BRIGHAM YOUNG UNIVERSITY (3-year grant awarded Oct 2009) 1 MOTIVATION/NEED * Operational Issues -Fuel flexibility (range of feedstock heat release) y ( g ) -Diluent use (e.g. steam) -Filtration requirements * Technical Challenges - Higher firing temperature I d h t t f ( t dil t) - Increased heat transfer (steam diluent) - Potential for increased levels of airborne contaminants


Electric car may not compete  

Science Journals Connector (OSTI)

Electric car may not compete ... The electric car could find a niche in urban utility driving, but it may never be fully competitive with the internal combustion auto, according to Richard S. Morse, lecturer at the Sloan School of Management at Massachu. ...



Environmentail Iplications of Electric Cars  

Science Journals Connector (OSTI)

...Battery lead per life-cycle kilometer (g/km) 27 4 Lead releases per life-cycle kilometer Virgin production...the battery. The Life Cycle of Lead: Environmental...lead retained in the engine and exhaust of the car...current cars. The more fundamental problem is that these...

Lester B. Lave; Chris T. Hendrickson; Francis Clay McMichael



Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

University o f An early alternative to an electric car.CALIFORNIA: THE DETROIT O F ELECTRIC CARS? BY A L L E N J .center for producing electric cars? It's a mistake to assume

Scott, Allen J.



Issue 5: High Interest in Hybrid Cars  

E-Print Network (OSTI)

Survey of Oregon Hybrid Gas-Electric Car Owners. July. U.S.of a qualifying gas-electric car, but because this is a

Ong, Paul M.; Haselhoff, Kim



Car Charging Group Inc | Open Energy Information  

Open Energy Info (EERE)

Car Charging Group, Inc. Place: Miami Beach, Florida Product: Miami Beach, USA based installer of plug-in vehicle charge equipment. References: Car Charging Group, Inc.1 This...


How the car became king  

Science Journals Connector (OSTI)

... they avenues for movement? And what kind of movement was to be allowed there pedestrian passage or vehicular transport in the form of trams or cars? Norton considers the ... the time: efficiency. Congestion in the streets grew because of the chaotic interference of pedestrians with traffic. Free access to the streets, without rules, slowed transportation between business ...

Marcial Echenique



Skidding of Cars and Quadratic Formulae  

Science Journals Connector (OSTI)

......proportional to its kinetic energy. Alternatively, this...this in turn stops the car. However, we are interested...about double that for cars. It may be advisable...creating a suitable gap. An alternative would be to slow down...saw how the speed of a car should be used to determine......




Making Car Sharing and Car Clubs Work: Case Study Summaries | Open Energy  

Open Energy Info (EERE)

Making Car Sharing and Car Clubs Work: Case Study Summaries Making Car Sharing and Car Clubs Work: Case Study Summaries Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Making Car Sharing and Car Clubs Work: Case Study Summaries Agency/Company /Organization: United Kingdom Department for Transport Focus Area: Other Topics: Best Practices Website: webarchive.nationalarchives.gov.uk/+/http://www.dft.gov.uk/pgr/sustain These case studies result from a study that examined best practices in car sharing and car clubs and appraised the successes and failures to date. The results of this study are incorporated into "Making Car Sharing and Car Clubs Work: Good Practice Guide." How to Use This Tool This tool is most helpful when using these strategies: Avoid - Cut the need for travel Shift - Change to low-carbon modes


Making Car Sharing and Car Clubs Work: Final Report | Open Energy  

Open Energy Info (EERE)

Making Car Sharing and Car Clubs Work: Final Report Making Car Sharing and Car Clubs Work: Final Report Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Making Car Sharing and Car Clubs Work: Final Report Agency/Company /Organization: United Kingdom Department for Transport Focus Area: Other Topics: Best Practices Website: webarchive.nationalarchives.gov.uk/+/http://www.dft.gov.uk/pgr/sustain This report seeks to examine best practices in car sharing and car clubs, explore in detail the levels of uptake, and critically appraise the successes and failures to date. The outcome of the study is supported by case study summaries, and a best practice guidance note for existing and future developers of car sharing and car club schemes. How to Use This Tool This tool is most helpful when using these strategies:


US motor giants fail to quell enthusiasm for electric cars  

Science Journals Connector (OSTI)

... regulation that will require all car companies operating in the state to develop and sell electric cars by 1998.

Colin Macilwain



Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells  

SciTech Connect

Carcinoid tumors are rare neuroendocrine tumors with a predilection for the gastrointestinal tract. Protein kinase D (PKD), a novel serine/threonine protein kinase, has been implicated in the regulation of transport processes in certain cell types. We have reported an important role for PKD in stimulated peptide secretion from a human (BON) carcinoid cell line; however, the role of PKD isoforms, including PKD2, in the proliferation and invasion of carcinoid tumors remains unclear. In the present study, we found that overexpression of PKD2 by stable transfection of BON cells with PKD2-wild type (PKD2{sub WT}) significantly increased proliferation and invasion compared to cells transfected with PKD2-kinase dead (PKD2{sub KD}) or pcDNA3 (control). Similarly, inhibition of PKD2 activity with small interfering RNA (siRNA) significantly decreased proliferation and invasion compared to cells transfected with non-targeting control (NTC) siRNA. These data support an important role for PKD2 in carcinoid tumor progression. Targeted inhibition of the PKD family may prove to be a novel treatment option for patients with carcinoid tumors.

Jackson, Lindsey N. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Li Jing [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States); Chen, L. Andy [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Townsend, Courtney M. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Evers, B. Mark [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States) and Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: mevers@utmb.edu



Logistics implications of electric car manufacturing  

Science Journals Connector (OSTI)

The increasingly important role of electric cars manufacturing needs to develop new logistics concepts in automotive industry. This article analyses critical issues in logistics operations of electric cars based on the in-house perspective of the car manufacturer. The purpose of this paper is two-fold. Firstly, to verify existing research about the impact of electric car manufacturing on logistics operations. Secondly, to investigate concrete logistics implications based on different electric car operations models. Therefore, we use manufacturing phenotypes, which can be applied to separate and classify configuration and coordination principles and helps to reach a better understanding of relationships with their logistics implications. The presented model is based on real case study data of global auto industry and supports the academic study of cross-site comparisons. A holistic and consistent understanding of different operations types in electric car manufacturing will be necessary, which will help in evaluating the actual and future supply chain forms in the car industry.

Florian Klug



Positive and negative spillover effects from electric car purchase to car use  

Science Journals Connector (OSTI)

This study reports the results of two online surveys conducted on buyers of conventional combustion engine cars compared to those of electric vehicles in Norway. The results show that electric cars are generally purchased as additional cars, do not contribute to a decrease in annual mileage if the old car is not substituted, and that electric car buyers use the car more often for their everyday mobility. Psychological determinants derived from the theory of planned behavior and the norm-activation theory show a high correlation between the purchase and use stages. Electric car buyers, have lower scores on many determinants of car use, especially awareness of consequences and close determinants of car use.

Christian Andreas Klckner; Alim Nayum; Mehmet Mehmetoglu



Emissions Control Failures in Passenger Cars  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Emissions Control Failures in Passenger Cars Two measures of car model malfunction probability, fraction of cars over 1% CO (y-axis) and average CO concentration of all cars (x-axis), demonstrate that five 1987-89 car models (14 year-model combinations) have a malfunction probability several times that of all other models. When an automobile's emissions control system fails, it may be because that model is more prone to failure than others, according to a study conducted by the Center's Energy Analysis Program and Marc Ross of the University of Michigan. This finding goes against the conventional wisdom that improper maintenance or deliberate disabling of the emissions systems by car owners is the cause of "high-emitting" vehicles. The results may provide clean-air


2014 Best and Worst MPG Cars  

NLE Websites -- All DOE Office Websites (Extended Search)

Cars Cars 2014 Most Efficient Cars by EPA Size Class (including Electric Drive Vehicles) 2014 Most Efficient Cars by EPA Size Class (excluding Electric Drive Vehicles) 2014 Least Efficient Cars by EPA Size Class 2014 Most Fuel Efficient Cars (including electric vehicles) EPA Class Vehicle Description Fuel Economy Combined Two-Seaters smart fortwo electric drive Convertible A-1, 55kw DCPM, Electric Vehicle 107* smart fortwo electric drive coupe smart fortwo electric drive coupe A-1, 55kw DCPM, Electric Vehicle 107* Minicompacts Fiat 500e Fiat 500e A-1, 82 kW AC Induction, Electric Vehicle 116* Subcompacts Chevrolet Spark EV Chevrolet Spark EV A-1, 104 kW ACPM, Electric Vehicle< 119* Compacts Ford Focus Electric Ford Focus Electric Automatic (CVT), 107 kW AC Induction, Electric Vehicle


Making Car Sharing and Car Clubs Work: Good Practice Guide | Open Energy  

Open Energy Info (EERE)

Making Car Sharing and Car Clubs Work: Good Practice Guide Making Car Sharing and Car Clubs Work: Good Practice Guide Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Making Car Sharing and Car Clubs Work: Good Practice Guide Agency/Company /Organization: United Kingdom Department for Transport Focus Area: Other Topics: Best Practices Website: webarchive.nationalarchives.gov.uk/+/http://www.dft.gov.uk/pgr/sustain This guide is aimed at a wide variety of groups to provide help on the delivery of car sharing and car club schemes for specific organizations and communities. The guidance is supported by a detailed study report and full case study reports. This guide seeks to enhance existing guidance given in other best practice notes, particularly those related to travel plans. How to Use This Tool This tool is most helpful when using these strategies:


Faculty & Information Centres Building Car Park Key Facilities Building Car Park  

E-Print Network (OSTI)

10 ORANGE A PURPLE Navitas 2 ORANGE A ORANGE North Australian Centre for Oil and Gas 7 PINK B PURPLE7 WATER TANK 5 4 18 S Faculty & Information Centres Building Car Park Key Facilities Building Car

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fixed Offshore Wind Turbines  

Science Journals Connector (OSTI)

In this chapter, a perspective of offshore wind farms, applied concepts for fixed offshore wind turbines, and related statistics are given. One example of a large wind farm, which is successfully operating, is st...

Madjid Karimirad



Advanced Clean Cars Zero Emission Vehicle Regulation  

E-Print Network (OSTI)

Advanced Clean Cars Zero Emission Vehicle Regulation ZEV #12;Advanced Clean Cars ZEV Program 2020 2021 2022 2023 2024 2025 Current Regulation -ZEVs Current Regulation -PHEVs Projected: PHEVs 15Net ­ Blueprint Plan ­ Regional clusters, environmental and economic analysis · Clean Fuels Outlet

California at Davis, University of


European Green Cars Initiative | Open Energy Information  

Open Energy Info (EERE)

European Green Cars Initiative European Green Cars Initiative Jump to: navigation, search Tool Summary Name: European Green Cars Initiative Agency/Company /Organization: European Commission Focus Area: Governance - Planning - Decision-Making Structure Topics: Best Practices Website: www.green-cars-initiative.eu/public/ The European Green Cars Initiative is one of three Public Private Partnerships (PPP) of the European Economic Recovery Plan. The objective of the initiative is to support research and development for technologies and infrastructure needed to achieve breakthroughs in the use of renewable and non-polluting energy sources, safety, and traffic fluidity. How to Use This Tool This tool is most helpful when using these strategies: Shift - Change to low-carbon modes Improve - Enhance infrastructure & policies


R&D Partnership for the Next Cars  

E-Print Network (OSTI)

supercede batter y-electric cars and i n t rusive governmentproduction hybrid-electric car, followed in 2000 automakersthan todays f rom electric cars, especially small city

Sperling, Daniel



Local Uniqueness for the Fixed Energy Fixed Angle Inverse Problem ...  

E-Print Network (OSTI)

Abstract. We prove local uniqueness for the inverse problem in obstacle scattering at a fixed energy and fixed incident angle. We consider the inverse problem of...


Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version)  

NLE Websites -- All DOE Office Websites (Extended Search)

Cars (Text Cars (Text Alternative Version) to someone by E-mail Share Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version) on Facebook Tweet about Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version) on Twitter Bookmark Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version) on Google Bookmark Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version) on Delicious Rank Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version) on Digg Find More places to share Fuel Cell Technologies Office: Hydrogen Cars (Text Alternative Version) on AddThis.com... Publications Program Publications Technical Publications Educational Publications Newsletter Program Presentations Multimedia Conferences & Meetings


Recent Trends in Car Usage in Advanced Economies - Slower Growth...  

Open Energy Info (EERE)

Trends in Car Usage in Advanced Economies - Slower Growth Ahead? Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Recent Trends in Car Usage in Advanced Economies -...


The FreedomCAR & Vehicle Technologies Health Impacts Program...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

FreedomCAR & Vehicle Technologies Health Impacts Program - The Collaborative Lubricating Oil Study on Emissions (CLOSE) Project The FreedomCAR & Vehicle Technologies Health Impacts...


Green Racing - Where Clean Cars Finish First  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology Technology R&D Center INVENTING THE FUTURE. efficient. clean. safe. Green Racing Where Clean Cars Finish First In green racing, speed is a factor, but the overall winner is determined by a formula that also takes the car's environmental footprint into consideration. Race organizers calculated a principal component of each car's score by using Argonne's Greenhouse gas, Regulated Emissions, and Energy use in Transportation (GREET) model. Research funding provided by the U.S. Department of Energy's Vehicle Technologies Program. Did you know... Opportunity The racetrack is a proving ground that often leads to innovations in consumer vehicles. Green


Hydrogen fuel cells for cars and buses  

Science Journals Connector (OSTI)

The use of hydrogen fuel cells for cars is strongly promoted by the governments of ... . The electrochemical behaviour of the most promising fuel cell (polymer electrolyte membrane fuel cell, PEMFC) is critically...

L. J. J. Janssen




Science Journals Connector (OSTI)

A FUEL CELL IN EVERY CAR ... FUEL CELLS ARE MOVING PAST THE developmental stage and into realworld trials. ... The effort to construct the first working prototypes is giving way to improving designs and developing a hydrogen-fuel infrastructure. ...




Development of the TV Receiver for Cars  

Science Journals Connector (OSTI)

Market trends toward personal television sets can be seen with the increasing ownership of television sets and variety of personal likings. There is also a demand for car television receivers. Reception of television on a moving vehicle requires a receiving ...

1. Yashima; M. Ikenishi; T. Ikeda; A. Yamamoto



Towards the Use of Electric Cars  

Science Journals Connector (OSTI)

Holtsmark [8] questions if the electrical car policies give the intended results. He claims ... but naive notion that sufficiently large subsidies for alternative energy, whether it is wind energy, biofuels or el...

Otto Andersen



EcoCAR Challenge Profile: Virginia Tech  

ScienceCinema (OSTI)

Since childhood, Lynn Gantt has had a deep seeded passion for cars and the mechanics that drive them. The Virginia native spent his weekends rebuilding antique tractors with his dad to race at tractor pulls across the state, and now the Virginia Tech graduate student is the proud team co-leader of Virginia Tech's EcoCAR Challenge team -- the winners of the three-year long competition, as announced last night at an awards ceremony in Washington, D.C..

Gantt, Lynn



Measuring the Emissions of Passing Cars  

Science Journals Connector (OSTI)

Measuring the Emissions of Passing Cars ... Pollutants found in car exhaust are formed in a number of different ways, depending on the pollutant. ... Of the 307 vehicles with complete data sets,19 126 (41%) showed deliberate tampering, another 77 had defective or missing equipment which may not have been deliberate (such as missing air pump belts), and 261 (85%) of the vehicles failed the tailpipe test. ...

G. A. Bishop; D. H. Stedman



Modelling Electrical Car Diffusion Based on Agent Tao Zhang, 3  

E-Print Network (OSTI)

Modelling Electrical Car Diffusion Based on Agent 1 Lei Yu, ,2 Tao Zhang, 3 Siebers Peer-Ola, 4 to include things like car parking charges, price of electrical car, energy awareness and word of mouth parking rates and other incentives on the uptake of electrical cars. The goal of this case study

Aickelin, Uwe


IntelliCarTS: Intelligent Cars Transportation System Ashwin Gumaste, Rahul Singhai and Anirudh Sahoo  

E-Print Network (OSTI)

, cooperation and cost efficiency. These characteristics enable avoidance of collision between vehicles Sahoo Department of Computer Science and Engineering Indian Institute of Technology, Bombay, PowaiCarTS (Intelligent Car Transport System), a Vehicle-to-Vehicle (V2V) anti-collision mechanism that determines

Sahoo, Anirudha


Preferences for alternative fuel vehicles of company car drivers  

Science Journals Connector (OSTI)

Abstract Costs of car ownership for company cars drivers and private car owners are very different. Car use, car choice decisions and preferences for car characteristics may therefore differ substantially between these two markets. In this paper, we present results of a study on the preferences of company car drivers for alternative fuel vehicles and their characteristics, based on data from an online stated choice experiment in the Netherlands. Results show that, assuming current car characteristics, preferences for alternative fuel vehicles, and for electric and fuel cell cars in particular, are substantially lower than those for the conventional technology. Limited driving ranges, long recharge/refuelling times and limited availability of refuelling opportunities, are to a large extent responsible for this. Preferences for alternative fuel vehicles increase considerably with improvements on these aspects, especially for the hybrid and flexifuel car. Under the current company car tax system in the Netherlands, which favours cleaner technologies, these two car types are even preferred to the conventional technology, assuming equal catalogue prices and personal monthly cost contributions. Comparing results with those from a similar choice experiment among private car owners shows that willingness to pay patterns for AFV improvements regarding driving range, recharge and refuelling times, fuel availability and diversity in AFV supply, are considerably different for company car drivers than for private car owners. Company and private car drivers may therefore react (very) differently to future improvements in AFV technology and fuel availability. We finally show that preferences of company car drivers for fuel cell and electric cars depend to a large extent on annual mileage. Market share simulations show that potential early adopters of electric and fuel cell cars can be found among people with a relatively low annual mileage.

Mark J. Koetse; Anco Hoen



A comprehensive socio-psychological approach to car type choice  

Science Journals Connector (OSTI)

Abstract Data from a web survey, which was conducted in 2012 among 1421 owners of a new internal combustion engine car and 372 new battery electric car owners in Norway, were used to test an adapted version of the comprehensive action determination model to explain private consumers purchase of fuel-efficient cars. It was first examined whether the average fuel efficiency differs among internal combustion engine car classes. Consequently, with battery electric cars being regarded as the most fuel-efficient group, five car groups ordered by fuel efficiency were retained. The results of subsequent structural equation modelling show that intention to buy a fuel-efficient car, brand loyalty, number of cars and drivers license holders in the household, household size, and household income had significant direct effects on choosing a more fuel-efficient car. Normative processes had a mediated impact on behaviour. Implications for design and implementation of interventions are discussed.

Alim Nayum; Christian A. Klckner



The Fix Issue 9  

E-Print Network (OSTI)

or reproductions may be made without written permission of the editor. ~ ;fRectar anb %{moro.$ia ... Welcome to OU T ho liday issue of THE FIX. Yes, it's a little latc, but you 'll also notice that it's a lit tle larger than usual. Part of thc reason fOT Ihc... themes to be important in the holiday context for our characters. There's ou r Hutch, a little glum and concerned about the state of the world, with Starsky at his side full of holiday chccr and hOpe. There's a little bi t of the both of them in all o f...

Multiple Contributors


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ChemMatCARS Data Archive  

DOE Data Explorer (OSTI)

ChemMatCARS is a high-brilliance national synchrotron x-ray facility dedicated primarily to static and dynamic condensed matter chemistry and materials science. The scientific focus of the facility includes the study of surface and interfacial properties of liquids and solids as well as their bulk structure at atomic, molecular and mesoscopic length scales with high spatial and energy resolution. Experimental techniques supported by the facility include: 1) Liquid Surface X-ray Scattering; 2) Solid Surface X-ray Scattering; 3) Time-Resolved Crystallography; 4) Micro-Crystal Diffraction; 5) Small and Wide-angle X-ray Scattering. The data archive referenced here contains data for various components along the beamline within the First Optics Enclosure and is intended to be input or parameter data. See the Science Nuggets at http://cars9.uchicago.edu/chemmat/pages/nuggets.html for leads to some of the research conducted at the ChemMatCARS beamline.


The taxation of diesel cars in Belgium revisited  

Science Journals Connector (OSTI)

This paper compares the current taxation of diesel and gasoline cars in Belgium with the guidelines for optimal taxation. We find that diesel cars are still taxed much less than gasoline cars, resulting in a dominant market share for diesel cars in the car stock. If the fuel tax is the main instrument to control for externalities and generate revenues, the diesel excise should be much higher than the excise on gasoline for two reasons: diesel is more polluting than gasoline and more importantly, through the better fuel efficiency, diesel cars contribute less fiscal revenues per mile.

Inge Mayeres; Stef Proost



Use of SiBN and SiBON films prepared by plasma enhanced chemical vapor deposition from borazine as interconnection dielectrics  

SciTech Connect

Thin films of silicon boron nitride (SiBN) of typical composition Si{sub 0.09}B{sub 0.39}N{sub 0.51} and silicon boron oxynitride (SiBON) of typical composition Si{sub 0.16}B{sub 0.29}O{sub 0.41}N{sub 0.14} were prepared by plasma enhanced chemical vapor deposition and the properties of these films were evaluated with respect to their suitability as interconnection dielectrics in microelectronic fabrication. Films were deposited on 125 mm silicon substrates in a parallel-plate reactor at a substrate temperature of 400 C and a plasma power of 0.5 W/cm{sup 2}. Boron nitride, for comparison of electrical properties, was deposited from borazine (B{sub 3}N{sub 3}H{sub 6}); silicon boron nitride was deposited from borazine, disilane (Si{sub 2}H{sub 6}), and ammonia (NH{sub 3}); silicon boron oxynitride was deposited from borazine, disilane, ammonia, and nitrous oxide (N{sub 2}O). Metal-insulator-metal capacitors were fabricated and electrical measurements indicated that all three films had excellent dielectric properties with dielectric constants of 4.1, 4.7, and 3.9 for BN, SiBN, and SiBON, respectively. Tests of conformality indicated that deposition into trenches with an aspect ratio of 4:1 gave conformality greater than 70%. Silicon boron oxynitride was shown to be an excellent barrier to the diffusion of copper. A planar, single level metal-insulator structure was constructed using a SiBN/SiBON insulator with copper metallization.

Kane, W.F.; Cohen, S.A.; Hummel, J.P.; Luther, B. [IBM Research Div., Yorktown Heights, NY (United States). T.J. Watson Research Center; Beach, D.B. [Oak Ridge National Lab., TN (United States). Chemical and Analytical Sciences Div.



Optimal mixing and optimal stirring for fixed energy, fixed power or fixed palenstrophy flows  

E-Print Network (OSTI)

Optimal mixing and optimal stirring for fixed energy, fixed power or fixed palenstrophy flows-time perfect mixing with a finite energy constraint on the stirring flow. On the other hand, using techniques, University of Michigan, Ann Arbor, MI 48109 (Dated: 31 March 2012) We consider passive scalar mixing

Novikov, Alexei


Applied ecotechnological issues for recycling cars  

Science Journals Connector (OSTI)

The paper shows the need for recycling cars. Recycling operation is particularly complicated because after dismantling and split a wide range of material resulting in a proportion different and difficult to separate. There are presented two recycling ... Keywords: end-of-life-vehicle recycling, hammer mill technology, shrreder technology

Gheorghe Amza; Zoia Apostolescu; Mihaiela Iliescu; Zlatko Garac; Sanda Paise; Maria Groza



When Cars Start Gossiping Paolo Costa  

E-Print Network (OSTI)

, computers embedded in cars can rely on the vehicle's power supply and may have plenty of memory storage - Universität Stuttgart Germany Boris.Koldehofe@ipvs.uni- stuttgart.de Hugo Miranda University of Lisbon. Both academia and industry have shown an increasing in- terest in building vehicular networking systems

Musolesi, Mirco


Chemistry and the Motor Car Industry  

Science Journals Connector (OSTI)

Chemistry and the Motor Car Industry ... It so happens that this chemical reaction, the production of water and carbon dioxide (which in proper combination gives you seltzer water), is accompanied by the generation of heat which is used to produce power, and after all, power is what primarily concerns the automotive industry. ...




North Lauderdale Gets 'Smart' on Cars | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

North Lauderdale Gets 'Smart' on Cars North Lauderdale Gets 'Smart' on Cars North Lauderdale Gets 'Smart' on Cars September 10, 2010 - 1:47pm Addthis Kevin Craft What are the key facts? Two Smart Cars to save Florida city $4,800 annually Smart Cars to be used as part of night patrols of city parks City estimates will save more than $33,000 annually through Recovery Act projects The Parks and Recreation Department of North Lauderdale, Fla., is saving money and reducing its carbon footprint, thanks to the recent addition of two energy efficient "Smart Cars" to the city's fleet. The pint-sized cars, which can travel up to 40 miles on a single gallon of fuel, were purchased with funds from the U.S. Department of Energy's Energy Efficiency and Conservation Block Grant (EECBG) Program. The cars, which were purchased in Broward County, are used to perform night


Magna E-Car Opening | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Magna E-Car Opening Magna E-Car Opening Magna E-Car Opening April 27, 2012 - 4:40pm Addthis Vehicle Technologies Program Manager Patrick B. Davis gets ready to cut the ribbon at Magna E-Car's new electric drive component plant in Michigan. From left: Mike Finney - CEO, Michigan Economic Development Corporation; Gary Meyers - VP/General Manager, Magna E-Car USA, LP; Pat Davis; Kevin Pavlov - Chief Operating Officer, Magna E-Car Systems; Marilyn Hoffman, Township Supervisor, Grand Blanc Township, Michigan; Joseph Graves, State Representative 51st District, Michigan House of Representatives; Tim Herman, CEO, The Genesee County Chamber of Commerce. | Photo courtesy of Magna E-Car. Vehicle Technologies Program Manager Patrick B. Davis gets ready to cut the ribbon at Magna E-Car's new electric drive component plant in Michigan.


European Experience and Case study of SCR Passenger Car Integration...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Experience and Case study of SCR Passenger Car Integration European Experience and Case study of SCR Passenger Car Integration Presentation given at DEER 2006, August 20-24, 2006,...


Transportation & Work: Exploring Car Usage and Employment Outcomes  

E-Print Network (OSTI)

Transportation & Work: Exploring Car Usage and Employment Outcomes in the LSAL Data Field Area networks. This analysis addresses the role of car usage in employment outcomes such as employment status

Bertini, Robert L.


Lean Gasoline System Development for Fuel Efficient Small Car...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Small Car Lean Gasoline System Development for Fuel Efficient Small Car Vehicle Technologies Office Merit Review 2014: ATP-LD; Cummins Next Generation Tier 2 Bin 2 Diesel Engine...


New Mexico Electric Car Challenge: November 22 The New Mexico...  

NLE Websites -- All DOE Office Websites (Extended Search)

to view details. To close the opened accordion, click on the title(s) once again. New Mexico Electric Car Challenge: November 22 The New Mexico Electric Car Challenge (formerly...


Protection of Solar Electric Car DC Motor with PIC Controller  

Science Journals Connector (OSTI)

The electric car may represent new opportunities for any country and its electric utilities. Widespread use of electric cars can reduce ... can be accomplished to a large extent during utility off-peak hours, ele...

Ahmed M. A. Haidar; Ramdan Razali; Ahmed Abdalla



Technological Potential for CO2 Emission Reductions of Passenger Cars  

Science Journals Connector (OSTI)

Figure 17.1 shows the estimated development of energy demand from car fuel consumption between 2010 and 2050. Car fuel consumption is projected to increase until ... until 2050 in EU27. The share of alternative f...

Michael Krail; Wolfgang Schade



Are Consumers Myopic? Evidence from New and Used Car Purchases  

E-Print Network (OSTI)

We investigate whether car buyers are myopic about future fuel costs. We estimate the effect of gasoline prices on short-run equilibrium prices of cars of different fuel economies. We then compare the implied changes in ...

Busse, Meghan R


Los Alamos catalyst could jumpstart e-cars, green energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Catalyst could jumpstart e-cars, green energy Los Alamos catalyst could jumpstart e-cars, green energy The new material has the highest oxygen reduction reaction (ORR) activity in...


Explanations of FreedomCAR/DOE Hydrogen Storage Technical Targets  

Energy.gov (U.S. Department of Energy (DOE))

Summary of FreedomCAR Targets and Basis for Targets prepared for the Grand Challenge Hydrogen Storage Solicitation.


CarSpeak: a content-centric network for autonomous driving  

E-Print Network (OSTI)

This paper introduces CarSpeak, a communication system for autonomous driving. CarSpeak enables a car to query and access sensory information captured by other cars in a manner similar to how it accesses information from ...

Suresh Kumar, Swarun


CarSpeak : a content-centric network for autonomous driving  

E-Print Network (OSTI)

We introduce CarSpeak, a communication system for autonomous driving. CarSpeak enables a car to query and access sensory information captured by other cars in a manner similar to how it accesses information from its local ...

Suresh Kumar, Swarun


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Wheego Electric Cars | Open Energy Information  

Open Energy Info (EERE)

Wheego Electric Cars Wheego Electric Cars Jump to: navigation, search Name Wheego Electric Cars Place Atlanta, Georgia Zip 30318 Sector Vehicles Product Atlanta-based Wheego has designed compact full-speed electric vehicles and low-speed EVs and said it plans to complete testing by summer 2010. The company has signed a battery supply deal with Flux Power. Coordinates 33.748315°, -84.391109° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.748315,"lon":-84.391109,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cars af Tomorrow and the American Community  

NLE Websites -- All DOE Office Websites (Extended Search)

Cars of Tomorrow and the American Community High School Curriculum Created by Northeast Sustainable Energy Association (NESEA) Click on the links below to take you to the Chapter heading: Cover Page and Orientation Availability and Distribution of Alternative Fuels Health, Pollution, and Safety Operation, Maintenance, and Refueling Fuel Fact Sheets H I G H S C H O O L C U R R I C U L U M O N A L T E R N A T I V E F U E L S 50 Miles Street, Suite 3, Greenfield, MA 01301 www.nesea.org June, 2002 CARS OF TOMORROW AND THE AMERICAN COMMUNITY L E A D I N G T H E W A Y T O S U S T A I N A B L E E N E R G Y H I G H S C H O O L C U R R I C U L U M O N A L T E R N A T I V E F U E L S CARS OF TOMORROW AND THE AMERICAN COMMUNITY 50 Miles Street, Suite 3, Greenfield, MA 01301 www.nesea.org June, 2002 L E A D I N G T H E W A Y T O S U S T A I N A B L E E N E R G Y © Copyright 2001 Northeast Sustainable Energy Association


EcoCAR Challenge: Finish Line  

ScienceCinema (OSTI)

The EcoCAR Challenege is a competition that challenges participating students from across North America to re-engineer a vehicle donated by General Motors. With the goal of minimizing the vehicle's fuel consumption and emissions, while maintaining its utility, safety and performance, teams had to find the best combination of cutting-edge technologies to meet these objectives. In the final year, the vehicles ran through a series of safety and technical tests at GM's Proving Ground in Milford, Michigan very similar to those GM's own production vehicles undergo. As EcoCAR wraps up, it is only the beginning for the next chapter in the DOE's 23-year history of advanced vehicle technology competitions. In April, Assistant Secretary for Policy and International Affairs David Sandalow announced the launch of EcoCAR 2: Plugging into the Future http://www.ecocar2.org/index.html . We look forward to seeing the new and innovative designs that students bring to this challenge and know they will find a way to exceed even our highest expectations.




Studying the Performances of Induction Motor Used in Electric Car  

Science Journals Connector (OSTI)

Abstract This research includes study of the performances of induction motor used in the electric car, as well as performances of an electronic inverter based on Field Oriented control used to drive this induction motor. The running equations of IM and Controller in dynamic state with reference frame d q were considered. These equations were modelled into computer form based using Matlab Simpower facilities obtaining a complete model. 3-Phase IM is considered and its parameters were used for simulation, in order to be mounted in certain car that is manufactured in Syria, and transform it to electric car. Also, it includes a study of electronic inverter appropriate to drive such motor and control its speed. It operates based on vector control technology. The study of the motor performances was conducted within presumptions of changing car load from one passenger (the driver) to five passengers and having different resistant torques. The tests of induction motor used in the electric car simulate running of the car having one passenger when car is stopped; simulate running of electric car starting IM from 0 speed and accelerating till a steady speed is reached, keeping this steady speed for a period of time, then reduce speed till car is stopped and finely Simulate running of electric car on rural roads having some holes and small slopes which cause several small acceleration and sudden breaks. Some conclusions and remarks about performances and behaviour of IM were concluded.

Zeina Bitar; Samih Al Jabi



Fact #849: December 1, 2014 Midsize Hybrid Cars Averaged 51% Better Fuel Economy than Midsize Non-Hybrid Cars in 2014- Dataset  

Energy.gov (U.S. Department of Energy (DOE))

Excel file with dataset for Fact #849: December 1, 2014 Midsize Hybrid Cars Averaged 51% Better Fuel Economy than Midsize Non-Hybrid Cars in 2014


Bussysteme IIII CarRing II ereits heute sind 90 Prozent al-  

E-Print Network (OSTI)

Entwicklungen haben heutzutage viele namhafte Automobil- hersteller massive Qualitäts- und Leis- tungs Rahmen dieses Projekts mit der Entwicklung eines neuen Netzwerks für das Automobil beauftragt: ,,Car für Automobile, das eine sichere Verbindung zwischen allen Komponenten von ,,Steer by Wire" be

Zachmann, Gabriel


DOE and FreedomCAR and Fuel Partnership Analysis Workshop  

Energy.gov (U.S. Department of Energy (DOE))

Attendees list for the DOE and FreedomCAR and Fuel Partnership Hydrogen Delivery and On-Board Storage Analysis Workshop on January 26, 2006.


DOE and FreedomCAR and Fuel Partnership Analysis Workshop  

Energy.gov (U.S. Department of Energy (DOE))

Action items and discussion comments from the DOE and FreedomCAR and Fuel Partnership Analysis Workshop on January 25, 2006.


Help promised for troubled maker of electric car  

Science Journals Connector (OSTI)

... Elon Musk, chief executive of electric-car company Tesla Motors, has denied rumours that the company is about to go bust. ...



Panhandle Junior High takes second at National Science Bowl Car...  

National Nuclear Security Administration (NNSA)

Panhandle Junior High takes second at National Science Bowl Car Race | National Nuclear Security Administration People Mission Managing the Stockpile Preventing Proliferation...


Fact #849: December 1, 2014 Midsize Hybrid Cars Averaged 51%...  

Energy Savers (EERE)

average is the production-weighted harmonic mean. 2014 data are preliminary. Fact 849 Dataset Supporting Information Average Fuel Economy of New Midsize Cars - Hybrid vs....


Printing a Car: A Team Effort in Innovation (Text Version) |...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

video Printing a Car: A Team Effort in Innovation highlighting the demonstration of 3D printing to create a working electric vehicle, live during the International Manufacturing...


Enterprise Rent-a-Car | Staff Services  

NLE Websites -- All DOE Office Websites (Extended Search)

Enterprise Rent-a-Car Enterprise Rent-a-Car Please note: Partial day rates only apply to rentals that are being returned to BNL. They do not apply to one way rentals. There is also a $25 fee for one way rentals going to JFK/LaGuardia/Newark airports. FX0019 Official Brookhaven Business Rates include unlimited free mileage 24 Hour Daily Weekly Monthly Economy $47.00 $282.00 $1040.00 Compact $49.00 $294.00 $1078.00 Midsize $51.00 $306.00 $1126.00 Full-size $52.00 $312.00 $1144.00 Mini Vans $81.00 $486.00 $1760.00 4 x 4 $81.00 $486.00 $1760.00 Partial Day Rates Hours are 11 a.m. - 4 p.m. or 4 p.m. - 9 p.m. Compact - $35.00 Midsize - $40.00 Full-size - $45.00 FX0020 - Leisure Rates Unlimited free miles are restricted to the following destinations: New York, New Jersey, Connecticut, Delaware, Maryland, District of Columbia.


Countdown to Fixed Target INSIDE  

NLE Websites -- All DOE Office Websites (Extended Search)

17, 1996 17, 1996 Number 10 Countdown to Fixed Target INSIDE 2 University Close-Up: The University of Illinois 4 Tollestrup Elected to National Academy 5 Bardeen Receives Sakurai Prize 6 Take Your Daughters and Sons to Work Day "At this moment," Fermilab Director John Peoples told the House Subcommittee on Energy and Environment in testimony deliv- ered in Washington on May 8, "Fermilab is in the midst of the transition from collider opera- tions to fixed-target operations. In June, we will begin extracting a beam of protons from the Tevatron, the highest-energy external beam in the world. By directing this beam onto eight targets we will create eight distinct particle beams that will in turn support 10 unique experiments. Although fixed-target experi- ments cannot explore the high-energy frontier


Geometric Model of a Narrow Tilting CAR using Robotics formalism  

E-Print Network (OSTI)

- structured multibody system composed of n bodies (links) where the chassis is the mobile base and the wheels tilting car "Lumeneo Smera" [4] through the analysis of its tilting mechanism. To model a complex system. Robotic representation of a multibody system The car can be seen as a mobile robot which is a tree

Boyer, Edmond


Control system for the prototype of hydrogen powered car  

Science Journals Connector (OSTI)

The contribution describes design and construction of hydrogen powered car based on fuel cell technology and electrical DC-drive. The main focus is given to control system and human machine interface of the car. The practical solution of control system ... Keywords: control system design, fuel cells, human machine interface, hydrogen, programmable controllers

Jiri Koziorek; Zdenek Slanina



Automotive Stirling engine development for a small passenger car  

SciTech Connect

The Aisin Seiki Co., Ltd. has challenged for the development of a Stirling engine that is usable for small cars which are predominant type produced in Japan. Recently, the authors finally managed to obtain the performance from a prototype engine with which they are substantially satisfied, including the result from running tests on an actual car.

Kondoh, T.; Katoh, K.



CHEMICAL ENGINEERING Cooper Union wins Chem-E-Car competition  

Science Journals Connector (OSTI)

CHEMICAL ENGINEERING Cooper Union wins Chem-E-Car competition ... At this years event, the shoebox-sized vehicles had to transport 350 mL of water exactly 67 feet. ... The challenge was to calculate how much fuel would be needed to power the cars so that the chemical reaction would end and the vehicles would stop on the finish line. ...




EcoCAR Reaches the Finish Line | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR Reaches the Finish Line EcoCAR Reaches the Finish Line EcoCAR Reaches the Finish Line June 21, 2011 - 2:09pm Addthis The EcoCAR Challenege is a competition that challenges participating students from across North America to re-engineer a vehicle donated by General Motors. With the goal of minimizing the vehicle's fuel consumption and emissions, while maintaining its utility, safety and performance, teams had to find the best combination of cutting-edge technologies to meet these objectives. Shannon Brescher Shea Communications Manager, Clean Cities Program Last Thursday, the Library of Congress's vaunted halls were filled with undergraduate and graduate students on the edge of their seats, waiting to hear the first place winner of the EcoCAR: The NeXt Challenge competition. As Patrick Davis, Vehicle Technologies Program Manager for the Department


NREL: News Feature - Middle Schoolers Shine in Electric Car Races  

NLE Websites -- All DOE Office Websites (Extended Search)

Middle Schoolers Shine in Electric Car Races Middle Schoolers Shine in Electric Car Races May 24, 2013 In this photo, a boy grins widely as he holds a yellow folder over his model solar car. In the background are several black neoprene tracks and other middle-school students awaiting the starting signal. An adult race judge holds her hand in the air, signaling that everything is ready for the start of the race. Enlarge image Xavier Urquijo from Summit Ridge Middle School in Littleton waits for the start signal to lift the folder covering the solar panel on his team's car, "Knight Hawk." His team was one of 97 from 28 Colorado middle schools racing solar and lithium-ion powered vehicles they designed and built themselves at NREL's 2013 Junior Solar Sprint and Lithium-Ion Battery car competitions on May 18.

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EcoCar Drives Students to Innovate | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCar Drives Students to Innovate EcoCar Drives Students to Innovate EcoCar Drives Students to Innovate October 26, 2010 - 5:21pm Addthis EcoCar Drives Students to Innovate Shannon Brescher Shea Communications Manager, Clean Cities Program Last year, Americans used about 138 billion gallons of gasoline - mostly imported - for transportation, costing Americans about $300 billion. The Department of Energy, through the Recovery Act, is investing in more fuel-efficient battery and electric vehicles to reduce these costs and training a strong, talented workforce to develop these cleaner, more sustainable technologies. Recognizing the importance of engaging students in this endeavor, the Department of Energy and General Motors (GM) established the EcoCar Challenge - a three-year Advanced Vehicle


Could TEG Improve Your Car's Efficiency? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Could TEG Improve Your Car's Efficiency? Could TEG Improve Your Car's Efficiency? Could TEG Improve Your Car's Efficiency? August 16, 2010 - 10:00am Addthis This image shows how a thermoelectric generator would be placed in a passenger car. | Photo courtesy of BMW This image shows how a thermoelectric generator would be placed in a passenger car. | Photo courtesy of BMW Lorelei Laird Writer, Energy Empowers What are the key facts? A Thermoelectric Generator (TEG) recaptures lost vehicle heat for better efficiency. This project is funded in part with $7.15 million federal Vehicle Technologies Program grant. This is targeted for the U.S. market in 2018 models. More than half of the gas we buy -- and the money we spend on it -- is wasted. Even the most efficient drivers are at the mercy of their vehicles'


Could TEG Improve Your Car's Efficiency? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Could TEG Improve Your Car's Efficiency? Could TEG Improve Your Car's Efficiency? Could TEG Improve Your Car's Efficiency? August 16, 2010 - 10:00am Addthis This image shows how a thermoelectric generator would be placed in a passenger car. | Photo courtesy of BMW This image shows how a thermoelectric generator would be placed in a passenger car. | Photo courtesy of BMW Lorelei Laird Writer, Energy Empowers What are the key facts? A Thermoelectric Generator (TEG) recaptures lost vehicle heat for better efficiency. This project is funded in part with $7.15 million federal Vehicle Technologies Program grant. This is targeted for the U.S. market in 2018 models. More than half of the gas we buy -- and the money we spend on it -- is wasted. Even the most efficient drivers are at the mercy of their vehicles'


A review of the NRL CARS microscope  

Science Journals Connector (OSTI)

This paper describes a technique that permits molecular specificity in microscopy while retaining good spatial resolution. Specificity is achieved using Raman scattering from characteristic molecular vibrations and high resolution is obtained by imaging the distribution of visible anti?Stokes radiation. Images have been obtained from a variety of pure organic liquids from deuterated water in onion?skin cells deuterated liposomes and other samples. Thermal and dielectric breakdown damage to even fragile biological materials is made negligible by choice of duty cycle and average power. Sample fluorescence is avoided by the choice of anti?Stokes imaging. Imaging through (usually astigmatic) spectrometers is not needed. Deuterium substitution can be used as a general purpose and artifact?free stain. The combination of high spatial resolution excellent molecular discrimination and digital image processing (background subtraction) provide the CARS microscope with capabilities not found in any other current microscopic imaging technique.

M. D. Duncan; J. Reintjes; T. J. Manuccia



FreedomCAR Capacitor Test Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

ID-11173 ID-11173 Revision 0 September 21, 2004 FreedomCAR Ultracapacitor Test Manual Disclaimer This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. References herein to any specific commercial product, process or service by trade name, trademark, manufacturer, or otherwise does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views


Fact #752: November 5, 2012 Western Europe Plug-in Car Sales...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

chart). France accounted for 22.3% of Western European plug-in car sales, followed by Germany at 17.3%. Plug-in Car Market Share, 2012* (Plug-in Sales as a Share of Total Car...


Solving the Car-Sequencing Problem as a Non-binary CSP  

Science Journals Connector (OSTI)

The car-sequencing problem arises from the manufacture of cars on an assembly line. A number of cars are to be made on a production line; they are not identical because different options are available as variants...

Mihaela Butaru; Zineb Habbas




E-Print Network (OSTI)

and transit linkages. Car sharing offers an alternative to satisfying the demand for individual mobil- ity1 CAR SHARING AND MOBILITY MANAGEMENT: FACING NEW CHALLENGES WITH TECHNOLOGY AND INNOVATIVE BUSINESS PLANNING Conrad Wagner, Consulting Manager Strategy & Development at Mobility Car

Kammen, Daniel M.


Fuel Economy Sticker Revs Up Used Car Sales | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Sticker Revs Up Used Car Sales Fuel Economy Sticker Revs Up Used Car Sales May 1, 2014 - 2:29pm Addthis FuelEconomy.govs newest tool -- the Used Car Fuel Economy Label --...


Comparison of detection threshold measurements and modeling for approaching electric cars and conventional cars presented in traffic and pink noise  

Science Journals Connector (OSTI)

This study investigates the difference in audibility of an approaching conventional car with internal combustion engine and an electric car at various velocities. The goal was to compare the risk that pedestrians do not hear the approaching car in time. Binaural recordings of each of these approaching cars were presented together with either a traffic noise masker or a pink noise masker. In the first detection experiment the threshold level was determined for which the cars could just be detected. In a second reaction time experiment the moment was determined at which the approaching car was first detectable. This measured reaction time should give an indication about how much time a person has to evade an impending collision. Results indicated that slowly approaching electric cars where less audible than cars with a conventional engine. The results also showed that the decrement of reaction times as a function of SNR was halved when pink noise was used instead of traffic noise. A psycho-acoustic masking model [Dau et al. J. Acoust. Soc. Am. 99 36153622 (1996)] was applied to predict detection thresholds and showed good correspondence with the subjective data.



Comparison of detection threshold measurements and modeling for approaching electric cars and conventional cars presented in traffic and pink noise  

Science Journals Connector (OSTI)

This study investigates the difference in audibility of an approaching conventional car with internal combustion engine and an electric car at various velocities. The goal was to compare the risk that pedestrians do not hear the approaching car in time. Binaural recordings of each of these approaching cars were presented together with either a traffic noise masker or a pink noise masker. In the first detection experiment the threshold level was determined for which the cars could just be detected. In a second reaction time experiment the moment was determined at which the approaching car was first detectable. This measured reaction time should give an indication about how much time a person has to evade an impending collision. Results indicated that slowly approaching electric cars where less audible than cars with a conventional engine. The results also showed that the decrement of reaction times as a function of SNR was halved when pink noise was used instead of traffic noise. A psycho-acoustic masking model [Dau et. al. (1996) J. Acoust. Soc. Am. 99 3615 - 3622] was applied to predict detection thresholds and showed good correspondence with the subjective data.

Julian Grosse; Reinhard Weber; Steven Van de Par



Used Oil, Antifreeze, and Car Battery Recycling in Centre County* Location Used Oil Used Antifreeze Car Batteries  

E-Print Network (OSTI)

Used Oil, Antifreeze, and Car Battery Recycling in Centre County* Location Used Oil Used Antifreeze) 237-0121 Yes No No #12;Location Used Oil Used Antifreeze Car Batteries Valvoline Instant Oil Change-9929 Yes Yes Yes * See the DEP website, www.dep.state.pa.us/cgi_apps/oil, for used oil recycling locations

Maroncelli, Mark


Fixed Parameter Algorithms Daniel Marx  

E-Print Network (OSTI)

, for example k-CLIQUE and k-INDEPENDENT SET, no FPT algorithm is known. Can we show that these problems if and only if it has a vertex cover of size n - k. Transforming an INDEPENDENT SET instance (G, k, but INDEPENDENT SET is not known to be FPT. Fixed Parameter Algorithms ­ p.5/41 #12;Parameterized reduction

Fondements et Applications, Université Paris 7


Fixed Parameter Algorithms Dniel Marx  

E-Print Network (OSTI)

complexity Problem: VERTEX COVER INDEPENDENT SET Input: Graph G, integer k Graph G, integer k Question-complete NP-complete Fixed Parameter Algorithms ­ p.3/40 #12;Parameterized complexity Problem: VERTEX COVER INDEPENDENT SET Input: Graph G, integer k Graph G, integer k Question: Is it possible to cover the edges

Narasayya, Vivek


Global energy consumption due to friction in passenger cars  

Science Journals Connector (OSTI)

This study presents calculations on the global fuel energy consumption used to overcome friction in passenger cars in terms of friction in the engine, transmission, tires, and brakes. Friction in tribocontacts was estimated according to prevailing contact mechanisms such as elastohydrodynamic, hydrodynamic, mixed, and boundary lubrication. Coefficients of friction in the tribocontacts were estimated based on available information in the literature on the average passenger car in use today, a car with todays advanced commercial tribological technology, a car with todays best advanced technology based upon recent research and development, and a car with the best technology forecasted in the next 10 years. The following conclusions were reached: In passenger cars, one-third of the fuel energy is used to overcome friction in the engine, transmission, tires, and brakes. The direct frictional losses, with braking friction excluded, are 28% of the fuel energy. In total, 21.5% of the fuel energy is used to move the car. Worldwide, 208,000 million liters of fuel (gasoline and diesel) was used in 2009 to overcome friction in passenger cars. This equals 360 million tonne oil equivalent per year (Mtoe/a) or 7.3millionTJ/a. Reductions in frictional losses will lead to a threefold improvement in fuel economy as it will reduce both the exhaust and cooling losses also at the same ratio. Globally, one passenger car uses on average of 340l of fuel per year to overcome friction, which would cost 510 euros according to the average European gas price in 2011 and corresponds to an average driving distance of 13,000km/a. By taking advantage of new technology for friction reduction in passenger cars, friction losses could be reduced by 18% in the short term (510 years) and by 61% in the long term (1525 years). This would equal worldwide economic savings of 174,000 million euros and 576,000 million euros, respectively; fuel savings of 117,000 million and 385,000 million liters, respectively; and CO2 emission reduction of 290 million and 960 million tonnes, respectively. The friction-related energy losses in an electric car are estimated to be only about half those of an internal combustion passenger car. Potential actions to reduce friction in passenger cars include the use of advanced coatings and surface texturing technology on engine and transmission components, new low-viscosity and low-shear lubricants and additives, and tire designs that reduce rolling friction.

Kenneth Holmberg; Peter Andersson; Ali Erdemir



History of the FreedomCAR Environmental Science and Health Impacts...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

History of the FreedomCAR Environmental Science and Health Impacts Activity History of the FreedomCAR Environmental Science and Health Impacts Activity 2004 Diesel Engine Emissions...


E-Print Network 3.0 - aluminum cars Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Sample search results for: aluminum cars Page: << < 1 2 3 4 5 > >> 1 ORNLTM-1999157 ENERGY DIVISION Summary: aluminum content in passenger cars. General Motors is increasing...


Modeling and Simulation of Series DC Motors in Electric Car  

Science Journals Connector (OSTI)

Abstract The objective of this paper is assessing use of series DC motor in electric car with its rotation speed controller, and evaluating its performances when different running cases of electric car with different loads. The mathematical equations model of series DC motor and electronic inverter in dynamic state with reference frame d q were considered. Computer model of these equations was implemented using MATLAB/SIMPOWER facilities obtaining a complete model for motor and controller. Series DC motor is considered and its parameters were used for simulation. The electronic controller operates based on PWM control technique. Simulation of series DC motor performances was conducted within presumptions of changing car load and different resistant torques. Changing loads was realised changing number of passengers when electric car is running on normal streets, when running on streets with slope, when car is accelerate to reach a stead speed and when car is changing speed rigidly and suddenly running on country road having some holes and small slopes. Some conclusions and remarks about performances and behaviour of series DC motor were concluded. The simulated series DC motor was tested and mounted experimentally in a small truck car in Faculty of Mechanical & Electrical Engineering at Damascus University.

Zeina Bitar; Samih Al Jabi; Imad Khamis



Modelling future private car energy demand in Ireland  

Science Journals Connector (OSTI)

Targeted measures influencing vehicle technology are increasingly a tool of energy policy makers within the EU as a means of meeting energy efficiency, renewable energy, climate change and energy security goals. This paper develops the modelling capacity for analysing and evaluating such legislation, with a focus on private car energy demand. We populate a baseline car stock and car activity model for Ireland to 2025 using historical car stock data. The model takes account of the lifetime survival profile of different car types, the trends in vehicle activity over the fleet and the fuel price and income elasticities of new car sales and total fleet activity. The impacts of many policy alternatives may only be simulated by such a bottom-up approach, which can aid policy development and evaluation. The level of detail achieved provides specific insights into the technological drivers of energy consumption, thus aiding planning for meeting climate targets. This paper focuses on the methodology and baseline scenario. Baseline results for Ireland forecast a decline in private car energy demand growth (0.2%, compared with 4% in the period 20002008), caused by the relative growth in fleet efficiency compared with activity.

Hannah E. Daly; Brian P. Gallachir



A rental car strategy for commercialization of hydrogen in Florida  

Science Journals Connector (OSTI)

This article proposes a hydrogen rental-car strategy for transitioning from fleets to consumers in Orlando, Florida. Orlando is the No. 1 tourist destination in the United States, but most car renters visit only a few destinations. A hydrogen rental-car fleet serving this cluster of destinations could provide visitors with a positive first exposure to hydrogen vehicles with minimal commitment, creating hydrogen advocates and potential early adopters in their home regions. The rental-car business combines the logistical advantages of a fleet operation with outreach to many consumers. A hydrogen-powered rental-car fleet at the Orlando International Airport could provide guaranteed demand, supporting an initial rollout of refueling stations. We surveyed 435 rental-car customers in Orlando to understand the idea from the consumer point of view. We analyzed the bundles of destinations visited by the respondents and found that only three stationsan existing station at the Orlando International Airport plus new stations near the theme parks and in downtown Orlandocould serve 64% of renters. Half of all respondents indicated a willingness to pay more to rent a hydrogen car, and this subset of customers ranked the ability to use a pollution-free car as the most important factor in their decision. We then identify the major barriers to a hydrogen rental-car business model from the corporate point of view and propose a number of potential solutions. The most significant barrier appears to be the fleet purchase costs, which we think can be offset by the benefits of free media coverage and contained by beginning with converted internal-combustion vehicles and converting eventually to fuel-cell vehicles. We also outline possible synergies with NASA, Disney, refueling stations, manufacturers and state government.

Lee Lines; Michael Kuby; Ronald Schultz; James Clancy; Zhixiao Xie


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Students Earn Street Cred With the EcoCAR Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Students Earn Street Cred With the EcoCAR Challenge Students Earn Street Cred With the EcoCAR Challenge Students Earn Street Cred With the EcoCAR Challenge Addthis EcoCAR Challenge Finish Line Event 1 of 8 1 of 8 EcoCAR Challenge Finish Line Event 1 of 8 US Department of Energy Secretary Steven Chu talks shop with members of the West Virginia EcoCAR team. Image: Energy Department Image | Photo by Charles Watkins, Contractor EcoCAR Challenge Finish Line Event2 of 8 2 of 8 EcoCAR Challenge Finish Line Event2 of 8 Secretary Steven Chu discusses the EcoCAR Challenge during the 'Finish Line' event held at the US Department of Energy headquarters in Washington, DC. Image: Energy Department Image | Photo by Charles Watkins, Contractor EcoCAR Challenge Finish Line Event 3 of 8 3 of 8 EcoCAR Challenge Finish Line Event 3 of 8


Tips for Planning, Building, and Testing a Model Car  

NLE Websites -- All DOE Office Websites (Extended Search)

Tips for Planning, Building, and Testing Your Lithium- Ion Battery Powered Car CONTENTS:  Teacher Overview  What Teachers Can Do To Help  Student Design Plan  Brainstorming  Materials  Chassis Design  Transmission  Gear Ratio  Wheels and Bearings  Battery  Testing  Trouble Shooting TEACHER OVERVIEW  The Lithium-ion battery powered car competition is designed to be an engineering challenge for middle school students.  Students will be exploring the following concepts while planning, building and testing their cars:  Alternative energy sources  Engineering design  Aerodynamics  Force and motion  Teamwork  Problem solving  Teams who do not have a completed car at the


EcoCAR Challenge: Finish Line | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR Challenge: Finish Line EcoCAR Challenge: Finish Line EcoCAR Challenge: Finish Line Addthis Description The EcoCAR Challenege is a competition that challenges participating students from across North America to re-engineer a vehicle donated by General Motors. With the goal of minimizing the vehicle's fuel consumption and emissions, while maintaining its utility, safety and performance, teams had to find the best combination of cutting-edge technologies to meet these objectives. Speakers Secretary Steven Chu; MIchael Bly, Lynn Gnatt, Carlos Cubero-Ponce, Ryan Melsert, Eric Schacht, Andrew Eldridge, Duration 4:23 Topic Alternative Fuel Vehicles Fuel Economy Batteries Hydrogen & Fuel Cells Credit Energy Department Video (Music.) LYNN GANTT (Virginia Tech): There are 16 universities that compete in the


Virginia Tech Wins EcoCAR Competition | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Virginia Tech Wins EcoCAR Competition Virginia Tech Wins EcoCAR Competition Virginia Tech Wins EcoCAR Competition June 17, 2011 - 12:00am Addthis Washington, D.C. - On Thursday evening a team of students from Virginia Tech University learned they received top honors when they were named the overall winners of EcoCAR: The NeXt Challenge after designing and building an extended-range electric vehicle (EREV) using E85 (ethanol). Virginia Tech competed against 15 other universities to take home the top prize of the three-year competition sponsored by the Department of Energy and General Motors. This unique competition helps train students and engineers to become the next generation of workers the U.S. needs to lead the global auto industry. "The ingenuity and dedication shown by the students of Virginia Tech in


Students race lithium ion battery powered cars in Pantex competition |  

NLE Websites -- All DOE Office Websites (Extended Search)

race lithium ion battery powered cars in Pantex competition | race lithium ion battery powered cars in Pantex competition | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Students race lithium ion battery powered cars ... Students race lithium ion battery powered cars in Pantex competition Posted By Greg Cunningham, Pantex Public Affairs


EcoCAR Challenge Profile: Virginia Tech | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Challenge Profile: Virginia Tech Challenge Profile: Virginia Tech EcoCAR Challenge Profile: Virginia Tech Addthis Description Since childhood, Lynn Gantt has had a deep seeded passion for cars and the mechanics that drive them. The Virginia native spent his weekends rebuilding antique tractors with his dad to race at tractor pulls across the state, and now the Virginia Tech graduate student is the proud team co-leader of Virginia Tech's EcoCAR Challenge team -- the winners of the three-year long competition, as announced last night at an awards ceremony in Washington, D.C.. Speakers Lynn Gantt Duration 1:43 Topic Alternative Fuel Vehicles Fuel Economy Batteries Consumption Credit Energy Department Video LYNN GANTT: My name is Lynn Gantt and I'm the team leader for the Virginia Tech EcoCAR team.


EcoCar Students Spread the Word | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCar Students Spread the Word EcoCar Students Spread the Word EcoCar Students Spread the Word June 16, 2011 - 11:34am Addthis Shannon Brescher Shea Communications Manager, Clean Cities Program "If you build it, they will come" is a mantra that might be well suited for rural sporting venues, but the organizers behind the EcoCAR competition realize that in the commercial sector, merely producing a finely tuned product often isn't enough to make it successful. That's why along with challenging students to re-engineer a donated vehicle to minimize gas consumption and emissions while maintaining consumer acceptability, they've made outreach and education key components of the competition. Whether they're speaking to policy makers or elementary school students, each of the teams have worked to convey the benefits of advanced technology


Rockets 2 Race Cars Teacher Program at Kentucky Speedway (NASA)  

Energy.gov (U.S. Department of Energy (DOE))

Register here. Go Green Edition / The Heat is ON! Get your students revved up about science, technology, engineering and mathematics with NASA's Rockets 2 Race Cars STEM Education program....


EcoCAR Challenge Georgia Institute of Technology  

E-Print Network (OSTI)

EcoCAR Challenge Georgia Institute of Technology Outreach Report Date: 11/09/2010 #12;11/9/2010 2 plan on leveraging our media contacts, GM sponsors, and Atlanta Clean Cities sponsors to potentially

Houston, Paul L.


Fact #849: December 1, 2014 Midsize Hybrid Cars Averaged 51%...  

Office of Environmental Management (EM)

832: August 4, 2014 Over Half of the Refueling Stations in the U.S. and Canada Sell Diesel Fuel - Dataset ATVM Technical Support Document Fact 847: November 17, 2014 Cars were...


Electric car batteries: Avoiding the environmental drawbacks via alternative technologies  

Science Journals Connector (OSTI)

In this article, we address the question of whether air pollution resulting from the pyrometallurgical winning, recycling, and casting of lead for car batteries is a serious threat to the environmental acceptabil...

Hans Warlimont Dr.rer.nat.; Marco Olper



Electric Cars Coming to Former Delaware GM Plant | Department...  

Office of Environmental Management (EM)

"Another reason we chose the site is because it can be very difficult and expensive to train workers to build world-class cars. The team over there had won several awards, so...


Addiction to car use and dynamic elasticity measures in France  

E-Print Network (OSTI)

mileage travelled by French households with their personal cars, defining their automobility. To feature-price and income elasticities of household automobility, for both the short and the long runs. Keywords

Boyer, Edmond


3D Printed Car at the International Manufacturing Technology...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Courtesy of Local Motors Carbon Fiber Pellets 4 of 6 Carbon Fiber Pellets Pellets of plastic mixed with carbon fiber were used in the production process of the 3D-printed car....


On the road performance simulation of hydrogen and hybrid cars  

Science Journals Connector (OSTI)

An assessment is made of on-the-road performance, for a pure hydrogen fuel cell car, a pure battery operated car, and a hydrogen fuel cell-battery hybrid car. The tool used for this study is the modular software-package ADVISOR [Markel T, et al. ADVISOR. J Power Sources 2002; 110:25566], which is well tested and offers a range of simple, parametrized sub-models or more detailed physical models for the fuel cell stack, the batteries, the electric motor, the exhaust control, the transmission and entire power train including controls and control strategies. The basis configurations of the cars modelled is characterized by high energy efficiency, before adding a fuel cell and electric motor also of high conversion efficiencies. Preceding the presentation of results, the best way to characterize energy efficiency is discussed.

Bent Srensen



EcoCAR 2 Competition: Meet the Teams Part III  

Office of Energy Efficiency and Renewable Energy (EERE)

The EcoCAR 2 finale starts tomorrow! Meet five of the student teams that are designing and integrating vehicle powertrains that lower the environmental impact of a Chevrolet Malibu without compromising performance, safety and consumer acceptability.


Printing a Car: A Team Effort in Innovation  

Energy.gov (U.S. Department of Energy (DOE))

Oak Ridge National Lab's work with Local Motors to build a 3D-printed car was highlighted at the International Manufacturing Technology Show (IMTS) in September 2014 with a live demonstration.


Modeling demand for electric vehicles: the effect of car users' attitudes and perceptions  

E-Print Network (OSTI)

electric cars and petrol-driven ones and in particular which include the respondents' own cars to electric cars on vehicle preferences. Opinion and perception data are also collected to capture the impact) and currently, few charging stations and infrastructures are available. The electric car user is hence compelled

Bierlaire, Michel


Concept of actuation and control for the EO smart connecting car (EO scc)  

Science Journals Connector (OSTI)

This paper describes the mechanical structure, electrical layout and control concept of the four-wheeled electric vehicle EO smart connecting car (EO scc). This car is able to change its shape, a feature provided by a foldable chassis, which also allows ... Keywords: car docking, drive by-wire, extended maneuverability, modular electric car, morphology, road train, wheel hub motor

Michael Jahn; Martin Schrer; Yong-Ho Yoo; Mehmed Yksel; Frank Kirchner



Optimizing Tank Car Safety Design to Reduce Hazardous Materials Transportation Risk  

E-Print Network (OSTI)

1 Optimizing Tank Car Safety Design to Reduce Hazardous Materials Transportation Risk M. Rapik Saat hazardous materials transport risk by rail · Tank Car Design Optimization Model Tank car weight and capacity model Metrics to assess tank car performance Illustration of the optimization model

Barkan, Christopher P.L.

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fact #827: June 30, 2014 Share of Import Cars Declines to less than 30% of Car Sales in 2013  

Energy.gov (U.S. Department of Energy (DOE))

In 1970, about 15% of all cars sold were imported (built outside of North America) and about 5% of all light trucks sold were imported. These import shares grew during the 1970s and the early 1980...



E-Print Network (OSTI)

BROUWER'S FIXED POINT THEOREM JASPER DEANTONIO Abstract. In this paper we prove Brouwer's Fixed be used to make three sequences which all have p as their limit point. Date: July 27, 2009. 1 #12;2 JASPER

May, J. Peter


Fact #849: December 1, 2014 Midsize Hybrid Cars Averaged 51% Better Fuel Economy than Midsize Non-Hybrid Cars in 2014  

Energy.gov (U.S. Department of Energy (DOE))

For the 2014 model year, midsize hybrid cars averaged 43.4 miles per gallon (mpg) while midsize non-hybrid cars averaged 28.7 mpg; the difference between the two has narrowed due to the rising...


Fixed Income Division Nomura International plc  

E-Print Network (OSTI)

Fixed Income Division © Nomura International plc Symmetry methods for quadratic Gaussian models International plc Outline Motivation The quadratic Gaussian distribution The quadratic Gaussian process The quadratic Gaussian model #12;Fixed Income Division 3© Nomura International plc Part 1 Motivation #12;Fixed

Macrina, Andrea


Combining VisNIR hyperspectral imagery and legacy measured soil profiles to map subsurface soil properties in a Mediterranean area (Cap-Bon, Tunisia)  

Science Journals Connector (OSTI)

Abstract Previous studies have demonstrated that Visible Near InfraRed (VisNIR) hyperspectral imagery is a cost-efficient way to map soil properties at fine resolutions (~5m) over large areas. However, such mapping is only feasible for the soil surface because the effective penetration depths of optical sensors do not exceed several millimeters. This study aims to determine how VisNIR hyperspectral imagery can serve to map the subsurface properties at four depth intervals (1530cm, 3060cm, 60100cm and 30100cm) when used with legacy soil profiles and images of parameters derived from digital elevation model (DEM). Two types of surfacesubsurface functions, namely linear models and random forests, that estimate subsurface property values from surface values and landscape covariates were first calibrated over the set of legacy measured profiles. These functions were then applied to map the soil properties using the hyperspectral-derived digital surface soil property maps and the images of landscape covariates as input. Error propagation was addressed using a Monte Carlo approach to estimate the mapping uncertainties. The study was conducted in a pedologically contrasted 300km2-cultivated area located in the Cap Bon region (Northern Tunisia) and tested on three soil surface properties (clay and sand contents and cation exchange capacity). The main results were as follows: i) fairly satisfactory (cross-validation R2 between 0.55 and 0.81) surfacesubsurface functions were obtained for predicting the soil properties at 1530cm and 3060cm, whereas predictions at 60100cm were less accurate (R2 between 0.38 and 0.43); ii) linear models outperformed random-forest models in developing surfacesubsurface functions; iii) due to the error propagations, the final predicted maps of the subsurface soil properties captured from 1/3 to 2/3 of the total variance with a significantly decreasing performance with depth; and iv) these maps brought significant improvements over the existing soil maps of the region and showed soil patterns that largely agreed with the local pedological knowledge. This paper demonstrates the added value of combining modern remote sensing techniques with old legacy soil databases.

Philippe Lagacherie; Anne-Ruth Sneep; Ccile Gomez; Sinan Bacha; Guillaume Coulouma; Mohamed Hdi Hamrouni; Insaf Mekki



Fixed Rank Kriging A Fixed Rank Prediction Algorithm for Massive Spatial  

E-Print Network (OSTI)

Fixed Rank Kriging A Fixed Rank Prediction Algorithm for Massive Spatial Data with Application, 2010 1 / 24 #12;Fixed Rank Kriging Outline Spatial model, assumptions and some implementation challenges. Summary of Fixed Rank Kriging by Cressie and Johannesson (2008). Propose algorithm to estimate

Gilbes, Fernando


Demand for hybrid car in Indian metro cities  

Science Journals Connector (OSTI)

The depleting stock of fossil fuels, environmental problems, and global warming are today's major concerns. Existing studies identify that transport sector is one of the major contributors towards these problems. Constant efforts in search of alternative, less polluting fuel are being made. Hybrid car technology uses the gasoline and electric technology to reduce air pollution, and save oil. From the field study it is observed that the people with conventional thinking, constituting about one-third of respondents, show more concern for environment. The variables leading to demand for hybrid cars could be energy efficiency, concern for environment, etc. Despite being price sensitive, Indian consumers are willing to pay a decent premium for acquiring this environment friendly car. This study is undertaken with the objective of analysing the scenario of hybrid car in India, and its market potential. The study conducts a questionnaire-based consumer survey based on demographic, economic, and desirable features in a hybrid car; using logit model and factor analysis for identifying variables useful for the study.

Debabrata Das; R. Srinivasan; Raj S. Dhankar



Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Car2Go Launches Car2Go Launches Electric Carsharing Fleet in San Diego to someone by E-mail Share Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in San Diego on Facebook Tweet about Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in San Diego on Twitter Bookmark Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in San Diego on Google Bookmark Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in San Diego on Delicious Rank Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in San Diego on Digg Find More places to share Alternative Fuels Data Center: Car2Go Launches Electric Carsharing Fleet in San Diego on AddThis.com... Feb. 2, 2013 Car2Go Launches Electric Carsharing Fleet in San Diego


Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing  

NLE Websites -- All DOE Office Websites (Extended Search)

7: April 20, 7: April 20, 2009 Cars are Growing Older to someone by E-mail Share Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing Older on Facebook Tweet about Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing Older on Twitter Bookmark Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing Older on Google Bookmark Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing Older on Delicious Rank Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing Older on Digg Find More places to share Vehicle Technologies Office: Fact #567: April 20, 2009 Cars are Growing Older on AddThis.com... Fact #567: April 20, 2009 Cars are Growing Older The median age of cars continues to grow in 2008 while the median age of


Los Alamos catalyst could jumpstart e-cars, green energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Catalyst could jumpstart e-cars, green energy Catalyst could jumpstart e-cars, green energy Los Alamos catalyst could jumpstart e-cars, green energy The new material has the highest oxygen reduction reaction (ORR) activity in alkaline media of any non-precious metal catalyst developed to date. June 4, 2013 A high-resolution microscopic image of a new type of nanostructured-carbon-based catalyst developed at Los Alamos National Laboratory that could pave the way for reliable, economical next-generation batteries and alkaline fuel cells. (Photo credit: Los Alamos National Laboratory) A high-resolution microscopic image of a new type of nanostructured-carbon-based catalyst developed at Los Alamos National Laboratory that could pave the way for reliable, economical next-generation batteries and alkaline fuel cells. (Photo credit: Los Alamos National


Nicole Lambiase: Aspiring Astronaut Turned Next-generation Car Designer |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nicole Lambiase: Aspiring Astronaut Turned Next-generation Car Nicole Lambiase: Aspiring Astronaut Turned Next-generation Car Designer Nicole Lambiase: Aspiring Astronaut Turned Next-generation Car Designer January 7, 2010 - 4:05pm Addthis Eric Barendsen Energy Technology Program Specialist, Office of Energy Efficiency and Renewable Energy Nicole Lambiase grew up near Cape Canaveral and the Kennedy Space Center where she attended space shuttle launches, dreamed of the stars and had hopes of becoming an astronaut. In 2004, Nicole's dreams advanced as she began the aeronautical engineering program at Embry-Riddle Aeronautical University in Daytona Beach, Florida. Even though Nicole thrived in the program, she quickly discovered this path would more likely lead her to driving a computer rather than a space module. So Nicole made a leap of faith and switched to the newly-formed mechanical


EcoCAR Reaches the Finish Line | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reaches the Finish Line Reaches the Finish Line EcoCAR Reaches the Finish Line June 21, 2011 - 2:09pm Addthis The EcoCAR Challenege is a competition that challenges participating students from across North America to re-engineer a vehicle donated by General Motors. With the goal of minimizing the vehicle's fuel consumption and emissions, while maintaining its utility, safety and performance, teams had to find the best combination of cutting-edge technologies to meet these objectives. Shannon Brescher Shea Communications Manager, Clean Cities Program Last Thursday, the Library of Congress's vaunted halls were filled with undergraduate and graduate students on the edge of their seats, waiting to hear the first place winner of the EcoCAR: The NeXt Challenge competition. As Patrick Davis, Vehicle Technologies Program Manager for the Department


Los Alamos catalyst could jumpstart e-cars, green energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Catalyst could jumpstart e-cars, green energy Catalyst could jumpstart e-cars, green energy Los Alamos catalyst could jumpstart e-cars, green energy The new material has the highest oxygen reduction reaction (ORR) activity in alkaline media of any non-precious metal catalyst developed to date. June 4, 2013 A high-resolution microscopic image of a new type of nanostructured-carbon-based catalyst developed at Los Alamos National Laboratory that could pave the way for reliable, economical next-generation batteries and alkaline fuel cells. (Photo credit: Los Alamos National Laboratory) A high-resolution microscopic image of a new type of nanostructured-carbon-based catalyst developed at Los Alamos National Laboratory that could pave the way for reliable, economical next-generation batteries and alkaline fuel cells. (Photo credit: Los Alamos National


An experimental study on a model Stirling engine car  

SciTech Connect

A Stirling engine is a mechanical device that operates on a closed regenerative thermodynamic cycle, with cyclic compression and expansion of the working fluid at different temperature levels. The flow is controlled by volume changes, and there exists a net conversion of the heat to work. Stirling engines are ideally suited to off-grid electric power generation because of their multi-fuel capability, potentially high efficiency and low noise. The first model Stirling Techno-rally was held in August 1997 for further promotion of the clean and quiet Stirling engine as one of the Centennial Anniversary events of JSME. In the race, more than one hundred cars competed for the time on a course of 13 meters length and 30 centimeters width. In Ashikaga Institute of Technology, a model Stirling engine car Ashikaga Gekkoh was made for this event. In this paper the authors report on this model car that won the championship of the Stirling Techno-rally.

Sohma, Yutaka; Wu, Chungming; Isshiki, Seita; Ushiyama, Izumi



FreedomCAR Partnership 2003 Highlights of Technical Accomplishments  

NLE Websites -- All DOE Office Websites (Extended Search)

FreedomCAR Partnership FreedomCAR Partnership 2003 Highlights of Technical Accomplishments Item Page Preamble 2 Advanced Combustion & Emissions Control * Charge Stratification to Improve HCCI Combustion Efficiency 3 * Lower Temperature Diesel Combustion 4 * Sensors for Closed-Loop Diesel Engine Control 5 Electrical & Electronics * High Voltage Power Module Hits Performance & Cost Targets 6 Electrochemical Energy Storage * 42V Battery Test Manual Issued 7 * Abuse Tolerant Li-Ion Cathode 8 * Li-Ion Battery Thermal Run-Away Mechanism 9 * Li-Ion Electrolyte Model for Low Temperatures 10 * Li-Ion HEV Battery Cost Reduced 11 Fuel Cells * Advanced Fuel Cell Membrane Electrolyte 12


Societal lifecycle costs of cars with alternative fuels/engines  

Science Journals Connector (OSTI)

Effectively addressing concerns about air pollution (especially health impacts of small-particle air pollution), climate change, and oil supply insecurity will probably require radical changes in automotive engine/fuel technologies in directions that offer both the potential for achieving near-zero emissions of air pollutants and greenhouse gases and a diversification of the transport fuel system away from its present exclusive dependence on petroleum. The basis for comparing alternative automotive engine/fuel options in evolving toward these goals in the present analysis is the societal lifecycle cost of transportation, including the vehicle first cost (assuming large-scale mass production), fuel costs (assuming a fully developed fuel infrastructure), externality costs for oil supply security, and damage costs for emissions of air pollutants and greenhouse gases calculated over the full fuel cycle. Several engine/fuel options are consideredincluding current gasoline internal combustion engines and a variety of advanced lightweight vehicles: internal combustion engine vehicles fueled with gasoline or hydrogen; internal combustion engine/hybrid electric vehicles fueled with gasoline, compressed natural gas, Diesel, FischerTropsch liquids or hydrogen; and fuel cell vehicles fueled with gasoline, methanol or hydrogen (from natural gas, coal or wind power). To account for large uncertainties inherent in the analysis (for example in environmental damage costs, in oil supply security costs and in projected mass-produced costs of future vehicles), lifecycle costs are estimated for a range of possible future conditions. Under base-case conditions, several advanced options have roughly comparable lifecycle costs that are lower than for today's conventional gasoline internal combustion engine cars, when environmental and oil supply insecurity externalities are countedincluding advanced gasoline internal combustion engine cars, internal combustion engine/hybrid electric cars fueled with gasoline, Diesel, FischerTropsch liquids or compressed natural gas, and hydrogen fuel cell cars. The hydrogen fuel cell car stands out as having the lowest externality costs of any option and, when mass produced and with high valuations of externalities, the least projected lifecycle cost. Particular attention is given to strategies that would enhance the prospects that the hydrogen fuel cell car would eventually become the Car of the Future, while pursuing innovations relating to options based on internal combustion engines that would both assist a transition to hydrogen fuel cell cars and provide significant reductions of externality costs in the near term.

Joan M Ogden; Robert H Williams; Eric D Larson



Biological fixed-film systems  

SciTech Connect

This paper includes reports on several biological fixed film systems in wastewater and hazardous waste treatment. Biological treatment of a refinery wastewater was studied in a rotating biological contactor (RBC) unit coupled with polyurethane foam (PUF) as a porous biomass support attached on both sides of the biodisks. The RBC-PUF bioreactor exhibited better performance than conventional RBCs for the removal of chemical oxygen demand (COD), NH{sub 3}-N, phenol, hydrocarbons, and suspended solids because of higher concentrations of active biomass. Successful performance of an anaerobic-aerobic treatment process using a combination of RCBs with activated sludge was achieved for treating a dye wastewater. Two high-rate trickling filters, cross-flow (CF) and vertical flow, were examined over a two year period for biological treatment of seafood processing wastewater. Results suggested superior performance of CF plastic media with substrate removal following a pseudo half-order kinetic reaction. Submerged structured packings in biofilm reactors were tested and characterized for a wide range of applications. Their efficiency was discussed in terms of contaminant removals and SS retention.

Chen, J.M.; Lim, B.S.; Al-Ghusain, I.A.; Hao, O.J.; Lin, C.F.; Davis, A.P.; Kim, M.H.; Huang, J.



Reading with fixed and variable character pitch  

Science Journals Connector (OSTI)

We compared the effects of fixed and variable (proportional) spacing on reading speeds and found variable pitch to yield better performance at medium and large character sizes and...

Arditi, Aries; Knoblauch, Kenneth; Grunwald, Ilana



The All-Electric Commute: An Assessment of the Market Potential for Station Cars in the San Francisco Bay Area  

E-Print Network (OSTI)

Sperling, D. 1994. "Electric Cars and the Future." ITSReviewUP HERE TO TEST DRIVE AN ELECTRIC CAR Availability for testtest drives of an electric car. Non-polluting commuting."

Cervero, Robert; Round, Alfred; Reed, Carma; Clark, Brian



Electric Power Controller for Steering Wheel Management in Electric Cars  

E-Print Network (OSTI)

Electric Power Controller for Steering Wheel Management in Electric Cars Vicente Milanés, Joshué-- Autonomous vehicles, Power control, System analysis and design, Intelligent transportation systems. I they are named hydraulic power steering (HPS) systems. If an electric motor is used then they are named electric

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Printing a Car: A Team Effort in Innovation  

ScienceCinema (OSTI)

The story behind the realization of a unique project: the building of a 3D printed electric car, as told by team members. Strati materialized out of 15% carbon-reinforced ABS thermoplastic in a record 44 hours, under the very eyes of attendees at this year's International Manufacturing Technology Show (IMTS).

Rogers, Jay; Love, Lonnie; Johnson, Mark; Ivester, Rob; Neff, Rick; Blue, Craig;



FUEL CELL TECHNOLOGIES PROGRAM Hydrogen is a versatile energy car-  

E-Print Network (OSTI)

FUEL CELL TECHNOLOGIES PROGRAM Fuel Cells Hydrogen is a versatile energy car- rier that can be used efficiently capture and use the power of hydrogen -- is the key to making it happen. Stationary fuel cells can and trucks. Why Fuel Cells? Fuel cells directly convert the chemical energy in hydrogen to electricity


Case Study B: Fuel Cell Power Train for Cars  

Science Journals Connector (OSTI)

This chapter reports the results of an experimental analysis on a 30kW fuel cell power train for city cars. The electric energy is generated by using a laboratory fuel cell system (FCS) based on a 20kW H2/air P...

Pasquale Corbo; Fortunato Migliardini



Modeling Cylinder Valve in Hydrogen Fuel Cell Car  

Science Journals Connector (OSTI)

We develop a fast alternative to a complex finite element analysis (FEA) model of cylinder valve in hydrogen fuel cell car based on support vector machine (SVM). The inputs of model are shape parameters of core and plunger of the valve, and the output ... Keywords: modeling, cylinder valve, SVM, uniform design

Liang Yu; Shengnian Cai; Wang Na



Efficiency assessment of an evolutive design system of car contours  

E-Print Network (OSTI)

International Conference on Engineering Design - ICED 09, Palo Alto, CA : United States (2009)" #12 the designer to browse through generations of car profiles from an initial population of existing silhouettes, called phenotype, are encoded in a genome. From an initial population of such individuals, a GA permits

Paris-Sud XI, Université de


The Bolting of Magnesium Components in Car Engines  

E-Print Network (OSTI)

1 The Bolting of Magnesium Components in Car Engines Sarennah J.P. Longworth Newnham College vehicles. At present this is achieved through the use of ultralight steels, aluminium alloys and magnesium alloys for some body parts. Magnesium has the highest strength-to-weight ratio of any structural metal

Cambridge, University of


EcoCAR 2: Meet the Teams Part II  

Office of Energy Efficiency and Renewable Energy (EERE)

As college graduation season draws near, so too does EcoCAR 2, the Energy Department competition that challenges the next generation of engineers and scientists to reduce the environmental impact of a Chevrolet Malibu without compromising performance, safety and consumer acceptability. Meet five of the 15 teams.


Printing a Car: A Team Effort in Innovation  

SciTech Connect

The story behind the realization of a unique project: the building of a 3D printed electric car, as told by team members. Strati materialized out of 15% carbon-reinforced ABS thermoplastic in a record 44 hours, under the very eyes of attendees at this year's International Manufacturing Technology Show (IMTS).

Rogers, Jay; Love, Lonnie; Johnson, Mark; Ivester, Rob; Neff, Rick; Blue, Craig; ,



Why do we power our cars with gas? NBC Chicago  

ScienceCinema (OSTI)

Why can we only power our cars with gas? NBC-Chicago tackles this question with a trip to Argonne National Lab, where work on the Omnivorous Engine (runs on any blend of ethanol, butanol, and gasoline) and electric vehicles continues. A segment from NBC-Chicago's "Good Question" series.




EcoCAR 2: Meet the Teams Part I  

Office of Energy Efficiency and Renewable Energy (EERE)

Next month, 15 university teams facing off in EcoCAR 2 will reach the home stretch of the race. A two part contest will determine which team is crowned winners of the Energy Departments latest advanced vehicle technology competition. Meet five of the teams and learn about their unique approaches to building innovative vehicles on the cutting edge of clean transportation.


Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or  

NLE Websites -- All DOE Office Websites (Extended Search)

6: May 7, 2012 6: May 7, 2012 SUVs: Are They Cars or Trucks? to someone by E-mail Share Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? on Facebook Tweet about Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? on Twitter Bookmark Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? on Google Bookmark Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? on Delicious Rank Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? on Digg Find More places to share Vehicle Technologies Office: Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? on AddThis.com... Fact #726: May 7, 2012 SUVs: Are They Cars or Trucks? The Corporate Average Fuel Economy (CAFE) Standards set for model years


Fact #692: September 12, 2011 Fuel Economy Distribution for New Cars and Light Trucks  

Energy.gov (U.S. Department of Energy (DOE))

Nearly 64% of new cars sold in model year (MY) 1975 had combined highway/city fuel economy of 15 miles per gallon (mpg) or less [blue shading]. By 2010, 63% of cars had fuel economy of 25 mpg or...


Automatic parallel parking and platooning to redistribute electric vehicles in a car-sharing application  

E-Print Network (OSTI)

subscribers , as well as the electric car-sharing system autolib, comprising 2000 vehicles, 1200 stations for an electric car sharing application. Both perception, planing, control and communication issues are tackled

Paris-Sud XI, Université de


E-Print Network 3.0 - automatic car identification Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Quest Car89, and Mozzie HRH97. One of the main attributes... the metaphor of trains made up of cars. The address space of the store is divided into a number of disjoint...


Transient Aerodynamic Effects on a Four-Car Platoon During Passing Maneuvers: Data Summary  

E-Print Network (OSTI)

B. Marcu, F. Browand, The Aerodynamic Forces on Misalignedof the Transient Aerodynamic Effects on a Four-Car PlatoonBERKELEY Transient Aerodynamic Effects on a Four-Car Platoon

Tsuei, L.; Hedrick, J. K.; Savas, O.



Advanced Generation Adenoviral Virotherapy Agents Embody Enhanced Potency Based upon CAR-Independent Tropism  

Science Journals Connector (OSTI)

...Embody Enhanced Potency Based upon CAR-Independent Tropism J. Michael Mathis...the retinoblastoma (Rb) pathway. A defective Rb pathway in the majority of tumor...coxsackie and adenovirus receptor (CAR), in primary tumors relative to their...

J. Michael Mathis; Phoebe L. Stewart; Zheng B. Zhu; and David T. Curiel



Fact #611: February 22, 2010 Top Ten Best Selling Cars and Light Trucks  

Energy.gov (U.S. Department of Energy (DOE))

The top ten lists of best selling cars and light trucks in 2009 show that the Toyota Camry was the best selling car, while the Ford F-Series pickup was the best selling light truck. The F-Series...


Hydrogen fuel-cell cars designed and built in student competition  

NLE Websites -- All DOE Office Websites (Extended Search)

Students build hydrogen fuel-cell cars Hydrogen fuel-cell cars designed and built in student competition Middle and elementary school teams from around New Mexico participated in...


Alternative Fuels Data Center: Students Power Remote-Controlled Cars With  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Students Power Students Power Remote-Controlled Cars With Biodiesel to someone by E-mail Share Alternative Fuels Data Center: Students Power Remote-Controlled Cars With Biodiesel on Facebook Tweet about Alternative Fuels Data Center: Students Power Remote-Controlled Cars With Biodiesel on Twitter Bookmark Alternative Fuels Data Center: Students Power Remote-Controlled Cars With Biodiesel on Google Bookmark Alternative Fuels Data Center: Students Power Remote-Controlled Cars With Biodiesel on Delicious Rank Alternative Fuels Data Center: Students Power Remote-Controlled Cars With Biodiesel on Digg Find More places to share Alternative Fuels Data Center: Students Power Remote-Controlled Cars With Biodiesel on AddThis.com... April 14, 2012 Students Power Remote-Controlled Cars With Biodiesel


Fact #724: April 23, 2012 Gas Guzzler Tax Levied on New Cars with Low Fuel Economy  

Energy.gov (U.S. Department of Energy (DOE))

The "Gas Guzzler Tax" is collected from the public for each new car purchased with fuel economy less than 22.5 miles per gallon (mpg). The Gas Guzzler Tax does not apply to light trucks, only cars....

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy use, cost and CO2 emissions of electric cars  

Science Journals Connector (OSTI)

We examine efficiency, costs and greenhouse gas emissions of current and future electric cars (EV), including the impact from charging EV on electricity demand and infrastructure for generation and distribution. Uncoordinated charging would increase national peak load by 7% at 30% penetration rate of EV and household peak load by 54%, which may exceed the capacity of existing electricity distribution infrastructure. At 30% penetration of EV, off-peak charging would result in a 20% higher, more stable base load and no additional peak load at the national level and up to 7% higher peak load at the household level. Therefore, if off-peak charging is successfully introduced, electric driving need not require additional generation capacity, even in case of 100% switch to electric vehicles. GHG emissions from electric driving depend most on the fuel type (coal or natural gas) used in the generation of electricity for charging, and range between 0gkm?1 (using renewables) and 155gkm?1 (using electricity from an old coal-based plant). Based on the generation capacity projected for the Netherlands in 2015, electricity for EV charging would largely be generated using natural gas, emitting 3577gCO2eqkm?1. We find that total cost of ownership (TCO) of current EV are uncompetitive with regular cars and series hybrid cars by more than 800year?1. TCO of future wheel motor PHEV may become competitive when batteries cost 400kWh?1, even without tax incentives, as long as one battery pack can last for the lifespan of the vehicle. However, TCO of future battery powered cars is at least 25% higher than of series hybrid or regular cars. This cost gap remains unless cost of batteries drops to 150kWh?1 in the future. Variations in driving cost from charging patterns have negligible influence on TCO. GHG abatement costs using plug-in hybrid cars are currently 4001400tonne?1CO2eq and may come down to ?100 to 300tonne?1. Abatement cost using battery powered cars are currently above 1900tonne?1 and are not projected to drop below 300800tonne?1.

Oscar van Vliet; Anne Sjoerd Brouwer; Takeshi Kuramochi; Machteld van den Broek; Andr Faaij



FreedomCAR and Fuel Partnership 2008 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

Report containing brief summaries of key technical accomplishments of the FreedomCAR and Fuel Partnership program for 2008.


FreedomCAR and Fuel Partnership 2007 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

Report containing brief summaries of key technical accomplishments of the FreedomCAR and Fuel Partnership program for 2007.


FreedomCAR and Fuel Partnership 2009 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

This report summarizes key technical accomplishments achieved in support of the FreedomCAR and Fuel Partnership in 2009.


FreedomCAR and Fuel Partnership 2004 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

Report containing brief summaries of key accomplishments of the FreedomCAR and Fuel Partnership program for 2004.


FreedomCAR and Fuel Partnership 2005 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

Report containing brief summaries of key technical accomplishments of the FreedomCAR and Fuel Partnership program for 2005.


FreedomCAR and Fuel Partnership 2006 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

Report containing brief summaries of key technical accomplishments of the FreedomCAR and Fuel Partnership program for 2006.


Fact #847: November 17, 2014 Cars were Over 50% of Light Vehicle Production in 2014- Dataset  

Energy.gov (U.S. Department of Energy (DOE))

Excel file with dataset for Fact #847: November 17, 2014 Cars were Over 50% of Light Vehicle Production in 2014


FreedomCAR and Fuel Partnership 2010 Highlights of Technical Accomplishments  

Energy.gov (U.S. Department of Energy (DOE))

This report summarizes key technical accomplishments achieved in support of the FreedomCAR and Fuel Partnership in 2010.


Limiting discharge voltage of a capacitive energy store in a subway car  

Science Journals Connector (OSTI)

A method is proposed for calculating the limiting discharge voltage of a capacitive energy store in a subway car.

G. G. Ryabtsev; I. A. Ermakov



Fourier Accelerated Conjugate Gradient Lattice Gauge Fixing  

E-Print Network (OSTI)

We provide details of the first implementation of a non-linear conjugate gradient method for Landau and Coulomb gauge fixing with Fourier acceleration. We find clear improvement over the Fourier accelerated steepest descent method, with the average time taken for the algorithm to converge to a fixed, high accuracy, being reduced by a factor of 2 to 4.

R. J. Hudspith



Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto



Fix-Up Loan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fix-Up Loan Fix-Up Loan Fix-Up Loan < Back Eligibility Low-Income Residential Multi-Family Residential Residential Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Construction Design & Remodeling Heating Insulation Windows, Doors, & Skylights Energy Sources Buying & Making Electricity Solar Wind Sealing Your Home Appliances & Electronics Water Heating Maximum Rebate $35,000 (see exceptions below) Unsecured loans: $15,000 Program Info Funding Source Fix-Up Fund State Minnesota Program Type State Loan Program Rebate Amount $2,000 - $50,000 Provider Minnesota Housing Finance Agency The Minnesota Housing Finance Agency's (MHFA) Fix-up Loan provides low-interest financing for energy conservation and other basic improvements


CarPal: interconnecting overlay networks for a community-driven shared mobility  

E-Print Network (OSTI)

of running vehicles by increasing the number of passengers per car amongst medium/big communities like and pollution, reduces trip expenses by alternating the use of the personal vehicle amongst different drivers.1007/978-3-642-15640-3_20 #12;find the closest car to pick. The same economical/ecological advantage of car pooling applies

Paris-Sud XI, Université de


EcoCAR 2 Competition Announces Year Two Winner: Penn State University |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR 2 Competition Announces Year Two Winner: Penn State EcoCAR 2 Competition Announces Year Two Winner: Penn State University EcoCAR 2 Competition Announces Year Two Winner: Penn State University May 24, 2013 - 2:14pm Addthis News Media Contact (202) 586-4940 SAN DIEGO, Calif. - EcoCAR 2: Plugging In to the Future today named Pennsylvania State University its Year Two winner at the EcoCAR 2013 Competition in San Diego. The 15 universities competing in EcoCAR 2 gathered in Yuma, Arizona last week for six days of rigorous vehicle testing and evaluation on drive quality and environmental impact at General Motors (GM) Desert Proving Ground. From there, the competition moved to San Diego for a second round of judging by automotive industry experts. EcoCAR 2 -- a three-year competition managed by Argonne National Laboratory


Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and  

NLE Websites -- All DOE Office Websites (Extended Search)

3: December 13, 3: December 13, 2010 Import Cars and Trucks Gaining Ground to someone by E-mail Share Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and Trucks Gaining Ground on Facebook Tweet about Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and Trucks Gaining Ground on Twitter Bookmark Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and Trucks Gaining Ground on Google Bookmark Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and Trucks Gaining Ground on Delicious Rank Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and Trucks Gaining Ground on Digg Find More places to share Vehicle Technologies Office: Fact #653: December 13, 2010 Import Cars and Trucks Gaining Ground on AddThis.com...


EcoCAR 2 Competition Announces Year Two Winner: Penn State University |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR 2 Competition Announces Year Two Winner: Penn State EcoCAR 2 Competition Announces Year Two Winner: Penn State University EcoCAR 2 Competition Announces Year Two Winner: Penn State University May 24, 2013 - 2:14pm Addthis News Media Contact (202) 586-4940 SAN DIEGO, Calif. - EcoCAR 2: Plugging In to the Future today named Pennsylvania State University its Year Two winner at the EcoCAR 2013 Competition in San Diego. The 15 universities competing in EcoCAR 2 gathered in Yuma, Arizona last week for six days of rigorous vehicle testing and evaluation on drive quality and environmental impact at General Motors (GM) Desert Proving Ground. From there, the competition moved to San Diego for a second round of judging by automotive industry experts. EcoCAR 2 -- a three-year competition managed by Argonne National Laboratory


Fire tests on defective tank-car thermal protection systems  

Science Journals Connector (OSTI)

Many railway tank-cars carrying hazardous materials are thermally protected from fire impingement by thermal insulation and a steel jacket applied to the outside of the tank-car shell. Over time, it is possible that the thermal insulation will sag, rip, degrade, or be crushed under the steel jacket. A thermographic technique to determine whether or not a tank has insulation deficiencies has been developed, but it is necessary to determine which thermal deficiencies do not affect a tanks survivability in a fire and which thermal deficiencies must be repaired. In order to develop a guideline in assessing thermal defects, a thermal model and experimental data would be beneficial. A series of fire tests were performed on a quarter-section tank-car mock-up to assist in developing a guideline and to provide validation data for a thermal model. Twelve fire tests, with constant, credible, simulated pool fire conditions, were performed on the tank-car mock-up with various insulation deficiencies. An infrared thermal imaging camera was used to measure the tank wall temperature. The thermal images were useful in determining the temperature profiles across the defects at different times and the transient temperature behaviour at different locations. It was seen that the properly installed thermal protection system significantly reduced the heat transfer from the fire to the tank wall. It was also seen that the steel jacket alone (i.e. 100% defect) acted as a radiation shield and provided a significant level of protection. With small defects, it was observed that the surrounding protected material provided a cooling effect by thermal conduction. A square defect greater than about 40 cm on each side should be considered significant, because unlike smaller defects, there is little benefit from the surrounding material as far as the peak defect temperature is concerned.

J.D.J VanderSteen; A.M Birk



RaisingRivals'FixedCosts Matthew Olczak  

E-Print Network (OSTI)

. In addition much of the recent Industrial Organisation literature has focused on the importance of sunk costs, whereas this paper considers fixed costs that do not have to be sunk costs. A set of guidelines produced

Feigon, Brooke


The role of hydrogen cars in the economy of California  

Science Journals Connector (OSTI)

Hydrogen has been proposed as an alternative transportation fuel that could reduce energy consumption and eliminate tailpipe emissions when used in fuel cell vehicles (FCVs). To investigate the potential effects of hydrogen vehicles on Californias economy over the next two decades, we employed the modified Costs for Advanced Vehicles and Energy (CAVE) model and a California-specific computable general equilibrium model. Results indicate that, even in the aggressive scenario, hydrogen cars can only account for a minor fraction of the on-road fleet through 2030. Although new sales could drop sharply, conventional gasoline cars and carryover pre-2010 vehicles are still expected to dominate the on-road vehicle stock and consume the majority of transportation energy through 2030. Transportation energy consumption could decline dramatically, mainly because of the fuel economy advantage of \\{FCVs\\} over conventional cars. Both moderate and aggressive hydrogen scenarios are estimated to have a slightly negative influence on Californias economy. However, the negative economic impacts could be lessened as the market for hydrogen and \\{FCVs\\} builds up. Based on the economic optimization model, both hydrogen scenarios would have a negative economic impact on Californias oil refining sector and, as expected, a positive impact on the other directly related sectors that contribute to either hydrogen production or FCV manufacturing.

Guihua Wang


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Development of plastic front side panels for green cars  

Science Journals Connector (OSTI)

Lightweight design with thermoplastics is a robust approach in order to reduce the CO2 emission and fuel consumption. This paper reviews the role of plastics in the green concept of automobile and develops the design process for replacing steel front side panels, so called steel car fender, with plastic ones. Conceptual design, material selection, and design strategy in terms of strength, moldability, and assembility were proposed. Injection molding optimization was carried out in order to ensure the quality of the plastic fender under a certain manufacturing conditions such as the applied molding machine and auxiliary equipment. Prototype manufacturing was also implemented to verify the manufacturability and the feasibility of the development process of a plastic car fender. The weight of the plastic car fender is 1.15kg, reducing 41% compared to the steel fender. Although the production cost of the plastic fender is just slightly cheaper than that of steel one due to the high cost of the special plastic, the benefits such as lightweight, recyclability, manufacturability and design flexibility are the potential and practical application of the thermoplastic to the green automotive industry for making exterior parts.

H.S. Park; X.P. Dang; A. Roderburg; B. Nau



Fixed target facility at the SSC  

SciTech Connect

The question of whether a facility for fixed target physics should be provided at the SSC must be answered before the final technical design of the SSC can be completed, particularly if the eventual form of extraction would influence the magnet design. To this end, an enthusiastic group of experimentalists, theoreticians and accelerator specialists have studied this point. The accelerator physics issues were addressed by a group led by E. Colton whose report is contained in these proceedings. The physics addressable by fixed target was considered by many of the Physics area working groups and in particular by the Structure Function Group. This report is the summary of the working group which considered various SSC fixed target experiments and determined which types of beams and detectors would be required. 13 references, 5 figures.

Loken, S.C.; Morfin, J.G.



EcoCAR 2: Racing Towards Vehicle Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR 2: Racing Towards Vehicle Efficiency EcoCAR 2: Racing Towards Vehicle Efficiency EcoCAR 2: Racing Towards Vehicle Efficiency May 23, 2012 - 1:55pm Addthis Teams of university students are exploring the hardware of plug-in hybrid electric vehicles this week at the EcoCAR 2 finals in Los Angeles, CA. | Energy Department photo, credit Myles Regan. Teams of university students are exploring the hardware of plug-in hybrid electric vehicles this week at the EcoCAR 2 finals in Los Angeles, CA. | Energy Department photo, credit Myles Regan. Connie Bezanson Education & Outreach Manager, Vehicle Technologies Program What are the key facts? First year finals of the EcoCAR2 competition conclude today in Los Angeles, CA. For the second and third years of the competition, teams integrate their systems into a "mule" vehicle and refine their vehicles to meet


EcoCAR2 Teams Start their Virtual Engines | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR2 Teams Start their Virtual Engines EcoCAR2 Teams Start their Virtual Engines EcoCAR2 Teams Start their Virtual Engines May 17, 2012 - 4:11pm Addthis A North Carolina State University student works on an EcoCAR vehicle at the Year 3 finals last year in Milford, MI. | Energy Department photo. A North Carolina State University student works on an EcoCAR vehicle at the Year 3 finals last year in Milford, MI. | Energy Department photo. Shannon Brescher Shea Communications Manager, Clean Cities Program What are the key facts? First-year finals of the EcoCar2 competition begin Friday, May 18 in Los Angeles, CA. As the auto industry introduces more alternative fuel and energy efficient vehicles to dealerships across the U.S., teams of university students are also making sure consumers have more choices on the showroom floor.


A New Generation of Labels for a New Generation of Cars | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

New Generation of Labels for a New Generation of Cars New Generation of Labels for a New Generation of Cars A New Generation of Labels for a New Generation of Cars May 25, 2011 - 5:42pm Addthis A New Generation of Labels for a New Generation of Cars John Schueler John Schueler Former New Media Specialist, Office of Public Affairs What does this mean for me? An improved car buying experience Clear cut cost comparisons of vehicles If you've ever gone through the process of shopping for a new car, you know just how difficult it can be to cut through the hype and find the best vehicle for you. For decades, consumers have been turning to fuel economy labels to get gas mileage estimates for city and highway driving, to narrow their choices and make an informed purchase. Today, there are more vehicle choices than ever and consumers want to know


From General Mechanics to General Motors: Lynn Gantt's EcoCAR Experience |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

From General Mechanics to General Motors: Lynn Gantt's EcoCAR From General Mechanics to General Motors: Lynn Gantt's EcoCAR Experience From General Mechanics to General Motors: Lynn Gantt's EcoCAR Experience June 17, 2011 - 3:35pm Addthis Virginia Tech's Lynn Gantt tells us about Virginia Tech's EcoCAR entry. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Since childhood, Lynn Gantt has had a deep seeded passion for cars and the mechanics that drive them. The Virginia native spent his weekends rebuilding antique tractors with his dad to race at tractor pulls across the state, and now the Virginia Tech graduate student is the proud team co-leader of Virginia Tech's EcoCAR Challenge team -- the winners of the three-year long competition, as announced last night at an awards ceremony


EcoCAR Vehicles Get Put to the Test at General Motors' Proving Ground |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR Vehicles Get Put to the Test at General Motors' Proving EcoCAR Vehicles Get Put to the Test at General Motors' Proving Ground EcoCAR Vehicles Get Put to the Test at General Motors' Proving Ground June 13, 2011 - 5:57pm Addthis Virginia Tech puts their EcoCar vehicle through the paces at General Motors' Milford Proving Grounds. | Credit Department of Energy Advanced Vehicle Technology Competitions Virginia Tech puts their EcoCar vehicle through the paces at General Motors' Milford Proving Grounds. | Credit Department of Energy Advanced Vehicle Technology Competitions Connie Bezanson Education & Outreach Manager, Vehicle Technologies Program What does this project do? EcoCar challenges students to reduce the environmental impact of vehicles by minimizing the vehicle's fuel consumption and emissions -- while retaining the vehicle's performance, safety and consumer appeal.


What Do You Think of Electric 'Cars of the Future'? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

What Do You Think of Electric 'Cars of the Future'? What Do You Think of Electric 'Cars of the Future'? What Do You Think of Electric 'Cars of the Future'? April 29, 2010 - 7:30am Addthis On Tuesday, Shannon wrote about plug-in hybrid electric vehicles and all-electric vehicles. DOE is has a number of projects in the works to encourage development and adoption of these vehicles. While the flying "cars of the future" we imagined in years past have not come to fruition, plug-in and all-electric vehicles have given us a new vision for the "cars of the future," and it's an efficient one! What do you think of electric "cars of the future"? Each Thursday, you have the chance to share your thoughts on a question about energy efficiency or renewable energy for consumers. Please comment


Students Drive Home Innovative Engineering in the EcoCAR2 Competition |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Students Drive Home Innovative Engineering in the EcoCAR2 Students Drive Home Innovative Engineering in the EcoCAR2 Competition Students Drive Home Innovative Engineering in the EcoCAR2 Competition April 18, 2011 - 1:52pm Addthis Participants in the EcoCar2 challenge gather for the spring workshop in Ann Arbor, Michigan. Participants in the EcoCar2 challenge gather for the spring workshop in Ann Arbor, Michigan. Patrick B. Davis Patrick B. Davis Vehicle Technologies Program Manager What does this project do? Engineering students work to re-engineer a standard vehicle, minimizing fuel consumption and emissions while retaining its original level of performance, safety and consumer appeal. The wait is over. After enduring a rigorous selection process, 16 teams have been chosen to compete in EcoCAR2: Plugging into the Future- a


From General Mechanics to General Motors: Lynn Gantt's EcoCAR Experience |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

From General Mechanics to General Motors: Lynn Gantt's EcoCAR From General Mechanics to General Motors: Lynn Gantt's EcoCAR Experience From General Mechanics to General Motors: Lynn Gantt's EcoCAR Experience June 17, 2011 - 3:35pm Addthis Virginia Tech's Lynn Gantt tells us about Virginia Tech's EcoCAR entry. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Since childhood, Lynn Gantt has had a deep seeded passion for cars and the mechanics that drive them. The Virginia native spent his weekends rebuilding antique tractors with his dad to race at tractor pulls across the state, and now the Virginia Tech graduate student is the proud team co-leader of Virginia Tech's EcoCAR Challenge team -- the winners of the three-year long competition, as announced last night at an awards ceremony


A New Generation of Labels for a New Generation of Cars | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A New Generation of Labels for a New Generation of Cars A New Generation of Labels for a New Generation of Cars A New Generation of Labels for a New Generation of Cars May 25, 2011 - 5:42pm Addthis A New Generation of Labels for a New Generation of Cars John Schueler John Schueler Former New Media Specialist, Office of Public Affairs What does this mean for me? An improved car buying experience Clear cut cost comparisons of vehicles If you've ever gone through the process of shopping for a new car, you know just how difficult it can be to cut through the hype and find the best vehicle for you. For decades, consumers have been turning to fuel economy labels to get gas mileage estimates for city and highway driving, to narrow their choices and make an informed purchase. Today, there are more vehicle choices than ever and consumers want to know


What Do You Think of Electric 'Cars of the Future'? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Think of Electric 'Cars of the Future'? Think of Electric 'Cars of the Future'? What Do You Think of Electric 'Cars of the Future'? April 29, 2010 - 7:30am Addthis On Tuesday, Shannon wrote about plug-in hybrid electric vehicles and all-electric vehicles. DOE is has a number of projects in the works to encourage development and adoption of these vehicles. While the flying "cars of the future" we imagined in years past have not come to fruition, plug-in and all-electric vehicles have given us a new vision for the "cars of the future," and it's an efficient one! What do you think of electric "cars of the future"? Each Thursday, you have the chance to share your thoughts on a question about energy efficiency or renewable energy for consumers. Please comment with your answers, and also feel free to respond to other comments. E-mail


Essential and Fixed Oils of Kansas Plants  

E-Print Network (OSTI)

Center for Digital Scholarship. http://kuscholarworks.ku.edu Submitted to the University of Kansas in partial fulfillment of the requirements for the Degree of Master of Arts EARL J. WELLINGTON E s s e n t i a l and F i x e d Oi l s of K a n s a... s Plants ESSENTIAL AND FIXED OILS OP KANSAS PLANTS. R0D1D7 HIODM The following report deals with those Kansas plants (one or two trees included) which are known to y i e l d or are suspected of yielding essential and fixed o i l s . Ho cultivated...

Wellington, Earl J.



Application of CARS to scramjet combustion. Final report  

SciTech Connect

A coherent anti-Stokes Raman spectroscopic (CARS) instrument has been developed for measuring simultaneously temperature and N/sub 2/ - O/sub 2/ species concentration in hostile flame environments. A folded BOXCARS arrangement was employed to obtain high spatial resolution. Polarization discrimination against the nonresonant background decreased the lower limits of O/sub 2/ detectivity. The instrument has been primarily employed for validation of computational fluid-dynamics computer-model codes. Comparisons have been made to both the CHARNAL and TEACH codes on a hydrogen diffusion flame with good results.

Antcliff, R.R.



The world car concept and the volume manufacturer  

Science Journals Connector (OSTI)

The concept of the ''world car'' is examined historically and in the light of fluctuations in the price of oil and of the expansion of the Japanese into the world market. This paper suggests ways in which governments and the EEC can enhance the ability of the European motor industry to compete successfully with the Japanese: by eliminating distortions in the European ''home market'' due to differing policies on tax, price control and state subsidy; by evolving a consistent approach to Japanese investment in plant in Europe; by concerted moves by governments to less restrictive monetary and fiscal policies; and by reviewing how social policies affect international competitiveness.

Robert A. Lutz



Middle School Electric Car Competition | U.S. DOE Office of Science...  

Office of Science (SC) Website

Electric Car Competition National Science Bowl (NSB) NSB Home About High School Middle School Attending National Event Volunteers 2014 Competition Results Middle School Round...


E-Print Network 3.0 - awakening response car Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

or movie) As a passenger in a car for an hour without a break ... Source: Fuerschbach, Phillip - Joining and Coating Department, Materials and Process Sciences Center, Sandia...


Fact #848: November 24, 2014 Nearly Three-Fourths of New Cars...  

Energy Savers (EERE)

share of light truck production by fuel economy classification, 1975-2014. Fact 848 Dataset Supporting Information Share of Car Production by Fuel Economy Classification,...


The battle of batteries: a history of innovation in alternative energy cars  

Science Journals Connector (OSTI)

The paper gives a global view on the historical development of electrical cars. It is a history described in five major waves; the first one starting about 1835 and the last one ending about 2000. With two cases, important aspects of the two last waves are described in detail. The cases are the French VEL car and the Norwegian Think car. They have had their more specific setbacks. Problems in electrochemistry have caused important limitations, as they have through the whole history of electrical cars. This is the background for the paper title: The Battle of Batteries.

Karl G. Hoyer



Chapter 30 - Final Case Study: Materials and Energy in Car Design  

Science Journals Connector (OSTI)

Publisher Summary The status of steel as the raw material of choice for the manufacture of car bodies rests principally on its price. It has always been the cheapest material that meets the necessary strength, stiffness, formability, and weldability requirements of large-scale car body production. Until recently, the fact that steel has a density two-thirds that of lead accorded little significance. But increasing sustainability awareness and legislative requirements concerning carbon emissions are now changing that view. Car makers are looking hard at alternative materials. Energy is used to build a car and energy is used to run it. High oil prices mean that the cost of the gas consumed during the life of a car is comparable with the cost of the car itself. Consumers now want more fuel-efficient cars, and more fuel-efficient cars have lower carbon emissions. This chapter addresses these concerns. The chapter discusses various ways of achieving energy economy. The chapter also focuses on alternative materials that can be used, which is divided into primary mechanical properties and secondary properties. Although resistance to deflection and plastic yielding are obviously of first importance in choosing alternative materials, other properties too enter into the selection. The chapter concludes with a discussion of various production methods of cars.

Michael F. Ashby; David R.H. Jones


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fuels of the Future for Cars and Trucks | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Final Report - Hydrogen Delivery Infrastructure Options Analysis Cost Analysis of Hydrogen Storage Systems FreedomCAR and Fuel Partnership 2009 Highlights of Technical...


Next Generation Lunch: Revealing the Worlds First 3D Printed Car (text version)  

Energy.gov (U.S. Department of Energy (DOE))

Below is the text version for the Next Generation Lunch: Revealing the Worlds First 3D Printed CarVideo.


REVA Electric car: a case study of innovation at RECC  

Science Journals Connector (OSTI)

High levels of pollution in urban areas have forced automobile companies to think innovative ways of manufacturing vehicles to mitigate pollution. As a result, development of electric vehicles has gained acceptance worldwide. With innovation as the primary motto, REVA, India's first electric car was developed and commercialised by REVA Electric Car Company (RECC), a joint venture of Maini Group in India and AEV LLC of California, USA. Supports in different forms have helped the company to carve a niche for itself in the domestic as well as in the global market. RECC's strategy is to sustain its competitiveness and apply continuous improvement as a design philosophy. Though electric vehicle technology is at a nascent stage in India, but RECC definitely sees a long and bright future for electric vehicles in India. RECC will continue to strive towards its vision of establishing a tradition of excellence and leadership in environment friendly urban transportation by offering the best value and highest quality electric vehicles for city mobility. Strong orientation towards R&D, technology planning and quality together with a highly motivated and dynamic team, RECC has the potential to become global. Clearly defined vision, leadership in innovation and a quest for excellence have been the key to the success of the concept and incessant driving force behind RECC.

Chetan Kumaar Maini



The price of energy efficiency in the Spanish car market  

Science Journals Connector (OSTI)

Abstract Due to climate change, energy dependence and other energy-related issues, most developed countries are attempting to reduce fossil-fuel use in the transport sector. Accordingly, there are several instruments that have been in place for many years, such as mandatory design standards, taxes on fuels, car purchase and ownership, and energy efficiency labels. Yet it is still not clear whether consumers value energy efficiency as a characteristic of vehicles. In this paper we use the European labelling system for light vehicles, which classifies automobiles according to their relative fuel consumption levels, as a novel, alternative indicator for energy efficiency. Moreover, we use a unique database that incorporates official commercial prices along with prices obtained through mystery shopping at a selection of Spanish car retailers. We apply the hedonic price method to this database to estimate the price functions for vehicles and thereby obtain the marginal price of vehicles rated highly in terms of energy efficiency. Our results show that vehicles labelled A and B are sold at prices 3 to 5.9 percent higher than those with similar characteristics but lower energy-efficiency labels.

Ibon Galarraga; Ana Ramos; Josu Lucas; Xavier Labandeira



Buying a Car? Find Out What it Will REALLY Cost You Each Year | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Buying a Car? Find Out What it Will REALLY Cost You Each Year Buying a Car? Find Out What it Will REALLY Cost You Each Year Buying a Car? Find Out What it Will REALLY Cost You Each Year November 9, 2009 - 12:52pm Addthis Allison Casey Senior Communicator, NREL If you're in the market for a new car, you've probably been doing a lot of research. Talking to friends, reading reviews, scoping out other cars on the road, maybe even taking some test drives. You probably have a list of things you want in car, and you should consider all of these points of comparison before you make a final decision. Buying a car can be confusing, and you may feel overwhelmed by data points, but I'm going to give you more! Aren't you lucky? Before you start banging your head on the desk, read on. This one might be even more important than the car's color.


Model Year 2013-2014 SmartWay MidsizeCars Year Model Displ Cyl  

NLE Websites -- All DOE Office Websites (Extended Search)

MidsizeCars MidsizeCars Year Model Displ Cyl Trans Drive Fuel Sales Area Stnd Stnd Description Underhood ID Veh Class Smog Rating City MPG Hwy MPG Cmb MPG Greenhouse Gas Rating SmartWay 2013 AUDI A6 2 4 SCV-8 2WD Gasoline CA U2 California LEV-II ULEV DADXV02.03UB midsize car 6 25 33 28 7 yes 2013 BMW 528i 2 4 SemiAuto-8 4WD Gasoline CA U2 California LEV-II ULEV DBMXJ02.0N20 midsize car 6 22 33 26 7 yes 2013 BMW 528i 2 4 SemiAuto-8 2WD Gasoline CA U2 California LEV-II ULEV DBMXJ02.0N20 midsize car 6 24 34 28 7 yes 2013 BMW ActiveHybrid 5 3 6 SemiAuto-8 2WD Gasoline CA U2 California LEV-II ULEV DBMXV03.0AH5 midsize car 6 23 30 26 7 yes 2013 BUICK Lacrosse 2.4 4 SemiAuto-6 2WD Gasoline FA B5 Federal Tier 2 Bin 5 DGMXV02.4060 midsize car 5 25 36 29 8 yes 2013 BUICK Lacrosse 2.4 4 SemiAuto-6 2WD Gasoline CA L2 California LEV-II LEV DGMXV02.4060 midsize car 5 25 36 29 8 yes 2013 BUICK Regal


Model Year 2013-2014 SmartWay Large Cars Year Model Displ Cyl  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Cars Large Cars Year Model Displ Cyl Trans Drive Fuel Sales Area Stnd Stnd Description Underhood ID Veh Class Smog Rating City MPG Hwy MPG Cmb MPG Greenhouse Gas Rating SmartWay 2013 BMW X1 sDrive28i 2 4 SemiAuto-8 2WD Gasoline CA U2 California LEV-II ULEV DBMXJ02.0N20 large car 6 24 34 28 7 yes 2013 BMW X1 xDrive28i 2 4 SemiAuto-8 4WD Gasoline CA U2 California LEV-II ULEV DBMXJ02.0N20 large car 6 22 33 26 7 yes 2013 FORD C-MAX Hybrid 2 4 CVT 2WD Gasoline FC B3 Federal Tier 2 Bin 3 DFMXV02.0VZL large car 7 45 40 43 10 yes 2013 FORD Taurus 2 4 SemiAuto-6 2WD Gasoline CA U2 California LEV-II ULEV DFMXV02.0VE6 large car 6 22 32 26 7 yes 2013 HYUNDAI Sonata 2 4 Auto-6 2WD Gasoline CA U2 California LEV-II ULEV DHYXV02.01FE large car 6 22 34 26 7 yes 2013 HYUNDAI Sonata 2.4 4 Auto-6 2WD Gasoline CA U2 California LEV-II ULEV DHYXV02.41GE large car 6 24 35 28 7 yes 2013 HYUNDAI Sonata


Did "Cash for Clunkers" Deliver? The Consumer Effects of the Car Allowance Rebate System  

E-Print Network (OSTI)

Did "Cash for Clunkers" Deliver? The Consumer Effects of the Car Allowance Rebate System Meghan R-zettelmeyer@kellogg.northwestern.edu #12;Did "Cash for Clunkers" Deliver? The Consumer Effects of the Car Allowance Rebate System Abstract investigate how much of the rebate benefited consumers as opposed to dealers, whether the rebate crowded out

Rothman, Daniel


Riversimple to trial fuel cell cars in two rural English counties  

Science Journals Connector (OSTI)

In the UK, Riversimple, the Ludlow-based sustainable car company, has signed a ground-breaking agreement with Shropshire and Herefordshire, that will see them cooperate in finding both private citizens and organizations to test drive hydrogen fuel cell cars, and locate and staff suitable refueling points.



Calibrating Steady-State Traffic Stream and Car-Following Models Using Loop Detector Data  

Science Journals Connector (OSTI)

The research reported in this paper develops a heuristic automated tool (SPD_CAL) for calibrating steady-state traffic stream and car-following models using loop detector data. The performance of the automated procedure is then compared to off-the-shelf ... Keywords: calibration of traffic simulation software, car-following models, traffic modeling, traffic stream models

Hesham Rakha; Mazen Arafeh



An Intelligent Video System for Vehicle Localization and Tracking in Police Cars  

E-Print Network (OSTI)

An Intelligent Video System for Vehicle Localization and Tracking in Police Cars Amirali Jazayeri. Particularly, detecting a tracked or stopped vehicle is a crucial task for further examination of suspects, Experimentation Keywords In-Car Video, Tracking, Vehicle Detection, Spatial-Temporal Image, 1D projection

Tuceryan, Mihran


The influence of lubrication on the energy cost of pushing a mine car  

Science Journals Connector (OSTI)

The oxygen intakes of 16 well-trained Bantu mine recruits were studied while they pushed a mine car at a constant speed of 2 miles p. h. The car had dry or partially lubricated axles and was pushed with loads ...

C. G. Williams; J. H. Viljoen



Relay Attacks on Passive Keyless Entry and Start Systems in Modern Cars  

E-Print Network (OSTI)

to certain types of relay attacks 1 . Our attack allowed to open and start the car while the true distanceRelay Attacks on Passive Keyless Entry and Start Systems in Modern Cars Aur´elien Francillon, Boris.francillon, boris.danev, srdjan.capkun}@inf.ethz.ch Abstract We demonstrate relay attacks on Passive Keyless Entry


Fixed target electroweak and hard scattering physics  

SciTech Connect

The possibilities for future physics and experiments involving weak and electromagnetic interactions, neutrino oscillations, general hard scattering and experiments involving nuclear targets were explored. The studies were limited to the physics accessible using fixed target experimentation. While some of the avenues explored turn out to be relatively unrewarding in the light of competition elsewhere in the world, there are a number of positive conclusions reached about experimentation in the energy range available to the Main Injector and Tevatron. Some of the experiments would benefit from the increased intensity available from the Tevatron utilizing the Main Injector, while some require this increase. Finally, some of the experiments would use the Main Injector low energy, high intensity extracted beams directly. A program of electroweak and hard scattering experiments at fixed target energies retains the potential for important contributions to physics. The key to major parts of this program would appear to be the existence of the Main Injector. 115 refs, 17 figs.

Brock, R. (Michigan State Univ., East Lansing, MI (USA)); Brown, C.N.; Montgomery, H.E. (Fermi National Accelerator Lab., Batavia, IL (USA)); Corcoran, M.D. (eds.) (Rice Univ., Houston, TX (USA))



Protection Programming Defensive Planning for Fixed Facilities  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NOT MEASUREMENT NOT MEASUREMENT SENSITIVE DOE STD-1207-2012 December 2012 DOE STANDARD Protection Program Defensive Planning For Fixed Facilities U.S. Department of Energy AREA SANS Washington, D.C. 20585 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. DOE STD-1207-2012 This Page Intentionally Left Blank ii DOE STD-1207-2012 TABLE OF CONTENTS FOREWORD..................................................................................................................................v PROTECTION PROGRAM DEFENSIVE PLANNING ..........................................................1 1. SCOPE............................................................................................................................ 1 2. PURPOSE. ..................................................................................................................... 1


Private development of artificial reefs  

E-Print Network (OSTI)

when compared with terestrial ecosystems. Recent studies at Woods Hole Oceanographic Institution emphasized that the oceans are far from an unlimited resource. The net pro- duction of the open ocean is about 50 grams of fixed car- bon per square... enhanced already existing fisheries. The continental shelf of the Gulf of Mexico is an expanse of shallow ocean bottom, and is the area inhabited by the majority of the commercially valuable reef fishes. Much of the shelf area, however, is r...

Burns, Arthur Allen



Vehicle Technologies Office: Fact #751: October 29, 2012 Plug-in Car Sales  

NLE Websites -- All DOE Office Websites (Extended Search)

1: October 29, 1: October 29, 2012 Plug-in Car Sales Higher in the U.S. Compared to Western Europe and China to someone by E-mail Share Vehicle Technologies Office: Fact #751: October 29, 2012 Plug-in Car Sales Higher in the U.S. Compared to Western Europe and China on Facebook Tweet about Vehicle Technologies Office: Fact #751: October 29, 2012 Plug-in Car Sales Higher in the U.S. Compared to Western Europe and China on Twitter Bookmark Vehicle Technologies Office: Fact #751: October 29, 2012 Plug-in Car Sales Higher in the U.S. Compared to Western Europe and China on Google Bookmark Vehicle Technologies Office: Fact #751: October 29, 2012 Plug-in Car Sales Higher in the U.S. Compared to Western Europe and China on Delicious Rank Vehicle Technologies Office: Fact #751: October 29, 2012


EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge May 18, 2010 - 7:30am Addthis While most college students' experience with vehicles goes no further than the beater they picked up for a few thousand dollars, students participating in the EcoCAR: The NeXT Challenge competition get to experience the cutting-edge of driving technology. The competition, which was established by the U.S. Department of Energy and General Motors, is a three year advanced vehicle engineering contest. Yesterday, May 17, was the first day of their Year 2 judging sessions. In EcoCAR, students from 16 universities across North America are competing against each other to build the most environmentally sustainable and practical vehicle. This year's teams have adopted a number of advanced


Vehicle Technologies Office: Fact #568: April 27, 2009 For Modern Cars,  

NLE Websites -- All DOE Office Websites (Extended Search)

8: April 27, 8: April 27, 2009 For Modern Cars, Replacing an Air Filter Will Improve Performance but Not Fuel Economy to someone by E-mail Share Vehicle Technologies Office: Fact #568: April 27, 2009 For Modern Cars, Replacing an Air Filter Will Improve Performance but Not Fuel Economy on Facebook Tweet about Vehicle Technologies Office: Fact #568: April 27, 2009 For Modern Cars, Replacing an Air Filter Will Improve Performance but Not Fuel Economy on Twitter Bookmark Vehicle Technologies Office: Fact #568: April 27, 2009 For Modern Cars, Replacing an Air Filter Will Improve Performance but Not Fuel Economy on Google Bookmark Vehicle Technologies Office: Fact #568: April 27, 2009 For Modern Cars, Replacing an Air Filter Will Improve Performance but Not Fuel Economy on Delicious


DOE Hydrogen Analysis Repository: Review of FreedomCAR and Fuel Partnership  

NLE Websites -- All DOE Office Websites (Extended Search)

Review of FreedomCAR and Fuel Partnership Review of FreedomCAR and Fuel Partnership Project Summary Full Title: Review of the Research Program of the U.S. DRIVE Partnership Previous Title(s): Review of the Research Program of the FreedomCAR and Fuel Partnership Project ID: 203 Principal Investigator: Brief Description: The National Research Council's Committee on Review of the FreedomCAR and Fuel Research Program evaluates the structure and management of the Partnership as well as the Partnership's adequacy, progress, and technical problem areas on a biannual basis. Keywords: Advanced technology vehicles, fuel cells, hydrogen storage, hydrogen production Purpose Evaluate DOE-sponsored research efforts directed at the goal of a hydrogen economy under the U.S. DRIVE Partnership (formerly the FreedomCAR and Fuel

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Middle Schoolers Face-Off in Model Car Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Schoolers Face-Off in Model Car Challenge Schoolers Face-Off in Model Car Challenge Middle Schoolers Face-Off in Model Car Challenge May 1, 2012 - 10:04am Addthis The team of James Wei, Andrew Jin, Andy Xu, Allen Guo, and Will Chang from Daniel Wright Middle School, in Lincolnshire, Illinois, built the fastest Lithium-Ion Battery Powered Model Car at this year's competition. At sub-6-second runs, their vehicle easily advanced to victory, being a full second faster than its closest rival. | Photo by Jack Dempsey, National Science Bowl. The team of James Wei, Andrew Jin, Andy Xu, Allen Guo, and Will Chang from Daniel Wright Middle School, in Lincolnshire, Illinois, built the fastest Lithium-Ion Battery Powered Model Car at this year's competition. At sub-6-second runs, their vehicle easily advanced to victory, being a full


Betting on Chinese electric cars? analysing BYD's capacity for innovation  

Science Journals Connector (OSTI)

This article will examine some of the reasons why the automobile industry in China has become the subject of so much interest in recent years. In particular, it will focus on its capacity for innovation through an in-depth study of one company: the BYD group. The article will examine the growth of the group and trace the development of the innovative strategies that have helped it to become a significant player in the electric car market. It will highlight three particular levels at which innovation has taken place, the organisational, human resource management and technological levels, and will analyse how these innovations interrelate to the overall breakthrough strategy of BYD. The article concludes with some observations about the capacity of BYD to continue to innovate, prosper and grow using its existing strategy.

Hua Wang; Chris Kimble



Can alternative car fuels reduce greenhouse gas emissions?  

Science Journals Connector (OSTI)

There has been controversy in the published literature regarding the scope for alternative fuels to reduce greenhouse gas emissions in passenger transport. This paper aims to resolve this question in an Australian context, and, where possible, to calculate the costs of emission reductions. Fossil-fuel-based alternatives give either marginal or uncertain reductions. Ethanol from sugar cane, the most promising biomass fuel, has high costs per tonne of CO2 reduction, and, when other trace gases are considered, shows no definite improvement over petrol. Electric vehicles, if deployed today in Australia, would exacerbate greenhouse warming. Only if an alternative new energy source such as wind power generated 15% or more of total electricity would emission reductions occur compared to equivalent petrol-fuelled cars.

P. Moriarty



The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis--A Reflively Designed Survey of New-car-buying, Multi-vehicle California Households  

E-Print Network (OSTI)

Gromer, C. New age of the electric car. Popular Mechanics.VEHICLES strongly favor electric cars, but on the other,electric vehicles, if an electric car was available to buy

Turrentine, Thomas; Kurani, Kenneth



The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis -- A Reflexively Designed Survey of New-Car-Buying Multi-Vehicle California Households  

E-Print Network (OSTI)

Gromer, C Newage of the electric car. Popular Mechanics.VEHICLES strongly favor electric cars, but on the other,electric vehicles, if an electric car wasavailable to buy

Turrentine, Thomas; Kurani, Kenneth S.



Fact #716: February 27, 2012 Diesels are more than Half of New Cars Sold in Western Europe  

Energy.gov (U.S. Department of Energy (DOE))

In 2011, nearly 52% of all new cars sold in Western Europe were diesel. In Belgium, Norway, France and Spain more than 70% of the new car market in 2011 were diesels. The market penetration of...


Fact #638: August 30, 2010 Average Expenditure for a New Car Declines in Relation to Family Earnings  

Energy.gov (U.S. Department of Energy (DOE))

Although the average expenditure for a new car has increased from 1967 to 2009, family earnings have also been on the rise. For this period, new car expenditures went from $3,216 to $23,186, while...


Fact #848: November 24, 2014 Nearly Three-Fourths of New Cars have Fuel Economy above 25 Miles per Gallon  

Energy.gov (U.S. Department of Energy (DOE))

In 1975, only three percent of all new cars had a fuel economy above 25 miles per gallon (mpg), but by 2014, 73% did. Great improvements were made in the fuel economy of cars from 1975 to 1985, so...


Comparative analysis of household car, motorcycle and bicycle ownership between Osaka metropolitan area, Japan and Kuala Lumpur, Malaysia  

Science Journals Connector (OSTI)

Motorcycle is still frequently used in many Asian cities, and the fuel efficiency is higher than car. Thus, the switch back from car to motorcycle can bring considerable fuel savings. Moreover, if it is possible ...

Toshiyuki Yamamoto



Development of a new light-weight car audio using polycarbonate/acrylonitrile-butadiene-styrene copolymer composite based hybrid material  

Science Journals Connector (OSTI)

Engineering plastics have been applied to automobile components ... /ABS) based composite material to the car audio chassis was investigated with respect to the key properties of a car audio chassis mainly throug...

Seong-Ho Jeon; Woo Chun Choi; Tae-Hong Park



CARS 2002 H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights reserved.  

E-Print Network (OSTI)

CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors;CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) © CARS

Paris-Sud XI, Université de


Local Motors Begins Their Six Day Quest to 3D Print the Strati Car Live at IMTS  

Energy.gov (U.S. Department of Energy (DOE))

An article detailing Local Motors' preparation to 3D print a car at the September 2014 International Manufacturing Technology Show.


Natural and synthetic DNA elements with the CArG motif differ in expression and protein-binding properties.  

Science Journals Connector (OSTI)

...research-article Research Article Natural and synthetic DNA elements with the CArG motif differ...cognate promoters. Natural and synthetic DNA elements with the CArG motif differ...Vol. 11, No. 12 Natural and Synthetic DNA Elements with the CArG Motif Differ...

I M Santoro; K Walsh



iDriver -Human Machine Interface for Autonomous Cars Arturo Reuschenbach, Miao Wang, Tinosch Ganjineh, Daniel Gohring  

E-Print Network (OSTI)

¨at Berlin Germany Abstract-- Modern cars are equipped with a variety of sensors, advanced driver assistance autonomous research cars "Spirit of Berlin" and "Made in Germany". Key Words: autonomous, car, iPad, remote control, driver assistance, spirit of berlin, made in germany I. INTRODUCTION AND MOTIVATION With modern

Göhring, Daniel


The initial stages of bioglass dissolution: a CarParrinello molecular-dynamics study of the glasswater interface  

Science Journals Connector (OSTI)

...doi:10.1021/jp805206z ) Car, R. , and M. Parrinello1985Unified...amorphous silica surfaces:a Car-Parrinello simulation studyJ...multicomponent silicate glasses:Car-Parrinello molecular dynamics...layers on defect-free and defective anatase TiO2(101) surfacesJ...



Optical and infrared light curves of the eclipsing X-ray binary V395 Car = 2S 0921630  

Science Journals Connector (OSTI)

......Fig. 4; folding on the alternative periods results in light...Orbital light curves of V395 Car in all three bands B...long-period LMXB V395 Car. We refine the orbital...2003). This makes V395 Car a relatively low mass-transfer...obtained through the High Energy Astrophysics Science Archive......

T. A. Ashcraft; R. I. Hynes; E. L. Robinson



Neutron Electric Dipole Moment at Fixed Topology  

E-Print Network (OSTI)

We describe the finite volume effects of CP-odd quantities, such as the neutron electric dipole moment and the anapole moment in the $\\theta$-vacuum, under different topological sectors. We evaluate the three-point Green's functions for the electromagnetic current in a fixed non-trivial topological sector in order to extract these CP-odd observables. We discuss the role of zero modes in the CP-odd Green's function and show that, in the quenched approximation, there is a power divergence in the quark mass for CP-odd quantities at finite volume.

Keh-Fei Liu



Fixed point theorems in ultrametric spaces  

E-Print Network (OSTI)

Point Theorems in Ultrametric Spaces. (May 1972) Steven E. Fullbright, B. A. , Texas A&M University M. S. , Texas A&M University Directed by: L. F. Guseman, Jr. and Jack Bryant Let (X, d) be an ultrametric space and f a contractive selfmap of X.... It is shown that the existence of fixed points of f is related to simple properties of the metric d. iv ACKNOWLEDGEMENTS I wish to thank the following people for their assistance and support in writing this thesis: Larry Guseman, who provided guidance...

Fullbright, Steven Edward



Fixed Target Beauty Physics Experimental Programs  

SciTech Connect

The current and near term future fixed target physics efforts in observing particles with open beauty are reviewed. This includes a compilation of the non-observation upper limits and the observation of both upsilon and b-states. A short discussion of the theoretical predictions for the hadro-produced beauty pairs is included. The major part of this review is devoted to the techniques and tricks employed, a survey of the current and proposed experiments. A personal summary of the experimental prospects concludes this report. 28 refs., 26 figs.

Garbincius, P.H.



EcoCAR 2 Announces Year One Winner: Mississippi State University |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR 2 Announces Year One Winner: Mississippi State University EcoCAR 2 Announces Year One Winner: Mississippi State University EcoCAR 2 Announces Year One Winner: Mississippi State University May 24, 2012 - 10:40am Addthis NEWS MEDIA CONTACT (202) 586-4940 Los Angeles, Calif. - EcoCAR 2: Plugging In to the Future today named Mississippi State University its Year One winner at the EcoCAR 2012 Competition in Los Angeles. The 15 universities competing in EcoCAR 2 gathered for six days of judged competition this week with $100,000 in prize money up for grabs. EcoCAR 2, a three-year competition sponsored by the U.S. Department of Energy (DOE), General Motors (GM) and 25 other government and industry leaders, gives students the opportunity to gain real-world, eco-friendly automotive engineering experience while striving to improve the energy efficiency of an already highly-efficient vehicle -

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


FIXED PRICE RESIDUAL FUNDS POLICY Policy dated March 29, 1999  

E-Print Network (OSTI)

FIXED PRICE RESIDUAL FUNDS POLICY Policy dated March 29, 1999 After completion of all deliverables required under a fixed-price award, after costs in fulfilling the requirements of the award have been

Weston, Ken


Note on R&D expenditures and fixed capital formation  

Science Journals Connector (OSTI)

In this paper we deal with the fixed capital nature of the means of production and ... . We argue that these R&D current expenditures typically have the nature of fixed investments. ... then present an empirical ...

Mario De Marchi; Maurizio Rocchi



AAC R14-2 - Fixed Utilities | Open Energy Information  

Open Energy Info (EERE)

Fixed Utilities Jump to: navigation, search OpenEI Reference LibraryAdd to library Legal Document- RegulationRegulation: AAC R14-2 - Fixed UtilitiesLegal Abstract This chapter...


On the computational content of the brouwer fixed point theorem  

Science Journals Connector (OSTI)

We study the computational content of the Brouwer Fixed Point Theorem in the Weihrauch lattice. One of our main results is that for any fixed dimension the Brouwer Fixed Point Theorem of that dimension is computably equivalent to connected choice of ...

Vasco Brattka; Stphane Le Roux; Arno Pauly



Integration of streaming and elastic traffic: a fixed point approach  

Science Journals Connector (OSTI)

We present a fixed point approach to evaluate the quality of service of streaming traffic multiplexed with elastic traffic in multi-service networks. First, we handle elastic traffic and streaming traffic separately, and then we derive a general fixed ... Keywords: elastic traffic, fixed point, quality of service, streaming traffic

H. Hassan; O. Brun; J. M. Garcia; D. Gauchard



Viscosity of alumina nanoparticles dispersed in car engine coolant  

SciTech Connect

The present paper, describes our experimental results on the viscosity of the nanofluid prepared by dispersing alumina nanoparticles (<50 nm) in commercial car coolant. The nanofluid prepared with calculated amount of oleic acid (surfactant) was tested to be stable for more than 80 days. The viscosity of the nanofluids is measured both as a function of alumina volume fraction and temperature between 10 and 50 C. While the pure base fluid display Newtonian behavior over the measured temperature, it transforms to a non-Newtonian fluid with addition of a small amount of alumina nanoparticles. Our results show that viscosity of the nanofluid increases with increasing nanoparticle concentration and decreases with increase in temperature. Most of the frequently used classical models severely under predict the measured viscosity. Volume fraction dependence of the nanofluid viscosity, however, is predicted fairly well on the basis of a recently reported theoretical model for nanofluids that takes into account the effect of Brownian motion of nanoparticles in the nanofluid. The temperature dependence of the viscosity of engine coolant based alumina nanofluids obeys the empirical correlation of the type: log ({mu}{sub nf}) = A exp(BT), proposed earlier by Namburu et al. (author)

Kole, Madhusree; Dey, T.K. [Thermophysical Measurements Laboratory, Cryogenic Engineering Centre, Indian Institute of Technology, Kharagpur 721 302 (India)



Review of the Research Program of the FreedomCAR and Fuel Partnership:  

Open Energy Info (EERE)

Review of the Research Program of the FreedomCAR and Fuel Partnership: Review of the Research Program of the FreedomCAR and Fuel Partnership: Third Report Jump to: navigation, search Tool Summary Name: Review of the Research Program of the FreedomCAR and Fuel Partnership: Third Report Agency/Company /Organization: National Academies Press Focus Area: Vehicles Topics: Best Practices Website: www.nap.edu/catalog.php?record_id=12939 This report reviews the FreedomCAR and Fuel Partnership, a public-private partnership focusing on the high-risk, pre-competitive research needed to develop clean, energy efficient vehicle and infrastructure technologies to transform the personal transportation system. How to Use This Tool This tool is most helpful when using these strategies: Improve - Enhance infrastructure & policies Learn more about the avoid, shift, improve framework for limiting air


THURSDAY: Secretary Chu Welcomes Students and Tours Vehicles at EcoCAR's  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

THURSDAY: Secretary Chu Welcomes Students and Tours Vehicles at THURSDAY: Secretary Chu Welcomes Students and Tours Vehicles at EcoCAR's Finish Line THURSDAY: Secretary Chu Welcomes Students and Tours Vehicles at EcoCAR's Finish Line June 15, 2011 - 12:00am Addthis Washington, D.C. - On Thursday, June 16, 2011, Energy Secretary Steven Chu will welcome the sponsors and 16 student teams participating in EcoCAR: the NeXt Challenge, a three-year collegiate student engineering competition that focuses on advanced vehicle technologies that minimize fuel consumption and emissions, to the Finish Line at the U.S. Department of Energy in Washington, D.C. At the Finish Line, Secretary Chu will tour the vehicles on display and speak with the students who engineered and built them. The winner of the overall competition will be announced at the EcoCAR


CarBen Version 3: Multisector Carbon Dioxide Emissions Accounting Tool |  

Open Energy Info (EERE)

CarBen Version 3: Multisector Carbon Dioxide Emissions Accounting Tool CarBen Version 3: Multisector Carbon Dioxide Emissions Accounting Tool Jump to: navigation, search Tool Summary LAUNCH TOOL Name: CarBen Version 3: Multisector Carbon Dioxide Emissions Accounting Tool Focus Area: Geothermal Power Topics: Policy, Deployment, & Program Impact Website: www.netl.doe.gov/energy-analyses/refshelf/PubDetails.aspx?Action=View& Equivalent URI: cleanenergysolutions.org/content/carben-version-3-multisector-carbon-d Language: English Policies: Deployment Programs DeploymentPrograms: Technical Assistance The CarBen model enables users to conduct wedge anlayses of scenarios for mitigating U.S. greenhouse gas emissions. The spreadsheet-based tool relies upon expert opinion for scenario formulation and is not intended to be used


Emissions and Experiences with E85 Converted Cars in the BEST Project |  

Open Energy Info (EERE)

Emissions and Experiences with E85 Converted Cars in the BEST Project Emissions and Experiences with E85 Converted Cars in the BEST Project Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Emissions and Experiences with E85 Converted Cars in the BEST Project Agency/Company /Organization: BioEthanol for Sustainable Transport Focus Area: Fuels & Efficiency Topics: Best Practices Website: www.best-europe.org/upload/BEST_documents/info_documents/Best%20report The BioEthanol for Sustainable Transport (BEST) project converted vehicles from petrol to E85, exploring the possibilities, advantages, and any difficulties. Several suggestions are presented for how converted cars may be incorporated into Swedish government financial incentives. How to Use This Tool This tool is most helpful when using these strategies: Shift - Change to low-carbon modes


Fact #557: February 9, 2009 Change in New Car Dealerships by State  

Energy.gov (U.S. Department of Energy (DOE))

From 2007 to 2008 the total number of new car dealerships in the U.S. declined by 430 dealerships or about 2%. During this period, most states lost dealerships while 10 states remained the same or...


Rockets 2 Race Cars Teacher Program at the Kentucky Speedway (NASA)  

Energy.gov (U.S. Department of Energy (DOE))

Register here. Go Green Edition / The Heat is ON! Get your students revved up about science, technology, engineering and mathematics with NASA's Rockets 2 Race Cars STEM Education program....


CO2 Changes from the Increasing Percentage of Diesel Passenger Cars in Norway  

Science Journals Connector (OSTI)

The changes in CO2 emissions are calculated for different percentages of Diesel penetration in the Norwich market. ... The majority of the EU and Norwich markets corresponds to four classes:? economic, small car, lower medium, and upper medium. ...

Efthimios Zervas; Georgios Bikas



A method for perceptual evaluation of products by naive subjects: application to car engine sounds  

E-Print Network (OSTI)

studies have been carried out on diesel motor sounds: firstly, the panel of experts of a car maker made. Introduction In today's highly competitive markets, developing new products that satisfy consumers' needs

Paris-Sud XI, Université de


NREL: News - Winners for NREL's 24th Solar and Lithium Ion Car...  

NLE Websites -- All DOE Office Websites (Extended Search)

batteries used in the competition are supplied by the DOE and teams purchase authorized solar panels, then design and build the rest of their cars themselves. Solar and lithium...


Development of an 800-V Electric Car with Rear-Wheel Drive  

Science Journals Connector (OSTI)

Increasing the voltage level in the traction power network is an evident and reasonable development step in producing sporty and powerful electric cars. Therefore, the engineers at AVL are ... with 1200-V IGBT te...

Dr.-Ing. Armin Engstle; Dipl.-Ing. Mathias Deiml



Overview of FreedomCAR & Fuels Partnership/DOE Delivery Program...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

on FreedomCAR & Fuells Partnership for the DOE Hydrogen Delivery High-Pressure Tanks and Analysis Project Review Meeting held February 8-9, 2005 at Argonne National...


Redesigning experimental equipment for determining peak pressure in a simulated tank car transfer line  

E-Print Network (OSTI)

When liquids are transported from storage tanks to tank cars, improper order of valve openings can cause pressure surges in the transfer line. To model this phenomenon and predict the peak pressures in such a transfer line, ...

Diaz, Richard A



Fact #575: June 15, 2009 Diesel Car Sales in Europe Still Over 50% in 2008  

Energy.gov (U.S. Department of Energy (DOE))

More than half of all cars sold in Western Europe since 2006 are fueled by diesel. The overall share of diesel sales, however, declined slightly from 2007 to 2008. Belgium, France, and the United...


The Future of Manufacturing Takes Shape: 3D Printed Car on Display...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Courtesy of Local Motors Carbon Fiber Pellets 4 of 6 Carbon Fiber Pellets Pellets of plastic mixed with carbon fiber were used in the production process of the 3D-printed car....

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Performance Comparison of Hydrogen Fuel Cell and Hydrogen Internal Combustion Engine Racing Cars  

Science Journals Connector (OSTI)

Students from RMIT University and the University of Applied Sciences Ingolstadt have collaborated to build a hydrogen-powered racing car. As part of the initial conceptual design ... lap simulation was developed ...

G. Pearson; M. Leary; A. Subic; J. Wellnitz



Nanotechnology in our Daily Life Iridescent car paint: Based on interference colors  

E-Print Network (OSTI)

Nanotechnology in our Daily Life Iridescent car paint: Based on interference colors (like a butterly, no bleaching after 5 years Miami) #12;Nanotechnology on our Desktops Hard Disk Sensor Medium

Himpsel, Franz J.


Fact #847: November 17, 2014 Cars were Over 50% of Light Vehicle Production in 2014  

Energy.gov (U.S. Department of Energy (DOE))

In 1975, cars were just over 80% of light vehicle production. From the early 1980s to 2005, light trucks were an increasing share of the light vehicles produced. The share of sport utility vehicles...


Ohio State University Races to the Finish as the Winner of EcoCAR 2  

Office of Energy Efficiency and Renewable Energy (EERE)

After three years of intense competition, the team from Ohio State University takes first place in EcoCAR 2 for its energy-efficient, consumer-ready alternative fuel vehicle design.


Fact #856 January 19, 2015 Plug-in and Hybrid Cars Receive High...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

classification does not include pickups, vans, or sport-utility vehicles. Fact 856 Dataset Supporting Information Share of Survey Respondents Who WOULD Buy Their Car Again 1-3...


Cars and the City: An Investigation of Transportation and Residential Location Choices in New York City  

E-Print Network (OSTI)

Higher subway line availability raises the utility of thatof subway lines near home rises, the utility of alternativesof subway lines at home reduces the utility of owning a car

Salon, Deborah



Optimal driving strategy for a solar car on a level road  

Science Journals Connector (OSTI)

......energy may be stored in batteries. The cars start the race in Darwin with full batteries-- enough energy to travel...40 FIG. II. Predicted battery energy profile for the 1993...velocities to the minimization of fuel consumption in the control......




Coherent Anti-Stokes Raman Scattering (CARS) Microscopy for Three-Dimensional Flow Characterization in Microfluidics  

Science Journals Connector (OSTI)

The diffusion of mixing species inside of microchannels, as measured by CARS microscopy, is related to the flow field for the purpose of resolving non-symmetric velocity profiles.

Schafer, Dawn N; Squier, Jeff; Mller, Michiel; Bonn, Mischa; Van Maarseveen, Jan


Fact #597: November 16, 2009 Median Age of Cars and Trucks Rising in 2008  

Energy.gov (U.S. Department of Energy (DOE))

The median age of cars and trucks in the U.S. continued to grow in 2008. Due to the economic climate and high gasoline prices that summer, consumers held onto their vehicles longer and delayed new...


Fact #847: November 17, 2014 Cars were Over 50% of Light Vehicle...  

Energy Savers (EERE)

847: November 17, 2014 Cars were Over 50% of Light Vehicle Production in 2014 fotw847web.xlsx More Documents & Publications Fact 848: November 24, 2014 Nearly Three-Fourths of...


Linings with optimum heat-emission surfaces for cars receiving and transporting incandescent coke  

SciTech Connect

The least reliable components of the cars which receive and transport incandescent coke are the lining plates. This applies to both the quenching cars used for wet quenching and the hot-coke cars used in the dry cooling process. Technical advances have been described whereby the life of car linings is prolonged by increasing heat emission from the lining plate surfaces. As the heat emission level is enhanced the mean plate temperature is lowered and the lining life thereby prolonged; moreover, the between-servicings period is prolonged. This involves providing fins on the non-working (outer) plate surfaces. The problem of optimizing the size and shape of the fins with reference to heat emission remains unsolved: the requirement is maximum heat emission from plates of a given weight, or conversely minimum plate weight for a given heat emission level. 6 refs., 3 figs.

Kotlyar, B.D.; Pleshkov, P.I.; Gadyatskii, V.G. [and others



Fact #647: November 1, 2010 Sales Shifting from Light Trucks to Cars  

Energy.gov (U.S. Department of Energy (DOE))

From 2005 to 2009 light vehicle sales have gradually shifted toward cars over light trucks. The graph below shows this trend broken down by the major manufacturers. This trend is more evident among...


3D-Printed Car by Local Motors - The Strati | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

on the screen, along with the words "3DPrintedCar." The video continues to show the 3D printing process high speed, interspersed with diagrams of the Strati and close-up images of...


Electric vehicles energy consumption of car-following models  

Science Journals Connector (OSTI)

In this paper, we use the optimal velocity model, full velocity difference model, full velocity and acceleration difference model, and the car-following model with consideration of the traffic interruption probab...

Shichun Yang; Cheng Deng; Tieqiao Tang; Yongsheng Qian



Model Year 2013-2014 SmartWay Small Cars Year Model Displ Cyl  

NLE Websites -- All DOE Office Websites (Extended Search)

Small Cars Small Cars Year Model Displ Cyl Trans Drive Fuel Sales Area Stnd Stnd Description Underhood ID Veh Class Smog Rating City MPG Hwy MPG Cmb MPG Greenhouse Gas Rating SmartWay 2013 ACURA ILX 1.5 4 SCV-7 2WD Gasoline FC B3 Federal Tier 2 Bin 3 DHNXV01.5WF2 small car 7 39 38 38 9 yes 2013 ACURA ILX 1.5 4 SCV-7 2WD Gasoline FA B2 Federal Tier 2 Bin 2 DHNXV01.5YD2 small car 8 39 38 38 9 yes 2013 ACURA ILX 1.5 4 SCV-7 2WD Gasoline CA PZEV California PZEV DHNXV01.5YD2 small car 9 39 38 38 9 yes 2013 ACURA ILX 2 4 SemiAuto-5 2WD Gasoline CA U2 California LEV-II ULEV DHNXV02.0CB2 small car 6 24 35 28 7 yes 2013 ACURA TSX 2.4 4 SemiAuto-5 2WD Gasoline CA U2 California LEV-II ULEV DHNXV02.4DB3 small car 6 22 31 26 7 yes 2013 AUDI A4 2 4 Man-6 4WD Gasoline CA U2 California LEV-II ULEV DADXV02.03UB small car 6 22 32 26 7 yes 2013 AUDI A4 2 4 SCV-8 2WD Gasoline CA U2 California LEV-II ULEV DADXV02.03UB


Why Preparing Your Car For Winter Is a Good Idea (An Anecdote) | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Why Preparing Your Car For Winter Is a Good Idea (An Anecdote) Why Preparing Your Car For Winter Is a Good Idea (An Anecdote) Why Preparing Your Car For Winter Is a Good Idea (An Anecdote) February 23, 2010 - 5:30am Addthis Drew Bittner Web Manager, Office of Energy Efficiency and Renewable Energy This past month, we celebrated my little daughter's first birthday-which meant a trip from Virginia to New Jersey. Ordinarily, this isn't a major effort, but this was on the verge of the big snow storm on February 5. Naturally, we were a bit concerned about our travel prospects. I'm originally from Wisconsin and know what winter can do to a car and its passengers. That's why we took some care to prepare our car for what might have been truly horrifying driving. The tires on our car are new but we checked the air pressure anyway, just to be sure they were properly


Do tax incentives affect households? adoption of green cars? A panel study of the Stockholm congestion tax  

Science Journals Connector (OSTI)

Abstract Policymakers have made several attempts to introduce local and national policies to reduce CO2 emissions and stimulate the consumer adoption of alternative fuel vehicles (ethanol/E85 cars). The purpose of this paper is to analyze how a local policy measure impacts the composition of the car fleet over time. More specifically, we take advantage of the natural experiment setting caused by the introduction of the Stockholm congestion tax (2006) to analyze how the tax affected purchases of ethanol cars that were exempted from the tax. To estimate effects, we employ a Difference-in-differences methodology. By using a comprehensive database of the car fleet and car owners, sociodemographic and geographic factors are analyzed, which is unique in the existing literature. Our results suggest that the congestion tax had a significant impact on ethanol car purchases although the effect fades away over time. Furthermore, there is a positive relationship between the level of education and ethanol car purchases. Previous adoption of an ethanol car is found to be the strongest predictor of ethanol car purchases. Finally, data indicate that Stockholmers substantially increased purchases of ethanol cars half a year before the introduction of the congestion tax, which we refer to as an anticipation effect.

Andrea Mannberg; Johan Jansson; Thomas Pettersson; Runar Brnnlund; Urban Lindgren



Radiation-induced ICAM-1 Expression via TGF-?1 Pathway on Human Umbilical Vein Endothelial Cells; Comparison between X-ray and Carbon-ion Beam Irradiation  

Science Journals Connector (OSTI)

......expression in cells irradiated with car- bon-ion beam and the same...HUVE cells at 48 hours after car- bon beam irradiation. ICAM-1...human lymphoblasts and mice are defective in radiation- induced apoptosis...endothelial growth factor in lung car- cinoma cells. Int J Radiat......

Hiroki Kiyohara; Yasuki Ishizaki; Yoshiyuki Suzuki; Hiroyuki Katoh; Nobuyuki Hamada; Tatsuya Ohno; Takeo Takahashi; Yasuhiko Kobayashi; Takashi Nakano



Estimation of Yields of OH Radicals in Water Irradiated by Ionizing Radiation  

Science Journals Connector (OSTI)

......simulations by Monte Car- lo method have...time being, an alternative approach may still...the spur. The energy Es to form a spur...a function of energy (keV/amu...protons, helium- , car- bon-, neon...Solution with Car- bon- and Nitrogen...Chemistry of High-Energy Carbon, Neon......

Hiroshi Yamaguchi; Yukio Uchihori; Nakahiro Yasuda; Masashi Takada; Hisashi Kitamura



Apparatus for fixed bed coal gasification  

DOE Patents (OSTI)

An apparatus for fixed-bed coal gasification is described in which coal such as caking coal is continuously pyrolyzed with clump formation inhibited, by combining the coal with a combustible gas and an oxidant, and then continually feeding the pyrolyzed coal under pressure and elevated temperature into the gasification region of a pressure vessel. The materials in the pressure vessel are allowed to react with the gasifying agents in order to allow the carbon contents of the pyrolyzed coal to be completely oxidized. The combustion of gas produced from the combination of coal pyrolysis and gasification involves combining a combustible gas coal and an oxidant in a pyrolysis chamber and heating the components to a temperature of at least 1600.degree. F. The products of coal pyrolysis are dispersed from the pyrolyzer directly into the high temperature gasification region of a pressure vessel. Steam and air needed for gasification are introduced in the pressure vessel and the materials exiting the pyrolyzer flow down through the pressure vessel by gravity with sufficient residence time to allow any carbon to form carbon monoxide. Gas produced from these reactions are then released from the pressure vessel and ash is disposed of.

Sadowski, Richard S. (Greenville, SC)


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Diesel Particulate Oxidation Model: Combined Effects of Fixed...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Volatile Carbon Diesel Particulate Oxidation Model: Combined Effects of Fixed & Volatile Carbon Poster presented at the 16th Directions in Engine-Efficiency and Emissions Research...


Porcine adenovirus serotype 3 internalization is independent of CAR and ?v?3 or ?v?5 integrin  

Science Journals Connector (OSTI)

Nonhuman adenoviruses including porcine adenovirus serotype 3 (PAd3) are emerging vectors for gene delivery. \\{PAd3\\} efficiently transduces human and murine cells in culture, and circumvents preexisting humoral immunity in humans. The coxsackievirusadenovirus receptor (CAR) serves as a primary receptor and ?v?3 or ?v?5 integrin as a secondary receptor for several human adenovirus (HAd) subtypes including HAd5. In this study, we deduced the role of CAR, ?v?3 or ?v?5 integrin in \\{PAd3\\} internalization. Transduction experiments were conducted in human mammary epithelial (MCF-10A) cells using replication-defective PAd-GFP (PAd3 vector expressing green fluorescent protein [GFP]) and HAd-GFP (HAd5 vector expressing GFP). MCF-10A cells were treated with or without anti-human CAR, or anti-?v?3 or anti-?v?5 integrin antibodies prior to infection with HAd-GFP or PAd-GFP. Significant (P CAR- as well as ?v?3 or ?v?5 integrin-independent and the primary receptor for \\{HAd5\\} and \\{PAd3\\} were distinct. CAR- and ?v?3 or ?v?5 integrin-independent entry of \\{PAd3\\} vectors may have implications in targeting cell types that are not efficiently transduced by other adenoviral vectors.

Dinesh S. Bangari; Suresh K. Mittal



PPAR?-dependent induction of the energy homeostasis-regulating nuclear receptor \\{NR1i3\\} (CAR) in rat hepatocytes: Potential role in starvation adaptation  

Science Journals Connector (OSTI)

A tight hormonal control of energy homeostasis is of pivotal relevance for animals. Recent evidence suggests an involvement of the nuclear receptor \\{NR1i3\\} (CAR). Fasting induces CAR by largely unknown mechanisms and CAR-deficient mice are defective in fasting adaptation. In rat hepatocytes CAR was induced by WY14643, a PPAR?-agonist. A DR1 motif in the CAR promoter was necessary and sufficient for this control. The PPAR?-dependent increase in CAR potentiated the phenobarbital-induced transcription of the prototypical CAR-dependent gene CYP2B1. Since free fatty acids are natural ligands for PPAR?, a fasting-induced increase in free fatty acids might induce CAR. In accordance with this hypothesis, CAR induction by fasting was abrogated in PPAR?-deficient mice.

Nadine Wieneke; Karen I. Hirsch-Ernst; Manuela Kuna; Sander Kersten; Gerhard P. Pschel




Science Journals Connector (OSTI)

Sep 10, 1975 ... cepts radiant energy and uses it to pro- duce new ... Here we present an alternative derivation of Ban- ..... and particulate organic car- bon were...




E-Print Network (OSTI)

CONSTRUCTION OF MULTIPLY FIXED n-VALUED MAPS Robert F. Brown Department of Mathematics University of California Los Angeles, CA 90095-1555 e-mail: rfb@math.ucla.edu September 29, 2014 Abstract A self-map, either single-valued or multi-valued, is multiply fixed if every map homotopic to it has at least two

Brown, Robert F.



E-Print Network (OSTI)

PRESSURIZATION OF FIXED ROOF STORAGE TANKS DUE TO EXTERNAL FIRES Fabien FouiHen, INERIS, Parc. Reflections led on this accident have pushed to consider the phenomenon of tank pressurization as a potential initiating event of the fire ball observed. In concrete terms, when a fixed roof storage tank is surrounded

Paris-Sud XI, Université de


Steady periodic waves bifurcating for fixed-depth rotational flows  

E-Print Network (OSTI)

-current interactions [29, 37] or flows generated by wind-shear [30] (see [6] for a comprehensive discussion than the mass-flux. It is important to note that fixing the mass-flux p0 does not fix the depth d


Portfolio optimization with linear and fixed transaction costs  

E-Print Network (OSTI)

Portfolio optimization with linear and fixed transaction costs Miguel Sousa Lobo1 Maryam Fazel2 optimization with linear and fixed transaction costs Abstract We consider the problem of portfolio selection of the return, and bounds on different shortfall probabilities are efficiently handled by convex optimization


Promoting Clean Cars: Case Study of Stockholm and Sweden | Open Energy  

Open Energy Info (EERE)

Promoting Clean Cars: Case Study of Stockholm and Sweden Promoting Clean Cars: Case Study of Stockholm and Sweden Jump to: navigation, search Tool Summary Name: Promoting Clean Cars: Case Study of Stockholm and Sweden Agency/Company /Organization: BioEthanol for Sustainable Transport Focus Area: Fuels & Efficiency Topics: Best Practices Website: www.best-europe.org/upload/BEST_documents/incentives/D.5.12%20Promotin In this report, the work with clean vehicles and fuels and especially the incentives used both on a national level in Sweden and on a local level in Stockholm has been evaluated. The report is also filled with facts and figures describing the impressive development in Sweden and Stockholm within the field of clean vehicles and fuels. How to Use This Tool This tool is most helpful when using these strategies:


Middle School Electric Car Competition | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Electric Car Competition Electric Car Competition National Science Bowl® (NSB) NSB Home About National Science Bowl Contacts Regional Science Bowl Coordinators National Science Bowl FAQ's Alumni Past National Science Bowl Winners Past National Science Bowl Photos National Science Bowl Logos High School Middle School Attending National Event Volunteers 2013 Competition Results News Media WDTS Home Contact Information National Science Bowl® U.S. Department of Energy SC-27/ Forrestal Building 1000 Independence Ave., SW Washington, DC 20585 P: 202-586-6702 E: National.Science.Bowl@science.doe.gov 2012 Competition Results Middle School Electric Car Competition Print Text Size: A A A RSS Feeds FeedbackShare Page Final Results Team Time (s) Rank Daniel Wright Middle School 5.96 1 Treasure Valley Math & Science 6.42 2


From the Lab to the Showroom: How the Electric Car Came to Life |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

From the Lab to the Showroom: How the Electric Car Came to Life From the Lab to the Showroom: How the Electric Car Came to Life From the Lab to the Showroom: How the Electric Car Came to Life October 17, 2011 - 11:02am Addthis An illustration of the 2011 Chevy Volt, whose lithium-ion battery is based on technology developed at Argonne National Laboratory. | Image courtesy of General Motors. An illustration of the 2011 Chevy Volt, whose lithium-ion battery is based on technology developed at Argonne National Laboratory. | Image courtesy of General Motors. John Schueler John Schueler Former New Media Specialist, Office of Public Affairs The work at Argonne ends up in the hands of taxpayers who paid for research Jeff Chamberlain, head of battery R&D for Argonne National Lab Years of conducting advanced research in both the private and public


National Junior Solar Sprint & Other Car Competition Regional Host Sites  

NLE Websites -- All DOE Office Websites (Extended Search)

Junior Solar Sprint & Other Car Competition Regional Host Sites Junior Solar Sprint & Other Car Competition Regional Host Sites Below is a list of current Junior Solar Sprint (Junior Solar Sprint) and Other Car Competition host sites for regional competitions. For information on dates and locations please contact the person listed in the area or for the entire state you are interested in. Host sites typically hold multiple competitions between several schools. Contact Linda Lung at Linda.lung@nrel.gov or (303) 275-3044 to identify or locate new host sites or the locations of individual competitions with which your school or business may be able to coordinate. Alaska Contact: Cindy Carl Address: Weston Solutions, Inc. 425 G Street, Suite 300 Anchorage, AK 99501 Phone: 907-343-2744 E-mail: cindy.carl@westonsolutions.com


Electric Car Featuring High-Tech Material Made in the USA Makes Its Debut |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electric Car Featuring High-Tech Material Made in the USA Makes Its Electric Car Featuring High-Tech Material Made in the USA Makes Its Debut Electric Car Featuring High-Tech Material Made in the USA Makes Its Debut September 24, 2013 - 3:01pm Addthis Carbon fiber material produced at SGL Automotive Carbon Fibers in Moses Lake, Wash. (Photo courtesy of SGL Automotive Carbon Fibers) Carbon fiber material produced at SGL Automotive Carbon Fibers in Moses Lake, Wash. (Photo courtesy of SGL Automotive Carbon Fibers) Carbon fiber under production at SGL Automotive Carbon Fibers. The facility's construction resulted in 200 jobs. (Photo courtesy of SGL Automotive Carbon Fibers) Carbon fiber under production at SGL Automotive Carbon Fibers. The facility's construction resulted in 200 jobs. (Photo courtesy of SGL Automotive Carbon Fibers)


EcoCAR 2 Year 1 Winners Announced! | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Year 1 Winners Announced! Year 1 Winners Announced! EcoCAR 2 Year 1 Winners Announced! May 25, 2012 - 1:21pm Addthis EcoCAR 2: Pluggin in to the Future challenges 15 universities across North America to reduce the environmental impact of a 2013 Chevrolet Malibu by minimizing the vehicles' fuel consumption and reducing its emissions while retaining the vehicle's performance, safety, and consumer appeal. | Photo by Myles Regan. EcoCAR 2: Pluggin in to the Future challenges 15 universities across North America to reduce the environmental impact of a 2013 Chevrolet Malibu by minimizing the vehicles' fuel consumption and reducing its emissions while retaining the vehicle's performance, safety, and consumer appeal. | Photo by Myles Regan. Connie Bezanson Education & Outreach Manager, Vehicle Technologies Program


U.S. Department of Energy Announces Two Utility Companies Join FreedomCAR  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Two Utility Companies Join Two Utility Companies Join FreedomCAR and Fuel Partnership U.S. Department of Energy Announces Two Utility Companies Join FreedomCAR and Fuel Partnership June 20, 2008 - 1:29pm Addthis Group to Accelerate the Delivery of Plug-in Hybrid Electric Vehicles to Market DEARBORN, Mich. - U.S. Department of Energy (DOE) Assistant Secretary of Energy Efficiency and Renewable Energy Andy Karsner today announced the expansion of the FreedomCAR and Fuel Partnership to include two electric utility companies - Southern California Edison and DTE Energy. The addition of these utility members will help address the technical challenges and issues associated with market introduction and acceptance of Plug-In Hybrid Electric Vehicles (PHEVs), furthering DOE's goal of making


New Funding Boosts Carbon Capture, Solar Energy and High Gas Mileage Cars  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

New Funding Boosts Carbon Capture, Solar Energy and High Gas New Funding Boosts Carbon Capture, Solar Energy and High Gas Mileage Cars and Trucks New Funding Boosts Carbon Capture, Solar Energy and High Gas Mileage Cars and Trucks June 11, 2009 - 12:00am Addthis WASHINGTON D.C. --- U.S. Energy Secretary Steven Chu today announced more than $300 million worth of investments that will boost a range of clean energy technologies - including carbon capture from coal, solar power, and high efficiency cars and trucks. The move reflects the Obama Administration's commitment to a broad based strategy that will create millions of jobs while transforming the way we use and produce energy. "There's enormous potential for new jobs and reduced carbon pollution just by implementing existing technologies like energy efficiency and wind


Chapter 5 - DP4 Advanced Simulation Settings: Racing Car Engine Connecting Rod  

Science Journals Connector (OSTI)

Publisher Summary In developing race-winning cars, Triple Eight utilizes Autodesk Inventor and Dynamic Simulation. One of the critical design issues in developing race-winning cars is weight, as this has a considerable impact on the performance of the cars. In this design problem, one highlights the key components of the engine and demonstrates how one can make effective use of Dynamic Simulation to simulate the explosion of gases on the pistoncrank assembly. In the design problem, one determines several things like the time taken for the engine speed to reach 7000 rpm, the engine torque with friction taken into account, the engine torque with friction not taken into account, and the reaction forces acting on the connecting rod.

Wasim Younis



FreedomCAR and Fuel Partnership 2010 Highlights of Technical Accomplishments  

NLE Websites -- All DOE Office Websites (Extended Search)

FreedomCAR and Fuel Partnership FreedomCAR and Fuel Partnership 2010 Highlights of Technical Accomplishments Table of Contents Item Page Preface v Vehicle Technologies Advanced Combustion & Emissions Control * Dual-Fuel (Gasoline+Diesel) RCCI Offers High Efficiency and Low Emissions in Engines 1 * Turbocharger Technology to Deliver Better Performance and Reduced Fuel Consumption 2 * Late Intake Valve Closing Improves Tradeoff Between Diesel-Engine Smoke and NO x Emissions 3 * Modeling of Lean NO x Trap Chemistry 4 * Neutron Radiography Non-Destructive Image of EGR Cooler and DPF Build- ups 5 * Accurate Detailed Chemical Kinetic Surrogate Model for Gasoline 6 * Sources of Inefficiency Identified in Light-Duty, Low-Temperature Diesel Combustion 7 * 2010 FreedomCAR Engine Milestone for 45% Brake Thermal Efficiency Met 8


Apps for Vehicles: What is the OBD port in my car and what information is  

Open Energy Info (EERE)

the OBD port in my car and what information is the OBD port in my car and what information is available on it? Home > Groups > Developer This question relates to energy hackathons and the OpenXC platform. More information at http://en.openei.org/wiki/Help:Energy_Hackathon_Resources Submitted by Rmckeel on 24 September, 2012 - 10:36 2 answers Points: 1 Modern automobiles are laced with a number of microcontrollers and sensors that monitor and control everything from the throttle position to the ambient air temperature. These devices communicate with each other over a wired in-vehicle network, a CAN bus. The CAN bus is one of the primary components of OBD-II, a vehicle diagnostic standard mandatory for all cars sold in the United States since 1996. The OBD-II standard sends and receives messages on the CAN bus. If you've ever watched your mechanic plug



NLE Websites -- All DOE Office Websites (Extended Search)

BioCARS News BioCARS News Generation and Use of 100 fs Hard X-ray Pulses: BioCARS Participation in the SPPS Project at SLAC/SSRL The X-ray pulse length emitted by synchrotron sources such as the APS is determined by the electron bunch pulse length, which in turn is limited to about 100ps by essential, long-term stability requirements on the electron beam. However, many interesting structural processes in hard and soft condensed matter and in biological systems occur on time scales shorter than 100 ps (Martin and Vos, 1992), which are inaccessible with existing synchrotron sources. Considerable effort has therefore been put into the development of novel ultra-fast hard X-ray sources, the most promising of which is the proposal to construct a hard X-ray free electron laser

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


From the Lab to the Showroom: How the Electric Car Came to Life |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

From the Lab to the Showroom: How the Electric Car Came to Life From the Lab to the Showroom: How the Electric Car Came to Life From the Lab to the Showroom: How the Electric Car Came to Life October 17, 2011 - 11:02am Addthis An illustration of the 2011 Chevy Volt, whose lithium-ion battery is based on technology developed at Argonne National Laboratory. | Image courtesy of General Motors. An illustration of the 2011 Chevy Volt, whose lithium-ion battery is based on technology developed at Argonne National Laboratory. | Image courtesy of General Motors. John Schueler John Schueler Former New Media Specialist, Office of Public Affairs The work at Argonne ends up in the hands of taxpayers who paid for research Jeff Chamberlain, head of battery R&D for Argonne National Lab Years of conducting advanced research in both the private and public


From the Lab to the Showroom: How the Electric Car Came to Life |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

From the Lab to the Showroom: How the Electric Car Came to Life From the Lab to the Showroom: How the Electric Car Came to Life From the Lab to the Showroom: How the Electric Car Came to Life October 17, 2011 - 11:02am Addthis An illustration of the 2011 Chevy Volt, whose lithium-ion battery is based on technology developed at Argonne National Laboratory. | Image courtesy of General Motors. An illustration of the 2011 Chevy Volt, whose lithium-ion battery is based on technology developed at Argonne National Laboratory. | Image courtesy of General Motors. John Schueler John Schueler Former New Media Specialist, Office of Public Affairs The work at Argonne ends up in the hands of taxpayers who paid for research Jeff Chamberlain, head of battery R&D for Argonne National Lab Years of conducting advanced research in both the private and public


Fixed Capital Investment Tax Credit (Connecticut) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fixed Capital Investment Tax Credit (Connecticut) Fixed Capital Investment Tax Credit (Connecticut) Fixed Capital Investment Tax Credit (Connecticut) < Back Eligibility Commercial Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Connecticut Program Type Corporate Tax Incentive Provider Connecticut Department of Economic and Community Development The Fixed Capital Investment Tax Credit allows a tax credit of 5% of the amount paid for any new fixed capital investment. Companies with fewer than 800 full-time employees may take a tax credit for machinery and equipment purchased and installed in a facility. The credit is based on a percentage of the amount spent on machinery that exceeds the amount spend on machinery


FreedomCAR and Fuel Partnership 2007 Highlights of Technical Accomplishments  

NLE Websites -- All DOE Office Websites (Extended Search)

FreedomCAR FreedomCAR and Fuel Partnership 2007 Highlights of Technical Accomplishments Table of Contents Item Page Preface iv Vehicle Technologies Advanced Combustion & Emissions Control * Injection Timing Strongly Impacts H 2 - Air Mixing in a Direct-Injection Hydrogen Engine 1 * Demonstrated 2007 Engine Efficiency Milestone of 42% Peak Brake Thermal Efficiency 2 * Kinetic Mechanism for Diesel Lean NO x Trap Regeneration 3 * Studies of Lean NO x Trap Aftertreatment Contribute to Diesel Vehicle Commercialization 4 Electrical & Electronics * Floating Loop Inverter 5 * Sintered Die Attachment 6 * Thermal Systems Analysis for Advanced Vehicle Power Electronics 7 * High Temperature DC Bus Capacitors 8 Electrochemical Energy Storage


The Remarkable Environmental Rebound Effect of Electric Cars: A Microeconomic Approach  

Science Journals Connector (OSTI)

For FBE and HFC cars, the high capital costs cause a noteworthy decrease in environmental pressures for some indicators (negative rebound effect). ... For instance, there are approaches based on Engel curves (expenditure elasticities)(24, 25) or on the shifting of expenditure patterns between income groups. ... When the environmental profile of the product of investigation is very different from that in other sectors, rebound effects from a reallocation of expenditures can be very high, as was the case for FEP and TETP for FBE cars. ...

David Font Vivanco; Jaume Freire-Gonzlez; Ren Kemp; Ester van der Voet



CARS 2002 H.U. Lemke, M.W. Vannier, K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights reserved.  

E-Print Network (OSTI)

CARS 2002 ­ H.U. Lemke, M.W. Vannier, K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors.W. Vannier, K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) © CARS/Springer. All rights reserved. 2

Wahle, Andreas


CARS 2002 H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights reserved.  

E-Print Network (OSTI)

CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights reserved. 2 2. Method 2.1. Computer

Payan, Yohan


CARS 2002 H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights reserved.  

E-Print Network (OSTI)

CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) © CARS/Springer. All rights reserved. 756


CARS 2002 H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights reserved. Segmentation of microcalcification in X-ray mammograms  

E-Print Network (OSTI)

CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors) CARS/Springer. All rights

Joskowicz, Leo


CARS 2002 H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber CARS/Springer. All rights reserved.  

E-Print Network (OSTI)

CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J.H.C. Reiber (Editors is extracted based on the #12;CARS 2002 ­ H.U. Lemke, M.W. Vannier; K. Inamura, A.G. Farman, K. Doi & J

Louisville, University of


Experimental study on the effects of high/low pressure EGR proportion in a passenger car diesel engine  

Science Journals Connector (OSTI)

Abstract An experimental study was conducted to investigate the effects of the proportion between high pressure and low pressure exhaust gas recirculation (HP/LP EGR) on engine operation. The study focused on the characteristics of combustion, emissions, and fuel consumption in a 2.2L passenger car diesel engine. The experiments were performed under three part-load and steady-state operating conditions. The LP EGR portion was swept from 0 to 1, while the mass flow rate of fresh air and boost pressure were fixed. The results showed that the intake manifold temperature decreased gradually as the LP EGR portion increased due to its greater cooling capability by a longer supply line and an intercooler. However, the required cooling power for the intercooler increased because the LP EGR gas, which has a higher temperature than the fresh air, was induced upstream of the compressor. The lowered intake manifold temperature with the increase of the LP EGR portion led to the prolonged ignition delay of pilot injections, which resulted in a slightly higher peak heat release rate in the main combustion. A higher LP EGR portion showed a lower fuel consumption level than the HP EGR only case because the variable geometry turbocharger (VGT) nozzle opened more widely to maintain the boost pressure, which means a lower pumping loss. Nitrogen oxide (NOx) emissions were also decreased as the LP EGR portion increased due to lowered intake charge temperature. Consequently, it was possible to improve the trade-off relationship between \\{NOx\\} emissions and fuel consumption with the increase of the LP EGR portion under steady-state operating conditions.

Youngsoo Park; Choongsik Bae



A new compact fixed-point blackbody furnace  

SciTech Connect

More and more NMIs are realizing their primary scale themselves with fixed-point blackbodies as their reference standard. However, commercially available fixed-point blackbody furnaces of sufficient quality are not always easy to obtain. CHINO Corp. and NMIJ, AIST jointly developed a new compact fixed-point blackbody furnace. The new furnace has such features as 1) improved temperature uniformity when compared to previous products, enabling better plateau quality, 2) adoption of the hybrid fixed-point cell structure with internal insulation to improve robustness and thereby to extend lifetime, 3) easily ejectable and replaceable heater unit and fixed-point cell design, leading to reduced maintenance cost, 4) interchangeability among multiple fixed points from In to Cu points. The replaceable cell feature facilitates long term maintenance of the scale through management of a group of fixed-point cells of the same type. The compact furnace is easily transportable and therefore can also function as a traveling standard for disseminating the radiation temperature scale, and for maintaining the scale at the secondary level and industrial calibration laboratories. It is expected that the furnace will play a key role of the traveling standard in the anticipated APMP supplementary comparison of the radiation thermometry scale.

Hiraka, K.; Oikawa, H.; Shimizu, T.; Kadoya, S.; Kobayashi, T. [CHINO CORPORATION, Itabashi, Tokyo (Japan)] [CHINO CORPORATION, Itabashi, Tokyo (Japan); Yamada, Y.; Ishii, J. [National Metrology Institute of Japan, AIST, Tsukuba, Ibaraki (Japan)] [National Metrology Institute of Japan, AIST, Tsukuba, Ibaraki (Japan)



Power Electronics Design of a Solar Powered In-car Wireless Tag for Asset Tracking and Parking Applications  

E-Print Network (OSTI)

Power Electronics Design of a Solar Powered In-car Wireless Tag for Asset Tracking and Parking and testing of a power conditioning circuit for a solar powered in-car wireless tag for asset tracking. A suitable solar cell was chosen for its high power density. Charging circuit, hysteresis control circuit


Experimental Validation of a Numerical Controller Using Convex Optimization with Linear Matrix Inequalities on a Quarter-Car Suspension System  

E-Print Network (OSTI)

of the transfer function from the road disturbance to the actuating effort with the change in the sprung mass of the quarter-car system. The quarter-car system makes use of a linear brushless permanent magnet motor (LBPMM) as an actuator, a linear variable...

Chintala, Rohit



The design of electric motor car's body network based on CAN-bus distributed control  

Science Journals Connector (OSTI)

CAN-bus is a typical bus control technology, and is now widely applied in many areas. In view of the characteristics of the electric vehicle body, this paper puts forward a plan that applies CAN-bus technology to build electric vehicle body network. ... Keywords: CAN bus, distributed control, electric car and body network

Wang Jianfeng; Wang Dafang; Xiong Jie



Sound-insulation layer modelling in car computational vibroacoustics in the medium-frequency range  

E-Print Network (OSTI)

Sound-insulation layer modelling in car computational vibroacoustics in the medium-frequency range In a previous article, a simplified low- and medium-frequency model for un- certain automotive sound-insulation. In this paper, the insulation simplified model is implemented in an in- dustrial stochastic vibroacoustic model

Boyer, Edmond


Two Billion Cars: What it Means for Climate and Energy Policy  

ScienceCinema (OSTI)

April 13, 2009: Daniel Sperling, director of the Institute of Transportation Studies at UC Davis, presents the next installment of Berkeley Lab's Environmental Energy Technologies Divisions Distinguished Lecture series. He discusses Two Billion Cars and What it Means for Climate and Energy Policy.

Daniel Sperling



Hyundai Motor shows ix35 Fuel Cell car can be used to grow food  

Science Journals Connector (OSTI)

Korean automaker Hyundai Motor Company recently unveiled a unique piece of design theatre that aims to educate people about the real-life benefits of hydrogen fuel cell technology. The Hyundai Fuel Cell Farm the world's first aquaponics ecosystem powered by Hyundai's zero-emission ix35 Fuel Cell car was on display for one day in front of the Design Museum in London.



The Effect of Monetary Incentives on Sales of Advanced Clean Cars  

E-Print Network (OSTI)

-scale commercialization of zero emission vehicles-- both hydrogen fuel cell vehicles (FCVs) and plug-in electric vehiclesThe Effect of Monetary Incentives on Sales of Advanced Clean Cars in the United States: Summary a transformation of the transportation sector to vehicles and fuels that have low-to-zero lifecycle emissions

California at Davis, University of


A Clustering-Assisted Regression (CAR) approach for developing spatial climate data sets in China  

E-Print Network (OSTI)

A Clustering-Assisted Regression (CAR) approach for developing spatial climate data sets in China t There is an increasing demand for improving spatial resolution of climate data. However, an increase in resolution does spatial data of monthly mean temperature and monthly precipitation at a national scale in mainland China

Pittendrigh, Barry

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CRC fuel rating program: road octane performance of oxygenates in 1982 model cars  

SciTech Connect

Because of the widespread interest in the use of alcohols and ethers as gasoline blending components, this program was conducted to evaluate the effects of several oxygenates on gasoline octane performance and to evaluate the effects of car design features such as engine and transmission type. Five oxygenates were evaluated at two nominal concentrations, 5 and 10 volume%, at both regular- and premium-grade octane levels: methanol (MeOH), ethanol (ETOH), isopropanol (IPA), tertiary butanol (TBA), and methyl tertiary butyl ether (MTBE). A blend of 5% MeOH and 5 percent TBA was also tested at both octane levels. Twenty-eight unleaded fuels, including four hydrocarbon fuels, two hydrocarbon fuels plus toluene, and twenty-two oxygenated fuels, were rated in duplicate in thirty-eight cars using the Modified Uniontown Technique (CRC Designation F-28-75 described in Appendix C), plus some additional instructions. All testing was done on chassis dynamometers. Ratings were obtained at full throttle with all thirty-eight cars, and at the most critical part-throttle condition (occurring with manifold vacuum of 4 in. Hg (13.5 kPa) or greater above the full-throttle vacuum) with nine cars.

Not Available



Project Information Form Project Title Eco-Driving to Reduce Emissions Cars (Behavioral Focus)  

E-Print Network (OSTI)

Source(s) and Amounts Provided (by each agency or organization) USDOT $34,618.33 Total Project Cost $34Project Information Form Project Title Eco-Driving to Reduce Emissions ­ Cars (Behavioral Focus Description of Research Project The purpose of this review is to provide energy and environment policy makers

California at Davis, University of


Solvation Structure of Hydroxyl Radical by Car?Parrinello Molecular Dynamics  

Science Journals Connector (OSTI)

Car?Parrinello molecular dynamics simulations of a hydroxyl radical in liquid water have been performed. ... A hydrogen bond between the two waters is formed and the first water molecule is pushed toward the hydroxyl. ... The resulting velocity autocorrelation power spectra calculated separately for the atomic species from the hydroxyl and from the water molecules are shown in Figure 12. ...

Julia M. Khalack; Alexander P. Lyubartsev




E-Print Network (OSTI)

for vehicle detection [3, 4], our approach does not rely on motion information, and the system can detect bothA RECOGNITION SYSTEM THAT USES SACCADES TO DETECT CARS FROM REAL-TIME VIDEO STREAMS Predrag ABSTRACT In this work we present a system for detection of ob- jects from video streams based on properties


Two Billion Cars: What it Means for Climate and Energy Policy  

SciTech Connect

April 13, 2009: Daniel Sperling, director of the Institute of Transportation Studies at UC Davis, presents the next installment of Berkeley Lab's Environmental Energy Technologies Divisions Distinguished Lecture series. He discusses Two Billion Cars and What it Means for Climate and Energy Policy.

Daniel Sperling



Strong permanent magnets provide a backbone technology required many products, including computers, electric cars, and  

E-Print Network (OSTI)

, electric cars, and wind-powered generators. Currently, the strongest permanent magnets contain rare earth for most technologies requiring permanent magnets, due to their high energy product and coercivity. However, and the extreme price volatility in recent years have led scientists to seek alternative formulas for permanent

McQuade, D. Tyler


THE JOURNAL OF WORLD TRANSPORT POLICY & PRACTICE 10. CarLink -A smart carsharing system  

E-Print Network (OSTI)

Shaheen, CarLink Project Manager Editor's Note: The author of this piece is today intensely involved, here she is as entrepreneur and managerbehind an ambitious carsharing project. This is a report on the first months of their experience and goals for the future. Introduction Carsharing organizations, which

Kammen, Daniel M.


Virtual Ergonomic Assessment of First Saudi Arabian Designed Car in a Semi-Immersive Environment  

Science Journals Connector (OSTI)

Abstract During the last decade human factors is drawing more attention in the design, engineering, production, and maintenance of new industrial products especially in automotive industry. Ergonomic quality is becoming a critical criterion for the success of many products. Recently, virtual reality (VR) technique is widely applied during different phases of product development. The use of VR allows designer reducing the production of physical prototypes that are very expensive and requires long production time. Virtual humans are used in the automotive industry especially for ergonomic analysis of a virtual prototype of a car. In this research work, an ergonomic assessment for first Saudi Arabian Car known has been performed. CATIA V5 human builder module was used to develop the virtual humans of American male 50 and 95 percentile, which were utilized to carry out the ergonomic analysis of driver's seat. The main goal of the research is to develop a virtual environment (VE) that allow designers and engineer to evaluate the car interiors and driver's seat position using the digital mock-up instead of building the physical prototype, having a virtual validation of the project, in its early development phases. A successful ergonomics assessment has been performed on the digital model of the car in a semi-immersive virtual environment and recommendations were made for the driver's seat position based on the assessment.

Mustufa H. Abidi; A.M. El-Tamimi; A.M. Al-Ahmari; S.M. Darwish; M.S. Rasheed



Homing a Teleoperated Car using Monocular SLAM Nuno Ribeiro, Ricardo Ferreira, Jos Gaspar  

E-Print Network (OSTI)

possible the communication between the user's pc, the Axis camera and the Arduino; and (iii) Design- ing and Software Setup A car is assembled based in a network (IP) camera, one Arduino Uno, one Motor Shield and two with the objective of processing user's instructions and sends the corresponding signals to the Arduino board. Once

Instituto de Sistemas e Robotica


CARS, GAS, AND POLLUTION POLICIES Distributional and Efficiency Impacts of Gasoline Taxes  

E-Print Network (OSTI)

CARS, GAS, AND POLLUTION POLICIES Distributional and Efficiency Impacts of Gasoline Taxes, reduc- ing automobile-related gasoline consumption has become a major U.S. public policy issue. Recently, many analysts have called for new or more stringent policies to discourage gasoline consumption

Boyer, Edmond


Hydrogen fuel-cell cars designed and built in student competition  

E-Print Network (OSTI)

- 1 - Hydrogen fuel-cell cars designed and built in student competition April 3, 2012 Designing and elementary school teams from around New Mexico participated in the annual Hydrogen Fuel Cell Challenge - Tommy Rockward, of LANL's Sensors and Electromechanical Devices group, demonstrated a hydrogen fuel-cell


Future energy and emissions policy scenarios in Ireland for private car transport  

Science Journals Connector (OSTI)

In this paper we use a technological model of Ireland's future car stock to simulate the impact of a range of policy measures on the baseline trend in energy demand in the period to 2030. The policies and measures modelled comprise meeting deployment targets for electric vehicles and compressed natural gas vehicles, an EU regulation for the improvement of vehicle efficiency, implementation of a national biofuel obligation, as well as several behavioural measures (encouraging modal shifting and reduced travel demand). The impact of the different measures simulated is measured in terms of their contribution to meeting Ireland's ambitious targets for energy savings, for renewable energy penetration and for greenhouse gas (GHG) emissions reductions. The results point to a possible improvement of 32% in car stock efficiency, the achievement of 7.8% renewable energy share of road and rail transport and a 22% reduction in non-ETS private car CO2 emissions relative to 2009 levels. A scenario analysis on meeting the EV penetration target shows a significant range of CO2 emissions reductions depending on the cars (and mileage) displaced and on the electricity generation portfolio.

Hannah E. Daly; Brian P. Gallachir



How does interior car noise alter driver's perception of motion? Multisensory integration in speed perception  

E-Print Network (OSTI)

of electric motorizations brings new balance between noise sources inside the car, due to the loss of engine, electric motor sound, no sound), in two visual conditions (night and day). We found that acoustic feedback threshold of apparent motion, trajectory or speed. Automobile noise sources can give information about

Paris-Sud XI, Université de


Toward a Low-CarMunicipal Financing for Energy Efficiency and Solar Power  

E-Print Network (OSTI)

Toward a Low-CarMunicipal Financing for Energy Efficiency and Solar Power By Merrian C. Fuller of the Inter- governmental Panel on Climate Change (IPCC). Thus far much of the effort has been focused, such as improving energy efficiency and add- ing solar photovoltaics (PV) and solar thermal systems to buildings

Kammen, Daniel M.


EcoCAR 2 Teams Cruise Forward with Second Year Finals | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Teams Cruise Forward with Second Year Finals Teams Cruise Forward with Second Year Finals EcoCAR 2 Teams Cruise Forward with Second Year Finals May 20, 2013 - 5:44pm Addthis The University of Washington team works on their vehicle while lifted on a hoist. Teams are working in a garage that is fully equipped with tools that will help them make the most of their time this week. | Photo courtesy of EcoCAR 2. The University of Washington team works on their vehicle while lifted on a hoist. Teams are working in a garage that is fully equipped with tools that will help them make the most of their time this week. | Photo courtesy of EcoCAR 2. A team member from Purdue University works on a line for their vehicle’s high voltage battery. Purdue University’s vehicle is a split parallel hybrid. | Photo courtesy of EcoCAR 2.


Optimization of Storage Location Assignment for Fixed Rack Systems  

Science Journals Connector (OSTI)

A multi-objective mathematical model and an improved Genetic Algorithm (GA) are formulated for storage location assignment of the fixed rack system. According to the assignment rules, ... efficiency and to keep t...

Qinghong Wu; Ying Zhang; Zongmin Ma



Total effective dose equivalent associated with fixed uranium surface contamination  

SciTech Connect

This report provides the technical basis for establishing a uranium fixed-contamination action level, a fixed uranium surface contamination level exceeding the total radioactivity values of Appendix D of Title 10, Code of Federal Regulations, part 835 (10CFR835), but below which the monitoring, posting, and control requirements for Radiological Areas are not required for the area of the contamination. An area of fixed uranium contamination between 1,000 dpm/100 cm{sup 2} and that level corresponding to an annual total effective dose equivalent (TEDE) of 100 mrem requires only routine monitoring, posting to alert personnel of the contamination, and administrative control. The more extensive requirements for monitoring, posting, and control designated by 10CFR835 for Radiological Areas do not have to be applied for these intermediate fixed-contamination levels.

Bogard, J.S.; Hamm, R.N.; Ashley, J.C.; Turner, J.E.; England, C.A.; Swenson, D.E.; Brown, K.S.



Fix photo here CSU Fullerton Exchange Program Application  

E-Print Network (OSTI)

Fix photo here CSU Fullerton Exchange Program Application Instructions: Don't abbreviate. Answer purposes (check one) CA resident Non-Resident F-1 Visa Student Any photo that shows your face well will do

de Lijser, Peter


Orlando Utilities Commission- Home Energy Efficiency Fix-Up Program  

Energy.gov (U.S. Department of Energy (DOE))

Orlando Utilities Commission's Home Energy Fix-Up Program provides assistance to low-income residential customers. To qualify for the program the total annual family income must be less than $40...


Complete Variable-Length \\Fix-Free" Codes David Gillman  

E-Print Network (OSTI)

Complete Variable-Length \\Fix-Free" Codes David Gillman Institute for Mathematics & Its-free codes Supported by NSF grant 9212184-CCR and Darpa contract N00014-92-J-1799. Email address: gillman

Rivest, Ronald L.

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thermodynamics of SU(3) gauge theory at fixed lattice spacing  

E-Print Network (OSTI)

We study thermodynamics of SU(3) gauge theory at fixed scales on the lattice, where we vary temperature by changing the temporal lattice size N_t=(Ta_t)^{-1}. In the fixed scale approach, finite temperature simulations are performed on common lattice spacings and spatial volumes. Consequently, we can isolate thermal effects in observables from other uncertainties, such as lattice artifact, renormalization factor, and spatial volume effect. Furthermore, in the EOS calculations, the fixed scale approach is able to reduce computational costs for zero temperature subtraction and parameter search to find lines of constant physics, which are demanding in full QCD simulations. As a test of the approach, we study the thermodynamics of the SU(3) gauge theory on isotropic and anisotropic lattices. In addition to the equation of state, we calculate the critical temperature and the static quark free energy at a fixed scale.

T. Umeda; S. Ejiri; S. Aoki; T. Hatsuda; K. Kanaya; Y. Maezawa; H. Ohno



(1) Lathe Design for High- and Low-Speed Steels (2) Mechanics of Engineering (3) Motor-car Mechanism and Management  

Science Journals Connector (OSTI)

... which the buyer must also be able to satisfy himself before deciding to purchase an electric car. In dealing with the management of the car, the author describes two forms of ... has been given to the management of the batter}', since success in driving an electric car depends so much upon the manner in which the battery is handled. In regard ...

T. H. B.



Fact #751: October 29, 2012 Plug-in Car Sales Higher in the U.S. Compared to Western Europe and China  

Energy.gov (U.S. Department of Energy (DOE))

In 2011, plug-in car sales in the U.S. were 0.28% of the U.S. car market, and grew to 0.44% of the U.S. car market in the first eight months of 2012. Western Europe has also increased their plug-in...


E1A, E1B Double-Restricted Adenovirus with RGD-Fiber Modification Exhibits Enhanced Oncolysis for CARDeficient Biliary Cancers  

Science Journals Connector (OSTI)

...adenovirus receptor (CAR) and integrins (alphavbeta3...LacZ-expressing replication-defective adenoviruses with wild-type...adenovirus receptor (CAR) and integrins (alpha...LacZ-expressing replication-defective adenoviruses with wild-type...model. Expression of CAR significantly correlated...

Mariko Wakayama; Masato Abei; Rei Kawashima; Emiko Seo; Kuniaki Fukuda; Hideo Ugai; Takehide Murata; Naomi Tanaka; Ichinosuke Hyodo; Hirofumi Hamada; and Kazunari K. Yokoyama



FreedomCAR and Fuel Partnership 2008 Highlights of Technical Accomplishments  

NLE Websites -- All DOE Office Websites (Extended Search)

FreedomCAR FreedomCAR and Fuel Partnership 2008 Highlights of Technical Accomplishments Table of Contents Item Page Preface iv Vehicle Technologies Advanced Combustion & Emissions Control * Hydrogen Engine Achieves 45% Efficiency 1 * A Detailed Picture of Exhaust Gas Recirculation Effects on HCCI Operation Developed 2 * A Predictive Model Developed for Spark Assisted HCCI Combustion 3 * Understanding Lean NO x Trap (LNT) Sulfur Tolerance 4 Electrical & Electronics * Direct Back-Side Cooling of Power Electronics 5 * High Temperature SOI Gate Driver 6 * Advanced DC to DC Converter 7 * High Temperature Polymer DC Bus Capacitors 8 Electrochemical Energy Storage * NCA-Based Li-ion Battery Packs Delivered 9 * Airless Spray Deposited Ceramic Separator 10


FreedomCAR and Fuel Partnership 2006 Highlights of Technical Accomplishments  

NLE Websites -- All DOE Office Websites (Extended Search)

FreedomCAR and Fuel Partnership 2006 Highlights of Technical Accomplishments Table of Contents Item Page Preface iii Vehicle Technologies Advanced Combustion & Emissions Control * Model of 3D Diesel Particulate Filter Shows Location Where Soot Collects 1 * High-Efficiency, Low-Emission Combustion Achieved at Modal Test Conditions Relevant for Small-Car FTP 2 * KIVA Enhanced for Faster Computations and HCCI Combustion 3 * Durability of a DOC-UREA SCT-DPF System for a Light-Duty Truck Studied for 120,000 Miles 4 Electrical & Electronics * DC/DC Converter for Fuel Cell and Hybrid Vehicles 5 * Silicon-Silicon Carbide Hybrid Inverter 6 Electrochemical Energy Storage * New High-Power Cell Chemistry Identified 7 * Gap Analysis Software Developed 8


Influence of Oxidized Biodiesel Blends on Regulated and Unregulated Emissions from a Diesel Passenger Car  

Science Journals Connector (OSTI)

Few studies are available on modern passenger cars, employed common-rail engine systems, and after-treatment technologies, and even fewer studies report results, which are not necessarily representative of actual driving conditions, making it difficult to assess the fuel impact on diesel car fleet emissions. ... Although gasoline engines are expected to be replaced by hydrogen-powered fuel cells, compression-ignition engines, the diesel engines, are expected to remain in use for high-power applications because of limitations of hydrogen-storage densities. ... transesterification and sequential esterification-transesterification, followed by washing in water in both cases, in order to set out the most suitable operational conditions to achieve the highest FAME percentage in the shortest time. ...

Georgios Karavalakis; Evangelos Bakeas; Stamos Stournas



FreedomCAR and Fuel Partnership 2009 Highlights of Technical Accomplishments  

NLE Websites -- All DOE Office Websites (Extended Search)

FreedomCAR FreedomCAR and Fuel Partnership 2009 Highlights of Technical Accomplishments Table of Contents Item Page Preface iv Vehicle Technologies Advanced Combustion & Emissions Control * High Efficiency Clean Combustion (HECC) Shows Potential to Reduce Fuel Penalty for Diesel Particulate Control by 25% 1 * E85 Engine Achieves Greater Torque and Similar Fuel Economy Compared to a Larger Diesel Engine 2 * Simulations Provide New Insight into the Potential Benefits and Limitations of Compression Ignition Engines in Hybrid Vehicles 3 * Understanding of Lean NO x Trap Chemistry Enables Improved On-Board Diagnostics 4 * Fuel Injector Motion Linked to Structure of Spray 5 * Boosted Gasoline HCCI Achieves 2x Load Increase over Previous Best 6


Renormalization of Quantum Anosov Maps: Reduction to Fixed Boundary Conditions  

E-Print Network (OSTI)

A renormalization scheme is introduced to study quantum Anosov maps (QAMs) on a torus for general boundary conditions (BCs), whose number ($k$) is always finite. It is shown that the quasienergy eigenvalue problem of a QAM for {\\em all} $k$ BCs is exactly equivalent to that of the renormalized QAM (with Planck's constant $\\hbar ^{\\prime}=\\hbar /k$) at some {\\em fixed} BCs that can be of four types. The quantum cat maps are, up to time reversal, fixed points of the renormalization transformation. Several results at fixed BCs, in particular the existence of a complete basis of ``crystalline'' eigenstates in a classical limit, can then be derived and understood in a simple and transparent way in the general-BCs framework.

Itzhack Dana



Cheap Fixes for Beating the Heat Indoors | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cheap Fixes for Beating the Heat Indoors Cheap Fixes for Beating the Heat Indoors Cheap Fixes for Beating the Heat Indoors July 25, 2013 - 11:20am Addthis Blinds are a great option for cooling your home in the summer. | Photo courtesy of ©iStockphoto/nycshooter Blinds are a great option for cooling your home in the summer. | Photo courtesy of ©iStockphoto/nycshooter Erik Hyrkas Erik Hyrkas Media Relations Specialist, Office of Energy Efficiency & Renewable Energy How can I participate? Instead of turning on the air conditioning, consider window treatments and fans to cool down your home. If your internal thermostat is melting like the rest of the U.S. right now, you probably could use some fanning, ice, or air conditioning. With that in mind, we are providing a rundown of the cheapest ways to keep your home


Proton Transport in Triflic Acid Hydrates Studied via Path Integral Car?Parrinello Molecular Dynamics  

Science Journals Connector (OSTI)

Proton Transport in Triflic Acid Hydrates Studied via Path Integral Car?Parrinello Molecular Dynamics ... The mono-, di-, and tetrahydrates of trifluoromethanesulfonic acid, which contain characteristic H3O+, H5O2+, and H9O4+ structures, provide model systems for understanding proton transport in materials with high perfluorosulfonic acid density such as perfluorosulfonic acid membranes commonly employed in hydrogen fuel cells. ... Hydrogen is described as a promising future fuel if the fuel cell technol. ...

Robin L. Hayes; Stephen J. Paddison; Mark E. Tuckerman



Cisplatin Binding to DNA Oligomers from Hybrid Car-Parrinello/Molecular Dynamics Simulations  

Science Journals Connector (OSTI)

The first-principles calculations are carried out with the Car-Parrinello approach,52 which has proven to reliably describe structure, dynamics, and electronic properties of platinum?nucleotide complexes in the solid state53 as well as in water solution. ... There are more than three waters in the first solvation shell of AM1. ... The predictive power of our computational setup was investigated by constructing a structural model of platinated DNA. ...

Katrin Spiegel; Ursula Rothlisberger; Paolo Carloni



Reaction Mechanism of HIV-1 Protease by Hybrid Car-Parrinello/Classical MD Simulations  

Science Journals Connector (OSTI)

Reaction Mechanism of HIV-1 Protease by Hybrid Car-Parrinello/Classical MD Simulations ... To form the hydrated intermediate, a water molecule (WAT) must attack the carbonyl carbon of SUB15,17,18,21,31 (chemical step 1). ... This result, surprising at first, can be rationalized by realizing that a fundamental ingredient of HIV-1 PR catalytic power is the low polarity of the cleavage site environment15 that destabilizes the negatively charged Asp dyad. ...

Stefano Piana; Denis Bucher; Paolo Carloni; Ursula Rothlisberger



Chaotic Vibration of a Quarter-Car Model Excited by the Road Surface Profile  

E-Print Network (OSTI)

The Melnikov criterion is used to examine a global homoclinic bifurcation and transition to chaos in the case of a quarter car model excited kinematically by the road surface profile. By analyzing the potential an analytic expression is found for the homoclinic orbit. By introducing an harmonic excitation term and damping as perturbations, the critical Melnikov amplitude of the road surface profile is found, above which the system can vibrate chaotically.

Grzegorz Litak; Marek Borowiec; Michael I. Friswell; Kazimierz Szabelski



An order theoretic approach in fixed point theory  

E-Print Network (OSTI)

In the present article, we show the existence of a coupled fixed point for an order preserving mapping in a preordered left K-complete quasi-pseudometric space using a preorder induced by an appropriate function. We also define the concept of left-weakly related mappings on a preordered space and discuss common coupled fixed points for two and three left-weakly related mappings in the same space. Similar results are given for right-weakly related mappings, the dual notion of left-weakly related mappings.

Ya Ulrich Gaba



Capturing the Usage of the German Car Fleet for a One Year Period to Evaluate the Suitability of Battery Electric Vehicles A Model based Approach  

Science Journals Connector (OSTI)

Abstract The low driving range of battery electric vehicles (BEV) is often considered as relevant reason for the low BEV sales. In order to verify this assumption, the usage of conventional cars in Germany needs to be analyzed. These analyses may help to make more reliable and realistic statements to what extent German cars could be replaced by \\{BEVs\\} without restrictions for their users. Most travel surveys do only consider a single day or a short period of time in the analysis. Longer time periods should be taken into consideration when analyzing the travel data since the daily car usage is not identical every day. Since there are no representative and detailed car usage surveys over longer periods available a hybrid car usage model was developed to close that gap. This model is mainly based on three mobility surveys: the German Mobility Panel (MOP), the car mileage and fuel consumption survey, and the long distance travel survey INVERMO. We show that 13% of the modeled German private car fleet never exceeds 100km per day during a full year and could be replaced by \\{BEVs\\} without any usage restrictions for their car owners. Another 16% of the modeled private car fleet is driven more than 100km on 1-4 days during a full year and can be substituted with slight adjustments. These cars are often second cars of a household and used less intensively (6,600km/year resp. 7600km/year) than cars not suited for BEV substitution (14,800km/year). Households that could replace their cars tend to have a lower disposable income. The crux of the matter, however, is that substitution of conventional cars is often not feasible since the mobility budget of BEV suited households tends to be too low or does not make economic sense due to the low annual mileage.

Christine Weiss; Bastian Chlond; Michael Heilig; Peter Vortisch



Remote keyless entry honking, convenience horn honking, and audible car alarms: redundancies and quieter options  

Science Journals Connector (OSTI)

Vehicle sound emissions car alarms and horn honking are the subject of many noise complaints. Auto manufacturers spent years engineering quieter vehicles and have created cars whose approach is so subtle that they pose a danger to blind pedestrians. But while engine noise has decreased and car alarms are less reactive horn honking that is linked with remote keyless entry (RKE) technology increasingly contributes to community noise. RKE horn noise has never been the subject of public health inquiry. In scientific literature discussion of road noise and health does not distinguish noise among separate sources and tends to measure aggregate ambient noise levels rather than impulsive noise. RKE horn noise violates state traffic laws and some local noise ordinances regarding horn use but there have been no legislative attempts to address the technology. This raises questions about whether political leaders and policy setters are not exposed to RKE noise or do not discern RKE sounds from traffic noise and are therefore unaware of it. Using available auto industry data and case studies this paper will introduce key facts about RKE horn use in the United States and Canada reviewing new technologies that render noisy counterparts still in use as redundant.

Jeanine Botta



Remote keyless entry honking, convenience horn honking, and audible car alarms: Redundancies and quieter options  

Science Journals Connector (OSTI)

Vehicle sound emissions car alarms and horn honking are the subject of many noise complaints. Auto manufacturers spent years engineering quieter vehicles and have created cars whose approach is so subtle that they pose a danger to blind pedestrians. But while engine noise has decreased and car alarms are less reactive horn honking that is linked with remote keyless entry (RKE) technology increasingly contributes to community noise. RKE horn noise has never been the subject of public health inquiry. In scientific literature discussion of road noise and health does not distinguish noise among separate sources and tends to measure aggregate ambient noise levels rather than impulsive noise. RKE horn noise violates state traffic laws and some local noise ordinances regarding horn use but there have been no legislative attempts to address the technology. This raises questions about whether political leaders and policy setters are not exposed to RKE noise or do not discern RKE sounds from traffic noise and are therefore unaware of it. Using available auto industry data and case studies this paper will introduce key facts about RKE horn use in the United States and Canada reviewing new technologies that render noisy counterparts still in use as redundant.



Computational analysis of flow field around Ahmed car model passing underneath a flyover  

Science Journals Connector (OSTI)

A flow structure around a ground vehicle has been studied by many researchers using numerous methods either computational or experimental. However no analysis of flow field generated by a car passing under a flyover has been carried out. One of the famous simplified models of a car is the Ahmed body that has been established to investigate the influence of the flow structure on the drag. In this paper we investigate a flow field around Ahmed body of a single cruising condition as the vehicle passes under a flyover using a computational method with RANS equation. The main objective of this paper is to evaluate the turbulence kinetic energy and velocity magnitude developed within the wall boundary created by the flyover to the air flow field that is generated by the Ahmed reference car. It was observed that the simulated airflow passes the vehicle was bounded by the wall of the flyover and consequently changes the pattern of the flow field. Understanding the characteristic of this flow field under a flyover is essential if one wants to maximize the recovery of the dissipated energy which for example can be used to power a small vertical-axis wind turbine to produce and store electrical energy for lighting under the flyover.

Md Nor Musa; Kahar Osman; Ab Malik A. Hamat



Probing the Vibrational Relaxation of N2 and O2 by Use of CARS Spectroscopy to Model NTE-Turbulence  

E-Print Network (OSTI)

NTE-preparation. The detection technique used in the experiment was coherent anti-Stokes Raman spectroscopy (CARS) and variations of this laser-based technique were optimized to maximize accuracy and signal-to-noise in the vibrational relaxation...

Dean, Jacob


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE and FreedomCAR and Fuel Partnership Hydrogen Delivery and On-Board Storage Analysis Workshop  

Energy.gov (U.S. Department of Energy (DOE))

On January 25, 2006, the U.S. Department of Energy, together with the FreedomCAR & Fuel Partnership, held a workshop to review and discuss ongoing hydrogen storage and delivery analysis efforts...


Performance Characteristics of Coal-to-Liquids (CTL) Diesel in a 50-State Emissions Compliant Passenger Car  

Energy.gov (U.S. Department of Energy (DOE))

Comparisons between CTL, GTL, no. 2, and European diesel include fuel economy, regulated and unregulated emissions in a 50 State compliant passenger car with DOC, NOx adsorber and particulate trap


Cover: PNNL's Photovoltaic array produces electricity for our super-computing facility and adjacent car charging stations. IN THIS REPORT  

E-Print Network (OSTI)

and adjacent car charging stations. #12;IN THIS REPORT 2 Message From the Director 3 PNNL Overview 5 and greenhouse gas emissions Reducing material purchases and waste Minimizing use of water Keeping employees


Time-Dependent Properties of Liquid Water:? A Comparison of Car?Parrinello and Born?Oppenheimer Molecular Dynamics Simulations  

Science Journals Connector (OSTI)

Time-Dependent Properties of Liquid Water:? A Comparison of Car?Parrinello and Born?Oppenheimer Molecular Dynamics Simulations ... Dynamical information of water interacting with its local environment can be gleaned from the vibrational power spectrum. ...

I-Feng W. Kuo; Christopher J. Mundy; Matthew J. McGrath; J. Ilja Siepmann



Development scenario for passenger-car diesel engines with optimised: Combustion processes to meet future emission standards  

Science Journals Connector (OSTI)

The main reason why the modern supercharged direct-injection diesel engine is so successful as a means of propelling passenger cars is because it is more efficient than spark-ignition engines in nearly every o...

Jrn Kahrstedt; Kai Behnk; Ansgar Sommer; Thorsten Wormbs



Multi-Agent Based Techniques for Coordinating the Distribution of Electricity in a Micro-Grid Environment  

E-Print Network (OSTI)

vehicles, to ultra-low carbon vehicles (ULCV) such as hybrids, electric vehicles and hydrogen fuel cell. 2 Background Research To reduce carbon emissions and ensure that the UK low car- bon emissions plan to the current national grid, the in- creasing demand for electricity will only result in more car- bon emissions

Southampton, University of


Studies on Biological Effects of Ion Beams on Lethality, Molecular Nature of Mutation, Mutation Rate, and Spectrum of Mutation Phenotype for Mutation Breeding in Higher Plants  

Science Journals Connector (OSTI)

......rearrangements preferably induced by car- bon ions have different molecular...mutant, suv2-1, which is defective in cell-cycle arrest in response...Rearrangement of the DNA in car- bon ion-induced mutants...mutant in Arabidopsis thaliana is defective in the DNA damage response......

Atsushi Tanaka; Naoya Shikazono; Yoshihiro Hase



High-temperature formation of concentric fullerene-like structures within foam-like carbon: Experiment and molecular dynamics simulation  

E-Print Network (OSTI)

car- bon ion implantation,4 and arc discharge from a carbon target in water.5 Onionlike structures of concentric fullerene-like structures, car- bon onions can be formed in a variety of harsh environments laser operating at 532 nm, generating 12 ps pulses at a rep- etition rate of 1.5 MHz, with average power

Powles, Rebecca


The relationship between electronmolecule collision cross?sections, experimental Townsend primary and secondary ionization coefficients and constants, electric strength and molecular structure of gaseous hydrocarbons  

Science Journals Connector (OSTI)

...and constants, electric strength and molecular...hydrogen atoms/car- bon{hydrogen...relevant electron energy range being deter...Townsend ionization; electric strength; molecular...length (i.e. car- bon nucleus...the same in the energy range of interest...Lond. A (2000) Electric characteristics...



Mercury/Waterfilling for Fixed Wireless OFDM Angel Lozano  

E-Print Network (OSTI)

Mercury/Waterfilling for Fixed Wireless OFDM Systems Angel Lozano Bell Labs (Lucent Technologies- mation is then given by the more general mercury/waterfilling policy. This paper illustrates the usance of mercury/waterfilling on frequency-selective OFDM channels with QAM constellations and it quantifies

Verdú, Sergio


obligations. When these products are obtained at fixed prices  

E-Print Network (OSTI)

al. have failed to properly analyze these fixed- price full-requirements load- following products and Andrew Lemon, Power Procurement: What's in Your Mix?, PUB. UTIL. FORTNIGHTLY, Nov. 2006, at 50. 4. Load-following of generation assets in New England has become less concentrated following the use of load-following products

Gross, George


Walkable Communities, Inc. March 1999 Fixing the Big  

E-Print Network (OSTI)

-1- © Walkable Communities, Inc. March 1999 Road Diets Fixing the Big Roads By Dan Burden and Peter fund a study and to convert a one-mile section of Electric Avenue in Lewistown, Pennsylvania, from four crash statistics and other data, the team concluded that more uniform flow, reduced conflicts and great

Handy, Susan L.


14.6 CLOSE-OUT OF FIXED PRICE CONTRACTS Auditors recently have identified three problems with our practices regarding close-out of fixed-price  

E-Print Network (OSTI)

14.6 CLOSE-OUT OF FIXED PRICE CONTRACTS Auditors recently have identified three problems with our practices regarding close-out of fixed-price contracts when 10% or more of the budget remains in the account Principal Investigators to ensure that no more than 5% of the budget remains in a fixed-price contract


Chain Retraction Potential in a Fixed Entanglement Network  

Science Journals Connector (OSTI)

When a chain, tethered at one end, is immersed in a fixed entanglement network, the mobile tip of the chain encounters an entropic potential barrier that penalizes deep fluctuations needed to bring the tip close to the tethering point. Using the tube model, Doi and Kuzuu [J. Polym. Sci., Polym. Lett. Ed. 18, 775 (1980)] estimated that this potential, which is crucial to describe the rheology of branched polymers in fixed networks and melts, has a quadratic form with a prefactor ?=1.5. Later calculations based on regular lattices indicated that the potential is nonquadratic, and its steepness depends on the lattice coordination number. In this Letter, we analyze the primitive paths obtained using the bond-fluctuation model for chains with up to 12.5 entanglements. Our simulations confirm a quadratic form for the potential with a prefactor close to the Doi-Kuzuu value, ??1.5.

Sachin Shanbhag and Ronald G. Larson



Fixed points, stable manifolds, weather regimes, and their predictability  

In a simple, one-layer atmospheric model, we study the links between low-frequency variability and the models fixed points in phase space. The model dynamics is characterized by the coexistence of multiple weather regimes. To investigate the transitions from one regime to another, we focus on the identification of stable manifolds associated with fixed points. We show that these manifolds act as separatrices between regimes. We track each manifold by making use of two local predictability measures arising from the meteorological applications of nonlinear dynamics, namely, bred vectors and singular vectors. These results are then verified in the framework of ensemble forecasts issued from clouds (ensembles) of initial states. The divergence of the trajectories allows us to establish the connections between zones of low predictability, the geometry of the stable manifolds, and transitions between regimes.

Deremble, Bruno; D'Andrea, Fabio; Ghil, Michael [Univ. of California, Los Angeles, CA (United Staes). Atmospheric and Oceanic Sciences and Institute of Geophysics and Planetary Physics



Modeling for Anaerobic Fixed-Bed Biofilm Reactors  

SciTech Connect

The specific objectives of this research were: 1. to develop an equilibrium model for chemical aspects of anaerobic reactors; 2. to modify the equilibrium model for non-equilibrium conditions; 3. to incorporate the existing biofilm models into the models above to study the biological and chemical behavior of the fixed-film anaerobic reactors; 4. to experimentally verify the validity of these models; 5. to investigate the biomass-holding ability of difference packing materials for establishing reactor design criteria.

Liu, B. Y. M.; Pfeffer, J. T.



Multi-Period Planning for Electric Car Charging Station Locations: a Case of Korean Expressways  

Science Journals Connector (OSTI)

Abstract One of the most critical barriers to widespread adoption of electric cars is the lack of charging station infrastructure. Although it is expected that a sufficient number of charging stations will be constructed eventually, due to various practical reasons they may have to be introduced gradually over time. In this paper, we formulate a multi-period optimization model based on a flow-refueling location model for strategic charging station location planning. We also propose two myopic methods and develop a case study based on the real traffic flow data of the Korean Expressway network in 2011. We discuss the performance of the three proposed methods.

Sung Hoon Chung; Changhyun Kwon



Three-phase optimisation design of an electric car body at conceptual design stage  

Science Journals Connector (OSTI)

A three-phase optimisation design method is proposed in the paper. It is composed of two steps of topology optimisation and one step of size optimisation, and used for design of a mini electric car Body In White (BIW) at conceptual design stage. The method provides an opportunity to comprehend performances of the body construction under different load conditions in detail. Final result of the optimised BIW achieves 31% weight reduction with improved stiffness, strength and the first-order frequency compared with previous design.

Dafeng Jin; Jin Chen; Weiwei Qiao



Reduction of idle knock by EGR in a passenger car diesel engine  

SciTech Connect

In order to reduce the diesel idle knock, the effects of EGR on the idling characteristics were investigated on a passenger car equipped with an EGR Idle Knock Reduction System developed for practical use. It was found that EGR was effective not only for reducing idle knock but also for decreasing fuel consumption, smoke density, exhaust emissions and engine vibration. Moreover, the practical range and possibility of the EGR Idle Knock Reduction System were found by clarifying the relationship between EGR, injection timing, cooling water temperature, noise level and fuel consumption.

Fukutani, I.; Watanabe, E.



Aberdeen plans extra hydrogen station, plus fuel cell vans and cars  

Science Journals Connector (OSTI)

A second hydrogen refueling and storage station could be built in Aberdeen, Scotland according to a local media report in The Press and Journal. It would become part of the Aberdeen Hydrogen Project (H2 Aberdeen), which aims to establish a supply chain based around hydrogen product and service development in the city. The city council is also considering the purchase of additional hydrogen vehicles, in the form of Renault vans with fuel cell range-extenders as well as Hyundai ix35 Fuel Cell cars.


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Assessing current vehicle performance and simulating the performance of hydrogen and hybrid cars  

Science Journals Connector (OSTI)

A measure of the efficiency in transforming energy input into transport work is defined and applied to road vehicles as well as to sea, air and rail vehicles for passenger or freight transportation. The insight obtained with this measure is compared with the results of applying the conventional measure of kilometres per unit of energy for current fleets of vehicles. Then, simulation methods are used to assess the performance of fuel cell vehicles, electric vehicles and hybrids between the two. The latter are found to provide an optimum performance for a small, efficient passenger car.

Bent Srensen



An Efficient and Accurate Car-Parrinello-like Approach to Born-Oppenheimer Molecular Dynamics  

E-Print Network (OSTI)

We present a new method which combines Car-Parrinello and Born-Oppenheimer molecular dynamics in order to accelerate density functional theory based ab-initio simulations. Depending on the system a gain in efficiency of one to two orders of magnitude has been observed, which allows ab-initio molecular dynamics of much larger time and length scales than previously thought feasible. It will be demonstrated that the dynamics is correctly reproduced and that high accuracy can be maintained throughout for systems ranging from insulators to semiconductors and even to metals in condensed phases. This development considerably extends the scope of ab-initio simulations.

Thomas D. Khne; Matthias Krack; Fawzi R. Mohamed; Michele Parrinello



Car?Parrinello Molecular Dynamics Study of Anharmonic Systems:? A Mannich Base in Solution  

Science Journals Connector (OSTI)

Car?Parrinello Molecular Dynamics Study of Anharmonic Systems:? A Mannich Base in Solution ... Proton dynamics play a crucial role in many chemical, biochemical, and industrial processes1-4 because most of the properties of the water, which is the solvent in these systems, can be traced to intermolecular hydrogen bonds. ... However, there is also a fundamental reason for our choice of the atomic velocity power spectrum method; only in this way can we capture the dynamic nature of processes at the molecular level. ...

Aneta Jezierska; Jaros?aw Panek; Urban Bortnik; Janez Mavri; Duanka Janei?



Pyrolysis Using Microwave Heating: A Sustainable Process for Recycling Used Car Engine Oil  

Science Journals Connector (OSTI)

Pyrolysis Using Microwave Heating: A Sustainable Process for Recycling Used Car Engine Oil ... A reaction temperature of 600 C provided the greatest yield of commercially valuable products: the recovered liquid oils were composed of light paraffins and aromatic hydrocarbons that could be used as industrial feedstock; the remaining incondensable gases comprised light hydrocarbons that could potentially be used as a fuel source to power the process. ... The pyrolysis products leave the reactor and pass through a system of three water-cooled Liebig condensers [5, 6, 7], which collect condensed hydrocarbons in main and secondary collection flasks [8, 9]. ...

Su Shiung Lam; Alan D. Russell; Howard A. Chase



The history of alternative fuels in transportation: The case of electric and hybrid cars  

Science Journals Connector (OSTI)

The article describes and presents a critical analysis of the long history of alternative fuels and propulsion technologies, particularly in automobile applications. Cases are electric and hybrid cars. The term critical analysis refers to the analysis of the various alternative technologies in relation to their societal contexts. In particular, these are the varying contexts of energy security, energy policy, environmental problems, sustainability, and also the later more explicit climate change context. This approach gives some knowledge with relevance to the current discussions on implementation issues. The work is first of all founded on the knowledge field of Social Studies of Technological Systems.

Karl Georg Hyer



Model-based development and calibration of last generation diesel powertrains for passenger cars  

Science Journals Connector (OSTI)

This paper presents an original model-based approach to the system level development and calibration of diesel powertrains for passenger cars, implemented in a comprehensive software tool. The models for the different subsystems are coupled to execute optimisation loops, involving also the system calibration, and are characterised by flexibility of usage, limited tuning effort and reduced computational time. As an example of the general approach, the engine model is described and some results from its execution are shown and compared with the measurements. Finally, a practical example is given of the usage of the tool for system level optimisation through a specifically developed methodology.

Fabio Mallamo; Federico Millo; Luciano Rolando



CarParrinello Molecular Dynamics Simulations of CaCl2 Aqueous Solutions  

Science Journals Connector (OSTI)

(24, 25) Such ab initio molecular orbital calculations, performed at the restricted HartreeFock (HF) and second-order M?llerPlesset perturbation (MP2) levels of theory and followed by natural energy decomposition analysis, emphasized the importance of polarization effects in the binding energies of M2+(H2O)n clusters. ... It shows a maximum at 3.35 D, due to the electron polarization caused by the strong electric field of the ion. ... Solution Structure of Energy Stored System I: Aqua-B(OH)4: A DFT, CarParrinello Molecular Dynamics, and Raman Study ...

Teodora Todorova; Philippe H. Hnenberger; Jrg Hutter



MHK Technologies/Wave Treader fixed | Open Energy Information  

Open Energy Info (EERE)

MHK Technologies/Wave Treader fixed MHK Technologies/Wave Treader fixed < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Wave Treader fixed.jpg Technology Profile Primary Organization Green Ocean Energy Ltd Project(s) where this technology is utilized *MHK Projects/Development of Ocean Treader Technology Resource Click here Wave Technology Type Click here Attenuator Technology Readiness Level Click here TRL 4: Proof of Concept Technology Description The Wave Treader concept utilises the arms and sponsons from Ocean Treader and instead of reacting against a floating Spar Buoy, will react through an Interface Structure onto the Foundation of an Offshore Wind Turbine. Between the Arms and the Interface Structure hydraulic cylinders are mounted and as the wave passes the machine first the forward Sponson will lift and fall and then the aft Sponson will lift and fall each stroking their hydraulic cylinder in turn. This pressurises hydraulic fluid which is then smoothed by hydraulic accumulators before driving a hydraulic motor which in turn drives an electricity generator. The electricity is then exported through the cable shared with the Wind Turbine.


The fixed irreducible bridge ensemble for self-avoiding walks  

E-Print Network (OSTI)

We define a new ensemble for self-avoiding walks in the upper half-plane, the fixed irredicible bridge ensemble, by considering self-avoiding walks in the upper half-plane up to their $n$-th bridge height, $Y_n$, and scaling the walk by $1/Y_n$ to obtain a curve in the unit strip, and then taking $n\\to\\infty$. We then conjecture a relationship between this ensemble to $\\SLE$ in the unit strip from $0$ to a fixed point along the upper boundary of the strip, integrated over the conjectured exit density of self-avoiding walk spanning a strip in the scaling limit. We conjecture that there exists a positive constant $\\sigma$ such that $n^{-\\sigma}Y_n$ converges in distribution to that of a stable random variable as $n\\to\\infty$. Then the conjectured relationship between the fixed irreducible bridge scaling limit and $\\SLE$ can be described as follows: If one takes a SAW considered up to $Y_n$ and scales by $1/Y_n$ and then weights the walk by $Y_n$ to an appropriate power, then in the limit $n\\to\\infty$, one should obtain a curve from the scaling limit of the self-avoiding walk spanning the unit strip. In addition to a heuristic derivation, we provide numerical evidence to support the conjecture and give estimates for the boundary scaling exponent.

Michael James Gilbert



The role of electric cars in Amsterdams transport system in the year 2015; a scenario approach  

Science Journals Connector (OSTI)

Electric cars may contribute significantly to a reduction in external costs of urban transport. This paper investigates, using a scenario analysis, the necessary conditions for their possible introduction in the city of Amsterdam. First, a background sketch of recent developments in Amsterdam is given, followed by an outline of the potential of, and the problems inherent in, the introduction of electric cars. Four scenarios are constructed by means of the so-called Spider-model. It is visualized in a picture that consists of quadrants and eight axes on which important future developments are sketched on a five point scale. The quadrants represent policy concerns about national and international flanking policies, local economic developments, local spatial policies and public transport policies, respectively. The scenarios used are: Prosperous Amsterdam, Sustainable Amsterdam, Pauperized Amsterdam and Lonely Amsterdam, which largely differ in economic developments and in the spatial focus on sustainability issues. These scenarios act as frameworks for the policy development centered around the future adaption of electric cars in the city. Finally, the transport system and the potential role of the electric car in each scenario is investigated. It is concluded that flanking policies at all levels of spatial aggregation, as well as economic development are a sine qua non for a successful introduction of the electric car.

Sytze A Rienstra; Peter Nijkamp



Fact #852 December 22, 2014 Turbocharged Engines Account for 64.7% of all Four-Cylinder Gasoline Car Engines in 2014- Dataset  

Energy.gov (U.S. Department of Energy (DOE))

Excel file with dataset for Fact #852 December 22, 2014 Turbocharged Engines Account for 64.7% of all Four-Cylinder Gasoline Car Engines in 2014


Fact #848: November 24, 2014 Nearly Three-Fourths of New Cars have Fuel Economy above 25 Miles per Gallon- Dataset  

Energy.gov (U.S. Department of Energy (DOE))

Excel file with dataset for Fact #848: November 24, 2014 Nearly Three-Fourths of New Cars have Fuel Economy above 25 Miles per Gallon


Comparative study of the cutting of car interior trim panels reinforced by natural fibers  

Science Journals Connector (OSTI)

The use of natural fibers such as flax sisal or kenaf to reinforce plastic body panels for automotive applications is being introduced for car interior trim parts such as door panels hat shelves roofing etc. The benefits derived from using natural fibers instead of glass fibers are mainly ecological and economical. As a renewable product natural fibers have a greater environmental interest than oil based plastics. Natural fibers can be recycled and reused in a better way than glass fibers. On the other hand panels made of natural fibers have good mechanical properties but are lighter than glass fiber reinforced panels which means lower fuel consumption and therefore cost savings. The aim of this work is to explore the capabilities of lasers to effectively cut these new types of natural fiber reinforced panels. A comparison between the abrasive water jet cutting and the use of a CO 2 and Nd:YAG lasers is carried out. The experiments show that the laser can be used satisfactorily to cut the car interior panels reinforced by natural fibers.

J. Pou; M. Boutinguiza; F. Quintero; F. Lusquios; R. Soto; M. Prez-Amor



Product-service systems in the electric car industry: critical success factors in marketing  

Science Journals Connector (OSTI)

Abstract In the electric car industry the service component assumes considerable importance and it is a relevant factor in purchasing decisions. Therefore, proper management of the Product-Service System (PSS) is essential. This article aims to 1) identify the main sub-systems of the PSS in the electric car industry and 2) identify the critical success factors (CSFs) in marketing. The review of the literature led to the definition of four sub-systems: vehicle, infrastructure, on-board electronics, and energy. Based on these PSS sub-systems, organisations belonging to each sub-system were selected, and five managers were interviewed. The data were analysed using a cognitive mapping technique. Ten \\{CSFs\\} were identified, of which two belong to the vehicle sub-system (value proposition and product-service system bundle); one relates to the electronic on-board sub-system (advanced navigation systems); three relate to infrastructure sub-system (incentives, alternative transport systems and advocacy campaigns) and three belong to infrastructure and energy sub-systems (ease of use, proximity of charging point and standardisation). Finally, partnerships among players involve all the four sub-systems. Moreover, the relevance/manageability matrix offers evidence that partnerships represent a priority factor that requires immediate action from companies. The research offers a new means to identify \\{CSFs\\} by using a PSS analysis rather than taking an industry sector perspective.

Sergio Cherubini; Gennaro Iasevoli; Laura Michelini



The social construction of the market for electric cars in France: politics coming to the aid of economics  

Science Journals Connector (OSTI)

With so many questions being raised nowadays about the future of the global automobile industry, electric cars have tended to be viewed as an increasingly desirable sustainable solution for the sector. Encouraged by many states in Europe and across the world, this market ?? devolved from electrical technology ?? is slowly taking shape and has a serious chance of achieving future growth for the first time in its history. The present article tries to identify operational factors in the construction of the market for electric cars in France, highlighting the crucial role played by the state and public policy in the emergence of the new branch and in the construction of its demand. It also shows the definitional and symbolical conflicts which have structured debates on the future of the electric car and its commercial implications. Grasping these processes is decisive to understanding the current situation and the importance of representations on market building.

Axel Villareal



Improving Value in Medicare with an SGR Fix  

Science Journals Connector (OSTI)

...something that the relative-value scale does not do. The use of a relative-value scale with fees adjusted according to the SGR is inconsistent with the renewed interest in value creation in health care. A fee schedule that reimburses physicians on the basis of billing for approximately 8000 discrete service... Congressional attention is being directed toward developing an alternative Medicare reimbursement system that rewards physicians who improve the quality and efficiency of care, rather than trying to fix the sustainable growth rate formula.

Wilensky G.R.



Remarks on a fixed point theorem of Caristi  

E-Print Network (OSTI)

1977) David Lee Egle, B . S . , Pan American University Chairman of Advisory Committee: L. F. Guseman, Jr. Let (X, d) be a complete metric space and f a selfmap of X. It is shown that various known theorems on the existence of fixed and periodic..., &) is a partially ordered set. Let x c X. Define a set M by A = lA : A C X, x c A, and A is totally ordered&. Order M by set inclusion; that is, A Q B iff A C B. Let ( g, 6 ) be a chain in Af, and let B= UA Ac (g, g) Clearly, x c B and 8 L: X. Let a...

Egle, David Lee



Surface tension in bilayer membranes with fixed projected area  

E-Print Network (OSTI)

We study the elastic response of bilayer membranes with fixed projected area to both stretching and shape deformations. A surface tension is associated to each of these deformations. By using model amphiphilic membranes and computer simulations, we are able to observe both the types of deformation, and thus, both the surface tensions, related to each type of deformation, are measured for the same system. These surface tensions are found to assume different values in the same bilayer membrane: in particular they vanish for different values of the projected area. We introduce a simple theory which relates the two quantities and successfully apply it to the data obtained with computer simulations.

Alberto Imparato



Hadron Production at Fixed Target Energies and Extensive Air Showers  

E-Print Network (OSTI)

NA61/SHINE is a fixed-target experiment to study hadron production in hadron-nucleus and nucleus-nucleus collisions at the CERN SPS. Due to the very good acceptance and particle identification in forward direction, NA61/SHINE is well suited for measuring particle production to improve the reliability of air shower simulations. Data with proton and pion beams have been taken in 2007 and 2009. First analysis results for the pion yield in proton-carbon interactions at 31 GeV will be shown and compared to predictions from models used in air shower simulations.

M. Unger; for the NA61/SHINE Collaboration




Office of Environmental Management (EM)

5-02 INCREMENTALLY FUNDING FIXED-PRICE ACTIONS Policy Flash 2015-02 INCREMENTALLY FUNDING FIXED-PRICE ACTIONS Questions concerning this policy flash should be directed to Michael...

Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Utilisation de theor`emes de point fixe. Par Nicolas Lanchier 1  

E-Print Network (OSTI)

Utilisation de th´eor`emes de point fixe. Par Nicolas Lanchier 1 1 Th´eor`emes de point fixe. D´efinition 1.1 -- On appelle point fixe de f : X - X tout ´el´ement X tel que f() = . Th´eor`eme 1.2 (point point fixe. [4], Sect. 1.2 Th´eor`eme 1.3 -- Soient X un espace complet et f : X - X une application. S

Lanchier, Nicolas


Performance analysis of Azimuth Tracking Fixed Mirror Solar Concentrator  

Science Journals Connector (OSTI)

Abstract The fixed mirror solar collector (FMSC) fixes reflector and mobiles receiver to collect solar energy. However, this type of concentrator has a low efficiency and short operating duration in practical applications. In this paper, we propose to install the FMSC on an azimuth tracking device (ATFMSC) and the reflectors are arranged by intermission to avoid the shading of neighbor reflector for incidence angle of less than 10 to improve its optical performance. Through the integration of the reflected solar radiation distribution function over any reflection point, and then the whole collector aperture, we develop the analytical expressions of various system efficiencies to numerically simulate the performance of ATFMSC with evacuated tube receiver in different design parameters. It is validated by the ray tracing results. The result shows that the mean annual net heat efficiency of the whole system would be up to 61% with the operating temperature of 400C, which is higher than parabolic trough collector and traditional FMSC. This is because the longitudinal incidence angle of ATFMSC always remains zero by tracking the sun azimuth, so the end loss of the concentrator can be avoided and enables it to operate with high efficiency continually.

Longlong Li; Huairui Li; Qian Xu; Weidong Huang



Fixed Point Analysis of the Saturation Throughput of IEEE 802.11 WLANs with Capture  

E-Print Network (OSTI)

1 Fixed Point Analysis of the Saturation Throughput of IEEE 802.11 WLANs with Capture Venkatesh capture, fading or frame error), using a fixed point framework developed in [7]. Here, we extend the work then obtain the fixed point equations for the infrastructure model. We show that these equations accurately

Kumar, Anurag


Fixed Point Analysis of Single Cell IEEE 802.11e WLANs: Uniqueness and Multistability  

E-Print Network (OSTI)

1 Fixed Point Analysis of Single Cell IEEE 802.11e WLANs: Uniqueness and Multistability Venkatesh Ramaiyan1 Anurag Kumar1 and Eitan Altman2 Abstract-- We consider the vector fixed point equations arisingFrame Space (AIFS) values. We consider balanced and unbalanced solutions of the fixed point equations arising

Kumar, Anurag


New Insights from a Fixed Point Analysis of Single Cell IEEE 802.11 WLANs  

E-Print Network (OSTI)

New Insights from a Fixed Point Analysis of Single Cell IEEE 802.11 WLANs Anurag Kumar1, Eitan Altman2, Daniele Miorandi2 and Munish Goyal1 Abstract-- We study a fixed point formalisation of the well. In this more general framework, the fixed point solution and performance measures resulting from it are studied

Kumar, Anurag


New Insights from a Fixed Point Analysis of Single Cell IEEE 802.11 WLANs  

E-Print Network (OSTI)

1 New Insights from a Fixed Point Analysis of Single Cell IEEE 802.11 WLANs Anurag Kumar1, Eitan Altman2, Daniele Miorandi3 and Munish Goyal1 Abstract-- We study a fixed point formalisation of the well of the analysis. In this more general framework, the fixed point solution and performance measures resulting from

Kumar, Anurag


NE-23 List of California Sites NE-23 Hattie Car-well, SAN/NSQA Division  

Office of Legacy Management (LM)

NE-23 NE-23 Hattie Car-well, SAN/NSQA Division Attached for your information is the list of California sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified"fbr'FUSRAP:'~- The only site in California,that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Prcgram are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on the list, please call me at FTS 233-5439. /ct( Andrew Walls III. Desiynation and Certification Manager


Technical Targets of the President's FreedomCAR and Hydrogen Fuel Initiative  

NLE Websites -- All DOE Office Websites (Extended Search)

Targets of the President's Targets of the President's Freedom Car and Hydrogen Fuel Initiative Arlene Anderson Technology Development Manager US Department of Energy Hydrogen, Fuel Cells & Infrastructure Technologies DOE Workshop on Hydrogen Separations and Purification Technologies September 8-9, 2004 Arlington, Virginia 10/12/2004 2 Resources to Support the President's Hydrogen Fuel Initiative $77,500 $65,187 Fuel Cell Technologies : system components, stack components, fuel processors, technology validation $29,183 $0* Basic Science : production, storage and use $832 $555 Department of Transportation : safety, codes/standards $16,000 $4,889 Coal-based Hydrogen Production : gasification, gas separation $9,000 $6,377 Nuclear-based Hydrogen Production : high temperature reactions $227,840 $158,999**


OY Car During Normal Outburst: Balmer Emission From The Red Star And The Gas Stream  

E-Print Network (OSTI)

We present observations of OY Car, obtained with the Anglo-Australian Telescope, during a normal outburst in August 1991. Two sinusoidal components are resolved in the H$\\beta$ trailed spectra and we determine the location of the narrow component to be on the secondary star with a maximum contributed flux of ~2.5 per cent to the total flux. Imaging of the line distribution reveals that the other emission component is associated with the gas stream. This follows a velocity close to the ballistic one from the red star to a distance of ~0.5 R$_{L_{1}}$ from the white dwarf. This emission penetrates the accretion disc (from 0.5--0.1 R$_{L_{1}}$), with a velocity now closer (but lower) to the keplerian velocities along the path of the gas stream. We finally discuss the implications of having observed simultaneously line emission from the gas stream and the red star during outburst.

E. T. Harlaftis; T. R. Marsh



OY Car in Outburst: Balmer emission from the red star and the gas stream  

E-Print Network (OSTI)

We present observations of OY Car, obtained with the Anglo-Australian telescope, during a normal outburst in 1991. Two sinusoidal components are resolved in the Hbeta trailed spectra and we determine the location of the narrow component to be on the secondary star with a maximum contributed flux of ~2.5 per cent to the total flux. Imaging of the line distribution reveals that the other emission component is associated with the gas stream. This follows a velocity close to the ballistic one from the red star to a distance of ~0.5 R_L1 from the white dwarf. Then. its kinematics changes from 0.5-0.2 R_L1 (accretion disc) following velocities now closer to (but lower than) the keplerian velocities along the path of the gas stream. We finally dicsuss the implications of having observed simultaneously line emission from the gas stream and the red star during outburst.

E. T. Harlaftis; T. R. Marsh



Forecasting sales and product evolution: The case of the hybrid/electric car  

Science Journals Connector (OSTI)

We present a model that forecasts sales and product evolution, based on data on market and industry, which can be collected before the product is introduced. Product evolution can be incremental but can also take place by releasing new generations. In our model adoption of a new product is motivated by attribute improvements (enabled by technology evolution), and firms' attribute improvements strategies are motivated by market growth and directed by market preferences. The interdependency between attributes' improvements and cumulative adoption level makes the problem inherently dynamic. The dependency of attribute levels on adoption levels is assessed using industry and technology analysis. Market preferences and purchase intention response to attribute levels changes are assessed based on a conjoint study. The option of collecting and interpreting data about both demand and supply aspects, before the new product is introduced, enables us to estimate sales and technology progress endogenously rather than to require them as inputs. We demonstrate the method on the hybrid car market.

Yair Orbach; Gila E. Fruchter



Incorporating heterogeneity to forecast the demand of new products in emerging markets: Green cars in China  

Science Journals Connector (OSTI)

Abstract Emerging markets are becoming increasingly important for many companies and it is not surprising to see that an increasing number of new products, especially technology products, are now being launched in these markets fairly quickly after they are launched in Western markets. However, most of the research on forecasting demand for new products focuses on developed markets. Marketing managers in multinational companies may therefore be tempted to use models that have been applied in developed markets to forecast demand of new products in emerging markets. However, there is ample evidence that supports the contention that emerging markets are different to markets in developed economies. This research proposes a dynamic segmentation approach to forecast demand that explicitly incorporates heterogeneity of consumers within and across segments: a key distinguishing feature of emerging markets. The research is applied in the context of the Chinese green car market but can be replicated for other products and in similar market conditions.

Lixian Qian; Didier Soopramanien



Car?Parrinello Molecular Dynamics in a Finite Homogeneous Electric Field  

Science Journals Connector (OSTI)

We introduce a variational total?energy functional to treat finite homogeneous electric fields with periodic boundary conditions and show that this functional can be implemented within a Car?Parrinello molecular dynamics scheme. The coupling to an electric field is achieved through the Berry?phase expression of the polarization. The minimization of this extended functional gives a ground state which describes the polarized state in an electric field. For a crystalline system the ground state of this extended functional preserves the Bloch symmetry. The reliability of the method is demonstrated in the case of bulk MgO for the Born effective charges and the high? and low?frequency dielectric constants. In the latter case we evaluated the static dielectric constant by performing a damped molecular dynamics in the presence of a finite electric field completely avoiding the calculation of the dynamical matrix.

P. Umari; Alfredo Pasquarello



Taxing Car-produced Carbon Dioxide Emissions: Matching the Cure to the Disease  

Science Journals Connector (OSTI)

Abstract The amount of carbon dioxide (CO2) emissions produced by cars is a linear (albeit fuel specific) function of the amount of fuel consumed. Because CO2 emissions generate social costs, through their effect on climate change, which escape the price mechanism, a tax on CO2 is indicated. An ideal tax would alter the consumer prices so that they match the marginal social costs. This setting thus calls for a specific tax on fuel equal to the value of externality resulting from the combustion of a unit of fuel. Since such tax scheme is readily available, we study to what extent the existing CO2 tax policies make use of it. We find that they do only to a limited extent. Thus our policy prescription is to drop existing CO2 taxes and use the existing fuel taxes to adjust fuel prices so that they match the marginal social costs related to burning of fuel.

Petr David; Josef Montag



Universal flow-density relation of single-file bicycle, pedestrian and car motion  

E-Print Network (OSTI)

The relation between flow and density, also known as the fundamental diagram, is an essential quantitative characteristic to describe the efficiency of traffic systems. We have performed experiments with single-file motion of bicycles and compare the results with previous studies for car and pedestrian motion in similar setups. In the space-time diagrams we observe three different states of motion (free flow state, jammed state and stop-and-go waves) in all these systems. Despite of their obvious differences they are described by a universal fundamental diagram after proper rescaling of space and time which takes into account the size and free velocity of the three kinds of agents. This indicates that the similarities between the systems go deeper than expected.

Zhang, Jun; Holl, Stefan; Boltes, Maik; Andresen, Erik; Schadschneider, Andreas; Seyfried, Armin



Time-of-Flight camera based 3D point cloud reconstruction of a car  

Science Journals Connector (OSTI)

Abstract Modern car wash systems are generally controlled by light barriers and power measurement sensors. These sensors are directly mounted on the movable parts of the system which result in a slow regulation, leading to non-optimal performance, e.g. in terms of energy, water and detergent consumption or regarding the quality of the result. This paper presents an alternative approach, based on online automatic acquisition of 3D vehicle models, thus allowing for an a priori optimization of the washing process in order to achieve a better overall performance of the car wash system. Technically, the approach uses merged and synchronized data acquired by a multiple Time-of-Flight (ToF) camera setup. The proposed processing concept handles the range data sets acquired online, and performs data preprocessing, registration and fusion, as well as geometry extraction. The realized system is based on Graphics Processing Units (GPUs) in order to achieve a sufficient temporal processing performance. Furthermore, details are given showing how to solve the main challenges related to point cloud data processing, especially due to low image resolution, the influences of specific environment conditions, e.g. variations in coating and material reflectivity. The data registration is twofold, on the one hand the multiple ToF images are registered using the pre-calibrated camera system (extrinsic parameters), whereas the inter-frame registration is performed using a point-to-plane based iterative closest point (ICP) on the other hand. Finally, the merged data is integrated in a GPU data structure to allow a fast and efficient 3D point cloud reconstruction.

Thomas Hoegg; Damien Lefloch; Andreas Kolb



Front gardens to car parks: Changes in garden permeability and effects on flood regulation  

Science Journals Connector (OSTI)

Abstract This study addresses the consequences of widespread conversion of permeable front gardens to hard standing car parking surfaces, and the potential consequences in high-risk urban flooding hotspots, in the city of Southampton. The last two decades has seen a trend for domestic front gardens in urban areas to be converted for parking, driven by the lack of space and increased car ownership. Despite media and political attention, the effects of this change are unknown, but increased and more intense rainfall, potentially linked to climate change, could generate negative consequences as runoff from impermeable surfaces increases. Information is limited on garden permeability change, despite the consequences for ecosystem services, especially flood regulation. We focused on eight flooding hotspots identified by the local council as part of a wider urban flooding policy response. Aerial photographs from 1991, 2004 and 2011 were used to estimate changes in surface cover and to analyse permeability change within a digital surface model in a GIS environment. The 1, 30 and 100year required attenuation storage volumes were estimated, which are the temporary storage required to reduce the peak flow rate given surface permeability. Within our study areas, impermeable cover in domestic front gardens increased by 22.47% over the 20-year study period (19912011) and required attenuation storage volumes increased by 26.23% on average. These increases suggest that a consequence of the conversion of gardens to parking areas will be a potential increase in flooding frequency and severity a situation which is likely to occur in urban locations worldwide.

Jennifer R. Warhurst; Katherine E. Parks; Lindsay McCulloch; Malcolm D. Hudson



| News | Sports | Business | Politics | Opinion | Entertainment | Lifestyle | Travel | Women | Classified | Homes | Cars | Jobs | Sho SUBSCRIBE: Internet SubscSacbee: / Opinion  

E-Print Network (OSTI)

| Classified | Homes | Cars | Jobs | Sho SUBSCRIBE: Internet SubscSacbee: / Opinion Sections: 24-HOUR NEWS · 24 COLUMNS · Peter Schrag · Dan Walters · Daniel Weintraub · Public Editor Editorial: Abuse of power: Abuse of power - sacbee.com 8/2/2005http://www.sacbee.com/content/opinion/story/13340087p-14182071c

Massachusetts at Amherst, University of


Battery Powered Electric Car, Using Photovoltaic Cells Assistance Juan Dixon, Alberto Ziga, Angel Abusleme and Daniel Soto  

E-Print Network (OSTI)

Battery Powered Electric Car, Using Photovoltaic Cells Assistance Juan Dixon, Alberto Zúñiga, Angel Vehicles (EVs) is the scarce capacity of conventional electrical energy storage systems. Although Abusleme and Daniel Soto Abstract One of the major problems for the massive applicability of Electric

Catholic University of Chile (Universidad Católica de Chile)


CityCarControl : an electric vehicle drive-by-wire solution for distributed steering, braking and throttle control  

E-Print Network (OSTI)

In this paper, we propose CityCarControl, a system to manage the steering, braking, and throttle of a new class of intra-city electric vehicles. These vehicles have a focus on extreme light-weight and a small parking ...

Brown, Thomas B., M. Eng. Massachusetts Institute of Technology


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SPECTROSCOPY IN CRYOCRYSTALS AND MATRICES Time-resolved CARS measurements of the vibrational decoherence of I2 isolated  

E-Print Network (OSTI)

SPECTROSCOPY IN CRYOCRYSTALS AND MATRICES Time-resolved CARS measurements of the vibrational succeeded in making measurements on packets prepared at vibrations as high as v 14, and as a function of tempera- ture, for T 17­33 K. TRCARS measurements are well suited for the preparation of vibrational

Apkarian, V. Ara


Hydrogen Bond Dynamics of Histamine Monocation in Aqueous Solution: CarParrinello Molecular Dynamics and Vibrational Spectroscopy Study  

Science Journals Connector (OSTI)

Hydrogen Bond Dynamics of Histamine Monocation in Aqueous Solution: CarParrinello Molecular Dynamics and Vibrational Spectroscopy Study ... Our focus was on the part of vibrational spectra that corresponds to histamine NH stretching, since these degrees of freedom are essential for its interactions with either water molecules or transporters and receptors. ... The resulting vibrational power spectrum is presented in Figure 9. ...

Jernej Stare; Janez Mavri; Joe Grdadolnik; Jernej Zidar; Zvonimir B. Maksi?; Robert Vianello



Taking an Alternative Route: A guide for fleet operators and individual owners using alternative fuels in cars and trucks  

SciTech Connect

Taking an Alternative Route is a 30-page guide for fleet managers and individual owners on using alternative fuels in cars and trucks. Discussed in detail are all fuels authorized for federal credits under the Energy Policy Act of 1992 (EPAct). The publication informs federal and state fleet managers about how to comply with EPAct, and provides information about the Clean Air Act Amendments.

LaRocque, T.



Abundance of mass 47 CO2 in urban air, car exhaust, and human breath Hagit P. Affek *, John M. Eiler  

E-Print Network (OSTI)

. For example, d13 C values of respired CO2 and CO2 generated by combustion of oil, gasoline or biomass. In particular, the mass 47 anomaly (D47) can distinguish between CO2 produced by high temperature combustion a car exhaust pipe was enriched in a combustion source having a composition, as determined by a ?Keeling


Joint Meeting on Hydrogen Delivery Modeling and Analysis FreedomCAR and Fuels Partnership Hydrogen Delivery, Storage and  

E-Print Network (OSTI)

. ­ The current capital costs for the hydrogen pipelines in the model are based on 1.1X the price of steel natural that the refueling station default compressor capital costs are based on a 300 psi inlet pressure.) 2. CurrentJoint Meeting on Hydrogen Delivery Modeling and Analysis FreedomCAR and Fuels Partnership Hydrogen


The marriage of car sharing and hydrogen economy: A possible solution to the main problems of urban living  

Science Journals Connector (OSTI)

The hydrogen economy is seeking its killer application, which can break down the chicken and egg problem, i.e., no hydrogen powered car can be sold if it cannot be refueled, and nobody will invest to a hydrogen refueling station if no one has a hydrogen powered vehicle. The applications like material handling, backup-power, and small stationary combined heat and power (CHP) engines are the most promising candidates, which may show financial return in 35 years. The replacement of fossil fuel with hydrogen in the automotive industry offers a substantial reduction of the harmful environmental effects, however, it is still the most challenging because of the absence of the hydrogen infrastructure, the price and the lifetime of the fuel cell (FC) engine and the unsuitable regulations, as well. In this work a new possible market was identified and analyzed in different points of view. This market segment is a car-sharing system operating with small urban vehicles, which not only can solve some environmental problems (e.g., air pollution and CO2 emission), but also helps to reduce congestion, secure energy supply and ease its distribution. First, a sensitivity analysis was done and the key performance indicators of the system were determined. The financial return of a hydrogen-based car-sharing system was examined carefully as a function of the rated power of the fuel cell power train, the way of hydrogen supply, the cost of the hydrogen and the size of the car fleet. Finally, a possible hydrogen-based car-sharing service was designed and optimized to the downtown of Budapest, Hungary. A sustainable system was proposed, which can satisfy the needs of the business (i.e., profitability) and the environment.

Akos Kriston; Tams Szab; Gyrgy Inzelt



SF6432-FP (02-01-12) Firm Fixed Price  

NLE Websites -- All DOE Office Websites (Extended Search)



Breakout Items Action Items Fixed Price Contracting Topic Group Summaries  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Albuquerque Meeting - July 1997 Albuquerque Meeting - July 1997 Breakout Items Action Items Fixed Price Contracting Topic Group Summaries TOPIC GROUP SUMMARIES Routing * Group reviewed and approved fourth draft of working paper "Routing Issues Related to U.S. Department of Energy Radioactive Materials Transportation: Discussion and Analysis" * Group submitted working paper and draft list of "Stakeholder Recommendations" to TEC/WG and DOE Group reached consensus on three major routing-related issues: * DOE should develop standardized, cooperative approach to route selection * DOE needs to involve all stakeholders * DOE should submit final version of Group's working paper to other federal entities Future topics for consideration: * routing issues relevant to tribal entities and local jurisdictions


Grate assembly for fixed-bed coal gasifier  

DOE Patents (OSTI)

A grate assembly for a coal gasifier of a moving-bed or fixed-bed type is provided for crushing agglomerates of solid material such as clinkers, tailoring the radial distribution of reactant gases entering the gasification reaction zone, and control of the radial distribution of downwardly moving solid velocities in the gasification and combustion zone. The clinker crushing is provided by pinching clinkers between vertically oriented stationary bars and angled bars supported on the upper surface of a rotating conical grate. The distribution of the reactant gases is provided by the selective positioning of horizontally oriented passageways extending through the grate. The radial distribution of the solids is provided by mounting a vertically and generally radially extending scoop mechanism on the upper surface of the grate near the apex thereof.

Notestein, John E. (Morgantown, WV)



A fixed-parameter algorithm for the vertex cover problem  

Science Journals Connector (OSTI)

Abstract A subset F of vertices of a graph G is called a vertex cover P t set if every path of order t in G contains at least one vertex from F. Denote by ? t ( G ) the minimum cardinality of a vertex cover P t set in G. The vertex cover P t ( VCP t ) problem is to find a minimum vertex cover P t set. The VCP t problem is NP-hard for any integer t ? 2 . In this paper, we restrict our attention to the VCP 3 problem and present a fixed-parameter algorithm with runtime O ( 2 k k 3.376 + n 4 m ) for the VCP 3 problem. Here, n denotes the number of vertices, m denotes the number of the edges, k denotes the size of the vertex cover P 3 set searched for.

Jianhua Tu



Determining average bed temperature of nonisothermal fixed-bed hydrotreater  

Science Journals Connector (OSTI)

Employing three catalysts in three parallel pilot-scale fixed-bed reactors, hydrotreating experiments were performed in both isothermal and ascending temperature modes to investigate kinetics and to determine a representative bed temperature. Assuming 1.5th-order for hydrodesulfurization (HDS) and 1st-order for both hydrodenitrogenation (HDN) and mild hydrocracking (MHC), kinetic parameters were obtained from the isothermal mode operation. With the activation energies from isothermal operations, equivalent isothermal temperatures (EITs) in the ascending mode operations were established for specific HDS, HDN and MHC. Employing 19 thermocouple readouts in the catalyst beds and applying an Arrhenius-type rate equation containing the same activation energy, the representative bed temperature was determined. The temperature so determined is called kinetic EIT. The kinetic EIT was found to be the best to represent the nonisothermal bed temperature. The kinetic EIT has been applied to monitoring the catalyst activity in commercial hydrotreating units.

Sok Yui; John Adjaye



Gravity Duals of Lifshitz-Like Fixed Points  

SciTech Connect

We find candidate macroscopic gravity duals for scale-invariant but non-Lorentz invariant fixed points, which do not have particle number as a conserved quantity. We compute two-point correlation functions which exhibit novel behavior relative to their AdS counterparts, and find holographic renormalization group flows to conformal field theories. Our theories are characterized by a dynamical critical exponent z, which governs the anisotropy between spatial and temporal scaling t {yields} {lambda}{sup z}t, x {yields} {lambda}x; we focus on the case with z = 2. Such theories describe multicritical points in certain magnetic materials and liquid crystals, and have been shown to arise at quantum critical points in toy models of the cuprate superconductors. This work can be considered a small step towards making useful dual descriptions of such critical points.

Kachru, Shamit; /Stanford U., Phys. Dept. /SLAC; Liu, Xiao; /Perimeter Inst. Theor. Phys.; Mulligan, Michael; /Stanford U., Phys. Dept. /SLAC



Multi-parametric study of the effect of materials substitution on life cycle energy use and waste generation of passenger car structures  

Science Journals Connector (OSTI)

Aluminium and fibre reinforced plastics have been put forward as alternatives for steel to reduce passenger car weight and save energy during use. Often-reported drawbacks are increased energy for production and reduced recyclability, and hence, increased waste generation. This study considers the merits of the alternatives by making a multi-parametric comparison of the life cycle energy use and waste generation of three lightweight alternatives to todays all-steel car structure. The development level, captured as the percentage of high strength steel in todays car structure, is identified as an important new variable in the analysis of automotive life cycle energy use.

E. Tempelman



Case Study No. 2: Bon Apptit Management Company  

E-Print Network (OSTI)

and hormone use, seafood health and sustainability,began with a sustainable seafood educational tour around thelearning how to make better seafood choices. This effort

Thistlethwaite, Rebecca; Brown, Martha



Evolutions in 3D numerical relativity using fixed mesh refinement  

E-Print Network (OSTI)

We present results of 3D numerical simulations using a finite difference code featuring fixed mesh refinement (FMR), in which a subset of the computational domain is refined in space and time. We apply this code to a series of test cases including a robust stability test, a nonlinear gauge wave and an excised Schwarzschild black hole in an evolving gauge. We find that the mesh refinement results are comparable in accuracy, stability and convergence to unigrid simulations with the same effective resolution. At the same time, the use of FMR reduces the computational resources needed to obtain a given accuracy. Particular care must be taken at the interfaces between coarse and fine grids to avoid a loss of convergence at higher resolutions, and we introduce the use of "buffer zones" as one resolution of this issue. We also introduce a new method for initial data generation, which enables higher-order interpolation in time even from the initial time slice. This FMR system, "Carpet", is a driver module in the freely available Cactus computational infrastructure, and is able to endow generic existing Cactus simulation modules ("thorns") with FMR with little or no extra effort.

Erik Schnetter; Scott H. Hawley; Ian Hawke



Ash level meter for a fixed-bed coal gasifier  

DOE Patents (OSTI)

An ash level meter for a fixed-bed coal gasifier is provided which utilizes the known ash level temperature profile to monitor the ash bed level. A bed stirrer which travels up and down through the extent of the bed ash level is modified by installing thermocouples to measure the bed temperature as the stirrer travels through the stirring cycle. The temperature measurement signals are transmitted to an electronic signal process system by an FM/FM telemetry system. The processing system uses the temperature signals together with an analog stirrer position signal, taken from a position transducer disposed to measure the stirrer position to compute the vertical location of the ash zone upper boundary. The circuit determines the fraction of each total stirrer cycle time the stirrer-derived bed temperature is below a selected set point, multiplies this fraction by the average stirrer signal level, multiplies this result by an appropriate constant and adds another constant such that a 1 to 5 volt signal from the processor corresponds to a 0 to 30 inch span of the ash upper boundary level. Three individual counters in the processor store clock counts that are representative of: (1) the time the stirrer temperature is below the set point (500.degree. F.), (2) the time duration of the corresponding stirrer travel cycle, and (3) the corresponding average stirrer vertical position. The inputs to all three counters are disconnected during any period that the stirrer is stopped, eliminating corruption of the measurement by stirrer stoppage.

Fasching, George E. (Morgantown, WV)



Compact Fixed-exit UHV DCM for XAFS  

SciTech Connect

A double-crystal, UHV-compatible monochromator for XAFS applications at bending magnet beamlines has been designed. It uses two crystal sets, Si(111) and (311), on a common central rotation axis driven by an ex-vacuo goniometer. All mechanical and electrical components are mounted on a 400 mm UHV flange which is attached to a compact vacuum chamber. The first crystals are water cooled using connector- and bellowless tubing through the fluidic sealed feedthrough of the central rotation. The first crystal set is mounted off-axis and can be translated vertically to keep the fixed exit condition. The second crystal set uses small crystals of the same size as the first. In order to accept the reflected beam of the first crystal at small Bragg angles, it is tangentially translated along the beam. The angle can be varied from 5 deg. to 55.5 deg. resulting in a total energy range 2.4 - 43.4 keV for Si(111)/(311). Crystal sets are interchangeable by translating the vacuum chamber. Angle encoding is achieved by a Renishaw incremental optical encoder in vacuo.

Rickers, K.; Brueggmann, U.; Drube, W.; Herrmann, M.; Heuer, J.; Welter, E.; Schulte-Schrepping, H.; Schulz-Ritter, H. [Hamburger Synchrotronstrahlungslabor HASYLAB am Deutschen Elektronen-Synchrotron DESY, Notkestr. 85, D-22607 Hamburg (Germany)



Flame quality monitor system for fixed firing rate oil burners  

DOE Patents (OSTI)

A method and apparatus for determining and indicating the flame quality, or efficiency of the air-fuel ratio, in a fixed firing rate heating unit, such as an oil burning furnace, is provided. When the flame brightness falls outside a preset range, the flame quality, or excess air, has changed to the point that the unit should be serviced. The flame quality indicator output is in the form of lights mounted on the front of the unit. A green light indicates that the flame is about in the same condition as when the burner was last serviced. A red light indicates a flame which is either too rich or too lean, and that servicing of the burner is required. At the end of each firing cycle, the flame quality indicator goes into a hold mode which is in effect during the period that the burner remains off. A yellow or amber light indicates that the burner is in the hold mode. In this mode, the flame quality lights indicate the flame condition immediately before the burner turned off. Thus the unit can be viewed when it is off, and the flame condition at the end of the previous firing cycle can be observed.

Butcher, Thomas A. (Pt. Jefferson, NY); Cerniglia, Philip (Moriches, NY)



Isolated thermocouple amplifier system for stirred fixed-bed gasifier  

DOE Patents (OSTI)

A sensing system is provided for determining the bed temperature profile of the bed of a stirred, fixed-bed gasifier including a plurality of temperature sensors for sensing the bed temperature at different levels, a transmitter for transmitting data based on the outputs of the sensors to a remote operator's station, and a battery-based power supply. The system includes an isolation amplifier system comprising a plurality of isolation amplifier circuits for amplifying the outputs of the individual sensors. The isolation amplifier circuits each comprise an isolation operational amplifier connected to a sensor; a first "flying capacitor" circuit for, in operation, controlling the application of power from the power supply to the isolation amplifier; an output sample and hold circuit connected to the transmitter; a second "flying capacitor" circuit for, in operation, controlling the transfer of the output of the isolation amplifier to the sample and hold circuit; and a timing and control circuit for activating the first and second capacitor circuits in a predetermined timed sequence.

Fasching, George E. (Morgantown, WV)


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fixed bed downdraft gasification of paper industry wastes  

Science Journals Connector (OSTI)

The two main wastes generated from secondary fibre paper mills are rejects (composed mainly of plastics and fibres) and de-inking sludge, both of which are evolved from the pulping process during paper manufacture. The current practice for the disposal of these wastes is either by land-spreading or land-filling. This work explores the gasification of blends of pre-conditioned rejects and de-inking sludge pellets with mixed wood chips in an Imbert type fixed bed downdraft gasifier with a maximum feeding capacity of 10kg/h. The producer gases evolved would generate combined heat and power (CHP) in an internal combustion engine. The results show that as much as 80wt.% of a brown paper mills rejects (consisting of 20wt.% mixed plastics and 80wt.% paper fibres) could be successfully gasified in a blend with 20wt.% mixed wood chips. The producer gas composition was 16.24% H2, 23.34% CO, 12.71% CO2 5.21% CH4 and 42.49% N2 (v/v%) with a higher heating value of 7.3MJ/Nm3. After the removal of tar and water condensate the producer gas was of sufficient calorific value and flow rate to power a 10kWe gas engine. Some blends using rejects from other mill types were not successful, and the limiting factor was usually the agglomeration of plastics present within the fuel.

M. Ouadi; J.G. Brammer; M. Kay; A. Hornung



Fixed denial system for access control of nuclear weapons  

SciTech Connect

The Fixed Denial System (FDS) is a simple, low cost, vertical, underground silo used to store individual nuclear weapons within secured areas of present storage sites. The normal storage position of each weapon is at or near the top of the shaft, allowing rapid operational weapon access and removal. In response to a threat, the weapon within a storage canister can be dropped to the bottom of the shaft where it is automatically locked in place. Once the alert condition is resolved and control of the site reestablished, the weapon canister is unlocked with a coded signal and retrieved. This system offers a high degree of hardening and access denial that is characteristic of Vertical Underground Storage (VUGS) systems. An aboveground test apparatus was constructed to demonstrate the feasibility of using a pneumatic air cushion, which is generated by the free-fall of the weapon container, to control impact velocity and descent time. Stockpile weapons that might be stored in the FDS include the W33, W48, W79, and the W54 ADM.

Willan, V.O.; Gustafson, E.C.



Fixed-bed bioreactor system for the microbial solubilization of coal  

DOE Patents (OSTI)

A fixed-bed bioreactor system for the conversion of coal into microbially solubilized coal products. The fixed-bed bioreactor continuously or periodically receives coal and bio-reactants and provides for the large scale production of microbially solubilized coal products in an economical and efficient manner. An oxidation pretreatment process for rendering coal uniformly and more readily susceptible to microbial solubilization may be employed with the fixed-bed bioreactor. 1 fig., 1 tab.

Scott, C.D.; Strandberg, G.W.



Demand side management of electric car charging: Benefits for consumer and grid  

Science Journals Connector (OSTI)

Ireland is currently striving to source 10% of the energy required for its transport fleet from renewable energy sources by 2020. As part of the measures being implemented in order to help realise this ambitious target a number of Government schemes have been introduced to financially subsidise the purchase of alternative energy vehicles in an effort to achieve 10% EV (electric vehicle) penetration in the country's road fleet by 2020. The replacement of ICE (internal combustion engine) vehicles with EV equivalents poses challenges for grid operators while simultaneously offering opportunities in terms of distributed energy storage and flexible load. This paper examines how optimising the charging cycles of an electric car using DSM (Demand Side Management) based on a number of criteria could be used to achieve financial savings, increased demand on renewable energy, reduce demand on thermal generation plant, and reduce peak load demand. The results demonstrate that significant gains can be achieved using currently available market data which highlights the point that DSM can be implemented without any further technological advents.

P. Finn; C. Fitzpatrick; D. Connolly



Observation of excited state charge transfer with fs/ps-CARS  

SciTech Connect

Excited state charge transfer processes are studied using the fs/ps-CARS probe technique. This probe allows for multiplexed detection of Raman active vibrational modes. Systems studied include Michler's Ketone, Coumarin 120, 4-dimethylamino-4{prime}-nitrostilbene, and several others. The vibrational spectrum of the para di-substituted benzophenone Michler's Ketone in the first excited singlet state is studied for the first time. It is found that there are several vibrational modes indicative of structural changes of the excited molecule. A combined experimental and theoretical approach is used to study the simplest 7-amino-4-methylcoumarin, Coumarin 120. Vibrations observed in FTIR and spontaneous Raman spectra are assigned using density functional calculations and a continuum solvation model is used to predict how observed modes are affected upon inclusion of a solvent. The low frequency modes of the excited state charge transfer species 4-dimethylamino-4{prime}-nitrostilbene are studied in acetonitrile. Results are compared to previous work on this molecule in the fingerprint region. Finally, several partially completed projects and their implications are discussed. These include the two photon absorption of Coumarin 120, nanoconfinement in cyclodextrin cavities and sensitization of titania nanoparticles.

Blom, Alex Jason



VI.5 Recycling of plastic waste, rubber waste and end-of-life cars in Germany  

Science Journals Connector (OSTI)

Publisher Summary Among different types of consumer waste in Germany, plastic waste, rubber waste, and end-of-life cars are closely intertwined. Processing techniques applied to these types of consumer waste are identical in many cases. This chapter outlines these similarities and discusses each type of consumer waste. The regulations for plastic waste recycling only apply to private households. Regulations are limited to packaging waste with the ordinance on packaging waste being the legal provision. The recycling of packaging remnants from production or defective production units is partially organized by producers themselves. Energy recovery of plastic packaging is limited to combined heat and power stations. Packaging waste that cannot be submitted to mechanical recycling is usually treated by the means of feedstock recycling. The treatment of plastic waste comprises fragmentation, sizing, sorting, washing and drying, agglomeration, and granulation. Rubber waste is unsuitable for deposition at landfill sites because of poor compressibility, resilient surfaces, extremely long rotting time, and forming of cavities with air inclusion. An increased utilization of rubber waste in the production of new tires depends directly on the quality of the vulcanization process.

Peter Dreher; Martin Faulstich; Gabriele Weber-Blaschke; Burkhard Berninger; Uwe Keilhammer



Analysis on the feedback effect for the diffusion of innovative technologies focusing on the green car  

Science Journals Connector (OSTI)

Previous studies of technical competitive relationship have mostly focused on the analysis of one-directional impact of the technical attribute on market share. However, there is a cyclical feedback effect between the technical attributes and market share, and that means the small difference of competitiveness at the early phase of technology diffusion can greatly affect the final market share. As such, this study presents the system dynamics model which can forecast sales of innovative technology considering the feedback effect of market share on technical attributes. For that, the causal loop diagram among the various variables was defined using the econometric model applied and proven in various studies of the Bass diffusion model, discrete choice model, etc. to reinforce the theoretical background of the causal relationship among the variables of the forecasting model. Furthermore, infrastructure building scenarios and feedback effect scenarios were applied to the developed forecasting model to present the implication for successful adoption of green car technology from the infrastructure development view point.

Duk Hee Lee; Sang Yong Park; Jong Wook Kim; Seong Kon Lee



ENERGY STAR Update: ENERGY STAR Encourages Car Dealerships to Work with NADA on Survey (May 20, 2013)  

NLE Websites -- All DOE Office Websites (Extended Search)

Update Update U.S. Environmental Protection Agency May 20, 2013 ENERGY STAR Encourages Car Dealerships to Work with NADA on Survey In conjunction with ENERGY STAR and the EPA, the National Automobile Dealers Association (NADA) has launched a program to help new car and truck dealerships reduce energy consumption through the Agency's ENERGY STAR program. In many other sectors of the commercial buildings market, there exist national data sets detailing how buildings use energy. These data enable EPA to develop 1 - 100 ENERGY STAR scores, which rank individual buildings relative to other similar buildings across the country. A score of 50 represents median energy performance, whereas a score of 75 means that a building is more energy efficient than 75


Apps for Vehicles: Why should I care what data is in my car and what can be  

Open Energy Info (EERE)

Why should I care what data is in my car and what can be Why should I care what data is in my car and what can be done with this data (examples)? Home > Groups > Developer This question relates to energy hackathons and the OpenXC platform. More information at http://en.openei.org/wiki/Help:Energy_Hackathon_Resources Submitted by Rmckeel on 24 September, 2012 - 10:36 3 answers Points: 0 The goal of the Open Data initiative is to empower customers to use their data to their individual advantage. An eco-conscious individual may focus on data that reveals how driving patterns affect GHG emissions. Someone interested in vehicle performance may use it to compare engine operations given different oil weights or gasoline octane ratings to determine what engine inputs provide optimal performance. With the magnitude of data


Relationship between the merit factor of thermoelectric materials and the air conditioning unit of urban electric cars  

SciTech Connect

The main benefit of electric cars is to reduce air pollution in cities that is thus desirable to equip them with non polluting air conditioning units and this rules out frigorific compressors operating with CFC. The planned replacement of CFC by HFC is at best an interim solution. The best solution is certainly to use thermoelectric air conditioning units, which are inherently pollution-free. However, these have a fairly low COPF when compared to traditional compressor units. We study the relationship between the cooling of the interior of urban electric cars and the merit factor of the thermoelectric material in their Peltier unit. This should help provide concrete target properties of future T E materials. {copyright} {ital 1995} {ital American} {ital Institute} {ital of} {ital Physics}.

Buffet, J. [Counsulting Engineer, 2 av. DODE de la BRUNERIE 75016 Paris (France)



Structural, dynamic, and vibrational properties during heat transfer in Si/Ge superlattices: A Car-Parrinello molecular dynamics study  

SciTech Connect

The structural, dynamic, and vibrational properties during heat transfer process in Si/Ge superlattices are studied by analyzing the trajectories generated by the ab initio Car-Parrinello molecular dynamics simulation. The radial distribution functions and mean square displacements are calculated and further discussions are made to explain and probe the structural changes relating to the heat transfer phenomenon. Furthermore, the vibrational density of states of the two layers (Si/Ge) are computed and plotted to analyze the contributions of phonons with different frequencies to the heat conduction. Coherent heat conduction of the low frequency phonons is found and their contributions to facilitate heat transfer are confirmed. The Car-Parrinello molecular dynamics simulation outputs in the work show reasonable thermophysical results of the thermal energy transport process and shed light on the potential applications of treating the heat transfer in the superlattices of semiconductor materials from a quantum mechanical molecular dynamics simulation perspective.

Ji, Pengfei; Zhang, Yuwen, E-mail: zhangyu@missouri.edu [Department of Mechanical and Aerospace Engineering, University of Missouri, Columbia, Missouri 65211 (United States); Yang, Mo [College of Energy and Power Engineering, University of Shanghai for Science and Technology, Shanghai 200093 (China)



Unique Thylakoid Membrane Architecture of aUnicellular N2-Fixing...  

NLE Websites -- All DOE Office Websites (Extended Search)

intracellular transport and trafficking. Citation: Liberton ML, JR Austin, RH Berg, and HB Pakrasi.2011."Unique Thylakoid Membrane Architecture of aUnicellular N2-Fixing...


Robert Lemos, News.com, 2004.12.01: "Microsoft rushes out critical IE fix  

E-Print Network (OSTI)

saves it for later. See, e.g., phpWebSite security hole fixed 2004.11.16. #12;Mixed-source command lines

Bernstein, Daniel


Genome-wide Expression Assay Comparison Across Frozen and Fixed Postmortem Brain Tissue Samples  

E-Print Network (OSTI)

Continued) B6207 Control M Heart attack/disease Frozen B6756Fixed B6208 Control F Heart attack/disease Frozen B4756



EM Finds Success with Fixed-Priced Hybrid Contract Approach Benefittin...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

fixed-priced procurements in the future, and some may involve a new combination of contracting strategies proven successful at the Hanford site. The Hanford success story marked...


Off-peak summer performance enhancement for rows of fixed solar thermal collectors using reflective surfaces.  

E-Print Network (OSTI)

??The possibility of increasing the efficiency of fixed solar thermal collectors without greatly adding to the cost or complexity of the overall solar collection system (more)

Armenta, Casiano



Tarifs Tlphonique (26/12/2013) -Page 1/5 Destination Tarifs Fixe Tarifs mobile Exception  

E-Print Network (OSTI)

/5 Destination Tarifs Fixe Tarifs mobile Exception Comores 0,49/mn 0,49/mn Congo 0,49/mn 0,49/mn Congo RDC 0

Rossi, Vivien


Regional distributions of nitrogen-fixing bacteria in the Pacific Ocean  

Science Journals Connector (OSTI)

ABSTRACT: We evaluated the regional distributions of six nitrogen (N2)-fixing bacteria in the North Pacific Ocean using quantitative polymerase chain reaction


E-Print Network 3.0 - aerated submerged fixed-film Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

January 2007 Summary: Trickling Filter - Facility type with fixed film bacteria. Wastewater is typically pumped up... TRANSFER EFFICIENCY MONITORING OF WASTEWATER AERATION...


Memory difference control of unknown unstable fixed points: Drifting parameter conditions and delayed measurement  

E-Print Network (OSTI)

Difference control schemes for controlling unstable fixed points become important if the exact position of the fixed point is unavailable or moving due to drifting parameters. We propose a memory difference control method for stabilization of a priori unknown unstable fixed points by introducing a memory term. If the amplitude of the control applied in the previous time step is added to the present control signal, fixed points with arbitrary Lyapunov numbers can be controlled. This method is also extended to compensate arbitrary time steps of measurement delay. We show that our method stabilizes orbits of the Chua circuit where ordinary difference control fails.

Jens Christian Claussen; Thorsten Mausbach; Alexander Piel; Heinz Georg Schuster


Note: This page contains sample records for the topic "fixed car bon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Dynamical Host/Guest Interactions in Zeolites:? Framework Isotope Effects on Proton Transfer Studied by Car?Parrinello Molecular Dynamics  

Science Journals Connector (OSTI)

Dynamical Host/Guest Interactions in Zeolites:? Framework Isotope Effects on Proton Transfer Studied by Car?Parrinello Molecular Dynamics ... While in liquids the proper relaxation mechanisms can be described in terms of the orientational correlation functions of solvent molecules,8 in solids and in zeolites in particular, velocity or dipole autocorrelation functions (or their Fourier Transform giving the power or IR spectra) are good candidates to describe this phenomenon. ... A single band in the stretching region indicates the absence of water molecules. ...

Ettore Fois; Aldo Gamba



Life cycle cost analysis of a car, a city bus and an intercity bus powertrain for year 2005 and 2020  

Science Journals Connector (OSTI)

The international economy, in the beginning of the 20th century, is characterized by uncertainty about the supply and the price of oil. Together with the fast decrease of electrical propulsion component prices, it becomes more and more cost effective to develop vehicles with alternative powertrains. This paper focuses on two questions: Are alternative powertrains especially cost effective for specific applications?; How does an increased fossil fuel price influences the choose of powertrain? To assess these questions, a computer tool named THEPS, developed in a Ph.D. project, is used. Three applications and three scenarios are analysed. The applications, a car, a city bus and an intercity bus, are vehicles all assumed to operate in Sweden. One scenario represents year 2005, the other two year 2020. The two future scenarios are characterized by different fossil fuel prices. The study, presented in the paper, indicates that alternative powertrains can be competitive from a cost perspective, in some applications, already in year 2005. It is for example cost effective to equip a city bus, running in countries with a high fuel price, with a hybrid powertrain. The study also indicates that pure electric, hybrid and/or fuel cell cars will probably be a more cost effective choice than conventional cars in year 2020. Another indication is that it will not be clear which powertrain concept to choose. The reason is that many cost effective powertrain concepts will be offered. The best choice will depend on the application.

Jonas Hellgren



Energy use and CO2 emissions reduction potential in passenger car fleet using zero emission vehicles and lightweight materials  

Science Journals Connector (OSTI)

Introduction of \\{ZEVs\\} (zero emission vehicles) and lightweight materials in a conventional steel-intensive internal combustion engine vehicle fleet will affect energy consumption and automotive material requirements. We developed a bottom-up dynamic accounting model of the light-duty vehicle fleet, including vehicle production and disposal, with detailed coverage of powertrains and automotive materials. The model was used to study the potential for energy consumption and CO2 emissions reduction of \\{ZEVs\\} and lightweight materials in the Colombian passenger car fleet from 2010 to 2050. Results indicate that passenger car stock in Colombia is increased by 6.6 times between 2010 and 2050. In the base scenario energy consumption and CO2 emissions are increased by 5.5 and 4.9 times respectively. Lightweighting and battery electric vehicles offer the largest tank-to-wheel energy consumption and CO2 emissions reductions, 48 and 61% respectively, compared to 2050 baseline values. Slow stock turnover and fleet size increment prevent larger reductions. Switching to electric powertrains has larger impact than lightweighting on energy consumption and CO2 emissions. Iron and steel remain major materials in new cars. Aluminum consumption increases in all scenarios; while carbon fiber reinforced polymer consumption only increases due to fuel cell hybrid electric vehicle or lightweight vehicle use.

Juan C. Gonzlez Palencia; Takaaki Furubayashi; Toshihiko Nakata



Fact #708: January 2, 2012 Amenities, Safety and Emissions Equipment Make Up an Increasing Share of the Cost of a Car  

Energy.gov (U.S. Department of Energy (DOE))

While the overall price of a new car has not increased greatly from 1967 to 2010 when adjusted for inflation, the costs associated with added amenities like navigation, telematics, power seats and...


Consumers Surplus with a Racial Apology? Black Relative to Non-Black Inequality in the Welfare Gains of Fuel-Efficient Cars and Trucks  

Science Journals Connector (OSTI)

This paper considers whether race conditions the welfare gains associated with the purchase of cars and trucks that comply with National Highway Traffic Safety Administration Corporate Average Fuel Efficiency Sta...

Juliet U. Elu; Gregory N. Price



DOE Hydrogen and Fuel Cells Program Record 11002: Number of Cars Equivalent to 100 Metric Tons of Avoided Greenhouse Gases per Year  

NLE Websites -- All DOE Office Websites (Extended Search)

02 Date: January 5, 2011 02 Date: January 5, 2011 Title: Number of Cars Equivalent to 100 Metric Tons of Avoided Greenhouse Gases per Year Originator: Andrea Chew & Tien Nguyen Approved by: Sunita Satyapal Date: January 25, 2011 A conventional mid-size gasoline car emits 0.45 kg of greenhouse gases (GHG) per mile. 1 One hundred (100) metric tons (t) of GHG per year are equivalent to emissions from 17 conventional gasoline cars. Item: The GHG emissions cited above are from an analysis record prepared by the Department of Energy's Fuel Cell Technologies and Vehicle Technologies Programs on life-cycle emissions of greenhouse gases and petroleum use for several light-duty vehicles. 1 For cars that are between 1 and 5 years old, the average mileage is approximately 13,000,


Wave and place fixed DPOAE maps of the human ear  

Science Journals Connector (OSTI)

Human intermodulation distortion product otoacoustic emissions (DPOAE) can be a mixture of low and high latency components. They have different level phase and suppression characteristics which indicate that emissions arise both from the frequency region of the primary tones directly and indirectly via the DP frequency place. Which component dominates the measured DPOAE in the ear canal depends on the stimulus parameters especially the frequency ratio f 2 /f 1 . Interference between the two emissions adds complexity to measurements of DPOAE. The behavior and even existence of whichever emission route is lower in level often cannot directly be deduced from the raw DPOAE data because the other emission covers it. It is therefore not known whether both emissions are present for all stimulus parameters or whether the trends seen in each emission when they are the dominant emission route continue under stimulus conditions when they are not dominant. In this study the two DPOAE components are separated by a post-processing method. Previously maps of raw DPOAE data against f 2 /f 1 and DP frequency have been obtained. To separate the components sets of data consisting of f 2 /f 1 sweeps were transformed by an inverse Fourier transform into the time domain. The low and high latency components appeared as two distinct peaks because of their different phase gradients. These peaks were separated by windowing in the time domain and two frequency domain maps were reconstructed representing the low and high latency DPOAEs. It was found that the low latency component of the 2?f 1 ?f 2 DP was only emitted strongly with f 2 /f 1 between approximately 1.1 and 1.3. The removal of the high latency component revealed the low ratio edge of this region at which the level falls sharply. However the low latency emission has been traced at reduced amplitude over a wide range of stimulus parameters. Although previously only observed at small frequency ratios the high latency component was found to be present widely in the lower sideband its level reducing slowly at larger f 2 /f 1 . Its phase behavior changes in the lower sideband being approximately constant with DP frequency at small ratios of f 2 /f 1 but deviating from this at wider ratios. These results support the hypothesis that a DPOAE component which propagates to and is re-emitted from the DP frequency place (place fixed emission) is present across a wide parameter range. However for all but the close primary condition the lower sideband DPOAE is dominated by direct emission from the region of f 2 and f 1 wave interaction(wave fixed emission). A simple transmission line model is presented to illustrate how the observed DPOAE maps can arise on the basis of this hypothesis.

Richard D. Knight; David T. Kemp



Combustion and Emissions Characterization of Biodiesel Blends in a City-Car Engine  

Science Journals Connector (OSTI)

Whereas in the available literature, most of the researches addressed the multicylinders diesel engine of large displacement;(7, 22-27) only some works have investigated the light duty engines, designed for agricultural purpose and mainly tested for a fixed value of the engine speed. ... Rakopoulos, C. D.; Antonopoulos, K. A.; Rakopoulos, D. C.; Hountalas, D. T.; Giakoumis, E. G.Comparative performance and emissions study of a direct injection Diesel engine using blends of diesel fuel with vegetable oils or bio-diesels of various origins Energy Convers. ... Heywood, J. B. Internal combustion engine fundamentals; Mcgraw-Hill: New York, 1988. ...

Giancarlo Chiatti; Ornella Chiavola; Fulvio Palmieri; Stefano Albertini



Mainstream consumers driving plug-in battery-electric and plug-in hybrid electric cars: A qualitative analysis of responses and evaluations  

Science Journals Connector (OSTI)

Plug-in electric vehicles can potentially emit substantially lower CO2 emissions than internal combustion engine vehicles, and so have the potential to reduce transport emissions without curtailing personal car use. Assessing the potential uptake of these new categories of vehicles requires an understanding of likely consumer responses. Previous in-depth explorations of appraisals and evaluations of electric vehicles have tended to focus on early adopters, who may not represent mainstream consumers. This paper reports a qualitative analysis of responses to electric cars, based on semi-structured interviews conducted with 40 UK non-commercial drivers (20 males, 20 females; age 2470years) at the end of a seven-day period of using a battery electric car (20 participants) or a plug-in hybrid car (20 participants). Six core categories of response were identified: (1) cost minimisation; (2) vehicle confidence; (3) vehicle adaptation demands; (4) environmental beliefs; (5) impression management; and, underpinning all other categories, (6) the perception of electric cars generally as work in progress products. Results highlight potential barriers to the uptake of current-generation (2010) plug-in electric cars by mainstream consumers. These include the prioritization of personal mobility needs over environmental benefits, concerns over the social desirability of electric vehicle use, and the expectation that rapid technological and infrastructural developments will make current models obsolete. Implications for the potential uptake of future electric vehicles are discussed.

Ella Graham-Rowe; Benjamin Gardner; Charles Abraham; Stephen Skippon; Helga Dittmar; Rebecca Hutchins; Jenny Stannard



Time-resolved ultraviolet spectroscopy of the compact interacting binary QU Car  

E-Print Network (OSTI)

We present HST/STIS (1160--1700A) echelle spectra of the cataclysmic variable (CV) star, QU Car, observed in time-tag mode at three epochs. In catalogues this binary is classified as a nova-like variable. We find evidence of a high-state non-magnetic CV at low inclination, with unusually high ionisation. We observed narrow absorption lines (few hundred km/s wide) in N V1240, O V1371 and Si IV1398, as well as broader (HWZI ~1000km/s) emission in C III1176, C IV1549 and He II1640, all with a superposed absorption component. High ionisation is indicated by the unusually string He II emission and the relative strength of the O V absorption line. The dereddened UV SED of, on average, -2.3 suggests that disc accretion dominates the spectral energy distribution. In two observations velocity shifting is noted in the absorption lines on a timescale long enough not to repeat within the ~2600-sec exposures. The absorption superposed on the C IV emission line moves coherently with the N V and Si IV absorption, suggesting the same origin for all absorption lines -- most likely to be in the accretion disc atmosphere. Weak blueshifted absorption in NV and C\\IV provides evidence of an outflow component and we estimate a maximum outflow velocity of ~2000km/s. This may be linked to a wind launched from further out in the disc than is typically seen in those high-state non-magnetic CV whose wind speeds are observed to reach to >4000km/s. Unusually, three ionisation stages of carbon -- C II, C III and C IV -- are present in emission, with line width increasing with higher ionisation. The presence of C II in emission and the positive line-width/ionisation correlation is most easily reconciled with an origin in a disc chromosphere, beyond the influence of the EUV-emitting inner disc.

L. E. Hartley; J. E. Drew; K. S. Long



A Robust STATCOM Control to Augment LVRT capability of Fixed Speed Wind Turbines  

E-Print Network (OSTI)

A Robust STATCOM Control to Augment LVRT capability of Fixed Speed Wind Turbines M. J. Hossain, H Compensator (STATCOM) to enhance the Low-Voltage Ride- Through (LVRT) capability of fixed-speed wind turbines cost and maintenance due to rugged brushless construction. Constant speed wind turbines equipped

Pota, Himanshu Roy


Taxes-Fixed Price UT-B Contracts Div Page 1 of 1  

E-Print Network (OSTI)

Taxes-Fixed Price UT-B Contracts Div July 2006 Page 1 of 1 taxes-fp-ext-july06.doc TAXES--FIXED PRICE (July 2006) FEDERAL, STATE, AND LOCAL TAXES (a) Definitions. As used throughout this clause in this Agreement, the Agreement price includes all applicable Federal taxes in effect on the Agreement date. (c

Pennycook, Steve


A Rank-Corrected Procedure for Matrix Completion with Fixed Basis Coefficients  

E-Print Network (OSTI)

A Rank-Corrected Procedure for Matrix Completion with Fixed Basis Coefficients Weimin Miao, Shaohua address low-rank matrix completion problems with fixed basis coefficients, which include the low-rank correlation matrix completion in various fields such as the financial market and the low-rank density matrix

Chaudhuri, Sanjay


Target Acquisition, Localization, and Surveillance using a Fixed-Wing Mini-UAV and Gimbaled Camera  

E-Print Network (OSTI)

Target Acquisition, Localization, and Surveillance using a Fixed-Wing Mini-UAV and Gimbaled Camera acquisition and continuous surveillance using fixed-wing UAVs is a difficult task due to the many degrees of freedom inherent in aircraft and gimbaled cameras. Mini-UAVs further complicate the problem by introducing

Goodrich, Michael A.


A Systemic Design Methodology of PM Generators for Fixed-Pitch Marine Current Turbines  

E-Print Network (OSTI)

A Systemic Design Methodology of PM Generators for Fixed-Pitch Marine Current Turbines Sofiane of permanent magnet (PM) generator associated with fixed-pitch turbine for tidal energy generation. The main problem with marine current turbines systems are the maintenance requirements of the drive

Paris-Sud XI, Université de


Characterization of Inorganic Biocarriers That Moderate System Upsets during Fixed-Film Biotreatment Processes  

Science Journals Connector (OSTI)

...improving the reliability of fixed-film...dried prior to analysis. Biocarrier...configuration. Bio- reactor studies were...levels. However, reactor productivity...The decline in reactor performance...phenol removal. Analysis of the effluent...increase the reliability of fixed-film...

Don R. Durham; Leda C. Marshall; James G. Miller; Alan B. Chmurny



Optimal control of a time-varying catalytic fixed bed reactor with catalyst deactivation  

Science Journals Connector (OSTI)

The paper deals with the linear-quadratic control problem for a time-varying partial differential equation model of a catalytic fixed-bed reactor. The classical Riccati equation approach, for time-varying infinite-dimensional systems, is extended to ... Keywords: catalyst deactivation, fixed bed reactor, infinite dimensional time-varying system, linear quadratic optimal control

L. Mohammadi; I. Aksikas; J. F. Forbes



Approximate Response Time for Fixed Priority Real-Time Systems with Energy-Harvesting  

E-Print Network (OSTI)

Approximate Response Time for Fixed Priority Real-Time Systems with Energy-Harvesting Yasmina sufficient schedulability tests for fixed-priority pre-emptive scheduling of a real-time system under energy constraints. In this problem, energy is harvested from the ambient environment and used to replenish a storage

Boyer, Edmond


New Glycolipid specific to Nitrogen-fixing Blue-green Algae  

Science Journals Connector (OSTI)

... layer chromatography on silica gel of chloroform-methanol extracts from three nitrogen-fixing blue-green algae (Anabaena cylindrica, Anabaena flos-aquae and Chlorogloea fritschii) has, however, indicated the ... Chromatographie studies on the corresponding lipid fractions from the two other nitrogen-fixing blue-green algae suggest that these are also heterogeneous, and it would seem that these organisms possibly ...




Glacioeustatic Transgressive Reflux: Stratiform Dolomite in Pennsylvanian Bioherms of the Western Orogrande Basin, New Mexico  

Science Journals Connector (OSTI)

...mound rocks from the Virgilian Panther Seep Formation, Hembrillo Canyon...suggesting that, in general, car-bon in the dolomites was derived...alteration of dolomite: A review: Car-bonates and Evaporites, v...Simo, T., eds., Advances in Car-bonate Sequence Stratigraphy...

Gerilyn S. Soreghan; Michael H. Engel; Roger A. Furley; Katherine A. Giles